Yeast product used as a postbiotic in the field of oral hygiene and health

Abstract

The present invention relates to the field of oral hygiene and health. The invention concerns a yeast product obtained from a yeast extract, used to maintain or restore the health of the oral microbiota by reducing or inhibiting the growth of bacteria of the genus Tannerella, preferably bacteria of the species Tannerella forsythia. No figure

Description

Title of the invention: Yeast product as a postbiotic in the field of oral hygiene and health. Technical field

[0001] The present invention relates to the field of oral hygiene and health. The invention relates to a yeast product obtained from a yeast extract, or a composition comprising it, used to maintain or restore the health of the oral microbiota by reducing or inhibiting the growth of bacteria of the genus Tannerella, preferably bacteria of the species Tannerella forsythia. Technical background

[0002] In mammals, the oral cavity is a complex ecosystem, both open to the outside and the inside, inhabited by numerous microorganisms.

[0003] In humans, the oral cavity is inhabited by more than 700 detected bacterial species (see for example the articles: Marsh et al., Periodontology 2000, 2011, 55, 16-35; Paster et al., Periodontology 2000, 2006, 42, 80-87; Aas et al., J. Clin. Microbiol., 2005, 43, 5721-5732; Dewhirst et al., J. Bacteriol., 2010, 192, 5002-5017).

[0004] For example, in a single individual, the number of resident bacterial species varies from 150 to 250. Most of these species are commensal and necessary to maintain the balance of this ecosystem. However, in certain situations (for example, dietary habits, high carbohydrate intake, smoking, physiological changes such as aging, puberty, pregnancy), a disruption of this balance occurs and can lead to the development of infectious diseases of the oral cavity.

[0005] The main infectious diseases of the oral cavity in humans are dental caries and periodontal diseases.

[0006] Dental caries are polybacterial diseases characterized by demineralization of the hard tissues of the tooth. This demineralization is due to the production of acids by fermentative bacteria present within the dental biofilm. Streptococcus mutans and Lactobacillus are considered the main cariogenic bacteria. The World Health Organization (WHO) report on oral health highlights the high prevalence of caries, particularly among young people. Compared to the rest of the world, the risk of caries during childhood is much higher in developed countries (North America, Australia, Europe, Japan) due to diets very high in sugars.

[0007] Periodontal diseases are a group of pathologies affecting the periodontium, that is, the supporting tissues of the teeth—bone and gingival mucosa. These diseases are divided into two main categories: gingivitis and periodontitis. Gingivitis refers to any inflammation limited to the superficial periodontium. Periodontitis is an advanced infectious lesion of the periodontium and often follows gingivitis. The presence of certain bacteria and an intense immune response lead to the destruction of the periodontium. The transition from a healthy state to a state of periodontal disease is accompanied by a gradual shift towards a flora richer in anaerobic and Gram-negative bacteria. This phenomenon is called anaerobic drift.Among the bacterial species most frequently implicated in periodontal diseases in humans, there is the red complex composed of bacteria of the species Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. There are also, notably, bacteria of the species Fusobacterium nucleatum, whose co-aggregation with bacteria of the species Porphyromonas gingivalis appears to improve their survival and pathogenicity (see, for example, the articles: Diaz et al., Microbiology, 2002, 148, 467-472; Saito et al., FEMS Immunol. Med. Microbiol., 2008, 54, 349-355; Polak et al., J. Clin. Periodonto., 2009, 36, 406-410).

[0008] In order to prevent the onset of infectious diseases of the oral cavity, or to treat them if necessary, it is useful to maintain or restore the balance between the populations of non-pathogenic and pathogenic microorganisms present within the human oral microbiota, so as to control the formation, development, and composition of dental biofilm. Many pathogenic bacteria may be present in the oral microbiota and may stimulate the formation, development, and composition of dental biofilm, and potentially promote the occurrence of infectious diseases of the human oral cavity.

