Yeast product used as a postbiotic in the field of oral hygiene and health

A yeast product derived from Saccharomyces cerevisiae yeast cell walls, rich in β-glucans, addresses the challenge of dental biofilm formation by inhibiting pathogenic bacteria, enhancing oral hygiene and health in humans and pets.

FR3168336A1Pending Publication Date: 2026-05-15LESAFFRE & CIE
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
FR · FR
Patent Type
Applications
Current Assignee / Owner
LESAFFRE & CIE
Filing Date
2024-11-08
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

There is a need to reduce and/or prevent the formation of dental biofilm caused by the growth of pathogenic bacteria such as Leptotrichia, Tannerella forsythia, Porphyromonas gingivalis, Peptostreptococcus canis, and Porphyromonas bacteria, which contribute to oral infectious diseases like dental caries and periodontal diseases in humans and pets.

Method used

A yeast product extracted from Saccharomyces cerevisiae yeast cell walls, rich in β-glucans, is used to inhibit the growth of these bacteria and reduce dental biofilm formation.

Benefits of technology

The yeast product effectively reduces the macromolecular and bacterial density of dental biofilm, promoting oral hygiene and health in both humans and pets, particularly by inhibiting the growth of pathogenic bacteria associated with dental biofilm.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to the field of oral hygiene and health, in particular a product extracted from the cell walls of the yeast Saccharomyces cerevisiae, rich in β-glucans, for use in reducing and / or preventing the formation of dental biofilm. No figure
Need to check novelty before this filing date? Find Prior Art

Description

Title of the invention: Yeast product as a postbiotic in the field of oral hygiene and health. Technical field

[0001] The present invention relates to the field of oral hygiene and health. The present invention relates to a product extracted from the cell walls of Saccharomyces cerevisiae yeasts rich in P-glucans, or a composition comprising it, for use in reducing and / or preventing the formation of dental biofilm. Technical background

[0002] In mammals, the oral cavity is a complex ecosystem, both open to the outside and the inside, inhabited by numerous microorganisms.

[0003] In humans, the oral cavity is inhabited by more than 700 detected bacterial species (see for example the articles: Marsh et al., Periodontology 2000, 2011, 55, 16-35; Paster et al., Periodontology 2000, 2006, 42, 80-87; Aas et al., J. Clin. Microbiol., 2005, 43, 5721-5732; Dewhirst et al., J. Bacteriol., 2010, 192, 5002-5017).

[0004] For example, in a single individual, the number of resident bacterial species varies from 150 to 250. Most of these species are commensal and necessary to maintain the balance of this ecosystem. However, in certain situations (for example, dietary habits, high carbohydrate intake, smoking, physiological changes such as aging, puberty, pregnancy), a disruption of this balance occurs and can lead to the development of infectious diseases of the oral cavity.

[0005] The main infectious diseases of the oral cavity in humans are dental caries and periodontal diseases.

[0006] Dental caries are polybacterial diseases characterized by demineralization of the hard tissues of the tooth. This demineralization is due to the production of acids by fermentative bacteria present within the dental biofilm. Streptococcus mutans and Lactobacillus are considered the main cariogenic bacteria. The World Health Organization (WHO) report on oral health highlights the high prevalence of caries, particularly among young people. Compared to the rest of the world, the risk of caries during childhood is much higher in developed countries (North America, Australia, Europe, Japan) due to diets very high in sugars.

[0007] Periodontal diseases are a group of pathologies affecting the periodontium, that is, the supporting tissues of the teeth—bone and gingival mucosa. These diseases are divided into two main categories: gingivitis and periodontitis. Gingivitis refers to any inflammation limited to the superficial periodontium. Periodontitis is an advanced infectious lesion of the periodontium and often follows gingivitis. The presence of certain bacteria and an intense immune response lead to the destruction of the periodontium. The transition from a healthy state to a state of periodontal disease is accompanied by a gradual shift towards a flora richer in anaerobic and Gram-negative bacteria. This phenomenon is called anaerobic drift.Among the bacterial species most frequently implicated in periodontal diseases in humans, there is the red complex composed of bacteria of the species Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. There are also, notably, bacteria of the species Fusobacterium nucleatum, whose co-aggregation with bacteria of the species Porphyromonas gingivalis appears to improve their survival and pathogenicity (see, for example, the articles: Diaz et al., Microbiology, 2002, 148, 467-472; Saito et al., FEMS Immunol. Med. Microbiol., 2008, 54, 349-355; Polak et al., J. Clin. Periodonto., 2009, 36, 406-410).

[0008] In order to prevent the onset of infectious diseases of the oral cavity, or to treat them if necessary, it is useful to maintain or restore the balance between the populations of non-pathogenic and pathogenic microorganisms present within the human oral microbiota, so as to control the formation, development, and composition of dental biofilm. Many pathogenic bacteria may be present in the oral microbiota and may stimulate the formation, development, and composition of dental biofilm, and potentially promote the occurrence of infectious diseases of the human oral cavity.

[0009] For example, bacteria of the genus Leptotrichia promote the formation of dental biofilm and increase its density, which is undesirable. Leptotrichia bacteria are generally found in the filament-rich annular zone of dental biofilms, particularly in association with Fusobacterium and Capnocytophaga bacteria. Leptotrichia bacteria are therefore involved in the structuring of maturing dental biofilms. Colonization of the oral microbiota by Leptotrichia bacteria, and their growth within the dental biofilm, is thus likely to contribute to the onset and development of infectious diseases of the human oral cavity.

