Anti-alpp / alppl2 antibodies, antibody-drug conjugates, and uses thereof
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- AXCYNSIS THERAPEUTICS PTE LTD
- Filing Date
- 2024-08-23
- Publication Date
- 2026-07-01
AI Technical Summary
There is an unmet need for therapeutics targeting ALPP/ALPPL2 for cancer therapy, as these proteins are highly tumor-specific but currently lack approved drugs.
Development of novel anti-ALPP/ALPPL2 antibodies, antigen-binding fragments, and antibody-drug conjugates (ADCs) that specifically bind to ALPP and/or ALPPL2, optimized for improved binding affinity, hydrophilicity, and reduced propensity for aggregation.
The optimized anti-ALPP/ALPPL2 antibodies and ADCs demonstrate enhanced binding affinity and suitability for cancer treatment, particularly for cancers such as mesothelioma, ovarian, pancreatic, and testicular cancers.
Smart Images

Figure SG2024050541_06032025_PF_FP_ABST
Abstract
Description
ANTI-ALPP / ALPPL2 ANTIBODIES, ANTIBODY-DRUG CONJUGATES, AND USES THEREOFCROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to Singaporean Patent Application No. 1020230241 OS, filed August 25, 2023, which is incorporated herein by reference in its entirety.TECHNICAL FIELD
[0002] The present technology relates to therapeutic antibodies, antigen-binding fragments thereof, and antibody-drug conjugates (ADCs) that target alkaline phosphatase, placental (ALPP) and / or alkaline phosphatase, placental-like 2 (ALPPL2) and uses thereof for cancer therapy.REFERENCE TO SEQUENCE LISTING
[0003] Sequence Listing associated with this application is provided electronically in XML file format and is hereby incorporated by reference into the specification in its entirety. The name of the XML file containing the Sequence Listing is AXCY_001_02WO_SeqList_ST26.xml. The XML file is 42,561 bytes in size and was created on August 20, 2024.BACKGROUND
[0004] ALPPL2 and ALPP, often co-expressed together in cancer, are highly tumorspecific and thus attractive targets for cancer therapy. ALPP and ALPPL2 are membranebound proteins involved in ATP recycling from the extracellular space. Both proteins are expressed in ovarian, endometrial, gastric, and testicular cancers with limited expression in normal tissues. There are currently no approved drugs targeting ALPP / ALPPL2, even though there are several clinical candidates in preclinical and early clinical trials. To address the unmet need for therapeutics targeting ALPP / ALPPL2 for cancer therapy, the present technology provides optimized anti-ALPP / ALPPL2 antibodies or antigen-binding fragmentsthereof, as well as ADCs comprising the antibodies or antigen-binding fragments thereof and further comprising a cytotoxic payload, as novel therapeutics for cancer treatment.SUMMARY
[0005] The present technology relates to novel anti-ALPP / ALPPL2 antibodies, antigenbinding fragments thereof, and ADCs that can be employed as novel therapeutics for the treatment of cancer including, for example, mesothelioma, ovarian, pancreatic, endometrial, non-small cell lung, stomach, gastroesophageal junction, cervical, colorectal, and testicular cancers.
[0006] In some aspects, provided is a recombinant antibody or an antigen-binding fragment thereof that specifically binds to ALPP and / or ALPPL2.
[0007] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising at least one, two, or three complementarity-determining regions (CDRs) selected from SEQ ID NOs: 10, 3, 11 ; and / or a light chain variable region comprising at least one, two, or three CDRs selected from SEQ ID NOs: 6-8.
[0008] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 9, 12, or 13; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 14 or 15.
[0009] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising at least one, two, or three CDRs selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38), and AKPHYGSSYVGAMEY (SEQ ID NO: 11), wherein:Xi is E, H, Q, or S; andX2 is A, E, L, or Q; and / or a light chain variable region comprising at least one, two, or three CDRs selected from SEQ ID NOs: 6-8.
[0010] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises:(a) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 17, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(b) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 19, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(c) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 21 , and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(d) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 23, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(e) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 25, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(f) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 27, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(g) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 29, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8; or(h) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 31 , and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8.
[0011] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises:(a) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 16; and / or a light chain variable regioncomprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(b) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 18; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(c) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 20; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(d) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(e) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 24; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(f) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 26; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(g) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 28; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15; or(h) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 30; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;
[0012] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof further comprises a light chain constant region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 33 and / or a heavy chain constant region, wherein the heavy chain constant region comprises:(a) one or more amino acid substitutions at positions A121 , S242, L237, L238, D268, K150, V205, C223, A330, and S443, relative to SEQ ID NO: 34; or(b) one or more amino acid substitutions relative to SEQ ID NO: 34 selected from the group consisting of: A121 C, S242C, L237A, L238A, D268C, K150C, V205C, C223S, A330C, and S443C; or(c) an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 32, 35, 36, or 37.
[0013] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof is humanized, is hypoimmune, does not bind alkaline phosphatase, intestinal (ALPI) and / or alkaline phosphatase, biomineralization associated (ALPL), and / or does not have cross reactivity to a non-human species.
[0014] In some aspects, provided is a pharmaceutical composition comprising the anti- ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein.
[0015] In some aspects, provided is a nucleic acid comprising a nucleotide sequence encoding the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein. In some embodiments, the nucleotide sequence is at least 80% identical to SEQ ID NO: 35 or 36. In some embodiments, the nucleic acid is in the form of a vector or virus.
[0016] In some aspects, provided is a host cell containing the nucleic acid or the vector or virus according to various embodiments disclosed herein.
[0017] In some aspects, provided is a composition comprising the vector or virus or the host cell according to various embodiments disclosed herein.
[0018] In some aspects, provided is an ADC comprising (1) an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosedherein; and (2) one or more payloads, wherein the anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof is connected to each of the one or more payloads by a linker.
[0019] In some embodiments, the ADC of has a formula of:wherein Ab is the antibody or antigen-binding fragment thereof, L is a linker, D is a payload, and z is an integer between 1 and 20.
[0020] In some embodiments, the linker (L) has a structure of:wherein D is a payload, and n is an integer between 1 and 20. In some embodiments, the linker (L) has a structure of any one of L9-L21 provided in Table 3.
[0021] In some embodiments, the payload comprises monomethyl auristatin E (MMAE) or a derivative thereof, DXd / exatecan or a derivative thereof, trabectedin or a derivative thereof, lurbinectedin or a derivative thereof, and / or a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of any of the foregoing.
[0022] In some embodiments, the payload comprises MMAE or a derivative thereof having a structure of:(II), wherein R is a saccharide, optionally a monosaccharide.
[0023] In some embodiments, the payload comprises Dxd / exatecan or a derivative thereof.
[0024] In some embodiments, the payload comprises lurbinectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;Rs is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a Ci 4 alkyl; andR4 is -H or a C1-4 alkyl, optionally wherein formula (III) does not include:R2 is -H, R3 is -H, and R4 is -H; andR2 is -OCH3, R3 is -H, and R4 is -H.
[0025] In some embodiments, the payload comprises lurbinectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a Ci 4 alkyl; andR4 is -H or -CH2NHR11, wherein Rn is H or a C1-4 alkyl.
[0026] In some embodiments, the payload comprises trabectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R6), a carboxyl group (-C(=O)OR?, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein R6 and R7 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R8)2)0-1(X)0-1R9, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R8 and R9 are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(Rio)2)0-1(X)0-1Rii , wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R10 and R1 are independently H or a Ci 4 alkyl; andR4 is -H, -CH2OR12, -CH2NHR13, or -CH2C(=O)ORi4, wherein R12, R13, and R1 are independently H or a C1-4 alkyl; andR5 is -H or a C1-4 alkyl, optionally wherein formula (V) does not include:R2 is -OCH3, Rs is -OH, R4 is -H, and R5 is -H.
[0027] In some embodiments, the payload (D) has a structure of any one of P1 -P12 provided in Table 4. In some embodiments, the linker payload (L-D) has a structure of any one of PL1 -PL38 provided in Table 8.
[0028] In some aspects, provided is a pharmaceutical composition comprising the ADC according to various embodiments disclosed herein.
[0029] In some aspects, provided is a method of in vitro inhibition of the growth of a cancer cell that expresses ALPP and / or ALPPL2, the method comprising contacting the cancer cell with an effective amount of an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, an ADC, or a pharmaceutical composition containing the same, according to various embodiments disclosed herein.
[0030] In some aspects, provided is a method of treating a cancer that expresses ALPP and / or ALPPL2 in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof, an ADC, or a pharmaceutical composition containing the same, according to various embodiments disclosed herein.
[0031] In some embodiments of the method of treating a cancer that expresses ALPP and / or ALPPL2, the method further comprises administering to the subject one or more additional anti-cancer therapies. In some embodiments, the one or more additional anticancer therapies is a therapeutic antibody, an ADC, chemotherapy, radiotherapy, endocrine therapy, a targeted molecular agent, immunotherapy, or any combination thereof.
[0032] In some embodiments of the method of treating a cancer that expresses ALPP and / or ALPPL2, the cancer is a solid cancer, including, for example, mesothelioma, ovarian, pancreatic, endometrial, non-small cell lung, stomach, gastroesophageal junction, cervical, colorectal, and testicular cancers.BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1 shows binding of the original mouse antibody H17E2 (AT04-5A) to ALPPL2, ALPP, and similar enzymes like alkaline phosphatase, intestinal (ALPI) and alkaline phosphatase, biomineralization associated (ALPL).
[0034] FIG. 2 shows cross reactivity of H17E2 (AT04-5A) to mouse and monkey ALPPL2.
[0035] FIG. 3 shows binding of H17E2 (AT04-5A) to various cancer cell lines.
[0036] FIG. 4 shows hydrophobic interaction chromatography analysis of H17E2 (AT04-5A).
[0037] FIG. 5A shows efforts of humanizing H17E2 (AT04-5A) to generate six new constructs (AT04-10A to AT04-15A) by combining one of two humanized light chain designs (VL1 (SEQ ID NO: 14) and VL2 (SEQ ID NO: 15)) and one of three humanized heavy chain designs (VH4 (SEQ ID NO: 9), VH5 (SEQ ID NO: 12), and VH6 (SEQ ID NO: 13)) carrying different backbone mutations. FIG. 5B shows binding of the humanized antibodies to ALPPL2.
[0038] FIG. 6 shows hydrophobic interaction chromatography analysis of the humanized antibodies
[0039] FIG. 7A shows optimization of antibody AT04-13A by performing post- translational modification (PTM) removal to improve its developability and by making certainmutations at the D54 or G55 residue of the heavy chain to avoid isomerization of the antibody. An alignment of the heavy chain variable region sequences of AT04-13A (SEQ ID NO: 9) and of eight optimized antibodies, AT04-16A to AT04-23A (SEQ ID NOs: 16, 18, 20, 22, 24, 26, 28, 30; see Table 6) is shown. FIG. 7B shows binding of the optimized antibodies to ALPPL2.
[0040] FIG. 8 shows hydrophobic interaction chromatography analysis of the optimized antibodies.
[0041] FIG. 9 shows surface plasmon resonance (SPR) analysis of the parental and select humanized / optimized antibodies, AT04-5A, AT04-13A, AT04-23A, and AT04-26A.
