Hybrid protocols and barcoding schemes for multiple sequencing technologies

Abstract

The disclosure provides for hybrid protocols and barcoding schemes that allow for sequencing of targeted polynucleotides in multiple types of sequencing platforms, and applications thereof, including

Description

STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grants HL105704, R21 AI120977 and R33 AI129077, awarded by The National Institutes of Health. The US Government has certain rights in the invention. TECHNICAL FIELD

[0003] The disclosure provides for hybrid protocols and barcoding schemes that allow for sequencing of targeted polynucleotides in multiple types of sequencing platforms, and applications thereof, including for metagenomic analysis. BACKGROUND

[0004] Early detection of causative microorganisms in patients with severe infections is important to informing clinical interventions and administering appropriately targeted antibiotics. Timely and accurate diagnosis, however, remains highly challenging for many hospitalized patients. As most infectious syndromes present with indistinguishable clinical manifestations, broad-based, multiplexed diagnostic tests are urgently needed but not yet available for the vast majority of potential pathogens. Some microorganisms are difficult to grow in culture (e.g., Treponema pallidum, Bartonella sp.), or unculturable (e.g., some viruses), while others (e.g., mycobacteria and molds) can take weeks to grow and speciate. Accurate molecular detection by PCR provides an alternative diagnostic approach to culture, but is hypothesis-driven and thus requires a priori suspicion of the causative pathogen(s). SUMMARY

[0005] Metagenomic analysis by next-generation sequencing of random, “shotgun” reads has a number of applications, including (1) clinical diagnosis, (2) pathogen discovery, (3) de novo genome assembly, (4) whole-exome sequencing, (5) targeted gene panel sequencing, (5) transcriptome profiling, and (6) whole-genome resequencing. Disclosed herein is a metagenomic next-generation sequencing (mNGS) method using cell-free DNA from body fluids to identify pathogens. The performance of mNGS testing of 182 body fluids from 160 acutely ill patients was evaluated using two sequencing platforms in comparison to microbiological testing using culture, 16S bacterial PCR, and / or 28S-ITS fungal PCR. Test sensitivity and specificity of detection were 79% and 91% for bacteria and 91% and 89% for fungi, respectively, by Illumina sequencing; 75% and 81% for bacteria and 91% and 100% for 17 1025 fungi, respectively, by nanopore sequencing. In a case series of 12 patients with culture / PCR-35 negative body fluids but for whom an infectious diagnosis was ultimately established, 7 (58%) were mNGS-positive. Real-time computational analysis enabled pathogen identification by nanopore sequencing in a median 50-minute sequencing and 6-hour sample-to-answer time. The Rapid mNGS methods of the disclosure are promising tools for diagnosis of unknown infections from body fluids. [0005a] In one aspect, the present invention provides a set of oligonucleotides, according to claim 1. In another aspect, the present invention provides a use of a sequencing library to claim 10. In still another aspect, the present invention provides a method for rapid pathogen detection according to claim 11. Certain more specific aspects of the invention are set out in the dependent claims.

[0006] The disclosure provides an oligonucleotide comprising barcodes for use in multiple types of next generation sequencing technologies, the barcodes comprising at least about 18 to about 160 nucleotides in length having a first nucleotide domain and at least one second nucleotide domain; wherein the first nucleotide domain comprises 4-12 nucleotides (4-12mer) of the barcode located at either end of the barcode and wherein the 4-12mer are compatible with a next generation sequencing technology that utilizes bridge amplification, wherein the second nucleotide domain comprises 14-35 nucleotides (14-35mer) of the barcode and wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores, wherein at least a minimum Levenshtein distance between a pair of 4-12mers is utilized, and wherein the Levenshtein distance has been maximized between a pair of barcodes in order to minimize barcode “crosstalk”. In one embodiment, the oligonucleotide further comprises a flow cell attachment domain. In a further embodiment, the flow cell attachment domain comprises a sequence selected from SEQ ID NO:1, 2, 3 or 4. In another embodiment, the oligonucleotide further comprises a sequencing primer binding domain. In another embodiment, the barcode is comprised of the 4-12mer and the second domain comprises 3 sets of 1 Omers that when concatenated together form a 34-42mer, wherein the last nucleotide is removed to form the 33-4 Imer barcode. In another embodiment, the oligonucleotide comprises a sequence selected from any one of SEQ ID Nos: 226-416 and 417. In another embodiment of any of the foregoing embodiments, oligonucleotide consists of 47-80 nucleotides. In another embodiment, the oligonucleotide is 62-83 nucleotides in length.

[0007] The disclosure also provides an oligonucleotide comprising barcodes for use in multiple types of next generation sequencing technologies, the barcodes comprising at least 17 1025 about 18 to about 39 nucleotides in length having a first nucleotide domain and at least one second nucleotide domain; wherein the first nucleotide domain comprises 4-9 nucleotides (4-9mer) of the barcode located at either end of the barcode and wherein the 4-9mers are compatible with a next generation sequencing technology that utilizes bridge amplification, wherein the second nucleotide domain comprises 14-35 nucleotides (14-35mer) of the barcode and wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores, wherein at least a minimum Levenshtein distance between a pair of 4-9mers is utilized, and wherein the Levenshtein distance has been maximized between a pair of barcodes in order to minimize barcode “crosstalk”.

[0008] The disclosure also provides an oligonucleotide barcode sequence for use in multiple types of next generation sequencing, wherein the oligonucleotide barcode is about 24 to 39 nucleotides in length and comprises a first oligonucleotide barcode domain of about 4-12 nucleotides (4-12mer) at the 5’ or 3’ end of the oligonucleotide barcode and a second oligonucleotide barcode domain of about 10-29 nucleotides in length operably linked to the first oligonucleotide barcode domain, wherein the Levenshtein distance has been maximized between a pair of oligonucleotide barcodes in order to minimize barcode “crosstalk”; wherein the first oligonucleotide barcode domain is compatible with next generation sequencing using bridge amplification; wherein the second oligonucleotide barcode domain is compatible with next generation sequencing using nanopores; and wherein the oligonucleotide has a minimum Levenshtein distance between a pair of 4-9mers. In one embodiment, the barcode is about 36-39 nucleotides in length. In still another or further embodiment, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID Nos: 226-416 and 417.

[0009] The disclosure also provides a set of oligonucleotides comprising a barcode as set forth herein. In another embodiment, each barcode is located between a pair of sequencing adaptors. In still a further embodiment, the pair of sequencing adaptors have sequences selected from (i) or (ii): (i) CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO:1), and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (SEQ ID NO:2); or (ii) AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NOG), and ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (SEQ ID NO:4), wherein * indicates a phosphorothioate bond between the nucleotides. In still another embodiment, the set of oligonucleotides are PCR primers used for sequencing library barcoding.

[0010] The disclosure also provides a sequencing library comprising the set of barcodes as described herein. In another embodiment, the sequencing library is used for an application 17 1025 selected from: pathogen discovery, environmental metagenomics, de novo genome assembly, whole-exome sequencing, transcriptomics sequencing, targeted gene panel sequencing or whole-genome resequencing.

[0011] The disclosure also provides a method for rapid pathogen detection in a sample using metagenomic next-generation sequencing (mNGS), comprising: obtaining one or more samples comprising cell-free DNA (cfDNA); generating a plurality of sequencing reads comprising a barcode from the set of oligonucleotides of the disclosure using next-generation sequencing; performing metagenomic analysis on the plurality of sequencing read data using a clinical bioinformatics software pipeline that can rapidly analyze sequencing read data for pathogenic DNA; determining and identifying pathogen(s) in the one or more samples based upon the metagenomic analysis of the sequencing read data. In another embodiment, the one or more samples comprises a body fluid sample from a subject. In a further embodiment, the body fluid sample is an infected body fluid sample. In still another or further embodiment, the body fluid sample is selected from cerebrospinal fluid, urine, semen, pericardial fluid, pleural fluid, peritoneal fluid, synovial fluid, amniotic fluid, fetal fibronectin, saliva, sweat, eye vitreous humor, eye aqueous humor, bronchoalveolar lavage fluid, breast milk, bile, and ascites fluid. In still a further embodiment, the one or more samples further comprise a blood serum sample. In another embodiment, the next-generation sequencing comprises sequencing technology that utilizes bridge amplification. In another or further embodiment, the nextgeneration sequencing comprises or further comprise sequencing technology that utilizes nanopores. In still another embodiment, the clinical bioinformatics software pipeline that can rapidly analyze sequencing read data for pathogenic DNA is SURPI+ or SURPIrt. In still another embodiment, the pathogen(s) comprise one or more pathogenic bacteria. In another embodiment, the pathogen(s) comprise one or more pathogenic fungi. [ 0012 ] The disclosure provides a set of paired 37mer barcodes comprising dual indexes that are configured for dual use in multiple types of next generation sequencing technologies, wherein the Levenshtein distance has been maximized between each pair of 37mer barcodes in order to minimize barcode “crosstalk”; wherein the first 8 nucleotides (8mer) of each pair of 37mer barcodes is compatible with a next generation sequencing technology that utilizes bridge amplification, and wherein at least a minimum Levenshtein distance between each pair of 8mers is utilized; wherein at least a minimum Levenshtein distance between each pair of 37mers barcodes is used so that the 37mer barcode is compatible with a next generation sequencing technology that utilizes nanopores. 17 1025

[0013] In a certain embodiment, the disclosure provides for a composition or method as substantially described and / or illustrated herein. DESCRIPTION OF DRAWINGS [ 0014 ] Figure 1-C provides various embodiments of the metagenomic next-generation sequencing (mNGS) method of the disclosure. (A) Schematic of mNGS body fluid analysis workflow. The clinical gold standard consisted of aggregated results from cultures, bacterial 16S PCR, and / or fungal 28S-ITS PCR, while the composite standard also included confirmatory digital PCR with Sanger sequencing and clinical adjudication. For nanopore sequencing in <6 h, 40-60 min are needed for nucleic acid extraction, 2-2.5 h for mNGS library preparation, 1 h for nanopore ID library preparation, and 1 h for nanopore sequencing and analysis. (B) Analysis workflow for the 182 total body fluid samples in the study. 170 samples were included in the accuracy assessment, while 12 samples collected from patients with a clinical diagnosis of infection but negative microbiological testing were included for mNGS analysis. The pie chart displays the body fluid sample types analyzed in the study. (C) Timing for mNGS testing relative to culture. Whereas culture-based pathogen identification can take days to weeks, mNGS testing using nanopore or Illumina sequencing platforms has a 5-24 h overall turnaround time.

