Nucleic acid sequence, vector, screening method and method of producing recombinant antibodies
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- GOTTFRIED WILHELM LEIBNIZ UNIVERSITÄT HANNOVER (LUH)
- Filing Date
- 2023-08-17
- Publication Date
- 2026-06-24
Smart Images

Figure EP2023072686_20022025_PF_FP_ABST
Abstract
Description
[0001] Nucleic acid sequence, vector, screening method and method for producing recombinant antibodies
[0002] TECHNICAL FIELD
[0003] The present invention relates to a nucleic acid sequence with an increased expression rate for the production of recombinant proteins, as well as a vector or an isolated nucleic acid for the heterologous expression of proteins. Furthermore, the present invention relates to a corresponding amino acid sequence, a cell, a screening method for selecting cells with an increased expression rate, and a method for producing recombinant antibodies.
[0004] STATE OF THE ART
[0005] A problem with common immunoassays that utilize antibodies is that they are of animal origin. Antibodies are produced either in animals or in animal cell cultures. CHO (Chinese hamster oviduct cells) and HEK-293T cells are used in particular.
[0006] (human embryonic kidney cells) are used. This cell culture-based production is very cost-intensive, so existing capacities are primarily used for the production of high-priced, therapeutic antibodies. Antibodies used in diagnostics have much lower margins and are therefore still often produced in animals. In addition to the associated animal suffering, such antibodies produced in animals also have low binding properties, limited availability, and the risk of contamination with human pathogens.
[0007] Alternatives for producing antibodies, as well as other complex proteins, are quite limited. Bacteria such as Escherichia coli cannot perform the necessary post-translational modifications to the antibodies, and production rates are extremely low. The same applies to yeast- or P / c / 7 / a-based production systems. Here, too, the antibodies can rarely be folded correctly by the host cells, and production rates are similarly low as in bacteria. Transgenic plants have been discussed as alternative producers for many years, but here too, the very low production rates do not allow for commercial exploitation. The production of antibodies in Phaeodactylum tricomutum, a microalgae, has also been described. For example, EP 2 671 950 A1 discloses the expression and secretion of recombinant, fully assembled protein complexes by microalgae.EP 2 660 323 A1 discloses the production of secreted therapeutic antibodies in the microalgae Phaeodactylum tricornutum. Even using these expression systems, production rates that allow for economic production could not be achieved.
[0008] To induce overexpression of a specific protein in Phaeodactylum tricornutum and thus significantly increase the productivity of a recombinant protein, WO 2021 / 002630 A1 describes the use of the HASP1 promoter. Furthermore, a signal peptide HASP1-SP, an expression vector comprising HASP1 and HASP1-SP, a transformant in which the expression vector has been introduced into a host cell, and methods for producing, expressing, and increasing the expression level of a protein of interest in a host cell are disclosed. The production rate can also be further increased using this method.
[0009] TASK
[0010] The present invention is therefore based on the technical object of providing a nucleic acid sequence, a vector, an amino acid sequence, a cell, as well as a screening and a production method which allow the expression level and thus the production rate of recombinant proteins to be further increased compared to the methods and genetic components known in the prior art.
[0011] SOLUTION
[0012] The object is achieved by a nucleic acid sequence having the features of claim 1, as well as a vector or an isolated nucleic acid, an amino acid sequence, a cell, a screening method, and a method for producing recombinant antibodies having the features of the independent claims. Further advantageous embodiments can be found in the subclaims, the description, and the exemplary embodiments. The object is achieved in particular by a nucleic acid sequence with an increased expression rate for the production of recombinant proteins, comprising at least one expression cassette for expressing one or more peptides.According to the invention, the expression cassette comprises at least one promoter element and at least one first transcription unit which codes for a protein, wherein the promoter element consists of the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence with a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 1.
[0013] For the purposes of the invention, the term “homology” refers to the similarity between nucleotide sequences of DNA or RNA and / or between amino acid sequences of proteins.
[0014] Advantageously, SEQ ID NO:1 represents a nucleotide sequence hereinafter referred to as HASP1 mod promoter, which has been found to be particularly suitable for regulated protein production. The HASP1 mod-Promotor a promoter element derived from the natural HASP1 promoter, whereby a partial sequence of the natural HASP1 promoter has been duplicated.
[0015] SEQ ID NO:1 is as follows, where the underlined part represents the duplication:
[0016] 5'-
[0017] CATACAGTGAATGTAACTTTCGAATTGACAGTATTAGTAGTCGTATTGACAGTGAGGCAC GCCCCTCAATGTGCGAGGTGGAAAATATACCAGCATGACAATGAATCTTGGAGATTCTT TTGCTGTCATCAAGATTCACCGCCAAATCTTCAGGAACCTATCACGTCCACAGGCGATG TTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACCTGTAGAAGTTGACAGCGAGCAA TTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAAGTATCTTCAATTAG GCATTTTGTCACTGTCAGTCCGTTCCGACAATATAGGTAGATTTGGAATGAATCTTTTCT ATGCTCATACAGTGAATGTAACTTTCGAATTGACAGTATTAGTAGTCGTATTGACAGTGA GGCACGCCCCTCAATGTGCGAGGTGGAAAATATACCAGCATGACAATGAATCTTGGAGA TTCTTTTG CTGTCATCAAG ATTCACCG CCAAATCTTCAG G AACCTATCACG TCCACAG GC GATGTTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACCTGTAGAAGTTGACAGCGA GCAATTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAAGTATCTTCA ATTAGGCATTTTGTCACTGTCAGTCCGTTCCGACAATATAGGTAGATTTGGAATGAATCT TTTCTATGCTGCTGCGAATCTTGTACACCTTTGAGGCCGTAGATTCTGTCCGACGAAGC GATAATTATTGCAAAATACATGGACTCATTATTTTGATTCGATTTCTTTTTGGTATCCGAC TCGAAAAGATCCATCACGGCGAGC-3' The invention also encompasses nucleic acid sequences,whose promoter element contains individual HASP1 sequence segments repetitively, for example, between -100 and -1, between -200 and -101, between -300 and -201, between -400 and -301, and / or between -500 and -400, relative to the start codon ATG. These segments can be combined in any configuration and copy number. This results in a new sequence with less than 85% homology to the native and HASP1 promoter.
[0018] According to a preferred embodiment of the present invention, at least one transcription unit comprises a polynucleotide which encodes an amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 2.
[0019] SEQ ID NO:2 represents an amino acid sequence of the hinge region of an antibody derived from equine immunoglobulin sequences and found to be particularly protease-resistant. The use of this protease-resistant hinge region significantly reduces proteolysis of antibodies produced in various formats and from various species, both in vivo and in vitro.
[0020] SEQ ID NO:2 is as follows:
[0021] VIKEPCCCPKCP
[0022] The object is further achieved by an amino acid comprising SEQ ID NO: 2 or an amino acid sequence having a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 2.
[0023] Furthermore, the object is achieved by a vector or an isolated nucleic acid which comprises a nucleic acid according to the invention in simple or repetitive form, and by a cell comprising a vector according to the invention or an isolated nucleic acid according to the invention or a nucleic acid sequence according to the invention or an amino acid sequence according to the invention.
[0024] According to the invention, the cell is a photosynthetically active cell, in particular a viridiplant or a unicellular plant, preferably a diatom. The object is further achieved by a screening method for selecting cells with an increased expression rate of a nucleic acid sequence according to the invention. The screening method comprises the steps of a) providing cells which have been transformed with a vector according to the invention or an isolated nucleic acid according to the invention and / or with a nucleic acid sequence according to the invention, b) isolating and transferring the cells to a culture medium, c) enriching the culture medium with a phosphate concentration in the range from 0.1 pM to 200 pM, preferably 0.5 pM to 200 pM, particularly preferably 1 pM to 200 pM, most particularly preferably 1 pM to 35 pM, and d) examining the cells for a desired expression rate.
[0025] Advantageously, the screening method according to the invention not only makes it possible to find producing cell lines, but also to identify the cell lines that produce the highest protein yields at the earliest possible stage of the process.
[0026] Furthermore, the object is achieved by a method for producing recombinant antibodies using a vector according to the invention or an isolated nucleic acid according to the invention or a nucleic acid sequence according to the invention, wherein the method comprises the following steps: a) providing cells with a nucleic acid sequence according to the invention, preferably determined by a screening method according to the invention, b) cultivating the transformed cells in a culture medium, wherein the culturing is initially carried out in a preculture and subsequently in a main culture and wherein the culture conditions are adapted in such a way that the yield of heterologously produced proteins is maximized, and c) extracting the heterologously produced proteins.
[0027] It may be useful for the culture medium to contain phosphate in an amount of 20 pM to 300 pM, preferably 20 pM to 400 pM, particularly preferably 20 pM to 500 pM. GENERAL ADVANTAGES
[0028] The invention describes a method and the components required for it, which for the first time enables the efficient and vegan production of recombinant proteins in diatoms, for example in Phaeodactylum tricornutum. Vegan production is understood to mean production that avoids the use of animals or animal cells, as well as substances derived from animals. The production method according to the invention is primarily aimed at the heterologous expression of antibodies of various formats, but can also be used for other proteins, preferably from animals and humans. In contrast to previously described methods, the method according to the invention allows for the first time production quantities of at least 50 mg of recombinant protein * L -1Culture. The quantities thus achieved are at least 20 times higher than those described to date and have not yet been achieved by any stably transformed, plant-based, or Sar-based production system. Furthermore, the inventive manufacturing process meets the requirements for completely vegan production, as long as the DNA sequences of the proteins to be produced do not originate from animals, but rather, for example, from recombinant (human) antibody banks.
[0029] A further advantage over the production of polyclonal antisera is the consistent quality and reproducibility of the produced antibodies. For example, antibody-producing animals die after a certain period of time, and antibodies from different animals exhibit different properties. This means that the quality of antibodies produced using conventional methods fluctuates considerably. Furthermore, antibodies and auxiliary proteins obtained from diatoms, single-celled plants, or viridiplants are precisely defined antibodies, meaning they have a predefined and consistent amino acid sequence.
[0030] DETAILED DESCRIPTION OF THE INVENTION
[0031] According to a preferred embodiment of the invention, the recombinant antibodies are obtained by expression from diatoms, green algae (Chlorobionta), or a seed plant, whereby very high yields are advantageously achieved, for example, for expression from seed plants, yields of more than 20 mg of antibody per liter of culture (for single cells) or per 100 g of fresh weight. Particularly preferably, the recombinant antibodies are obtained from diatoms or green algae, in particular from diatoms such as Phaeodactylum tricornutum. Nucleic acid sequence
[0032] The invention relates, on the one hand, to a nucleic acid sequence with an increased expression rate for the production of recombinant proteins, comprising at least one expression cassette for the expression of a protein, wherein the expression cassette has at least one promoter element and at least one first transcription unit which codes for at least one peptide, preferably for an antibody, and wherein the promoter element consists of the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence with a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 1.
[0033] For the purposes of the invention, the term “homology” refers to the similarity between nucleotide sequences of DNA or RNA and / or between amino acid sequences of proteins.
[0034] An expression cassette according to the invention consists of at least a regulatory promoter element, a 5'-UTR (untranslated region at the 5' end), a codon-determining sequence (CDS, which is translated into a peptide), a 3'UTR (untranslated region at the 3' end), and a terminator, which acts as a stop codon and terminates translation. The CDS can contain various subelements, such as signal peptides that direct antibodies or antigens to a specific cell compartment, tag sequences such as Strep-Tag or ßx His-Tag, which primarily serve for purification or detection of the peptide, or fluorescent markers such as GFP (Green Fluorescent Protein), etc., which primarily serve for detection via their fluorescence.