[0042] FIG. 10 shows specificity of the parental and select humanized / optimized antibodies, AT04-5A, AT04-13A, AT04-23A, and AT04-26A, to ALPPL2, ALPP, and similar enzymes like ALPI and ALPL. ITC, isotype control antibody lacking specificity to the target, was used as negative control.
[0043] FIG. 11 shows cross reactivity of the parental and select humanized / optimized antibodies, AT04-5A, AT04-13A, AT04-23A, and AT04-26A, to mouse and monkey ALPPL2. ITC, isotype control.
[0044] FIG. 12 shows internalization data of AT04-23A on ALPPL2-expressing cell lines.
[0045] FIG. 13 shows exemplary structures of monomethyl auristatin E (MMAE)-based antibody-drug conjugates (ADCs).
[0046] FIGS. 14A-14E show cytotoxicity data of ADCs made from various humanized and / or optimized antibodies on cancer cells.
[0047] FIG. 15 shows strong antitumor activity of ADC-14 in tumor cell derived xenografts in mice.
[0048] FIG. 16 shows potent inhibition of tumor growth by ADC-14 in a patient-derived xenograft tumor model in mice.
[0049] FIG. 17 shows potent inhibition of tumor growth by ADC-14 in a patient-derived xenograft tumor model in mice.DETAILED DESCRIPTION
[0050] In various embodiments, the present technology provides novel anti- ALPP / ALPPL2 antibodies, antigen-binding fragments thereof, and ADCs that can be employed as novel therapeutics for the treatment of cancer including, for example, mesothelioma, ovarian, pancreatic, endometrial, non-small cell lung, stomach, gastroesophageal junction, cervical, colorectal, and testicular cancers..
[0051] Travers and Bodmer identified one of the first anti-ALPP / ALPPL2 murine monoclonal antibodies (H17E2) of lgG1 isotype purified from mice immunized with human term placental plasma membranes. SeeTravers & Bodmer, Int. J. Cancer 1984; 33(5):633- 41 , which is incorporated by reference herein in its entirety. The original mouse H17E2 clone has been “reshaped” and humanized, but the humanized antibody has limited developability to generate ADCs due to its poor humanness score, yield, and pharmacokinetic properties (high hydrophobicity and high propensity for aggregation), causing it to be unsuitable for use for conjugation to a payload.
[0052] As demonstrated in the working examples herein, the present technology provides optimized anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof with improved binding affinity (around 10-fold), improved hydrophilicity, and increased yield (around 5 to 15-fold). Moreover, with improved hydrophilicity and reduced propensity for aggregation, the anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof of the present technology are suitable for the development of ADCs, for example, by conjugation with a cytotoxic payload. Therefore, the present technology presents promising therapeutic agents for treatment of various cancers, including, for example, ovarian, endometrial, gastric, and testicular cancers, that bear the ALPP and / or ALPPL2 antigens.
[0053] While the present disclosure is capable of being embodied in various forms, the description below of several embodiments is made with the understanding that the present disclosure is to be considered as an exemplification of the invention and is not intended to limit the invention to the specific embodiments illustrated. Headings are provided for convenience only and are not to be construed to limit the invention in any manner. Embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading.
[0054] The use of numerical values in the various quantitative values specified in this application, unless expressly indicated otherwise, are stated as approximations as though the minimum and maximum values within the stated ranges were both preceded by the word “about.” It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term “about.” It is to be understood that such range format is used for convenience and brevity and should be understood flexibly to include numerical values explicitly specified as limits of a range, but also to include all individual numerical values or sub-ranges encompassed within that range as if each numerical value and subrange is explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly recited limits of about 1 and about 200, but also to include individual ratios, such as about 2, about 3, and about 4, and sub-ranges, such as about 10 to about 50, about 20 to about 100, and so forth. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
[0055] To the extent any materials incorporated by reference herein conflict with the present disclosure, the present disclosure controls.Definitions
[0056] Unless otherwise specified, each of the following terms has the meaning set forth in this section.
[0057] The indefinite articles “a” and “an” denote at least one of the associated nouns and are used interchangeably with the terms “at least one” and “one or more.” For example, the phrase “a module” means at least one module, or one or more modules.
[0058] The conjunctions “or” and “and / or” are used interchangeably.
[0059] The term “about,” as used herein when referring to a measurable value, such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1 % of the specified amount.
[0060] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded bythe genetic code, as well as those amino acids that are later modified. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid. Such analogs have modified R groups or modified peptide backbones but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid.
[0061] The term “antibody” is used herein in the broadest sense and includes polyclonal and monoclonal antibodies, such as intact antibodies and functional (antigenbinding) fragments thereof. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, synthetic antibodies, and heteroconjugate antibodies, multi-specific (e.g., bispecific) antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, and tandem tri-scFv. Unless otherwise indicated, the term encompasses intact or full-length antibodies, including antibodies of any class or subclass (e.g., IgG and sub-classes thereof such as IgGI, lgG2, lgG3, and lgG4; IgM; IgE; IgA; and IgD), as well as antibody fragments.
[0062] In those embodiments wherein an antibody comprises an antigen-binding fragment of an immunoglobulin molecule, the antibody may include, but is not limited to, a single chain variable fragment antibody (scFv), a disulfide linked Fv, a single domain antibody (sdAb), a VHH antibody, an antigen-binding fragment F(ab), a F(ab’) fragment, a F(ab’)2fragment, or a diabody. An scFv antibody is derived from a natural antibody by linking the variable regions of the heavy (VH) and light (VL) chains of the immunoglobulin with a short linker peptide. Similarly, a disulfide linked Fv can be generated by linking the Vn and VL using an interdomain disulfide bond. On the other hand, sdAbs consist of only the variable region from either the heavy or light chain and usually are the smallest antigen-binding fragments of antibodies. A VHH antibody is the antigen binding fragment of heavy chain only. A diabody is a dimer of scFv fragment that consists of the VH and VL regions noncovalent connected by a small peptide linker or covalently linked to each other. The term “antigen-binding fragment” may refer to an immunogenically active fragment of an antibody as described that possesses the ability to specifically recognize, associate, unite,or combine with an antigen or target molecule. An antigen-binding fragment includes any naturally occurring, synthetic, semi-synthetic, or recombinantly produced. Both the antibodies and antigen-binding fragments thereof disclosed herein retain the ability to bind a specific antigen. In some embodiments, an antigen-binding fragment of a full-length antibody may be used in making an antibody-drug conjugate of the present invention.
[0063] An antibody may include a heavy chain (or a polypeptide sequence derived therefrom) and a light chain (or a polypeptide sequence derived therefrom). The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in the antibody's binding to an antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions and three complementarity-determining regions. A single VH or VL domain may sometimes be sufficient to confer all or a majority of the antigen-binding specificity of an antibody. Furthermore, antibodies that bind a particular antigen may be isolated by using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991 ).
[0064] The term “antigen” as used herein refers to a molecule capable of provoking an immune response. Antigens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and nonpeptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts and multicellular organisms such as parasites and allergens. The term antigen broadly includes any type of molecule which is recognized by a host immune system as being foreign. The term “neoantigen” can be used to refer to a cancer-specific antigen (i.e. , an antigen found on cancer cells but not on non-cancer cells) that is specifically recognized by a cognate binding molecule as described.
[0065] The term “specific binding,” “specifically binds,” or “specifically recognize” refers to an antibody or antigen binding fragment thereof which binds to a predetermined antigen / target molecule. Specific binding of an antibody or antigen binding fragment thereof typically describes an antibody or antigen binding fragment thereof having an affinity of atleast 10-7M (as Kd value; i.e. preferably those with Kd values smaller than 10-7M), with the antibody or antigen binding fragment thereof having an at least two times higher affinity for the predetermined antigen / target molecule than for a non-specific antigen / target molecule (e.g. bovine serum albumin, or casein) which is not the predetermined antigen / target molecule or a closely related antigen / target molecule. Specific binding of an antibody or antigen binding fragment thereof does not exclude the antibody or binder binding to a plurality of antigens / target molecules. The antibodies preferably have an affinity of at least 10~7M, at least 10~8M, or at least 10~9M to 10~11M. The Kd values may be determined, for example, by means of surface plasmon resonance spectroscopy.
[0066] A “clinically effective amount,” “clinically effective concentration,” or “clinically effective dose” refers to a concentration or dose of a peptide, composition, or pharmaceutical composition that is shown to be effective in clinical trials or is predicted to be effective based on early phase or pre-clinical trials. In some embodiments, a “clinically effective amount” is the same as a “therapeutically effective amount.” In some embodiments, a “clinically effective amount” is higher or lower than a “therapeutically effective amount.” Further, the effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the subject’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and severity of the condition may require an increase or decrease in the actual effective amount administered.
[0067] The term “codon-optimized” or “codon optimization” when referring to a nucleotide sequence is based on the discovery that the frequency of occurrence of synonymous codons (i.e., codons that code for the same amino acid) in coding nucleotide is biased in different species. Such codon degeneracy allows an identical polypeptide to be encoded by a variety of nucleotide sequences. Codon optimization refers to the process of substituting certain codons in a coding nucleotide sequence with synonymous codons based on the host cell’s preference without changing the resulting polypeptide sequence. A variety of codon optimization methods are known in the art, and include, for example, methods disclosed in at least U.S. Pat. Nos. 5,786,464 and 6,114,148.
[0068] The term “complementarity determining regions (CDRs)” is synonymous with “hypervariable region” or “HVR,” and is known in the art to refer to sequences of amino acids within antibody variable regions, which, in general, confer antigen specificity and / or binding affinity and are separated from one another in primary structure by framework sequence. Framework regions (FRs) refer to the non-CDR portions of the variable domains. In general, there are four FRs in each full-length heavy chain variable domain and four FRs in each full- length light chain variable domain. In some cases, framework amino acids can also contribute to binding. In general, there are three CDRs in each variable region. Variable domain sequences can be aligned to a numbering scheme (e.g., Kabat, EU, international ImMunoGeneTics information system® (IMGT®), and Aho), which can allow equivalent residue positions to be annotated and for different molecules to be compared using the Antibody Numbering and Antigen Receptor Classification (ANARCI) software tool (2016, Bioinformatics 15:298-300). The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of several well-known schemes, including those described by Kabat et al., 5th Ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991 ) (“Kabat” numbering scheme); Al-Lazikani et al., JMB 273,927-948 (1997) (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996) (“contact” numbering scheme); Lefranc et al., Dev Comp Immunol. 27(1 ): 55-77 (2003) (“IMGT” numbering scheme); and Honegger and Pluckthun, J Mol Biol, 309(3):657-70 (2001 ) (“Aho” numbering scheme). The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on sequence alignments, while the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a.” The two schemes place certain insertions and deletions (“indels”) at different positions, resulting in differential numbering. The contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme. Unless indicated otherwise, the CDRs of the antibodies referred to herein may be identified according to any of the Kabat, Chothia, IMGT, and contact methods.