[0009] For example, bacteria of the genus Tannerella are frequently found in individuals with periodontal disease. In humans, Tannerella bacteria, particularly bacteria of the species Tannerella forsythia, form a bacterial complex with bacteria of the species Porphyromonas gingivalis and Treponema denticola, known as the "red complex." This "red complex" is strongly associated with advanced periodontal lesions. The bacteria composing the red complex express numerous virulence factors that allow them to colonize the subgingival space, disrupt the host's defense system, invade and destroy periodontal tissues, and promote the host's destructive immunosuppressive response.

[0010] There is therefore a real need to reduce or inhibit the growth of bacteria of the genus Tannerella, in particular bacteria of the species Tannerella forsythia, in the oral microbiota, avoiding the disadvantages mentioned above Summary of the invention

[0011] The invention relates to the non-therapeutic use of a yeast product, or a composition comprising it, to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight per total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.

[0012] The invention also relates to the non-therapeutic use for reducing or inhibiting the growth of Tannerella bacteria in the oral microbiota, of the combination of the yeast product as defined above with an additional yeast product comprising at least 20% P-glucans, by weight per total weight of the additional yeast product, or of a composition comprising them.

[0013] The invention also relates to a yeast product, or a composition comprising it, for therapeutic use to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.

[0014] In embodiments, the yeast product is used to reduce or inhibit the growth of bacteria of the species Tannerella forsythia.

[0015] In embodiments, the yeast product is a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.

[0016] In embodiments, the yeast product is a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight by total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.

[0017] In some embodiments, the yeast product is obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing of the yeast cream obtained by adding water and centrifugal concentration; - heating of the washed yeast cream to a temperature between 60 and 95 °C, preferably between 75 and 90 °C; - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours; - separation of yeast extract and yeast cell walls by centrifugation; - concentration of the yeast extract by evaporation and / or reverse osmosis; and - optionally drying of the concentrated yeast extract.

[0018] In embodiments, the yeast product or the combination of the yeast product and the additional yeast product, or a composition comprising it or them, is administered to mammals; preferably to humans.

[0019] In embodiments, the additional yeast product may be chosen from the group consisting of one of the following additional products, or mixtures thereof: - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 20%, preferably between 20 and 30%, of P-glucans; at least 20%, preferably between 20 and 30%, of mannans; 25% or less, preferably between 10 and 25%, of proteins; and 10% or less of glycogen; - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 50%, preferably 50 to 90%, more preferably 50 to 80%, more preferably 50 to 70%, more preferably 50 to 60%, of P-glucans; 5% or less, preferably 1 to 5%, of mannans; 10% or less of protein; and 10% or less of glycogen.

[0020] In embodiments (non-therapeutic use), the yeast product, the combination of the yeast product and the additional yeast product, or a composition comprising them, is administered to a healthy subject.

[0021] In embodiments, the yeast product or the combination of the yeast product and the additional yeast product, or a composition comprising it or them, is administered to a subject orally.

[0022] In embodiments (therapeutic use), the product, or a composition comprising it, is administered to a subject with a disease of the oral cavity, or at risk of having one.

[0023] In some embodiments, the composition comprising the yeast product or the combination of the yeast product and the additional yeast product is selected from a food supplement or a parapharmaceutical composition. In some embodiments, the composition comprising the yeast product is a pharmaceutical composition.

[0024] The inventors have surprisingly demonstrated that the yeast product, optionally in combination with additional yeast products, reduces or inhibits the growth of Tannerella bacteria in the oral microbiota. These bacteria, along with bacteria of the species Porphyromonas gingivalis and Treponema denticola, form a bacterial complex known as the "red complex," which is strongly associated with advanced periodontal lesions. The yeast product, optionally in combination with additional yeast products, or the composition including them, is particularly interesting in that it can be used in healthy subjects (non-therapeutic use) or in subjects with oral cavity disease, or at risk of having one (therapeutic use), these two subject populations being distinct. Detailed description

[0025] The invention is now described in more detail and in a non-limiting manner in the following description. Definitions

[0026] By “Saccharomyces cerevisiae yeast strain”, we mean a relatively homogeneous population of Saccharomyces cerevisiae yeast cells obtained by culture (or multiplication) of the starting strain.