[0015] Figure 2A-F demonstrates mNGS testing accuracy and relative pathogen burden in body fluid samples. (A) ROC curves of Illumina (n=43 samples) and nanopore (n=42 samples) training sets based on culture and 16S testing. Plotted are mNGS test sensitivities and specificities at nRPM threshold values ranging from 0.1 to 100. (B) ROC curves of both training sets based on a composite standard. (C) Contingency tables for the independent Illumina (n=127 samples) and nanopore (n=43 samples) validation sets. PPA and NPA are shown in lieu of sensitivity and specificity respectively if a composite standard was used. The scoring system for determination of positive and negative results is described in Table 5. (D) ROC curves stratified by body fluid type (n=170 samples in total). Plotted is the performance of the combined Illumina training and validation datasets relative to composite standard testing. Plasma is not counted as a body fluid in panels D and F but is plotted as a separate set. (E) Direct comparison of Illumina with nanopore sequencing (79 bacteria) across all body fluids. The yield of pathogen-specific reads based on a nRPM metric is linearly correlated and comparable between nanopore and Illumina sequencing. (F) Relative pathogen burden in body fluids, stratified by body fluid and microorganism type. The burden of pathogen cfDNA in body fluid samples is estimated using calculated nRPM values. Based on Illumina data, 17 1025 bacterial cfDNA in plasma was significantly lower on average than in local body fluids (p=0.0035), and pathogen cfDNA in body fluids was significantly higher for bacteria than for fungi (p=0.0049). All box plots represent the median (centre), the interquartiles (minima and maxima), and 1.5 x interquartile range (whiskers). All p-values are calculated using a two-sided Welch’s t-test. Abbreviations: ROC, receiver operator characteristic; nRPM, normalized reads per million; PPA, positive percent agreement; NPA, negative percent agreement; cfDNA, cell-free DNA.

[0016] Figure 3A-C provides a comparison of mNGS with 16S (bacterial) or 28S-ITS (fungal) PCR. The Venn diagram shows all cases out of 182 where mNGS and associated 16S or 28S-ITS PCR detected a microorganism. Krona plots depict genus and species levels of all sequence-matched bacterial or fungal reads depending on the microorganism type. (A) mNGS and 16S / 28S-ITS PCR testing results for 14 culture-negative body fluid samples. (B) Concordant bacterial cases (n=7 samples). (C) Discordant bacterial cases (n=3 samples). In case S31 (top left), mNGS identified the causative pathogen in a case of necrotizing pneumonia, Klebsiella pneumoniae, whereas 16S PCR testing was falsely positive for Streptococcus mitis. In case S88 (right), mNGS identified Klebsiella aerogenes in CSF that tested negative by culture and 16S PCR, a finding confirmed by culture of an infected deep brain stimulator located upstream of the lumbar puncture site (drawing and axial slice). Nanopore sequencing was able to detect both bacteria within 3 minutes after start of sequencing (xy plots with dotted line showing the detection threshold). In case S144 (bottom left), Mycobacterium avium complex was detected by 16S PCR but not by mNGS. (D) Fungal cases (n=4 samples). In 3 discordant cases, mNGS testing detected the causative pathogen while 28S-ITS testing was negative. All 3 mNGS results was orthogonally confirmed by concurrent or subsequent culture of the body fluid or culture of biopsy tissue. For additional details on the cases, please see Table 10 and Clinical Vignettes presented in the Examples. Abbreviations: BAL, bronchoalveolar lavage fluid; CT, computed tomography.

[0017] Figure 4A-B provides a comparison of relative pathogen burden in paired body fluid and plasma samples. (A) Schematic showing concurrent collection of blood plasma and body fluid samples from the same patient. (B) Bar plot of the nRPM corresponding to 9 organisms in paired body fluid and plasma samples from 7 patients. The vertical lines show the thresholds used for a positive bacterial (nRPM = 2.6) or fungal (nRPM = 0.1) detection. The checkboxes denote microorganisms that were not identified by conventional microbiological testing (culture and / or 16S PCR) but that were orthogonally confirmed by dPCR, serology, 17 1025 and / or clinical adjudication (see Clinical Vignettes presented in the Examples). Abbreviation: nRPM, normalized reads per million.

[0018] Figure 5A-I presents metagenomic sequencing of body fluids. (A) Log scale plot of the bacterium Achromobacter xylosoxidans from mNGS data, a common background contaminant in sequencing libraries. There is a log-linear relationship between the qPCR cycle threshold (Ct) value and the RPM corresponding to Achromobacter xylosoxidans. The background level of Achromobacter xylosoxidans is inversely correlated with the input concentration and is relatively constant. (B) Precision-recall curves based on the Illumina training bacterial dataset in comparison with the composite standard. (C) Precision-recall curves based on nanopore bacterial training datasets. (D) Precision-recall curves for Illumina and nanopore training fungal datasets. (E) Pie chart showing distribution of bacterial pathogen titers as estimated by semi-quantitative culture. (F) Plot of nRPM values versus semi-quantitative bacterial titers. The nRPM corresponding to bacteria cultured in enrichment broth was significantly lower than the other higher-titer cultures (p=0.006). (G) Relative pathogen burden in positive and negative (non-infectious) body fluid samples. (H) Nanopore time to detection (minutes) across different body fluid types. Each data point represents the time to detection of the organism, if any, in each body fluid sample. (I) Nanopore time to detection (minutes) in relation to pathogen DNA abundance in samples (reads per million, RPM). All box plots represent the median (centre), the interquartiles (minima and maxima), and 1.5 x interquartile range (whiskers).

[0019] Figure 6A-D presents ROC curves of mNGS test performance. ROC curves are plotted from validation set data based on a clinical gold standard or composite standard. Data are presented as median true positive rates + / - the 95% confidence intervals. The 95% confidence interval was obtained via a bootstrap method with 2000 resampling iterations. (A) Illumina dataset, bacterial detection (n=127 samples). (B) Nanopore dataset, bacterial detection (n=43 samples), (C) Illumina dataset, fungal detection (n=127, 32 fungal organisms). (D) Nanopore dataset, fungal detection (n=43, 11 fungal organisms).

[0020] Figure 7A-D displays the relationship of external positive control organism titer with mNGS detection signal (expressed in nRPM). Simple linear regression of normalized reads per million (nRPM) over four replicates per dilution factor, calculated as genome equivalents per mL (GE / mL) for (A) Streptococcus uberis, (B) Rhodobacter sphaeroides, (C) Millerozyma farinosa, and (D) Aspergillus oryzae. 17 1025

[0021] Figure 8A-E provides orthogonal testing for Case S31: Klebsiella pneumoniae infection of pleural fluid. (A) Genomic coverage of K pneumoniae from Illumina mNGS. Sequencing spanned 36,490 base pairs, or 0.65% of the K pneumoniae genome. (B) Orthogonal confirmation of K pneumoniae by dPCR of the sequencing library. Nine negative controls from other cases were run in parallel. Out of 10 sequencing libraries, only Case S31 had any positive droplets (n=43 of 12022 total droplets as circled). (C) Orthogonal confirmation of K pneumoniae by dPCR of the DNA extract.Three positive droplets were detected, indicating a low positive result. (D) Orthogonal confirmation of K pneumoniae by dPCR of contralateral pleural fluid (sample C31). 29 and 24 positive droplets were detected out of 2 replicates. Digital PCR targeting Streptococcus mitis on both pleural fluids did not yield any positive droplets. The positive controls for these experiments were from sheared DNA from Klebsiella pneumoniae and Streptococcus mitis respectively, whereas the negative control was water. (E) Sanger sequencing of the K pneumoniae amplicon from dPCR. Shown are sequencing traces confirming the presence of K pneumoniae (SEQ ID NO:418).

[0022] Figure 9A-C provides orthogonal testing for Cases S88: Klebsiella aerogenes from cerebrospinal fluid and S87: Bartonella henselae from a skin abscess. (A) Orthogonal confirmation of K aerogenes by dPCR of the DNA extract. The sample was run in parallel with 9 negative controls. Out of 10 sequencing libraries, only Case S88 had positive dPCR droplets (n=61). (B) Genomic coverage of K aerogenes from Illumina mNGS. The assembled genomic regions spanned 536,461 bp, or 9.9% of the bacterial genome. (C) Orthogonal confirmation of Bartonella henselae by dPCR of the DNA extract. Positive dPCR droplets (n=12) are seen in abscess fluid and the positive control consisting of sheared DNA from Bartonella henselae (ATCC). The negative control was water.

[0023] Figure 10A-D shows length distributions of pathogen cfDNA in mNGS data. Analysis is performed on the 87 body fluid samples sequenced on both Illumina and nanopore platforms. (A) Diagram showing how original genomic DNA lengths are recovered. Paired-end sequencing data is aligned to either a human or microbial genome, followed by determination of fragment length from the start and end positions and construction of a read length histogram. (B) Histogram of average DNA lengths for human, bacterial, and fungal organisms obtained from mNGS data. Human DNA is observed to peak at the stereotypical 160 bp nucleosome footprint; both bacterial and fungal DNA are most abundant at sizes of <100 bp, but a higher molecular weight tail is observed extending to 500-600 bp. (C) Histogram of bacterial read lengths according to sequencing platform. Illumina and nanopore sequencing 17 1025 platforms produce different size distributions. (D) Length analysis of mNGS-positive, 168-negative cases. Comparison of the length profiles of the 16S discordant bacteria cases (S31 and S88), 16S concordant bacteria cases (mean of S10, S36, S41, S69, S85, S128), and all bacteria mean. The pathogen cfDNA in cases S31 and S88 are more fragmented, with the vast majority of fragments <300 bp. The relative paucity of longer fragments could hinder 16S PCR amplification.

[0024] Figure 11A-E provides a comparison of different threshold variables on the training set to calibrate the thresholds for each variable used. The final thresholds used are circled in each ROC chart. (A) Comparison of different minimal read thresholds for bacteria calling. Based on this data and prior selection of minimal reads, we selected a minimal of 3 reads for the validation set. (B) Comparison of using or not using a PCR Ct value normalization for bacteria calling. Normalization resulted in higher specificity and was used on the validation set. (C) Comparison of using a same-genus / same-family filter to decrease an informatics artifact where a pathogen burden is high and related species would appear at significant lower values. Using this filter improved specificity. (D) Comparison of different minimal read thresholds for fungal calling. We selected a minimal of 1 read based on the significantly higher sensitivity at the lowest threshold. (E) Comparison of using or not using a PCR Ct value normalization for fungal calling. Normalization resulted in higher specificity and was used on the validation set.

[0025] Figure 12 provides 192 37mer barcode sequences of the disclosure. DETAILED DESCRIPTION

[0026] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a body fluid" includes a plurality of such body fluids and reference to "the organism" includes reference to one or more organisms and equivalents thereof known to those skilled in the art, and so forth.