[0069] The term “conservative substitution,” when referring to amino acid sequences, is recognized in the art as a substitution of one amino acid for another amino acid that hassimilar properties. A variety of criteria known to persons skilled in the art indicate whether an amino acid that is substituted at a particular position in a peptide or polypeptide is conservative (or similar). For example, a similar amino acid or a conservative amino acid substitution is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Similar amino acids may be included in the following categories: amino acids with basic side chains (e.g., lysine, arginine, histidine); amino acids with acidic side chains (e.g., aspartic acid, glutamic acid); amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, histidine); amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); amino acids with beta-branched side chains (e.g., threonine, valine, isoleucine); and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). Proline, which is considered more difficult to classify, shares properties with amino acids that have aliphatic side chains (e.g., leucine, valine, isoleucine, and alanine). In certain circumstances, substitution of glutamine for glutamic acid or asparagine for aspartic acid may be considered a similar substitution in that glutamine and asparagine are amide derivatives of glutamic acid and aspartic acid, respectively.
[0070] The term “epitope” includes any molecule, structure, amino acid sequence or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an antibody or a T cell receptor, or other binding molecule, domain, or protein.
[0071] The term “expression” refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene. The process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof. An expressed nucleic acid molecule is typically operably linked to an expression control sequence (e.g., a promoter).
[0072] The term “host cell” as used herein refers to a cell or microorganism targeted for genetic modification by introduction of a construct or vector carrying a nucleotide sequence for expression of a protein or polypeptide of interest.
[0073] The term “nucleic acid” or “polynucleotide” refers to a polymeric compound including covalently linked nucleotides comprising natural subunits (e.g., purine orpyrimidine bases). Purine bases include adenine and guanine, and pyrimidine bases include uracil, thymine, and cytosine. Nucleic acid molecules include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), which includes cDNA, genomic DNA, and synthetic DNA, either of which may be single- or double-stranded. A nucleic acid molecule encoding an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence.
[0074] The term “operably linked” refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other.
[0075] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length, though a number of amino acid residues may be specified. Polypeptides may include amino acid residues including natural and / or non-natural amino acid residues. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. In some embodiments, the polypeptides may contain modifications with respect to a native or natural sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site- directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
[0076] The term “subject” refers to a mammalian subject, preferably a human. A “subject in need thereof” refers to a subject who has been diagnosed with cancer or is at an elevated risk of developing cancer. The phrases “subject” and “patient” are used interchangeably herein.
[0077] The terms “treat,” “treating,” and “treatment,” as used herein with regard to cancer, refers to alleviating the cancer partially or entirely, inhibiting cancer cell growth, reducing the number of cancer cells, preventing the cancer, decreasing the likelihood of occurrence or recurrence of the cancer, slowing the progression or development of the cancer, or eliminating, reducing, or slowing the development of one or more symptoms associated with the cancer. For example, “treating” may refer to preventing or slowing the existing tumor from growing larger, preventing or slowing the formation or metastasis ofcancer, and / or slowing the development of certain symptoms of the cancer. In some embodiments, the term “treat,” “treating,” or “treatment” means that the subject has a reduced number or size of tumor compared to a subject not being administered the treatment. In some embodiments, the term “treat,” “treating,” or “treatment” means that one or more symptoms of the cancer are alleviated in a subject receiving the pharmaceutical compositions as disclosed and described herein, compared to a subject who does not receive such treatment.
[0078] A “therapeutically effective amount” as used herein is an amount that produces a desired effect in a subject for an indication, condition, disease, or disorder. In certain embodiments, the therapeutically effective amount is an amount that yields maximum therapeutic effect. In other embodiments, the therapeutically effective amount yields a therapeutic effect that is less than the maximum therapeutic effect. For example, a therapeutically effective amount may be an amount that produces a therapeutic effect while avoiding one or more side effects associated with a dosage that yields maximum therapeutic effect. A therapeutically effective amount for a particular composition will vary based on a variety of factors, including, but not limited to, the characteristics of the therapeutic composition (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability); the physiological condition of the subject (e.g., age, body weight, sex, disease type and stage, medical history, general physical condition, responsiveness to a given dosage, and other present medications); the nature of any pharmaceutically acceptable carriers, excipients, and preservatives in the composition; and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, namely, by monitoring a subject’s response to administration of the therapeutic composition and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy, 21st Edition, Univ, of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, PA, 2005.
[0079] The term “variable region” or “variable domain” refers to a fragment of an antibody heavy or light chain that is involved in antigen binding. Variable domains of antibody heavy (VH) and light (VL) chains each generally comprise four generally conserved framework regions (FRs) and three complementarity determining regions (CDRs).Framework regions separate CDRs, such that CDRs are situated between framework regions.
[0080] A “vector” refers to a DNA construct containing a nucleic acid molecule that is operably linked to a suitable control sequence capable of effecting the expression of the nucleic acid molecule in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, a virus, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.Antibodies, antigen-binding fragments, and compositions thereof
[0081] In some aspects, provided are recombinant antibodies or antigen-binding fragments thereof that specifically recognize or bind ALPP and / or ALPPL2. Exemplary amino acid sequences of the heavy and light chain variable regions and constant regions of anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof, including the CDRs, are provided in Table 1 .
[0082] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region and / or a light chain variable region derived from the murine monoclonal antibody H17E2. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NOs: 2-4 and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 2-4; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 1 , or an amino acid sequence that is atleast 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 1 ; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 5, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 5.
[0083] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region and / or a light chain variable region modified from the murine monoclonal antibody H17E2 to have improved binding affinity, improved hydrophilicity, improved yield, improved hydrophilicity, and / or reduced propensity for aggregation compared to the original H17E2 antibody. The modification can comprise one or more amino acid mutations, substitutions, additions, or deletions in one or more of the CDRs and / or the framework regions (FRs) of the heavy and / or light chains.
[0084] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEDGST (SEQ ID NO: 3), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 9, 12, or 13, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 9, 12, or 13; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0085] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region and / or a light chain variable region further modified from the murine monoclonal antibody H17E2, e.g., by post-translational modification (PTM) removal, to have improved binding affinity, improved hydrophilicity, improved yield, improved hydrophilicity, and / or reduced propensity for aggregation compared to the original H17E2 antibody. The modification can comprise one or moreamino acid mutations, substitutions, additions, or deletions in one or more of the CDRs of the heavy and / or light chains.
[0086] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ), wherein:Xi is E, H, Q, or S; andX2 is A, E, L, or Q.In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8.
[0087] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEEGST (SEQ ID NO: 17; comprising a D54E mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 16, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 16; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0088] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g.,one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEHGST (SEQ ID NO: 19; comprising a D54H mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 18, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 18; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0089] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEQGST (SEQ ID NO: 21 ; comprising a D54Q mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 20; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0090] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ IDNO: 10), IWESGST (SEQ ID NO: 23; comprising a D54S mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 22; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0091] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEDAST (SEQ ID NO: 25; comprising a G55A mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 24; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0092] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEDEST (SEQ ID NO: 27; comprising a G55E mutation compared to the originalH17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 26, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 26; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0093] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEDLST (SEQ ID NO: 29; comprising a G55L mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 28, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 28; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0094] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from GFSLTSYG (SEQ ID NO: 10), IWEDQST (SEQ ID NO: 31 ; comprising a G55Q mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1 )), andAKPHYGSSYVGAMEY (SEQ ID NO: 11 ); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 30, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 30; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 14 or 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 14 or 15.
[0095] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 3, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 3, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 9, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 9; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0096] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 17, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 17, and 11 ; and / or alight chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 16, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 16; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0097] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 19, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 19, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 18, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 18; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0098] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 21 , 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 21 , and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs havingamino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 20; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0099] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 23, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 23, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 22; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0100] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 25, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 25, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments,the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 24; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0101] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 27, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 27, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 26, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 26; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0102] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 29, 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 29, and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavychain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 28, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 28; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0103] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more (e.g., one, two, three, four, five, or six) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 31 , 11 , and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 10, 31 , and 11 ; and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NOs: 6-8. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 30, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 30; and / or a light chain variable region that comprises or consists of an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 15.
[0104] In any of the embodiments described herein, the anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof may comprise one or more amino acid substitutions (e.g., conservative substitutions), insertions, and / or deletions in any of the exemplary amino acid sequences, including, for example, one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions in any of the exemplary CDR sequences. The present technology especially contemplates anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof having one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to a reference CDR sequence as described herein that still maintain a certain level of binding affinity to ALPP and / or ALPPL2, e.g., human ALPP / ALPPL2. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody orantigen-binding fragment thereof having one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to a reference CDR sequence as described herein would maintain at least 80% (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) of the binding affinity exhibited by the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof having the reference CDR sequence, when tested under same or similar conditions. For example, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof having one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to a reference CDR sequence as described herein would bind to ALPP / ALPPL2 (e.g., human ALPP / ALPPL2) with an affinity (KD) of about 1 x10-11-1 x107M, e.g., about 1x1011-1 x108M, about 1 x1011-1 x109M, about 1 x1011-1x1010M, about 1 x1010-1 x107M, about 1x1010-1 x108M, about 1x1010-1 x109M, about 1 x1011-1 x107M, about 1x10-9-1 x10-7M, about 1 x109-1 x10-8M, or about 1 x10-81-1 x107M.Table 1. Exemplary sequences of anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof
[0105] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein is humanized. A “humanized" form of a non-human (e.g., rodent) antibody is a chimeric antibody including a sequence derived from a non-human antibody. In the cases where the antibody or antigenbinding fragment thereof is derived from a non-human species, the antibody or antigenbinding fragment thereof may be humanized to reduce immunogenicity in a human subject. For example, the non-human antibody can be humanized through CDR grafting, in which the CDRs from the non-human antibody are placed into the respective positions in a framework of a compatible human antibody. For another example, the constant region of the non-human antibody can be replaced with human sequence. Techniques used to humanize a monoclonal antibody are within the purview of one of ordinary skill in the art.
[0106] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region. In certain of these embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 32, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 32; and / or a light chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 33, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 33.
[0107] In some embodiments, the constant region of the heavy and / or light chains of the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof is further modified to include strategically placed reactive cysteine residues, for example, for subsequent conjugation with a drug payload to generate ADCs. In some embodiments, the constant region of the modified anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises one or more of the following mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34): A121 C, K150C, V205C, C223S, S242C, D268C, A330C, and S443C. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof comprises a heavy chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 35 (comprising A121 C and S242C mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)), or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 35; and / or a light chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 33, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 33. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 36 (comprising A121 C, L237A, L238A, and D268C mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)), or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 36; and / ora light chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 33, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 33. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof comprises a heavy chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 37 (comprising A121C, L237A, L238A, and S242C mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)), or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 37; and / or a light chain constant region that comprises or consists of an amino acid sequence of SEQ ID NO: 33, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 33.
[0108] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein is hypoimmune, e.g., less prone to elicit an immune response or an immune rejection by a subject into which the antibody is transplanted.
[0109] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein is specific to ALPP / ALPPL2 and does not bind a protein that shares a degree of sequence homology to ALPP / ALPPL2, including, for example, alkaline phosphatase, intestinal (ALPI) and / or alkaline phosphatase, biomineralization associated (ALPL).
[0110] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein is specific to human ALPP / ALPPL2, i.e., does not have cross reactivity to ALPP / ALPPL2 from a non-human species.