[0027] The term "oral microbiota" refers to all microorganisms, particularly bacteria, present in the oral cavity. The terms "oral microbiota," "buccal microbiota," "human oral microbiota," "dog and cat mouth microbiota," "oral cavity microbiota," "oral flora," and "oral flora" may be used interchangeably. The microorganisms present in the oral microbiota can be non-pathogenic or pathogenic. The balance between non-pathogenic and pathogenic microorganism populations thus determines, from a clinical and biological perspective, whether the oral microbiota is healthy or not.Des microorganismes présent peuvent être, par exemple, les baccteria appartant au genre Actinomyces, Actinomycetemcomitans, Aggregatibacter, Alloprevotella, Alloscardovia, Anaeroglobus, Atopobium, Bacteroides Bifidobacterium, Capnocytophaga, Catonella, Corynebacterium, Dialister, Eggerthia, Eubacteria, Fusobacterium, Haemophilus, Lachnoanaerobaculum, Leptotrichia, Mogibacterium, Moryella, Neisseriaceae, Olsenella, Oribacterium, Parvimonas, Peptoniphilus, Peptostreptococcus, Propionibacterium, Porphyromonas, Prevotella, Rikenellaceae, Ruminococcaceae, Selenomonas, Shuttleworthia, Slackia, Solobacterium, Stomatobaculum, Streptococcus, Tannerella, Treponema ou Veillonella. Pathogenic microorganisms are for example: Tannerella forsythia (T. forsythia), Porphyromonas gingivalis (P. gingivalis), Treponema denticola (T. denticola), Porphyromonas cangingivalis (P. cangingivalis), Porphyromonas gulae (P. gulae), Porphyromonas endodontalis (P. endodontalis), Prevotella intermedia (P.intermedia), Streptococcus mutans (S. mutons) and Streptococcus sobrinus (S. sobrinus). Non-pathogenic microorganisms include, for example: Streptococcus oralis (S. oralis), and Streptococcus mitis (S. mitis).

[0028] The term “biofilm” refers to the film formed on the surface of teeth and oral mucosa, for example the mucosa of the tongue, gums, palate, and cheeks, by the oral microbiota. The terms “biofilm,” “dental biofilm,” “dental plaque,” ​​“polymicrobial biofilm,” and “polymicrobial film” may be used interchangeably.

[0029] By "paradante" we mean all the supporting tissues of the tooth, the gums, the bone tissue, the cementum and the periodontal ligament.

[0030] The term "infectious disease of the oral cavity" refers to a medical condition located in the oral cavity (mouth) that results from infection by a pathogenic microorganism. Infectious diseases of the oral cavity include, but are not limited to, dental caries and periodontal diseases.

[0031] By “dental caries” or “cavity”, we mean an infectious disease of the tooth, which causes damage to the enamel, dentin and / or cementum (pulp).

[0032] By “periodontal health” is meant the absence of inflammation or the presence of a low level of inflammation of an intact or reduced but stable periodontium.

[0033] Periodontal disease refers to inflammation of the tissues supporting the teeth, namely the bone and gums. These are infections caused by the accumulation of pathogenic bacteria and their toxins on the gum margins surrounding the teeth. It initially manifests as gingivitis and then, if left untreated, as periodontitis. The terms "periodontal disease" and "periodontal disease" may be used interchangeably.

[0034] The term "gingivitis" refers to inflammation of the gums, stage 1 of periodontal disease. The terms "gingivitis," "gingival disease," and "gingival inflammation" may be used interchangeably.

[0035] By “periodontitis” we mean inflammation of the deep tissues of the periodontium, stage 2 of periodontal disease.