[0027] Also, the use of “or” means “and / or” unless stated otherwise. Similarly, “comprise,” “comprises,” “comprising” “include,” “includes,” and “including” are interchangeable and not intended to be limiting.

[0028] It is to be further understood that where descriptions of various embodiments use the term “comprising,” those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language “consisting essentially of’ or “consisting of.” 17 1025

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although many methods and reagents are similar or equivalent to those described herein, the exemplary methods and materials are disclosed herein.

[0030] All publications mentioned herein are cited for the purpose of describing and disclosing the methodologies, which might be used in connection with the description herein. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.

[0031] It should be understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the disclosure, which is defined solely by the claims. [0032 ] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" when used to described the present invention, in connection with percentages means ±1%.

[0033] As used herein, the term “amount” or “level” in reference to a targeted biomolecule, refers to a quantity of the targeted molecule that is detectable or measurable in a sample and / or control.

[0034] As used herein, the term “biological sample” includes any sample(s) that is taken from a subject which contains one or more targeted biomolecules described herein. Suitable samples in the context of the present disclosure include, for example, blood, plasma, serum, amniotic fluid, vaginal excretions, saliva, and urine. In a particular embodiment, biological samples used in a method disclosed herein comprise a blood plasma sample and a body fluid sample. In a further embodiment, biological samples used in a method disclosed herein comprise cell-free DNA (cfDNA) from body fluids.

[0035] Although PCR tests targeting the conserved 16S ribosomal RNA (rRNA) gene (“16S PCR”) and 28S-intemal transcribed ribosomal gene spacer (“28S-ITS PCR”) regions of bacteria and fungi, respectively, have been developed, concerns have been raised regarding detection sensitivity. Failure or delay in diagnosing infections results in extended hospitalizations, readmissions, and increased mortality and morbidity. In addition, 17 1025 undiagnosed patients nearly always require empiric broad-spectrum therapy, with increased risk of adverse side effects and antimicrobial drug resistance.

[0036] Metagenomic next-generation sequencing (mNGS) enables detection of nearly all known pathogens simultaneously from clinical samples. Previous work in this area has focused on a single, generally non-purulent body fluid type, and few studies to date have demonstrated clinical validation and / or utility. Methodology and sample types are also highly variable, making it difficult to evaluate comparative performance across different studies. In particular, purulent fluids, which often suggest an infectious etiology, can be challenging to analyze by mNGS due to high human host DNA background, which can decrease assay sensitivity.

[0037] Methods exist to enrich for pathogen-specific reads from metagenomic data, such as differential lysis of human cells, but the scope of detection using these approaches is largely restricted to bacteria and / or fungi. Rapid identification of pathogens from infected body fluid compartments is important because empiric antimicrobial treatment is often suboptimal, contributing to increased morbidity and mortality. Most metagenomic studies have employed Illumina™ sequencing platforms, with sequencing run times exceeding 16 hours and overall sample-to-answer turnaround times of 48-72 hours. In contrast, nanopore sequencing (MinlON™ sequencer by Oxford Nanopore Technologies) can detect microbes within minutes of starting sequencing and with a <6-hour turnaround time. Nanopore sequencing has been extensively used for genomic surveillance of emerging viruses, but clinical metagenomic applications of the technology for pathogen detection have been limited. One published study describes the use of a saponin-based differential lysis enrichment method for metagenomic nanopore sequencing-based detection of bacteria in respiratory infections with 96.6% sensitivity yet only 41.7% specificity. [ 0038 ] Provided herein are simple, rapid, and universal methods for pathogen detection by mNGS analysis of cell-free DNA (cfDNA) from a variety of different body fluids, ranging from low-cellularity cerebrospinal fluid (CSF) to purulent fluids with high human host DNA content (e.g., abscesses). An innovative dual-use protocol, suitable for either Oxford Nanopore Technologies™ nanopore or Illumina™ sequencing platforms, is used to evaluate the diagnostic accuracy of mNGS testing against traditional culture and PCR-based testing. A case series evaluating the performance of mNGS testing in 12 patients with culture- and PCR-negative body 95 fluids is described herein. For all cases, there was either high clinical 17 1025 suspicion for an infectious etiology or a confirmed microbiological diagnosis by orthogonal laboratory testing.

[0039] Described herein are rapid diagnostic assays for unbiased metagenomic detection of DNA-based pathogens from body fluids. Some advances underlying the approaches presented herein, include: (i) detection across a broad range of sample types, (ii) compatibility with input cfDNA concentrations varying across 6 orders of magnitude (100 pg / mL - 100 ug / mL), (iii) a dual-use barcoding system enabling deployment on Illumina and nanopore sequencing platforms, and (iv) clinically validated bioinformatics pipelines for automated analysis and interpretation of mNGS data. Importantly, it was found that sensitivities and specificities for bacterial and fungal detection across Illumina and nanopore sequencing platforms were comparable. The potential utility of the methods of the disclosure are highlighted by detection of pathogens in 7 of 12 (58.3%) selected cases for which culture and PCR testing of the body fluid were negative, with subthreshold detection of pathogen reads in an additional two cases (9 of 12, 75%) (Table 11).

[0040] In the studies presented herein, mNGS testing failed to detects, aureus at higher rates than other bacteria, a finding that was statistically significant for nanopore but not for Illumina sequencing. The lower sensitivity of S. aureus detection by nanopore sequencing was attributed to higher levels of human host background DNA. Notably, the median body fluid white blood cell (WBC) count for S. aureus was 70,250 x 109 / L (IQR 42,800 - 137,500), an approximately 100-fold increase over median WBC counts for other microorganisms (p<0.00001 by Mann-Whitney U-test). Other factors contributing to lower sensitivity for nanopore sequencing may be the lower read depths achieved in the current study and higher error rates relative to Illumina sequencing. These limitations are addressed by increasing average sequencing throughput per sample or making improvements in nanopore read accuracy over time.

[0041] The methods disclosed herein utilize pathogen-specific cfDNA sequences in body fluid supernatant. Intact pathogen DNA from high human DNA background samples, such as respiratory or joint fluids, can be obtained using differential lysis protocols. However, as the supernatant containing pathogen cfDNA is removed during the differential lysis protocol, such enrichment methods may not work as well for low cellularity samples such as plasma and CSF. Differential lysis can also hinder detection of other microorganisms such as viruses and parasites. In addition, these methods involve multiple steps of lysis and centrifugation, which can increase method complexity and prolong assay turnaround times. The methods disclosed 17 1025 herein also forego the use of mechanical processing steps such as bead-beating. Bead-beating may improve the detection of intact fungi and some bacteria containing rigid cell walls, but is laborious for routine use in the clinical laboratory and can reduce detection sensitivity by increasing host background from the release of human DNA. [ 0042 ] While other studies have used metagenomic sequencing for pathogen detection in sepsis and pneumonia, the reported test specificities of 63% and 42.7% respectively, limiting broad clinical application, as it can be challenging to evaluate the clinical significance of falsepositive results. In direct contrast, an overall specificity ranging from 83% to 100% was achieved using the methods and compositions of the disclosure.

[0043] Pathogen cfDNA analysis from blood has been used to diagnose deep-seated infections. However, bacterial DNA is often present at low levels in blood, with a lower quartile of 5 bacterial genome copies per mL in patients with sepsis. In matched pairs of samples, it was shown herein that there was an observed 160-fold higher pathogen cfDNA burden in body fluids. Similarly, tumor cfDNA is higher in adjacent body fluids than in blood. Higher levels of pathogen cfDNA in body fluids can increase analytical sensitivity and decrease sequencing depths required for accurate detection, thereby lowering the cost of testing. In addition, direct identification of a pathogen from a body fluid can localize the source of an infection, which is important to guiding definitive management and treatment.

[0044] In comparing mNGS with bacterial 16S or fungal 28S-ITS PCR, occult pathogens were detected solely by mNGS in 5 of 14 cases. False-negative 16S PCR results have been previously reported, and are generally attributed to suboptimal primer design or decreased assay sensitivity from background contamination. However, discordant results between 16S PCR and mNGS may also be due to short pathogen read lengths in cell-free body fluids. Notably, size ranges for bacterial 16S PCR amplicons span 300-460 nt, whereas those for fungal 28S-ITS PCR amplicons span 250-650 nt. Decreases in sensitivity due to fragmented cfDNA that are not amenable to long-read amplicon PCR have also been observed for detection of EBV virus in clinical samples.

[0045] The mNGS methods of the disclosure expand the scope of conventional diagnostic testing to multiple body fluid types. The achievable <6-hour turnaround time using nanopore sequencing may also be important for infections such as sepsis and pneumonia that demand a rapid response and timely diagnosis. The results presented herein indicate that mNGS testing methods disclosed herein are useful for a plurality of scenarios, including: (i) for identification of culture-negative or slow-growing pathogens, (ii) for diagnosis of rare or 17 1025 unusual infections that were not considered by the health care provider a priori, (iii) as a first-line test in critically ill patients, and (iv) as an early alternative to the large number of send out tests that would otherwise be ordered as part of the diagnostic workup.

[0046] The studies presented herein have focused on clinical development and validation of metagenomic sequencing technologies, including pathogen detection and gene expression profiling, to diagnose infections in clinical samples from patients. There are key advantages and disadvantages regarding the choice of sequencing technologies for the metagenomic sequencing approach. For instance, nanopore sequencing (currently available on the MinlON™, GridlON™, or PromethlON™ instruments by Oxford Nanopore Technologies™, or ONT) enables longer reads and “real-time” sequencing analysis; the latter aspect enables more rapid sequencing protocols and shorter turnaround times, albeit with lower throughput and higher error rates. Illumina™ sequencing, in contrast, has much higher throughput (number of reads per given unit time) and lower costs, albeit at greater turnaround times.

[0047] Presented herein is the development and validation of a hybrid approach and barcoding schemes in which sequencing libraries can be constructed from samples that would be compatible (e.g.. can be sequenced) on a variety of different sequencing platforms. Most sequencing technologies utilize “adapter-ligation” protocols for barcoding and sequencing, whereby an indexed adapter is attached to the end(s) of free DNA or cDNA molecules in order to barcode multiplexed samples and facilitate a subsequent sequencing reaction. The hybrid approach for use with ONT and Illumina platforms can use an adapter-ligation approach coupled to the same or different-sized barcodes (e.g., 37mers for the ONT and 8mers - the first or last 8 bases of the 37mer for Illumina) to generate barcoded, dual- or singly-indexed libraries that are compatible with both platforms.