[0111] In some aspects, provided are pharmaceutical compositions comprising a recombinant anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed and described herein. The pharmaceutical compositions may further comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or a combination thereof. A “pharmaceutically acceptable carrier or excipient”refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or fragment of the body to another tissue, organ, or fragment of the body. For example, the carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier or excipient must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It also must be suitable for contact with any tissue, organ, or fragment of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits. Non-limiting examples of such carriers or excipients include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.
[0112] In some embodiments, the pharmaceutical composition can be formulated (e.g., injectable, lyophilized, liquid, or oral formulations) to be compatible with their intended route of administration. Examples of routes of administration include oral administration, extracorporeal administration, parenteral administration, intravenous administration, subcutaneous administration, intralesional administration (e.g., injection into tumors), and by administration into biological spaces infiltrated by tumors (e.g., intraspinal administration, intracerebel lar administration, intraperitoneal administration, intralymphatic administration, intranodal administration, and / or pleural administration). For example, a pharmaceutical composition provided herein can be administered systemically by oral administration or by intravenous administration (e.g., injection or infusion). Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.
[0113] In some embodiments, the pharmaceutical composition can be co-formulated in the same dosage unit or can be individually formulated in separate dosage units. The term “dosage unit” herein refers to a fragment of a pharmaceutical composition that contains an amount of a therapeutic agent suitable for a single administration to provide a therapeutic effect. Such dosage units may be administered one to a plurality (e.g., 1 to about 10, 1 to 8, 1 to 6, 1 to 4, or 1 to 2) of times per day, or as many times as needed to elicit a therapeutic response.Nucleic acids, vectors, host cells, and compositions thereof
[0114] In some aspects, provided are nucleic acids comprising a nucleotide sequence encoding a recombinant anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments according to various embodiments disclosed and described herein. The nucleic acids may be used (for example, in the form of a vector) to transfect or transduce a host cell so that the host cell would express the encoded recombinant anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof. Exemplary nucleotide sequences to be used in the present technology are provided in Table 2.
[0115] In some embodiments, the nucleic acid comprises a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof. In some embodiments, the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 39, or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 39. In some embodiments, the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 40, or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 40.
[0116] In some embodiments, the nucleic acid comprises a nucleotide sequence that is codon-optimized for a host cell (for example, a human cell) according to techniques known to one of ordinary skill in the art. Codon-optimized sequences include sequences that are partially or fully codon-optimized.Table 2. Exemplary nucleotide sequences encoding anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof
[0117] In some embodiments, the nucleic acid comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof may be present in the form of a vector (e.g., a plasmid or a viral vector) or packaged into a virus for introduction into a host cell. The vector can be any type of vector suitable for introduction of nucleotide sequences into a host cell, including, for example, plasmids, adenoviral vectors, adeno-associated viral (AAV) vectors, retroviral vectors, lentiviral vectors, phages, and homology-directed repair (HDR)-based donor vectors. The virus can be any type of virus suitable for transducing a host cell and introducing nucleotide sequences into the host cell, including, for example, adenoviruses, adeno-associated viruses (AAVs), retroviruses, lentiviruses, and phages. In some embodiments, the nucleotide sequence is in a vector (e.g., a viral vector) or a virus which facilitates integration of the nucleotide sequence into a host cell’s genome upon introduction into the host cell and thereby replication along with the host genome. In some embodiments, such nucleotide sequence may be present inside a host cell, for example, integrated into the genome of the host cell, for production of the encoded protein in the host cell.
[0118] In some embodiments, the nucleic acid according to various embodiments disclosed herein may be delivered to a host cell via one or more non-viral delivery methods and / or using one or more non-viral vectors, including, but not limited to, physical / mechanicalmethods, inorganic particles, and synthetic or natural biodegradable particles. Non-limiting examples of physical / mechanical methods include needle injection, ballistic injection, gene gun, electroporation, sonoporation, photoporation, optoporation, magnetofection, and hydroporation. Non-limiting examples of inorganic particles include calcium phosphate, silica, gold, and magnetic particles. Non-limiting examples of synthetic or natural biodegradable particles include polymeric-based non-viral vectors (e.g., poly lactic-co- glycolic acid, poly lactic acid, polyethylene imine, chitosan, dendrimers, polymethacrylates), cationic lipid-based non-viral vectors (e.g., cationic liposomes, cationic emulsions, solid lipid nanoparticles), and peptide-based non-viral vectors (e.g., poly-L-lysine).
[0119] In some embodiments, the nucleic acid according to various embodiments disclosed herein may be operatively linked to certain regulatory elements of the vector. As known to a skilled artisan, expression vectors are typically engineered to contain polynucleotide sequences that are needed to affect the expression and processing of coding sequences to which they are operatively linked. Expression control sequences may include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency; sequences that enhance protein stability; and possibly sequences that enhance protein secretion. Expression control sequences may be operatively linked if they are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
[0120] In some embodiments, the vector may comprise a promoter that drives constitutive gene expression in a host cell (e.g., a mammalian cell). Those frequently used promoters include, for example, elongation factor 1 alpha (EF1 a) promoter, cytomegalovirus (CMV) immediate-early promoter (Greenaway et al., Gene 18: 355-360 (1982)), simian vacuolating virus 40 (SV40) early promoter (Fiers et al., Nature 273:113-120 (1978)), spleen focus-forming virus (SFFV) promoter, phosphoglycerate kinase (PGK) promoter (Adra et al., Gene 60(1 ):65-74 (1987)), human beta actin promoter, polyubiquitin C gene (UBC) promoter, and CAG promoter (Nitoshi et al., Gene 108:193-199 (1991)).
[0121] In some embodiments, the vector may comprise an inducible promoter. Unlike constitutive promoters, inducible promoters can switch between an on and an off state in response to certain stimuli (e.g., chemical agents, temperature, light) and can be regulated in tissue- or cell-specific manners. Non-limiting examples of frequently used inducible promoters include the tetracycline On (Tet-On) system and the tetracycline Off (Tet-Off) system, which utilize tetracycline response elements (TRE) placed upstream of a minimal promoter (e.g., CMV promoter) (Gossen & Bujard, Proc. Natl. Acad. Sci. USA 89(12):5547- 5551 (1992)). The TRE is made of 7 repeats of a 19-nucleotide tetracycline operator (tetO) sequence and can be recognized by the tetracycline repressor (tetR). In the Tet-Off system, a tetracycline-controlled transactivator (tTA) was developed by fusing the tetR with the activating domain of virion protein 16 of herpes simplex virus. In the absence of tetracycline or its analogs (e.g., doxycycline), the tTA will bind the tetO sequences of the TRE and drives expression; in the presence of tetracycline, the rTA will bind to tetracycline and not to the TRE, resulting in reduced gene expression. Conversely, in the Tet-On system, a reverse transactivator (rtTA) was generated by mutagenesis of amino acid residues important for tetracycline-dependent repression, and the rtTA binds at the TRE and drives gene expression in the presence of tetracycline or doxycycline (Gossen et al., Science 268(5218):1766-1769 (1995)). Other examples of inducible promoters include, for example, AlcA, LexA, and Cre.
[0122] In some embodiments, the vector further comprises a Kozak consensus sequence, usually upstream of the coding sequence. A Kozak consensus sequence is a nucleic acid motif that functions as the protein translation initiation site in most eukaryotic mRNA transcripts and mediates ribosome assembly and translation initiation. In some embodiments, the Kozak consensus sequence comprises or consists of the sequence of (gcc)gccrccatgg (SEQ ID NO: 41 ), wherein r is a purine (i.e., a or g). The use of “()” around a sequence in the present disclosure means that the enclosed sequence is optional.
[0123] In some embodiments, the vector further comprises a Woodchuck hepatitis virus (WHV) posttranscriptional regulatory element (WPRE), optionally after the coding sequence. A WPRE is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The WPRE sequence is commonly used to increase expression of genes delivered by viral vectors. In some embodiments, the WPRE sequence comprises orconsists of a nucleotide sequence of SEQ ID NO: 42, or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 42: aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgcttta atgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcc cgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctc ctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcg gctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgc gcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctctt ccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc (SEQ ID NO: 42).
[0124] In some aspects, provided are host cells, such as bacterial, yeast, or mammalian cells, that contain the nucleic acid comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, and / or express anti- ALPP / ALPPL2 antibody or antigen-binding fragment thereof, according to various embodiments disclosed herein.
[0125] In some embodiments, the vector, virus, or host cell comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof according to various embodiments disclosed herein may be present in a composition. In some embodiments, the composition may further comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or a combination thereof. A “pharmaceutically acceptable carrier or excipient” refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or fragment of the body to another tissue, organ, or fragment of the body. For example, the carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier or excipient must be “pharmaceutically acceptable,” in that it must be compatible with the other ingredients of the formulation. It also must be suitable for contact with any tissue, organ, or fragment of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any othercomplication that excessively outweighs its therapeutic benefits. Suitable excipients include water, saline, dextrose, glycerol, or the like and combinations thereof.ADCs and compositions thereof
[0126] In some aspects, provided are ADCs comprising (1 ) an antibody or antigenbinding fragment thereof that specifically recognize or bind ALPP and / or ALPPL2; and (2) one or more payloads, wherein the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof is connected to each of the one or more payloads by a linker. The ADCs may have a general formula of formula (I) shown below:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), L is a linker, D is a payload, and z is an integer between 1 and 20. The linker may be covalently bound to the antibody or antigen-binding fragment thereof, and the payload may be covalently bound to the linker, for example, via a nitrogen or oxygen present in the payload. The L-D fragment of the ADC may be referred to as a “linker payload” in this disclosure.
[0127] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L1A:Wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0128] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L1 B:wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0129] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L2A:wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0130] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L2B:wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0131] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L3A:wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0132] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, n is an integer between 1 and 20, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L3B:wherein D is a payload, and n is an integer between 1 and 20, e.g., 1 , 2, 3, 4, 5, or 6.
[0133] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L4:wherein D is a payload.
[0134] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L5:wherein D is a payload.
[0135] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L6:wherein D is a payload.
[0136] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L7:wherein D is a payload.
[0137] In some embodiments, the ADC has a structure of:wherein Ab is an antibody or antigen-binding fragment thereof (e.g., an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof), D is a payload, and z is an integer between 1 and 20. In these embodiments, the linker has a structure of L8:wherein D is a payload.
[0138] As known to a skilled artisan, other linkers commonly used and / or appropriate for linking a payload to an antibody or antigen-binding fragment thereof may be used in the present technology, including, for example, the structures provided in Table 3:Table 3. Additional exemplary linker structures
[0139] In some embodiments, the payload fragment of the ADC comprises a cytotoxic or anti-cancer agent. In some embodiments, the payload comprises monomethyl auristatin E (MMAE), DXd / exatecan, trabectedin, lurbinectedin, and / or a derivative of any of the foregoing. In any of the embodiments, a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of a particular agent may also be used.
[0140] In some embodiments, the payload comprises MMAE or a derivative thereof. MMAE is a potent antimitotic drug which inhibits cell division by blocking the polymerization of tubulin. MMAE is usually linked to a monoclonal antibody, which directs it to the cancer cells expressing the target to which the monoclonal antibody binds. MMAE and derivatives thereof have a general formula of formula (II) shown below:wherein R may be a saccharide (e.g., a monosaccharide) bound via an O-glycosidic bond to the MMAE. Non-limiting examples of a saccharide or a monosaccharide include p-D-galactose, N-acetyl-p-D-galactosamine, N-acetyl-a-D-galactosamine, N-acetyl-p-D- glucosamine, p-D-glucuronic acid, a-L-iduronic acid, a-D-galactose, a-D-glucose, p-D- glucose, a-D-mannose, (3-D-mannose, a-L-fucose, p-D-xylose, neuraminic acid, and any of the foregoing with a sulfate, phosphate, carboxyl, amino, or O-acetyl modification.
