Infectious plant rhabdovirus vectors and use of same for non-transgenic genome editing in plants

Abstract

Provided are a method for using a plant rhabdovirus vector to perform site-directed modification on plant chromosomal DNA, and a viral vector composition. Also provided is a method for performing editing on plant genome target DNA, said method not requiring a selectable marker gene, and comprising the following steps: using a plant rhabdovirus vector system to infect a plant and express a sequence-specific nuclease, the sequence-specific nuclease targeting a genome target site of the infected plant and cleaving the target site, and a DNA repair mechanism of the plant completing site-directed editing of the target site.

Description

FIELD OF THE DISCLOSURE The present disclosure belongs to the field of plant genetic engineering and relates to methods for targeted genome editing in plants with plant virus vectors and, more particularly, but not exclusively, to the use of recombinant negative-stranded RNA rhabdovirus vectors for in planta delivery of CRISPR / Cas nuclease to achieve non-transgenic targeted genome editing in plants. BACKGROUND OF THE DISCLOSURE Recent developments in the field of targeted genome editing offer great prospects in functional genomics and precision crop trait improvement in a variety of plant species including wheat, rice, and maize. The targeted genome editing technology relies on the sequence-specific nucleases (SSNs) composed of sequence-specific DNA-binding domains and a non-specific DNA cleavage module. Once an SSN is introduced into a cell, the programmable DNA binding domain specifically binds to a target sequence in the genome and directs the nuclease domain to generate a DNA double-strand break (DSB). DSB activates the endogenous DNA repair machinary to repair the DSBs, either through non-homologous end joining (NHEJ), which leads to the insertion or deletion of nucleotides, or through homologous recombination (HR), which can cause targeted DNA insertion or gene replacements. Common sequence-specific nucleases include Zinc-finger nucleases (ZFNs), Transcription activator-like effector nucleases (TALENs), and Clustered regularly interspaced short palindromic repeats / CRISPR associated proteins (CRISPR / Cas). Compared with ZFNs and TALENs, the CRISPR / Cas nucleases are the most widely used systems owing to its simplicity and high efficiency. The key step in plant genome editing is the delivery of SSN reagents into plant cells. SSNs can be delivered in the form of either nucleic acid constructs encoding SSNs, or protein / preassembled ribonucleoprotein complex. The ideal SSN delivery technique may meet the following requirements: i) the capacity to deliver the entire SSN components into recipient plant tissues; 2) the recipient plant materials are readily available and the delivery process is easy to perform; 3) the ability to induce targeted genome modification with high efficiency; 4) mutant plants without exogenous genetic sequence can be readily obtained from the recipient plant materials. Conventionally, SSNs such as CRIPSR / Cas nucleases are introduced into a plant cell in the form of DNA through stable transformation methods such as Agrobacterium infection and biolistic bombardment where transgene encoding CRIPSR / Cas nuclease is integrated into the plant chromosome. The SSN is then expressed from the transgene and induces targeted genetic modifications. The transgene-based SSN delivery approaches show several limitations. Many crop species and / or cultivars are recalcitrant to stable transformation. Also, transgene integration occurs randomly and may cause unanticipated chromosome changes or damage. Although the transgene can be segregated out after gene editing is complete, this process is time consuming and tedious, especially for plant with long breading cycle or polyploidy genome. Segregation of transgene by sexual reproduction is infeasible for vegetatively propagated plants. Furthermore, stable transformation may trigger administrative burden in countries with stringent regulation on genome-edited plants. Given the drawbacks of transgenic delivery methods, it is highly desirable to establish a non-transgenic CRIPSR / Cas nuclease delivery method. Plant viral vector is a promising tool for delivery and transient expression of genetic cargo into cells. Fully infectious viral vectors can spread from inoculated cells or tissues to non-inoculated cells or tissues and achieve systemic delivery. Infectious RNA viral vectors are of special value in transgene-free SSN delivery because RNA virus replication does not involve a DNA phase and do not integrate into the host chromosome. However, the large size of CRISPR / Cas nuclease expression cassette (up to 5-7 kb) poses a great challenge to the packaging capacity of the currently available plant viral vectors. Insertion of large genetic cargo exceeding the packaging limits of the viral vector results in either failure in systemic infection or purging of the foreign fragments (Avesani et al., Transgenic Res, 2007, 16: 587 -597). Due to the limited carrying capacity, infectious plant virus vectors have been used to deliver the small size SSN components such as CRISPR guide RNA (~100-nt). The list of these virus vectors include the DNA virus cabbage leaf curl virus (Yin et al., Sci Rep, 2015, 5: 14926), the positive-stranded RNA viruses tobacco rattle virus (Ali et al., Mol Plant, 2015, 8: 1288-1291; WO 2015189693), tobacco mosaic virus (Cody et al., Plant Physiol, 2017, 175: 23-35), pea early browning virus (Ali et al., Virus Res, 2018, 244: 333-337), beet necrotic yellow vein virus (Jiang et al., Plant Biotechnol J, 2019, 17: 1302-1315). In these cases, the Cas9 protein provided from transgenic plants form a complex with the virus-delivered guide RNA to implement target gene editing. Thus, mutant plants obtained using this approach contain a Cas9 transgene. Mei et al. (Plant Direct, 2019, 3: 1-16) discloses the engineering of a foxtail mosaic virus (FoMV) vector, a positive single-stranded RNA (ssRNA) virus belonging to genus Potexvirus, for transient gene expression and single RNA delivery. Their study showed that the FoMV vector failed to stably maintain a green fluorescent protein (GFP) gene of —720 bp in upper leaves of systemically infected plants. The FoMV-based vector was therefore used to deliver CRISPR guide RNA (100-nt) and achieved targeted gene editing in Cas9 transgenic plants. Zhang et al. (Funct & Integr Genomics, 2020, 20: 471-477; Patent CN 111979262 A) also discloses the method of FoMV-based CRISPR / Cas9 delivery system. Due to the limited packaging capacity, two separated FoMV vectors was used to express the Cas9 protein and guide RNA, achieving low mutagenesis efficiency. Potato X virus (PVX) vector has a carrying capacity of less than 2 kb (Larsen et al., BMC Biotech, 2012, 12: 21; Avesani et al., Transgenic Res, 2007, 16: 587-597). Airga et al. (Plant Cell Physiol, 2020, 61: 1946-1953) discloses a method for delivering CRISPR / Cas nuclease using the PVX vector. Although CRISPR / Cas nuclease was successfully expressed in the agroinoculated leaves, systemic delivery of CRISPR / Cas nuclease in non-inoculated leaf tissues was not reported or suggested. Viral replicon vectors retain the elements for viral replication but lack the packaging and / or movement elements. Replicon vectors can replicate efficiently but do not infect plants systemically and have a much larger cargo capacity. Baltes et al. (Plant Cell, 2014, 151-163) discloses the delivery of CRISPR / Cas nucleases using a geminivirus replicon derived from bean yellow dwarf virus (BeYDV). Wang et al (Mol Plant, 2017, 10: 1007-1010; Chinese patent CN 109880846 A) discloses the delivery of CRISPR / Cas nucleases and DNA repair templates using a wheat dwarf virus (WDV) replicon. However, due to the lack of systemic infectivity, these replicon-based vectors are dependent on Agrobacterium-mediated transformation or biolistic bombardment to be introduced into the transformed plant cells; thus integration of exogenous DNA into the plant genome can hardly be avoided. In light of the shortcomings of currently developed plant viral vectors, there is a need for infectious plant viral vectors capable of systemic delivery of the CRISPR / Cas reagents, particularly infectious RNA virus vectors whose replication do not involve a DNA phase. Members in the family Rhabdoviridae are negative-stranded RNA viruses. Wang et al. (PLoS Pathog, 2015, 11: e 1005223) and Pat. CN 105039388 B disclose a method for genetic manipulation of sonchus yellow net virus (SYNV). Pat. CN 105039388 B discloses SYNV-based vector and method for expression of heterologous nucleic acids (e.g. GFP and P-glucuronidase fusion protein), but systemic delivery of larger foreign genes (e.g. Cas nuclease) for DNA-free genome editing has not been reported. Gao et al. (New Phytol, 2019, 223: 2120-2133; Pat. CN 110511955 A) discloses the engineering of a barley yellow striped mosaic virus (BYSMV) vector for systemic reporter gene in wheat, but this vector failed to mediate systemic delivery of the large CRISPR-Cas nuclease in N.benthamiana and wheat, or in insect vector planthoppers. In summary, to date the use of plant viral vectors for systemic delivery of CRISPR / Cas nuclease to introduce DSBs in plant genomes was not demonstrated. SUMMARY OF THE DISCLOSURE In order to overcome the current technical difficulties in transgene-free plant genome editing using viral vectors. The present disclosure provides the infectious recombinant rhabdovirus and the method of virus-mediated non-transgenic genome editing in plants. The infectious recombinant rhabdovirus vectors deliver the sequence-specific nuclease into the plant cells to generate DNA double-strand break (DSB) in the target sequence. Modifications of the genetic material of plant cell are achieved through the cellular DNA repair mechanisms. Further, the recombinant plant rhabdovirus vectors are capable of infecting plants systemically and expressing sequence-specific nucleases in infected cells. The target sequence in infected plant cells is modified without insertion of exogenous nucleic acid sequences in plant genome. Furthermore, a genetically modified, non-transgenic plant can be obtained from plant cells with targeted sequence modifications. According to one aspect of the present disclosure, there is provided a method for modifying the genetic material of a plant cell without integrating exogenous sequences into the genome of said plant cells, comprising: a) providing at least one plant cell comprising the genetic material to be modified; b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease targets specific sequence in said plant genome and the target site sequence is modified by the said nuclease through the cellular DNA repair mechanisms. Preferably, following step b), the method further comprises step c) selecting a plant cell with modified genetic material, wherein said selection occurs without the use of a selectable marker. According to another aspect of the present disclosure, there is provided a method for generating a plant containing modified genetic material without integrating exogenous sequences into the genome of said plant comprising: a) providing at least one plant cell comprising the genetic material to be modified; b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease targets specific sequence in said plant genome and the target site sequence is modified by said nuclease; c) obtaining a plant from said plant cell with modified genetic material and selecting a plant having a modification in said target site sequence, wherein selection occurs without the use of a selectable marker. According to another aspect of the present disclosure, there is provided a method for generating callus containing modified genetic material without integrating exogenous sequences into the genome of said plant comprising: a) providing at least one plant cell comprising the genetic material to be modified; b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease targets specific sequence in said plant genome and the target site sequence is modified by said nuclease; c) obtaining callus from said plant cell with modified genetic material and selecting callus having a modification in said target site sequence, wherein selection occurs without the use of a selectable marker. According to some embodiments of the disclosure, wherein said infection of plant cell by a rhabdovirus vector is performed through natural virus spread from inoculated cells to non-inoculated cells, virus sap inoculation, plant grafting, insect vector transmission, or any other means to initiate virus infection. According to another aspect of the present disclosure there is provided an infectious recombinant plant rhabdovirus vector, comprising at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease is transiently expressed in plant cells infected by said virus vector and targets specific sequence in the genome of infected cells, and wherein said target site sequence is modified by said nuclease. Wherein said recombinant rhabdovirus is capable of systemic infection and is preferably sonchus yellow net virus (SYNV) or eggplant mottled dwarf virus (EMDV). According to some embodiments of the disclosure, the genome sequence of said sonchus yellow net virus as set forth in SEQ ID NO:38, and said eggplant mottle dwarf virus as set forth in SEQ ID NO:39. According to some embodiments of the disclosure, the infectious recombinant rhabdovirus vector contains one or more mutations and / or deletions, and preferably contains one or more mutations and / or deletion in the viral glycoprotein gene. According to some embodiments of the disclosure, the one or more mutations and / or deletion of the viral glycoprotein gene is deletion or substitution of the N-terminal domain of the glycoprotein gene, thereby producing a virus vector derivative capable of systemic infection of plant hosts but unable to be transmitted by insect vector. According to some embodiments of the disclosure, the one or more mutations and / or deletion of the viral glycoprotein gene is substitution of the N-terminal domain of the glycoprotein for a heterologous nucleic acid sequence such as fluorescence protein gene. According to some embodiments of the disclosure, the modification of a plant cell comprises insertion of at least one nucleotide, deletion of at least one nucleotide, substitution of at least one nucleotide, or combinations thereof. According to some embodiments of the disclosure, the sequence-specific nuclease is CRISPR / Cas nuclease, TALEN nuclease, Zinc finger nuclease or any nuclease that can achieve genome editing, and preferably, CRISPR / Cas nuclease, and more preferably, Streptococcus pyogenes CRISPR / Cas9 nuclease (SpCas9, SEQ ID NO: 19) or Lachnospiraceae bacterium CRISPR / Cpfl nuclease (LbCpfl, or known as LbCasl2a, SEQ ID NO: 18). According to some embodiments of the disclosure, the polynucleic acid sequence encoding the sequence-specific nuclease encodes a single or multiple guide RNAs and a Cas protein. According to some embodiments of the disclosure, the single or multiple guide RNAs include the sequence complementary to the targeted genomic DNA sequence, and the sequence binds to Cas nuclease to form a complex. According to some embodiments of the disclosure, the polynucleic acid sequence encoding the sequence-specific nuclease is inserted in the rhabdovirus genome as an independent transcription unit. According to some embodiments of the disclosure, expression of said sequence-specific nuclease is driven by viral cis-elements responsible for viral mRNA transcription. According to some embodiments of the disclosure, expression of guide RNA and Cas protein is directed by a single engineered transcription unit in the virus vector genome. According to some embodiments of the disclosure, expression of guide RNA and Cas protein is directed by separate transcription units in the virus vector genome. According to some embodiments of the disclosure, the guide RNA is processed from primary viral transcript by the cellular tRNA processing machinery to remove virus-derived terminal sequence. According to some embodiments of the disclosure, the guide RNA is processed from primary viral transcript by Cas polypeptide to remove virus-derived terminal sequence. According to some embodiments of the disclosure, the guide RNA transcript is processed by Cpf 1 nuclease. According to some embodiments of the disclosure, the plant is selected from the natural or experimental hosts of plant rhabdoviruses, and preferably from the hosts of the sonchus yellow net virus or eggplant mottle dwarf virus. According to some embodiments of the disclosure, the plant is Nicotiana benthamiana. According to some embodiments of the disclosure, the plant is Solanum tuberosum. According to some embodiments of the disclosure, the plant is Solanum Lycopersicum. According to some embodiments of the disclosure, the plant is Nicotiana tabacum. According to some embodiments of the disclosure, the plant is Solanum melongena, Cucumis sativus, Hydrangea macrophylla, Cucumis melo, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana edwardsonii, Capsicum annuum, Chenopodium amaranticolor, Chenopodium quinoa, Datura metel, Hibiscus rosa-sinensis, Lonicera, Solanum nigrum, Sonchus oleraceus, Lactuca sativa, hybrids of Nicotiana glutinosa and Nicotiana clevelandii, Zinnia elegans, Bidens pilosa, or Chenopodium quinoa. According to another aspect of the present disclosure, there is provided genetically modified plants, and progeny thereof, produced by the methods or infectious rhabdovirus vectors disclosed in this disclosure. According to another aspect of the present disclosure, there is provided the infectious recombinant rhabdovirus vector, either in the form of recombinant nucleic acid constructs, bacterial strains containing the constructs, or recombinant virus particles. According to another aspect of the present disclosure, there is provided applications of the method or rhabdovirus vector disclosed in the present disclosure in plant genome editing. DESCRIPTION OF EMBODIMENTS The following definitions and methods are provided to better define the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood be one of ordinary skill in the art. As used herein, the term “plant” encompasses whole plants, ancestors and progeny of the plants and plant parts. The plant parts include differentiated and undifferentiated tissues including, but not limited to, plant cells, cell suspensions, cells in the process of forming callus, tissues, callus tissue, meristematic regions, organs (e.g., pollens, embryos, flowers, fruits, shoots, leaves, roots, stems and explants), seeds (e.g., mature seeds, immature seeds, and immature embryos). The term “plant cell” as used herein refers to individual units of a living plant, either in an intact whole plant or in an isolated form grown in vitro tissue cultures, on media or agar, in suspension in a growth media or buffer or as a part of higher organized units, such as, plant tissue, a plant organ, or a whole plant. The term “plant cell” as used herein also encompasses plant protoplasts. The term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to a cell. Generally, a vector is capable of autonomous replication when associated with proper control elements. One type of vector is a “plasmid”, which refers to a circular double stranded DNA, into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. The terms “recombinant virus vector”, “recombinant viral expression vector”, “recombinant virus clone” are used interchangeably herein and refer to a nucleic acid vector including nucleic acid encoding for viral genes or parts of viral genes and non-viral exogenous nucleic acid sequences. Viral vectors also capable of autonomous replication in a host cell, tissue and organ into which they are introduced and directing the expression of non-viral exogenous nucleic acid sequences to which they are operatively linked. The terms “infectious viral expression vector”, “fully infectious virus vector” or “infectious clone” are used interchangeably herein and refer to the virus capable of systemic infection and systemic introduction and expression of non-viral exogenous nucleic acid sequences in targeted cell, tissue and organ. In contrast, “viral replicon vector” refer to defective viral vector retaining the elements necessary for viral replication but lacking the packaging and / or movement and / or infection elements. Plant viral replicon vectors can replicate efficiently but do not infect plants systemically and are dependent on biological (e.g., Agrobacterium-mediated transformation) or mechanical means (e.g., biolistic bombardment) to be introduced into a host plant cell. The terms “exogenous” or “heterologous” refer to sequences from alien species or, if from the same species, sequences that have undergone significant changes in composition and / or locus from their natural form through deliberate intervention. The term “genetic material” refers to material that transmits genetic information between parents and offspring. The terms “modified nucleotide” or “modified genetic material” refer to a nucleotide sequence of interest that comprises at least one alteration when compared to the non-modified nucleotide sequence. Such alterations included, but not limited to an insertion of at least one nucleotide, a deletion of at least one nucleotide, a substitution of at least one nucleotide, or the combination thereof. The terms “nucleic acid” “nucleic acid molecule” and “nucleic acid sequence” are used interchangeably and include single- or double- stranded DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), and naturally occurring, mutated, synthetic DNA or RNA molecules, and analogs of DNA or RNA. Such nucleic acids include, but not limited to, coding sequences, antisense sequences, and non-coding regulatory sequences. The terms “gene” or “gene sequence” refer to a DNA nucleic acid associated with a biological function, include introns and exons in genomic sequence, or coding sequences, and / or regulatory sequences. The term “sequence-specific nuclease” refers to a programable nuclease