[0035] The term "promoter" in the context of the present invention refers to a polynucleotide sequence located upstream of a gene and regulating the transcription of a functional gene. The promoter forms a recognition and binding site for an RNA polymerase, which initiates transcription of the gene.
[0036] The use of a promoter element derived from the HASP1 promoter (Highly Abundant Secreted Protein from P. tricorn ut um) has proven particularly advantageous and is referred to below as HASP1 mod The nucleic acid sequence of HASP1 mod is listed under SEQ ID NO:1 and is as follows: 5'-
[0037] CATACAGTGAATGTAACTTTCGAATTGACAGTTAGTTAGTCGTATTGACAGTGAGGCAC GCCCCTCAATGTGCGAGGTGGAAAATACCAGCATGACAATGAATCTTGGAGATTCTT TTGCTGTCATCAAGATTCACCGCCAAATCTTCAGGAACCTATCACGTCCACAGGCGATG TTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACCTGTAGAAGTTGACAGCGAGCAA TTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAAGTATCTTCAATTAG GCATTTTGTCACTGTCAGTCCGTTCCGACAATATAGGTAGATTTGGAATGAATCTTTCTCT ATGCTCATACAGTGAATGTAACTTTCGAATTGACAGTATTAGTAGTCGTATTGACAGTGA GGCACGCCCCTCAATGTGCGAGGTGGAAAATATACCAGCATGACAATGAATCTTGGAGA TTCTTTTG CTGTCATCAAG ATTCACCG CCAAATCTTCAG G AACCTATCACG TCCACAG GCAC GATGTTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACCTGTAGAAGTTGACAGCGA GCAATTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAATTCTTCA ATTAGGCATTTGTCACTGTCAGTCCGTCCGACAATATAGGTAGATTTGGAATGAATCT
[0038] TTTCTATGCTGCTGCGAATCTTGTACACCTTTGAGGCCGTAGATTCTGTCCGACGAAGC GATAATTATTGCAAAATACATGGACTCATTATTTTCGATTTCTTTTTGGTATCCGAC TCGAAAAGATCCATCACGGCGAGC-3'
[0039] The invention also encompasses nucleic acid sequences whose promoter element has individual HASP1 sequence segments repetitively, for example, with respect to the start codon ATG, between -100 and -1, between -200 and -101, between -300 and -201, between -400 and -301 and / or between -500 and -400. These segments can be combined in any constellation and copy number. This results in a new sequence that has less than 85% homology to the native and HASP1 mod Promoter results.
[0040] According to one embodiment of the invention, the promoter element can consist of a nucleic acid sequence in which up to 30% of the bases differ, particularly in the proximal promoter regions. These bases can also originate from P. tricornutum or from other organisms, including humans or vertebrates. This modification is another reason for the high performance of the developed expression system.
[0041] According to a preferred embodiment, the expression cassette further comprises at least a second transcription unit encoding a reporter protein. This second transcription unit is also referred to herein as a reporter gene. Preferably, a gene is used as the reporter gene that does not normally occur in eukaryotic cells, preferably in photosynthetically active cells, in particular in unicellular plants or viridiplants. The reporter gene primarily serves to indicate or detect the activity of the promoter under which it was introduced and / or the expression of the first transcription unit to which it is functionally linked. For example, a reporter enzyme, for example a bioluminescent enzyme, a fluorescent reporter protein, such as GFP (green fluorescent protein), or a detectable antigen can be used as the reporter protein.
[0042] Reporters are proteins that directly or indirectly generate a detectable signal. This signal can, for example, B. be a fluorescence (e.g. tGFP (turbo green fluorescent protein), GFP (green fluorescent protein), BFP (blue fluorescent protein), YFP (yellow fluorescent protein), CFP (cyan fluorescent protein), DsRed (Discosoma sp. red fluorescent protein)), a luminescence (e.g. luciferase), a staining by chromoproteins (e.g. meffBlue, aeBlue, cjBlue, amilGFP, fwYellow, amajLime, scOrange, amilCP gfasPurple, eforRed, asPink (asCP), meffRed, tsPurple and spisPink, as well as mCherry), a color reaction (e.g. ß-glucoronidase, ß-galatosidase) or the conversion of a substrate into a product, which changes the absorption spectrum of the respective solution.
[0043] In combination with a nutrient deficiency-triggered or a nutrient-triggered promoter, a reporter gene can be used to simplify the optimization of culture conditions and / or to monitor cell viability or nutrient availability in a cell culture. This enables in-time analysis of the cultured cells. The strength of the signal correlates with the availability or deficiency of the nutrient under investigation. HASP1 has been shown to mod -Promotor (according to SEQ ID NO:1) is inhibited by phosphate and triggered by phosphate deficiency. "Phosphate" refers to all phosphate salts and phosphate-containing organic compounds, and all chemical forms of phosphorus.
[0044] Phosphate concentrations above 360 pM are particularly important for the regulation of
[0045] H AS P1 mod - Pro motors. Such high concentrations can increase the expression rate of HASP1mod -Promoter not only inhibits the protein very efficiently and for a longer period of time, but also achieves a higher cell density before a strong increase in expression occurs due to the consumption of phosphate. Thus, the HASP1 mod The promoter provides the ideal control mechanism, allowing high cell densities to be achieved without expression of the controlled gene before expression is massively increased by phosphate consumption. On the other hand, its expression level is very finely controllable, and the maximum possible expression rates are very high.
[0046] Preferably, the expression cassette further comprises at least one sequence region encoding a selectable marker, preferably a resistance gene. Resistance genes are genes that encode factors that render the cell resistant to certain substances, for example, antibiotics and / or plant pathogens and / or heavy metals. Resistance genes are typically used as selectable markers to detect the successful transformation of a vector into a cell.
[0047] Examples of preferred resistance genes are the Zeocin resistance gene (Zeocin is the commonly known trade name for Phleomycin D1), the Nourseothricin resistance gene, the Blasticidin resistance gene and the Chloramphenicol resistance gene.
[0048] It is particularly advantageous if the resistance gene is coupled to the second transcription unit, which encodes a reporter protein.
[0049] It may be provided that the resistance gene is linked to the reporter gene via genetic linkage in a polycistronic mRNA. Those skilled in the art are aware that polycistronic mRNA is understood to be an mRNA that is encoded by several consecutive genetic units on the nucleic acid sequence of the DNA and therefore has several open reading frames (ORFs).
[0050] In a further advantageous embodiment, the second transcription unit is fused to the first transcription unit, with separation occurring during or immediately after translation, for example, caused by P2 peptides (e.g., P2A, P2B, P2T) or IRES elements (internal ribosome entry site). Both P2 peptides and IRES elements have been demonstrated to be active in P. tricornutum.
[0051] Another possibility for coupling the reporter protein is direct coupling at the protein level to the protein to be detected, preferably to the antibody to be detected.
[0052] According to a preferred embodiment, individual genetic elements, preferably the promoter element and / or the first transcription unit and / or a complete expression cassette, are present repetitively. Through the repetitive use, i.e., the multiple repeated use, of genetic elements, in particular regulatory elements such as the promoter element, an increase in the expression rate of the nucleic acid sequence according to the invention can be achieved. In particular, the respective genetic elements and / or the respective expression cassette are used at least in duplicate, preferably at least in triplicate, preferably immediately one after the other.
[0053] The repetitive use of transcription units, in particular the first transcription unit encoding a recombinant protein to be produced, particularly an antibody, leads to a significant increase in yield as well as the number of clones or the proportion of clones showing detectable production. This minimizes processing complexity. Multiple copies of the genetic information or transcription unit of the protein (or antibody) to be produced are cloned onto a plasmid or vector. These transcription units preferably flank a resistance gene. The position effect is exploited, i.e., upon integration into the genome at a "favorable" locus, the gene of interest (GOI) is present in multiple copies, resulting in an increased transcript amount, ultimately increasing the yield of recombinant protein.
[0054] Preferably, in the case of a repetitive presence of a transcription unit or in the case of the presence of several different transcription units, the resistance gene is arranged particularly "closely" linked to the transcription units. In particular, "close" linkage means that the genetic link between the transcription unit and the resistance gene is not broken by genetic recombination (via internal or externally introduced recombinases).
[0055] According to a preferred embodiment, the nucleic acid according to the invention is codon-optimized for use in a specific host organism, for example in diatoms, preferably in P. tricornutum
[0056] A nucleic acid sequence is codon-optimized, in particular, if the codons are optimally adapted to the frequency of the corresponding tRNAs, so that efficient translation is not inhibited by the lack of tRNAs loaded with the corresponding amino acid. Furthermore, optimization is considered to include the elimination of certain restriction enzyme recognition sites that can complicate cloning processes. The invention therefore also encompasses a nucleic acid encoding an antibody, wherein the nucleic acid sequence is codon-optimized for expression in a diatom, unicellular plant, or viridiplant, in particular in a diatom.
[0057] The inventors have also discovered that codon optimization of the nucleic acid sequence can take into account the amino acid sequence profile from the original sequence. This improves, in particular, the correct folding of the antibody compared to its native counterpart, leading to increased antibody stability and enhanced biological activity of the antibody expressed in the host organism (as defined herein).
[0058] Furthermore, a codon-optimized sequence of a nucleic acid has the advantage that the expression rate in the host organism is increased by at least a factor of 10, preferably at least a factor of 20, particularly preferably at least a factor of 30, and most preferably at least a factor of 40 compared to a non-codon-optimized sequence of a nucleic acid. For example, the production rate in the diatom can be increased from a conventional maximum of 3 mg of antibody per liter of culture to 160 mg of antibody per liter of culture.
[0059] In addition, a codon-optimized sequence of a nucleic acid for expression in a host organism (as defined herein) has the advantage that the folding of the antibody is improved corresponding to the native counterpart of the antibody, which leads to increased stability of the antibody and increased biological activity of the antibody expressed in the host organism.
[0060] According to a preferred embodiment, the nucleic acid sequence according to the invention comprises at least one replicative viral unit, preferably a replicon from the Weed Dwarf Virus (WDV). Such viral elements enable independent replication of the transformed DNA in the form of DNA or RNA. This increases the copy number of transformed DNA or RNA, which, for example, increases the amount of transcript (mRNA) and produces more protein. Furthermore, an increased copy number of the transcription unit to be introduced can result in this DNA being integrated multiple times into the genome, which increases the chance of integration at a "favorable" locus.
[0061] Furthermore, the nucleic acid sequence according to the invention preferably has at least one sequence region that encodes a retention signal, preferably the amino acid sequence KDEL and / or HDEL. Equipping heterologously expressed proteins with a retention signal ensures that the expressed protein remains in the endoplasmic reticulum. Examples of such retention signals are the amino acid sequences KDEL and HDEL. Normally, only the heavy chain is equipped with such a sequence. However, when antibodies are produced in the diatom, not only the heavy chain is equipped with such a signal, but also the light chain. This is intended to prevent the possible transport of the light chain into the Golgi apparatus and promote the assembly of both molecules.In addition, retention of the expressed proteins in the endoplasmic reticulum ensures protection from proteases and successful glycosylation, thereby increasing yield and maintaining functionality.
[0062] According to a preferred embodiment of the present invention, the first transcription unit comprises a polynucleotide which encodes an amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 2.
[0063] SEQ ID NO:2 represents an amino acid sequence of the hinge region of an antibody derived from equine immunoglobulin sequences and found to be particularly protease-resistant. The use of this protease-resistant hinge region significantly reduces proteolysis of antibodies of various formats and from various species produced in P. tricornutum, both in vivo and in vitro.
[0064] SEQ ID NO:2 is as follows:
[0065] VIKEPCCCPKCP
[0066] Vector or isolated nucleic acid
[0067] A vector according to the invention or an isolated nucleic acid according to the invention for the heterologous expression of proteins, preferably of antibodies, has at least one nucleic acid sequence according to the invention in simple or repetitive form.