[0141] In some embodiments, the MMAE or derivative thereof has a structure of P1 or P2 provided in Table 4.
[0142] In some embodiments, the payload comprises exatecan, Dxd, or a derivative thereof. Exatecan is a structural analog of camptothecin with antineoplastic activity. Dxd is an exatecan derivative used for ADCs. Both are potent DNA topoisomerase I inhibitors. In some embodiments, the Dxd / exatecan or derivative thereof has a structure of any one of P3-P5 provided in Table 4.
[0143] In some embodiments, the payload comprises lurbinectedin or a derivative thereof. Lurbinectedin is a synthetic tetrahydropyrrolo [4,3,2-de]quinolin-8(1 H)-one alkaloid analogue with antineoplastic activity. Lurbinectedin covalently binds to residues lying in the minor groove of DNA, which may result in delayed progression through S phase, cell cycle arrest in the G2 / M phase, and cell death. Lurbinectedin is sold under the brand name ZEPZELCA®, which is a medication approved for the treatment of small cell lung cancer. In some embodiments, lurbinectedin and derivatives thereof have a general formula of formula (III) shown below:whereinRi is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a Ci 4 alkyl; andR4 is -H or a C1-4 alkyl, optionally wherein the following combinations of R2, R3, and R4 are excluded from formula (III):R2 is -H, R3 is -H, and R4 is -H; andR2 is -OCH3, R3 is -H, and R4 is -H.
[0144] Unless defined otherwise, the term “alkyl” used herein refers to an unsubstituted and saturated hydrocarbon group (branched or unbranched). Where indicated, the number of carbons refers to all carbons present in that group, including in sidechains. For example, the term “C1-4 alkyl” includes -CH3, -CH2CH3, -CH2CH2CH3 (n-propyl), -CH(CHs)2 (isopropyl), -CH2CH2CH2CH3 (n-butyl), -CH2CH2CH(CH3)2 (iso-butyl), -CH(CH3)CH2CH3(secbutyl), and -CH(CHs)3 (tert-butyl).
[0145] Alternatively, in some embodiments, lurbinectedin and derivatives thereof have a general formula of formula (IV) shown below:whereinRi is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;Rs is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a C1-4 alkyl; andR4 is -H or -CH2NHR11, wherein Rn is H or a Ci 4 alkyl.
[0146] In some embodiments, the lurbinectedin or derivative thereof has a structure of P6 provided in Table 4.
[0147] In some embodiments, the payload comprises trabectedin or a derivative thereof. Trabectedin is a chemotherapy agent, sold under the brand name YONDELIS® for the treatment of advanced soft-tissue sarcoma and ovarian cancer. Trabectedin and derivatives thereof have a general formula of formula (V) shown below:whereinRi is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R6), a carboxyl group (-C(=O)OR?, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein R6 and R7 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R8)2)0-1(X)0-1R9, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and Rs and R9 are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(Rio)2)0-1(X)0-1Rii , wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R10 and Rn are independently H or a Ci 4 alkyl; andR4 is -H, -CH2OR12, -CH2NHR13, or -CH2C(=O)ORi4, wherein R12, R13, and Ru are independently H or a C1-4 alkyl; andRs is -H or a C1-4 alkyl, optionally wherein the following combination of R2, R3, R4, and Rs is excluded from formula (V):R2 is -OCH3, R3 is -OH, R4 is -H, and Rs is -H.
[0148] In some embodiments, the trabectedin or derivative thereof has a structure of any one of P7-P12 provided in Table 4.Table 4. Exemplary payload structures
[0149] The linker payload fragment of the ADC may comprise any combination of any linker and any payload as disclosed herein. Table 8 provides exemplary linker payloads that can be used for the present technology.
[0150] In some aspects, provided are pharmaceutical compositions comprising an ADC according to various embodiments disclosed and described herein. The pharmaceutical compositions may further comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or a combination thereof. For example, the carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Non-limiting examples of such carriers or excipients include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.
[0151] In some embodiments, the pharmaceutical composition can be formulated (e.g., injectable, lyophilized, liquid, or oral formulations) to be compatible with their intended route of administration. Examples of routes of administration include oral administration, extracorporeal administration, parenteral administration, intravenous administration, subcutaneous administration, intralesional administration (e.g., injection into tumors), and by administration into biological spaces infiltrated by tumors (e.g., intraspinal administration, intracerebel lar administration, intraperitoneal administration, intralymphatic administration, intranodal administration, and / or pleural administration). For example, a pharmaceutical composition provided herein can be administered systemically by oral administration or by intravenous administration (e.g., injection or infusion). Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.
[0152] In some embodiments, the pharmaceutical composition can be co-formulated in the same dosage unit or can be individually formulated in separate dosage units. The term “dosage unit” herein refers to a fragment of a pharmaceutical composition that containsan amount of a therapeutic agent suitable for a single administration to provide a therapeutic effect. Such dosage units may be administered one to a plurality (e.g., 1 to about 10, 1 to 8, 1 to 6, 1 to 4, or 1 to 2) of times per day, or as many times as needed to elicit a therapeutic response.Therapeutic methods
[0153] In some aspects, provided are methods for inhibiting the growth of a cell (e.g., a cancer cell) that expresses ALPP and / or ALPPL2 in vitro. The methods entail contacting the cell with an effective amount of the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, an ADC comprising an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof connected to a payload by a linker, or a pharmaceutical composition containing the same, according to various embodiments disclosed herein.
[0154] In some aspects, provided are methods for treating and / or preventing a disease in a subject in need thereof. The methods entail administering to the subject a therapeutically effective amount or a clinically effective amount of an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, an ADC comprising an anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof connected to a payload by a linker, or a pharmaceutical composition containing the same, according to various embodiments disclosed herein. The subject can be a mammal, for example, without limitation, primates (e.g., humans and non-human primates such as chimpanzees, baboons, or monkeys), dogs, cats, pigs, sheep, rabbits, mice, and rats. In some embodiments, the subject is a human.
[0155] In some embodiments, the disease is cancer, including, for example, a cancer that expresses ALPP and / or ALPPL2 or bears ALPP and / or ALPPL2 antigens, or one that involves or is dependent on the signaling ALPP and / or ALPPL2.
[0156] In some embodiments, the cancer is a solid cancer. Non-limiting examples of solid cancers include pancreatic cancer, glioma, glioblastoma, colorectal cancer, thyroid cancer, gastric cancer, ovarian cancer, melanoma, endometrial cancer, lung cancer, renal cancer, cervical cancer, prostate cancer, breast cancer, urothelial cancer, testicular cancer, head and neck cancer, liver cancer, esophageal cancer, and other types of solid cancers. In some embodiments, the cancer is mesothelioma, ovarian, pancreatic, endometrial, non-small cell lung, stomach, gastroesophageal junction, cervical, colorectal, or testicular cancer.
[0157] It is within the purview of one of ordinary skill in the art to select a suitable administration route, such as oral administration, extracorporeal administration, parenteral administration, intravenous administration, subcutaneous administration, intralesional administration (e.g., injection into tumors), and by administration into biological spaces infiltrated by tumors (e.g., intraspinal administration, intracerebellar administration, intraperitoneal administration, intralymphatic administration, intranodal administration, and / or pleural administration). For treating a subject in need thereof, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, can be administered continuously or intermittently, for an immediate release, controlled release, or sustained release.
[0158] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered to the subject in a range of from about 0.1 mg / kg to about 30 mg / kg, from 0.1 mg / kg to about 10 mg / kg, from 0.1 mg / kg to about 3 mg / kg, for example, at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, or about 30 mg / kg. In some embodiments, a single dose or multiple doses may be administered to a subject. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered once or multiple times a day.
[0159] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered to the subject once a day, twice a day, three times a day, or four times a day for a period of about 1 day, about 2 days, about 3 days, about 5 days, about 7 days, about 10 days, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, or more than about 5 years. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered every day, every other day, 3 times a week, every third day, weekly, biweekly (i.e., every other week), every third week, monthly, every other month, every third month, every fourth month, every fifth month, every sixth month, every ninth month, every year, every 18 months, every 2 years, every 5 years, every 10 years, or every 20 years. In some embodiments, the dose regimens listed above could be repeated after a period of about 1 week, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, or more than about 5 years. In some embodiments, the schedule of administration is a hybrid of these periods, for example, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered a number of times a week and that pattern is repeated a number of times a month every month or every second, third, fourth, fifth, or sixth month, and treatment according to that pattern is continued for part of a year to several years, as set out above. In some embodiments, the anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered in a cycle of a number or administrations over a week or two weeks, and the cycle is repeated at spaced intervals over a number of months or years, as set out above. In some embodiments treatment is continued until disease is eliminated, until no further improvement is achieved, or as long as the disease does not progress. In some embodiments, a cancer within a subject to be treated can be monitored to evaluate the effectiveness of the treatment using any appropriate method known to a skilled artisan. For example, imaging techniques or laboratory assays can be used to assess the number of cancer cells and / or the size of a tumor present within the subject. The same can also be used to assess the location of cancer cells and / or a tumor present within the subject.
[0160] In some embodiments, the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered over a predetermined time period. Alternatively, the anti-ALPP / ALPPL2antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same, is administered until a particular therapeutic benchmark is reached. In some embodiments, the methods provided herein further include a step of evaluating one or more therapeutic benchmarks in a biological sample, such as, but not limited to, the level of a cancer biomarker, to determine whether to continue administration of the treatment.
[0161] In some embodiments, the method further entails administering one or more other cancer therapies such as surgery, immunotherapy, radiotherapy, and / or chemotherapy to the subject sequentially or simultaneously.
[0162] In some embodiments, the methods further comprise administering to the subject a pharmaceutically or clinically effective amount of one or more additional anticancer therapies to obtain improved or synergistic therapeutic effects. Examples of the one of more additional anti-cancer therapies include, but are not limited to, a biologic agent (e.g., a therapeutic antibody and an ADC), chemotherapy, radiotherapy, endocrine therapy, targeted molecular agents, and immunotherapy. In some embodiments, the one or more additional anti-cancer therapies comprise chemotherapy and / or radiotherapy. In some embodiments, the one or more additional anti-cancer therapies or agents are selected from the group consisting of immunotherapy, chemotherapy, and a biologic agent. Examples of therapeutic agents used for chemotherapy include, without limitation, platinum compounds (e.g., a cisplatin or carboplatin), taxanes (e.g., paclitaxel, docetaxel, or an albumin bound paclitaxel such as nab-paclitaxel), altretamine, capecitabine, alkylating agents (e.g., cyclophosphamide, ifosfamide, melphalan, mechlorethamine, chlorambucil, or thiotepa), etoposide (vp-16), gemcitabine, irinotecan (cpt-11 ), anthracyclines (e.g., liposomal doxorubicin, daunorubicin, epirubicin, or idarubicin), pemetrexed, topotecan, vinca alkaloids and derivatives thereof (e.g., vincristine or vinorelbine), and any combinations thereof. In some embodiments, corticosteroids are used in combination with the chemotherapy agents. Examples of other anti-cancer therapies agents include, but are not limited to, luteinizing- hormone-releasing hormone (LHRH) agonists (e.g., goserelin and leuprolide), antiestrogens (e.g., tamoxifen), aromatase inhibitors (e.g., letrozole, anastrozole, and exemestane), angiogenesis inhibitors (e.g., bevacizumab), poly(ADP)-ribose polymerase (PARP) inhibitors (e.g., olaparib, rucaparib, and niraparib), and radioactive phosphorus. Examples of biologic agents include, but are not limited to, checkpoint inhibitors (e.g., anti-CTLA-4 antibodies, anti-PD-1 antibodies, or anti-PD-L1 antibodies), cytokines (e.g. IL-2, IL- 12, or IL-15), other bispecific antibodies, and any combinations thereof.