[0036] By "postbiotic" is meant a preparation of inanimate microorganisms and / or their components which confer a health benefit to the host.

[0037] The term "treatment" means a method intended to: (1) delay or prevent the onset of a disease or clinical condition; (2) slow or stop the progression, worsening, or deterioration of disease symptoms; (3) improve disease symptoms; and / or (4) cure the disease. A treatment may be administered before the onset of the disease, for prophylactic action (referred to as "prevention"), or it may be administered after the disease has begun, for therapeutic action. In the context of the invention, the term "treatment" generically refers to the reduction and / or prevention of dental biofilm formation, particularly through the growth of periodontogenic and / or cariogenic bacteria.

[0038] By "physiologically acceptable excipient" is meant any medium or additive which does not interfere with the effectiveness of the biological activity of the active ingredient and which is not excessively toxic to the subject at the concentrations at which it is administered.

[0039] The term “pharmaceutical active ingredient” means any compound or substance the administration of which has a therapeutic effect or the administration of which has a beneficial effect on the health or general condition of a subject to whom it is administered.

[0040] Unless otherwise indicated, all percentages for stated quantities are mass percentages. For percentages of 3-glucans, these are expressed as an equivalent mass of glucose. For percentages of mannans, these are expressed as an equivalent mass of mannose. Yeast product

[0041] The yeast product is a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight per total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.

[0042] Yeast, as a living microorganism, comprises cytoplasm surrounded by a cytoplasmic membrane (also called the inner membrane or cell membrane). The cytoplasm includes intracellular compartments, including the nucleus, mitochondria, and Golgi apparatus. The cytoplasmic membrane is surrounded by a cell wall or cortex (the terms "yeast cell walls" and "yeast cortex" are used interchangeably and refer to the insoluble portion of yeast cells, i.e., the cell wall and the plasma membrane of yeast) composed mainly of P-glucans and mannans. The area between the cell membrane and the cell wall forms the periplasm (also called the periplasmic space).

[0043] The yeast product is obtained from the yeast Saccharomyces cerevisiae, and more particularly from a strain of Saccharomyces cerevisiae. Saccharomyces cerevisiae is also known as brewer's yeast or baker's yeast. Many strains of Saccharomyces cerevisiae are known in the art. They are widely used in the food industry for their role in the production of various foods, including breads and fermented beverages. A yeast strain can be obtained from a clone, a clone being a population of yeast cells obtained from a single yeast cell. The cultivation of a Saccharomyces cerevisiae strain can be carried out using any suitable method. Yeast culture methods are known in the prior art, and those skilled in the art know how to optimize the culture conditions for each strain according to its nature.Thus, a Saccharomyces cerevisiae yeast can be obtained by multiplying a strain in a culture medium. appropriate, for example, as described in the reference work "Yeast Technology", 2nd edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.

[0044] In one embodiment, the yeast product being a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.

[0045] In one embodiment, the yeast product being a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight per total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.

[0046] The protein content is measured using the Kjedhl method (6.25 times the total nitrogen). The sodium chloride content is measured using the sodium chloride method. The pH is measured at room temperature (18°C) in a solution containing 8.33% dry matter.

[0047] The yeast product may be in powder form.

[0048] The yeast product may comprise at least 94%, preferably at least 96%, by weight of dry matter per total weight of yeast product. The yeast product may comprise 100% or less, preferably 99% or less, by weight of dry matter per total weight of yeast product. Alternatively, the yeast product may comprise 40 to 60% by weight of dry matter per total weight of yeast product. For example, the dry matter content may be measured by a drying method carried out for 5 hours at 105 °C.

[0049] In one embodiment, the yeast product is soluble. By "soluble" is meant a yeast product which can be homogeneously solubilized in water at a concentration of 50 g / L, under stirring and at a temperature of 50°C, the solution comprising less than 500 mg of solid residues i.e. undissolved.