[0068] Reference is hereby expressly made to the description of the nucleic acid sequence according to the invention. The number of transcription cassettes in the vector or in the isolated nucleic acid is preferably more than 1 and particularly preferably more than 2. The vector according to the invention or the nucleic acid according to the invention thus comprises at least two, preferably at least three, nucleic acid sequences according to the invention. The transcription cassettes regulated in this way preferably encode a protein, particularly preferably an antibody (in other words: several transcription cassettes all encode one and the same protein or one and the same antibody), wherein the protein, preferably the antibody, has a sequence identity of at least 50%, particularly preferably at least 60%, very particularly preferably at least 70%, in particular at least 80% at the amino acid level.
[0069] A transcription cassette (as described herein) consists of at least a regulatory promoter element, a 5' UTR, a codon-determining sequence (CDS, which is translated into a peptide), a 3' UTR, and a terminator. The CDS can contain various subelements, such as signal peptides that direct antibodies or antigens to a specific cellular compartment, tag sequences such as Strep-Tag or 6x His-Tag, which primarily serve for purification or detection of the peptide, or fluorescent markers such as GFP (Green Fluorescent Protein), etc., which primarily serve for detection via their fluorescence.
[0070] Preferably, the vector according to the invention or the isolated nucleic acid according to the invention has at least two, preferably at least three, particularly preferably at least four expression cassettes in repetitive form.
[0071] The expression cassettes of a vector or an isolated nucleic acid can be identical to one another or have an identity of at least 70%, preferably at least 80%, to one another. Furthermore, one or more second and / or further expression cassettes differing from a first expression cassette can be arranged in the vector according to the invention or the isolated nucleic acid according to the invention.
[0072] Through the repetitive use, i.e., the repeated use of one or more expression cassettes, an increase in the expression rate of the nucleic acid sequence according to the invention can be achieved. Likewise, the number of producers with higher production quantities, the number of transgenic clones, and the proportion of clones with a detectable signal increase. The signal of the reporter protein is a direct measure of protein production / antibody products. In particular, the expression cassettes in question are used in repetitive use at least in duplicate, preferably at least in triplicate, preferably immediately one after the other.
[0073] According to a preferred embodiment, the vector or nucleic acid according to the invention further comprises at least one sequence region which codes for a selection marker, preferably a resistance gene (as described herein).
[0074] Amino acid sequence
[0075] The invention also relates to an amino acid sequence comprising SEQ ID NO: 2 or an amino acid sequence having a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 2.
[0076] The amino acid sequence according to the invention forms a particularly protease-resistant hinge region in a recombinant antibody. Advantageously, the resulting recombinant antibody is modified in such a way that it exhibits increased stability against diatom-, human-, plant-, or microalgae-specific proteases. This can increase the stability of the antibody in the host organism in which the antibody is expressed, and thus also the expression rate.
[0077] The term “antibody” herein refers to an immunoglobulin (Ig) or a derivative of an immunoglobulin, as produced by the acquired immune system of vertebrates. Examples of naturally occurring antibodies are antibodies of classes M (IgM), G (IgG), A (IgA), and E (IgE), in particular from mammals such as humans, rabbits, mice, rats, camels, llamas, goats, and / or horses. Furthermore, artificial formats based on such proteins are also included; examples are scFvs (single chain variable fragments) or scFv-Fc (single chain variable fragments fused to a crystalline fragment).
[0078] A “native antibody” in the sense of the present invention is a natural antibody as found in an individual as defined herein, in particular a vertebrate, particularly preferably a mammal, most preferably a primate, in particular a human. The amino acid sequence according to the invention is preferably a cysteine-rich amino acid sequence which contains at least 20 cysteines, preferably at least 15 cysteines, particularly preferably at least 12 cysteines. According to a particularly preferred embodiment, the amino acid sequence in the hinge region comprises or consists of (a) the sequence VIKEPCCCPKCP or (b) a sequence identity which deviates from this amino acid sequence by a maximum of 30%, in particular by a maximum of 20%, particularly preferably by a maximum of 15%, or (c) an amino acid sequence which, compared to the variant according to (a), has only one amino acid exchange.
[0079] Also according to the invention is a nucleic acid sequence coding for an amino acid sequence comprising SEQ ID NO: 2 or for an amino acid sequence having a homology of at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% to SEQ ID NO: 2.
[0080] cell
[0081] The invention further relates to a cell comprising a vector according to the invention or an isolated nucleic acid according to the invention (as described herein) or a nucleic acid sequence according to the invention (as described herein), wherein the cell is a photosynthetically active cell, in particular a unicellular plant or viridiplantae, preferably a diatom.
[0082] Advantageously, by using photosynthetically active cells, at least a large part or even the entire process for producing recombinant proteins can be carried out in non-animal organisms and thus meet the requirements of vegan production.
[0083] Screening procedures
[0084] A screening method according to the invention for selecting cells with an increased expression rate of a nucleic acid sequence according to the invention (as described herein) comprises the steps: a) providing cells which have been transformed with a vector according to the invention or an isolated nucleic acid according to the invention and / or with a nucleic acid sequence according to the invention, b) isolating and transferring the cells into a culture medium, c) enriching the culture medium with a phosphate concentration in the range from 0.1 pM to 200 pM, preferably 0.5 pM to 200 pM, particularly preferably 1 pM to 200 pM, most particularly preferably 1 pM to 20 pM. d) examining the cells for a desired expression rate.
[0085] Common methods such as ballistic methods or electroporation are used to transform cells with the genetic material of the invention. While ballistic transformation involves firing DNA-coated nanoparticles at the cells, electroporation involves briefly treating cells with an electric shock in the range of 2000 V to 2500 V, which makes the cell membrane permeable to DNA.
[0086] The cells that have taken up the transgene must then be identified and selected. This is typically done by selecting against a selectable compound that interacts with a selectable marker contained in the expression cassettes.
[0087] Resistance genes (as described herein) are preferably used as selection markers. Following transformation, the cells are transferred to a selection plate and / or into a selection medium, with the selection plate or selection medium containing the respective selection substance in a sufficient concentration. The skilled person will know the concentration at which the selection substance must be used.
[0088] In a preferred embodiment, Zeocin (Phleomycin D1) and / or Blasticidin are used as selective reagents.
[0089] Only cells in which a successful gene transfer has taken place also contain the respective resistance gene (in addition to the gene of interest) and thus possess resistance to the selection substance, which enables them to survive on or in a medium containing the corresponding selection substance. Experts refer to this as positive selection.
[0090] The selection is preferably carried out on a solid nutrient medium, preferably on an agar plate, in particular on an agar plate with an agar concentration of less than 1.5%, preferably of less than 1%. Advantageously, the growth time of the cells on agar plates with such a reduced agar concentration is significantly reduced compared to a standard agar concentration of 1.5%. According to a preferred embodiment, the selection is carried out on a solid medium or solid nutrient medium which contains 0.5% to 1% agar, preferably 0.6% to 1% agar, particularly preferably 0.7% to 1% agar, very particularly preferably 0.8% to 1% agar. Such a solid medium is advantageously also used for the strain maintenance of the cells used, both transformed and non-transformed cells.
[0091] A key requirement is not only to find producing cell lines, but also to identify the cell lines that yield the highest protein yields as early as possible in the selection process. To achieve this, according to a preferred embodiment, reporter proteins (as described herein) are used. These can be present either as fusion proteins or dicistronic (e.g., linked via an IRES element). The massively parallel fluorescence-based detection by the reporter proteins correlates significantly with the amount of recombinant proteins later produced by this cell line. When using nutrient- or nutrient-deficiency-triggered promoters, such as the modified HASP1 promoter HASP1 described herein, modHowever, establishing a correlation between reporter signal and protein production is not possible directly after selection. To establish a meaningful correlation, the clones must be transferred from the selection plate or from the selection medium into a liquid medium (e.g., a multiwell plate). Subsequently, the clones must be measured over a specific period of time, ideally at a specific time, to achieve a meaningful correlation. The time of evaluation depends on the concentration of the relevant nutrient (e.g., phosphate in the case of HASP1). modThe concentration must be adjusted so that the number of cells does not exceed a critical value and the time until evaluation is as short as possible while remaining as close to reality as possible. For example, the intensity of the fluorescence of the reporter proteins can be correlated with the amount of antibody produced. However, as shown below, this correlation is not trivial and depends on many factors (e.g., the number of cells). The selection procedure described here is therefore designed to establish a very reliable correlation between fluorescence and antibody production with minimal effort.
[0092] The preselected cells are isolated according to step (b) and transferred to a culture medium. A modified f / 2 medium, for example, can be used as the culture medium. Preferably, the transfer takes place into at least one multiwell plate of at least 6 wells, preferably at least 12 wells, particularly preferably at least 24 wells, very particularly preferably at least 48 wells, further preferably at least 96 wells, and especially at least 384 wells. The resulting clones are isolated.
[0093] The use of multiwell plates represents a high-throughput method that significantly reduces the effort and costs required for selecting, for example, highly expressive clones, as it enables simultaneous measurement of up to 384 independent clones.
[0094] The medium contains a phosphate concentration of 0.1 pM to 50 pM, preferably 0.25 pM to 35 pM, particularly preferably 0.5 pM to 30 pM, most preferably 0.75 pM to 25 pM, in particular 0.1 pM to 20 pM, furthermore in particular 1 pM to 20 pM, according to step (c) advantageously leads to the phosphate deficiency-triggered modified promoter HASP1 described herein mod Due to the low phosphate concentration of the medium, the protein reacts with increased activity, and the resulting triggered protein production can be evaluated at an earlier time point than at higher phosphate concentrations. The resulting increased production of the reporter protein can be easily read out.
[0095] “Phosphate” refers to all phosphate salts and phosphate-containing organic compounds and all chemical forms of phosphorus.
[0096] When evaluating reporter signals, the clones can be analyzed directly after isolation and transfer of the cells to a culture medium. However, the cell number is low at this time, which increases measurement inaccuracy. To address this problem, the cells are cultured in the culture medium, preferably in a multi-well plate, to an optimal cell density. It must be taken into account, especially when working with nutrient deficiency-triggered promoters, that the initial nutrient concentration has a significant influence on the expected cell density during cultivation and thus also on the time of analysis. This is influenced by several factors: To obtain reliable reporter signals, the cell density must not be too high, because above a certain cell density, the reporter signal strength is no longer proportional to the cell number.Although a qualitative comparison might be possible under certain circumstances, it is not permissible for a quantitative statement.
[0097] Advantageously, the cells are examined for an expression rate of the
[0098] Nucleic acid sequence at multiple time points during cell cultivation. In particular, when using the phosphate starvation-triggered HASP1 described herein modWhen using a promoter in combination with a fluorescent reporter protein, there is no longer a linear relationship between cell count and signal intensity once a critical cell density is exceeded. Phosphate deprivation must therefore occur before the cell density exceeds the critical value; otherwise, a comparison between clones is not possible. When using nutrient-deficiency-triggered promoters, it is also important to ensure that only clones with a similar cell count are compared, and global peaks of the individual signal time series must be used to evaluate production.
[0099] Those skilled in the art know how to determine the cell count. One suitable method is the determination of the optical density (OD), for example, by means of absorption measurement, in which a light beam is directed into the medium and the light loss is measured with a detector. Up to a certain cell density, the optical density exhibits a substantially linear increase.
[0100] For the photometric measurement (both for determining cell density and for examining the cells for an expression rate of the nucleic acid sequence, in particular by determining the activity of the reporter protein, for example via fluorescence measurements), the multiwell plate is preferably filled with the culture medium to a volume of 30% to 70%, preferably 45% to 55% of the total volume of each individual well. The measurement inaccuracy is highest in this range, with a fill volume of 50% being suitable both for culturing the cells in the multiwell format and for a more error-tolerant measurement (e.g., in the event of volume deviations due to evaporation during cultivation or due to pipetting errors). Therefore, when transferring the preselected cells according to step (b), the wells of the multiwell plate are preferably filled with the culture medium to a volume of 30% to 70%, preferably 45% to 55% of the total volume of each individual well.A microplate reader can be used to read the parameters.