[0163] In some embodiments, the subject was administered the one or more additional anti-cancer agents before administration of the anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof, ADC, or a pharmaceutical composition containing the same. In some embodiments, the subject is co-administered the one or more additional anti-cancer agents and the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same. In some embodiments, the subject was administered the one or more additional anti-cancer agents after administration of the anti- ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same. As one of ordinary skill in the art would understand, the one or more additional anti-cancer agents and the anti-ALPP / ALPPL2 antibody or antigenbinding fragment thereof, ADC, or a pharmaceutical composition containing the same, can be administered to a subject in need thereof one or more times at the same or different doses, depending on the diagnosis and prognosis of the subject. If more than one dose of the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof, ADC, or a pharmaceutical composition containing the same are administered to the subject, the one or more additional anti-cancer therapy can be administered before or after all of said doses and / or administered between doses. One skilled in the art would be able to combine one or more of these therapies in different orders to achieve the desired therapeutic results.EXAMPLESExample 1 . Humanization and optimization of mouse anti-ALPP / ALPPL2 antibody H17E2
[0164] In this study, the original mouse anti-ALPP / ALPPL2 antibody H17E2 was humanized and / or optimized to generate new antibodies for use in the present technology. The original H17E2 antibody and the humanized / optimized antibodies were tested for their antigen specificity, cross reactivity to non-human species, and hydrophobicity.
[0165] First, the original mouse antibody H17E2 was tested. As shown in FIG. 1 , H17E2 (AT04-5A) is selective for ALPPL2 and ALPP, but not ALPI and ALPL. H17E2 (AT04-5A) cross reacted to monkey ALPPL2 but not mouse ALPPL2 (FIG. 2). When testedon cell lines, H17E2 (AT04-5A) bound strongly to Lovo (colorectal cancer) and NCI-N87 (gastric cancer), weakly to SKOV3 (ovarian cancer) as detected by flow cytometry but not to the other cell lines including 293T (embryonic kidney), A549 (lung cancer), BT549 (breast cancer), and MCF7 (breast cancer) (FIG. 3). H17E2 was then analyzed by hydrophobic interaction chromatography (HIC), and the HIC retention time for the antibody is 21 .83 min, suggesting that it is rather hydrophobic (FIG. 4).
[0166] Next, efforts were taken to humanize the H17E2 antibody. Six constructs (AT04-10A to AT04-15A) were made from two humanized light chain designs (VL1 and VL2) and three humanized heavy chain designs (VH4, VH5, and VH6) carrying different mutations in the FRs (see FIG. 5A; Table 5). ELISA was performed to examine binding of the humanized antibodies to ALPPL2; results showed that all six constructs had improved binding to ALPPL2 compared to the parent H17E2 antibody (FIG. 5B). Following humanization, the antibodies were tested for their hydrophobicity on HIC column. All antibodies showed shorter retention times (less hydrophobic) than the parent H17E2 antibody (FIG. 6).Table 5. Parental H17E2 and humanized anti-ALPP / ALPPL2 antibodies
[0167] Next, antibody AT04-13A (construct VH4 VL2) was selected as a starting point to develop further optimized antibodies, for example, by performing PTM removal to improve its developability. Eight constructs (AT04-16A to AT04-23A) were made with mutated D54 or G55 residues (referencing the amino acid position in the heavy chain variable region of the original H17E2 antibody (SEQ ID NO: 1 )) to avoid isomerization of the antibody (seeFIG. 7A; Table 6). ELISA was performed on the constructs, and most constructs retained good binding to ALPPL2 (FIG. 7B).Table 6. Optimized anti-ALPP / ALPPL2 antibodies
[0168] HIC analysis of the optimized antibodies shows that the HIC retention time was similar to that before PTM removal, and that the optimized antibodies are less hydrophobic than the parent H17E2 antibody (FIG. 8).
[0169] To further engineer antibodies with reactive cysteine residues for drug conjugation, mutations were made on monoclonal antibodies at one or more of the following sites of the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34): A121 C, K150C, V205C, C223S, S242C, D268C, A330C, and S443C. For example, antibodies AT04-25A and AT04-26A were generated (see Table 7).Table 7. Cysteine-modified anti-ALPP / ALPPL2 antibodies
[0170] FIG. 9 shows surface plasmon resonance (SPR) analysis of the parental H17E2 (AT04-5A) and select humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04- 26A). Specifically, binding affinity of AT04-23 was improved over the binding affinity of theparent H17E2 antibody (AT04-5A). FIG. 10 shows specificity of the parental H17E2 (AT04- 5A) and select humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04-26A) to ALPPL2, ALPP, and similar enzymes like ALPI and ALPL. An isotype control (ITC) antibody lacking specificity to the target was used as negative control. FIG. 11 shows cross reactivity of the parental H17E2 (AT04-5A) and select humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04-26A) to mouse and monkey ALPPL2. All antibodies retained similar binding specificity and selectivity as the parent H17E2 antibody (AT04-5A) (FIGS. 10-11 ). Additionally, FIG. 12 shows internalization of the optimized antibodies into ALPPL2 expressing cells.
[0171] Taken together, these data show that humanized and / or optimized anti- ALPP / ALPPL2 antibodies developed in this study retains high antigen and species selectivity and further exhibit improved hydrophilicity, yield, and reduced propensity for aggregation, rendering them suitable for therapeutic use by themselves or in the development of ADCs.Example 2. Development of ADCs using humanized / optimized anti-ALPP / ALPPL2 antibodies
[0172] In this study, the humanized and / or optimized anti-ALPP / ALPPL2 antibodies developed in Example 1 were used to generate ADCs with a payload to target cells that bear ALPP / ALPPL2 antigens.
[0173] First, ADCs were generated by conjugating a payload to the anti-ALPP / ALPPL2 antibody through a linker, using the following general procedures. FIG. 13 shows exemplary linker payloads used in ADCs generated below (top structure, see Table 8, LP26; bottom structure, see Table 8, LP14).General conjugation procedure (maleimide conjugation) for preparing ADCs
[0174] Monoclonal antibody (1 eq.) was placed in a centrifugation tube, and then 25 mM Na2B4O7, 25 mM NaCI, 1 mM DTPA pH 7.4 buffer was added to dilute the antibody concentration to 3-4 mg / mL. To the mixture was added 2 mg / mL TCEP (3 eq. to 9 eq.) aqueous solution for antibody reduction. After vortexing, the reaction was placed on a constant temperature mixer, and the reduction was conducted at 37°C for 2.0 hrs. A solutionof 10 mg / mL linker payload (3 eq. to 12 eq.) in DMSO was added, and DMSO was added according to 10% of the total volume of the final reaction solution respectively. After vortexing, the solution was placed on a constant temperature mixer for reaction and conjugated at 25°C for 1 .0 hr.
[0175] Unconjugated residual linker payloads in the reaction solution were removed by passing through a Zeba Spin Desalting Column (MWCO 40K). The flow-through containing the desired ADC was buffer exchanged to a suitable storage buffer through 3 to 4 times of ultrafiltration using a Pierce PES Protein Concentrator (MWCO 50K). The final product was stored at -80°C.General conjugation procedure (allenamide conjugation) for preparing ADCs
[0176] Monoclonal antibody (1 eq.) was placed in a centrifugation tube, and then 25 mM Na2B4O7, 25 mM NaCI, 1 mM DTPA pH 7.4 buffer was added to dilute the antibody concentration to 3-4 mg / mL. To the mixture was added 2 mg / mL TCEP (3 eq. to 9 eq.) aqueous solution for antibody reduction. After vortexing, the reaction was placed on a constant temperature mixer, and the reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. A solution of 10 mg / mL linker payload (3 eq. to 12 eq.) in DMSO was added, and DMSO was added according to 10% of the total volume of the final reaction solution respectively. After vortexing, the solution was placed on a constant temperature mixer for reaction and conjugated at 37°C for 16 hrs.
[0177] Unconjugated residual linker payloads in the reaction solution were removed by passing through a Zeba Spin Desalting Column (MWCO 40K). The flow-through containing the desired ADC was buffer exchanged to a suitable storage buffer through 3 to 4 times of ultrafiltration using a Pierce Protein Concentrator (MWCO 50K). The final product was stored at -80°C.Common characterization protocols for ADCs(a) ADC DAR value measurement by HIC-HPLC analysis
[0178] HPLC instrument: Agilent 1260 Bio-Inert High Performance Liquid Chromatography system.
[0179] Column: AdvanceBio HIC column, 4.6 x 100 mm, 3.5 urn (Manufacturer: Agilent).
[0180] Mobile phase: mobile phase A (MPA): 1.5 M ammonium sulphate in 50 mM phosphate buffer pH 7); Mobile phase B (MPB): 50 mM phosphate buffer pH 7.0 / isopropyl alcohol (75:25 V / V); the following gradient elution procedure was followed, in which the composition of mobile phase B was 30%-100% in 0-30 min. Mobile phase B was kept at 100% at 30-44.99 min and brought to 30% at 45 min. The post-run time was 10 min.
[0181] Detection conditions: The flow rate of mobile phase was set at 0.4 mL / min, the detection wavelength was set at 280 nm, and the column temperature was set at 25°C.
[0182] Experimental procedure: 50 pg ADC sample (the volume depends on the concentration of the sample) was injected into the HPLC, eluted by the above elution procedure, and the chromatogram was recorded.
[0183] DAR value is calculated as follows: DAR = Σ (relative peak area x number of loaded drugs) / 100.(b) ADC aggregate measurement by SEC-HPLC analysis
[0184] HPLC instrument: Agilent 1260 Bio-Inert High Performance Liquid Chromatography system.
[0185] Column: AdvanceBio SEC 300A, 7.8 x 300 mm, 2.7 pm.
[0186] Mobile phase: 1x PBS / isopropyl alcohol (90:10 V / V), isocratic flow.
[0187] Detection conditions: Flow rate of mobile phase was set at 0.86 mL / min, detection wavelength was set at 280 nm, and column temperature was set at 35°C.
[0188] Experimental procedure: 30 pg ADC sample (the volume depends on the concentration of the sample) was injected into the HPLC, eluted by the above elution procedure, and the chromatogram was recorded.