[0050] The yeast product can be obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing of the yeast cream obtained by adding water and centrifugal concentration; - heating of the washed yeast cream to a temperature between 60 and 95 °C, preferably between 75 and 90 °C; - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours; - separation of yeast extract and yeast cell walls by centrifugation; - concentration of the yeast extract by evaporation and / or reverse osmosis; and - optionally drying of the concentrated yeast extract.

[0051] The yeast product is available under the trade name Springer® 4101 / 0-PW-L from the company Biospringer by Lesaffre (Lesaffre group).

[0052] Springer® 4101 / 0-PW-L yeast product is in powder form, has a pH between 6.3 and 6.7 (8.33% solution), and comprises at least 94% by weight dry matter, less than 1% by weight sodium chloride, 7.5 to 9.0% by weight total nitrogen, 46.9 to 56.3% by weight protein (nitrogen x 6.25), and 18 to 22% by weight ash (excluding sodium chloride) by total weight of the product. Additional yeast products

[0053] The yeast product according to the invention can be used in combination with at least one additional yeast product.

[0054] The additional yeast product is an extract of cell walls of Saccharomyces cerevisiae yeasts rich in P-glucans, preferentially rich in P-1,3 / Pl,6-glucans (P-1,3 / Pl,6-glucans).

[0055] By "rich in β-glucans" is meant a product comprising at least 20% β-glucans by weight per total weight of the product. The additional yeast product may comprise from 20 to less than 30%, alternatively from 30 to less than 40%, alternatively from 40 to less than 50%, alternatively from 50 to less than 60%, alternatively from 60 to less than 70%, alternatively from 70 to less than 80%, alternatively from 80 to less than 90%, alternatively at least 90%, β-glucans, by weight per total weight of the additional yeast product.

[0056] P-glucans originating from the yeast cell wall are called "cell wall glucans". These P-glucans are essentially glucose polymers in which the glucose units of the main chain are linked by P-1,3 bonds and the branches are linked by P-1,6 bonds. P-glucans are insoluble and have low viscosity.

[0057] Mannans from the cell wall of yeasts are called "cell wall mannans." These mannans are polysaccharides composed mainly of mannose, more precisely of copolymers of neutral or acidic sugars (with 5 or 6 carbon atoms), linked together by glycosidic bonds and associated with proteins. In the cell wall mannans of Saccharomyces cerevisiae, mannose is present as a skeleton of mannose residues (50 or more) linked by α-(1,6), branched by short chains of mannose linked by α-(1,2) and α-(1,3).

[0058] In one embodiment, the additional yeast product may comprise, by weight per total weight of the additional yeast product: - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of P-glucans; - 5% or less, preferably between 1 and 5%, of mannans; - 10% or less protein; and - 10% or less glycogen.

[0059] This additional yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the additional yeast product.

[0060] P-glucans and mannans may be present in a (weight / weight) ratio of 12 to 40, preferably 15 to 30, very preferably 18 to 22.

[0061] For example, a product of this type is disclosed in application WO 2023194609 Al published on October 12, 2023.

[0062] In one embodiment, the additional yeast product may comprise, by weight per total weight of the additional yeast product: - at least 20%, preferably between 20 and 30%, of P-glucans; - at least 20%, preferably 20 to 30%, of mannans; - 25% or less, preferably 10 to 25%, of protein; and - 10% or less of glycogen.

[0063] This additional yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the additional yeast product.

[0064] For example, a product of this type is disclosed in international application WO 2020152229 Al published on July 30, 2020.

[0065] The additional yeast product can be obtained from any process that yields a product rich in P-glucans.