that cleaves specific target site. The sequence-specific nuclease included, but not limited to, Maganuclease, Zinc finger nuclease (ZFN), Transcription activator-like effector nucleases (TALEN), and CRISPR / Cas nuclease, etc. Zinc-finger nucleases are fusions of the non-specific DNA cleavage domain from the FokI restriction endonuclease with Zinc-finger proteins. ZFN dimers induce targeted DNA double-strand breaks (DSBs) that stimulate DNA damage response pathways. The binding specificity of the designed zinc-finger domain directs the ZFN to a specific genomic site. TALEs are naturally occurring proteins from the plant pathogenic bacteria genus Xanthomonas, and contain DNA-binding domains composed of a series of 33-35 amino acid repeat domains that each recognizes a single base pair. Like zinc-fingers, modular TALE repeats are linked together to recognize contiguous DNA sequences and induce targeted DSBs that activate DNA damage response pathways. The terms “CRISPR / Cas nuclease”, “CRISPR nuclease”, and “Cas nuclease” are used interchangeably and refer to the nucleases from the CRISPR / Cas system, the variants (such as nickase mutants and inactivated mutants, etc.), and the derivatives fused with functional proteins. The terms encompass any nucleases in the CRISPR / Cas system that can achieve genome editing. As used herein, the terms “single guide RNA” or “guide RNA” or “gRNA” or “sgRNA” refer to a polynucleotide comprising any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and to direct the sequence-specific nuclease to the target nucleic acid sequence. In the case of the CRISPR / Cas9 system, the guide RNA is a combination of a crRNA fragment and a tracrRNA fragment. The crRNA fragment at least comprises a sequence complementary with the sequence of the target DNA region and a sequence capable of interacting with the tracrRNA fragment to form a double-stranded RNA. The double-stranded RNA thus formed interacts with the Cas9 protein and guides it to the target DNA region. The crRNA fragment and the tracrRNA fragment can be fused to be expressed as a single molecule. On the other hand, in the case of the CRISPR / Cpfl system, the guide RNA means the crRNA fragment and the tracrRNA fragment is unnecessary. The Cpf 1 protein is guided to the target DNA region by interaction of the crRNA fragment with the Cpfl protein. Beside the double-strand endonuclease activity, the Cpfl protein also contains an RNase activity that is responsible for cleaving crRNA precursor to generate mature crRNA. The terms “target site”, “target sequence”, “target DNA”, “genomic target sequence”, “genomic target site” are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, coding or non-coding sequences, genes, exons, introns, regulatory sequences, intergenic sequences, synthetic sequences, and intracellular parasitic sequences, etc. The term “delivery” refers to the introduction of a nucleic acid sequence and / or encoded polypeptides into the targeted cell, tissue, organ, or organism. The methods of delivery included, but not limited to, biolistic bombardment, protoplast transformation, Agrobacterium-mediated transformation, rubbing inoculation, vacuum infiltration, high-pressure spraying, chemical delivery, etc. The terms “transfer RNA” or “tRNA” are used interchangeably and refer to the molecule with a cloverleaf structure that acts as temporary carries of amino acids, bringing the appropriate amino acids to the ribosome based on the messenger RNA nucleotide sequence. In nucleoplasm, the tRNA precursors are cleaved at specific sites in eukaryotes by RNase P and RNase Z to remove 5' and 3' extra sequences, respectively. In some embodiments of the disclosure, the tRNA sequence is chosen from the 77-bp long pre-tRNAGly gene which is disclosed in the PCT Publication NO. WO2016061481. The term “tissue culture” refers to a method of biological research in which fragments of tissue from plant are transferred to an artificial environment in which they can continue to survive and finally obtain the entire regenerated plant. The said fragments of tissue may consist of a single cell, a population of cells, protoplast, a whole or part of an organ, etc. The terms “gene editing”, “genome editing”, “targeted gene editing”, “targeted genome editing”, “targeted mutation” are used interchangeably and refer to the specific introduction of a knock-out, edit, or knock-in at a particular DNA sequence, such as in a chromosome or plasmid of a cell. In general, gene editing can be performed herein by cleaving one or both strands at a specific DNA sequence in a cell with sequence-specific nuclease. Such DNA cleavage, if form a double strand break, will induce NHEJ or HDR processes which can lead to modifications at the target site. As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure provided a method for modifying the genetic material of a plant cell without integrating exogenous sequences into the genome of said plant cells, comprising: a) providing at least one plant cell that comprise the genetic material to be modified; b) introducing into said plant cell an infectious recombinant rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease. Wherein said modifying the genetic material of plant cell is conducted by said sequence-specific nuclease mediating specific cleavage in the target sequence of the plant genome, and achieved through the endogenous DNA repair machinary in plants. Preferably, following step b), the method further comprises step c) selecting a plant cell with modified genetic material, wherein said selection occurs without the use of a selectable marker. The present disclosure provided a method for modifying the genetic material of a plant containing modified genetic material without integrating exogenous sequences into the genome of said plant comprising: a) providing at least one plant cell comprising the genetic material to be modified; b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease targets specific sequence in said plant genome and the target site sequence is modified by said nuclease; c) obtaining a plant from said plant cell with modified genetic materialandselecting a plant having a modification in said target site sequence, wherein selection occurs without the use of a selectable marker. The present disclosure provided a method for generating callus containing modified genetic material without integrating exogenous sequences into the genome of said plant comprising: a) providing at least one plant cell comprising the genetic material to be modified; b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease targets specific sequence in said plant genome and the target site sequence is modified by said nuclease; c) obtaining callus from said plant cell with modified genetic material andselecting callus having a modification in said target site sequence, wherein selection occurs without the use of a selectable marker. Examples of nuclease which can be used according to the present teaching includes, but are not limited to, restriction enzymes, Meganuclease, homing nuclease, TALEN nuclease, ZFN nuclease, preferably CRISPR / Cas nuclease. In some embodiments, the sequence-specific nuclease is CRISPR / Cas nuclease. Non-limiting examples of CRISPR / Cas proteins include Cas9 (such as SpCas9 or SaCas9), Cpfl (also known as Casl2a, such as AsCpfl, LbCpfl or FnCpfl), CasX or CasY, homologues thereof, or modified versions thereof (such as espCas9, nCas9, dCas9, adenine base editor, cytosine base editor, or prime editor), etc. In some embodiments, the sequence-specific nuclease is SpCas9 nuclease from Streptococcus pyogenes (SEQ ID NO: 19) or LbCpfl nuclease from Lachnospiraceae bacterium (SEQ ID NO: 18). Moreover, useful examples of nuclease which includes percent sequence identity of about at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. The term “sequence identity” or “identity” in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. In some embodiments, the polynucleic acid sequence encoding the sequence-specific nuclease contains the sequence encoding a Cas9 protein and at least a guide RNA (gRNA), the latter of which has a spacer sequence sharing sufficient complementarity with a target genomic DNA sequence and a Cas9-recruiting sequence to direct the nuclease complex to the target sequence. The guide RNA sequence is typically 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleotides long, and preferably is 20 nucleotides. In some embodiments, the polynucleic acid sequence encoding the sequence-specific nuclease contains the sequence encoding a Cpfl protein and proteinand at least a at least a crRNA, the latter of which has a spacer sequence sharing sufficient complementarity with a target genomic DNA sequence and a Cas9-recruiting sequence to directs the nuclease complex to the target sequence. The crRNA sequence is typically 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleotides long, and preferably is 23 nucleotides. It is understood to the person skilled in the art that the sequence encoding the Cas protein can be optimized in order to obtain more efficient expression of Cas nucleases in certain host species, and examples of codon optimization for specific host species are feasible. Codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently used in the genes of that host cell while maintaining the native amino acid sequence. In some embodiments, the Cas9 coding sequence is tobacco codon optimized (oCas9; SEQ ID NO: 36); In some embodiments, the Cpfl coding sequence is rice codon optimized (SEQ ID NO: 18). One or more codons (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a Cas9 or Cpfl nuclease correspond to the most frequently used codon for a particular amino acid in N. benthamiana or rice, respectively. The sequence-specific nuclease can further contain one or more subcellular localization domains. The one or more subcellular localization domains may include, without limitation, nuclear localization signal (NLS), mitochondrial targeting signal, or chloroplast targeting signal. In some embodiments, the subcellular localization domain is SV40 nuclear localization signal. Typically, an NLS consists of one or more short sequences of positively charge lysines or arginines exposed on the protein surface, but other types of NLS are known. The nuclease can comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs at or near the amino-terminus, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs at or near the carboxy-terminus, or a combination of these (e.g. one or more NLS at the amino-terminus and one or more NLS at the carboxy-terminus). In some embodiments, the SV40 NLSs are present at the amino-terminus and carboxy -terminus of the nuclease simultaneously. The present disclosure provided infectious recombinant plant rhabdovirus vectors, comprising at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein said sequence-specific nuclease is transiently expressed in plant cells infected by said virus vector and targets specific sequence in the genome of infected cells, and wherein said target site sequence is modified by said nuclease. Rhabdoviruses are single-stranded, negative-sense RNA (NSR) viruses belonging to the family Rhabdoviridae. NSR viruses have unsegmented or segmented genomes that are complementary to their messenger RNAs and infect a wide range of hosts, including mammals, insects and plants. NSR viruses with unsegmented genomes are classified in a large order Mononegavirale, consisting of the Paramyxoviridae, Filovirida, Nyamiviridae, Bornaviridae, Rhabdoviridae, Mymonaviridae, Nyamiviridae and Sunviridae Families. NSR viruses with segmented genomes comprise members of Bunyavirales, consisting of the Bunyaviridae, Feraviridae, Fimoviridae, Hantaviridae, Jonviridae, Nairoviridae, Peribunyaviridae, Phasmaviridae, Phenuiviridae, Tospoviridae, and of the unassigned Arenaviridae, Aspiviridae, Orthomyxoviridae. Members in the family Rhabdoviridae, referred to as rhabdoviruses, have bullet-shaped or bacilliform particles and infect animals and plants. Animal-infecting rhabdoviruses include, but not limited to, members in the genus Lyssaviru, Vesiculovirus, Ephemerovirus and Novirhabdovirus. Plant-adapted members in the Rhabdoviridae are classified into four genera including Nucleorhabdovirus, Cytorhabdovirus, Varicosavirus, and Dichorhavirus. Members in Nucleorhabdovirus include, but not limited to, SYNV, EMDV, maize fine streak virus (MFSV), maize Iranian mosaic virus (MIMV), maize mosaic virus (MMV), potato yellow dwarf virus (PYDV), wheat yellow striate virus (WYSV), rice yellow stunt virus (RYSV), taro vein chlorosis virus (TVCV), black currant-associated rhabdovirus (BCARV), and datura yellow vein virus (DYW). Members in Cytorhabdovirus include, but not limited to, rice stripe mosaic virus (RSMV), northern cereal mosaic virus (NCMV), maize yellow striate virus (MYSV), and barley yellow striate mosaic virus (BYSMV). Members in the Varicosavirus include, but not limited to, alopecurus myosuroides varicosavirus (AMW), lettuce big vein associated virus (LBVaV) and red clover varicosavirus (RCVV). Members in the Dichorhavirus include, but not limited to, orchid fleck virus (OFV), citrus leprosis virus (CiLV) and citrus chlorotic spot virus (CCSV). Rhabdovirus genome encodes five conserved structural proteins, including the nucleoprotein (N), the phosphoprotein (P), the matrix protein (M), the glycoprotein (G) and laige RNA polymerase (L), organized in the order 3'-N-P-M-G-L-5'. The minimal infectious unit of the rhabdovirus is the ribonucleoprotein core complex (RNP) which consists of genomic single-stranded RNA that is tightly encapsidated by the N protein and associated with the L proteins. The RNP also includes the P protein, a cofactor of the L polymerase. The M protein functions to coil the RNP into condensed structure during virion morphogenesis and act in concert with G protein in virus budding. In addition to the five conserved proteins, many rhabdoviruses encode accessory genes interspersed between the N-P, P-M, M-G, or G-L genes. The genome of plant rhabdoviruses contains one or more accessory gene postulated to encode a movement protein, such as SYNV sc4, which are generally located between the P and M genes. Common elements of all rhabdoviruses genomes consist of 3' leader (le) and 5' trailer (tr) sequences flanking five viral structural protein genes that are separated by gene junction sequences. Generally, the gene junction sequences consist of three essential cis-elements, i.e. the Gene-End elements that signal transcription termination and polyadenylation of upstream mRNAs, the Gene-Start elements for initiation of downstream mRNAs transcription and a non-transcribed intergenic region located between the Gene-End and Gene-Start elements. Transcription of the rhabdovirus genome is facilitated by a transcriptase complex and occurs progressively on a decreasing molar gradient based on gene distance from the genomic 3' end. The virus firstly transcribes the leader RNA, and subsequently transcribes each gene from 3' to 5'. The transcription is initiated with a specific consensus sequence and terminated at each gene junction region by iterative slippage on a poly-U tract that generates the poly-A tail. The transcripts are capped and methylated at their 5' end and polyadenylated at their 3' end by the L protein. Based on the feature of modular genome structures and discontinuous transcription, the rhabdoviruses are well suited for engineering viral expression vectors by inserting foreign genes into well-defined transcription units. It is worth noting that when engineering rhabdovirus as an expression vector, it is necessary to follow the transcriptional strategy of the virus. The exogenous nucleic acid sequence inserted in the viral genome should be flanked by transcriptional regulatory element, i.e., the gene junction region, to constitute an independent transcription unit. To engineer an extra transcription unit containing the foreign nucleic acid sequence to be expressed from a rhabdovirus vector, the foreign sequence is placed downstream of a duplicated gene junction sequence that contains cis-elements required for viral mRNA transcription, and the engineered transcription unit is inserted into viral genome. The gene junction region sequence that are duplicated to foreign gene expression can be the ones between the leader region and the N gene, or between the N and P genes, or between the P and M genes, or between the M and G genes, or between the G and L genes, or between the L gene and trailer region, or an engineered one derived from the above native ones. The Cas and gRNA / crRNA expression cassettes can be constructed separately as two independent transcription units or as a single independent transcription unit in a rhabdovirus vector for co-expression. In some embodiments, the polynucleic acid sequences encoding the Cas / Cpfl protein and gRNA / crRNA are controlled by two separated transcription units. In some embodiments, the polynucleic acid sequences encoding the Cas9 nuclease and guide RNA are linked by a connecting sequenceand controlled by the same transcription unit. The connecting sequence, includes but not limited to, RNA processing elements such as hammerhead ribozyme, hairpin ribozyme, hepatitis delta virus ribozyme, VS ribozyme, class I introns, or RNase P, tRNA sequences, Csy4 sequences, or other liker sequence. In one embodiment, the recombinant infectious plant rhabdovirus vector is selected from sonchus yellow net virus (SYNV). The complete genome sequence of an SYNV isolate from sonchus is shown in SEQ ID NO: 38, consisting of 13726 nucleotides and encode 6 proteins in the order 3'-N-P-sc4-M-G-L-5'. SYNV can infect various plants such as lettuce or tobacco. The gene junction sequences of SYNV consist of a conserved 16-nucleotide region which is necessary for regulation of mRNA transcriptional. Preferably, when engineering an extra transcription unit into the SYNV genome, a complete gene junction region, such as a complete N / P gene junction sequence. It is contemplated that the extra transcription units can be inserted into different sites within the SYNV genome, such as between the SYNV leader and the N gene, between the N and P genes, between the P and sc4 genes, between the sc4 and M genes, between the M and G genes, between the G and L genes, or between the L gene and the trailer region.. In some embodiments, the CRISPR / Cpfl expression cassettes were inserted into SYNV genome between the leader region and the N gene driven by the native leader / N gene junction sequence and / or a duplicated N / P gene junction sequence. In other embodiments, the CRISPR / Cas9 expression cassettes were inserted between the N and P genes driven by two duplicated N / P gene junction sequences. In a second embodiment, the recombinant infectious plant rhabdovirus vector is selected from is eggplant mottled dwarf virus (EMDV). The complete genome sequence of EMDV isolated from the eggplant is shown in SEQ ID NO: 39. EMDV can naturally infect various plants such as cucumber, hydrangea, eggplants, potato, tobacco, or tomato plants. The EMDV genome consists of 13155 nucleotides and encode 7 proteins in the order 3'-N-X-P-Y-M-G-L-5'. Preferably, when engineering an extra transcription unit into the EMDV genome, a complete gene junction region, such as the complete leader / N gene junction or the N / X gene junction sequence, can be used to drive the foreign gene expression. It is contemplated that the extra transcription units can be inserted into different sites within the EMDV genome, such as between the EMDV leader and the N gene, between the N and X genes, between the X and P genes, between the P and Y genes, between the Y and M genes, between the M and G genes, between the G and L genes, or between the L gene and the trailer region. In certain specific embodiments, the CRISPR / Cas9 expression cassettes were inserted between the N and X genes driven by two duplicated N / X gene junction sequences. Whereas the capped and polyadenylated mRNA transcribed by rhabdoviruses are ideal for Cas protein expression in plant cells, the gRNA transcript would contain virus-derived sequences at both termini that impede gRNA activities. In some embodiments of the present disclosure, the recombinant rhabdovirus vectors expressing the Cas9 protein and an unprocessed gRNA, resulted in relatively low mutagenesis frequency of 20% at the target site in virus infected tissues. In more advantageous embodiments of the present disclosure, to obtain authentic gRNA transcripts, the gRNA sequence was flanked by RNA processing elements, such as the pre-tRNAGly precursor sequences to form a configuration of “tRNA-gRNA-tRNA (tgtRNA)”, which can be recognized by the plant endogenous tRNA processing machinery to release the authentic gRNA. The recombinant SYNV- and EMDV-tgtRNA-Cas9 vectors (e.g., SYNV-tgtGFP2-Cas9 and SYNV-tgtGFP2-Cas9) resulted in mutagenesis frequencies of over 90% at the target site in virus infected tissues. Common RNA processing elements include, but are not limited to, ribonucleases (hammerhead nuclease, hairpin nuclease, hepatitis D nuclease, VS nuclease, class I introns, RNase P, etc.), tRNA sequences, Csy4 sequences, etc. One of the primary advantages of the present methods of rhabdovirus vector-mediated delivery of CRISPR / Cas nucleases according to the disclosure is its amenability to multiplexing. To express more than one gRNA and a Cas protein using SYNV vectors, two gRNAs were engineered in transcription units in a configuration of “tRNA-gRNAl-tRNA-gRNAl-tRNA (tgtgtRNA)”, and the two gRNAs were released through cleavage by endogenous tRNA processing enzymes. In some specific embodiments, the SYNV-tgtgtRNA-Cas9 vectors with two gRNAs simultaneously targeting two endogenous genes RNA-dependent RNA Polymerase 6 (RDR6) and Suppressor of Gene Silencing 3 (SGS3) in N. benthamiana achieved high mutagenesis frequencies comparable to those induced by SYNV-tgtRNA-Cas9 vectors with a single tRNA at specific target loci. The ability to express of multiple gRNAs by rhabdovirus vectors also permits targeting of more than one sites in a specific gene or chromosome for chromosomal fragment deletion. In a specific embodiment, an SYNV-tgtgtRNA-Cas9 vector