[0189] Calculation formula: Monomer purity (%) = A monomer / A total x 100%; aggregate purity (%) = A aggregate / A total x 100%.ADCs made from antibody AT04-10A(a) Preparation of ADC-1
[0190] According to the general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-10A (0.45 mg, 6.39 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 3.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs, and then conjugated with maleimidocaproyl (mc)-vc-PAB-MI\ / IAE (10 mg / mL, 10.0 eq.) in DMSO at 25°C for 1.0 hr. The mixture was purified as described to afford ADC-1 (CADC (mg / mL): 2.52, V (mL): 0.10, yield: 56.0%).
[0191] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 5.08, SEC purity: 99.7%.
[0192] ADC-1 has the following structure (see also FIG. 13, bottom; Table 8, LP14):(b) Preparation of ADC-2
[0193] According to the general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-10A (0.45 mg, 6.39 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs, and then conjugated with mc-vc-PAB-MMAE (10 mg / mL, 12.0 eq.) in DMSO at 25°C for 1.0 hr. The mixture was purified as described to afford ADC-2 (CADC (mg / mL): 2.18, V (mL): 0.10, yield: 48.4%).
[0194] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 8.00, SEC purity: 99.6%.
[0195] ADC-2 has the following structure (see also FIG. 13, bottom; Table 8, LP14):(c) Preparation of ADC-3
[0196] According to the general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-10A (0.45 mg, 6.39 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 3.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Conjugation with allenamidocaproyl (ac)-vc-MMAE (10 mg / mL, 10.0 eq.) in DMSO was performed at 37°C for 16.0 hrs. The mixture was purified as described to afford ADC-3 (CADC (mg / mL): 2.87, V (mL): 0.10, yield: 63.7%).
[0197] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 4.57, SEC purity: 93.2%
[0198] ADC-3 has the following structure (see also FIG. 13, top; Table 8, LP26; Table 3, L11):(d) Preparation of ADC-4
[0199] According to the general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-10A (0.35 mg, 6.39 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Conjugation with ac-vc-MMAE in DMSO was performed at 37°C for 16.0 hrs. The mixture was purified as described to afford ADC-4 (CADO (mg / mL): 2.04, V (mL): 0.10, yield: 58.2%).
[0200] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 7.89, SEC purity: 86.6%
[0201] ADC-4 has the following structure (see also FIG. 13, top; Table 8, LP26; Table 3, L11):ADCs made from antibody AT04-13A(a) Preparation of ADC-5
[0202] According to the general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-13A (0.45 mg, 6.49 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 3.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs, and then conjugated with mc-vc-PAB-MMAE (10 mg / mL, 10.0 eq.) in DMSO at 25°C for 1.0 hr. The mixture was purified as described to afford ADC-5 (CADC (mg / ml): 2.38, V (ml): 0.10, Yield: 52.9%).
[0203] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 5.84, SEC purity: 98.8%
[0204] ADC-5 has the following structure (see also FIG. 13, bottom; Table 8, LP14):(b) Preparation of ADC-6
[0205] According to the general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-13A (0.355 mg, 4.15 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs, and then conjugated with mc-vc-PAB-MMAE (10 mg / mL, 12.0 eq.) in DMSO at 25°C for 1 .0 hr. The mixture was purified as described to afford ADC-6 (CADO (mg / mL): 1 .66, V (mL): 0.10, yield: 46.7%).
[0206] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 7.98, SEC purity: 99.5%
[0207] ADC-6 has the following structure (see also FIG. 13, bottom; Table 8, LP14):(c) Preparation of ADC-7
[0208] According to the general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-13A (0.4 mg, 4.15 mg / mL, 1.0 eq.) was partially reduced by adding TCEP (2 mg / mL, 3.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Conjugation with ac-vc-MMAE(10 mg / mL, 10.0 eq.) in DMSO was performed at 37°C for 16.0 hrs. The mixture was purified as described to afford ADC-7 (CADC (mg / mL): 2.14, V (mL): 0.10, yield: 53.6%).
[0209] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 4.23, SEC purity: 85.1%
[0210] ADC-7 has the following structure (see also FIG. 13, top; Table 8, LP26; Table 3, L11):(d) Preparation of ADC-8
[0211] According to the general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-13A (0.4 mg, 4.15 mg / mL, 1.0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Conjugation with ac-vc-MMAE (10 mg / mL, 12.0 eq.) in DMSO was performed at 37°C for 16.0 hrs. The mixture was purified as described to afford ADC-8 (CADC (mg / mL): 1.91 , V (mL): 0.10, yield: 47.8%).
[0212] The following characteristic values were obtained according to common characterization protocols for ADCs: HIC-DAR: 8.00, SEC purity: 81.0%.
[0213] ADC-8 has the following structure (see also FIG. 13, top; Table 8, LP26; Table 3, L11):(e) Preparation of ADC-9
[0214] According to the general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-13A (0.63 mg, 4.36 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (1 mg / mL, 4.5 eq.) aqueous solution. The reduction was conducted at 20°C for 1.5 hrs, and then conjugated with LP4 (see Table 8) (10 mg / mL, 5.0 eq.) in DMSO at 20°C for 0.5 hr. The mixture was purified as described to afford ADC-9 (CADC (mg / mL): 1 .63, V (mL): 0.24, yield: 61.8%).
[0215] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 5.07, SEC purity: 85.5%.
[0216] ADC-9 has the following structure (see also Table 8, LP4):(f) Preparation of ADC-10
[0217] According to the general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-13A (0.448 mg, 4.07 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (1 mg / mL, 4.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Conjugation with LP1 (see Table 8) (10 mg / mL, 10.0 eq.) in DMSO was performed at 25°C for 1 hr. The mixture was purified as described to afford ADC-10 (CADC (mg / mL): 1 .91 , V (mL): 0.08, yield: 36.2%).
[0218] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 5.13, SEC purity: 97.7%.
[0219] ADC-10 has the following structure (see also Table 8, LP1 ):ADCs made from antibody AT04-23A(a) Preparation of ADC-11
[0220] According to general conjugation procedure (maleimide conjugation) for preparing ADCs, AT04-23A (0.45 mg, 7.72 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37 °C for 2.0 hrs, and then conjugated with mc-vc-PAB-MMAE (10 mg / mL, 12.0 eq.) in DMSO at 25 °C for 1.0 hr. The mixture was purified as described to afford ADC-11 (CADC (mg / mL): 1.78, V (mL): 0.10, yield: 39.5%).
[0221] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 7.86, SEC purity: 100.0%
[0222] ADC-11 has the following structure (see also FIG. 13, bottom; Table 8, LP14):
[0223] According to general conjugation procedure (allenamide conjugation) for preparing ADCs, AT04-23A (0.45 mg, 7.72 mg / mL, 1 .0 eq.) was partially reduced by adding TCEP (2 mg / mL, 9.0 eq.) aqueous solution. The reduction was conducted at 37°C for 2.0 hrs. An equal volume of 0.5M Tris pH 8.8 buffer was added. Conjugation with ac-vc-MMAE (10 mg / mL, 12.0 eq.) in DMSO was performed at 37 °C for 16.0 hrs. The mixture was purified as described to afford ADC-12 (CADC(mg / mL): 2.20, V (mL): 0.10, yield: 48.8%).
[0224] The following characteristic values were obtained according to the common characterization protocols for ADCs: HIC-DAR: 7.84, SEC purity: 84.0%
[0225] ADC-12 has the following structure (see also FIG. 13, top; Table 8, LP26; Table 3, L11):ADCs made from antibodies AT04-25A and AT04-26 A(a) General site-specific conjugation procedure for preparing ADCs
[0226] Antibodies engineered with reactive cysteine residues for drug conjugation (e.g., AT04-25A and AT04-26A) were generated and subjected to conjugation with various linkers to make ADC-13 to ADC-16 using the following general procedure.
[0227] Briefly, monoclonal antibodies were buffer exchanged into 2 mM EDTA and 100 mM Tris-HCI (pH 8.0). 1 mg of antibody was added to a 1 .5 ml_ centrifuge tube and mixed with 200 equivalent DTT. The antibody was incubated at 22°C overnight for reduction. The reduced antibody was buffer exchanged into 2 mM EDTA, 150 mM NaCI, 50 mM Tris-HCI (pH 7.5), and 20 equivalent of DHAA was added. Reaction was incubated at 22°C for 2 hrs after pipetting and mixing. DHAA was removed with a Zeba spin desalting column into buffer containing 150 mM NaCI, 50 mM Tris-HCI (pH 7.5). Six equivalents of linker-payload were added. Incubation was performed at 20°C for 4 hrs with agitation. At the end of the reaction,the free small molecules were removed, and ADC storage buffer was replaced with 50 mM His-HAC (pH 5.5). Conjugated ADCs were stored at -80°C for later use.(b) Preparation of ADC-13
[0228] ADC-13 prepared from AT04-25A has the following characteristic values obtained according to the common characterization protocols for ADCs: HIC-DAR: 3.9, SEC purity: 97.0%.
[0229] ADC-13 has the following structure (see also FIG. 13, bottom; Table 8, LP14):(c) Preparation of ADC-14
[0230] ADC-14 prepared from AT04-26A has the following characteristic values obtained according to the common characterization protocols for ADCs: HIC-DAR: 3.9, SEC purity: 94.0%.
[0231] ADC-14 has the following structure (see also FIG. 13, bottom; Table 8, LP14):
[0232] ADC-15 prepared from AT04-25A has the following characteristic values obtained according to the common characterization protocols for ADCs: HIC-DAR: 4.0, SEC purity: 94.0%.
[0233] ADC-15 has the following structure (see also Table 8, LP8):(e) Preparation of ADC-16
[0234] ADC-16 prepared from AT04-26A has the following characteristic values obtained according to the common characterization protocols for ADCs: HIC-DAR: 4.0, SEC purity: 92.0%
[0235] ADC-16 has the following structure (see Table 8, LP8):
[0236] Taken together, these data show that humanized and / or optimized anti- ALPP / ALPPL2 antibodies developed in this study can be conjugated to a payload to generate ADCs that will target cells expressing ALPP / ALPPL2.Table 8. Exemplary linker payloadsExample 3. Determination of the Efficacy of ADCs targeting ALPP / ALPPL2
[0237] In this study, the ability of the generated ADCs, ADC-1 to ADC-16, to mediate ALPP / ALPPL2-dependent cytotoxicity was evaluated in NCI-N87 cells. N87 cells were seeded, allowed to adhere overnight, and then treated for 120 hours with at least 9 different concentrations of each of ADC-1 to ADC-16, prepared through serial dilution. Cell viability of the NCI-N87 cells was determined by CellTitre-Glo Cell Viability Assay per manufacturer instructions. Dose response curves were generated for ADC-1 to ADC-4 (FIG. 14A), ADC- 5 to ADC-8 (FIG. 14B), ADC-9 to ADC-10 (FIG. 14C), ADC-11 to ADC-12 (FIG. 14D), and ADC-13 to ADC-16 (FIG. 14E). The half-maximal inhibitory concentration (IC50) for each of the ADCs was calculated and ranged from 0.0081 nM to 618.6nM, demonstrating potent cytotoxicity of the ADCs.