[0010] For example, bacteria of the species Tannerella forsythia, which is one of the three species of the red complex in humans, express numerous virulence factors that allow them to colonize the subgingival space, to disrupt the host defense system, to invade and destroy periodontal tissues, or to promote the host's destructive immunosuppressive response. Colonization of the oral microbiota by bacteria of the species Tannerella forsythia and their growth in dental biofilm contributes to the onset and development of infectious diseases of the human oral cavity.

[0011] For example, bacteria of the species Porphyromonas gingivalis, one of the three species of the red complex in humans, cause severe lesions in oral tissues and gums, leading to the destruction of the structure that supports the teeth. These lesions are caused by a cocktail of toxic proteins secreted by Porphyromonas gingivalis bacteria called gingipains. Gingipains have adhesin or protease-like activities that allow the bacteria to adhere to oral tissues and promote the invasion of gingival tissues by degrading the protein matrix that protects them. Colonization of the oral microbiota by Porphyromonas gingivalis bacteria, and their growth in the dental biofilm, contributes to the onset and development of infectious diseases of the human oral cavity.

[0012] In companion animals, particularly dogs and cats, the oral cavities are also complex ecosystems inhabited by numerous microorganisms (see, for example, the article: Holcombe et al., PlosOne, 2014, 9, 12, el 13744). Most of these microorganisms are commensal and necessary to maintain the balance of this ecosystem. However, a disruption of this balance can occur and lead to the development of infectious diseases of the oral cavity.

[0013] The main infectious diseases of the oral cavity are periodontal diseases. Indeed, dental caries are very rare in dogs and cats. Among the bacterial species most frequently implicated in periodontal diseases of companion animals are bacteria of the species Porphyromonas cangingivalis, Porphyromonas gulae, and Tannerella forsythia.

[0014] In order to prevent the onset of infectious diseases of the oral cavity, or to treat them if necessary, it is useful to maintain or restore the balance between the populations of non-pathogenic and pathogenic microorganisms present within the oral microbiota, so as to control the formation, development, and composition of the dental biofilm. Many pathogenic bacteria may be present in the canine or feline oral microbiota and can stimulate the formation, development, and composition of the dental biofilm, and possibly promote the occurrence of infectious diseases of the oral cavity.

[0015] For example, bacteria of the species Peptostreptococcus canis express virulence factors that allow them to colonize the subgingival space. Colonization of the oral microbiota by bacteria of the species Peptostreptococcus canis and their growth in dental biofilm contributes to the onset and development of infectious diseases of the oral cavity in pets.

[0016] For example, bacteria of the genus Porphyromonas express numerous virulence factors that allow them to colonize the subgingival space, disrupt the host's defense system, invade and destroy periodontal tissues, or promote the host's destructive immunosuppressive response. Colonization of the oral microbiota by bacteria of the genus Porphyromonas and their growth in dental biofilm contribute to the onset and development of infectious diseases of the oral cavity in companion animals.

[0017] There is therefore a real need, both in humans and in pets, particularly dogs and cats, to provide a product that reduces and / or prevents the formation of dental biofilm, avoiding the drawbacks mentioned above. There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria. There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of bacteria of the species Tannerella forsythia, and thus reduces or inhibits the growth of these bacteria, particularly in humans. There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of bacteria of the genus Leptotrichia, and thus reduces or inhibits the growth of these bacteria, particularly in humans.There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Porphyromonas gingivalis bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in humans. There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Peptostreptococcus canis bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in pets. There is also a need to provide a product that reduces and / or prevents the formation of dental biofilm caused by the growth of Porphyromonas bacteria, and therefore reduces or inhibits the growth of these bacteria, particularly in pets. Summary of the invention

[0018] The invention relates to the non-therapeutic use of a yeast product, or a composition comprising it, in the reduction and / or prevention of the formation of dental biofilm; preferably the reduction and / or prevention of the formation of dental biofilm by growth of periodontogenic and / or cariogenic bacteria; said yeast product being an extract of cell walls of Saccharomyces cerevisiae yeast rich in P-glucans.

[0019] The invention also relates to a yeast product, or a composition comprising it, for therapeutic use in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria, said yeast product being an extract of cell walls of Saccharomyces cerevisiae yeast rich in P-glucans.

[0020] In embodiments, the yeast product comprises at least 20% P-glucans, by weight per total weight of the product.

[0021] In embodiments, the yeast product, or a composition comprising it, comprises, by weight per total weight of the product: - at least 20%, preferably between 20 and 30%, of P-glucans; - at least 20%, preferably 20 to 30%, of mannans; - 25% or less, preferably 10 to 25%, of protein; and - 10% or less of glycogen.

[0022] In embodiments, the yeast product, or a composition comprising it, comprises, by weight per total weight of the product: - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of P-glucans; - 5% or less, preferably between 1 and 5%, of mannans; - 10% or less protein; and - 10% or less of glycogen.

[0023] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the species Tamer ella forsythia.

[0024] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the genus Leptotrichia.

[0025] In embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the genus Porphyromonas, preferably bacteria of the species Porphyromonas gingivalis.