[0048] In a particular embodiment, the disclosure provides at least one, typically a set including 2, 3, 4 or more pairs of a barcode Xmer (wherein X is an integer selected 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 or more) barcodes comprising an index (e.g., dual indexes comprising a first domain or bridge domain index and a second domain or nanopore domain index) that is configured for use in multiple types of next generation sequencing technologies, wherein the Levenshtein distance has been maximized between each pair of Xmer barcodes in order to minimize barcode “crosstalk”; wherein the first or last, e.g., 4 to 9 nucleotides (4-9mer) of each pair of Xmer barcodes is compatible with a next generation sequencing technology that utilizes bridge 17 1025 amplification (e.g., iSeqlOO, MiniSeq, MiSeq, HiSeq, NovaSeq, and NextSeq from Illumina™), and wherein at least a minimum Levenshtein distance between each pair of, e.g., 4-9mers is utilized; wherein at least a minimum Levenshtein distance between each pair of Xmer barcodes is used so that the Xmer barcode is compatible with a next generation sequencing technology that utilizes nanopores (e.g., Flongle, MinlON, MinlON MklC, GridlON, and promethlON from Oxford Nanopore Technologies™). In a further embodiment, the Xmer barcodes are comprised of the, e.g., 4-9mer and, e.g., 3 sets of lOmer barcodes that concatenated together to form, for example, a Xmer of 33-39 nucleotides, wherein the last nucleotide is removed to form the Xmer barcodes of 32-38 nucleotides. In regards to Levenshtein distance, the Levenshtein distance can be computed using the methods presented herein, or the Levenshtein distance calculations described in detailed in Bushmann et al., (“Levenshtein error-correcting barcodes for multiplexed DNA sequencing.” BMC Bioinformatics 14: 272 (2013)).

[0049] It should be recognized that the second 'nanopore' domain index can completely overlap and encompass the first ‘bridge’ domain index. The overall length can have a higher upper limit, such as 160 nucleotides. The exemplary oligonucleotides described in the Examples below used two 37mers, for a total of 74 nucleotides. Moreover, the first 'bridge' domain can go up to two 12mers, so the minimum can be high at 24 or 25 nucleotides total. Although the Examples, use a 37mer, an exact 37mer is not necessary, e.g., 36mer or 38mer will also work. The second ‘nanopore’ barcode index can be at least a total of 24 nucleotides (all locations combined). Alternatively, the second ‘nanopore’ barcodes are at least double in length the size of the bridge amplification barcodes. In addition, paired barcodes are not required. The barcodes can be arbitrarily shifted between the two sides, all the way on one side or the other, to effectively have single-end barcodes. Index barcodes can also be easily shifted into other locations— currently, in the Illumina and nanopore configuration, there are 4 convention locations, so the total can be quadruple barcodes rather than paired. In addition, although the Examples below used an 8mer first ‘bridge’ domain index it does not have to be a precise 8mer. For example, bridge amplification systems such as that on Illumina systems also use 6mers, 7mers, 8mers or 9mers. [ 0050 ] In a particular embodiment, the disclosure provides for a set of oligonucleotides comprising a set of Xmer barcodes (e.g., a 37mer) disclosed herein. In a further embodiment each Xmer barcode is located between a pair of sequencing adaptors. In yet a further embodiment, the pair of sequencing adaptors have sequences selected from (i) or (ii): 17 1025 (i) CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO:1), and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (SEQ ID NO:2); or (ii) AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NOG), and ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (SEQ ID NO:4), wherein * indicates a phosphorothioate bond between the nucleotides. In another embodiment, the set of oligonucleotides are PCR primers used for sequencing library barcoding.

[0051] In a certain embodiment, the disclosure also provides a sequencing library comprising a set of paired Xmer barcodes (wherein X is between 15 and 42 nt) disclosed herein. In a further embodiment, the sequencing library is used for an application selected from: pathogen discovery, environmental metagenomics, de novo genome assembly, whole-exome sequencing, transcriptomics sequencing, targeted gene panel sequencing or whole-genome resequencing. In a further embodiment, the sequencing library is generated using a library preparation kit. In yet a further embodiment, the library preparation kit is from Illumina, Inc (e.g., AmpliSeq™ kits, COVIDSeq™ kit, Illumina DNA prep kits, Illumina RNA prep kits, Nextera™ Kits, SureCell WTA™ Kits, TruSeq™ kits, and TruSight™ kits).

[0052] In a particular embodiment, the disclosure also provides a method for rapid pathogen detection in a sample using metagenomic next-generation sequencing (mNGS), comprising: obtaining one or more samples comprising cell-free DNA (cfDNA); generating a plurality of sequencing read data comprising a Xmer barcode (wherein X is between 15 and 42 nt) from a set of paired Xmer barcodes wherein the Levenshtein distance has been maximized between each pair of Xmer barcodes in order to minimize barcode “crosstalk”; wherein the first or last 4 to 9 nucleotides (4-9mer) of each pair of Xmer barcodes is compatible with a next generation sequencing technology that utilizes bridge amplification, and wherein at least a minimum Levenshtein distance between each pair of 4-9mers is utilized and wherein at least a minimum Levenshtein distance between each pair of Xmer barcodes is used so that the Xmer barcode is compatible with a next generation sequencing technology that utilizes nanopores; performing metagenomic analysis on the plurality of sequencing read data using a clinical bioinformatics software pipeline that can rapidly analyze sequencing read data for pathogenic DNA; identifying pathogen(s) in the one or more samples based upon the metagenomic analysis of the sequencing read data. In another embodiment, the one or more samples comprises a body fluid sample from a subject. In yet another embodiment, the body fluid sample is a purulent body fluid sample. In a certain embodiment, the body fluid sample is selected from cerebrospinal fluid, urine, semen, pericardial fluid, pleural fluid, peritoneal fluid, 17 1025 synovial fluid, amniotic fluid, fetal fibronectin, saliva, sweat, eye vitreous humor, eye aqueous humor, bronchoalveolar lavage fluid, breast milk, bile, and ascites fluid. In another embodiment, the one or more samples further comprise a blood serum sample. In yet another embodiment, the next-generation sequencing comprises sequencing technology that utilizes bridge amplification. In a further embodiment, the next-generation sequencing comprises or further comprise sequencing technology that utilizes nanopores. In yet a further embodiment, the next-generation sequencing comprises sequencing technology that utilizes bridge amplification and sequencing technology that utilizes nanopores. In another embodiment, the clinical bioinformatics software pipeline that can rapidly analyze sequencing read data for pathogenic DNA is SURPI+ or SURPIrt. In a further embodiment, the pathogen(s) comprise one or more pathogenic bacteria. In an alternate embodiment, the pathogen(s) comprise one or more pathogenic fungi.

[0053] Methods using the hybrid approach described herein allows for short read, high-throughput, slower sample-to-sequence technologies, such as Illumina, to be performed simultaneously with long read, lower-throughput, rapid sequencing technologies, such as ONT. The methods disclosed herein by using such a hybrid approach, can leverage key advantages of each sequencing technology (e.g., ONT nanopore sequencing - speed; Illumina sequencing - throughput). In the studies presented herein, the hybrid approach described herein was successfully run with 37mer barcoding for ONT nanopore sequencing and 8mer barcoding for Illumina sequencing. Accordingly, the disclosure has provided methodologies where two or more sequencing platforms can be used simultaneously and successfully for metagenomic analysis in a number of applications, including, but not limited to, clinical diagnosis, pathogen discovery, de novo genome assembly, whole-exome sequencing, targeted gene panel sequencing, transcriptome profiling, and whole-genome resequencing.

[0054] Accordingly, the disclosure further provides for integrated assays to simultaneously use multiple sequencing platforms for metagenomic analysis, such as assay kits. Such assay kits can be used for applications, including but not limited to, clinical diagnosis with initial sequencing for rapid diagnosis (e.g.. ONT platform) followed by more complete reflex sequencing for high sensitivity (e.g.. Illumina platform); generating hybrid libraries for all sequencing applications, including, but not limited to, pathogen discovery, environmental metagenomics, de novo genome assembly whole-exome sequencing, transcriptomics sequencing (e.g.. RNA-Seq); targeted gene panel sequencing; and wholegenome resequencing (e.g., cancer genome sequencing). Such assay kits provide a “one stop” 17 1025 kit to perform metagenomic analysis on samples, include primers, sequencing reagents, analysis software, etc. In a particular embodiment, the kit comprises, consists essentially of, or consists of dual use barcode primers that have been designed using the methods disclosed herein that can be used in both Illumina and Oxford Nanopore Technologies instruments. In another embodiment, a kit described herein is used to determine pathogenic microorganism(s) in patient sample(s) using the methods disclosed herein.

[0055] The assay kit will comprise a plurality of detection / quantification tools specific to each targeted biomolecule detected by the kit (e.g., pathogenic nucleic acid). Many of the targeted biomolecules disclosed herein comprise DNA, which may be detected by next generation sequencing and like technologies. The detection / quantification tools may comprise a set of dual use barcode primers, each barcode primer directed to the selective amplification by NGS of a targeted biomolecule(s) in a sample.

[0056] In yet another embodiment, the assay kits of the disclosure further comprise reagents or enzymes which can be used for next generation sequencing and like technologies. Assay kits may further comprise elements such as reference DNAs (e.g.. positive and negative controls), washing solutions, buffering solutions, reagents, printed instructions for use, and containers.

[0057] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used. EXAMPLES

[0058] Sample selection and processing. All body fluid samples were obtained from patients at the University of California San Francisco (UCSF) hospitals and clinics for three years. The study only used residual body fluid samples after standard-of-care clinical laboratory testing was performed. Body fluid samples were collected in sterile tubes or using swabs as part of routine clinical care and included abscess, joint, peritoneal, pleural, cerebrospinal, urine, bronchoalveolar lavage and other fluids (see Table 1). Swabs were stored in charcoal gel columns (Swab Transport Media Charcoal 220122, BD) and reconstituted in 0.5 mL of Universal Transport Media (350C, Copan Diagnostics, Murrieta, CA); the media liquid was subsequently used for culture, PCR, and mNGS analyses. Cultures for bacteria, fungi, and AFB from body fluid samples were done in-house at UCSF. Clinical 16S rDNA and 28S-ITS PCR for bacterial and fungal detection were performed by a reference laboratory at the University of Washington. Residual samples were stored at 4°C and tested within 14 days 17 1025 of collection or centrifuged at 16,000 relative centrifugal force for 10 minutes and the supernatant stored at -80 °C until time of extraction.