[0066] The additional yeast product corresponds to the insoluble fraction of the yeast. The insoluble fraction can be obtained by conventional production processes. The production process can be a biochemical and / or a mechanical process. For example, the mechanical process can be carried out with glass beads, a high-pressure homogenizer, ultrasound, or microwaves. For example, the biochemical process can be carried out by autolysis, thermal plasmolysis, enzymatic hydrolysis, osmotic shock, or repeated freezing and thawing cycles. In particular, the process can include the following steps: autolysis or enzymatic hydrolysis of the whole yeast; then separation of the insoluble fraction and removal of the soluble fraction; and optionally, drying of the soluble fraction.The soluble fraction is conventionally called "yeast extract" and includes the majority of amino acids including the acid. glutamic acid, peptides, and minerals. The insoluble fraction includes yeast cell walls, polymers, polysaccharides, nucleotides, and thermocoagulated proteins. Conventional production methods are disclosed in the reference work "Yeast Technology," 2nd edition, 1991, by G. Reed and T.W. Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8. Uses

[0067] The present invention relates to the use of a yeast product as a postbiotic in the field of oral hygiene and health. Indeed, the yeast product selectively inhibits the growth of host microorganisms, thus conferring a health benefit.

[0068] The yeast product is used to reduce or inhibit the growth of bacteria of the genus Tannerella, in particular the bacterium of the species Tannerella forsythia, in the oral microbiota.

[0069] The action of the yeast product on reducing or inhibiting the growth of bacteria of the genus Tannerella, in particular the bacterium of the species Tannerella forsythia, makes it possible to maintain or restore the good health of the oral microbiota and therefore to prevent or treat infectious diseases of the oral cavity, in particular periodontal diseases.

[0070] The use of the yeast product, in particular its therapeutic or non-therapeutic use, depends on the subject to whom it is administered.

[0071] If the subject is in good health, the yeast product may be administered to maintain the subject's well-being, in particular to maintain satisfactory oral hygiene. This is a non-therapeutic use of the yeast product. The yeast product may be formulated as a food supplement, a parapharmaceutical composition, or any other suitable non-therapeutic form.

[0072] If the subject has an infectious disease of the oral cavity, or is at risk of developing one, the yeast product may be administered to prevent, limit, or treat the disease. This is a therapeutic use of the yeast product. The yeast product may be formulated as a pharmaceutical composition or any other suitable therapeutic form.

[0073] The method according to the invention can be used to treat a first episode of infectious disease of the oral cavity, in particular gingivitis or periodontitis, or a recurrence.

[0074] The yeast product can be administered alone. Alternatively, the product can be administered with another yeast product as defined above. Alternatively, the yeast product can be administered with another therapy, for example, an antibiotic or an antiseptic. Alternatively, the yeast product can be administered with another prebiotic, probiotic and / or postbiotic product. Alternatively, the yeast product can be administered in combination with a mechanical or surgical procedure, including scaling, root planing, curettage, filling, restoration or devitalization. Topics

[0075] The yeast product can be administered to a subject. The subject may already have an infectious disease of the oral cavity, or is at risk of developing one. When the subject has such a disease, the term "patient" may be used interchangeably.

[0076] The yeast product can be administered to a human. This can be a human of any age, including newborns, children, adolescents, adults and the elderly. Effective quantity

[0077] Use to reduce or inhibit the growth of bacteria of the genus Tannerella (and the corresponding method of treatment and / or prevention) includes administering an effective amount of the yeast product to a subject. The effective amount, which may be administered in one or more doses, may be determined by the physician, dentist, or other appropriate person. The exact amount to be administered may vary from subject to subject, depending on the species, age, weight, general condition of the subject, the absence or presence of an infectious disease of the oral cavity, and if so, its nature, severity, and / or extent. The effective amount may also vary depending on the desired therapeutic effect (reduction and / or prevention of dental biofilm formation). Form of administration

[0078] The yeast product can be administered as such or in the form of a preparation or composition.

[0079] The yeast product can be administered as a food supplement to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The food supplement can be in the form of a lozenge, a candy, chewing gum, an orodispersible powder, a powder to be diluted in water in the form of a stick or sachet, a lozenge or chewable tablet, chewing gum, a capsule, a tablet, a biscuit, a sweet, drops, or a bottle with a dosing cap.