[0026] In some embodiments, the periodontogenic and / or cariogenic bacteria involved in the formation of dental biofilm are bacteria of the species Peptostreptococcus canis.

[0027] In some embodiments, the product is administered to a subject; preferably to a mammal; most preferably to a human, a dog or a cat.

[0028] In embodiments (non-therapeutic use), the product is administered to a healthy subject.

[0029] In some embodiments, the product is administered to a subject orally.

[0030] In some embodiments (therapeutic use), the product is administered to a subject with a disease of the oral cavity, or at risk of having one.

[0031] In embodiments, the composition comprising the yeast product being selected from a food supplement, a parapharmaceutical composition or a pharmaceutical composition.

[0032] Surprisingly, the inventors found that the use of a yeast product extracted from the cell walls of Saccharomyces cerevisiae yeast, rich in P-glucans, has beneficial effects on oral hygiene and health, particularly in humans, cats, and / or dogs. Indeed, the inventors demonstrated that the yeast product reduces the macromolecular density and bacterial density of the dental biofilm.Furthermore, the yeast product has a beneficial effect on pathogenic bacteria colonizing the oral microbiota and involved in the formation and development of dental biofilm, particularly bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., Porphyromonas gingivalis), and bacteria of the genus Peptostreptococcus (e.g., Peptostreptococcus canis). The yeast product, or its composition, is particularly interesting because it can be used in healthy individuals (non-therapeutic use) or in individuals with oral cavity disease, or at risk of developing such disease (therapeutic use), these two populations being distinct.

[0033] A more detailed description of the invention is given below. Detailed description

[0034] The invention is now described in more detail and in a non-limiting manner in the following description. Definitions

[0035] By “Saccharomyces cerevisiae yeast strain”, we mean a relatively homogeneous population of Saccharomyces cerevisiae yeast cells obtained by culture (or multiplication) of the starting strain.

[0036] The term "oral microbiota" refers to all microorganisms, particularly bacteria, present in the oral cavity. The terms "oral microbiota," "buccal microbiota," "human oral microbiota," "dog and cat oral microbiota," "oral cavity microbiota," "oral flora," and "oral flora" may be used interchangeably. The microorganisms present in the oral microbiota can be non-pathogenic or pathogenic. The balance between non-pathogenic and pathogenic microorganism populations thus determines, from a clinical and biological perspective, whether the oral microbiota is healthy or not.Des microorganismes présent peuvent être, par exemple, les baccteria appartant au genre Actinomyces, Actinomycetemcomitans, Aggregatibacter, Alloprevotella, Alloscardovia, Anaeroglobus, Atopobium, Bacteroides Bifidobacterium, Capnocytophaga, Catonella, Corynebacterium, Dialister, Eggerthia, Eubacteria, Fusobacterium, Haemophilus, Lachnoanaerobaculum, Leptotrichia, Mogibacterium, Moryella, Neisseriaceae, Olsenella, Oribacterium, Parvimonas, Peptoniphilus, Peptostreptococcus, Propionibacterium, Porphyromonas, Prevotella, Rikenellaceae, Ruminococcaceae, Selenomonas, Shuttleworthia, Slackia, Solobacterium, Stomatobaculum, Streptococcus, Tannerella, Treponema ou Veillonella. Pathogenic microorganisms are for example: Tannerella forsythia (T. forsythia), Porphyromonas gingivalis (P. gingivalis), Treponema denticola (T. denticola), Porphyromonas cangingivalis (P. cangingivalis), Porphyromonas gulae (P. gulae), Porphyromonas endodontalis (P. endodontalis), Prevotella intermedia (P.intermedia), Streptococcus mutans (S. mutons) and Streptococcus sobrinus (S. sobrinus). Non-pathogenic microorganisms include, for example: Streptococcus oralis (S. oralis), and Streptococcus mitis (S. mitis).

[0037] The term “biofilm” refers to the film formed on the surface of teeth and oral mucosa, for example the mucosa of the tongue, gums, palate, and cheeks, by the oral microbiota. The terms “biofilm,” “dental biofilm,” “dental plaque,” ​​“polymicrobial biofilm,” and “polymicrobial film” may be used interchangeably.

[0038] By "paradante" we mean all the supporting tissues of the tooth, the gums, the bone tissue, the cementum and the periodontal ligament.

[0039] The term "infectious disease of the oral cavity" refers to a medical condition located in the oral cavity (mouth) that results from infection by a pathogenic microorganism. Infectious diseases of the oral cavity include, but are not limited to, dental caries and periodontal disease.

[0040] By “dental caries” or “cavity”, we mean an infectious disease of the tooth, which causes damage to the enamel, dentin and / or cementum (pulp).

[0041] By “periodontal health” is meant the absence of inflammation or the presence of a low level of inflammation of an intact or reduced but stable periodontium.

[0042] Periodontal disease refers to inflammation of the tissues supporting the teeth, namely the bone and gums. These are infections caused by the accumulation of pathogenic bacteria and their toxins on the gum margins surrounding the teeth. It initially manifests as gingivitis and then, if left untreated, as periodontitis. The terms "periodontal disease" and "periodontal disease" may be used interchangeably.

[0043] The term "gingivitis" refers to inflammation of the gums, stage 1 of periodontal disease. The terms "gingivitis," "gingival disease," and "gingival inflammation" may be used interchangeably.