[0059] Plasma samples were obtained by collecting blood from hospitalized patients as part of routine clinical testing into EDTA Plasma Preparation Tubes (BD) or standard EDTA Tubes (BD). The tubes were centrifuged (4000-6000 ref for 10 minutes) within 6 hours, and plasma was isolated from the buffy coat and red cells. The plasma component was further aliquoted and centrifuged at 16,000 ref for 10 minutes in microcentrifuge tubes. Plasma samples were stored at -80 °C until the time of extraction.

[0060] In the study of test performance, body fluids samples were included if they were culture positive or PCR positive for bacterial or fungal pathogen(s) with pathogen(s) identified to genus / species level. Body fluids from patients with ambiguous laboratory findings (e.g., a positive culture that was judged clinically to be a contaminant) or from patients with an established infectious diagnosis and already receiving targeted treatment at the time of body fluid collection were excluded. Negative control body fluid samples were selected from patients who had clear alternative non-infectious diagnoses (e.g.. cancer, trauma) and negative for infection by culture and clinical adjudication (CYC and WG).

[0061] In the series of 12 cases, body fluid samples were included if (i) they were culture and PCR negative and (ii) from a patient with a microbiologically established infection (by orthogonal testing such as serology or testing of a different body fluid / tissue) or clinically probable infection based on review of the clinical charts by an infectious disease specialist (CYC) and clinical pathologist (WG) (Table 11). Table 1. Clinical characteristics and mNGS results of all cases used in the accuracy study. Sample # Inclusion Criteria Gold Standard - Culture / 16S Tests Performed Blood Culture (same admission, within + / - 3 days) Sample Type Organism detected by Illumina over threshold Organism detected by Nanopore at Validation threshold nRPM nanopore (1st org if polymicrobial) Sequenci ng to Detection Time (mins) SI Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Abscess Staphylococcus aureus Staphylococ cus aureus 106.33 128 S2 Positive Culture (Bacteria) Enterobacter aerogenes Bacterial Culture negative xl CSF Enterobacter aerogenes Klebsiella aerogenes 27155.11 21 S3 Positive Culture (Bacteria) Group B Streptococcus Bacterial Culture negative x2 Joint Fluid Streptococcus agalactiae Streptococc us agalactiae 197.81 23 S4 Positive Culture (Bacteria) Candida parapsilosis Bacterial Culture n / a CSF Candida parapsilosis Candida parapsilosis 0.54 30 S5 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Staphylococcus aureus xl Joint Fluid Saccharomyces cerevisiae, off species hits related to Saccharomyces cerevisiae (confirmed with BLAST) <negative> 110 S6 Positive Culture (Bacteria) Pseudomonas aeruginosa Bacterial and Fungal Culture n / a Abscess Pseudomonas aeruginosa Pseudomon as aeruginosa 340.11 22 S7 Negative Control (cause: cancer) negative Cytology (malignant); Bacterial Culture n / a Pleural Fluid < negative > <negative> 80 S8 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal Culture n / a BAL < negative > Pseudomon as aeruginosa 236.16 65 S9 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Staphylococcus aureus xl0+ Pleural Fluid Staphylococcus aureus Staphylococ cus aureus 1114.42 30 S10 Positive 16S Haemophilus influenzae 16S, Bacterial, Fungal, and AFB Culture Haemophilus influenzae xl (OSH) BAL Haemophilus influenzae, Rothia dentocariosa Haemophilu s influenzae 8483.10 21 Sil Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Peritoneal Fluid < negative > Staphylococ cus aureus 4.12 65 S12 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative x2 Joint Fluid < negative > <negative> 90 S13 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative x2 Joint Fluid < negative > Staphylococ cus aureus 1.25 92 S14 Positive Culture (Bacteria) Pseudomonas aeruginosa Bacterial and Fungal Culture n / a Vitreous Fluid Pseudomonas aeruginosa Pseudomon as aeruginosa 252.77 23 S15 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal and AFB Culture n / a BAL Staphylococcus aureus Staphylococ cus aureus 0.60 320 S16 Negative Control (cause: cancer) negative Bacterial and Fungal Culture n / a CSF < negative > <negative> 90 S17 Positive Culture (Bacteria) Serratia marcescens Bacterial and Fungal and AFB Culture 1 blood culture 2 days later: Candida tropicalis. Previous Serratia bacteremia this admission. Pleural Fluid Serratia sp. SCBI, Enterococcus faecium Serratia marcescens, Enterococcu s faecium 42.71 40 S18 Positive Culture (Bacteria) Staphylococcu s epidermidis group Bacterial Culture negative CSF Staphylococcus epidermidis Staphylococ cus epidermidis 3130.95 21 S19 Positive Culture (Bacteria) Serratia marcescens Bacterial and Fungal Culture Central line 3 days ago positive for Candida tropicalis Pleural Fluid Serratia sp. SCBI, Enterococcus faecium Serratia marcescens, Enterococcu s faecium 8.72 30 S20 Positive Culture (Bacteria) Enterococcus faecium Bacterial Culture n / a CSF Enterococcus faecium Enterococcu s faecium, Stenotropho monas maltophilia 93.15 21 S21 Positive Culture (Bacteria) Enterococcus faecium Bacterial Culture negative CSF Enterococcus faecium Enterococcu s faecium 2.87 50 S22 Positive Culture (Bacteria) Candida albicans, Cand ida glabrata Bacterial Culture n / a Peritoneal Fluid Candida albicans, Candida glabrata Candida glabrata, Candida albicans 236.16 50 S23 Positive Culture (Bacteria) Staphylococcu s aureus,Escher ichia coli Bacterial Culture negative Abscess Staphylococcus aureus <negative> 80 S24 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and AFB Culture negative Pleural Fluid < negative > <negative> 80 S25 Negative Control (cause: trauma) negative Bacterial Culture n / a Joint Fluid < negative > <negative> 75 S26 Positive Culture (Bacteria) Enterococcus faecium, Candi da albicans Bacterial Culture negative x2 2 days later Pleural Fluid Enterococcus faecium Enterococcu s faecium 14.86 90 S27 Positive Culture (Bacteria) Candida glabrata Bacterial Culture negative Abscess Candida glabrata, Candida albicans Candida glabrata 4.72 40 S28 Positive Culture (Bacteria) Streptococcus pyogenes Bacterial Culture + <not known> Data unavailable Abscess Escherichia coli Escherichia coli 1283.49 21 S29 Positive Culture (Bacteria) Enterobacter cloacae complex, Cand ida albicans Bacterial Culture n / a Abscess Enterobacter cloacae Enterobacte rkobei 40.66 50 S30 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Same organism 2 and 3 days prior Joint Fluid Staphylococcus aureus Staphylococ cus aureus 84.20 29 S31 Positive 16S Streptococcus mitis group 16S, Bacterial Culture negative Pleural Fluid Klebsiella pneumoniae Klebsiella pneumoniae 12.79 22 S32 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Multiple blood cultures positive for same organism Abscess Staphylococcus aureus Staphylococ cus aureus 16.31 50 S33 Negative Control (cause: cancer) negative Bacterial and AFB Culture n / a CSF < negative > <negative> 90 S34 Positive Culture (Bacteria) Streptococcus anginosus group Bacterial Culture negative or Corynebacterium spp NOS Pleural Fluid Streptococcus constellatus, Streptococcus anginosus, Streptococcus intermedins, Parvimonas micra Streptococc us anginosus group 75.23 40 S35 Negative Control (cause: cancer) negative Bacterial and AFB Culture negative Pleural Fluid < negative > <negative> 80 S36 Positive 16S Staphylococcu s aureus 16S, Bacterial and Fungal Culture negative Abscess Staphylococcus aureus <negative> 72 S37 Positive Culture (Bacteria) Enterococcus faecalis,Enter coccus faecium, Candi da krusei Bacterial Culture Enterococcus faecalis x2 a day prior Perihepati c Fluid Enterococcus faecium, Enterococcus faecalis, Prevotella melaninogenic a, Lactobacillus gasseri, Campylobacter curvus, Peptoclostridiu m difficile, Campylobacter concisus Enterococcu s faecium, Enterococcu s faecalis 1461.31 21 S38 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Abscess Staphylococcus aureus <negative> 80 S39 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Joint Fluid < negative > <negative> 90 S40 Negative Control (cause: cancer) negative Bacterial Culture negative Pleural Fluid < negative > Achromoba cter xylosoxidan s 0.95 80 S41 Positive 16S Streptococcus pyogenes 16S, Bacterial and Fungal and AFB Culture negative Pleural fluid Streptococcus pyogenes Streptococc us pyogenes 85.99 25 S42 Positive Culture (Bacteria) Escherichia coli Bacterial Culture negative (2x positive 5 days ago) Abscess Escherichia coli Escherichia coli 237.70 25 S43 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Positive same organism Joint Fluid Staphylococcus aureus Staphylococ cus aureus 21.55 32 S44 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Abscess Staphylococcus aureus Staphylococ cus aureus 7.86 70 S45 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Abscess Staphylococcus aureus Staphylococ cus aureus 79.77 32 S46 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Joint Fluid Staphylococcus aureus Staphylococ cus aureus 19.69 26 S47 Positive Culture (Bacteria) Escherichia coli,Klebsiella pneumoniae Bacterial Culture + <not known> Data unavailable Peritoneal Fluid Klebsiella pneumoniae, Escherichia coli Klebsiella pneumoniae, Escherichia coli 950.19 22 S48 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal n / a Abscess < negative > <negative> 80 and AFB Culture S49 Positive Culture (Bacteria) Enterococcus spp, Candida albicans Bacterial Culture negative Swab Enterococcus faecium, Candida albicans Enterococcu s faecium, Candida albicans 332.58 23 S50 Positive Culture (Bacteria) Escherichia coli Bacterial Culture negative Joint Fluid Klebsiella pneumoniae Klebsiella pneumoniae 2.32 35 S51 Positive Culture (Fungal) Aspergillus fumigatus Fungal Culture and ITS sequencing negative BAL Streptococcus pneumoniae, Aspergillus fumigatus, Prevotella melaninogenic a <negative> 90 S52 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal and AFB Culture negative Joint Fluid Staphylococcus aureus Staphylococ cus aureus 15.89 50 S53 Positive Culture (Bacteria) Klebsiella pneumoniae, C itrobacter freundii complex Bacterial Culture 2 days ago had Citrobacter freundii complex x2. Abscess Citrobacter freundii, Klebsiella pneumoniae, Salmonella enterica, Bacteroides xylanisolvens, Bacteroides thetaiotaomicr on Klebsiella pneumoniae, Citrobacter freundii 37.36 50 S54 Positive Culture (Bacteria) Escherichia coli Bacterial and Fungal Culture negative Subgaleal Fluid Escherichia coli Escherichia coli 615.27 22 S55 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Same organism same day and later days Joint Fluid < negative > Staphylococ cus aureus 0.45 130 S56 Positive Culture (Bacteria) Klebsiella pneumoniae Bacterial and Fungal Culture negative Peritoneal Fluid Klebsiella pneumoniae, Enterococcus faecium, gamma proteobacteriu m HdNl Klebsiella pneumoniae 2022.59 21 S57 Positive Culture (Bacteria) Enterococcus faecium Bacterial Culture negative Peritoneal Fluid Klebsiella pneumoniae Klebsiella pneumoniae 2.07 110 S58 Positive Culture (Fungal) Aspergillus fumigatus Bacterial and Fungal and AFB Culture negative Pleural Fluid Aspergillus fumigatus Aspergillus fumigatus 4.16 50 S59 Positive Culture (Bacteria) Pseudomonas aeruginosa, Ca ndida glabrata, Cand ida krusei Bacterial and Fungal and AFB Culture negative Peritoneal Fluid Pseudomonas aeruginosa, Staphylococcus epidermidis, Candida glabrata, Pichia kluyveri, Lactococcus lactis, Campylobacter concisus, Lactobacillus acidophilus, Veillonella parvula Pseudomon as aeruginosa, Candida glabrata, Staphylococ cus epidermidis, Neisseria sicca, Leuconostoc citreum 1619.76 22 S60 Positive Culture (Bacteria) Pseudomonas aeruginosa Bacterial and AFB Culture n / a Pleural Fluid Pseudomonas aeruginosa Pseudomon as aeruginosa 576.50 22 S61 Positive Culture (Bacteria) Staphylococcu s lugdunensis Bacterial Culture n / a Joint Fluid Staphylococcus lugdunensis Staphylococ cus lugdunensis 9.35 30 S62 Positive Culture (Bacteria) Escherichia coli Bacterial Culture Same organism x2 Urine Escherichia coli Escherichia coli 54.07 21 S63 Positive Culture (Bacteria) Staphylococcu s lugdunensis Bacterial Culture n / a Joint Fluid < negative > <negative> 40 S64 Positive Culture (Bacteria) Mycoplasma hominis 16S on isolate on Bacterial Culture only negative Peri-graft Fluid Swab Mycoplasma hominis Mycoplasma hominis 33.14 23 S65 Positive 16S Streptococcus pyogenes 16S and Bacterial negative Peritoneal Fluid Streptococcus pyogenes Streptococc us pyogenes 6.35 35 S66 Negative Control (cause: post surgical chronic synovitis) negative Bacterial and Fungal Culture n / a Joint Fluid < negative > <negative> 88 S67 Negative Control (cause: post surgical chronic synovitis) negative Bacterial and Fungal Culture n / a Joint Fluid < negative > <negative> 88 S68 Negative Control (cause: post surgical negative Bacterial and Fungal Culture n / a Joint Fluid < negative > <negative> 88 chronic synovitis) S69 Positive 16S Mycobacteriu m tuberculosis complex 16S, Bacterial and Fungal and AFB Culture negative Abscess Mycobacterium tuberculosis Mycobacteri um tuberculosis 2.87 200 S70 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Joint Fluid Staphylococcus aureus Staphylococ cus aureus 5.42 56 S71 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Abscess Staphylococcus aureus Staphylococ cus aureus 3.86 21 S72 Positive Culture (Bacteria) Candida albicans Bacterial Culture negative Peritoneal Fluid Candida albicans <negative> 110 S73 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Positive same organism 2 days ago Anterior Mediastin al Fluid Staphylococcus aureus Staphylococ cus aureus 2983.43 21 S74 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Peritoneal Fluid Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, Streptococcus mitis, Bifidobacteriu m breve, Peptoclostridiu m difficile Enterococcu s faecalis, Escherichia coli, Staphylococ cus aureus 1502.62 65 S75 Positive Culture (Bacteria) Streptococcus mitis group Bacterial Culture negative Abscess Streptococcus mitis group Streptococc us gordonii 59.03 26 S76 Positive Culture (Bacteria) Escherichia coli Bacterial Culture Positive same organism Peritoneal Fluid Escherichia coli Escherichia coli 372.95 21 S77 Positive Culture (Bacteria) Candida albicans Bacterial Culture n / a Peritoneal Fluid < negative > <negative> 80 S78 Positive Culture (Bacteria) Escherichia coli Bacterial Culture negative Urine Escherichia coli