with two gRNAs targeting two juxtaposed sites in the N. benthamiana Phytoene Desaturase (PDS) gene, achieved chromosomal fragment deletion efficiencies of 34-48%. In contrast to CRISPR / Cas9, Cpfl simultaneously possesses RNAase and DNAase activities and processes a pre-crRNA to yield a mature crRNA with a 19-nt repeat region (DR) and a 23-nt spacer (guide sequence). In certain embodiments of the present disclosure, the crRNA transcription units within the SYNV genome consist of a guide sequence flanked by two DR sequence elements to form a configuration of “DR-guide-DR”, such that the primary crRNA transcripts would be processed by co-expressed Cpfl protein to release a mature crRNA sequence. Such SYNV-crRNA-Cpfl vectors carrying individual crRNA targeting the crGFP-1 or -2, or crPDS-1 or -2 sites, achieved targeted mutagenesis frequencies of up to 90%. The CRISPR / Cpfl system is particularly amenable to mulplexed expression of crRNA due to the self-processing of pre-crRNA by the co-expressed Cpfl enzyme. In a specific embodiment, a recombinant SYNV-based vector with two tandemed crRNAs in the configuration of “DR-guide 1-DR-guide 2-DR”, namely SYNV-crGFP-l / PDS-l-Cpfl, which targets N. benthamiana PDS gene and the GFP transgene. This vector results in mutagenesis frequency of 81% and 82% at the GFP and PDS target sites, respectively, in virus infected tissues. A concern in applications of the rhabdovirus-based CRISPR / Cas9 vectors is the virus insect transmissibility, which may result in inadvertent escape from laboratory leading to biosafety issues. The rhabdovirus G protein is type I membrane protein consisting of a signal peptide (SP), an N-terminal domain (NT), a transmembrane domain (TM), and a C-terminal domain (CT). In the mature enveloped virions of rhabdovirus, G protein forms a trimer and is embedded on the surface of the virus particle, with the NT domain exposed on the virion surface. G protein binds to specific receptor in the insect vector cells through the NT domain and mediates virus entry, thus are indispensable for insect transmission. In certain embodiment, an infectious recombinant SYNV vector is further provided in which the native glycoprotein genecontains a truncation of the N-terminal domain. In another embodiments, the infectious SYNV vector contains a recombinant glycoprotein gene with the NT domain being replaced with a heterologous protein such as a fluorescent reporter gene mCherry. Both recombinant vector derivatives infected the plant systemically without compromising the abilities to induce targeted genome editing. Therefore, these biocontainable vectors with one or more mutations and / or deletion and / or substitution in the glycoprotein gene are ideal for laboratory uses. It is to be understood that using the system and methods of the disclosure, the SYNV and EMDV isolates derived from other hosts, can also be engineered to deliver nuclease reagents. Furthermore, it is contemplated that the system and methods of this disclosure can be used to engineer other plant rhabdovirus species for delivery of nuclease reagents, given the conserved genome structure and replication strategy of rhabdoviruses. The present disclosure also provided a method of obtaining a plant cells with modified genetic material by using recombinant rhabdovirus vector to deliver sequence-specific nuclease into the plant cells. Further, the present disclosure also provided a method for generating a plant having the modified genetic material without integrating exogenous sequences into the genome of said plant, comprising: a) providing at least one plant cell that comprise the genetic material to be modified; b) introducing into said plant cell an infectious recombinant rhabdovirus vector harboring at least one polynucleic acid sequence encoding the sequence-specific nuclease; c) obtaining a plant from said plant cell with modified genetic material; and d) selecting plant containing modified genetic material, wherein said selection occurs without the use of a selectable marker. In some embodiments of the present disclosure, the recombinant rhabdovirus vector is SYNV. In some embodiment, the recombinant rhabdovirus vector is EMDV. In some embodiment of the present disclosure, the sequence-specific nuclease is SpCas9 nuclease. In some embodiment, the sequence-specific nuclease is LbCpfl nuclease. The methods of infecting plants with rhabdovirus refer to any method known in the art, including but not limited to, biolistic bombardment, protoplast transformation, Agrobacterium-vaQAiateA transformation, rub inoculation, vacuum infiltration, high-pressure spraying, heterografting. In some embodiments of this aspect in the present disclosure, systemic infection of a plant is initiated by agroinoculation of rhabdovirus vectors where Agrobacterium mixtures carrying the DNA constructs containing the infectious rhabdovirus vectors were agroinfiltrated into the lower leaves of a plants. Infectious viruses were recovered from the infiltrated leaves and spread systemically to upper non-inoculated part of the plants into which no DNA constructs have been introduced. In another embodiment of the present disclosure, infection of a plant with achieved by rub inoculation with infectious sap derived infected plants. In another embodiment of the present disclosure, infection of a plant with achieved by high-pressure spaying with infectious sap derived infected plants. In another embodiment of the present disclosure, infection of a plant with a recombinant rhabdovirus vector is a recombinant rhabdovirus vector is a recombinant rhabdovirus vector is achieved by grafting of a healthy plant onto an infected plant. Using the viral vectors and methods in the disclosures, it is possible to obtain with high efficiencies the non-transgenic plants from symptomatic systemic leaves of rhabdovirus vector-infected plants through micropropagation. The regenerated plants with targeted gene modifications are selected, where the selection is performed without the use of a selection marker. In some embodiments, the selection is made by Sanger sequencing of target sites; in some embodiments, the selection is made by genotyping of target site by enzyme digestion. The genetic modifications are stably passed to at least the next two generations following classic Mendelian laws. Thus, the methods and infectious recombinant rhabdovirus vector in this disclosure also provided a method to produce progeny of the genetically modified plants. Any host of plant rhabdovirus can be used, including nionocot and dicot plants. Examples of plants include, but not limited to, Graminea, Solanaceae, Fabaceae, Cucurbitaceae, Compositae, Amaranthaceae, Chenopodiaceae, and Caprifoliacea. Such plants include, but not limited to, Nicotiana tabacum, Nicotiana benthamiana, Solanum tuberosum, Triticum aestivum, Glycine max, Zea mays, Oryza sativa, Coffea spp., Lycopersicon esculentum, Lactuca sativa, Sonchus oleraceus, Zinnia elegans, Bidens pilosa, Chenopodium quinoa, Solanum melongena, Cucumis sativus, Hydrangea macrophylla, Cucumis melo, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana edwardsonii, Capsicum annuum, Chenopodium amaranticolor, Chenopodium quinoa, Datura metel, Hibiscus rosa-sinensis, Lonicera, Solanum nigrum, etc. In some embodiments, the plant is Nicotiana benthamiana. In some embodiments, the plant is Nicotiana tabacum. In some embodiments, the plant is Solanum Lycopersicum. In some embodiments, the plant is Solanum tuberosum. The present disclosure also provided the construct and bacterial strain harboring the recombinant rhabdovirus vectors, and recombinant rhabdovirus vectors virions. The present disclosure also provided the applications in plant genome editing with the method or recombinant rhabdovirus vectors. The present disclosure offers several advantages over commonly used genome editing approaches: 1) The recombinant rhabdovirus vectors have an unprecedented cargo capacity amongst plant virus vectors known to date and are capable of carrying heterologous polynucleic acid sequences encoding for guide RNA and Cas nuclease. 2) Virus replication-driven abundant gRNA and Cas9 expression benefits efficient mutagenesis of target DNA sequences. 3) Guide RNA sequences transcribed from these rhabdovirus vectors are precisely processed and are therefore not limited to the first base being G or A as was the case with those produced U6 or U3 promoter. 4) The recombinant rhabdovirus vector can express a variety of nucleases which recognize distinct PAM sequences to broaden the applications in different target sites. 5) Multiplexed gene editing is readily achieved with these recombinant rhabdovirus vectors. 6) The extraordinary stability of recombinant rhabdovirus vector permits mechanical passage of progeny virus to numerous plants. 7) Target site modifications in regenerated plants are transmissible to next generations in the absence of virus vector or transgene. BRIEF DESCRIPTION OF THE DRAWINGS FIG 1 depicts engineering of a SYNV dual reporter gene expression vector. FIG 1A is a diagram showing the genome structure of the SYNV-GFP-RFP vector. Bsu36I and Nhel are unique restriction sites located in the N gene and P gene, and N / P J represents the N / P gene junction that is duplicated to drive reporter gene expression. FIG IB are pictures showing GFP and RFP fluorescence in N. benthamiana plants inoculated with SYNV-GFP and SYNV-GFP-RFP. FIG IC is a picture showing virus symptoms in N. benthamiana plants infected with SYNV-GFP and SYNV-GFP-RFP. FIG ID are Western blot images showing the expression of virus structural proteins, GFP and RFP proteins. FIG 2 are diagrams showing engineering strategy of SYNV CRISPR / Cas9 vectors. FIG 2A are diagrams showing the genome structure of the SYNV-Cas9, SYNV-gRNA-Cas9, and SYNV-tgtRNA-Cas9 vectors. Bsu36I, Nhel, AhdI are unique restriction sites located in the N gene, P gene, and Cas9 gene, respectively. N / P J, N / P gene junction; gRNA, guide RNA; tgtRNA, tRNAGly -gRNA-tRNAGly fusion. FIG 2B is a diagram showing viral transcription of gRNA. The gRNA transcript contains virus-derived non-coding regions, i.e., 5' UTR, 3' UTR sequences and a polyA tail. FIG 2C is a diagram showing that the primary tgtRNA transcripts are precisely processed by plant endogenous RNase P and RNase Z to release the gRNA with authentic ends. FIG 3 are images depicting systemic infection and expression of CRISPR / Cas9 nuclease by engineered SYNV vectors. FIG 3A is a serial of images showing GFP-transgenic N. benthamiana 16c plants infected with recombinant SYNV-Cas9, SYNV-tgtGFPl-Cas9, SYNV-tgtGFP2-Cas9 vectors, or mock-inoculated. GFP expression was visualized under UV ultraviolet light (middle panels) and confocal microscope (lower panels). The infected plants were photographed at 15 days post systemic infection. FIG 3B are Western blot images showing the expression of SYNV structural proteins, Cas9, and GFP protein in infected plants. FIG 3C are electron microscopic images showing the virion morphology of SYNV wild type (V-WT) and SYNV-tgtGFPl-Cas9 (V-tgtGFPl-Cas9). The length of the virions (n = 20) and their genome size are indicated below the images. FIG 4 are pictures illustrating mutagenesis of the GFP sites in N. benthamiana 16c plants infected by the SYNV CRISPR / Cas9 vector. FIG 4A depicts a PCR / RE assay for the detection of mutagenesis frequency. + / -, with / without restriction digestion; Indel (%), percentage of undigested PCR products per total PCR products. FIG 4B depicts Sanger sequencing analysis of mutation patterns and frequencies. WT, wild-type sequence; d#, deletion of # bases; x#, the number (#) of clones with identical sequence. FIG 4C shows Sanger sequencing chromatograms. FIG 5 depicts effect of gRNA processing on mutation efficiency. FIG 5A are diagrams illustrating the principle of circular reverse transcription PCR (cRT-PCR). FIG 5B depicts detection of cRT-PCR products. FIG 5C depicts a PCR / RE assay for detection of targeted mutagenesis efficiency. FIG 5D shows the sequences of the processed gRNA derivatives and the Sanger sequencing chromatograms. FIG 6 shows targeted mutagenesis of the endogenous PDS gene loci in N. benthamiana with SYNV-delivered CRISPR / Cas9 nuclease. FIG 6A are diagrams illustrating the gene structure of PDSa and PDSb homoeologs. The sequences of the three target sites (gPDSl, gPDS2, and gPDS3; SEQ ID NOs: 21, 30 and 31) are shown, with restriction sites underlined and the protospacer adjacent motif (PAM) indicated. FIG 6B shows N. benthamiana plants infected with recombinant SYNV-tgtRNA-Cas9 vectors targeting gPDSl, gPDS2, and gPDS3 at 50 days after inoculation. FIG 6C depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; WT / U or WT / D, PCR product of the wild-type plants either undigested (U) or digested (D) with corresponding restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. FIG 6D shows the target site sequences of cloned amplicons determined by Sanger sequencing, d#, deletion of # bases; i#, insertion of # bases; x#, the number (#) of clones with identical sequence. FIG 7 shows targeted mutagenesis o£RDR6 loci in A. benthamiana by SYNV-delivered CRISPR / Cas9 nuclease. FIG 7A are diagrams showing the gene structure of RDR6a and RDR6b homoeologs. The sequences of two target sites (gR6-l and gR6-4, SEQ ID NOs: 22 and 32) are shown, with restriction sites underlined and the protospacer adjacent motif (PAM) indicated. FIG 7B shows N. benthamiana plants infected with recombinant SYNV-tgtRNA-Cas9 vectors targeting gR6-l and gR6-4 at 50 days after inoculation. FIG 7C depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; WT / U or WT / D, PCR product of the wild-type plants either undigested (U) or digested (D) with corresponding restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. FIG 7D shows the target site sequences of cloned amplicons determined by Sanger sequencing, d#, deletion of # bases; i#, insertion of # bases; r#, replacement of # bases; x#, the number (#) of clones with identical sequence. FIG 8 shows targeted mutagenesis of SGS3 loci in N. benthamiana by SYNV-delivered CRISPR / Cas9 nuclease. FIG 8A are diagrams showing the gene structure of SGS3a and SGS3b homoeologs. The sequences of two target sites (gS3-l and gS3-2, SEQ ID NOs: 23 and 33) are shown, with restriction sites underlined and the protospacer adjacent motif (PAM) indicated. FIG 8B shows N. benthamiana plants infected with recombinant SYNV-tgtRNA-Cas9 vectors targeting gS3-l and gS3-2 at 50 days after inoculation. FIG 8C depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; WT / U or WT / D, PCR product of the wild-type plants either undigested (U) or digested (D) with corresponding restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. FIG 8D shows the target site sequences of cloned amplicons determined by Sanger sequencing, d#, deletion of # bases; i#, insertion of # bases; x#, the number (#) of clones with identical sequence. FIG 9 is a schematic illustration of an SYNV CRISPR / Cas9 vector for tandem expression of two gRNAs in a tRNA-gRNAl-tRNA-gRNA2-tRNA configuration. The primary tgtgtRNA transcripts are processed by the endogenous tRNA processing enzymes RNase P and RNase Z, resulting in generation of two gRNA species with authentic ends. FIG 10 shows simultaneous mutagenesis of RDR6 and SGS3 loci in N. benthamiana by SYNV-delivered CRISPR / Cas9 nuclease with two gRNAs. FIG 10A are pictures showing N. benthamiana plants infected with recombinant SYNV-tgtgtRNA-Cas9 vectors at 50 days after inoculation. FIG 10B depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; WT / U or WT / D, PCR product of the wild-type plants either undigested (U) or digested (D) with restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. FIG 10C shows the target site sequences of cloned amplicons determined by Sanger sequencing, d#, deletion of # bases; i#, insertion of # bases; r#, replacement of # bases; x#, the number (#) of clones with identical sequence. FIG 11 depicts chromosome deletions of PDS loci by SYNV-delivered CRISPR / Cas9 nuclease. FIG 11A shows symptoms of N. benthamiana plants infected with SYNV-tgtgtPDSl / 3-Cas9 at 50 days after inoculation. FIG 11B shows PCR detection of chromosomal fragment deletions at targeted loci in three separate plants infected with SYNV-expressing Cas9 nuclease targeting gPDS-1 and -3 sites (SEQ ID NOs: 21 and 31). The red arrowhead indicates PCR products corresponding to the deletion fragment, and Del (%) denotes the deletion frequency. FIG 11C shows representative sequences with chromosomal deletions aligned with the wild-type sequences of PDSa (left) and PDSb (right). FIG 12 depicts phenotypes and genotypes of M0 plants regenerated from SYNV-tgtPDSl-Cas9-infected leaf tissues. FIG 12A shows phenotypic appearance of shoots regenerated on MS medium from young leaf tissues of N. benthamiana plants infected with SYNV-tgtPDSl-Cas9. The pictures show regenerated shoots on MS media plate (left), an albino plantlet (middle) and a green plantlet (right) on rooting medium. FIG 12B shows PCR / RE genotyping of 30 representative M0 plants. Mutations were identified by Hinfl digestion of PCR products amplified from independent M0 lines with primers specific for both PDS homoeologs. Mock / U and Mock / D represent a mock-infected plant without or with restriction digestion, and M denotes a 500-bp ladder DNA marker. The red arrowhead denotes fragments resistant to enzyme digestion. FIG 12C shows RT-PCR detection for the presence of SYNV (virus). Detection of actin mRNA serves as internal controls. Mock denotes a healthy plant as a negative control, and M denotes marker. FIG 13 depicts phenotypic segregation patterns in Ml progeny derived from M0 lines tetra-allelic for the gPDSl site (SEQ ID NO: 21). The left picture shows Ml seedlings exhibiting phenotype segregation ratio in accordance with 3:1 (M0-8) or 15:1 (MO-22). The Table on the right summarizes the segregation ratio of Ml progeny derived from the 11 normal M0 lines tetra-allelic for PDS. Altered PDSa / b homoeoalleles are denoted by a or b, respectively, with functional alleles containing in-frame deletions in green. P values were calculated using a chi-squared test of goodness-of-fit to a segregation ratio of either 3:1 (one functional PDS homoeoallele) or 15:1 (two functional PDS homoeoalleles). P > 0.5, in very good agreement with theoretical segregation ratios. FIG 14 depicts genotype inheritance of CRISPR / Cas9-induced gPDSl modifications from M0 to M2 generations. FIG 14A shows the phenotype and genotype of M0-8 plant. FIG 14B and 14C shows the genotyping of Ml (FIG 14B) and M2 (FIG 14C) progeny by PCR / RE assay. 10 Ml plants derived from M0-8 plant and 10 M2 plants derived from MO-8-9 plant, each including 5 albino and 5 normal plants, were genotyped. The target site mutations of two randomly selected plants are shown on the right. FIG 15 are images illustrating RT-PCR detection of SYNV-CRISPR / Cas9 in Ml plants derived from 8 representative MO lines. RT-PCR was performed with total RNA samples using SYNV specific primers and actin primers as a control. An SYNV-infected plant sample serves as a positive control. M, 1-kb ladder DNA marker. FIG 16 depicts off-target analysis of the SYNV CRISPR / Cas9 genome editing system. FIG 16A is a table showing potential off-target (OT) sites of the gPDSl. The sequences of the OT sites are shown, with Hinfl restriction site underlined and the protospacer adjacent motif (PAM) indicated. FIG 16B depicts detection of the possible mutations in these OT sites by PCR / RE assay with either T7 endonuclease 1 (T7E1) and / or Hinfl endonucleases. FIG 17 shows evaluation of the genetic stability of SYNV CRISPR / Cas9 progeny virus after passage in N. benthamiana plants by mechanical inoculation. FIG 17A shows N. benthamiana plants mechanically inoculated with SYNV-Cas9 or SYNV-tgtGFPl-Cas9 saps at 50 days after inoculation. FIG 17B are Western blot images showing the expression of SYNV structural proteins, Cas9, and GFP protein in infected tissues. FIG 17C shows RT-PCR detection of the gRNA and Cas9 gene inserts in progeny virus genome. Detection of actin mRNA serves as internal controls. Mock denotes a healthy plant as a negative control, and M denotes a DNA ladder marker. FIG 17D are images showing PCR / RE assay to determine targeted mutation frequencies in mechanically inoculated plants. Lane V-tgtGFPl-Cas9 represents 3 randomly selected 16c plants infected with SYNV-tgtGFPl-Cas9. FIG 18 are diagrams showing engineering strategy for the SYNV CRISPR / Cpfl vectors. FIG 18A is a schematic illustration of the genome structure of the SYNV-Cpfl and pSYNV-crRNA-Cpfl vectors. Pvul and Bsu36I are unique restriction sites located upstream of the leader (le) sequence and in the N gene region, respectively, N / P J, N / P gene junction; crRNA, CRISPR RNA. FIG 18B is a diagram showing viral transcription and processing of crRNA. The crRNA transcript contains virus-derived non-coding regions, i.e., 5' UTR, 3' UTR sequences and a polyA tail. The direct repeat (DR) sequenceis fused at both ends of the guide sequence, such that primary crRNA transcript is processed by Cpfl to release the precise crRNA sequence. FIG 19 are images depicting systemic infection and expression of CRISPR / Cpfl nuclease by engineered SYNV vectors. FIG 19A is a serial of images showing GFP-transgenic N. benthamiana 16c plants infected with recombinant SYNV-Cpfl, SYNV-crGFPl-Cpfl, SYNV-crGFP2-Cpfl vectors, or mock-inoculated. GFP expression was visualized under UV ultraviolet light (middle panels) and confocal microscope (lower panels). FIG 19B are Western blot images showing the expression of SYNV structural proteins, Cpfl, and GFP protein in infected plants. FIG 20 are pictures illustrating mutagenesis of the GFP sites in N. benthamiana 16c plants infected by the SYNV CRISPR / Cpfl vector. FIG 20A depicts a PCR / RE assay for the detection of mutagenesis frequency. + / -, with / without restriction digestion; Indel (%), percentage of undigested PCR products per total PCR products. FIG 20B depicts Sanger sequencing analysis of mutation patterns and frequencies. WT, wild-type sequence; d#, deletion of # bases; x#, the number (#) of clones with identical sequence. FIG 