[0044] By "periodontitis" we mean inflammation of the deep tissues of the periodontium, stage 2 of periodontal disease.

[0045] By "postbiotic" is meant a preparation of inanimate microorganisms and / or their components which confer a health benefit to the host.

[0046] By "treatment" is meant a method intended to: (1) delay or prevent the onset of a disease or clinical condition; (2) slow or stop the progression, worsening, or deterioration of the symptoms of the disease; (3) improve the symptoms of the disease; and / or (4) cure the disease. A treatment may be administered before the onset of the disease, for a prophylactic effect (this is referred to as "prevention"), or it may be administered after the disease has begun, for a therapeutic effect. In the context of the invention, the term "treatment" generically refers to the reduction and / or prevention of the formation of dental biofilm, in particular through the growth of periodontogenic and / or cariogenic bacteria.

[0047] By "physiologically acceptable excipient" is meant any medium or additive which does not interfere with the effectiveness of the biological activity of the active ingredient and which is not excessively toxic to the subject at the concentrations at which it is administered.

[0048] By “pharmaceutical active ingredient” is meant any compound or substance the administration of which has a therapeutic effect or the administration of which has a beneficial effect on the health or general condition of a subject to whom it is administered.

[0049] Unless otherwise indicated, all percentages for stated quantities are mass percentages. For P-glucan percentages, these are expressed as an equivalent mass of glucose. For mannan percentages, these are expressed as an equivalent mass of mannose. Yeast product

[0050] The yeast product is an extract of cell walls of Saccharomyces cerevisiae yeasts rich in P-glucans, preferentially rich in P-1,3 / Pl,6-glucans (P-1,3 / Pl,6-glucans).

[0051] By "rich in fl-glucans" is meant a product comprising at least 20% P-glucans by weight of the total weight of the product. The yeast product may comprise from 20 to less than 30%, alternatively from 30 to less than 40%, alternatively from 40 to less than 50%, alternatively from 50 to less than 60%, alternatively from 60 to less than 70%, alternatively from 70 to less than 80%, alternatively from 80 to less than 90%, alternatively at least 90%, of P-glucans, by weight of the total weight of the product.

[0052] Yeast, as a living microorganism, comprises cytoplasm surrounded by a cytoplasmic membrane (also called the inner membrane or cell membrane). The cytoplasm includes intracellular compartments, including the nucleus, mitochondria, and Golgi apparatus. The cytoplasmic membrane is surrounded by a cell wall or cortex (the terms "yeast cell walls" and "yeast cortex" are used interchangeably and refer to the insoluble portion of yeast cells, i.e., the cell wall and the plasma membrane of yeast) composed mainly of P-glucans and mannans. The area between the cell membrane and the cell wall forms the periplasm (also called the periplasmic space).

[0053] The yeast product is obtained from the yeast Saccharomyces cerevisiae, and more particularly from a strain of Saccharomyces cerevisiae. Saccharomyces cerevisiae is also known as brewer's yeast or baker's yeast. Many strains of Saccharomyces cerevisiae are known in the art. They are widely used in the food industry for their role in the production of various foods, including breads and fermented beverages. A yeast strain can be obtained from a clone, a clone being a population of yeast cells obtained from a single yeast cell. The cultivation of a Saccharomyces cerevisiae strain can be carried out using any suitable method. Yeast culture methods are known in the prior art, and those skilled in the art know how to optimize the culture conditions for each strain according to its nature.Thus, a Saccharomyces cerevisiae yeast can be obtained by multiplying a strain in an appropriate culture medium, for example, as described in the reference work "Yeast Technology", 2nd edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.

[0054] P-glucans originating from the yeast cell wall are called "cell wall glucans". These P-glucans are essentially glucose polymers whose main chain glucose units are linked by P-1,3 bonds and whose branches are linked by 3-1,6 bonds. P-glucans are insoluble and have low viscosity.

[0055] Mannans from the cell wall of yeasts are called "cell wall mannans." These mannans are polysaccharides composed mainly of mannose, more precisely of copolymers of neutral or acidic sugars (with 5 or 6 carbon atoms), linked together by glycosidic bonds and associated with proteins. In the cell wall mannans of Saccharomyces cerevisiae, mannose is present as a skeleton of mannose residues (50 or more) linked by α-(1,6), branched by short chains of mannose linked by α-(1,2) and α-(1,3).

[0056] In one embodiment, the yeast product may comprise, by weight per total weight of the product: - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of 3-glucans; - 5% or less, preferably between 1 and 5%, of mannans; - 10% or less protein; and - 10% or less of glycogen.

[0057] This yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the product.

[0058] 3-Glucans and mannans may be present in a (weight / weight) ratio of 12 to 40, preferably 15 to 30, very preferably 18 to 22.

[0059] For example, a product of this type is disclosed in application WO 2023194609 Al published on October 12, 2023.

[0060] In one embodiment, the yeast product may comprise, by weight per total weight of the product: - at least 20%, preferably between 20 and 30%, of P-glucans; - at least 20%, preferably 20 to 30%, of mannans; - 25% or less, preferably 10 to 25%, of protein; and - 10% or less of glycogen.

[0061] This yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the product.

[0062] For example, a product of this type is disclosed in international application WO 2020152229 Al published on July 30, 2020.