[0080] The yeast product can be administered in the form of a parapharmaceutical composition to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of The species Tannerella forsythia. The parapharmaceutical composition may be in the form of sachets, powders, capsules, softgels, dental pastes, gummies or gels.

[0081] The yeast product can be administered as a pharmaceutical composition to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The pharmaceutical composition may be available by prescription or over the counter. The pharmaceutical composition may be administered using any combination of dosage and route of administration effective in achieving the desired therapeutic or prophylactic effect. The effective amount to be administered may vary from one individual to another, depending on the species, age, weight, general condition of the individual, the absence or presence of an infectious disease of the oral cavity, and, if applicable, its nature, severity, and / or extent, etc.

[0082] The pharmaceutical composition may be intended for topical administration or for oral administration.

[0083] The pharmaceutical composition may include a physiologically acceptable excipient. A physiologically acceptable excipient may be an excipient suitable for administration to mammals, in particular humans.

[0084] The pharmaceutical composition may include at least one additional pharmaceutical active ingredient having soothing, anti-irritant, analgesic, analgesic, anti-inflammatory, healing, antibiotic, antipyretic or antifungal activity.

[0085] The pharmaceutical composition may include at least one additive, for example an additive selected from the group consisting of preservatives, sweeteners, flavorings, thickening agents, colorings, humectants, disintegrating agents, absorption accelerators, lubricating agents, and mixtures thereof.

[0086] The pharmaceutical composition may be in any form suitable for administration to a subject, preferably a mammal, most preferably a human, a dog or a cat.

[0087] The pharmaceutical composition may be in the form of tablets, pills, dragees, capsules, pearls, syrups, emulsions, ointments, pastes, gels, powders, sachets or injectable solutions.

[0088] The yeast product, optionally in combination with an additional yeast product, or the composition comprising it, can be administered by incorporation into a dental medical device comprising the yeast product, as defined above, to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The dental device can be a dental implant, a dental crown, a dental bridge, a dental onlay, or a dental prosthesis. Examples

[0089] The following example illustrates the invention without limiting it.

[0090] Study of the effects of the yeast product Springer® 4101 / 0-PW-L on the Tannerella forsythia population with an in vitro human oral biofilm model

[0091] Preparation of the in vitro human oral biofilm model: For each culture, dental plaque was collected from four to seven patients with periodontal disease by brushing their teeth, followed by mouthwash. The dental biofilm samples were transferred to an anaerobic chamber immediately after collection and then pooled. An artificial saliva culture medium (modified McBain medium) was prepared extemporaneously for each culture and pre-reduced under anaerobic conditions. The culture was performed in twelve-well plates placed on a rotating platform at 37°C under anaerobic conditions. Glass coverslips, placed vertically in the wells, were used as a substrate for the attachment of the dental biofilm. The culture medium was replaced every three days. The cultures were performed in triplicate.

[0092] Yeast product to be tested: Springer® 4101 / 0-PW-L yeast product marketed by Biospringer by Lesaffre (Lesaffre Group). This yeast product, in powder form, has a pH between 6.3 and 6.7 (8.33% solution) and comprises at least 94% by weight of dry matter, less than 1% by weight of sodium chloride, 7.5 to 9.0% by weight of total nitrogen, 46.9 to 56.3% by weight of protein (nitrogen x 6.25), and 18 to 22% by weight of ash (excluding sodium chloride) by total weight of the product. The yeast product was dissolved in demineralized water and sterilized by filtration.

[0093] Quantities of yeast product tested: The yeast product was tested at two different concentrations, namely 5 g / L and 10 g / L.