Escherichia coli, Corynebacte rium striatum 525.95 21 S79 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal Culture negative Chest Mass Coccidioides immitis Coccidioide s immitis 30.07 23 S80 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal Culture negative Chest Mass Fluid Coccidioides immitis Coccidioide s immitis 0.69 80 S81 Positive Culture (Bacteria) Streptococcus pyogenes Bacterial Culture negative Wound Swab Streptococcus pyogenes Streptococc us pyogenes 129.99 23 S82 Negative Control (cause: cancer) negative Bacterial Culture negative (1 Propionibacteriu m acnes) Pleural Fluid < negative > <negative> 80 S83 Positive Culture (Fungal) Aspergillus terreus,Asperg Ulus fumigatus Bacterial and Fungal and AFB Culture negative BAL Aspergillus terreus, Aspergillus fumigatus Aspergillus terreus, Aspergillus fumigatus 0.72 60 S84 Negative Control (cause: cancer) negative Bacterial Culture negative Pleural Fluid < negative > <negative> 80 S85 Positive Culture (Bacteria) Streptococcus pyogenes Bacterial Culture, 16S negative Abscess Streptococcus pyogenes, Streptococc us pyogenes 4.10 65 Talaromyces marneffei S86 Positive Culture (Bacteria), not run on nanopore Staphylococcu s aureus Bacterial Culture Staphylococcus aureus Heel Fluid Swab < negative > Not tested n / a S87 Positive Culture (Bacteria), not run on nanopore Finegoldia magna (Anaerobic) Bacterial Culture negative Abscess Finegoldia magna, Bartonella henselae Not tested n / a S88 Suspected culture FN: positive culture from brain surgery 2 days later negative but highly probable infection Bacterial Culture, 16S negative CSF Klebsiella aerogenes Klebsiella aerogenes 21.26 23 S89 Suspected culture FN: bowel perforation negative but highly probable infection Bacterial Culture n / a Abscess Polymicrobial anaerobes Not tested n / a S90 Suspected culture FN: pneumonia and bacteremia negative but highly probable infection Bacterial and Fungal and AFB Culture Streptococcus pneumoniae 3 days ago Pleural Fluid Streptococcus pneumoniae Not tested n / a S91 Suspected culture FN: pneumonia and bacteremia negative but highly probable infection Bacterial Culture Blood Cx was Group A Streptococcus 4 days ago Pleural Fluid < negative > Not tested n / a S92 Suspected culture FN: negative but highly Bacterial and Fungal negative BAL Aspergillus fumigatus Not tested n / a probable invasive aspergillosis probable infection and AFB Culture S93 Positive Culture (Bacteria) Nocardia farcinica Bacterial and Fungal and AFB Culture negative Peritoneal Fluid < negative > - - - S94 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal Culture negative CSF Coccidioides immitis - - - S95 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal and AFB Culture positive for same organism Joint Fluid Staphylococcus aureus - - - S96 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Peritoneal Fluid Staphylococcus aureus, Enterococcus faecalis - - - S97 Positive Culture (Fungal) Candida glabrata Bacterial and Fungal Culture negative CSF Candida glabrata - - - S98 Positive Culture (Bacteria) Group A Streptococcus Bacterial Culture negative Peritonsila r Drainage Streptococcus pyogenes - - - S99 Positive Culture (Bacteria) Streptococcus pneumoniae Bacterial Culture 2x same organism CSF Streptococcus pneumoniae - - - S100 Positive Culture (Bacteria) Staphylococcu s epidermidis Bacterial and Fungal and AFB Culture n / a Peritoneal Fluid Staphylococcus epidermidis - - - S101 Positive Culture (Fungal) Candida albicans Bacterial and Fungal and AFB Culture negative Back Fluid Candida parapsilosis, Candida albicans - - - S102 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Joint Fluid Staphylococcus aureus - - - S103 Positive Culture (Bacteria) Escherichia coli Bacterial Culture positive for same organism CSF Escherichia coli - - - S104 Positive Culture (Fungal) Candida glabrata Bacterial and Fungal and AFB Culture n / a Peritoneal Fluid Candida glabrata - - - S105 Positive Culture (Fungal) Cryptococcus neoformans Bacterial and Fungal and AFB Culture same organism CSF Cryptococcus neoformans - - - S106 Positive Culture (Fungal) Candida parasilopsis Bacterial Culture 3 days after: negative CSF Candida parapsilosis - - - S107 Positive Culture (Fungal) Candida parasilopsis Bacterial Culture 1 day prior: negative CSF Candida parapsilosis - - - S108 Positive Culture (Fungal) Candida parasilopsis Bacterial Culture 5 days prior: negative CSF Candida parapsilosis - - - S109 Positive Culture (Fungal) Cryptococcus neoformans Bacterial and Fungal and AFB Culture same organism CSF Cryptococcus neoformans - - - Slid Positive Culture (Fungal) Aspergillus spp.,mixed morphotypes (moderate A. niger, rare A. flavus, rare A. fumigatus),Fe Bacterial and Fungal and AFB Culture 2 days prior: negative BAL Pseudomonas aeruginosa w Oronasal flora Sill Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture 1 and 5 days after: same organism Abscess Staphylococcus aureus - - - S112 Positive Culture (Bacteria) Enterococcus faecium Bacterial and Fungal and AFB Culture negative Peritoneal Fluid Enterococcus faecium - - - S113 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Joint Fluid Staphylococcus aureus - - - S114 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal and AFB Culture negative Pleural Fluid Coccidioides immitis, Methylobacteri um radiotolerans, Methylobacteri um extorquens, Burkholderia gladioli, Methylobacteri um populi, Sphingomonas taxi S115 Positive Culture (Bacteria) Group A Streptococcus, Corynebacteri um diphtheriae Bacterial and Fungal and AFB Culture n / a Knee Swab Streptococcus pyogenes, Corynebacteriu m diphtheriae S116 Positive Culture (Fungal) Cryptococcus neoformans Bacterial and Fungal and AFB Culture negative BAL Cryptococcus neoformans, Streptococcus parasanguinis S117 Positive Culture (Bacteria) Salmonella typhi group D Bacterial and Fungal and AFB Culture negative Abscess Salmonella enterica - - - S118 Positive Culture (Bacteria) Mycobacteriu m tuberculosis complex Bacterial and Fungal and AFB Culture n / a FNA Mycobacterium tuberculosis complex - - - S119 Positive Culture (Bacteria) Escherichia coli Bacterial Culture same day 2x same organism Peritoneal Fluid Escherichia coli - - - S120 Positive Culture (Fungal) Enterobacter cloacae, Candi da albicans Bacterial and Fungal and AFB Culture negative Urine Enterobacter cloacae, Candida albicans - - - S121 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal and AFB Culture negative CSF Coccidioides immitis - - - S122 Positive Culture (Bacteria) Achromobacte r xylosoxidans Bacterial and Fungal and AFB Culture n / a BAL Achromobacter xylosoxidans, Staphylococcus epidermidis, Pseudomonas pseudoalcalige nes S123 Positive Culture (Fungal) Cryptococcus gattii Bacterial and Fungal and AFB Culture n / a CSF Cryptococcus gattii S124 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal and AFB Culture 1 day prior: negative CSF Coccidioides immitis - - - S125 Positive Culture (Fungal) Histoplasma capsulatum Bacterial and Fungal and AFB Culture 3 days prior: 2x negative BAL < negative > - - - S126 Positive Culture (Fungal) Pneumocytis jireoveci Bacterial and Fungal and AFB Culture 3 days prior: 2x negative BAL Pneumocystis jirovecii - - - S127 Positive Culture (Fungal) Coccidioides immitis Bacterial and Fungal and AFB Culture negative CSF Coccidioides immitis - - - S128 Positive 16S negative Bacterial and Fungal and AFB Culture 3-5 days prior: negative Abscess Aggregatibacte r aphrophilus - - - S129 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Abscess Staphylococcus aureus - - - S130 Positive Culture (Bacteria) Group B Streptococcus Bacterial and Fungal Culture n / a Left Thigh Bursal Fluid Streptococcus agalactiae - - - S131 Positive Culture (Bacteria) Klebsiella pneumoniae Bacterial and Fungal Culture 9, 8, 7 days prior: Klebsiella pneumoniae CSF Klebsiella pneumoniae - - - S132 Positive Culture (Bacteria) Enterobacter aerogenes Bacterial Culture n / a CSF Enterobacter aerogenes - - - S133 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Same day, 2-3 days prior, 2 days later: positive for same organism Iliopsosas Collection Fluid Staphylococcus aureus, Bacillus thuringiensis S134 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture Multiple positive Left Iliac Wing Fluid Staphylococcus aureus - - - S135 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Abdomina 1 Fluid Wall Staphylococcus aureus - - - S136 Positive Culture (Fungal) Aspergillus fumigatus Bacterial and Fungal and AFB Culture negative BAL Aspergillus fumigatus - - - S137 Positive Culture (Bacteria) Klebsiella pneumoniae Bacterial Culture n / a Retrogastr ic Fluid Klebsiella pneumoniae, Sodalis sp. HS1, Veillonella parvula S138 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial and Fungal and AFB Culture n / a Abdomina 1 Fluid Wall Staphylococcus aureus - - - S139 Positive Culture (Bacteria) Enterococcus faecium Bacterial and AFB Culture n / a Peritoneal Fluid Enterococcus faecium, Bordetella petrii - - - S140 Positive Culture (Bacteria) Staphylococcu s lugdunensis Bacterial Culture n / a Thoracic Spine Seroma Staphylococcus lugdunensis - - - S141 Positive Culture (Fungal) Candida parasilopsis Bacterial and Fungal negative Perigastric Fluid < negative > - - - and AFB Culture S142 Positive Culture (Fungal) Candida tropicalis Bacterial Culture n / a Abscess Candida tropicalis - - - S143 Positive Culture (Bacteria) Mycobacteria m avium complex Bacterial and Fungal and AFB Culture n / a FNA Mycobacterium avium - - - S144 Positive 16S Mycobacteria m avium complex 16S, Bacterial, Fungal, and AFB Culture n / a Joint Fluid < negative > S145 Positive Culture (Bacteria) Nocardia blacklockiae Bacterial and Fungal and AFB Culture negative Pleural Fluid < negative > - - - S146 Positive Culture (Bacteria) Listeria monocytogene s Bacterial and Fungal and AFB Culture same day 2x Listeria monocytogenes CSF Listeria monocytogenes - - - S147 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture negative Back Fluid Staphylococcus aureus - - - S148 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture n / a Breast Fluid Staphylococcus aureus - - - S149 Positive Culture (Bacteria) Enterococcus faecium, Enter ococcus faecalis Bacterial Culture negative Peritoneal Fluid Enterococcus faecium, Enterococcus faecalis, Peptoclostridiu m difficile S150 Positive Culture (Bacteria) Staphylococcu s aureus Bacterial Culture same day 2x Staphylococcus aureus', also positive the next day Synovial Fluid Staphylococcus aureus S151 Positive 16S Mycobacteriu m tuberculosis Bacterial and Fungal and AFB Culture negative Peritoneal Fluid < negative > - - - S152 Positive Culture (Bacteria) Mycobacteriu m tuberculosis Bacterial and Fungal and AFB Culture negative Peritoneal Fluid < negative > - - - S153 Negative Control (cause: cancer) negative Bacterial Culture n / a Peritoneal Fluid < negative > - - - S154 Negative Control (cause: cancer) negative Bacterial Culture n / a Pleural Fluid < negative > - - - S155 Negative Control (cause: cancer) negative Bacterial Culture n / a Pleural Fluid < negative > - - - S156 Negative Control (cause: cancer) negative Bacterial and Fungal Culture n / a Peritoneal Fluid < negative > - - - S157 Negative Control (cause: cancer) negative Bacterial and AFB Culture negative Pleural Fluid < negative > - - - S158 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture negative Peritoneal Fluid < negative > - - - S159 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture negative Pleural Fluid < negative > - - - S160 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture negative Pleural Fluid < negative > - - - S161 Negative Control (cause: cancer) negative Bacterial Culture n / a Pleural Fluid < negative > - - - S162 Negative Control (cause: cancer) negative Bacterial Culture n / a Pleural Fluid < negative > - - - S163 Negative Control (cause: cancer) negative Bacterial and Fungal Culture n / a Pleural Fluid < negative > - - - S164 Negative Control (cause: cancer) negative Bacterial Culture n / a Pleural Fluid < negative > - - - S165 Negative Control (cause: cancer) negative Bacterial and Fungal Culture n / a Pleural Fluid < negative > - - - S166 Negative Control negative Bacterial Culture n / a Peritoneal Fluid < negative > - - - (cause: cancer) S167 Negative Control (cause: cancer) negative Bacterial Culture 10 / 24 / 18: Escherichia coli Pleural Fluid Propionibacteri um acnes - - - S168 Negative Control (cause: cancer) negative Bacterial Culture 5 / 29: Staphylococcus epidermidis Peritoneal Fluid < negative > - - - S169 Negative Control (cause: cancer) negative Bacterial and Fungal Culture n / a CSF < negative > - - - S170 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture n / a CSF < negative > - - - S171 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture n / a CSF < negative > - - - S172 Negative Control (cause: cancer) negative Bacterial Culture negative CSF < negative > - - - S173 Negative Control (cause: cancer) negative Bacterial Culture negative CSF < negative > - - - S174 Negative Control (cause: cancer) negative Bacterial and Fungal and AFB Culture negative CSF < negative > - - - S175 Negative Control (cause: cancer) negative Bacterial and Fungal Culture 14 days later: Enterobacter aerogenes CSF < negative > - - - S176 Suspected culture FN: respiratory fungal infection negative but highly probable infection Bacterial and Fungal and AFB Culture n / a BAL Streptococcus sp. VT 162, Streptococcus oralis, Veillonella parvula, Rothia mucilaginosa S177 Suspected culture FN: CNS infection confirmed by culture from brain biopsy negative but highly probable infection Bacterial and Fungal and AFB Culture 9 days later: several CSF < negative > S178 Suspected culture FN: Cryptococcus pneumonia negative but highly probable infection Bacterial and Fungal and AFB Culture negative Pleural Fluid < negative > - - - S179 Suspected culture FN: neurosyphilius negative but highly probable infection Bacterial and Fungal and AFB Culture negative CSF < negative > - - - S180 Suspected culture FN: tuberculous infection negative but highly probable infection Bacterial and Fungal and AFB Culture n / a Pleural Fluid < negative > - - - S181 Suspected culture FN: CNS infection confirmed by later culture negative but highly probable infection Bacterial and Fungal and AFB Culture n / a CSF < negative > S182 Suspected culture FN: Sporothrix infection by serology negative but highly probable infection Bacterial and Fungal and AFB Culture n / a CSF < negative > 17 1025