[0101] To determine the cell count in a Phaeodactylum tricornutum culture, different wavelengths can be used, preferably between 600 and 800 nm. The measurement is particularly preferably carried out at a wavelength of 600 and 750 nm.
[0102] For both fluorescence and optical density measurements, the number of cells must not exceed a certain value to obtain a linear relationship or reliable, linear measurement results. The range within which the cell count must lie depends on the cell size and type and is preferably determined empirically, e.g., via serial dilutions. For diatoms, the cell count at which the test according to step (d) is preferably carried out is 0.1 million cells * mL. -1 up to 120 million cells * mL -1 , preferably at 0.25 million cells * mL-1 up to at least 100 million cells * mL -1 , especially preferred at 0.5 million cells * mL -1 up to 100 million cells * mL -1 especially preferred at 1 million cells * mL -1 up to 90 million cells * mL -1 , more preferably at 2 million cells * mL -1 up to 80 million cells * mL -1 , even more preferably at 3 million cells * mL -1 up to 70 million cells * mL 1 , especially at 4 million cells * mL -1 up to 60 million cells * mL -1 .
[0103] It is advantageous to consider the morphology of the respective cells when determining cell count, especially with regard to its potential influence on the measurement results of the respective method used. For example, when determining the cell count of Phaeodactylum, the presence of two different cell shapes (fusiform cells and oval cells) can lead to an erroneous correlation between cell count and optical density.
[0104] Preferably, an immunobiochemical and / or photometric method, preferably a high-throughput method, is used to examine the cells for an expression rate of the nucleic acid sequence according to step (d). Examples of suitable immunobiochemical methods include ELISA, SDS-PAGE, or dot blot. Examples of suitable photometric methods include the photometric determination of cell density and / or chlorophyll content and / or fluorescent proteins and / or chromoproteins and / or color reactions and / or luminescence. All suitable methods can also be used complementarily and / or in conjunction with one another, or alternatively to one another.
[0105] According to a preferred embodiment, the examination according to step (d) is carried out after a period of 1 to 21 days, preferably 1.5 to 21 days, particularly preferably 2 to 14 days, after the implementation of step (c). It has been shown that the optimal cell density for conducting the examination according to step (d) can be expected after this period.
[0106] Preferably, in the screening method according to the invention, at least 5, preferably at least 10, particularly preferably at least 30, very particularly preferably at least 60, further preferably at least 96 different clones are examined in order to determine cells with an increased, preferably with the highest expression rate of a nucleic acid sequence according to the invention.
[0107] Following the screening method according to the invention, additional investigations of the cells that express the most strongly, such as ELISA or SDS-PAGE, can be carried out to determine whether and which antibodies are produced, in which quality and with which binding properties.
[0108] The disruption of cells in a multi-well format (especially 2 - 384 wells) is preferably carried out using a buffer (e.g. PBS, HEPES, Tris-HCl, CHES, CAPSO, AMP, CAPS, CABS) containing detergents or by means of a temperature elevated relative to the physiological state or a combination of detergents and a temperature elevated relative to the physiological state.
[0109] The temperature is preferably more than 40 °C, particularly preferably more than 50 °C, and most preferably at least 60 °C. Incubation times of between 0.5 h and 72 h are preferably used.
[0110] Suitable detergents are known to those skilled in the art. Examples include Tween 20, Triton X 100, sodium dodecyl sulfate (SDS), digitonin, or cetyltrimethylammonium bromide (CTAB). The respective detergent is used in a final concentration preferably between 0.1% and 10%, particularly preferably between 0.2% and 10%, very particularly preferably between 0.3% and 10%, further preferably between 0.4% and 10%, in particular between 0.5% and 10%.
[0111] Centrifugation after cell disruption leads to better quality results in purification analysis, e.g., by ELISA or SDS-PAGE.
[0112] The digested material can be used for ELISA screening using multiwell plates, but also—after adding SDS-PAGE loading buffer and heating to 80°C to 100°C—for direct SDS-PAGE screening. Such methods are well known to those skilled in the art. However, the sedimentation of the solids and pigments described here leads to qualitatively better results in ELISA and SDS-PAGE and plays a central role in the analysis of the purification steps. Production method
[0113] The method according to the invention for producing recombinant antibodies using a vector according to the invention and / or an isolated nucleic acid according to the invention and / or a nucleic acid sequence according to the invention comprises the following steps: a) providing cells with a nucleic acid sequence according to the invention, preferably determined by a screening method according to the invention, b) cultivating the transformed cells in a culture medium, wherein the culturing is initially carried out in a preculture and subsequently in a main culture and wherein the culture conditions are adapted in such a way that the yield of heterologously produced proteins is maximized, and c) extracting the heterologously produced proteins.
[0114] The provision of the cells according to step (a) may also comprise transforming the cells (as described herein) by suitable methods such as ballistic transformation or electroporation.
[0115] When cultivating the transformed cells according to step (b), the focus is on optimizing high yields of heterologously produced proteins, especially in closed cultivation systems.
[0116] Cultivation can be carried out in batch format, i.e. under the static conditions of a constant culture medium, or in fed-batch format, i.e. with regular addition of fresh medium, whereby the expert knows which culture can achieve the highest yield.
[0117] It should be noted at this point that there are different cultivation methods, such as batch, fed-batch and the continuous cultivation method, and that the invention relates to all cultivation methods, but in particular to batch cultivation, in which all nutrient concentrations are adjusted only at the beginning of the cultivation.
[0118] In fed-batch cultivation, nutrients are added over the course of the cultivation. It is crucial that the multiple addition of phosphate in fed-batch cultivation accelerates the induction of the promoter (described here) and thus reduces the cultivation time. Furthermore, phosphate (regardless of its chemical form), especially towards the end of the cultivation, can be added in small amounts to avoid complete depletion of the phosphate and thus optimize the yield.
[0119] The invention is not limited to the culture sequence (pre-culture -> main culture). Cultivation can also be carried out without prior pre-culture. According to the invention, the cells are brought to a specific cell density during the pre-culture. These cells are then transferred to the main culture. The desired product is obtained from the main culture. The vitality and division rate of the cells in the pre-culture are crucial for the biomass increase in the main culture; the more vital and actively dividing the cells in the pre-culture, the greater the biomass increase. Higher biomass leads to a higher yield in the main culture.
[0120] Therefore, the cells are preferably transferred from the pre-culture to the main culture at a certain division rate and, accordingly, the division rate of the cells is determined to determine the optimal time for transferring the pre-culture to the main culture.
[0121] According to a preferred embodiment, the preculture according to step (b) is carried out without external gassing of the culture medium.
[0122] In this embodiment, the preculture is transferred to the main culture at a certain division rate, preferably after a period of at least 4 days, more preferably at least 7 days, and most preferably at least 12 days. This period refers to the start of the culture. Specialist personnel know how to determine the division rate.
[0123] According to a further preferred embodiment, the preculture according to step (b) is carried out with external gassing of the culture medium.
[0124] In this further embodiment, the preculture is transferred to the main culture at a certain division rate, preferably after a period of at least 4 days, more preferably at least 7 days, and most preferably at least 12 days. This period refers to the start of the culture.
[0125] In particular, the optimal time for transferring the preculture to the main culture depends on the vitality of the cells. Vitality, in turn, depends on the nutrient composition of the culture medium. The lower the nutrient supply, the faster the optimal time for transferring the preculture to the main culture is exceeded. The following phosphate concentrations are particularly relevant for the preculture: 37 pM - 5000 pM phosphate; particularly preferred are 40 pM - 5000 pM; and most preferred are 50 pM - 5000 pM.
[0126] In Phaeodactylum tricornutum, alternatively to the division rate, the morphology of the cells, in particular the ratio between duplicate and single cells, or the amount of chlorophyll per cell or another measure representing the number of cells, such as the optical density (OD), can be used.
[0127] Phaeodactylum cells can take on different morphotypes: a fusiform and an oval shape. Both morphological types are present in every culture, although the ratio between the two can vary between > 0 and < 1. A morphological change can be achieved using the following method:
[0128] 1. Spreading the cells on an agar plate and selecting colonies,
[0129] 2. Subsequently, a “limiting dilution” is carried out, in which individual cells become the starting point for new colonies that all belong to the same morphotype.
[0130] Alternatively, the enrichment or switch to a particular morphology can be promoted or induced by physical or chemical conditions.
[0131] It has been shown that a morphology switch can significantly increase transformation efficiency. Fusiform cells achieve higher transformation efficiency than oval cells. Furthermore, switching to the optimal cell shape can significantly increase the yield of recombinantly produced proteins. Another reason for switching to a morphology switch is that this process can significantly reduce cell clumping after the morphology switch. Clumped cells interfere with the cultivation process, the overgrowth process, and the extraction of heterologous proteins.
[0132] For the optimal time of transferring the preculture into the main culture in Phaeodactylum tricornutum, the ratio of single cells to at least double cell chains is between 0.1 and 10, preferably between 0.1 and 4, particularly preferably between 0.1 and 3.
[0133] Furthermore, the division rate can be used to determine the optimal time for transferring the preculture to the main culture in Phaeodactylum tricornutum. The optimal extrapolated or actual weekly division rate is log2>0.1, preferably log2>0.2, particularly preferably log2>0.3, very particularly preferably log2>0.5, further preferably between log2>=0.5 and 20, further particularly preferably between log2>=0.5 and 10, further particularly preferably between log2>=0.5 and 5.
[0134] Advantageously, a culture medium is used which is adapted to the genetic elements according to the invention, in particular the nucleic acid sequence according to the invention or the vector according to the invention or the isolated nucleic acid according to the invention.
[0135] In particular, the culture medium comprises phosphate in an amount of 20 pM to 300 pM, preferably from 20 pM to 400 pM, particularly preferably from 20 pM to 500 pM.
[0136] Phosphate not only plays a role in the activation of HASP1 mod -Promoter (as defined herein) plays a central role, but is also crucial for achieving the highest cell densities. It has been shown that pro:
[0137] 8-50 million cells*!' 1 : 20 pM - 500 pM phosphate,
[0138] Preferably 12-50 million cells*!' 1 : 20 pM - 400 pM phosphate, particularly preferably 15 -50 million cells*!.' 1: 20 pM - 300 pM phosphate, are required in the medium. This allows the necessary amount of phosphate to be calculated to achieve the desired biomass and avoid premature phosphate depletion.
[0139] It should be noted that phosphate concentrations above 360 pM are particularly important for the regulation of the HASP1 described here mod -promoter. Such high concentrations can increase the expression rate of HASP1 mod -Promoter not only inhibits the enzyme very efficiently and for a longer period of time, but also achieves a higher cell density before a strong increase in expression occurs due to the consumption of phosphate. Thus, the H AS P1 mod- Pro motor provides the ideal control mechanism, allowing, on the one hand, to achieve high cell densities without expression of the controlled gene before expression is massively increased by phosphate degradation. On the other hand, its expression level is very finely controllable, and the maximum possible expression rates are very high.
[0140] According to a preferred embodiment, the culture medium comprises glycerol as a carbon source in an amount of more than 50 mM, preferably more than 60 mM, particularly preferably more than 70 mM, very particularly preferably more than 80 mM, further preferably more than 90 mM, in particular more than 100 mM. According to a further preferred embodiment, the initial culture medium comprises glucose as a carbon source in an amount of more than 0.5 g / L, preferably more than 1 g / L, particularly preferably more than 2 g / L, very particularly preferably more than 5 g / L, further preferably more than 10 g / L, in particular more than 20 g / L.