[0063] The yeast product can be obtained from any process that yields a product rich in 3-glucans.

[0064] The yeast product corresponds to the insoluble fraction of the yeast. The insoluble fraction can be obtained using conventional production processes. The process The extraction process can be biochemical and / or mechanical. For example, the mechanical process can be carried out using glass beads, a high-pressure homogenizer, ultrasound, or microwaves. For example, the biochemical process can be carried out by autolysis, thermal plasmolysis, enzymatic hydrolysis, osmotic shock, or repeated freeze-thaw cycles. In particular, the process may include the following steps: autolysis or enzymatic hydrolysis of whole yeast; then separation of the insoluble fraction and removal of the soluble fraction; and optionally, drying of the soluble fraction. The soluble fraction is conventionally called "yeast extract" and includes the majority of amino acids, including glutamic acid, peptides, and minerals.The insoluble fraction includes yeast cell walls, polymers, polysaccharides, nucleotides, and thermocoagulated proteins. Conventional methods of obtaining it are disclosed in the reference work "Yeast Technology", 2nd edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8. Additional yeast products

[0065] The yeast product according to the invention can be used in combination with an additional yeast product.

[0066] The additional yeast product may be a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight per total weight of the additional yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash, 3% or less sodium chloride.

[0067] The additional yeast product may be a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight per total weight of the additional yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash, 2% or less sodium chloride.

[0068] The additional yeast product may be a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight per total weight of the additional yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash, 1% or less sodium chloride.

[0069] The protein content is measured using the Kjedhl method (6.25 times the total nitrogen). The sodium chloride content is measured using the sodium chloride method. The pH is measured at room temperature (18°C) in a solution containing 8.33% dry matter.

[0070] The additional yeast product may be in powder form.

[0071] The additional yeast product may comprise at least 94%, preferably at least 96%, by weight of dry matter per total weight of yeast product. The yeast product may comprise 100% or less, preferably 99% or less, by weight of dry matter per total weight of additional yeast product. Alternatively, the additional yeast product may comprise 40 to 60% by weight of dry matter per total weight of additional yeast product. For example, the dry matter proportion may be measured by a drying method carried out for 5 hours at 105 °C.

[0072] The additional yeast product may be soluble. By "soluble" is meant a yeast product which can be homogeneously solubilized in water at a concentration of 50 g / L, under stirring and at a temperature of 50°C, the solution comprising less than 500 mg of solid residues i.e. undissolved.

[0073] The additional yeast product can be obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing of the yeast cream obtained by adding water and centrifugal concentration; - heating the washed yeast cream to a temperature between 60 and 95 °C, preferably between 75 and 90 °C; - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours; - separation of yeast extract and yeast cell walls by centrifugation; - concentration of the yeast extract by evaporation and / or reverse osmosis; and - optionally drying of the concentrated yeast extract.

[0074] The additional yeast product is available under the trade name Springer® 4101 / 0-PW-L from the company Biospringer by Lesaffre (Lesaffre group).

[0075] The Springer® 4101 / 0-PW-L yeast additive product is in powder form, has a pH between 6.3 and 6.7 (8.33% solution), comprises at least 94% by weight of dry matter and comprises less than 1% by weight of sodium chloride, 7.5 to 9.0% by weight of total nitrogen, 46.9 to 56.3% by weight of protein (nitrogen x 6.25), and 18 to 22% by weight of ash (excluding sodium chloride) by total weight of product. Uses

[0076] The present invention relates to the use of a yeast product as a postbiotic in the field of oral hygiene and health. The yeast product used is obtained from yeast, but is not a living microorganism, unlike probiotics.

[0077] The yeast product is used in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by the growth of periodontogenic and / or cariogenic bacteria; very Preferably, the product is used for the reduction and / or prevention of dental biofilm formation caused by the growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., Porphyromonas gingivalis), and / or bacteria of the genus Peptostreptococcus (e.g., Peptostreptococcus canis). In addition, the product is used for the maintenance and / or restoration of periodontal health; for the prevention and / or treatment of periodontal disease; and / or for the prevention and / or treatment of gingivitis, preferably for the prevention and / or treatment of gingivitis induced by dental biofilm; and / or for the prevention and / or treatment of periodontitis, preferably for the prevention and / or treatment of periodontitis induced by dental biofilm.

[0078] The use of the yeast product, in particular its therapeutic or non-therapeutic use, depends on the subject to whom it is administered.

[0079] If the subject is in good health, the yeast product may be administered to maintain the subject's well-being, in particular to maintain satisfactory oral hygiene. This is a non-therapeutic use of the yeast product. The yeast product may be formulated as a food supplement, a parapharmaceutical composition, or any other suitable non-therapeutic form.

[0080] If the subject has an infectious disease of the oral cavity, or is at risk of developing one, the yeast product may be administered to prevent, limit, or treat the disease. This is a therapeutic use of the yeast product. The yeast product may be formulated as a pharmaceutical composition or any other suitable therapeutic form.

[0081] The method according to the invention can be used to treat a first episode of infectious disease of the oral cavity, in particular gingivitis or periodontitis, or a recurrence.