[0062] DNA extraction. Samples were processed in a blinded fashion In a CLIA (Clinical Laboratory Improvement Amendments)-certified clinical microbiology laboratory with physically separate pre- and post-PCR rooms. Cells were first removed through centrifugation to minimize host background. 400 pL of body fluid supernatant or plasma then underwent total nucleic acid extraction to 60 pL extract using the EZ1 Advanced XL BioRobot and EZ1 Virus Mini Kit v2.0 (QIAGEN) according to the manufacturer’s instructions.

[0063] Library preparation and PCR amplification. Library preparation was performed using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs), with the use of 25 pL of extracted DNA input and half of the reagent volumes suggested by the manufacturer’s protocol. Briefly, extracted DNA from most samples was quantified on a NanoDrop spectrophotometer (ThermoFisher) and diluted to 10-100 ng of input as recommended by the manufacturer. Plasma or CSF DNA was not quantified or diluted as typical input concentrations of <10 ng / pL could not be reliably detected using a spectrophotometer. The DNA was then end-repaired, ligated with the NEBNext Adapter (0.6 pM final concentration) to enrich for short-fragment pathogen DNA (100-800 nt) relative to residual human genomic DNA (>1 kb), and cleaned using AMPure beads. In addition to the initial manual preparation of 17 samples, an automated protocol using the epMotion 5075 liquid handler (Eppendorf) was used to process the remaining 165 samples, with 16-48 samples batch-processed per run.