20C shows representative Sanger sequencing chromatograms. FIG 21 shows targeted mutagenesis of the endogenous PDS gene loci in N. benthamiana with SYNV-delivered CRISPR / Cpfl nuclease. FIG 21A are diagrams illustrating the gene structure of PDSa and PDSb homoeologs. The sequences of the two target sites (crPDSl and crPDS2, SEQ ID NOs: 27and28) are shown, with restriction sites underlined and the protospacer adjacent motif (PAM) indicated. FIG 21B shows N. benthamiana plants infected with recombinant SYNV-tgtRNA-Cas9 vectors targeting crPDSl and crPDS2. FIG 21C depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; WT / U or WT / D, PCR product of the wild-type plants either undigested (U) or digested (D) with corresponding restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. FIG 2ID shows the target site sequences of cloned amplicons determined by Sanger sequencing, d#, deletion of # bases; i#, insertion of # bases; x#, the number (#) of clones with identical sequence. FIG 22 is a schematic illustration of an SYNV CRISPR / Cpfl vector for tandem expression of two crRNAs in a DR-guidel-DR-guide2-DR configuration. The primary RNA transcripts are processed by Cpfl nuclease, resulting in generation of two crRNA species with authentic ends. FIG 23 shows simultaneous mutagenesis of GFP and PDS loci in N. benthamiana 16c plants by SYNV-delivered CRISPR / Cpfl nuclease with two crRNAs. FIG 23A are pictures showing N. benthamiana plants infected with the recombinant SYNV-crGFP-l / PDS-l-Cpfl vector. FIG 23B depicts detection of the mutagenesis frequency by PCR / RE assay. M, marker; Mock / U or Mock / D, PCR product of the wild-type plants either undigested (U) or digested (D) with restriction enzyme. Indel (%), percentage of undigested PCR products per total PCR products. crGFP-l / PDS-1 and crGFP-l / PDS-1 represent mutagenesis frequencies of GFP and PDS, respectively. FIG 24 depicts phenotypes and genotypes of MO plants regenerated from SYNV CRISPR / Cpfl-infected leaf tissues. FIG 24A shows phenotypic appearance of shoots regenerated on MS medium from young leaf tissues of N. benthamiana plants infected with SYNV-crPDSl-Cpfl. The pictures show regenerated shoots on MS media plate (upper) and an albino plantlet (bottom) on rooting medium. FIG 24B shows genotyping of 31 representative MO plants by PCR / RE. Mutations were identified by Hinfl digestion of PCR products amplified from independent MO lines with primers conserved for both PDS homoeologs. Mock / U and Mock / D represent a mock-infected plant without or with restriction digestion, and M denotes a 500-bp ladder DNA marker. FIG 24C shows RT-PCR detection of the presence of SYNV (virus) in regenerated plants. Detection of actin mRNA serves as internal controls. FIG 25 depicts phenotypic segregation patterns in Ml progeny derived from MO lines tetra-allelic for the crPDSl site (SEQ ID NO: 27). FIG 25A shows Ml seedlings exhibiting phenotype segregation ratio in accordance with 3:1 (MO-11) or 15:1 (MO-9). FIG 25B summarizes the segregation ratio of Ml progeny derived from the 12 normal MO lines tetra-allelic for PDS. Altered PDSa / b homoeoalleles are denoted by a or b, respectively. FIG 26 depict the engineering of SYNV CRISPR / Cas9 vector derivatives carrying a deletion or substitution of the N-terminal domain of the G gene. FIG 26A is a diagram showing the domain structure of the G protein and the SYNV vector derivatives. SP, signal peptide; NT, N-terminal domain; TM, transmembrane domain, CT, C-terminal domain. FIG 26B is a serial of images showing the symptoms and red fluorescence in N. benthamiana plants infected with the recombinant SYNV vectors. FIG 26C are Western blot images showing the size of G protein mutant derivatives expressed by the SYNV vector. FIG 26D is an image showing PCR / RE assay for the detection of mutation frequency. M, marker, Mock / U or Mock / D, PCR product of the wild-type plants either undigested or digested with corresponding restriction enzyme. FIG 27 compares the mutagenesis efficiency induced by the SYNV vector-delivered CRISPR / Cas9 nuclease without or with codon optimization (oCas9, SEQ ID NO:36) in N. benthamiana. FIG 27A are diagrams showing the genome structure of SYNV vectors. FIG 27B are images of virus-infected N. benthamiana plants and a mock-inoculated plant. FIG 27C shows detection of the mutagenesis efficiency in the gPDS2 target site by PCR / RE assay. Indel percentages are shown below the panels. FIG 28 compares the mutagenesis activity of CRISPR / Cas9 nuclease expressed from a single transcription unit (SYNV-oCas9gPDS2) or separate transcription unit (SYNV-tgtPDS2-oCas9) in virus-infected N. benthamiana plants. FIG 28A is a diagram depicting the structure of SYNV-oCas9gPDS2. FIG 28B are images showing infected N. benthamiana plants. FIG 28C shows the detection of targeted mutagenesis efficiency by PCR / RE assay. Indel percentages are shown below the panels. FIG 29 depicts engineering of EMDV vector for expression of fluorescent reporter protein. FIG 29A are schematic diagrams of the EMDV-GFP and EMDV-RFP vectors. NXJ, N / X gene junction that is duplicated to drive reporter gene expression, N3'+N5' represents the GFP / N junction which comprise the N3'UTR, three additional G nucleotides, and N5'UTR. FIG 29B and FIG 29C are images showing Western blot detection of EMDV structural protein, GFP protein and RFP protein and pictures representing symptoms and fluorescence in N. benthamiana plants infected with the EMDV-GFP (FIG 29B) and EMDV-RFP (FIG 29C) vectors. FIG 30 depicts N. tabacum, S. tuberosum, S. melongena and S. lycopersicon plants systemically infected with the EMDV vector. FIG 30A shows N. tabacum plants infected with EMDV-RFP. The left pictures show Western blot images for the detection of EMDV structural protein and RFP protein, and the right pictures show symptoms of infected plants. FIG 3 OB are images showing spreading fluorescence in leaves of infected S. melongena, S. lycopersicon and S. tuberosum plants following mechanical inoculation with EMDV-RFP or EMDV-GFP. FIG 30C are pictures showing S. tuberosum scion grafted with N. benthamiana rootstock infected with EMDV-RFP. Fluorescent images showing RFP is expressed in S. tuberosum scion grated on N. benthamiana rootstock infected with EMDV-RFP. FIG 31 shows mutagenesis of the GFP transgene in N. benthamiana 16c plants infected by the EMDV CRISPR / Cas9 vector. FIG 31A is a diagram showing the construction of EMDV-tgtGFP2-Cas9 vector. FIG 31B shows 16c N. benthamiana plants infected with recombinant EMDV-tgtGFP2-Cas9 vector. The left images show EMDV structural proteins and Cas9 protein detected by Western blot, and the right images show symptoms and GFP fluorescence in infected plants. FIG 3 IC shows targeted mutations in the gGFP2 site determined by PCR / RE assay and Sanger sequencing. + / -, with / without restriction digestion. WT, wild-type sequence; d#, deletion of # bases; x#, the number (#) of clones with identical sequence. FIG 3 ID shows Sanger sequencing chromatograms. FIG 32 shows targeted mutagenesis of the endogenous PDS gene loci in N. benthamiana with EMDV-delivered CRISPR / Cas9 nuclease. FIG 32A is a diagram showing the genome structure of EMDV-tgtPDS4-Cas9. FIG 32B shows N. benthamiana plants infected with EMDV-tgtPDS4-Cas9. The pictures show Western blot detection of EMDV structural proteins and Cas9 protein (left) and symptoms of virus-infected plants at 40 days post inoculation. FIG 32C shows mutagenesis of the gPDS4 target site determined by PCR / RE assay. Left image is a diagram showing the gene structure of PDS homologs in N. benthamiana, S. tuberosum, S. lycopersicon, Capsicum annuum, and N. tabacum plant. The sequences of gPDS4 site is shown. Image on the right depicts the T7E1 assay to detect the gPDS4 site mutations in virus-infected N. benthamiana plants. + / -, with / without T7E1 digestion. FIG 33 shows targeted mutagenesis of the PDS gene loci in N. tabacum (FIG 33A), S. lycopersicon (FIG 33B), and S. tuberosum (FIG 33C) plants infected by EMDV-tgtPDS4-Cas9. Images on the left show mutation frequencies of the gPDS4 target sites determined by Sanger sequencing, and images on the right show Sanger sequencing chromatograms. EXAMPLES Hereafter, the present disclosure will be further described in more detail in the following Examples, which are to be construed as merely illustrative but not limitative of the remainder of the disclosures in any way whatsoever. Many variations and modifications may be made to the disclosure without departing substantially from the spirit and principles of the disclosure. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims. Laboratory procedures utilized in the present disclosure including molecular, biochemical, microbiological and recombinant DNA techniques, unless otherwise stated, are thoroughly explained in the literature. Reagents and materials are purchased from regular commercial Biotech companies. Nicotiana benthamiana L., SYNV clones, binary vectors can be made available from the inventor's laboratory (Institute of Biotechnology, Zhejiang University, China) upon request. Recombinant SYNV and SYNV-GFP clones (pSYNV and pSYNV-GFP), the pGD binary vector containing expression cassettes for SYNV core proteins (pGD-NPL), and the pGD binary vectors for expression of RNA silencing suppressors (pGD-Hc-Pro, pGD-pl9, and pGD-yb), have been described previously (Wang Q, Ma X, Qian S, et al. Rescue of a plant negative-strand RNA virus from cloned cDNA: Insights into enveloped plant virus movement and morphogenesis. PLoS pathogens, 2015, 11: el005223). Recombinant viral vectors SYNV-RFP, SYNV-RFP-dGN, and SYNV-RFP-mCherry:GN have been described previously (Sun K, Zhou X, Lin W, et al. Matrix-glycoprotein interactions required for budding of a plant nucleorhabdovirus and induction of inner nuclear membrane invagination. Molecular Plant Pathology, 2018, 19:2288-2301). Description of the binary vectors pBGK01-gRNA-Cas9 and pYQ230 can be found in literature (Fu S, Xu Y, Li C, et al. Rice stripe virus interferes with S-acylation of remorin and induces its autophagic degradation to facilitate virus infection. Molecular Plant, 2018,11:269-287; Tang X, Lowder LG, Zhang T, et al. A CRISPR-Cpfl system for efficient genome editing and transcriptional repression in plants. Nature Plants, 2017, 3:17018). Recombinant EMDV and EMDV-GFP clones (rgEMDV and rgEMDV-GFP), and the pGD binary vector for expression of the EMDV N, P, and L core proteins (pGD-EMDV N, pGD-EMDV P, and pGD-EMDV L) have been disclosed previously in a Chinese Patent (CN 111 849927 A). Example 1 Construction of an SYNV Vector for Expression of Two Reporter Genes SYNV vector construction We inserted the GFP and RFP reporter genesinto the SYNV genome as independent transcription units. The insertion positions include but are not limited to the region between N and P genes. The procedure for constructing SYNV-GFP-RFP (FIG 1A), in which the reporter gene cassettes were inserted between the N and P genes, is detailed as follows. We amplified the fragment Bsu36I-N / P J, GFP, and RFP-Nhel by PCR with the primer pairs N-Bsu36I / F and NPJ-GFP / R, GFP / F and NPJ-RFP / R, RFP / F and P-Nhel / R, using the SYNV, SYNV-GFP, SYNV-RFP plasmid DNA as templates, respectively. Primer sequences are detailed in Table 6. The fragment Bsu36I-N / P J spans the region from Bsu36I restriction site in the N gene to the downstream NP junction. The fragment RFP-Nhel contains region spanning from the RFP ORF, the downstream NP junction, to the Nhel restriction site in the P gene (FIG 1A). The above three fragments contain 15-20 bp terminal sequence extensions that are homologous to the adjacent fragments to facilitate In-Fusion cloning. To insert the three fragments into the SYNV genome, SYNV vector plasmid was digested with Bsu36I and Nhel. The linearized vector backbone fragment was purified and mixed with the purified PCR products of the Bsu36I-N / P J, GFP, and RFP-Nhel and then ligated by In-Fusion cloning (Clontech) reagent. Positive clones were screened by colony PCR, identified by restriction enzyme digestion, and verified by Sanger sequencing. Agrobacterium transformation, cultivation, and infiltration of N. benthamiana plants SYNV-GFP-RFP along with pGD-NPL and pGD-VSRs (pGD-Hc-pro, pGD-pl9, pGD-yb) were individually transformed into Agrobacterium strain EHA105 by electroporation. Then, agrobacterium strains harboring individual binary plasmid were cultured overnight at 28°C in 4 mL YEP liquid medium (containing 50 pg / mL kanamycin and 25 pg / mL rifampicin) to OD600 0.8-1.2. The bacterial cells were collected by centrifuging at 5500 rpm for 10 minutes, and the supernatant was discarded. The cell pellets were resuspended in an infiltration buffer (10 mM MgC12, 10 mM MES, 200 mM acetosyringone) to ODeoo- 1.0 and incubated for 2-3 hours at room temperature. Agrobacterium strains harboring binary plasmids described above were mixed in an equal volume at a ratio of 1:1:1 immediately before use. The mixtures were infiltrated into lower leaves of N. benthamiana plants at 4-6 leaf stage using a 1 mL needleless syringe. 3-4 expanded leaves for each plant were infiltrated and the infiltrated plants were maintained in a growth chamber at 25°C. As a control, N. benthamiana plants were agroinoculated with the recombinant SYNV-GFP vector expressing only GFP protein in parallel using a similar procedure. Verification of GFP and RFP expression in inoculated N. benthamiana plants By ~ 6 days post inoculation (dpi), visible GFP and RFP fluorescence were observed in the inoculated leaves, and by 12 dpi, the fluorescence began to expand from cell-to-cell in the inoculated leaves. By about 30 dpi, strong GFP and RFP fluorescence were observed in the veins and mesophyll cells of the upper non-inoculated leaves (FIG IB), whereas only GFP fluorescence could be detected in the plants inoculated with SYNV-GFP. The systematically infected plants displayed symptoms typical of SYNV infection such as dwarfing, leaf curling, vein yellowing, and calyx curling (FIG IC), and due to the accumulation of RFP, the petals of plants infected with SYNV-GFP-RFP gradually became pink. To verily SYNV infections, total protein samples were extracted from the upper young leaves of infected plants and subjected to Western blot analyses using antibodies raised against SYNV virions, GFP, and RFP. SYNV structure proteins, GFP, and RFP proteins were detected in SYNV-GFP-RFP protein samples, whereas only SYNV structure proteins and GFP protein were detected in the SYNV-GFP samples (FIG ID). The data establish that the SYNV vector can be engineered to express two exogenous reporter genes (GFP and RFP) simultaneously. Example 2 Construction of SYNV CRISPR / Cas9 Genome Editing Vectors We engineered the gRNA and / or Cas9 genes into the SYNV genome as independent transcription units. The procedure below describes the cloning of viral vectors with the expression cassettes inserted between the N and P gene, but the cassettes can be engineered into other genomic positions. Here we designate SYNV-Cas9, SYNV-gRNA-Cas9, and SYNV-tgtRNA-Cas9 as SYNV vectors carrying expression cassettes for Cas9 protein only, for both Cas9 and sgRNA, and for Cas9 and sgRNA with flanking pre-tRNAGly sequencesfor precise sgRNA processing. The specific construction methods for these viral vectors are described as follows. i. SYNV-Cas9 vector We amplified the fragments Bsu36I-N / P J, Cas9 ORF, and N / P J-Nhel with N-Bsu36I-F and Flag-NPJ / R, Cas9 / F and Cas9 / R, Cas9-NPJ / F and P-Nhel / R in Table 6 as primers and SYNV, pBGK01-gRNA-Cas9, SYNV as templates, respectively (FIG 2A). Fragment Bsu36I-N / P J contains region from the Bsu36I restriction site on the N gene to the downstream NP junction, and fragment N / P J-Nhel contains region from upstream NP junction sequence to the Nhel restriction site of P gene. Fragments above all contain 15-20 bp sequences homologous to the adjacent fragments, while fragment Bsu36I-N / P J and N / P J-Nhel contain sequences homologous to the linearized SYNV vector after double digestion with Bsu36I and Nhel, the above-mentioned three fragments can be sequentially connected with linearized SYNV vector through in-fusion to obtain the vector SYNV-Cas9. ii. SYNV-gRNA-Cas9 vectors We amplified the fragments Bsu36I-N / P J, gRNA and N / P J-AhdI by PCR with the primer pairs N-Bsu36I / F and GFP2-NPJ / R, GFP2-gRNA / F and gRNA / R, gRNA-NPJ / F and Cas9-Ahdl / R (Table 6) using the SYNV, pBGK01-gRNA-Cas9, SYNV vector plasmids as templates. The fragment Bsu36I-N / P J contains region spanning from the Bsu36I restriction site in the N gene to the downstream NP junction, the fragment gRNA contains GFP target site 2 (gGFP2, SEQ ID NO: 20) and gRNA scaffold sequence, and the fragment N / P J-AhdI contains region spanning from the NP junction sequence to the AhdI restriction site in the Cas9 gene (FIG 2A). The three fragments, along with the Bsu36I and AhdI-linearized SYNV binary plasmid, were ligated through In-Fusion cloning method to obtain the vector SYNV-gGFP2-Cas9. Note that gRNA produced by the SYNV-gGFP2-Cas9 vector contains terminal sequences derived from viral untranslated regions (UTRs) as shown in FIG 2B. iii. SYNV-tgtRNA-Cas9 vectors To achieve precise transcription of gRNA, the gRNA sequence was franked by two identical tRNAGly precursor sequences to produce the tRNA-gRNA-tRNA sequence, abbreviated as tgtRNA. Upon viral transcription of tgtRNA, the tRNAGly sequences are expected to be recognized and processed by the plant's endogenous tRNA processing machinery, and precise gRNA sequence is released (FIG 2C). We chemically synthesized the tgtRNA sequences (GenScript, Nanjing, China) with different target sites according to SEQ ID NOs: 1-12. These sequences contain 15-nt homologous sequences to the 3' and 5' ends of the N / P gene junction sequences (5'-TTATTTGTCTAGGCC-3' and 5'-TAAACTACAGCCACA-3',) at their 5' and 3' ends to facilitate In-Fusion cloning. The sgRNAs were designed to target two target sites of the GFP transgene, there of NbPDS (Phytoene Desaturase), NbRDR6 (RNA-dependent RNA Polymerase 6), and NbSGS3 (Suppressor of Gene Silencing 3) genes in N. benthamiana genome. All these targets contained a restriction site overlapping with the Cas9 cleavage site to facilitate the detection of mutagenesis efficiency through PCR / RE assay. In addition, these endogenous target sites are conserved in both homoeologs (designated a and b) of NbPDS, NbRDR6, and NbSGS3. The chemically synthesized sequences were used as templates in PCR using the primers NPJ-tRNA / F and NPJ-tRNA / R (Table 6), and the obtained tRNA-gRNA-tRNA products were individually mixed with the Bsu36I-N / P J and N / P J-AhdI DNA fragments and ligated through multi-segment In-Fusion cloning method to obtain the SYNV-tgtRNA-Cas9 vectors, i.e., SYNV-tgtGFPl-Cas9, SYNV-tgtGFP2-Cas9, SYNV-tgtPDSl-Cas9, SYNV-tgtPDS2-Cas9, SYNV-tgtPDS3-Cas9, SYNV-tgtRDR6-l-Cas9, SYNV-tgtRDR6-4-Cas9, SYNV-tgtSGS3-l-Cas9, and SYNV-tgtSGS3-2-Cas9. iv. SYNV-tgtgtRNA-Cas9 vectors For construction of SYNV vectors for tandem expression of two sgRNAs in a configuration of tRNA-gRNA-tRNA-gRNA-tRNA (abbreviated as tgtgtRNA), the DNA fragments corresponding to the tandem sgRNA were chemically synthesized according to the sequences provided in SEQ ID NOs: 10-12. The viral vectors with multiplexed sgRNAs were constructed by the same procedure with the SYNV-tgtRNA-Cas9 vector described above. These viral vectors, designated as SYNV-tgtgtRDR6-l / SGS3-l-Cas9, SYNV-tgtRDR6-4 / SGS3-2-Cas9, and SYNV-tgtPDSl / 3-Cas9, are designed to express two sgRNAs targeting NbRDR6 target site 1 and NbSGS3 target site 1, NbRDR6 target site 4 and NbSGS3 target site 2, NbPDS target site 1 and 3, respectively. Example 3 Mutagenesis of GFP Transgene in N. benthamiana plants with SYNV CRISPR / Cas9 Vector According to the CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online design software, we selected two target site sequences in the mGFP5 transgene of the N. benthamiana 16c line (gGFPl: 5'-GATACCCAGATCATATGAAG-3'; gGFP2: 5 '-ACAAGTGTTGGCCATGGAAC-3(SEQ ID NOs: 29 and 20), the restriction sites Ndel and Ncol are underlined), and the SYNV-tgtGFPl-Cas9 and SYNV-tgtGFP2-Cas9 vectors were constructed according to the method in Example 2. The SYNV-Cas9, SYNV-tgtGFPl-Cas9, and SYNV-tgtGFP2-Cas9 vector plasmids were electroporated into Agrobacterium EHA105 strain, and N. benthamiana 16c transgenic plants were agroinoculated by these viral vector as described in Example 1. By about 30 dpi, the inoculated plants exhibited symptoms similar to plants infected with wide-type SYNV (SYNV-WT), including leaf curling and clearing veins. GFP fluorescence decreased significantly in plants infected with SYNV-tgtGFPl-Cas9 and SYNV-tgtGFP2-Cas9 when examined under a handheld ultraviolet lamp or confocal laser microscope observation. Expression of GFP was hardly detected in mesophyll cells but remain visible in guard cells. In contrast, plants infected with SYNV-Cas9 exhibited GFP fluorescence was strong as those in the Mock-infected A. benthamiana 16c plants (FIG 3A). Upper leaves of the infected plants above were collected, and total protein was extracted. Western blot was performed with antibody raised against SYNV virions, Flag epitope (fused with Cas9 protein), and GFP. SYNV structure proteins and Cas9 protein were detected. The expression of GFP in plants infected with SYNV-tgtGFPl-Cas9 and SYNV-tgtGFP2-Cas9 was significantly decreased but remained similarly high in SYNV-Cas9-infected or Mock-inoculated plants (FIG 3B). These data indicate that SYNV vectors carrying the Cas9 and / or sgRNA expression cassettes are infectious. To further examine the accommodation of exogenous expression cassette in the viral genome, virus particles were purified from the infected plants. Typical bacilliform or bullet-shaped virions were observed with an electron microscope. Compared with SYNV-WT virus particles that measure as ~ 247 nm in length, the SYNV-tgtGFPl-Cas9 virions are significantly longer (~ 333 nm) (FIG 3C). The length of the virions is proportional to the size of the recombinant virus genome. These results show that foreign fragments up to 4.8 kb can be accommodated in