[0082] The yeast product may be administered alone. Alternatively, the product may be administered with an additional yeast product as defined above. Alternatively, the yeast product may be administered with another therapy, for example, an antibiotic and / or an antiseptic. Alternatively, the yeast product may be administered with another prebiotic, probiotic, and / or postbiotic product. Alternatively, the yeast product may be administered in combination with a mechanical or surgical procedure, including scaling, root planing, curettage, filling, restoration, or devitalization.

[0083] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Leptotrichia in the oral microbiota.

[0084] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Tannerella, in particular bacteria of the species Tannerella forsythia, in the oral microbiota.

[0085] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the genus Porphyromonas, in particular bacteria of the species Porphyromonas gingivalis, in the oral microbiota.

[0086] In one embodiment, the product is used to reduce or inhibit the growth of bacteria of the species Peptostreptococcus canis. Topics

[0087] The yeast product can be administered to a subject. The subject may already have an infectious disease of the oral cavity, or is at risk of developing one. When the subject has such a disease, the term "patient" may be used interchangeably.

[0088] The yeast product can be administered to a human. This can be a human of any age, including newborns, children, adolescents, adults and the elderly.

[0089] The yeast product can be administered to an animal, preferably to a dog or a cat. Effective quantity

[0090] Use in reducing and / or preventing dental biofilm formation (and the corresponding treatment and / or prevention method) involves administering an effective amount of the yeast product to an individual. The effective amount, which may be administered in one or more doses, can be determined by the physician, dentist, veterinarian, breeder, or any other appropriate person. The exact amount to be administered may vary from one individual to another, depending on the species, age, weight, general condition of the individual, the absence or presence of an infectious disease of the oral cavity, and, if applicable, its nature, severity, and / or extent. The effective amount may also vary depending on the desired therapeutic effect (reduction and / or prevention of dental biofilm formation). Form of administration

[0091] The yeast product can be administered as such or in the form of a preparation or composition.

[0092] The yeast product can be administered as a food supplement for use in reducing and / or preventing the formation of dental biofilm; preferably reducing and / or preventing the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria; most preferably the reduction and / or prevention of the formation of dental biofilm by growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (for example bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (for example bacteria of the species Porphyromonas gingivalis) and / or bacteria of the genus Peptostreptococcus (for example bacteria of the species Peptostreptococcus canis). The food supplement may be in the form of a lozenge, a candy, a chewing gum, an orodispersible powder, a powder to be diluted in water in the form of a stick or sachet, a lozenge or chewable tablet, a chewing gum, a capsule, a tablet, a biscuit, a treat, a kibble, drops, a vial with a dosing cap or may be incorporated directly into the food during its manufacture, especially animal food such as kibble.

[0093] The yeast product can be administered in the form of a parapharmaceutical composition for use in reducing and / or preventing the formation of dental biofilm; preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria; most preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., bacteria of the species Porphyromonas gingivalis), and bacteria of the genus Peptostreptococcus (e.g., bacteria of the species Peptostreptococcus canis). The parapharmaceutical composition can be in the form of sachets, powders, capsules, softgels, dental pastes, gummies, or gels.

[0094] The yeast product can be administered as a pharmaceutical composition for use in reducing and / or preventing the formation of dental biofilm; preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of periodontogenic and / or cariogenic bacteria; most preferably for reducing and / or preventing the formation of dental biofilm caused by the growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (e.g., Tannerella forsythia), bacteria of the genus Porphyromonas (e.g., Porphyromonas gingivalis), and / or bacteria of the genus Peptostreptococcus (e.g., Peptostreptococcus canis). The pharmaceutical composition may be available by prescription or over the counter.The pharmaceutical composition can be administered using any combination of dosage and route of administration effective in achieving the desired therapeutic or prophylactic effect. The effective amount to be administered may vary from one individual to another, depending on species, age, weight, and condition. general condition of the subject, the absence or presence of an infectious disease of the oral cavity, and where applicable its nature, severity and / or extent, etc.

[0095] The pharmaceutical composition may be intended for topical administration or for oral administration.

[0096] The pharmaceutical composition may include a physiologically acceptable excipient. A physiologically acceptable excipient may be an excipient suitable for administration to mammals, in particular humans.

[0097] The pharmaceutical composition may include at least one additional active pharmaceutical ingredient having soothing, anti-irritant, analgesic, analgesic, anti-inflammatory, healing, antibiotic, antipyretic or antifungal activity.

[0098] The pharmaceutical composition may include at least one additive, for example an additive selected from the group consisting of preservatives, sweeteners, flavorings, thickening agents, colorings, humectants, disintegrating agents, absorption accelerators, lubricating agents, and mixtures thereof.

[0099] The pharmaceutical composition may be in any form suitable for administration to a subject, preferably a mammal, most preferably a human, a dog or a cat.

[0100] The pharmaceutical composition may be in the form of tablets, pills, dragees, capsules, pearls, syrups, emulsions, ointments, pastes, gels, powders, sachets or injectable solutions.