[0238] ADC-14 was then tested in mouse xenograft models of pancreatic (HPAC) and gastric (NCI-N87) tumor cells. Tumor cells were injected into BALB / c nude mice. After tumors became palpable, mice were treated intravenously with 3mg / kg of ADC-14 on day 0 and day 7. Non-binding lgG1 anti-DT conjugated to maleimidocaproyl (mc)-vc-MMAE (DAR 3.8) was used as an isotype ADC control, and PBS was used as vehicle control. Tumor size was determined from measurements taken with calipers at least twice a week. As shown in FIG. 15, ADC-14 inhibited tumor growth and induced tumor regression at 3 mg / kg (QWx2) in pancreatic (HPAC) and gastric (NCI-N87) models expressing ALPP / ALPPL2, while not significantly affecting body weight.
[0239] Finally, ADC-14 was tested in patient-derived xenograft (PDX) mouse model of cancer. Tumor cells isolated from tissue biopsies of patient with gastric (FIG. 16) or gastroesophageal junction (GEJ) cancer (FIG. 17) were implanted into BALC / c nude mice. After tumors became palpable, mice were treated with either 3mg / kg (FIG. 16) or 6mg / kg (FIG. 17) of ADC-14 on day 0, day 7, and day 14 (QWx3). At the endpoint, the tumor growth inhibition ratio (TGI, %) was determined using the following formula: TGI (%) = [1 - (RTV of the treated group) / (RTV of the control group)] x 100 (%). The RTV, or relative tumor volume, was calculated using the following formula: RTV = (tumor volume on measured day) / (tumor volume on day 0). ADC-14 inhibited tumor growth and induced tumor regression at 3 mg / kg (FIG. 16) and 6mg / kg (FIG. 17), with the 3mg / kg dosage achieving a TGI of 93% and the6mg / kg dosage achieving a TGI of 100%. Taken together, these results show that ADCs targeting ALPP / ALPPL2 are safe, elicit strong antitumor activity, and hold great promise for therapeutic use in cancer treatment.
[0240] The above detailed description of embodiments of the technology are not intended to be exhaustive or to limit the technology to the precise forms disclosed above. Although specific embodiments of, and examples for, the technology are described above for illustrative purposes, various equivalent modifications are possible within the scope of the technology as those skilled in the relevant art will recognize. The various embodiments described herein may also be combined to provide further embodiments.
[0241] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.
[0242] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present disclosure.
Claims
CLAIMSI / We claim:1 . A recombinant antibody or an antigen-binding fragment thereof that specifically binds to alkaline phosphatase, placental (ALPP) and / or alkaline phosphatase, placental-like 2 (ALPPL2).
2. The antibody or antigen-binding fragment thereof of claim 1 , comprising a heavy chain variable region comprising at least one, two, or three complementarity-determining regions (CDRs) selected from SEQ ID NOs: 10, 3, 11 ; and / or a light chain variable region comprising at least one, two, or three CDRs selected from SEQ ID NOs: 6-8.
3. The antibody or antigen-binding fragment thereof of claim 2, comprising a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 9, 12, or 13; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 14 or 15.
4. The antibody or antigen-binding fragment thereof of claim 1 , comprising a heavy chain variable region comprising at least one, two, or three CDRs selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38), and AKPHYGSSYVGAMEY (SEQ ID NO: 11 ), wherein:Xi is E, H, Q, or S; andX2 is A, E, L, or Q; and / or a light chain variable region comprising at least one, two, or three CDRs selected from SEQ ID NOs: 6-8.
5. The antibody or antigen-binding fragment thereof of claim 4, comprising:(a) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 17, and 11 ; and / or a light chain variable regioncomprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(b) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 19, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(c) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 21 , and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(d) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 23, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(e) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 25, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(f) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 27, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8;(g) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 29, and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8; or(h) a heavy chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 10, 31 , and 11 ; and / or a light chain variable region comprising CDRs having amino acid sequences set forth in SEQ ID NOs: 6-8.
6. The antibody or antigen-binding fragment thereof of claim 5, comprising:(a) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 16; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(b) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 18; and / or a light chain variable regioncomprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(c) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 20; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(d) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 22; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(e) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 24; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(f) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 26; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;(g) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 28; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15; or(h) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 30; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 15;7. The antibody or antigen-binding fragment thereof of any one of claims 1-6, further comprising a light chain constant region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 33 and / or a heavy chain constant region, wherein the heavy chain constant region comprises:(a) one or more amino acid substitutions at positions A121 , S242, L237, L238, D268, K150, V205, C223, A330, and S443, relative to SEQ ID NO: 34; or(b) one or more amino acid substitutions relative to SEQ ID NO: 34 selected from the group consisting of: A121C, S242C, L237A, L238A, D268C, K150C, V205C, C223S, A330C, and S443C; or(c) an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 32, 35, 36, or 37.
8. The antibody or antigen-binding fragment thereof of any one of claims 1-7, wherein the antibody or antigen-binding fragment thereof is humanized.
9. The antibody or antigen-binding fragment thereof of any one of claims 1-8, wherein the antibody or antigen-binding fragment thereof is hypoimmune.
10. The antibody or antigen-binding fragment thereof of any one of claims 1-9, wherein the antibody or antigen-binding fragment thereof does not bind alkaline phosphatase, intestinal (ALPI) and / or alkaline phosphatase, biomineralization associated (ALPL).11 . The antibody or antigen-binding fragment thereof of any one of claims 1-10, wherein the antibody or antigen-binding fragment thereof does not have cross reactivity to a nonhuman species.
12. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1-11.
13. A nucleic acid comprising a nucleotide sequence encoding the antibody or antigenbinding fragment thereof of any one of claims 1 -11.
14. The nucleic acid of claim 13, wherein the nucleotide sequence is at least 80% identical to SEQ ID NO: 35 or SEQ ID NO: 36.
15. A vector comprising the nucleic acid of claim 13 or claim 14.
16. The vector of claim 15, wherein the vector is a viral or non-viral vector.
17. The vector of claim 16, wherein the vector is a viral vector.
18. The vector of claim 17, wherein the vector is a lentiviral vector.
19. A host cell containing the nucleic acid of claim 13 or claim 14, or the vector of any one of claims 15-18.
20. A composition comprising the vector of any one of claims 15-18, or the host cell of claim 19.
21. An antibody-drug conjugate (ADC), comprising (i) the antibody or antigen-binding fragment thereof of any one of claims 1 -11 ; and (ii) one or more payloads, wherein the antibody or antigen-binding fragment thereof is directly or indirectly connected to each of the one or more payloads by a linker.
22. The ADC of claim 21 , having a formula of: (|)jwherein Ab is the antibody or antigen-binding fragment thereof, L is a linker, D is a payload, and z is an integer between 1 and 20.
23. The ADC of claim 21 or claim 22, wherein the linker (L) has a structure of:wherein D is a payload, and n is an integer between 1 and 20.
24. The ADC of claim 21 or claim 22, wherein the linker (L) has a structure of any one of L9-L21 provided in Table 3.
25. The ADC of any one of claims 21 -24, wherein the payload comprises an antimitotic agent, a DNA topoisomerase I inhibitor, or an DNA minor groove binding agent.
26. The ADC of claim 25, wherein the payload comprises an antimitotic agent comprising monomethyl auristatin E (MMAE) or a derivative thereof and / or a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of any of the foregoing.
27. The ADC of claim 25, wherein the payload comprises a DNA topoisomerase I inhibitor comprising DXd or exatecan or a derivative thereof and / or a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of any of the foregoing.
28. The ADC of claim 25, wherein the payload comprises a DNA minor groove binding agent comprising trabectedin or a derivative thereof, lurbinectedin or a derivative thereof and / or a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of any of the foregoing.
29. The ADC of claim 26, wherein the payload comprises MMAE or a derivative thereof having a structure of:wherein R is a saccharide, optionally a monosaccharide.
30. The ADC of claim 27, wherein the payload comprises Dxd / exatecan or a derivative thereof.
31. The ADC of claim 28, wherein the payload comprises lurbinectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;Rs is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a Ci 4 alkyl; andR4 is -H or a C1-4 alkyl, optionally wherein formula (III) does not include:R2 is -H, R3 is -H, and R4 is -H; andR2 is -OCH3, R3 is -H, and R4 is -H.
32. The ADC of claim 28, wherein the payload comprises lurbinectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R5), a carboxyl group (-C(=O)OR6, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein Rs and R6 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R7)2)0-1(X)0-1R8, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and R7 and Rs are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R9)2)0-1(X)0-1Rio, wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R9 and R10 are independently H or a Ci 4 alkyl; andR4 is -H or -CH2NHR11, wherein Rn is H or a C1-4 alkyl.
33. The ADC of claim 28, wherein the payload comprises trabectedin or a derivative thereof having a structure of:wherein:Ri is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, a carbonyl group (-C(=O)R6), a carboxyl group (-C(=O)OR?, or -C=N; preferably a carbonyl group, -OH, -NO2, -F, or -C=N; more preferably -OH, -F, or -C=N; and most preferably -OH or -C=N, wherein R6 and R7 are independently H or an aryl;R2 is -H or -X(CH2)pC(=0)0-1(CH2)q(C(R8)2)0-1(X)0-1R9, wherein p and q are integers independently selected from 0 to 10, X is O or NH, and Rs and R9 are independently H or a C1-4 alkyl;R3 is -H or -X(CH2)mC(=0)0-1(CH2)n(C(R10)2)0-1(X)0-1R11 , wherein m and n are integers independently selected from 0 to 10, X is O or NH, and R10 and Rn are independently H or a C1-4 alkyl; andR4 is -H, -CH2OR12, -CH2NHR13, or -CH2C(=O)OR14, wherein R12, R13, and R14 are independently H or a C1-4 alkyl; andRs is -H or a C1-4 alkyl, optionally wherein formula (V) does not include:R2 is -OCH3, R3 is -OH, R4 is -H, and Rs is -H.
34. The ADC of any one of claims 21 -24, wherein the payload (D) has a structure of any one of P1-P12 provided in Table 4.
35. The ADC of claim 21 or claim 22, wherein the linker payload (L-D) has a structure of any one of PL1 -PL38 provided in Table 8.
36. A pharmaceutical composition comprising the ADC of any one of claims 21 -35.
37. A method of in vitro inhibition of the growth of a cancer cell that expresses ALPP and / or ALPPL2, the method comprising contacting the cancer cell with an effective amount of the antibody or antigen-binding fragment thereof of any one of claims 1 -1 1 , the pharmaceutical composition of claim 12, the ADC of any one of claims 21 -35, or the pharmaceutical composition of claim 36.
38. A method of treating a cancer that expresses ALPP and / or ALPPL2 in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof of any one of claims 1-11 , the pharmaceutical composition of claim 12, the ADC of any one of claims 21 -35, or the pharmaceutical composition of claim 36.
39. The method of claim 38, further comprising administering to the subject one or more additional anti-cancer therapies.
40. The method of claim 39, wherein the one or more additional anti-cancer therapies is a therapeutic antibody, an ADC, chemotherapy, radiotherapy, endocrine therapy, targeted molecular agents, immunotherapy, or any combination thereof.41 . The method of any one of claims 38-40, wherein the cancer is a solid cancer.
42. The method of claim 41 , wherein the solid cancer is mesothelioma, ovarian, pancreatic, endometrial, non-small cell lung, stomach, gastroesophageal junction, cervical, colorectal, or testicular cancer.