the SYNV genome and packaged into mature virions. To verify the mutation efficiency of the GFP target sites, PCR / RE assay (Polymerase Chain Reaction / Restriction digestion) was performed. The target site regions were amplified by PCR with the primers GFP / F and GFP / R (Table 7), and the amplicons were digested with corresponding restriction enzymes in the target sequence. The PCR product with mutated target sites would be resistant to restriction digestion, and the percentages of undigested bands reflect the mutation frequency. PCR / RE assays revealed mutagenesis frequencies of 77 and 91% at the gGFPl and gGFP2 sites, respectively (FIG 4A). To verify the mutation patterns of GFP, PCR products were cloned and 10 randomly selected colonies were Sanger sequenced. Seven and eight clones for the gGFPl and gGFP2, respectively, carried mutation (FIG 4B), which is consistent with the PCR / RE results. Mutation patterns were mostly deletion of single base or multiple bases (FIG 4C). Example 4 Precise gRNA Transcript Produced by SYNV CRISPR / Cas9 Vector Improves Mutagenesis Efficiency To detect the accuracy of the gRNA transcripts produced by SYNV-tgtRNA-Cas9 and SYNV-gRNA-Cas9, cRT-PCR was performed to verify the size of the gRNA transcripts. According to the transcriptional model of rhabdovirus including SYNV, the gRNA transcripts produced by SYNV-gRNA-Cas9 are anticipated to contain 5' UTR and 3' UTR sequences derived from the viral NP junction sequence, and the size of the transcripts would be about 208-nt transcripts plus polyA tails of unknown length. The sizes of tgtRNA transcripts produced by SYNV-tgtGFP2-Cas9 would be about 100-nt, if correctly processed by plant endogenous RNase enzyme. Otherwise the unprocessed tgtRNA should have the length of 362-nt plus a stretch of polyA tails of unknown length (FIG 5 A). The SYNV-gGFP2-Cas9 and SYNV-tgtGFP2-Cas9 vectors described in Example 2 were used to infect N. benthamiana 16c plants. Total RNA extracted from the upper leaves of infected plants was circularized by T4 RNA ligase and amplified by cRT-PCR with the primers scaffold / F and GFP-2 / R (Table 6). The size of the gRNA transcripts produced by SYNV-tgtGFP2-Cas9 were predominantly about 100-nt in length (FIG 5B), indicating that the tRNA sequences were efficiently removed by endogenous RNase enzymes and that precise gRNAs were released. Sanger sequencing was performed to further verify the ends of the gRNA sequences. These gRNA amplicons contain authentic 5' spacer and 3' terminal 1- to 3-nucleotide overhangs derived from the tRNA leader (FIG 5D). In contrast, SYNV-gGFP2-Cas9 produced the expected transcript with expected 208-300 nt in size and a smaller transcript with a size of about 100-nt (FIG 5B). The smaller fragments were sequenced, and the data showed that virus-derived sequence was removed imprecisely at the 3' end of the gRNA sequences, with either 1 base derived from the virus 5' UTR region or 4-5 bases of the scaffold sequence being deleted (FIG 5D). Plants infected with SYNV-gGFP2-Cas9 and SYNV-tgtGFP2-Cas9 at 30 dpi were randomly selected to compare the mutagenesis efficiency. PCR / RE assay and Sanger sequencing showed that the somatic mutation frequencies were 11 -20% for SYNV-gGFP2-Cas9 plants and 81-85% for SYNV-tgtGFP2-Cas9 plants (FIG 5C). Taken together, these data indicate that the small amount of precise gRNA transcripts produced in SYNV-gRNA-Cas9 infected tissues results in lower mutation efficiency. In comparison, the sgRNA transcripts produced by SYNV-tgtGFP2-Cas9 were precisely processed by the endogenous processing machinery to release authentic sgRNA species, leading to targeted mutagenesis frequencies of up to 90%. Therefore, the SYNV-tgtRNA-Cas9 vector with sgRNA sequence flanked by with the pre-tRNA sequence is the preferred vector in the present disclosure and will be used in subsequent Examples. Example 5 Targeting Endogenous NbPDS Sites Using the SYNV CRISPR / Cas9 Vector The endogenous NbPDS gene is further selected to verify the mutagenesis efficiency induced by the SYNV CRISPR / Cas9 vector in the present disclosure. The genomic sequence of the target gene was retrieved from the Sol Genomics Network (https: / / solgenomics.net / ) with the gene IDs shown in FIG 6A. According to the CRISPR-P online design software, three 20-nt target sites (gPDSl: 5 '-GCCGTTAATTTGAGAGT CCA-3gPDS2: 5'-TTGGTAGTAGCGACTCCATGG-3'. gPDS: 5'-TTAACTGTATTGTCTAGCTC-3'. SEQ ID NOs: 21, 30 and 31, Hinfl, Ncol, and Bfal restriction sites are underlined) were selected. N. benthamiana is an allotetraploid with most genes having two homoeologs derived from two hypothetical parental subgenomes, and all three sites are conserved in both NbPDS homoeologs (PDSa and PDSb; FIG 6A). The recombinant virus vectors SYNV-tgtPDSl-Cas9, SYNV-tgtPDS2-Cas9, and SYNV-tgtPDS3-Cas9 were constructed according to the method in Example 2. N. benthamiana plants were agroinoculated with each of the three viral vectors using the procedure described in Example 1. At 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT (FIG 6B). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both homoeologs. We detected mutagenesis frequencies ranging from 40% to 79% depending on the particular target site used and the individual plants infected (FIG 6C). For example, the mutation frequencies at the gPDSl site of three randomly selected plants were 79%, 70%, and 56%, respectively. Different mutation efficiencies may be due in part to varied expression level of gRNA transcripts and Cas9 protein. To verify gPDSl mutation patterns, PCR was performed with primers specific for both homoeologs (Table 7). The amplified products were cloned, and 10 randomly selected clones for each homoeolog were subjected to Sanger sequencing. Eight and seven clones in PDSa and PDSb loci carried targeted mutation, which is consistent with the frequencies detected by PCR / RE assay. Mutation patterns were mainly single or multiple base deletions and single base insertions (FIG 6D). Example 6 Targeting Endogenous NbRDR6 Sites Using the SYNV CRISPR / Cas9 Vector The endogenous NbRDR6 gene is further selected to verify the mutagenesis efficiency induced by the SYNV CRISPR / Cas9 vector. The genomic sequence of the target gene was retrieved from the Sol Genomics Network (https: / / solgenomics.net / ) with the gene IDs shown in FIG 7A. According to the CRISPR-P online design software, two target sites (gR6-l: 5'-AGTTGGGTAAGAGTCAGGAG-3'; gR6-4: 5'-ATTCTCAGCTAACCAGCTGA-3', SEQ ID NOs: 22 and 32, Hpyl88III and PvuII restriction sites are underlined) conserved in both NbRDR6 homoeologs (RDR6a and RDR6b; FIG 7A) were selected. The SYNV-tgtRDR6-l-Cas9 and SYNV-tgtRDR6-4-Cas9 targeting each of the two sites were constructed according to the method in Example 2. N. benthamiana plants were agroinoculated with the two viral vectors using the procedure described in Example 1. By 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT (FIG 7B). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both homoeologs. We detected mutagenesis frequencies ranging from 53% to 91% depending on the particular target site used and the individual plants infected (FIG 7C). To verily gR6-4 mutation patterns, PCR was performed with primers specific for each homoeolog (Table 7). The amplified products were cloned, and 10 randomly selected clones for each homoeolog were subjected to Sanger sequencing. Six and seven clones in RDR6a and RDR6b loci carried targeted mutation, which is consistent with the frequencies detected by PCR / RE assay. Mutation patterns were mainly single or multiple base deletions and single base insertions (FIG 7D). Example 7 Targeting Endogenous NbSGS3 Sites Using the SYNV CRISPR / Cas9 Vector The endogenous NbSGS3 gene is further selected to verify the mutagenesis efficiency induced by the SYNV CRISPR / Cas9 vector. The genomic sequence of the target gene was retrieved from the Sol Genomics Network (https: / / solgenomics.net / ) with the gene IDs shown in FIG 8A. According to the CRISPR-P online design software, two target sites (gS3-l: 5'-ACAAGAGTGGAAGCAGTGCT-3gS3-2: 5'- TGCCTCAACTGATCCCAAGG-3'. SEQ ID NOs: 23 and 33, TscAI and Ecol30I restriction sites underlined) conserved in both NbSGS3 homoeologs (NbSGS3a and NbSGS3b: FIG 8A) were selected. The recombinant virus vectors SYNV-tgtSGS3-l-Cas9 and SYNV-tgtSGS3-2-Cas9 were constructed according to the method in Example 2. N. benthamiana plants were agroinoculated with each of the two viral vectors using the procedure described in Example 1. By 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT (FIG 8B). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both homoeologs. We detected mutagenesis frequencies ranging from 79% to 91% depending on the particular target site used and the individual plants infected (FIG 8C). To verily gS3-2 mutation patterns, PCR was performed with primers specific for each homoeolog (Table 7). The amplified products were cloned, and 10 randomly selected clones for each homoeolog were subjected to Sanger sequencing. Eight and seven clones in SGS3a and SGS3b loci carried targeted mutation, which is consistent with the frequencies detected by PCR / RE assay. Mutation patterns were mainly single or multiple base deletions and single base insertions (FIG 8D). Example 8 Multiplexed Mutagenesis of NbRDR6 and NbSGS3 Using SYNV CRISPR / Cas9 Vectors with Two gRNAs To exploit the use of SYNV-based vector for multiplex editing, we engineered SYNV vector for tandem expression of two gRNAs in a tRNA-gRNAl-tRNA-gRNA2-tRNA (tgtgtRNA) configuration, and the gRNAl and gRNA2 transcripts with authentic ends will be released through cleavage by endogenous tRNA processing enzymes (FIG 9). The SYNV-tgtgtRDR6-l / SGS3-l-Cas9, SYNV-tgtgtRDR6-4 / SGS3-2-Cas9 vectors were constructed according to the method in Example 2 to express two sgRNAs targeting gR6-l and gS3-l sites or gR6-4 and gS3-2, respectively. N. benthamiana plants were agroinoculated with each of the two viral vectors using the procedure described in Example 1. By 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT (FIG 10A). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both homoeologs. The results showed that mutation rates for both gene targets achieved by the multiplexed vectors were similar to those by vectors expressing a single gRNA and multiplexed gRNA expression did not affect the efficiency of either gRNA (FIG 10B). To verify gR6-4 and gS3-2 mutation patterns, PCR was performed with primers specific for each homoeolog (Table 7). The amplified products were cloned, and 10 randomly selected clones for each homoeolog were subjected to Sanger sequencing. Five and five clones in RDR6a and RDR6b loci, and seven and eight clones in SGS3a and SGS3b loci carried targeted mutations, which is consistent with the frequencies detected by PCR / RE assay. Mutation patterns were mainly single or multiple base deletions and single base insertions (FIG IOC). Example 9 Chromosome Fragment Deletions Induced by SYNV CRISPR / Cas9 Vector To verily whether the SYNV-based vector could cause chromosome deletions of the plant genome, SYNV-tgtgtPDSl / 3-Cas9 are designed to express two sgRNAs targeting two juxtaposed sites in the NbPDS gene. According to the CRISPR-P online design software, the two target sites (gPDSl: 5'-GCCGTTAATTTGAGAGTCCA-3 gPDS3: 5'-TTAACTGTATTGTCTAGCTC-3'. SEQ ID NOs: 21 and 31, Hinfl and Bfal restriction sites underlined) were selected. The two sites are conserved in both NbPDS homoeologs (PDSa and PDSb) and spaced by a 299- and 293-bp fragment in PDSa and PDSb. The recombinant virus vectors SYNV-tgtPDSl / 3-Cas9 was constructed according to the method in Example 2. N. benthamiana plants were agroinoculated using the procedure described in Example 1. All inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT (FIG 11 A). PCR was performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers PDS-1 / 3 / F and PDS-1 / 3 / R which were conserved for both PDS homoeologs (Table 7). Amplification of truncated PCR products indicated chromosomal fragment deletion at frequencies of 34-48% (FIG 11B). To confirm chromosome deletion, the truncated PCR products were cloned and subjected to Sanger sequencing, and analysis of sequence verified successful deletions between or beyond the two cleavage sites in PDSa and PDSb (FIG 1 IC and D). Example 10 Genotyping and Phenotyping of MO Plants Regenerated from Leaves of N. benthaimana Plants Infected with SYNV CRISPR / Cas9 Vectors To test whether mutant plants could be regenerated from virus-infected cells, symptomatic upper leaf tissues infected by SYNV-tgtRNA-Cas9 targeting the gPDS-1 site were used for tissue regeneration under selection-free conditions. Systemically infected leaves at 2 weeks post symptom appearance were first surface sterilized with 70% ethanol solution for 30 s and then with 0.1% mercuric chloride (HgCL) for 2 min, washed three times with sterile water and cut into 1-cm discs on sterilized filter paper. Leaf discs were placed on non-selective shooting medium plates (4.4 g / L MS medium including vitamins, 30 g / L sucrose, 1 mg / L benzylaminopurine and 4 g / L phytagel, pH 5.8) in a chamber at 25 °C. After culture for 4-6 weeks, regenerated shoots were excised and transferred to non-selective rooting medium (4.4 g / L MS medium including vitamins, 3 g / L sucrose, 7 g / L glucose and 4 g / L phytagel, pH 5.8), and grown for 2-3 weeks to a height of 5-6 cm before transfer to soil. PCR / RE assays were performed with 30 regenerated M0 plants consisting of six albino and 24 normal green plants (FIG 12A), and the results shown in FIG 12B revealed that :1) six albino plants (M0-1, -2, -4, -5, -9, -11) were fully resistant to Hinfl digestion, suggesting that mutations in all four PDS homoeoalleles causing an albino phenotype; 2) 11 of the 24 normal plants (M0-8, -18, -21, -22, -27, -29, -31, -32, -33, -36, -42) were also fully Hinfl-resistant, suggesting that mutations in all four PDS homoeoalleles despite of lacking an albino phenotype; 3) the 13 other normal plants displayed digestion patterns of partial (MO-7, -10, -12, -13, -15, -23, -28, -34, -35, -39, -41) or no editing (MO-3, -6), suggesting partial or no editing of target sequence. Next, the genotypes of representative M0 plants were further determined by Sanger sequencing of multiple clones (Table 1). The 17 Hinfl-resistant (six albino plus 11 normal) lines carried either homozygous or bi-allelic mutations at both the PDSa and PDSb locus. Notably, all 11 Hinfl-resistant normal lines contained one or two PDS homoeoalleles with small deletions of 3 bp or multiples that would result in one to a few amino acid deletions rather than frameshift mutations. These observations suggest that in-frame small deletions did not inactivate PDS functions. Genotyping also confirmed the absence of mutations in MO-3 and -6 plants that displayed full Hinfl susceptibility, whereas two representative lines exhibiting partial Hinfl susceptibility were either heterozygous (MO-7) or mosaic (MO-34) for both PDS homoeologs. RT-PCR assays were conducted to detect the presence of viral vector in M0 plants. Except for MO-3, MO-7 and MO-42, all M0 plants were persistently infected with SYNV. Notably, the fact that MO-7 and MO-42 are free of virus and carry targeted mutations indicated that virus-free and transgene-free regenerated plants with targeted mutation could be obtained in M0 generation (FIG 12C). Example 11 Inheritance Pattern of Targeted Mutations Induced by Virally Delivered CRISPR-Cas9 Reagents To investigate whether the mutations induced by SYNV delivered CRISPR-Cas9 reagents are germline transmissible, the heritability of gPDS-1 target mutations in next generations was analysed. Since albino M0 plants were unable to grow in soil, 11 viable tetra-allelic M0 plants (M0-8, -18, -21, -22, -27, -29, -31, -32, -33, -36, -42) containing altered yet functional PDS homoeoalleles were selected and self-pollinated. Ml seeds harvested from M0 plants were germinated on Murashige & Skoog (MS) medium. The normal / albino phenotypes at a segregation ratio of 3:1 or 15:1 in Ml populations from M0 lines having one (M0-8, -18, -21, -31, -32, -33, -36) or two (MO-22, -27, -29, -42) functional PDS homoeoalleles were observed, suggesting that mutations were passed to the Ml generation following classic Mendelian laws (FIG 13). Genotyping of Ml progeny from the five M0 lines (M0-8, -18, -22, -29, -42) revealed that all progeny genotypes were derived from their respective M0 parents and no new mutations were detected, and all green plants, but no albino plants, contained one or more non-frameshift homoeoalleles (FIG 14A and B; Table 2). The 20 normal Ml plants were again allowed to self-pollinate, and phenotype segregations of the M2 progeny were also confirmed to have followed the expected Mendelian ratios of 3:1 or 15:1 for Ml plants with either one (e.g. M8-2) or two (e.g. M22-2) non-frameshift homoeoalleles. To confirm genotype inheritance from Ml to M2, five Ml homozygotes were selected to determine their progeny genotype. All M2 plants were homozygous for the same mutations as their Ml parents, with no new mutations or reversions detected (FIG 14C; Table 3). These data demonstrated that the stable inheritance of the mutations to next generations following classic Mendelian laws. Example 12 RT-PCR Detection of Viral Vector in Ml Plants with Targeted Mutations Plant rhabdoviruses are not known to invade meristemic or germline cells and to be transmitted through seeds. To verify the progeny of regenerated plants were virus-free, Ml progeny derived from various regenerated M0 lines (M0-8, -18, -22, -29, -42, -6, -7, -34) were screened by RT-PCR for the presence or absence of SYNV. The results showed that the progeny of regenerated plants were free of virus, and the Ml plants were non-transgenic, virus-free and mutated plants (FIG 15). Example 13 Detection of Off-target Effects Induced by SYNV-expressed CRISPR / Cas9 Nuclease To detect the potential off-target effects, we searched the N. benthamiana genome for sites highly homologous to the gPDS-1 spacer using the programs CRISPR-P (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) and Cas-OFFinder (http: / / www.rgenome.net / cas-offinder / ). 13 potential off-target sites containing two to five nucleotide mismatches were selected, with one and two sites having two and three mismatches in the spacer sequence (FIG 16A). DNA fragments encompassing off-target sites were amplified from the M0-11 albino plant using the specific primer (Table 8) and digestion with T7EI and Hinfl, if applicable. The results revealed no detectable off-target mutations (FIG 16B). Thus, SYNV-based CRISPR / Cas9 vector achieve highly specific genome editing in plants. Example 14 Genetic Stability of SYNV CRISPR / Cas9 Vector Following Passage In examples above, Agrobacterium infiltration was used to initiate SYNV CRISPR / Cas9 recombinant virus infection. To verify the feasibility of other inoculation methods, upper non-inoculated leaves of SYNV-tgtGFPl-Cas9 infected plants were collected to prepare leaf saps, healthy 16c transgenic N benthamiana plants were mechanically inoculated with leaf saps above. At about 30 dpi, the inoculated plants all showed typical symptoms of SYNV infection. When plants inoculated with SYNV-tgtGFPl-Cas9 were observed under portable ultraviolet light, the expression of green fluorescent protein was significantly decreased compared with the control plants, and the plants showed chloroplast red autofluorescence (FIG 17A). Upper leaves of the infected plants above were collected to exact total protein samples. Western blot was performed with antibody raised against SYNV virions, Flag epitope (fused with Cas9 protein), and GFP. High levels of SYNV structure proteins and Cas9 protein were detected. The expression of GFP in plants infected with SYNV-tgtGFPl-Cas9 was significantly decreased compare to the SYNV-Cas9-infected plants (FIG 17B). RT-PCR detection and PCR / RE assays indicated that after mechanical passage of the SYNV vectors to healthy plants by sap inoculation, progeny viruses stably expressed the inserted genetic cargos and retained the ability to induce efficient mutagenesis (FIG 17C and D). Example 15 Construction of SYNV CRISPR / Cpfl Genome Editing Vector We engineered the crRNA and Cpfl genes into the SYNV genome as independent transcription units between the Le and N gene (FIG 18A). However, it is also possible that crRNA and Cpfl gene can be engineered into other genomic positions, because we already showed that gRNA and Cas9 can be expressed from transcription units placed between the N and P genes. Here we designate SYNV-Cpfl and SYNV-crRNA-Cpfl as SYNV vectors carrying expression cassettes for Cpfl protein only and for both Cpfl and crRNA. The specific cloning procedures for these viral vectors are described as follows. i. SYNV-Cpfl We amplified the fragments PvuI-N5'UTR, Cpfl ORF, and N / P J-Bsu36I with the primer pairs Pvul / F and N5UTR / R, Cpfl / F and Cpfl / R, NPJ / F and N-Bsu36I / R, respectively (primers sequence shown in Table 6), using SYNV-GFPie / N, YQ230, SYNV-GFPie / N as templates, respectively (FIG 18A). Fragment PvuI-N5'UTR contains region spanning from Pvul restriction site to the 5'UTR in the Ngene, and fragment N / P J-Bsu36I contains region covering the upstream NP junction to the Bsu36I restriction site in the N gene. The fragments above contain a 15-20 bp terminal sequence homologous to the adjacent fragments, and can be ligated with the Pvul and Bsu36I -linearized SYNV vector fragment through In-Fusion to obtain the vector SYNV-Cpfl. ii. SYNV-crRNA-Cpfl We amplified the fragments PvuI-N5'UTR and N / P I-Cpfl-Bsu36I by PCR with the primer pairs Pvul / F and N5UTR / R, NPJ / F and N-Bsu36I / R (Table 6) using the SYNV-GFPie / N, SYNV-Cpfl vector plasmids as templates. The fragment PvuI-N5'UTR spans the region from the Pvul restriction site to the 5' UTR in the N gene, and the fragment N / P J-Cpfl-Bsu36I contains region spanning from the NP junction to the Bsu36I restriction site in the N gene (FIG 18A). We chemically synthesized the DR-target-DR sequences (GenScript, Nanjing, China) with different target sites according to, and the synthesized sequences