[0101] The yeast product, optionally in combination with an additional yeast product or the composition comprising it(s), can be administered by incorporation into a dental medical device, for use in the reduction and / or prevention of the formation of dental biofilm; preferably the reduction and / or prevention of the formation of dental biofilm by growth of periodontogenic and / or cariogenic bacteria; most preferably the reduction and / or prevention of the formation of dental biofilm by growth of bacteria of the genus Leptotrichia, bacteria of the genus Tannerella (for example bacteria of the species Tannerella forsythia), bacteria of the genus Porphyromonas (for example bacteria of the species Porphyromonas gingivalis) and / or bacteria of the genus Peptostreptococcus (for example bacteria of the species Peptostreptococcus canis).A dental appliance can be a dental implant, a dental crown, a dental bridge, a dental onlay, or a dental prosthesis. Examples

[0102] The following examples illustrate the invention without limiting it. Example 1: Products tested

[0103] Product 1: product comprising 20 to 30% P-glucans, 20 to 30% mannans, 10 to 25% proteins and 10% or less glycogen, by weight per total weight of the product (Lynside® Prebiotic product, Gnosis by Lesaffre, Lesaffre group).

[0104] Product 2: product comprising 50 to 60% P-glucans, 1 and 5% mannans, 10% or less protein and 10% or less glycogen, by weight per total weight of the product (Safglucan® product, Phileo by Lesaffre, Lesaffre group). Study model

[0105] In vitro model of a multi-species human biofilm consisting of collecting dental plaque from a healthy subject, culturing the sample under anaerobic conditions, and obtaining and maturing the biofilm on a solid substrate. This model allows, in particular, the evaluation of the appearance of the dental biofilm, its macromolecular density, its bacterial density, its composition, and the production of short-chain fatty acids. Methodology

[0106] The tests are performed in triplicate. Dental plaque is collected from ten healthy subjects by brushing their teeth, followed by rinsing the mouth. The collected samples are immediately placed in an anaerobic environment. Culture media forming artificial saliva (modified McBain medium) are prepared extemporaneously and conditioned anaerobically. The culture media are supplemented with 7.5 g / L of product 1 or 2 (tests). These culture media are compared to an unsupplemented medium (negative control) and a medium supplemented with 1% sucrose (sucrose control). The supplemented media are cultured on twelve-well cell culture plates placed on a rotating platform under anaerobic conditions and at a temperature of 37°C. A glass coverslip is placed in each well to support the dental biofilm. The culture medium is replaced every three days.The final culture medium and slides are harvested after nine days for analysis. Analysis of dental biofilm density

[0107] Biofilms were quantified by crystal violet staining. After harvesting, the biofilms were fixed in 96% ethanol and stained with Crystal Violet (Pro-lab Diagnostics). The bound crystal violet was solubilized in 33% acetic acid. Optical density was measured at 580 nm on the BioTek Synergy Neo2 plate reader.

[0108] Results concerning the macromolecular density of dental biofilm

[0109] Exposure to products 1 and 2 showed a decrease in the optical density reading of the violet crystal.

[0110] Product 1 reduces the macromolecular density of dental biofilm by approximately 70% (7.5 g / L) compared to the negative control.

[0111] Product 2 reduces the macromolecular density of dental biofilm by approximately 60% (7.5 g / L) compared to the negative control.

[0112] Analysis of the bacterial density of dental biofilm

[0113] Bacterial density was determined using a quantitative PCR method using the primers 5'-3' CGA AAG CGT GGG GAG CAA A, GTT CGT ACT CCC CAG GCG G and ATT AGA TAC CCT GGT AGT CCA (RT PCR master mix, Applied Biosystems 7500 RT PCR System, 45 cycles with a denaturation step at 95°C for 15 sec and an elongation step at 60°C for 1 min).

[0114] Results concerning the bacterial density of dental biofilm

[0115] Product 1 reduces the bacterial density of dental biofilm by approximately 45% (7.5 g / L) compared to the negative control.

[0116] Product 2 reduces the bacterial density of dental biofilm by approximately 80% (7.5 g / L) compared to the negative control.

[0117] Analysis of the bacterial composition of the species Tannerella forsythia and results obtained

[0118] The Tannerella forsythia population was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method with the following 5'-3' primers: - GACTGTCAGTTGCTAACAGGTAAAGCT (pl92) - CCAACCTTCCTCACAGCTTACG (pl93) - ACTCTGGCGGGACTG (pl94) (RT PCR master mix, Applied Biosystems 7500 RT PCR System, 45 cycles with a denaturation step at 95°C for 15 sec and a hybridization / elongation step at 60°C for 1 min).

[0119] Product 1 reduces the amount of bacteria of the species Tannerella forsythia by about 2.2 Log (7.5 g / L) compared to the negative control.

[0120] Product 2 reduces the amount of bacteria of the species Tannerella forsythia by approximately 1.7 Log % (7.5 g / L) compared to the negative control.

[0121] Analysis of the composition in bacteria of the genus Leptotrichia and results obtained

[0122] The composition of the biofilm was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method.

[0123] Product 1 reduces the relative abundance of bacteria of the genus Leptotrichia by about 70% (7.5 g / L) compared to the negative control.

[0124] Product 2 reduces the relative abundance of bacteria of the genus Leptotrichia by about 90% (7.5 g / L) compared to the negative control.

[0125] Analysis of the composition in bacteria of the genus Porphyromonas and results obtained

[0126] The composition of the biofilm was analyzed by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR method.

[0127] Product 1 reduces the relative abundance of bacteria of the genus Porphyromonas by approximately 100% (7.5 g / L) compared to the negative control.