[0094] Analysis of the composition of bacteria of the genus Tannerella by quantitative polymerase chain reaction (PCR) (method): The population of bacteria of the species Tannerella forsythia was determined by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR (qPCR) method with the following 5'-3' primers: GACTGTCAGTTGCTAACAGGTAAAGCT (p 192) CCAACCTTCCTCACAGCTTACG (pl93) ACTCTGGCGGGACTG (pl94) qPCR was performed using the "RT PCR master mix" (Diagenode, Seraing, B) with the "Applied Biosystems 7500 RT PCR System" for 45 cycles and with a denaturation step at 95°C for 15 seconds, then a hybridization / elongation step at 60°C for 1 min. A standard curve was established by analysis of the genomic DNA of the tested species.

[0095] Analysis of the composition of Tannerella bacteria by quantitative polymerase chain reaction (PCR) (results): The presence of Tannerella forsythia bacteria in the dental biofilm was measured by qPCR. The results obtained are reported in Table 1 below:

[0096] [Tables 1] Yeast product concentration T. forsythia abundance (gene abundance) 5 g / L 2.8 x 10⁻³ 10 g / L 4.8 x 10⁻¹ 0 g / L (control) 1.7 x 10⁻⁵

[0097] Conclusion: The yeast product has the potential to inhibit the growth of bacteria of the species Tannerella forsythia.

Claims

Demands

1. Non-therapeutic use of a yeast product, or a composition comprising it, in a healthy subject, to reduce or inhibit the growth of bacteria of the genus Tanner ella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.

2. Non-therapeutic use according to claim 1, the yeast product being used to reduce or inhibit the growth of Tannerella forsythia bacteria.

3. Non-therapeutic use according to any one of the preceding claims, the yeast product being a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.

4. Non-therapeutic use according to any one of the preceding claims, the yeast product being a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight by total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.

5. Non-therapeutic use according to any one of the preceding claims, the yeast product being obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing the yeast cream obtained by adding water and centrifugal concentration; - heating the washed yeast cream to a temperature between 60 and 95°C, preferably between 75 and 90°C; - incubating the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, under stirring, for a period of 1 to 5 hours; - separation of yeast extract and yeast cell walls by centrifugation; - concentration of yeast extract by evaporation and / or reverse osmosis; and - optionally drying of the concentrated yeast extract.

6. Non-therapeutic use according to any of the preceding claims, the yeast product being administered to mammals; preferably to humans.

7. Non-therapeutic use, in a healthy subject, to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, preferably to reduce or inhibit the growth of Tannerella forsythia bacteria, of the combination of the yeast product according to any of the preceding claims with an additional yeast product comprising at least 20% P-glucans, by weight per total weight of the product, or of a composition comprising them.

8. Non-therapeutic use according to claim 8, the additional yeast product being selected from the group consisting of one of the following additional products, or mixtures thereof: - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 20%, preferably between 20 and 30%, of P-glucans; at least 20%, preferably between 20 and 30%, of mannans; 25% or less, preferably between 10 and 25%, of proteins; and 10% or less of glycogen; - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 50%, preferably between 50 and 90%, again preferably between 50 and 80%, again preferably between 50 and 70%, again preferably between 50 and 60%, of P-glucans; 5% or less, preferably 1 and 5%, of mannans; 10% or less of protein; and 10% or less of glycogen.

9. Non-therapeutic use according to any one of claims 7 or 8, the combination of yeast products being administered to mammals; preferably to humans.

10. Non-therapeutic use according to any one of the preceding claims, the yeast product or the combination of the yeast product and the additional yeast product, or a composition comprising the or them, being administered to a subject orally.

11. Non-therapeutic use according to any one of the preceding claims, the composition comprising the yeast product or the combination of the yeast product and the additional product being selected from a food supplement or a parapharmaceutical composition.

12. Yeast product, or a composition comprising it, for therapeutic use in a subject with, or at risk of having, a disease of the oral cavity, to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, preferentially to reduce or inhibit the growth of Tannerella forsythia bacteria, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.

13. The composition comprising the yeast product, for use according to claim 13, the composition being a pharmaceutical composition.