were used as templates in PCR using the primers N5'UTR-GFP1 / F and NPJ-GFP1 / R, N5UTR-GFP2 / F and NPJ-GFP2 / R, N5UTR-PDS1 / F and NPJ-PDS1 / R, N5UTR-PDS2 / F and NPJ-PDS2 / R (Table 6), respectively. The obtained DR-target-DR products were individually mixed with the PvuI-N5'UTR and N / P J-Cpfl-Bsu36I DNA fragments and ligated through multi-segment In-Fusion cloning method to obtain the SYNV-crRNA-Cpfl vectors, i.e., SYNV-crGFPl-Cpfl, SYNV-crGFP2-Cpfl, SYNV-crPDSl-Cpfl, SYNV-crPDS2-Cpfl. Note that primaiy crRNA transcripts produced by SYNV-crRNA-Cpfl would contain terminal sequences derived from viral untranslated regions (UTRs). However, the duplicated DR sequences would be recognized by co-expressed Cpfl protein, which further cleaves at specific sites to produce crRNA with accurate 5' and 3' ends (FIG 18B). For construction of SYNV vectors for tandem expression of two crRNAs, the DNA fragment in a configuration of DR-guidel-DR-guide2-DR was chemically synthesized according to the sequences provided in SEQ ID NOs: 17. The viral vector, designate SYNV-crGFP-l / PDS-l-Cpfl is designed to express two crRNAs targeting GFP target site 1 and NbPDS target sitel. Example 16 Mutagenesis of GFP Transgene in N. benthamiana with the SYNV CRISPR / Cpfl Vector According to the CRISPR RGEN Tools (http: / / www.rgenome.nt) online design software, we selected two target site sequences in the GFP transgene of the N. benthamiana 16c line (crGFPl: 5 '-AAGATACCCAGATCATATGAAGC-3 crGFP2: 5'-AGGGAGACACCCTCGTCAACAGG-3SEQ ID NOs: 25 and 26) the restriction sites Ndel and Hindi are underlined), and the SYNV-crGFPl-Cpfl and SYNV-crGFP2-Cpfl vectors targeting the two sites were constructed according to the method in Example 15. The SYNV-Cpfl, SYNV-crGFPl-Cpfl, and SYNV-crGFP2-Cpfl vector plasmids were electroporated into Agrobacterium EHA105 strain, and N. benthamiana 16c transgenic plants were agroinoculated by these viral vector as described in Example 1. By about 30 dpi, the inoculated plants exhibited symptoms similar to plants infected with wide-type SYNV (SYNV-WT), including leaf curling and vein clearing. GFP fluorescence decreased significantly in plants infected with SYNV-crGFPl-Cpfl or SYNV-crGFP2-Cpfl when examined under a handheld ultraviolet lamp or confocal laser microscope. Expression of GFP was hardly detected in mesophyll cells but remain visible in guard cells. In contrast, GFP fluorescence remains in plants infected with SYNV-Cpfl (FIG 19A). Upper leaves of the infected plants above were collected, and total protein was extracted. Western blot was performed with antibody raised against SYNV virions, Flag epitope (fused with Cpfl protein), and GFP. SYNV structure proteins and Cpfl protein were detected. The expression of GFP in plants infected with SYNV-crGFPl-Cpfl and SYNV-crGFP2-Cpfl was significantly decreased but remained similarly high in SYNV-Cpfl-infected or Mock-inoculated plants (FIG 19B). These data indicate that SYNV vectors carrying the Cpfl and / or crRNA expression cassettes are infectious. PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers GFP / F and GFP / R (Table 7). Mutagenesis frequencies of 83 and 90% at the crGFPl and crGFP2 sites, respectively, were detected (FIG 20A). To verily the mutation patterns, PCR products were cloned and 10 randomly selected colonies were Sanger sequenced. Seven and eight clones for the crGFPl and crGFP2, respectively, carried mutations (FIG 20B), which is consistent with the PCR / RE results. Mutation patterns were mostly deletion of single base or multiple bases (FIG 20C). Example 17 Targeting Endogenous NbPDS Sites Using the SYNV CRISPR / Cpfl Vector The endogenous NbPDS gene is further selected to verify the mutagenesis efficiency induced by the SYNV CRISPR / Cpfl vector in the present disclosure. According to the CRISPR RGEN online design software, two 23-nt target sites (crPDSl: 5'-TGCCGTTAATTTGAGAGTCCAAG-3', crPDS-2: 5'-GTAGTAGCGACTCCATGGGGCAT-3', SEQ ID NOs: 27 and 28, Hinfl and Ncol restriction sites are underlined) conserved in both NbPDS homoeologs (PDSa and PDSb; FIG 21 A) were selected. The SYNV-crPDSl-Cpfl and SYNV-crPDS2-Cpfl with crRNA targeting to each site were constructed according to the method in Example 15. Following agroinoculation, these vectors were found fully infectious in N. benthamiana plants, inducing symptoms typical of SYNV infection (FIG 21B). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both homoeologs. Mutagenesis frequencies ranging from 67% to 79% were detected (FIG 2IC). For example, the mutation frequencies at the crPDSl site of three randomly selected plants were 79%, 70%, and 73%, respectively. To verify crPDS 1 mutation patterns, PCR was performed with primers specific for each homoeolog (Table 7). The amplified products were cloned, and 10 randomly selected clones for each homoeolog were subjected to Sanger sequencing. Eight and eight clones in PDSa and PDSb loci carried targeted mutation, which is consistent with the frequencies detected by PCR / RE assay. Mutation patterns were mainly single or multiple base deletions (FIG 2ID). Example 18 Multiplexed Mutagenesis of GFP and NbPDS Genes Using SYNV CRISPR / Cpfl Vector To exploit the use of SYNV CRISPR / Cpfl vector for multiplex editing, we engineered SYNV vector for tandem expression of two crRNAs in a DR-crRNAl-DR-crRNA2-DR configuration, and authentic crRNAl and crRNA2 are expected to be released through Cpfl self-cleavage (FIG 22). The SYNV-crGFP-l / PDS-l-Cpfl vector was constructed according to the method in Example 15, and express two crRNAs targeting the crGFP-1 (showed in Example 16) and crPDSl (showed in Example 17) sites. Upon agroinoculation with this vector, N. benthamiana 16c transgenic plants developed systemic symptoms similar to those infected with of SYNV-WT (FIG 23A). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants, and mutagenesis frequencies up to 82% were detected (FIG 23B). These results show that multiplexed expression of crRNA by SYNV vectors dose not compromise editing efficiency. Example 19 Plant Regeneration From SYNV CRISPR / Cpfl-infected Tissues and Genotyping and Phenotyping To obtain mutant plants from genetic modified somatic cells infected with SYNV-crPDSl-Cpfl, symptomatic upper leaf tissues were subjected to tissue regeneration under selection-free conditions according to the method in Example 10. Among 31 regenerated plants, four were albino and 27 were normal green (FIG 24A). PCR / RE assays and Sanger sequencing were performed with DNA samples amplified from the 31 regenerated M0 plants, and the results showed that: 1) four albino plants (M0-1, -2, -3, -4) were fully resistant to Hinfl digestion, and mutations in all four PDS homoeoalleles cause an albino phenotype; 2) 12 of the 27 normal plants (MO-9, -11, -14, -15, -16, -17, -21, -22, -23, -24, -26, -29) were also fully Hinfl-resistant, suggesting mutations in all four PDS homoeoalleles did not totally inactivate PDS functions; 3) the 15 other normal plants displayed digestion patterns of partial (MO-6, -8, -13, -18, -19) or no editing (M0-5, -7, -10, -12, -20, -25, -27, -28, -30, -31) (FIG 24B). RT-PCR assays were conducted to detect the presence of the viral vector in M0 plants and about 20% of regenerated plants were free of virus and carried targeted mutations, indicating that virus-free and transgene-free regenerated plants with targeted mutation can be obtained in M0 generation (FIG 24C). Example 20 Inheritance of Mutations Induced by Virally Delivered CRISPR / Cpfl Nuclease To investigate whether the mutations induced by SYNV delivered CRISPR / Cpfl are germline transmissible, the heritability of crPDS-1 target mutations in next generations was analysed according to the method in example 11. M0 plants (MO-9, -11, -14, -15, -16, -17, -21, -22, -23, -24, -26, -29) containing altered yet functional PDS homoeoalleles were selected for self-pollination. Ml seeds harvested from M0 plants were germinated on Murashige & Skoog (MS) medium. The normal / albino phenotypes at a segregation ratio of 3:1 or 15:1 in Ml populations from M0 lines having one (M0-11, -14, -16, -17, -21, -23, -24, -26) or two (MO-9, -29) functional PDS homoeoalleles were observed, and M0 plants homozygous for non-frameshift PDS-a and / or PDS-b homoeoalleles (M0-15, -22) did not yield albino Ml offspring (FIG 25). These results indicated mutations were passed from M0 to Ml generation following classic Mendelian laws. Example 21 Generation of SYNV CRISPR / Cas9 Vector Derivatives with Truncated Glycoprotein The rhabdovirus G protein is type I membrane protein consisting of a signal peptide (SP), an N-terminal domain (NT), a transmembrane domain (TM), and a C-terminal domain (CT). In mature enveloped virions, G protein forms a trimer and is embedded on the surface of the virus particle, with the NT domain exposed on the virion surface. G protein binds to specific receptor in the insect vector cells and mediates virus entry, thus is indispensable for insect transmission. We reason that if the NT domain of G protein is deleted or substituted, the mutant viruses would be no longer insect-transmissible and easy to contain in laboratory. To  construct the CRISPR / Cas9 vectors with a truncation of the G protein NT domain, the plasmid SYNV-tgtPDSl-Cas9 was digested by Bsu36I and Nhel to release the entire CRISPR-Cas9 cassette, and the released cassette  was then inserted into  the vector  SYNV-RFP-dGN or  SYNV-RFP-mCherry:GN  to produce SYNV-tgtPDSl-Cas9-dGN and SYNV-tgtPDSl-Cas9-mCheny:GN (FIG26A). The SYNV-tgtPDSl-Cas9-dGN and SYNV-tgtPDSl-Cas9-mCherry:GN vector plasmids were electroporated into Agrobacterium EHA105 strain, and N. benthamiana plants were agroinoculated by these viral vectors as described in Example 1. As a control, N. benthamiana plants were agroinoculated with the wild-type SYNV-tgtPDSl-Cas9 vector in parallel. By 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms similar to those infected with of SYNV-WT, and red fluorescence was observed in the veins and mesophyll cells of the upper non-inoculated leaves of plants infected with SYNV-tgtPDSl-Cas9-mCherry:GN (FIG 26B). The total protein extracted from upper leaves of infected plants was analyzed by Western blot with G protein specific polyclonal antisera. The SYNV-tgtPDSl-Cas9 protein sample contained a G protein band matching that in the SYNV-WT sample, whereas the SYNV-tgtPDSl-Cas9-mCherry:GNsample produced a specific band of about 36 kD corresponding to the expected size of mCherry:GN fusion (FIG 26C). PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants using primers conserved for both PDS homoeologs, and the results showed that the targeted mutagenesis frequencies induced by SYNV-tgtPDSl-Cas9-dGN and SYNV-tgtPDSl-Cas9-mCherry:GN was equivalent to those in SYNV-tgtPDSl-Cas9 (FIG 26D). Taken together, the data above show that the deletion or replacement of G protein N-terminal domain did not affect the abilities of these recombinant viruses to infect plant and induce targeted gene editing. Example 22 Evaluation of the Effect of Cas9 Codon-optimization on Mutagenesis Efficiency The above SYNV CRISPR / Cas9 vector carry a Cas9 gene optimized for mammalian cell expression, we next tested a similar vector with tobacco codon-optimized Cas9 gene, termed SYNV CRISPR / oCas9, and compared the targeted mutagenesis efficiency. For this purpose, the tobacco codon-optimized Cas9 according to SEQ ID: 36 was chemically synthesized. We amplified the fragments Bsu36I-N / P J, oCas9 ORF, and N / P J-Nhel with the primer pairs N-Bsu36I / F and NPJ-oCas9 / R, oCas9 / F and Cas9 / R, Cas9-NPJ / F and P-Nhel / R (Table 6), using the SYNV, oCas9 sequence, SYNV as templates, respectively. The fragment Bsu36I-N / P J contains region from Bsu36I restriction site in the N gene to the downstream N / P junction, and the fragment N / P J-Nhel contains region from the upstream N / P junction sequence to the Nhel restriction site in the P gene. These fragments above all contain 15-20 bp sequences homologous to the adjacent fragments, while fragment Bsu36I-N / P J and N / P J-Nhel contain sequences homologous to the Bsu36I and Nhel linearized SYNV vector, which facilitate ligation through In-Fusion to obtain the SYNV-oCas9. To construct SYNV-tgtPDS2-oCas9, we amplified the fragment N / Bsu36I-PDS2 and PDS2-oCas9 / Bsu36I with the primer pairs N-Bsu36I / F and PDS2 20nt / R, PDS2 20nt / F and oCas9 / Bsu36I / R (Table 6), using the SYNV-tgtPDS2-Cas9 and SYNV-oCas9 vector as templates, respectively. The above-mentioned fragments were ligated through multi-segment In-Fusion cloning method to obtain the vector SYNV-tgtPDS2-oCas9. N. benthamiana plants were agroinoculated by the SYNV-tgtPDS2-oCas9 and SYNV-tgtPDS2-Cas9 vectors as described in Example 1. At 30 dpi, all inoculated plants exhibited leaf curling and vein clearing symptoms (FIG 27B). 10 plants infected with SYNV-tgtPDS2-Cas9 or SYNV-tgtGFP2-oCas9 were randomly selected to compare the mutagenesis efficiency. PCR / RE assay showed that the mutation frequencies were 41-81% in SYNV-tgtPDS2-Cas9-infected plants and 76-91% in SYNV-tgtGFP2-oCas9-infected plants (FIG 27C). Thus, codon optimized Cas9 appears to increase the mutation efficiency slightly. Example 23 Engineering of an SYNV Vector for Expression sgRNA and Cas9 from a Single Transcription Unit To verily that sgRNA and Cas9 can be engineered to express from a single transcription unit in the SYNV genome, the sgRNA sequence is fused to the 3' end of the oCas9 with a 15 bp connecting sequence (5'-AAGCCATGGGATATC-3') to form a single transcript unit. This cassette was inserted between the N and P genes (FIG 28A). For this purpose, we amplified the fragments oCas9 / BstEII-linker, linker-Scaffold, N / P J-Nhel with primer pairs oCas9 / BstEII / F and Cas9 / R, oCas9 / linker P2 / F and gRNA / R, gRNA / NPJ / F and P / Nhel / R (Table 6) and using SYNV-oCas9, SYNV-tgtPDS2-Cas9, and SYNV plasmid as templates, respectively. The above-mentioned three fragments can be inserted into the linearized SYNV-oCas9 vector through In-Fusion cloning to obtain the SYNV-oCas9gPDS2 vector. For comparison, N. benthamiana plants were agroinoculated with the SYNV-oCas9gPDS2 or SYNV-tgtGFP2-Cas9 vector. By about 30 dpi, all inoculated plants exhibited similar systemic symptoms (FIG 28B). PCR / RE assay showed that the somatic mutation frequencies were 41-84% for SYNV-oCas9gPDS2 plants and 47-85% for SYNV-tgtPDS2-Cas9 plants (FIG 28C). The results show that sgRNA and Cas9 can be expressed from a single transcription unit in SYNV genome without compromising gene editing efficiency. Example 24 Engineering of EMDV Vector for Reporter Gene Expression in N. benthamiana We inserted the GFP or RFP reporter genes into the EMDV genome between N and X genes as independent transcription units. The procedure for constructing recombinant EMDV and EMDV-GFP clones has been described previously (Chinese Patent CN 111849927 A). In EMDV-GFP, the GFP expression cassette was engineered in the virus genome between the leader (le) and N genes. Here we also generated an EMDV-RFP clone where RFP cassette driven by a duplicated N / X gene junction sequence was inserted into EMDV genome between the N and X genes (FIG 29A). To do so, we amplified the fragments A, B, and C with the primer pairs EMDV-Spel / F and EMDV-A / R, EMDV-RFP / F and EMDV-RFP / R, EMDV-C / F and EMDV-Spel / R (Table 6) using the EMDV-WT plasmid and an RFP gene as templates. The fragment A contains region spanning from the Spel restriction site in the N gene to the downstream N / X gene junction, the fragment B contains RFP coding region, the fragment C contains region covering the upstream N / X gene junction sequence to the Spel restriction site in the M gene. The fragments were ligated with the Spel-linearized EMDV clone through In-Fusion to obtain the vector EMDV-RFP (FIG 29A). The EMDV-GFP and EMDV-RFP vector plasmids were electroporated to Agrobacterium EHA105 strain and N. benthamiana plants were agroinfiltrated with bacterial mixture harboring by each of the EMDV vector, along with the supporting binary vectors pGD-EMDV N, pGD-EMDV P, pGD-EMDV L, pGD-Hc-Pro, pGD-pl9, and pGD-yb, as described in Example 1. By about 23 dpi, the inoculated plants displayed symptoms typical of EMDV infection such as leaf cupping, stunting, and vein clearing, and strong GFP or RFP fluorescence were observed in the veins and mesophyll cells of the upper non-inoculated leaves (FIG 29 B and C). To verify EMDV infection, total protein samples were extracted from the upper young leaves of infected plants and subjected to Western blot analyses using antibodies raised against EMDV virions, GFP, or RFP. Expression of EMDV structure proteins and GFP or RFP protein were detected in EMDV-GFP- and EMDV-RFP-infected tissues. These results show that foreign gene expression cassettes inserted into several EMDV genomic positions (Le / N or N / X) can be efficient expressed in systemically infected tissues. Example 25 Infection of Solanaceous Crop Plants with Recombinant EMDV-GFP and EMDV-RFP Vectors EMDV infects naturally potato, tobacco, tomato, eggplant, cucumber and several other crop species. Therefore, the recombinant EMDV-RFP or EMDV-GFP viruses recovered from agroinoculated N. benthamiana leaves were used as lancing pads to initiate infection in several solanaceous plants through mechanical inoculation, stem injection, high pressure spray, grafting. Tobacco (N. tabacum) plants were rub inoculated with EMDV-RFP sap extracted from infected N. benthamiana plants. By about 30 dpi, the inoculated N. tabacum plants developed veins yellowing in newly emerged upper leaves, and the symptoms became severer by 45 dpi, showing twisted and deformed leaves. Strong red fluorescence was detected in infected leaves and stems under a fluorescence microscope and with Western blot analysis (FIG 30A). Using similar sap inoculation or high pressure spray methods, EMDV-RFP and EMDV-GFP was found to be infectious in eggplant, tomato, and potato plants (FIG 30B); however, systemic infection of potato plants after sap inoculation was less efficient. To develop a more efficient method to infect potato plants, we used heterografting method to transmit the virus from N. benthamiana to potato plants. 3-week-old N. benthamiana stems were cut with a 2-3 cm slit at the top and 1- to 2-month-old potato inflorescence stems were cut and trimmed into a V-shape. The scion was inserted into the slit of the stock and wrapped tightly with parafilm. A wooden bar was set along the stock and the scion for support. The entire scion was covered with a plastic bag, which had been sprayed inside with water beforehand. Grafted plants were grown for 7 days in an incubator at 27°C under continuous light (~30 pmol m 2 s 1), or in a greenhouse at 22-35°C under natural light (500-1500 pmol m 2 s 1 during the day). After this period, the plastic bags were partly opened by cutting the bags and making holes for acclimation. The next day, the plastic bags were removed and the grafted plants were grown in an incubator at 22-25°C under continuous light (~100 pmol m 2 s 1), in a plant growth room at 22-30°C under continuous light (~80 pmol m 2 s 1), or in a greenhouse. The N. benthamiana rootstock was then agroinoculated / mechanical inoculated with recombinant EMDV. After incubating at 24°C for about one month, systemic infection of potato scion by EMDV-RFP was successfully achieved, and strong red fluorescence could be observed in the rootstock and scion leaves (FIG 30C). Example 26 Engineering of EMDV CRISPR / Cas9 Vectors and Mutagenesis of GFP Transgene in N. benthamiana We next engineered the sgRNA and Cas9 genes into the EMDV genome between the N and X genes as two independent transcription units, each of which was driven by a duplicated N / X gene junction sequence to direct mRNA transcription. Firstly, we constructed an intermediate vector pGD-N / X junction-AarI-AarI-Cas9-NX junction, which contains two EMDV N / X junctions, two Aarl restriction sites, and Cas9 coding sequence. The sequence of GFP target site 2 (gGFP2: 5'-ACAAGTGTTGGCCATGGAAC-3'. SEQ ID NO: 20, Ncol site underlined) was selected and inserted in the intermediate vector through primer annealing (GFP2-AarI / F and GFP2-AarI / R) and Aarl digestion, which generated the pGD-NX-tgtGFP2-Cas9-NX plasmid. Secondly, we amplified the fragment I, II-GFP2, and III with primer pairs EMDV-Spel / F and EMDV-I / R, EMDV-II / F and EMDV-II / R, EMDV-III / F and EMDV-Spel / R (Table 6) and using EMDV-WT, pGD-NX-GFP2-Cas9-NX, EMDV-WT as templates, respectively. The fragments I, II-GFP2, and III were ligated with the Spel-linearized EMDV clone through In-Fusion cloning method to produce the EMDV-tgtGFP2-Cas9 vector (FIG 31 A). N. benthamiana 16c transgenic plants were agroinoculated with EMDV-tgtGFP2-Cas9 as described in Example 1. By about 30 dpi, the inoculated plants exhibited systemic infection with leaf curling and vein clearing symptoms. The GFP fluorescence decreased significantly in plants infected with EMDV-tgtGFP2-Cas9 when examined under a handheld ultraviolet lamp. In contrast, healthy 16c plant exhibited strong GFP fluorescence (FIG 3 IB). Upper leaves of the infected plants above were collected, and total protein was extracted. Western blot was performed with antibody raised against EMDV virions and Flag epitope (fused with Cas9 protein). EMDV structure proteins and Cas9 protein were detected (FIG 32B). These data indicate that the EMDV vector is capable of carrying the entire Cas9 and sgRNA expression cassettes and expressing the Cas9 protein in systemically infected tissues. PCR / RE assays were performed with DNA samples amplified from symptomatic systemic leaves of infected plants, and the data showed that the mutation frequencies at the gGFP2 site was about 90% (FIG 3 IC). To verily gGFP2 mutation patterns, PCR was performed with primers GFP / F and GFP / R (Table 7). The amplified products were cloned, and nine randomly selected clones were subjected to Sanger sequencing. Eight clones carried targeted mutation, which is consistent with the frequencies detected by PCR / RE assay (FIG 32C). Mutation patterns were mainly single or multiple base deletions and single base insertion (FIG 3 ID). Example 27 Targeting an