[0128] Product 2 reduces the relative abundance of bacteria of the genus Porphyromonas by about 100% (7.5 g / L) compared to the negative control. Conclusions

[0129] Products 1 and 2 tested significantly reduce the density of dental biofilm. Products 1 and 2 significantly reduce the growth of bacteria of the genus Leptotrichia, bacteria of the species Tannerella forsythia, and bacteria of the genus Porphyromonas. Example 2 Products tested

[0130] Product 3: product comprising 20 to 30% P-glucans, 20 to 30% mannans, 10 to 25% proteins and 10% or less glycogen, by weight by total weight of product (Safmannan® product, Phileo by Lesaffre, Lesaffre group).

[0131] Product 4: product comprising 50 to 60% P-glucans, 1 and 5% mannans, 10% or less protein and 10% or less glycogen, by weight per total weight of the product (Safglucan® product, Phileo by Lesaffre, Lesaffre group). Study model

[0132] In vitro model of a polymicrobial biofilm comprising five different bacterial species mimicking a canine dental biofilm, namely Neisseria zoodegmatis CCUG 52598T, Corynebacterium canis CCUG 58627T, Porphyromonas cangingivalis DSMZ VPB 4874, Peptostreptococcus canis CCUG 57081 and an isolate of Enterococcus faecalis. Analysis

[0133] The tests are carried out in three copies. A dental plaque biofilm was artificially created from 5 microorganisms described in the literature as being involved in periodontal disease, namely early colonizers of dental plaque such as Neisseria zoodegmatis and Corynebacterium canis, other anaerobic bacteria such as Peptostreptococcus canis, Porphyromonas cangingivalis, and a species that participates in the development of periodontal disease in dogs caused by Enterococcus faecalis. A bacterial suspension of each strain was loaded into the wells of a 96-well microplate placed on a Calgary device. A lid containing pegs, previously incubated for 2 hours in artificial canine saliva, was then added to the microplate. After 48 hours of incubation at 37°C under microaerophilic conditions, biofilm formed on the surface of the pegs. After incubation, the pegs were washed three times in 0.9% NaCl and transferred to a new microplate supplemented with each product to be tested, at a concentration of 10 times per product. The plate was then incubated for 24 hours at 37°C under microaerophilic conditions, after which the percentage of biofilm inhibition was determined by Crystal Violet staining (by determining optical density).

[0134] Results concerning the determination of biofilm density

[0135] Exposure to products 3 and 4 showed a concentration-dependent decrease in the optical density reading of crystal violet.

[0136] Product 3 exhibits biofilm inhibitory activity of approximately 19.5% (125 g / L) compared to the negative control.

[0137] Product 4 exhibits biofilm inhibitory activity of approximately 13% (50 g / L) compared to the negative control. Conclusions

[0138] Products 3 and 4 have the potential to inhibit canine biofilm.

Claims

Demands

1. Non-therapeutic use of a yeast product, or a composition comprising it, in a healthy subject, in the reduction and / or prevention of dental biofilm formation; preferably the reduction and / or prevention of dental biofilm formation by growth of periodontogenic and / or cariogenic bacteria, said yeast product being a cell wall extract of Saccharomyces cerevisiae yeast rich in P-glucans.

2. Non-therapeutic use according to claim 1, the product comprising at least 20% P-glucans, by weight per total weight of the product.

3. Non-therapeutic use according to any one of the preceding claims, the product comprising, by weight by total weight of the product: - at least 20%, preferably 20 and 30%, of P-glucans; - at least 20%, preferably 20 to 30%, of mannans; - 25% or less, preferably 10 to 25%, of proteins; and - 10% or less of glycogen.

4. Non-therapeutic use according to any one of the preceding claims, the product comprising, by weight by total weight of the product: - at least 50%, preferably from 50 to 90%, again preferably from 50 to 80%, again preferably from 50 to 70%, again preferably from 50 to 60%, of P-glucans; - 5% or less, preferably from 1 to 5%, of mannans; - 10% or less of proteins; - and 10% or less of glycogen.

5. Non-therapeutic use according to any one of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the species Tannerella forsythia.

6. Non-therapeutic use according to any one of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the genus Leptotrichia.

7. Non-therapeutic use according to any one of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the genus Porphyromonas, preferentially bacteria of the species Porphyromonas gingivalis.

8. Non-therapeutic use according to any one of the preceding claims, the periodontogenic and / or cariogenic bacteria being bacteria of the species Peptostreptococcus canis.

9. Non-therapeutic use according to any one of the preceding claims, the product being administered to a subject; preferably to a mammal; very preferably to a human, a dog or a cat.

10. Non-therapeutic use according to any of the preceding claims, the product being administered to a subject orally.

11. Non-therapeutic use according to any one of the preceding claims, the composition comprising the yeast product being selected from a food supplement or a parapharmaceutical composition.

12. Yeast product, or a composition comprising it, for therapeutic use in a subject having a disease of the oral cavity, or at risk of having one, in the reduction and / or prevention of the formation of dental biofilm; preferably the reduction and / or prevention of the formation of dental biofilm by growth of periodontogenic and / or cariogenic bacteria, said yeast product being an extract of cell walls of Saccharomyces cerevisiae yeast rich in 3-glucans.

13. The composition comprising the yeast product, for use according to claim 12, the composition being a pharmaceutical composition.