[0141] Throughout the entire cultivation process, glucose is administered at a rate of 0.5 g / L, preferably more than 1 g / L, particularly preferably more than 2 g / L, very particularly preferably more than 5 g / L, further preferably more than 10 g / L, especially more than 20 g / L every 2 to 14 days; preferably every 2 to 10 days, particularly preferably every 3 to 7 days. The administration may include only glucose, but also other nutrients such as phosphate, any nitrogen source, particularly preferably NO3 salts. The entire medium can be replaced or the nutrients can be added directly to the culture (continuous culture or fed-batch).
[0142] Alternatively, acetate, sucrose, fructose, starch or an equivalent carbon source may be present in the culture medium as a carbon source.
[0143] A carbon source is necessary because the light penetration of the medium is continuously reduced by the increasing cell density.
[0144] Despite the carbon source, growth is limited by the light supply: It has been found that light-dependent cell growth at a cell density between 30 million cells*ml -1 million and 400 million cells*ml -1 Thus, at a cell density between 35 million cells*ml -1 and 350 million cells*ml' 1 , preferably at a cell density between 40 million cells*ml -1 and 300 million cells*ml _ 1 , particularly preferred at a cell density between 45 million cells*ml -1 and 400 million cells*ml -1 and particularly preferably at a cell density between 55 million cells*ml -1 and 200 million cells*ml -1Either light-independent cell growth or continuous dilution of the cell culture or a process that allows light to penetrate the medium is required. Glycerol and / or glucose, in the amounts specified herein, have proven particularly advantageous for the production of high biomass with simultaneous high production of heterologous protein.
[0145] Furthermore, the culture medium preferably comprises nitrogen, preferably in the form of NO3 and / or NH4, in an amount of more than 10 mM, preferably more than 15 mM, particularly preferably more than 20 mM, very particularly preferably more than 30 mM, further preferably more than 40 mM, in particular more than 50 mM. A sufficient availability of a nitrogen source, particularly in the form of NO3 and / or NH4, is advantageously crucial for optimal protein production. If the nitrogen concentration is below a critical value, the cell density itself may remain unaffected, but the protein yield drops dramatically. To avoid losses in yield, the amount of nitrogen required to achieve a certain cell density must be within a specific range. Within the scope of the present invention, NH4 and / or NO3 can be present in any chemical form and bond.
[0146] Nitrogen is added either initially and / or gradually to achieve the specified values. Preferably, nitrogen is added initially and gradually.
[0147] Preferably, the initial NO3 concentration of the culture medium is between 5 mM and 250 mM, preferably between 10 mM and 250 mM, particularly preferably between 20 mM and 250 mM, especially preferably between 50 mM and 250 mM.
[0148] Preferably, the successive NO3 addition to the culture medium is between 5 mM and 250 mM, preferably between 10 mM and 250 mM, particularly preferably between 20 mM and 250 mM, especially preferably between 50 mM and 250 mM.
[0149] If NH4 is used as the nitrogen source, continuous monitoring of the pH value and continuous buffering of the culture medium are preferable, since otherwise a drop in the pH value leads to a strong reduction in the vitality of the cell culture.
[0150] According to a further advantageous embodiment, the culture medium has an initial amount of micronutrients / trace elements and vitamins of 2 to 400 times, preferably 3 to 400 times, particularly preferably 4 to 400 times, most particularly preferably 5 to 400 times above the respective “normal” concentration.
[0151] "Normal" concentrations for trace elements and vitamins have been described for the cultivation of diatoms and are known to those skilled in the art. They may vary from publication to publication. The reference values for "normal" concentrations within the scope of the present invention refer to the f / 2 medium and are shown below: Table 1: Composition of the media: trace elements contained.
[0152] Table 2: Trace elements added to the medium in increased concentrations.
[0153] Typical concentrations of the f / 2 medium (Guillard, 1975) are listed here.
[0154] Examples of vitamins that are present in the culture medium at the specified increased concentration are biotin (used as standard at a “normal” concentration of 2 pM), cyanocobalamin (used as standard at a “normal” concentration of 0.37 pM) and thiamine (used as standard at a “normal” concentration of 297 pM).
[0155] The culture medium preferably has a pH of 6 to 9.5, preferably from 6.5 to 9, particularly preferably from 7 to 8.5. The culture medium is preferably buffered using Tris buffer, although other buffer-active substances known to the person skilled in the art that have equivalent properties in the pH range mentioned are also suitable, for example HEPES or MOPS buffer.
[0156] In particular, the culture medium contains more than 2.5 mM Tris-HCl, pH 8, preferably more than 5 mM Tris-HCl, pH 8, particularly preferably more than 7.5 mM Tris-HCl, pH 8, most particularly preferably more than 10 mM Tris-HCl, pH 8.
[0157] According to a preferred embodiment, the culture medium has an oxygen saturation in the range of 40% to 100%, preferably in the range of 50% to 100%, particularly preferably in the range of 60% to 100%, very particularly preferably in the range of 70% to 100%, in particular in the range of 80% to 100%.
[0158] Especially at higher cell densities, the carbon source (e.g., in the form of glycerol, acetate, glucose, sucrose, fructose, starch) of the culture medium has a strong influence on biomass growth. When light availability is low, it is O2 rather than CO2 that drives cell growth. Oxygen can be added to the culture medium either from the air or as concentrated O2 or as a mixture containing O2. The saturation of the culture medium with O2 is crucial.
[0159] In heterotrophic or mixotrophic conditions, cultivation is carried out with air or O2, or a mixture containing O2. This method of aeration ensures that the culture medium remains supplied with oxygen.
[0160] When aerating with air, the initial ventilation is at least 1 L * min -1 * L -1 Culture medium, preferably at least 2 L * min -1 * L -1Culture medium, particularly preferably at least 3 L * min -1 * L -1 Culture medium, most preferably at least 4 L * min -1 * L -1 Culture medium. Aeration with air should preferably be gradually increased to at least 8 L * min -1 * L -1 Culture medium.
[0161] When aerating with oxygen, the initial aeration is at least 0.1 L * min -1 * L -1 Culture medium, preferably at least 0.2 L * min -1 * L -1 Culture medium, particularly preferably at least 0.3 L * min -1 * L -1 Culture medium, most preferably at least 0.4 L * min -1 * L -1 Culture medium. Aeration with O2 and / or air should preferably be gradually increased to at least 8 L * min -1 * L -1Culture medium. For photoautotrophic cultivation, a gas mixture containing air or another gas mixture with CO2 is preferably used to aerate the culture medium. In this application, the initial aeration rate when aerating with air is at least 1 L * min. -1 * L -1 Culture medium, preferably at least 2 L * min -1 * L -1 Culture medium, particularly preferably at least 3 L * min -1 * L -1 Culture medium, most preferably at least 4 L * min -1 * L -1 Culture medium. Aeration with air should preferably be gradually increased to at least 8 L * min -1 * L -1 Culture medium.
[0162] When aerating with a CO2-containing gas mixture, the CO2 content of the initial aeration is at least 0.1 L * min -1 * L -1 Culture medium, preferably at least 0.2 L * min -1 * L -1Culture medium, particularly preferably at least 0.3 L * min -1 * L -1 Culture medium, most preferably at least 0.4 L * min -1 * L -1 Culture medium. Aeration with CO2 should preferably be gradually increased to at least 8 L * min -1 * L -1 Culture medium.
[0163] Increased ventilation leads to a significantly faster growth of biomass.
[0164] Another essential parameter for optimized cultivation in terms of biomass and heterologous protein production is the type (regarding the spectrum used) and intensity of the light exposure.
[0165] According to a further preferred embodiment, the culture medium is exposed to light during the cultivation according to step (b) with an exposure intensity (light intensity) of 20 - 400 pmol *nr 2 * s -1 , preferably from 40 - 400 pmol *nr 2 * s -1, particularly preferably from 60 - 400 pmol *nr 2 * s -1 , most preferably from 80 - 400 pmol *nr 2 * s -1 , especially from 100 - 400 pmol *nr 2 * s -1 exposed, measured inside the culture medium, preferably in the center of the culture medium.
[0166] The light intensity is preferably measured using either a PAR sensor or an ePAR (Extended Photosynthetically Active Radiation) sensor, both of which allow the measurement of the total photon flux intensity. The measurement range of ePAR sensors (400 nm to 750 nm) extends the spectrum of PAR sensors (400 nm to 700 nm). Alternatively, the light intensity can be measured using another suitable sensor that detects light intensity and spectrum.
[0167] Preferably, the sensor used for light measurement is aligned at a 90° angle to the light source. The sensor is located at a distance relative to the vessel wall closest to the light source of 0.3 to 0.5 times the diameter of the culture vessel.
[0168] It may also be provided that a successive increase in the light intensity by 20 - 400 pmol *nr 2 * s -1 , preferably from 40 - 400 pmol *nr 2 * s -1 , particularly preferably from 60 - 400 pmol *rrr 2 * s -1 , most preferably from 80 - 400 pmol *m -2 * s -1 , especially from 100 - 400 pmol *m -2 * s -1 is measured (as described herein) inside the culture medium, preferably centrally in the culture medium.
[0169] Following the cultivation of the transformed cells, the heterologously produced proteins are extracted according to the invention.
[0170] In addition to the heterologously produced protein(s), also referred to herein as protein of interest, the disrupted cells may contain a variety of low-molecular-weight substances that can interfere with subsequent processes. These substances include, for example, pigments, i.e., colorants visible to the naked eye. It has been found that after cooling the disrupted cells, particularly the disrupted diatom cells, the pigments can be separated using common separation methods such as centrifugation or filtration. For this purpose, the following temperatures are set during the separation processes: preferably a maximum of 4°C, more preferably a maximum of 2°C, and most preferably a maximum of 0°C. Furthermore, the pH of the disruption buffer is preferably between pH 2-12 and particularly preferably between pH 4-10.
[0171] The extraction of the heterologously produced proteins is also carried out by methods known to the person skilled in the art.
[0172] EXAMPLES OF IMPLEMENTATION
[0173] The present invention is explained in more detail with reference to the following figures and exemplary embodiments, without limiting the invention to these.