Endogenous NbPDS Site Using the EMDV CRISPR / Cas9 Vector The endogenous NbPDS gene is further selected for targeted mutagenesis using the EMDV CRISPR / Cas9 vector. According to the CRISPR-P online design software, we selected the 20-nt gPDS4 target site (5'-CAATACAGTTAACTATTTGG-3'; SEQ ID NO: 24), which is conserved in PDS homologs in several solanaceous hosts including N. benthamiana, tobacco, potato, and tomato. N. benthamiana is an allotetraploid, the target site is conserved in both NbPDS homoeologs (PDSa and PDSb; FIG 32C). The genomic sequence of the target genes were retrieved from the Sol Genomics Network (https: / / solgenomics.net / ) with the gene IDs shown in FIG 32C. EMDV-tgtPDS4-Cas9 was constructed using similar procedure to the EMDV-tgtGFP2-Cas9 vector described above (FIG 32A). N. benthamiana plants were agroinoculated by the viral vector using the procedure described in Example 1. At 40 dpi, most inoculated plants exhibited leaf curling and vein clearing symptoms (FIG 32B). PCR were performed with DNA samples from symptomatic systemic leaves of infected plants using primers PDS-4a / F and PDS-4a / R, PDS-4b / F and PDS-4b / R, respectively (Table 7), and T7EI digestion assays revealed efficient mutagenesis in both NbPDS homoeologs (FIG 32C). These data show endogenous gene loci are efficiently modified by EMDV-delivered CRISPR / Cas9 nuclease. Example 28 Targeted Mutagenesis in tobacco, potato, and tomato Plants by Infection with EMDV-tgtPDS4-Cas9 The recombinant EMDV-tgtPDS4-Cas9 vector recovered from N. benthamiana following agroinoculation was used to infect tobacco, potato, and tomato plants using the method described in Example 25. About 30-45 days post inoculation, the infected plants developed symptoms. Total DNA were extracted from symptomatic systemic leaves of infected tobacco, potato, and tomato plants, and the target regions were amplified using the primer pairs PDS-Nt / F and PDS-Nt / R, PDS-ST / F and PDS-ST / R, PDS-SL / F and PDS-SL / R (Table 7), respectively. Sequencing of cloned DNA amplicons revealed that the PDS4 target sites of these plants above contained mutations, and mutation patterns were mainly single or multiple base deletions and base substitutions (FIG 33). Results above indicated that the EMDV CRISPR / Cas9 vector has successfully achieved targeted mutation in the genomes of A. tabacum, S. tuberosum and S. lycopersicon. MO Line No. Phenotype Genotype Vims Hinjl digestible Percentage Zygosity (PDSa / b) Mutation type (PDSa / b) Genotype MO-1 Albino No 17 / 30 (56.7%) Bi / Bi d5d7 / d5dl aabb + MO-2 No Bi / Bi dld7 / d4d7 aabb + MO-4 No Bi / Bi dld7 / dlil aabb + MO-5 No Ho / Ho ilil / ilil aabb + MO-9 No Bi / Ho ild2 / ilil aabb + MO-11 No Bi / Bi d2d8 / ild8 aabb + MO-8 Normal No Bi / Bi dlil / d3d5 aabb + MO-18 No Bi / Bi dld8 / d4d6 aabb + MO-21 No Bi / Bi dld8 / d4d6 aabb + MO-22 No Bi / Bi d4d9 / d7d9 aabb + MO-27 No Bi / Bi dld6 / d4d6 aabb + MO-29 No Bi / Bi d4d6 / d3il aabb + MO-31 No Bi / Bi d7il / d7d9 aabb + MO-32 No Bi / Bi d4d8 / d6d72 aabb + MO-33 No Bi / Bi d7il / d7d9 aabb + MO-36 No Bi / Bi d3d5 / dld8 aabb + MO-42 No Bi / Bi d3d5 / d5d9 aabb - MO-3 Yes 2 / 30 (6.7%) WT / WT WT / WT AABB - MO-6 Yes WT / WT WT / WT AABB + MO-7 Partial 11 / 30 (36.6%) He / He WTd4 / WTd6 AaBb - M0-10 Partial NT NT NT + MO-12 Partial NT NT NT + MO-13 Partial NT NT NT + MO-15 Partial NT NT NT + MO-23 Partial NT NT NT + MO-28 Partial NT NT NT + MO-34 Partial Ch / Ch WT,dl,d2,d6 ,d7,il / WT,d4, d3 NT + MO-35 Partial NT NT NT + MO-39 Partial NT NT NT + MO-41 Partial NT NT NT + MONo. Genotype (PDSa / b) Ml progeny M2 Progeny phenotype Plant ID Phenotype Genotype (PDSa / b) Zygosity (PDSa / b) Normal Albino Total 8 dlil / d3d5 8-1 Albino dldl / d5d5 Ho / Ho n / a n / a n / a 8-9 Normal dlil / d3d5 Bi / Bi 75 24 99 8-10 Normal ilil / d3d3 Ho / Ho 107 0 107 8-7 Normal ilil / d3d3 Ho / Ho 132 0 132 8-8 Normal dlil / d3d5 Bi / Bi 118 37 155 18 dld8 / d4d6 18-1 Albino dld8 / d4d4 Bi / Ho n / a n / a n / a 18-2 Normal dld8 / d4d6 Bi / Bi 78 26 104 18-3 Normal dldl / d6d6 Ho / Ho 94 0 94 18-4 Normal dld8 / d4d6 Bi / Bi 96 30 126 18-5 Normal d8d8 / d4d6 Ho / Bi 141 46 187 22 d4d9 / d7d9 22-1 Albino d4d4 / d7d7 Ho / Ho n / a n / a n / a 22-2 Normal d4d9 / d7d9 Bi / Bi 146 9 155 22-3 Normal d4d9 / d7d7 Bi / Ho 102 32 134 22-4 Normal d4d4 / d9d9 Ho / Ho 131 0 131 22-5 Normal d4d9 / d7d9 Bi / Bi 135 9 144 29 d4d6 / d3il 29-1 Albino d4d4 / ilil Ho / Ho n / a n / a n / a 29-2 Normal d6d6 / d3il Ho / Bi 143 0 143 29-3 Normal d4d6 / d3il Bi / Bi 168 11 179 29-4 Normal d4d4 / d3il Ho / Bi 154 51 205 29-5 Normal d6d6 / d3d3 Ho / Ho 72 0 72 42 d3d5 / d5d9 42-1 Albino d5d5 / d5d5 Ho / Ho n / a n / a n / a 42-2 Normal d3d5 / d9d9 Bi / Ho 120 0 124 42-3 Normal d3d5 / d5d5 Bi / Ho 158 51 209 42-4 Normal d5d5 / d9d9 Ho / Ho 163 0 163 42-5 Normal d3d5 / d5d5 Bi / Ho 168 62 230 Table 3 Germline Transmission of CRISPR-Cas9-mediated N. benthamiama PDS gene Loci Modification from the Ml to M2 Plants Ml Line No. Genotype (PDSa / b) Zygosity (PDSa / b) virus M2 Segregation ratio 8-3 ilil / d3d3 Ho / Ho — 10ilil / 10d3d3 18-3 dldl / d6d6 Ho / Ho — 10dldl / 10d6d6 22-4 d4d4 / d9d9 Ho / Ho — 10d4d4 / 10d9d9 29-5 d6d6 / d3d3 Ho / Ho — 10d6d6 / 10d3d3 42-4 d5d5 / d9d9 Ho / Ho — 10d5d5 / 10d9d9 Ml No,_____________Sequences Mutation type Ml No,_____Sequences_____Mutation type MO-1 a: GCCGTTAATTT-----TCCA d5 M0-29a: GCCGTTAATTTGA----CCA d4 b : GCCGTTAATT-------CCA GCCGTTAATTT-----TCCA d7 d5 b : GCCGTTAATTT------CCA GCCGTTAATTTGAG---CCA d6 d3 MO-2 a: GCCGTTAATTTGAGA-TCCA GCCGTTAATTTGAGA-TCCA dl dl M0-31a: GCCGTTAATTTGAGAGTTCCA GCCGTTAATT-------CCA il d7 b : GCCGTTAATT-------CCA GCCGTTAATTTGA--- CCA d7 d4 b : GCCGTTAATTTGAGAGTTCCA GCCGTTAATT-------CCA il d7 MO-4 a: GCCGTTAATT-------CCA GCCGTTAATTTGAGA-TCCA d7 dl M0-32a: GCCGTTA---------TCCA GCCGTTAATTTGA----CCA d9 d4 b : GCCGTTAATT-------CCA GCCGTTAATTTGAGA-TCCA d7 dl b : GCCGTTAAT--------CCA GCCGTTAATTT------CCA d8 d6 MO-5 a: GCCGTTAATTTGAGAGTTCCA GCCGTTAATTTGAGAGTTCCA 11 il M0-33a: GCCGTTAATT-------CCA d72 d7 b : GCCGTTAATTTGAGAGTTCCA il GCCGTTAATTTGAGAGTTCCA il MO-9 a: GCCGTTAATTTGAGAGTTCCA il b : GCCGTTAATT-------CCA d7 b : GCCGTTAATTTGAGA—CCA GCCGTTAATTTGAGAGTTCCA d2 il M0-36a: GCCGTTA---------TCCA GCCGTTAATTTGA---TCCA d9 d3 MO-lla: GCCGTTAATTTGAGA—CCA d2 GCCGTTAATTTGA-----CA d5 GCCGTTAAT--------CCA d8 b : GCCGTTAATTTGAGAG-CCA dl b : GCCGTTAATTTGAGAGTTCCA il GCCGTTAAT--------CCA d8 GCCGTTAAT--------CCA d8 M0-42a: GCCGTTAATTTGAG---CCA d3 MO-8 a: GCCGTTAATTTGAGA-TCCA dl GCCGTTAATTT-----TCCA d5 GCCGTTAATTTGAGAGTTCCA il b : GCCGTTAATTT-----TCCA d5 b : GCCGTTAATTTGAGAGT--- d3 GCCGTTAA---------CCA d9 GCCGTTAATTT-----TCCA d5 MO-3 a: GCCGTTAATTTGAGAGTCCA WT M0-18a: GCCGTTAATTTGAGA-TCCA dl b : GCCGTTAATTTGAGAGTCCA WT GCCGTTAA--------TCCA d8 MO-6 a: GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATTTGAG----CA d4 b : GCCGTTAATTTGAGAGTCCA WT GCCGTTAATTT------CCA d6 MO-7 a: GCCGTTAATTTGAGAGTCCA WT M0-21a: GCCGTTAATTTGAGA-TCCA dl GCCGTTAATTTGA----CCA d4 GCCGTTAA--------TCCA d8 b : GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATTTGAG----CA d4 GCCGTTAA------AGTCCA d6 GCCGTTAATTT------CCA d6 M0-34a: GCCGTTAATTTGAGAGTCCA WT M0-22a: GCCGTTAATTTGA----CCA d4 GCCGTTAATTTGAGA-TCCA dl b : GCCGTTAA---------CCA GCCGTTAATT-------CCA d9 d7 GCCGTTAATTTGAGA—CCA GCCGTTAATTT------CCA d2 d6 M0-27a: GCCGTTAA---------CCA GCCGTTAATTTGAGA-TCCA d9 dl GCCGTTAATT-------CCA GCCGTTAATTTGAGAGTTCCA d7 il GCCGTTAATTT------CCA d6 b : GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATTTGAG----CA d4 GCCGTTAATTTGAG---CCA d3 GCCGTTAATTT------CCA d6 GCCGTTAATTTGA----CCA d4 Ml No. Sequences     Mutati ion type Ml No. Sequences     Mutation type M8-1 a: GCCGTTAATTTGAGA-TCCA dl M29-la: GCCGTTAATTTGA----CCA d4 b : GCCGTTAATTT-----TCCA d5 b : GCCGTTAATTTGAGAGTTCCA il M8-9 a: GCCGTTAATTTGAGA-TCCA GCCGTTAATTTGAGAGTTCCA dl il M29-2a: GCCGTTAATTT------CCA GCCGTTAATTTGAG---CCA d6 d3 b : GCCGTTAATTTGAGAGT--- d3 b : GCCGTTAATTTGAGAGTTCCA il GCCGTTAATTT-----TCCA d5 M29-3a: GCCGTTAATTTGA----CCA d4 M8-10a: GCCGTTAATTTGAGAGTTCCA il GCCGTTAATTT------CCA d6 b : GCCGTTAATTTGAGAGT--- d3 b : GCCGTTAATTTGAG---CCA d3 M8-7 a: GCCGTTAATTTGAGAGTTCCA il GCCGTTAATTTGAGAGTTCCA il b : GCCGTTAATTTGAGAGT--- d3 M29-4a: GCCGTTAATTTGA----CCA d4 M8-8 a: GCCGTTAATTTGAGA-TCCA G CC GT TAAT TT GAGAGT TC CA dl il b : GCCGTTAATTTGAG---CCA GCCGTTAATTTGAGAGTTCCA d3 il b : GCCGTTAATTTGAGAGT--- d3 M29-5a: GCCGTTAATTT------CCA d6 GCCGTTAATTT-----TCCA d5 b : GCCGTTAATTTGAG---CCA d3 M18-la: GCCGTTAATTTGAGA-TCCA dl M42-la: GCCGTTAATTT-----TCCA d5 GCCGTTAA--------TCCA d8 b : GCCGTTAATTT-----TCCA d5 b : GCCGTTAATTTGAG----CA d4 M42-2a: GCCGTTAATTTGAG---CCA d3 M18-2a: GCCGTTAATTTGAGA-TCCA dl GCCGTTAATTT-----TCCA d5 GCCGTTAA--------TCCA d8 b : GCCGTTAA---------CCA d9 b : GCCGTTAATTTGAG----CA GCCGTTAATTT------CCA d4 d6 M42-3a: GCCGTTAATTTGAG---CCA GCCGTTAATTT-----TCCA d3 d5 M18-3a: GCCGTTAATTTGAGA-TCCA dl b : GCCGTTAATTT-----TCCA d5 b : GCCGTTAATTT------CCA d6 M42-4a: GCCGTTAATTT-----TCCA d5 M18-4a: GCCGTTAATTTGAGA-TCCA dl b : GCCGTTAA---------CCA d9 GCCGTTAA--------TCCA d8 M42-5a: GCCGTTAATTTGAG---CCA d3 b : GCCGTTAATTTGAG----CA d4 GCCGTTAATTT-----TCCA d5 GCCGTTAATTT------CCA d6 b : GCCGTTAATTT-----TCCA d5 M18-5a: GCCGTTAA--------TCCA d8 M7-1 a: GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATTTGAG----CA d4 GCCGTTAATTTGA----CCA d4 GCCGTTAATTT------CCA d6 b : GCCGTTAATTTGAGAGTCCA WT M22-la: GCCGTTAATTTGA----CCA d4 M7-2 a: GCCGTTAATTTGA----CCA d4 b : GCCGTTAATT-------CCA d7 GCCGTTAATTTGAGAGTCCA WT M22-2a: GCCGTTAATTTGA----CCA d4 b : GCCGTTAA------AGTCCA d6 GCCGTTAA---------CCA d9 M7-3 a: GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATT-------CCA d7 GCCGTTAATTTGA----CCA d4 GCCGTTAA---------CCA d9 b : GCCGTTAA------AGTCCA d6 M22-3a: GCCGTTAATTTGA----CCA d4 M34-la: GCCGTTAATTTGAGAGTCCA WT GCCGTTAA---------CCA d9 b : GCCGTTAATTTGAGAGTCCA WT b : GCCGTTAATT-------CCA d7 M34-2a: GCCGTTAATTTGAGAGTCCA WT M22-4a: GCCGTTAATTTGA----CCA d4 GCCGTTAATTTGAGAGTTCCA il b : GCCGTTAA---------CCA d9 b : GCCGTTAATTTGAGAGTCCA WT M22-5a: GCCGTTAATTTGA----CCA d4 M34-3a: GCCGTTAATTTGAGAGTTCCA il b : GCCGTTAA---------CCA GCCGTTAATT-------CCA GCCGTTAA---------CCA d9 d7 d9 b : GCCGTTAATTTGAGAGTCCA WT Primer Sequence (51 to 31) Application N-Bsu36l / F AGATCTTCAATGTCCTCAGGTTC Construction of SYNV-GFP-RFP NPJ-GFP / R GCCCTTGCTCACCATGG Construction of SYNV-GFP-RFP GFP / F atggtgagcaagggCGAGGA Construction of SYNV-GFP-RFP NPJ-RFP / R ctcggaggaggccatGGCCTAGACAAATAATACAAACAG Construction of SYNV-GFP-RFP RFP / F ATGGCCTCCTCCGAGAACGT Construction of SYNV-GFP-RFP P-Nhel / R TTTTCCGTATGACATGCTAGCC Construction of SYNV-GFP-RFP Flag-NPJ / R gtggtccttatagtccatGGCCTAGACAAATAATACAAACAG Construction of SYNV-Cas9 Cas9 / F ATGGACTATAAGGACCACGAC Construction of SYNV-Cas9 Cas9 / R 1 1 AC 1 1 1 1 1 C 1 1 1 1 1 1 GCC 1 GGC Construction of SYNV-Cas9 Cas9-NPJ / F gcaaaaaagaaaaagta aTAAACTACAG CCACAACTCTACC Construction of SYNV-Cas9 GFP2-NPJ / R gttccatggccaacacttgtGGCCTAGACAAATAATACAAACAG Construction of SYNV-gRNA-Cas9 GFP2-gRNA / F acaagtgttggccatggaacGTTTTAGAGCTAGAAATAGCAAG Construction of SYNV-gRNA-Cas9 gRNA / R CjCACCCjAC 1 CCjCj 1 CjCCAC 1 1 1 1 1 C Construction of SYNV-gRNA-Cas9 gRNA-NPJ / F aagtggcaccgagtcggtgcTAAACTACAGCCACAACTCTAC Construction of SYNV-gRNA-Cas9 Cas9-Ahdl / R TTGTCTTGCCGGACTGCTT Construction of SYNV-gRNA-Cas9 NPJ / R GGCCTAGACAAATAATACAAACAG Construction of SYNV-tgtRNA-Cas9 NPJ-tRNA / F ttatttgtctaggccAACAAAGCACCAGTGGTCTAG Construction of SYNV-tgtRNA-Cas9 NPJ-tRNA / R tgtggctgtagtttaTGCACCAGCCGGGAATC Construction of SYNV-tgtRNA-Cas9 NPJ / F TAAACTACAGCCACAACTCTACCT Construction of SYNV-tgtRNA-Cas9 GFP-l / F GATACCCAGATCATATGAAG RT-PCR detection of gRNA insert gRNA / R CjCACCCjAC 1 CCjCj 1 CjCCAC 1 1 1 1 1 C RT-PCR detection of gRNA insert Cas9 / F ATGGACTATAAGGACCACGAC RT-PCR detection of Cas9 insert Cas9-Ahdl / R TTGTCTTGCCGGACTGCTT RT-PCR detection of Cas9 insert SYNV-M / F ATGGCAGGTATATACGCAGTTTCAA RT-PCR detection of SYNV infection SYNV-M / R TCAGTCTCATCTTCAAAGTATGTAGGA RT-PCR detection of SYNV infection NbActin / F CAATCCAGACACTGTACTTTCTCTC RT-PCR detection of Actin mRNA NbActin / R AAGCTGCAGGTATCCATGAGACTA RT-PCR detection of Actin mRNA Scaffold / F GTTTTAGAGCTAGAAATAGCAAG cRT-PCR mapping of gRNA termini GFP-2 / R GTTCCATGGCCAACACTTGT cRT-PCR mapping of gRNA termini Pvul / F TGCCAAATGTTTGAACGATCG Construction of SYNV-Cpfl N-Bsu36l / R CTGAAAGAACAAGAACCTGAGGAC Construction of SYNV-Cpfl N5'UTR / R GATTACCTGCAATTAAAATACTCAAAAAATAC Construction of SYNV-Cpfl Cpfl / F taattgcaggtaatcATGGCTCCTAAGAAGAAGCG Construction of SYNV-Cpfl Cpfl / R tgtggctgtagttta 1CAC1 ILI 1 1 1 Id IAGCCIGICC Construction of SYNV-Cpfl N5'UTR-GFP1 / F taattgcaggtaaAATTTCTACTAAGTGTAGATAAGATACCCAGATCATATGAAGC Construction of SYNV-crRNA-Cpfl NPJ-GFP1 / R tgtggctgtagtttaATCTACACTTAGTAGAAATTGCTTCATATGATCTGGGTATCTT Construction of SYNV-crRNA-Cpfl N5'UTR-GFP2 / F taattgcaggtaaAATTTCTACTAAGTGTAGATAGGGAGACACCCTCGTCAACAGG Construction of SYNV-crGFP2-Cpfl NPJ-GFP2 / R tgtggctgtagtttaATCTACACTTAGTAGAAATTCCTGTTGACGAGGGTGTCTCCCT Construction of SYNV-crGFP2-Cpfl N5'UTR-PDS1 / F taattgcaggtaaAATTTCTACTAAGTGTAGATTGCCGTTAATTTGAGAGTCCAAG Construction of SYNV-crPDSl-Cpfl NPJ-PDS1 / R tgtggctgtagtttaATCTACACTTAGTAGAAATTCTTGGACTCTCAAATTAACGGCA Construction of SYNV-crPDSl-Cpfl N5'UTR-PDS2 / F taattgcaggtaaAATTTCTACTAAGTGTAGATGTAGTAGCGACTCCATGGGGCAT Construction of SYNV-crPDS2-Cpfl NPJ-PDS2 / R tgtggctgtagtttaATCTACACTTAGTAGAAATTATGCCCCATGGAGTCGCTACTAC Construction of SYNV-crPDS2-Cpfl NPJ-oCas9 / R atccttgtaatccatGGCCTAGACAAATAATACAAACAG Construction of SYNV-oCas9 oCas9 / F ATGGATAAGAAGTACAGTATAGGACTTGATATC Construction of SYNV-oCas9 PDS2 2Ont / F TTGGTAGTAGCGACTCCATG Construction of SYNV-tgtPDS2-oCas9 PDS2 2Ont / R CATGGAGTCGCTACTACCAA Construction of SYNV-tgtPDS2-oCas9 oCas9 / Bsu36l / R AGAGTGCGATAAGGTTACC Construction of SYNV-tgtPDS2-oCas9 oCas9 / BstEII / F AAGAACGGATTATTCGGTAACC Construction of SYNV-oCas9gPDS2 oCas9 / linker / P2 / F AAAAAGAAAAAGTAAAAGCCATGGGATATCTTGGTAGTAGCGACTCC Construction of SYNV-oCas9gPDS2 EMDV-Aatll / F cccttagccatccgagtggac Construction of EMDV-GFP EMDV-N37R ACjIAAIAI 1 Cj IAICj 1 1 Cj 1 1 CjCjCj 1 1 1 1 IAI 1 AAACjCjCjAAIAAIAC 1 1 IAI IACAAIACAC Construction of EMDV-GFP EMDV-N57F AATAAAAACCCAACAACATACAATATTACTTTAAAdTGAATTCATC Construction of EMDV-GFP EMDV-Aatll / R TGGATCTGCCTGTTGGGGAG Construction of EMDV-GFP EMDV-A / R CTTACAAACCAGAAAGGAATCCC Construction of EMDV-RFP EMDV-RFP / F cctttctggtttgtaAGATGATTTCTAATTTCAATTGCATGTG Construction of EMDV-RFP EMDV-RFP / R TTACAGGAACAGGTGGTGG Construction of EMDV-RFP EMDV-C / F accacctgttcctgtaaGATGATTTCTAATTTCAATTGCATGTG Construction of EMDV-RFP EMDV-Spel / F CATGGCACTTTTGAGACTAGTG Construction of EMDV-tgtGFP2-Cas9 EMDV-I / R aaattagaaatcatcTTACAAACCAGAAAGGAATCCCC Construction of EMDV-tgtGFP2-Cas9 EMDV-II / F GATGATTTCTAATTTCAATTGCATGTG Construction of EMDV-tgtGFP2-Cas9 EMDV-II / R ATCTCCTCCAAGTTGTGAAAGATC Construction of EMDV-tgtGFP2-Cas9 EMDV-III / F caacttggaggagatAAAAGGCCGGCGGCCAC Construction of EMDV-tgtGFP2-Cas9 EMDV-Spel / R TCATAGTTAGGAGAGACTAGTGTTTCG Construction of EMDV-tgtGFP2-Cas9 GFP2-Aarl / F AAACGTTCCATGGCCAACACTTGT Construction of EMDV-tgtGFP2-Cas9 GFP2-Aarl / R TGCAACAAGTGTTGGCCATGGAAC Construction of EMDV-tgtGFP2-Cas9 PDS4 / F TGCACAATACAGTTAACTATTTGG Construction of EMDV-tgtPDS4-Cas9 PDS4 / R AAACCCAAATAGTTAACTGTATTG Construction of EMDV-tgtPDS4-Cas9 Sequences in lowercase letters are designed to facilitate In-Fusion cloning. Table 7 PCR Primers Used in Mutation Detection Target loci Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Size (bp) GFP AIGAAGACIAAIC1 1 1 1 ICICI 1 ICICAIC TTAAAGCTCATCATGTTTGTATAGTTCATC 792 PDS-la AAICI Illi IACI 1 1 IGCAIAIAAAI 1 1 G 1 G AACI 1 Al GCCCCAI (jjGAG 1 C 329 / 328 PDS-lb TTTGTGTAATAAATGCTTAAGAACCAG CTTGGATAATCAATGCAGACTAC 284 PDS-2a TTAGGTTCACAAGTGGGACAATCTTC CAGCATCACACTTTCGCATTCAAAAC 333 PDS-2b TTTGTGTAATAAATGCTTAAGAACCAG GCTACTACCAAAACATAACAAATTC 476 / 469 PDS-3 TGTTTTGAATGCGAAAGTGTGATGCTG AACTAATAGAATGATCTTCCTTCCAAAGAAAG 291 / 285 PDS-1 / 3 TTAGGTTCACAAGTGGGACAATCTTC GTTGGGCGTGAGGAAGTACG 492 / 486 RDR6-1 CAAGTATGGAGATGTAGATTAAAG TTTGCGGACTCTGAAGATGC 152 RDR6-4 ATTGTAGAGGTTAGGAGATTGGTTAT GCATAAGTTGATGAAAAGCACTGTCC 461 / 460 SGS3-1 GGTGTTGGAGATATGGGCTTTAACTCTG GACCAATCCCATCCATTCTTCAGAGCAG 368 SGS3-2 GGTGTTGGAGATATGGGCTTTAACTCTG GCGTCTCATAACTCATTTCAGCCACATC 547 PDS-1A AACACAAACAGI IAAGIACI ILI 1 IAAICG GTGGCACTTGGAGTACGAATCCTT 783 PDS-1B (□AAALjAI ICAACAAI IALjIAI 1 ILI 1 IAALjCC AIGGCAC IGGGAG IACGAAI ILIA 797 RDR6-4A CAAATTCGAATCCACAGAGAACTGCA CAGAAGGAGGGTTGACACTTAAATG 408 RDR6-4B CAAATTCAAATCCCCAGAGAACTGCG ATAAGCAGAAACAGGGTTGACACTTAAAATC 414 SGS3-2A CAGCTATATGATGGAGGTCTTGG GATTCGAAAAGTTCTTTGATCCAACG 302 SGS3-2B CAGCTATATGACGGAGGTTCTGT GAGATTCGAAAAGTTCTTTGAACCAACA 304 GFP2 GGTGAAGGTGATGCAACATACGG TGAAGAAGATGGTCCTCTCCTGC 205 PDS-4a Cl IGAI 1 1 IGIGGG IGAAGGC ACAGTTAATCAGAAAAGAATGTACAGG 804 PDS-4b AGTGTGATGCTGAATTTATGATCAC AAATCACTCCTAATCTAATCAGTTGG 382 PDS-ST CTGGTAGCGAATCAATGGGTC GCATGCATTAGAAGACTGCAAC 781 PDS-SL TGGTAGCGAATCAATGGGTC TATCTGCTTCACGTTCTCACAG 815 PDS-Nt GGTAGTAGCGACTCCATGG CTAGTGATAATACAACTAATAGAATGATCTTCC 394 The sizes of PCR products and digestion products for a and b homoeologs, if differented, are denoted by # / #. Table 8 List of Primers Used for the Analysis of Off-target Effects Site name Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Size (bp) OFF-1 Al 1 1 1 IGGIAI 1 1 1 1 IGGGCI 1 1 IAG ATTCCGAGCCGGGTCC 89 OFF-2 CAATGCCCTTATTTCATTAATCTTGT TTAGTCATTCCCGAGTTCTGTGGTTT 390 OFF-3 CCACCGATCCAGTAAAGCTGATAC CCACCATTCAAATAGGCAATAACA 307 OFF-4 CAAGTTCAATTTGCAGACTCATA GACCCTAGGATTTGGAGGTT 114 OFF-5 TTCTCATCTCTATGTCTGATTCG TACAAATCCAATTTGTAGACTCAC 141 OFF-6 GTATTTGCAAGTTTGACTCTAAG CCTAATATATAAGCATACTAGTATCAAAC 154 OFF-7 GTTAATCCTCGTTATGTTCCCTTGCTCT CGAAATCAATCAATTAGTTGGTAAAGAT 552 OFF-8 TTAGCATTGAATGGGTCCAGG GCCTCCAACCCACCATAAA 417 OFF-9 ATTTTCAATTATGCTTGTTTATTCC CCAATTCCAAGCTTTGTAACC 600 OFF-10 TCTTTGCCAGGATGTAATTAAGA GCACATAGGAGTAATAGTGGGTGA 586 OFF-11 GCAACATGAAGTTAGTTTGAGCA GGGGCAGAAGGTAATTAGCAG 596 OFF-12 ICCIGIAAI 1 1 ILI 1 IGIGAI ICG I icccci I ici igaGI 1 CCA 699 OFF-13 TGTGAAAAGAAACTAGCTAACTGGAA CTCCATATGGCCCTCTTACAG 402 MO Line No. Phenotype Genotype Vims Hinjl digestible? Percentage Zygosity (PDSa / b) Mutation type (PDSa / b) Genotype MO-1 albino No 16 / 31 (51.6%) Bi / Bi dl3d4 / d8d7 aabb + MO-2 No Bi / Bi dlldl0 / d8d4 aabb + MO-3 No Bi / Bi dl7d8 / dl9d8 aabb + MO-4 No Bi / Bi dl0d8 / dl9d7 aabb + MO-9 normal No Bi / Bi d8d6 / dlld9 aabb + MO-11 No Bi / Bi dl8dl0 / d8d7 aabb + MO-14 No Bi / Bi d9d7 / d20dl3 aabb + MO-15 No Bi / Ho d95dl0 / d9 aabb + MO-16 No Ho / Bi d8 / d9d7 aabb + MO-17 No Ho / Bi d8 / d9d7 aabb - MO-21 No Bi / Ho d8d9 / d8 aabb + MO-22 No Bi / Ho d6d9 / d7 aabb - MO-23 No Ho / Bi d8d30 / d8 aabb - MO-24 No Bi / Ho d6d7 / d7 aabb - MO-26 No Bi / Ho d7d6 / d7 aabb + MO-29 No Bi / Bi d6d7 / dl5d23 aabb + MO-5 Yes 10 / 31 (32.2%) WT / WT WT / WT AABB + MO-7 Yes WT / WT WT / WT AABB + M0-10 Yes WT / WT WT / WT AABB + MO-12 Yes WT / WT WT / WT AABB + M0-20 Yes WT / WT WT / WT AABB + MO-25 Yes WT / WT WT / WT AABB + MO-27 Yes WT / WT WT / WT AABB - MO-28 Yes WT / WT WT / WT AABB - M0-30 Yes WT / WT WT / WT AABB + MO-31 Yes WT / WT WT / WT AABB + MO-6 Partial 5 / 31 (16.1%) NT NT NT - MO-8 Partial NT NT NT + MO-13 Partial NT NT NT + MO-18 Partial NT NT NT - MO-19 Partial NT NT NT + Bi, biallelic; Ho, tomozygous; He, heterozygous; WT, wi d-type; NT, not tested. Ml No. Sequence Mutation type Ml No. Sequences Mutation type MO-1 a: TTTCTGCCGTTAAT---------------- -------GTAATTC dl3 M0-15a: .............................................. -—GTAATTC d95 TTTCTGCCGTTAATTTGAGA-- -AAGGTAATTC d4 TTTCTGCCGTTAATTTA------------- -—GTAATTC diO b: TTTCTGCCGTTAATTTGAG------ --------GTAATTC d8 b: TTTCTGCCGTTAATTTGAGA------- ---------AATTC d9 TTTCTGCCGTTAATTTGAGAG- ----------TAATTC d7 M0-16a: TTTCTGCCGTTAATTTGA----------- -GGTAATTC d8 MO-2 a: TTTCTGCCGTTAATTTG---------- ----------TAATTC dll b: TTTCTGCCGTTAATTTGAG--------- -------TAATTC d9 TTTCTGCCGTTAATTTGA-------- ----------TAATTC diO TTTCTGCCGTTAATTTGAG--------- -GGTAATTC d7 b: TTTCTGCCGTTAATTTGAG------ --------GTAATTC d8 M0-17a: TTTCTGCCGTTAATTTGA----------- -GGTAATTC d8 TTTCTGCCGTTAATTTGAGAG- —AGGTAATTC d4 b: TTTCTGCCGTTAATTTGAG--------- -------TAATTC d9 MO-3 a: TTTCTGCCGT------------------------ --------GTAATTC dl7 TTTCTGCCGTTAATTTGAG--------- -GGTAATTC d7 TTTCTGCCGTTAATTTGAG------ --------GTAATTC d8 M0-21a: TTTCTGCCGTTAATTTGAG--------- -—GTAATTC d8 b: TTTCTGCCGTTAAT---------------- -------------------c dl9 TTTCTGCCGTTAATTTGAG--------- --------TAATTC d9 TTTCTGCCGTTAATTTGAG------ --------GTAATTC d8 b: TTTCTGCCGTTAATTTGA----------- —GGTAATTC d8 MO-4 a: TTTCTGCCGTTAATTTGAG------ ------------AATTC diO M0-22a: TTTCTGCCGTTAATTTGAGAG-— ------GTAATTC d6 TTTCTGCCGTTAATTTGAG------ --------GTAATTC d8 TTTCTGCCGTTAATTTGAG--------- --------TAATTC d9 b: TTTC----------------------------------CAAGGTAATTC dl9 b: TTTCTGCCGTTAATTTGAGAGT- ----------AATTC d7 TTTCTGCCGTTAATTTGAG------ -—GGTAATTC d7 M0-23a: TTTCTGCCGTTAATTTGAG--------- ------GTAATTC d8 MO-9 a: TTTCTGCCGTTAATTTGAGAG- -----------AATTC d8 b: TTTCTGCCGTTAATTTGAG--------- ................... d30 b: TTTCTGCCGTTAATTTGAG-GT- -------GTAATTC d6 TTTCTGCCGTTAATTTGAG--------- ------GTAATTC d8 TTTCTGCCGTTAATTTG---------- ----------TAATTC dll M0-24a: TTTCTGCCGTTAATTTGAGAG-— ------GTAATTC d6 TTTCTGCCGTTAATTTGA-------- --------GTAATTC d9 TTTCTGCCGTTAATTTGAGAGT- ----------AATTC d7 MO-lla: TTTCTGCCGTTAATT-------------- ------------------c d!8 b: TTTCTGCCGTTAATTTGAGAGT- ----------AATTC d7 TTTCTGCCGTTAATTTGAGA-- -------------ATTC diO M0-26a: TTTCTGCCGTTAATTTGAGAG-— --------TAATTC d7 b: TTTCTGCCGTTAATTTGAG------ -------GTAATTC d8 TTTCTGCCGTTAATTTGAGAGT- --------TAATTC d6 TTTCTGCCGTTAATTTGAG------ -—GGTAATTC d7 b: TTTCTGCCGTTAATTTGAGAG-— --------TAATTC d7 M0-14a: TTTCTGCCGTTAATTTG—GA—■ ---------TAATTC d9 M0-29a: TTTCTGCCGTTAATTTGAGAGT- --------TAATTC d6 TTTCTGCCGTTAATTTGAGA-- -------GTAATTC d7 TTTCTGCCGTTAATTTGAGAG-— --------TAATTC d7 b: TTTCTGCCGTT---------------------- ---------------ttc d20 b: TTTCTGCCGTTAATTT---------------- --------------TTC dl5 TTTCTGCCGTTAATTT------------- ----------AATTC dl3 TTTCTGCCGTTAATTT---------------- ................... d23 d#, deletion of # nucleotides; boldfaced letters indicate deletion of 3 multiples, e.g., d3, d6, or d9.