[0174] This shows
[0175] Fig. 1 : A schematic overview of the relationship between individual invention objects;
[0176] Fig. 2A: the repetition of two promoters;
[0177] Fig. 2B: a vector according to the invention with repetitively inserted expression cassettes;
[0178] Fig. 3: a diagram showing the formation of fluorescence as a function of the copy number of the promoter used in a nucleic acid sequence according to the invention or a vector according to the invention;
[0179] Fig. 4A: a diagram showing the distribution of signal intensities as a function of the number of expression cassettes in a vector according to the invention;
[0180] Fig. 4B: a diagram showing the number of transgenic colonies and the proportion of fluorescent clones as a function of the number of expression cassettes in a vector according to the invention;
[0181] Fig. 5A: a diagram showing the distribution of signal intensities depending on the type of vector modification with respect to a replicon;
[0182] Fig. 5B: evidence of the formation of a replicon in Phaeos;
[0183] Fig. 6A: the result of three gel electrophoreses comparing the proteolytic degradation depending on the hinge region used;
[0184] Fig. 6B: the amino acid sequence of the hinge region according to the invention;
[0185] Fig. 7: a diagram of the dependence of HASP1 mod-Promoter by phosphate consumption or repression of HASP1 mod -Promoters by regular addition of phosphate;
[0186] Fig. 8A: a diagram showing the relationship between cell density and measured GFP signal;
[0187] Fig. 8B: a diagram of the responses of seven independent clones to phosphate deficiency compared to a diagram of the same clones under phosphate addition; Fig. 9: a diagram of the phosphate deficiency-dependent activation of the HASP1 according to the invention mod -Prornotors;
[0188] Fig. 10: a diagram showing the shortening of the harvest cycle by adding phosphate;
[0189] Fig. 11: an embodiment of a vector according to the invention;
[0190] Fig. 12: a graph comparing the tGFP signal intensities of independent clones at three different time points in 96-well plates with the reference in 100 ml flasks.;
[0191] Fig. 13A: Microscopic image of fusiform cells of P. tricornutunr,
[0192] Fig. 13B: Microscopic image of oval cells of P. tricornutunr,
[0193] Fig. 13C / D: Diagrams of the correlation of optical density and cell number in fusiform cells (C) and oval cells (D) of P. tricornutunr,
[0194] Fig. 13E: a diagram showing the correlation between expected and measured optical density as a function of cell density;
[0195] Fig. 14: a diagram showing the correlation between ELISA signals and GFP signals following a screening method according to the invention;
[0196] Fig. 15A: a microscopic image of P. tricornutum-ZeWerr,
[0197] Fig. 15B: a diagram showing the proportion of different cell types depending on the culture age;
[0198] Fig. 15C: a representation of the vitality and division rate of cells of a preculture of P. tricornutum at different times during the cultivation;
[0199] Fig. 15D: a diagram showing the growth of the main culture as a function of the age of the pre-culture;
[0200] Fig. 16A: a graph showing the relationship between protein production, culture age and amount of nitrogen source;
[0201] Fig. 16B: a diagram showing the relationship between cell density, culture age and amount of nitrogen source;
[0202] Fig. 16C: a diagram showing the relationship between protein production, culture age and amount of urea source;
[0203] Fig. 16D: a diagram showing the relationship between cell density, culture age and amount of urea source;
[0204] Fig. 17: a diagram showing the dependence of cell growth on phosphate concentration; Fig. 18: a diagram showing the dependence of absolute biomass on the available concentration of trace elements and vitamins;
[0205] Fig. 19: a diagram showing the dependence of the increase in cell number on ventilation;
[0206] Fig. 20: the result of gel electrophoresis after digestion, separation of pigments and purification of antibodies in IgG format from P. tricornutunr,
[0207] Fig. 21 : Correlation between fluorescence and expression rate in 10 independent clones; and
[0208] Fig. 22: A diagram comparing the binding affinity of two diatom antibodies (formats) with the sequence-identical ones from human cell culture (Expi 293F ).
[0209] Figure 1 shows a schematic overview of the interrelationship between individual subject matter of the invention. All of the substeps shown (individually or in combination) lead to an improvement / optimization of the heterologous production of proteins, particularly antibodies, particularly in the diatom Phaeodactylum tricornutum.
[0210] As already explained in detail, a sequence optimization (1) of a nucleic acid sequence according to the invention is first carried out. This may, for example, include codon optimization and / or the use of particularly protease-resistant genetic elements (as described herein), such as hinge regions derived from equine IgGs (immunoglobulin G).
[0211] The nucleic acid sequence according to the invention is then introduced into a vector according to the invention (or an isolated nucleic acid according to the invention) (2), whereby individual genetic elements and / or complete expression cassettes are used repetitively. Furthermore, specific inducible promoters are used, in particular a promoter element from the nucleic acid sequence of SEQ ID NO: 1.
[0212] By utilizing specific signal sequences (as described herein), the heterologously produced proteins are expressed in the endoplasmic reticulum of the cells, which leads to protection of the proteins from proteases and successful glycosylation, thereby increasing the yield and maintaining the functionality of the proteins.
[0213] In a next step, the vector according to the invention (or the nucleic acid according to the invention) is transformed (3) into target cells, preferably into photosynthetically active cells, in particular cells of a unicellular plant or viridiplantae, preferably cells of Phaeodactylum tricornutum. The transformation can be carried out ballistically or by electroporation in a suitable medium. This is followed by a screening method according to the invention (4) to select cells with an increased expression rate of a nucleic acid sequence according to the invention. Screening can be carried out using reporter genes for high-performance producers, i.e., cells with an increased expression rate. Furthermore, the correlation between the expression of the reporter genes and the expression level of the proteins to be produced can be determined. Multiwell plates are preferably used for both the screening method and for culture monitoring.
[0214] Following the screening method (4) according to the invention, a method according to the invention for producing recombinant proteins, preferably recombinant antibodies, (5) can be carried out on the basis of the cells with an increased expression rate determined in the screening method (4).
[0215] According to the invention, the production of recombinant proteins takes place in a culture medium tailored to the genetic elements used, in particular to the promoters used. The cultivation conditions, such as minimum light intensities and aeration rates, are also adapted (as defined herein).
[0216] Both with regard to the nucleic acid sequence according to the invention and with regard to the vector (6) according to the invention or the isolated nucleic acid according to the invention, the use of repetitive genetic elements leads to an enormous increase in expression rates in P. tricornutum. Figure 2A shows the repetition of two HASP1 promoters. Figure 2B shows an example of an embodiment of a vector (6) according to the invention in which an expression cassette (9) was repeatedly inserted, here in the form of a triple cassette for the production of antibodies in the scFv-Fc format. In particular, this repetitive use of the expression cassette (9) leads to a significant increase in the yield as well as the number of clones or the proportion of clones that show detectable production, thereby minimizing the overall process effort. In the illustrated embodiment, the expression cassette (9) has a promoter element (9.1), a first transcription unit (9.2) which codes for a protein to be produced recombinantly, and a second transcription unit (9.3) which codes for the reporter gene tGFP, wherein the individual genetic elements (9.1, 9.2, 9.3) in Figure 2B are shown by way of example in one expression cassette (9), but are also present in the other expression cassettes (9).
[0217] Figure 3 shows a diagram of the fluorescence formation as a function of the
[0218] Copy number of the promoter used (9.1) in a
[0219] Nucleic acid sequence or a vector according to the invention (6) or an isolated nucleic acid according to the invention. In particular, Figure 3 shows the distribution of the medians of the GFP signals (fluorescence signals of the Green Fluorescent Protein normalized by ODeoo) depending on the promoter used (9.1), where the HASP1 mod-Prornotor was used either in a single version (left) or in a double version (right). It can be seen that the repetitive (here double) use of the HASP1 m ° d -Promoter leads to an amplification of the measured GFP signals.
[0220] Figure 4A shows a diagram of the distribution of signal intensities as a function of the number of expression cassettes (9) in a vector (6) according to the invention. It can be seen that an increased number of expression cassettes (9) in the vector (6) leads to an increase in the fluorescence signal (measured as a normalized tGFP signal, note the Iog2 scale), which is due to the increased expression of the reporter gene. Figure 4B shows a diagram of the number of transgenic colonies and the proportion of fluorescent clones as a function of the number of expression cassettes (9) in a vector (6) according to the invention (this is an Iog2 scale). It is clear that an increased number of expression cassettes (9) increases both the number of transgenic clones and the proportion of clones with a detectable fluorescence signal, with the fluorescent signal being a direct measure of protein production / antibody production.
[0221] Figure 5A illustrates the increase in the yield of heterologously produced protein depending on the use of replicative viral units. It shows a diagram of the distribution of signal intensities depending on the type of vector modification with respect to a replicon. In the example shown, the replicon from the Weed Dwarf Virus (WDV) was used. The use of the replicon (right in the diagram) leads to a significant enhancement of the fluorescence signal (measured as a normalized tGFP signal, note the Iog2 scaling) compared to vectors not modified in this way (left in the diagram) and thus to an increase in the yield of heterologously produced proteins. This is based on the fact that the replicon enables independent division of the transformed DNA. This increases the copy number of transformed DNA, which, for example, leads to an increase in the amount of transcript (mRNA) and more protein production.Furthermore, an increased copy number of the transcription unit to be introduced (9.2) can result in this DNA being integrated multiple times into the genome, which increases the chance of integration at a “favorable” locus.
[0222] Figure 5B shows a schematic representation of the repModi vector (vector modified with a so-called replicon) and putative replicon and the analysis of some clones from the repModi approach. (Top of the figure) Schematic representation of the repModi vector and the putative replicon with corresponding primer position for detection and sequencing. (Bottom left of the figure) PCR analysis of the control and clones D6, E2, E12, and F8 for antibodies and replicon formation. (Bottom right of the figure) Sequencing result of the replicon amplicons of clones E12 and F8. Marker (M): GeneRuler 1 kb Plus. The primer pair R1 / R2 was used to detect a replicon (480 bp) formation and the primer pair AK1 / AK2 was used to detect the antibody sequence (390 bp). Black arrows in the bottom left of the figure point to the respective amplicons at the correct height.
[0223] The repModi vector (in Fig. 5B repModi) was equipped with genetic elements from the Weed Dwarf Virus (WDV). The replicon-forming units (2x LIR, RepA, and SIR) flank the antibody cassette and participate in the vector's recombination. After the recombination event, the vector consists of an LIR element, the RepA element, the SIR element, and the antibody cassette. The backbone and one LIR element are removed. Such a unit is capable of independent replication in the host organism.
[0224] To verify whether this recombination event had occurred, appropriate primers were synthesized. The primer pair R1 / R2 was designed to detect the recombination event (480 bp), while the primer pair AK1 / AK2 was designed to detect a small portion of the antibody cassette (390 bp). In the case of recombination, the distance between primers R1 and R2 is reduced from 3720 bp to 480 bp.
[0225] The PCR results are shown in Figure 5B (bottom left). A clone containing the same antibody sequence as the repModi assays, but cloned into the noModi vector, was used as a control. Using the primer pair AK1 / AK2, a band of approximately 400 bp was detected in all clones. Using the primer pair R1 / R2, a band of approximately 500 bp was detected in all tested clones D6, E2, E12, and F8, except for the control. The amplicons of clones E12 and F8 were subsequently sequenced. The sequencing revealed a base sequence that would be expected during recombination (Figure 5B (bottom right)). The PCR result and the sequencing strongly indicate the formation of a replicon.
[0226] Figure 6A shows the results of different gel electrophoresis to compare the proteolytic degradation depending on the hinge region used.
[0227] The lanes labeled M always show the same size marker. Different IgGs are applied in the different lanes: Lane 1: equine IgG6, Lane 2: equine scFv-Fc, Lane 3: murine IgG1, and Lane 4: human IgG1. The solid arrows indicate the non-proteolytically cleaved heavy chain (HC), while the hatched arrows indicate the light chain (LC). This band is missing in lane 2 because, in the scFv-Fc format, the LC is covalently bound to the other regions of the scFv-Fc and is therefore not separated in SDS-PAGE. Therefore, the upper band in lane 2 has also traveled less far than those in all other lanes. The open arrows indicate the cleavage products occurring in murine and human IgGs. It can be seen that the use of protease-resistant elements, in this case a protease-resistant hinge region, significantly influences the proteolysis of the proteins found in P.tricornutum produced antibodies of different formats and from different species, both in vivo and in vitro.
[0228] Figure 6B shows the amino acid sequence of the equine hinge region from eqIgG6 according to the invention. The described effect of reducing proteolysis by the hinge region also applies to genetic elements in which this amino acid sequence has been altered by up to 30%.
[0229] Figure 7 shows a diagram of the dependence of HASP1 mod Promoter by phosphate consumption (dark grey curve) or repression of HASP1 mod Promoter by regular phosphate addition (light gray curve). The GFP signal is a direct measure of promoter activity or protein production. Several independent clones showed this phosphate dependence. One of the clones is shown here as a representative example. It can be seen that the HASP1 modpromoter is inhibited by phosphate and triggered by phosphate deficiency. "Phosphate" refers to all phosphate salts and phosphate-containing organic compounds, and all chemical forms of phosphate. It should be noted that phosphate concentrations above 360 pM are particularly suitable for the regulation of the promoter. Such high concentrations can increase the expression rate of HASP1. mod -Promoter not only inhibits the protein very efficiently and for a longer period of time, but also achieves a higher cell density before a strong increase in expression occurs due to the consumption of phosphate. Thus, the HASP1 mod -Promoter provides the ideal control mechanism for achieving high cell densities without expression of the controlled gene before expression is massively increased by phosphate degradation. On the other hand, its expression level is very finely controllable, and the maximum possible expression rates are very high.
[0230] Figure 8A shows a diagram of the relationship between cell density and measured GFP signal in three different cell cultures (dark gray, medium gray, light gray). The dashed line represents the expected (assuming unrestricted linear behavior), and the solid line represents the measured GFP signal. It can be seen that the measured signal deviates from the expected signal. This is due to the increasing cell density. The relationship between cell density and signal strength is linear within a certain range. If signals are measured above a critical cell density, a corresponding correction must be made. In particular, this deviation leads to the fact that when using a nutrient deficiency-dependent promoter (e.g., HASP1 mod, alkaline phosphatase) or a nutrient-triggered promoter (e.g. nitrate reductase), the nutrient concentration of the cell culture must be carefully selected for studies at the molecular level (e.g. testing of additional regulatory sequences as well as for cultivation studies). The deficiency must occur before the cell density exceeds the critical value, otherwise a comparison between the clones is not possible. When using nutrient deficiency-triggered promoters, it is also important to ensure that only clones showing a similar cell number are compared, and global peaks of the individual signal time series are used to evaluate production. If the critical cell density is exceeded, there is no linear relationship between the number of cells and signal intensity. Since the underlying effects predominantly depend on the cell density, the measurement can be corrected using a standard.
[0231] Figure 8B shows a graph of the responses of seven independent clones to phosphate deficiency (left) compared to a graph of the same clones under phosphate supplementation (right). The wild type is indicated in both graphs. Without the addition of phosphate (left graph), the tGFP signals of all transgenic clones increased. With the addition of phosphate (right graph), the tGFP signals decreased to a low level.
[0232] A diagram of the phosphate deficiency-dependent activation of the inventive H AS P1 mod- Promoters is shown in Figure 9. The strength of the GFP signal as a function of culture age is illustrated using four different cultures. The four cultures were cultivated in culture media with different phosphate concentrations, with 36 pM representing the lowest and 360 pM the highest phosphate concentration. Here, too, the GFP signal is a direct measure of promoter activation and protein production. With an increase in phosphate concentration, the peak of the GFP signal shifts, since the phosphate deficiency occurs at a later time or at a higher cell density. While in a medium with the lowest phosphate amount the peak appears after approximately 16 days (36 pM), at higher concentrations this peak occurs on approximately day 24 (72 pM), day 29 (140 pM), or the peak is not reached (360 pM). When this peak is reached depends on the initial phosphate concentration, the growth rate of the cells and the absolute cell number.Although the peak of the culture with the highest phosphate concentration is not reached here, the yield is nevertheless highest here, as the cell density is many times higher than that of other cultures due to the increased phosphate availability. In this way, both the yield and the "harvest time" can be precisely controlled by adjusting the amount of phosphate.
[0233] Figure 10 shows a diagram illustrating the shortening of the harvest cycle by phosphate addition using a phosphate deficiency-triggered promoter. Compared to the control, peak production is reached earlier when the phosphate level in the medium is kept at a constant "low" level or when phosphate is added at specific intervals. This effect occurs because the cells "expect" a phosphate deficiency at an earlier time point (than at the initial addition of the maximum desired phosphate level) due to a lower phosphate content in the culture medium (than the maximum desired phosphate level). Therefore, all phosphate-dependent promoters are regulated accordingly (such as HASP1). mod ). By adding more phosphate, the "expected" deficiency does not occur (or not to the "expected" extent), but the activation of, for example, HASP1 modHowever, the promoter's effect continues for some time, which means that the HASP1 mod A promoter-linked protein of interest (e.g., an antibody) is produced. Thus, the above-mentioned process can be continued by leaving the cells "in the belief" that a phosphate deficiency is occurring. Whether and when this deficiency occurs depends on the desired duration of cultivation and is monitored by the person in charge. In the illustrated example, phosphate is added at regular intervals in the form of NaH2PO4.
[0234] Figure 11 shows an exemplary embodiment of a vector (6) according to the invention for transforming P. tricornutum. Only elements relevant to P. tricornutum are shown. This construct leads to the production of an antibody in the so-called scFv-Fc format in the transformed diatom (whose individual elements are: a variable heavy chain VH (9.21), which is linked to a variable light chain VL (9.22) via a linker. This lies in front of the constant regions, here a human intermediate sequence, the hinge region (9.23) and an equine constant region (CH2 and CH3) (9.24). This region is linked via a proteolytically cleavable Flag tag to a reporter gene (9.3), here turboGFP, which in turn is fused to a Strep tag. Another genetic construct under the control of a constitutive fcpB promoter is a selectable marker (9.5), here the Zeocin resistance gene.It becomes clear that genetic elements of different origins (here antibodies in scFv format with synthetic, human and equine origin) can be combined and still form functional proteins.
[0235] Figure 12 illustrates a comparison of the tGFP signal intensities of independent clones at three different time points in 96-well plates with the reference in 100 ml flasks. To establish an evaluation of the tGFP signals in a multiwell plate, it was checked at which time point the tGFP signals in the multiwell plate were closest to the "final / actual" tGFP signal. For this purpose, the tGFP signals of 29 independent clones were measured at several time points in a 96-well plate, and then the tGFP signals of the same cultures in 100 ml flasks were determined. In previous experiments, SDS-PAGE showed that the tGFP signals in 100 ml flasks correlate with the actual protein amount. Figure 12 shows the development of the tGFP signals in the 96-well plates at four different time points after inoculation of the culture (day 1, day 4, day 6, day 8). The corresponding R 2 - values given. The R2 - Values are 0.1, 0.86, 0.93, and 0.93 for the corresponding time points 1, 4, 6, and 8. There was no correlation between the measured tGFP signal in the 96-well plate and the maximum achievable tGFP signal on day 1 after inoculation. On day 4, the R 2 -value to 0.86 and increased to 0.93 on day 6. From day 6 to day 8 there was no change in the R 2 -value measurable change in correlation.
[0236] Figures 13A and 13B show microscopic images of different cell types in the P. tricornutum culture, with Figure 13A showing fusiform cells and Figure 13B showing oval cells. Both morphological types are present in each culture, although the ratio between the proportions can vary between > 0 and < 1. When determining the cell count of Phaeodactylum using optical density, the morphology of the cells must be taken into account to avoid erroneous correlation. The relevant factor depends on the instrument.
[0237] Figures 13C and 13D show diagrams for the correlation of optical density (OD) and cell count in fusiform cells (C) and oval cells (D) of P. tricornutum. The diagram in Figure 13E showing the correlation between expected and measured optical density as a function of cell density clearly shows that the cells must not exceed a certain cell count in order to obtain a linear relationship or reliable, linear measurement results. The range in which the cell count must lie depends on the cell size, type, and the measuring instrument and must therefore be determined empirically, e.g., via serial dilutions. Different wavelengths can be used to determine the cell count in a Phaeodactylum tricornutum culture, preferably between 600 and 800 nm. The measurement is particularly preferably carried out at a wavelength of 600 to 750 nm.
[0238] Figure 14 shows a diagram of the correlation between ELISA signals and GFP signals following a screening method according to the invention. GFP signals represent the protein quantity. This correlation is expressed with an R 2 -Value of 0.92 shows that the applied high-throughput method can be used to lyse the cells in the ELISA procedure.
[0239] Figure 15A shows a microscopic image of P. tricomutum cells, where the cells are present either as a single cell (11.1), as a cell chain of two cells (11.2), or as multiple cell chains (11.3). The optimal time for transferring the preculture to the main culture (within the scope of the production process according to the invention) is a time at which the ratio of single cells to double cell chains is between
[0240] O,3 and 10.
[0241] A diagram of the proportion of different cell types as a function of culture age is shown in Figure 15B. "1x" denotes the proportion of single cells (11.1), "2x" denotes the proportion of cell chains consisting of two cells (11.2), and ">2x" denotes the proportion of multiple cell chains (11.3).
[0242] Figure 15C shows a representation of vitality and division rate of cells from a preculture of
[0243] P. tricornutum at different times during the cultivation of the preculture. Finally, Figure 15D shows a diagram of the growth of the main culture as a function of the age of the preculture. Figures 15B, 15C, and 15D clearly show that the time at which the preculture should be transferred to the main culture plays an important role. There is a relationship between vitality, division rate, and / or the ratio between single cells and cell chains of two or more cells in the preculture and the subsequent growth rate of the main culture. The proportion of living cells must be high, and a certain division activity of the preculture must not be exceeded to enable optimal biomass growth. Higher biomass leads to a higher yield in the main culture. To determine the optimal time, either the proportion of living cells (Fig.15C), the ratio between duplicate and single cells can be used or the division rate must be above a certain threshold (Fig. 15A and 15B).
[0244] Figure 16A shows a diagram illustrating the relationship between protein production, culture age, and the amount of nitrogen source, and Figure 16B shows a diagram illustrating the relationship between cell density, culture age, and the amount of nitrogen source. The nitrogen sources are given in mM. While cell density is only minimally influenced by the nitrogen concentration (Fig. 16B), the amount of protein produced depends strongly on the amount of nitrogen source (Fig. 16A). Here, too, the GFP signal is a direct measure of the amount of heterologously expressed protein. Adequate availability of a nitrogen source is crucial for optimal protein production (especially NO3 and NH4). If this is below a critical value, the cell density itself may remain unaffected, but the protein yield drops dramatically.To avoid yield losses, the amount of nitrogen needed to achieve a certain cell density must be within a certain range (e.g. NH4 or NO3 in any chemical form and bond).
[0245] Figure 16C shows a diagram illustrating the relationship between protein production, culture age, and the amount of urea source, while Figure 16D shows a diagram illustrating the relationship between cell density, culture age, and the amount of urea source. Here, too, the urea sources are given in mM. Similar to Figures 16A and 16B, the amount of nitrogen influences protein production. However, as can be seen in Figure 16D, urea is harmful to the culture above a certain concentration, as the culture dies after some time at a concentration of 10 mM urea. Thus, the initial concentration of urea is limited to >10 mM.
[0246] Figure 17 shows a diagram of the dependence of cell growth on phosphate concentration. A specific amount of phosphate is required to achieve a specific maximum cell density. The different phosphate concentrations are given in pM. This clearly shows the delicate balance between activation of the HASP1 promoter. mod and achieving a high cell density (compare Figure 9).
[0247] Figure 18 shows a diagram illustrating the relationship between absolute biomass and the available concentration of trace elements and vitamins. In the control, vitamins and trace elements are used at a concentration similar to that described in the f / 2 medium (“standard medium”). In the four subsequent samples, vitamins (V) and trace elements (S) were used in an x-fold amount compared to the standard medium: 5-fold, 40-fold, 80-fold, and 160-fold. It can be seen that even an extreme increase in concentration does not lead to a significant reduction in biomass. Especially in batch culture, it is advantageous to enrich the medium with as many nutrients as possible to avoid potential deficiencies.
[0248] A diagram illustrating the relationship between the increase in cell number and the aeration of the culture medium is shown in Figure 19. Increased aeration at 3 L / min (upper line) resulted in a significantly faster increase in biomass compared to the control (aeration at 1 L / min, lower line). This demonstrates the need to ensure a sufficient supply of gases such as CO2 and O2. In particular, the light penetration of the medium decreases significantly at even low cell densities, causing photosynthesis to cease. From this point on, the cell increasingly relies on the uptake of external, organic carbon sources such as glycerol or glucose and thus requires increasing amounts of O2.