Claims

1. A method for modifying genetic material of a plant cell without integrating exogenous sequences into the genome of the plant cell, comprising:a) providing at least one plant cell comprising the genetic material to be modified;b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein the sequence-specific nuclease targetsspecific sequence in the genome of the plant cell and the target site sequence is modified by the nuclease; andstep c) selecting a plant cell with modified genetic material, wherein said selection occurs without the use of a selectable marker;wherein the sequence-specific nuclease is CRISPR / Cas nuclease;the fully infectious rhabdovirus is sonchus yellow net virus (SYNV) or eggplant mottled dwarf virus (EMDV), and the genome sequence of sonchus yellow net virus are set forth in SEQ ID NO:38, and eggplant mottled dwarf virus as set forth in SEQ ID NO:39.A method for generating a plant containing modified genetic material without integrating exogenous sequences into the nome of the plant, comprising:providing at least one plant cell comprising the genetic material to be modified;infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence coding a sequence-specific nuclease, wherein the sequence-specific nuclease targets specific sequence in the genome of 5 plant cell and the target site sequence is modified by the nuclease; andobtaining a plant from said plant cell with modified genetic material; and selecting a plant having a modification in said ! target site sequence, wherein selection occurs without using a selectable marker;wherein the sequence-specific nuclease is CRISPR / Cas nuclease;the fully infectious rhabdovirus is sonchus yellow net virus (SYNV) or eggplant mottled dwarf virus (EMDV).3.A method for generating callus containing modified genetic material without integrating exogenous sequences into the genome of the plant, comprising:a) providing at least one plant cell comprising the genetic material to be modified;b) infecting the plant cell with a fully infectious rhabdovirus vector harboring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein the sequence-specific nuclease targets specific sequence in the genome of the plant cell and the target site sequence is modified by the nuclease;c) obtaining callus from said plant cell with modified genetic material; and selecting callus having a modification in said target site sequence, wherein selection occurs without using a selectable marker;wherein the sequence-specific nuclease is CRISPR / Cas nuclease;the fully infectious rhabdovirus is sonchus yellow net virus (SYNV) or eggplant mottled dwarf virus (EMDV).

4. The method of claim 1, wherein infecting a plant cell by a rhabdovirus vector is performed through natural virus spread from inoculated cells to uninoculated cell, virus sap inoculation, plant grafting, or insect vector transmission, or any other means to initiate virus infection; the genome sequence of sonchus yellow net virus are set forth in SEQ ID NO:38, andeggplant mottled dwarf virus as set forth in SEQ ID NO:39.

5. The method of claim 1, wherein the fully infectious rhabdovirus vector includes variants comprising one or more mutations or modifications created by recombinant DNA technology, and preferably contains one or more mutations and / or modifications in the viral glycoprotein gene, and more preferablywherein the fully infectious rhabdovirus vector comprises a genetic mutation or deletion in the N-terminal domain of the viral glycoprotein gene; orwherein the fully infectious rhabdovirus vector comprises a substitution of the N-terminal domain of the glycoprotein for a heterologous nucleic acid sequence.

6. The method of claim 1, wherein a modification of the plant cell comprises deletion of at least one nucleotide, insertion of at least one nucleotide, substitution of at least one nucleotide, or a combination thereof.

7. The method of claim 1, wherein the sequence-specific nuclease is Streptococcus pyogenes CRISPR / Cas9 nuclease (SpCas9) or Lachnospiraceae bacterium CRISPR / Cpfl nuclease (LbCpfl).

8. The method of claim 1, wherein the at least one polynucleic acid sequence encoding the sequence-specific nuclease comprises the sequence encoding a single or multiple guide RNAs and a Cas polypeptide, and optionallywherein the single or multiple guide RNAs include the sequence complementary to the targeted genomic DNA ^sequence, and the sequence binds to Cas nuclease to form a complex.CMco The method of claim 1, wherein the polynucleic acid sequence encoding the sequence-specific nuclease is inserted in ^^rabdovims genome as an independent transcription unit, and optionally0) wherein expression of the sequence-specific nuclease is driven by viral cis-elements responsible for viral messenger ! RNA transcription.

10. The method of claim 1, wherein the guide RNA and Cas polypeptide are co-expressed from a single engineered transcription unit; orwherein the guide RNA and Cas polypeptide are co-expressed from separate transcription units.

11. The method of claim 1, wherein the guide RNA contains terminal sequences derived from virus; orwherein the guide RNA is processed to remove virus-derived sequences, and optionally, wherein the guide RNA is processed from primary viral transcript by the cellular tRNA processing machinery to remove virus-derived sequences, or wherein the guide RNA is processed from primary viral transcript by Cpfl to remove virus-derived sequences.

12. The method of claim 1, wherein the plant cell is derived from natural or experimental hosts of plant rhabdoviruses, and preferably from the hosts of the sonchus yellow net virus or eggplant mottled dwarf virus.

13. The method of claim 1, wherein the plant is Nicotiana benthamiana, or Solanum tuberosum, or Solanum Lycopersicum, or Nicotiana tabacum.macrophylla, Cucumis melo, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana edwardsonii, Capsicum annuum, Chenopodium amaranticolor. Chenopodium quinoa. Datura metel, Hibiscus rosa-sinensis, Lonicera, Solanum nigrum, Sonchus oleraceus, Lactuca sativa, hybrids of Nicotiana glutinosa and Nicotiana clevelandii, Zinnia elegans, Bidenspilosa, and Chenopodium quinoa.

15. A fully infectious plant rhabdovirus vector, characterized in that:a) being able to systematically infect a suitable plant host; andb) harbouring at least one polynucleic acid sequence encoding a sequence-specific nuclease, wherein the sequence-specific nuclease is transiently expressed in plant cells infected by the virus vector and targets specific sequence in the genome of the infected cells, and wherein target site sequence is modified by the nuclease;wherein the sequence-specific nuclease is CRISPR / Cas nuclease;the rhabdovirus vector capable of systemic infection is preferably sonchus yellow net virus (SYNV) vector or eggplant mottled dwarf virus (EMDV) vector.

16. The infectious plant rhabdovirus vector of claim 15, wherein the genome sequence of sonchus yellow net virus are set forth in SEQ ID NO:38, and eggplant mottled dwarf virus as set forth in SEQ ID NO:39.

17. The infectious plant rhabdovirus vector of claim 15, further comprising one or more mutations or modifications created by recombinant DNA technology, containing one or more mutations and / or deletion in the viral glycoprotein gene,wherein the fully infectious rhabdovirus vector comprises a genetic mutation or deletion in the N-terminal domain of e viral glycoprotein gene; orwherein the fully infectious rhabdovirus vector comprises a substitution of the N-terminal domain of the glycoprotein r a heterologous nucleic acid sequence.!. The infectious plant rhabdovirus vector of claim 15, wherein the sequence-specific nucleases are Streptococcus >ogenes CRISPR / Cas9 nuclease (SpCas9) or Lachnospiraceae bacterium CRISPR / Cpfl nuclease (LbCpfl).

19. The infectious plant rhabdovirus vector of claim 15, wherein the at least one polynucleic acid sequence encoding sequence-specific nuclease comprises the sequence encoding a single or multiple guide RNAs and a Cas polypeptide, and optionallywherein guide RNAs include the sequence complementary to the targeted genomic DNA sequence, and the sequence binds to Cas nuclease to form a complex.

20. The infectious plant rhabdovirus vector of claim 19, wherein a single or multiple guide RNAs direct to a single target gene; orwherein a single or multiple guide RNAs direct to multiple target genes.

21. The infectious plant rhabdovirus vector of claim 15, wherein the polynucleic acid sequence encoding the sequence-specific nuclease is inserted in rhabdovirus genome as an independent transcription unit, and optionallywherein expression of the sequence-specific nuclease in infected cells is driven by viral cis-elements responsible for viral mRNA transcription.

22. The infectious plant rhabdovirus vector of claim 19, wherein the guide RNA and Cas polypeptide are co-expressed fromseparate transcription units; orwherein the guide RNA and Cas polypeptide are co-expressed from a single engineered transcription unit.

23. The infectious plant rhabdovirus vector of claim 19, wherein the guide RNA contains terminal sequences derived from virus; orwherein the guide RNA is processed to remove virus-derived sequences, and optionally, wherein the guide RNA is processed from primary viral transcript by the cellular tRNA processing machinery to remove virus-derived sequences, or wherein the guide RNA is processed from primary viral transcript by Cpfl to remove virus-derived sequences.

24. The infectious plant rhabdovirus vector of claim 15, wherein infection of the said plant rhabdovirus vector is initiated through natural virus spread from inoculated cells to uninoculated cell, virus sap inoculation, plant grafting, or insect vector transmission, or any other means to initiate virus infection.

25. The infectious plant rhabdovirus vector of claim 15, wherein the sequence-specific nuclease is transiently expressed in cells of the natural or experimental host plant infected by the virus vector, and preferably from the hosts of the sonchus yellow net virus or eggplant mottled dwarf virus.

26. The infectious plant rhabdovirus vector of claim 15, wherein the plant is Nicotiana benthamiana, or Solanum tuberosum, or Nicotiana tabacum, or Solanum Lycopersicum.>^27 The infectious plant rhabdovirus vector of claim 15, wherein the host plant is Solanum melongena, Cucumissativus, ^^ydrangea macrophylla, Cucumis melo, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana edwardsonii, Capsicum annuum, Chenopodium amaranticolor, Chenopodium quinoa. Datura metel, Hibiscus rosa-sinensis, COonicera, Solanum nigrum, Sonchus oleraceus, Lacluca saliva, Nicotiana glulinosa, and Nicotiana clevelandii.^■^8. A genetically modified plant, and progeny thereof, produced by the method of claims 1-14.1—29. A genetically modified plant, and progeny thereof, produced from the infectious rhabdovirus vectors of claim 15-27.

30. The infectious plant rhabdovirus vector produced by the method of claims 1-14, either in the form of recombinant nucleic acid constructs, bacterial strains containing the constructs, or recombinant virus particles.

31. The use of the method of claims 1-14 or infectious rhabdovirus vectors of claim 15 in plant genome editing.

Images