[0249] Figure 20 (A and B) shows the results of gel electrophoresis after digestion and purification of antibodies in IgG format from P. tricornutum. Figure 20A shows the Coomassie-stained SDS-PAGE, and Figure 20B the corresponding immunostaining. The supernatant is applied to the lanes labeled "Ü," while the lanes labeled "PP" contain pigment-containing pellets. The pigment could be separated from the recombinant antibody without significant losses in yield. Interference from the pigment during the subsequent process is minimized. Immunostaining was performed with mouse anti-Strep antibody and rabbit anti-mouse IgG-AP, which is why only the heavy chain is detected in the immunostaining, since the light chain does not contain a Strep tag. The crude diatom lysate was cooled. After centrifugation or filtration, two fractions formed. The fraction “Ü” was the soluble supernatant and the fraction “PP” was the pigment-containing pellet.It is crucial that the pigment can be separated and that the majority of the antibody remains in the soluble supernatant.
[0250] Figures 21A-D show the correlation between fluorescence and expression rate in 9 of a total of 30 independent clones. Figure 21A shows tGFP fluorescence units (Turbo-Green Fluorescent Protein, tGFP) for the 9 clones. Figure 21B shows corresponding protein extracts separated from a Coomassie-stained SDS-PAGE, with the numbers above the lanes representing different, independent clones (black arrow marks the heavy chain of the antibody). Figure 21C shows the immunostaining of the expressed antibodies in the corresponding samples, the labeling of which corresponds to that in Figure 21B (black arrow marks the heavy chain of the antibody). Figure 21D shows a strong correlation between the GFP signal from Figure 21A and the pixel intensity of the heavy chain from Figure 21B with an R 2-value of 0.94 and Figure 21 E shows the corresponding bar graph in which the values of tGFP signal and SDS band strength (antibody band, measured densitometrically in the Bio-Doc (Bio-Rad)) are plotted side by side.
[0251] The product manufactured by the manufacturing process according to the invention is therefore not only cheaper to produce, but the manufacturing process also has a number of advantages over conventional processes: The antibodies produced have the same avidities as the counterpart from Expi 293F -cells (Error! Reference source could not be found. 22). Furthermore, the process presented here is sustainable, animal-free, and—depending on the origin of the antibody sequence to be produced—even vegan. Compared to antibody sera from animals, the antibodies presented here are permanently available. Production can be easily scaled up, and the products are free of human pathogens.
[0252] Figure 22 shows a diagram comparing the binding affinity of two diatom antibody (formats) (light gray, triangles) with sequence-identical ones from human cell culture (Expi293F) (dark gray, squares). In a competitive titration assay, the avidities of antibodies of different formats (IgG or scFv-Fc) against equine interleukin 31 were analyzed at increasing antibody concentrations. For the sequence-identical IgGs (solid lines) from diatoms or Expi 293F -Cells, no differences are observed; in the scFv-Fc's (dashed) of the different starting lines, the scFv-Fc from diatoms is even more affine than the original from the human cell culture.
[0253] Concrete implementation example
[0254] The exemplary embodiment, the sequence of which is outlined in Fig. 1, shows the production of an antibody using the method according to the invention. This antibody in IgG format is directed against equine interleukin 31 and was treated with more than 160 mg of purified eqIgG * L -1 Cell culture produced within a 14-day culture period.
[0255] In a first step, the codon usage is adapted to P. tricornutum. In this case, the starting sequence comes from a human scFv library and was codon-optimized before use in the diatoms. The required genetic elements, typically the variable light chain (V L ) and the variable heavy chain (V H) were synthesized by IDT-DNA (Coralville, Iowa) so that they fit optimally into the created vectors (Fig. 2B). Interfering restriction sites were also removed or modified. A variant of the vectors according to the invention for the production of antibodies in the scFv-Fc format is shown in Fig. 2B. Here, the variable light chain (kappa or lambda format (V LK or V L A)) and the variable heavy chain (V H). In this example, the constant regions of both chains originate from the horse. Constructs containing constant antibody regions from other host organisms (e.g., mouse or human) have also been generated. Further variants of the vectors according to the invention have been produced and successfully used for the heterologous production of other formats such as Fab or scFv-Fc. The example shown in Fig. 2B contains the finished vector construct and, in addition to the elements to be introduced into P. tricornutum, also bacterial genetic elements that serve for cloning in E. coli (colE1 origin and gentamycin resistance gene). The gene of interest was inserted in three copies in the construct. After ballistic or electroporation-based transformation of P.tricornutum, the resulting clones must not only be checked for the uptake of the antibody genes, but also the rapid identification of clones that express the introduced antibody gene particularly strongly, which represents a central innovation of this invention. The underlying screening method according to the invention enables the correlation of the fluorescence caused by tGFP (Turbo-Green Fluorescent Protein), which is measured in a special microtiter plate reader, with the amount of antibody that can be expected later (Figure 21 shows the correlation between fluorescence and expression rate in 9 independent clones).
[0256] Compared to the state-of-the-art production rates of a maximum of 3 mg antibody * L 1In the system according to the invention, 160 mg of purified antibodies could be obtained from 1 L of culture. To achieve this, new media compositions, aeration with more than 3 L * min -1 Compressed air and lighting with a luminous intensity of 100 - 1000 W * nr 2 used in a specially developed reactor column.
[0257] An example media composition is given in the following table:
[0258] After typically fourteen to twenty days of fed-batch culture, the diatoms can be harvested and digested. Purification follows the classic method, i.e., after lysis and centrifugation and / or ultrafiltration, purification is carried out either via protein A, protein G, or via the tag sequences used, for example, the 6xHis tag. This is a further advantage of the method according to the invention, because unlike higher plants, which produce antibodies transiently or stably, diatoms do not contain fibers that make antibody purification extremely difficult. The purification therefore largely corresponds to the method used, for example, for animal cell cultures, such as CHO cells. LIST OF REFERENCE SYMBOLS
[0259] 1 Sequence optimization of the nucleic acid sequence according to the invention
[0260] 2 Introducing the nucleic acid sequence according to the invention into a vector according to the invention
[0261] 3 Transformation
[0262] 4 Screening procedures
[0263] 5 Processes for the production of recombinant proteins
[0264] 6 Vector
[0265] 7 cells
[0266] 8 Culture medium
[0267] 9 Expression cassette
[0268] 9.1 Promoter element
[0269] 9.2 first transcription unit
[0270] 9.21 variable heavy chain
[0271] 9.22 variable light chain
[0272] 9.23 Hinge region
[0273] 9.24 equine constant region (CH2 and CH3)
[0274] 9.3 second transcription unit
[0275] 9.4 Signal peptide
[0276] 9.5 Selection markers
[0277] 10.1 Length standard for gel electrophoresis
[0278] 10.2 Wild-type extract in gel electrophoresis
[0279] 10.3 equine lgG6 in gel electrophoresis
[0280] 10.4 scFv-Fc in gel electrophoresis
[0281] 10.5 murine lgG1 in gel electrophoresis
[0282] 10.6 human IgG in gel electrophoresis
[0283] 10.7 human lgG1 in gel electrophoresis
[0284] 11.1 single cells of Phaeodactylum tricornutum
[0285] 11.2 Double cell chains of Phaeodactylum tricornutum
[0286] 11.3 Multiple cell chains of Phaeodactylum tricornutum
Claims
PATENT CLAIMS 1 . A nucleic acid sequence comprising at least one expression cassette for expressing a protein, wherein the expression cassette comprises at least one promoter element and at least one first transcription unit encoding at least one peptide, wherein the promoter element consists of the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence having a homology of at least 70% to SEQ ID NO:
1.
2. Nucleic acid sequence according to claim 1, wherein the expression cassette further comprises at least a second transcription unit encoding a reporter protein.
3. Nucleic acid sequence according to claim 1 or 2, wherein the expression cassette further comprises at least one sequence region encoding a selection marker.
4. Nucleic acid sequence according to one of claims 1 to 3, wherein the promoter element and / or the first transcription unit and / or a complete expression cassette is present repetitively.
5. Nucleic acid sequence according to one of claims 1 to 4, wherein the first transcription unit is present at least twice and the two first transcription units flank the sequence region encoding a resistance gene.
6. Nucleic acid sequence according to any one of claims 1 to 5 further comprising at least one replicative viral unit.
7. Nucleic acid sequence according to one of claims 1 to 6, further comprising at least one sequence region encoding a retention signal.
8. Nucleic acid sequence according to any one of claims 1 to 7, wherein the first transcription unit comprises a polynucleotide encoding an amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having a homology of at least 70% to SEQ ID NO:
2.
9. Vector or isolated nucleic acid comprising at least one nucleic acid sequence according to one of claims 1 to 8 in simple or repetitive form.
10. Vector or isolated nucleic acid according to claim 9, comprising at least two, preferably at least three expression cassettes.
11. Vector or isolated nucleic acid according to claim 9 or 10, further comprising at least one sequence region encoding a selection marker.
12. A nucleic acid sequence encoding an amino acid sequence comprising SEQ ID NO: 2 or an amino acid sequence having at least 70% homology to SEQ ID NO:
2.
13. An amino acid sequence comprising SEQ ID NO: 2 or an amino acid sequence having at least 70% homology to SEQ ID NO:
2.
14. A cell comprising a vector or an isolated nucleic acid according to any one of claims 9 to 11, or a nucleic acid sequence according to any one of claims 1 to 8, or a nucleic acid sequence according to claim 12, or an amino acid sequence according to claim 13, wherein the cell is a photosynthetically active cell, in particular a viridiplantae or a unicellular plant, preferably a diatom.
15. A screening method for selecting cells with an increased expression rate of a nucleic acid sequence according to any one of claims 1 to 8, comprising the steps of a) providing cells which have been transformed with a vector or an isolated nucleic acid according to any one of claims 9 to 11 and / or with a nucleic acid sequence according to any one of claims 1 to 8, b) isolating and transferring the cells into a culture medium, c) enriching the culture medium with a phosphate concentration in the range from 0.1 pM to 200 pM and d) examining the cells for an expression rate of the nucleic acid sequence.
16. The screening method according to claim 15, wherein the expression rate of the nucleic acid sequence according to step (d) is determined by the activity of a reporter protein or by the described ELISA method.
17. Screening method according to claim 15 or 16, wherein the examination according to step (d) is carried out after a period of 1 to 21 days, preferably 1.5 to 21 days, particularly preferably 2 to 21 days after the performance of step (c).
18. A screening method according to any one of claims 15 to 17, wherein the assay according to step (d) is carried out at a cell count of 20 to 120 million cells * ml_ -1 occurs.
19. A method for producing recombinant antibodies using a vector or an isolated nucleic acid according to any one of claims 9 to 11 and / or a nucleic acid sequence according to any one of claims 1 to 8, comprising the steps of a) providing cells with a nucleic acid sequence according to any one of claims 1 to 8, preferably determined by a screening method according to any one of claims 15 to 18, b) cultivating the transformed cells in a culture medium, wherein the culturing is carried out initially in a preculture and subsequently in a main culture and wherein the culture conditions are adapted in such a way that the yield of heterologously produced proteins is maximized, and c) extracting the heterologously produced proteins.
20. The method according to claim 19, wherein the preculture according to step (b) is cultivated without external gassing of the culture medium.
21. The method according to claim 20, wherein the preculture with the described division rate is transferred into the main culture after a period of at least 20 days.
22. The method according to claim 19, wherein the preculture according to step (b) is cultivated with external gassing of the culture medium.
23. The method according to claim 22, wherein the preculture is transferred to the main culture at the time of the highest division rate after a period of at least 16 days.
24. The method according to any one of claims 19 to 23, wherein the culture medium comprises phosphate in an amount of 20 pM to 300 pM, preferably 20 pM to 400 pM, particularly preferably 20 pM to 500 pM.