[0064] PCR amplification was performed using a 40 pL mix consisting of adapter-ligated DNA, premixed custom index primers at 3 pM final concentration (see Table 2), and a quantitative PCR master mix (KAPA RT-kit, KK2702, Roche). DNA amplification was performed to saturation of the fluorescent signal on a qPCR thermocycler (Lightcycler 480, Roche) using the following PCR conditions: initiation at 98 °C x 45 s, then 24 cycles of 98 °C x 15 s / 63°C x 30 s / 72 °C x 90 s, and a final extension step of 72 °C x 60 s. Ct values were continually monitored until the libraries were fully amplified to saturation. Final DNA libraries were cleaned up using Ampure beads (Beckman) at a 0.9X volumetric ratio and eluted in 30 pL EB buffer (Qiagen). Table 2. PCR primers and indexes used for sequencing library barcoding. SEQ ID Index NO i7 / P7 primer 1 5 CAAGCAGAAGACGGCATACGAGAT CTCCGTATCTTCTCCATTTGTTGTGCAGAAATGGCTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 2 6 CAAGCAGAAGACGGCATACGAGAT GAGACTCTATACCTCCTCCTCTATACGTTCGCTTCAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 3 7 CAAGCAGAAGACGGCATACGAGAT ACCGTGGAGTCATAAGCTTGACCTCGCCACATGTCTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 4 8 CAAGCAGAAGACGGCATACGAGAT C CGGACTGATGAC CGGATTAAGTT CGCAGTCACCGAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 5 9 CAAGCAGAAGACGGCATACGAGAT GCTCTAGCCGTCACTCTTTATCCTCACACTACTGGCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 6 10 CAAGCAGAAGACGGCATACGAGAT CATCTGTTCTCGTTACACAGAGCTGCCAAGTACAGTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 7 11 CAAGCAGAAGACGGCATACGAGAT CCGTTCTCTTGAGCGCATTATAGAAGCGCCAAGATCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 8 12 CAAGCAGAAGACGGCATACGAGAT ATCGTGGTCGCTTACCGTTGTCAAGGACAAGCTGATG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 9 13 CAAGCAGAAGACGGCATACGAGAT AGAGCAATGACGATATGTTCTTCGGCATGGTAGTAGC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 10 14 CAAGCAGAAGACGGCATACGAGAT GTCGGTATCTTATGTGCAGCTGTTCGACCGGTGTACA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 11 15 CAAGCAGAAGACGGCATACGAGAT GTGACAACTGAGTGACTTTATGCTGCCGGCTCTCAAC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 12 16 CAAGCAGAAGACGGCATACGAGAT GAACGATTCCAACGTAATTGTGTTGTCCTCAAGGAGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 13 17 CAAGCAGAAGACGGCATACGAGAT GGTTCGCAGGCAGGTCACAACACCGTTCTTTACGGAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 14 18 CAAGCAGAAGACGGCATACGAGAT TGTTCTCCCAATTGTAGTTGCTCCACATATCTGTGCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 15 19 CAAGCAGAAGACGGCATACGAGAT ATGGCCGTCAGTTGTGTAACTGTGACCTCTCTGAGGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 16 20 CAAGCAGAAGACGGCATACGAGAT TAAGCGTCCATGATTGATGCTAATGTTCCCTCTACCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 17 21 CAAGCAGAAGACGGCATACGAGAT TAACTGTCTTAGGCTAATTCTGGACTAGCATGTTCGC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 18 22 CAAGCAGAAGACGGCATACGAGAT TGGC CACGGT CATTGTACAGGTAC CGCATAGT C CTAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 19 23 CAAGCAGAAGACGGCATACGAGAT TAGCGAAAGATGCCGACGAATAGCTTGCGGGTCAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 20 24 CAAGCAGAAGACGGCATACGAGAT C CATACGGC CTGGAT CAC CAATATGGAGC CGT C CATA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 21 25 CAAGCAGAAGACGGCATACGAGAT ACGTCTCATGCCACCTGTTGGCCATGCAGTTCTCTGG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 22 26 CAAGCAGAAGACGGCATACGAGAT CAGAGACATACATGGCTCCAAGTTCAGGCGTCCTTCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 23 27 CAAGCAGAAGACGGCATACGAGAT CGAGCTTCTCGACCATACCACATCGACATTTCCGCAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 24 28 CAAGCAGAAGACGGCATACGAGAT AAC CGAGGATAGCAC CGTAC CAT C CAT CTAGGATAC C GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 25 29 CAAGCAGAAGACGGCATACGAGAT TATGGCGGCTGCGATTCTGGAGATATGTGCGCTATGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 26 30 CAAGCAGAAGACGGCATACGAGAT GAGAGAGTGACCAAGTACCACTAGTTAAGCAGCTACT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 27 31 CAAGCAGAAGACGGCATACGAGAT CTGGTCCAGCTTCTCTAACAAGTTGGTTCGAGAAGTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 28 32 CAAGCAGAAGACGGCATACGAGAT GTCACACGCTCACCGTTTGGACCTGTTGGTTCGCGTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 29 33 CAAGCAGAAGACGGCATACGAGAT GGTCCTATCGTGTCTAATTCCGCCTTGGATTGAGGCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC CAAGCAGAAGACGGCATACGAGAT AGTTCACTCCAGATCTGTTGCGCACCTTGCTTCACAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT ACGGTGCTGTAGTCAGCTTAGCACTTCGGTACCACCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT AAGATTCATACGACAGTTAAGCTAGAGACTTCCTCGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GACGTGACGGCTGCAATTTGAGCGTTGTTTACCTCTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT CAACTACTCGGATTGAGTTGTACGTCCGCCGAGTTGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT ACGGCAGTGGTACAACTTTGGTAGAGGTTGGTGGATT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT CGATTCTGCCGTGAACTTTCGACTATCCTGATGGAGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GTCGTAGACGGACCTGTTGAATGCCTCAACGAAGGTT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GTAACTGAGCAACTGCCTCGAATTCCAAGTGCGGTAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TGTCCAACTAATGCTCTTTGTAGCCAATGTCACTTCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TTCGGACGGTTCATTAGTTCACAAGCGGATGAAGACC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GGTTAAGCATGCCTCTATTCCTGATCTGACAGCATCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT AATGTACTGTGACTCTTTACCAGAGACCGCCTTAACG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GGTTACCATGCACCAATTTGATGGAACCTGTCTCACA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TCGTAGAACCTCCACAGTTGTCTCTTGTGACACCTTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GCATGGAACACCTCGTTTTCTCAGGTTGGCTGCACTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT AAGATCGTATAGCGCTCTTCGGTGTTCCGGCTAGGAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT ACGGATTCCTAACAGGTAAGCGTAAGCGGTTGTTGCC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT ATCCATATGGCGTTGGACCGTCGTTATCAGCCGATAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TAACCATTCGCTTCATTTTCCGAACAGGTCCGACTTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GAGTGTTTGCCTATGTTTACGAACGCCTTTTCCGTTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TACTAACCCGTTCTTCGTTCTGGTTGACATCGGAGAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TATACAATAGTGATTGCCCGAGGATCGAACCAACCAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GTTGGCTGGAGGCGAATTTCTCCGCTGTCAGGATCGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TCTTGGAGTTCATCACATTGCAATACCACTCCATGGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GACTAACGAGCGATCACTACCATGGCGACTTGAACGC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT CGTCTGTCCAGTTGACCTGGTCTGGTATTTACCATGC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT CCTGTGACTACTATCCATAACTCAACGCAAGTACGGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT AGACCAATGGCACGAGACAGAATTGGCGGGTTACCTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GTGAAGTCTTGTCTTCTTTCGAAGGTATCTAGAGAGG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT GATGCAACTGGTAGAGCTTCCACTCCGTAAATCCGTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT ATTGAGGCAACTGAACCTACGACATTCACGGATGACT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T CAAGCAGAAGACGGCATACGAGAT TGGTGTCCTTAAGTGAGCAAGACCTAGATTGTGGTTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 67 CAAGCAGAAGACGGCATACGAGAT CAGTTGATATGCACACATTGGTGACTAAGAGATGCGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 68 CAAGCAGAAGACGGCATACGAGAT CAGACATTGGTACTGGCTTGGCTAGTCGACCAAGACA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 69 CAAGCAGAAGACGGCATACGAGAT GCTTAATGGCGGATGAATTGCAGTCGTGGGGTACCAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 70 CAAGCAGAAGACGGCATACGAGAT CCTAGGATCATTGCCGCTCACCGCCAGAATTGGACAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 71 CAAGCAGAAGACGGCATACGAGAT GACGGTGCTCCTACTTATTGTCACCAGCCAACTCGAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 72 CAAGCAGAAGACGGCATACGAGAT CAGTGCCCGTCTTATACCCGTGTATTATGAGCGAGAA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 73 CAAGCAGAAGACGGCATACGAGAT AATCGCTATCGGAGAGGTTCGCAGAAGCATCGGTTAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 74 CAAGCAGAAGACGGCATACGAGAT TCAGTCGAGGCCAATGCTTCTTCCTAGAGTTGTCCGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 75 CAAGCAGAAGACGGCATACGAGAT ACGTGAAGGTCAACCTCTTACCTACTGGCACTGTACG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 76 CAAGCAGAAGACGGCATACGAGAT AAGCCATGAGGTGCTCATTATCGGCCTCCCGTGATCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 77 CAAGCAGAAGACGGCATACGAGAT GTGTTAGTGACTTCGCTCCAACAAGCTACCAGTCAAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 78 CAAGCAGAAGACGGCATACGAGAT GACTGCCCGGATTCATCGGCACTTAAGAACTAACACC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 79 CAAGCAGAAGACGGCATACGAGAT CTGCATCTGGAGAATACTTGGCAGCATATTAGCGGTT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 80 CAAGCAGAAGACGGCATACGAGAT TAACACCACCGCTTGTCTTCAATGGCAGTGGTCTTGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 81 CAAGCAGAAGACGGCATACGAGAT TGGCATTGTAAGCTGTCTTAAGGACGTTCATTCGGAC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 82 CAAGCAGAAGACGGCATACGAGAT CGGTGTGTCGCGCAATGTTCTCGTTCCTTGGAACTGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 83 CAAGCAGAAGACGGCATACGAGAT TGTAGGAACGTAGCATATTCCGATTGTTGCTGTCTCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 84 CAAGCAGAAGACGGCATACGAGAT TCACTGACAGTGCAGCTTGAGGCCGAAGTTTATCGGC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 85 CAAGCAGAAGACGGCATACGAGAT ACACTGGAGGTACGTATACGTATCCGAGGTTGCTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 86 CAAGCAGAAGACGGCATACGAGAT CTCTCTAGTGGCCTACACCAGCTTCTAGTTTCCACTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 87 CAAGCAGAAGACGGCATACGAGAT GACTTATACGTGCGAAGTTCAAGATTGCCCAGGCATT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 88 CAAGCAGAAGACGGCATACGAGAT TCACGCCGTTCTATGGCCCGGTTACAATTACGACACT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 89 CAAGCAGAAGACGGCATACGAGAT AGGTGGAATGACAGCGCTTCATAACACCGTCAAGTGG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 90 CAAGCAGAAGACGGCATACGAGAT TTGAGCATGAACTGCATTCAGTGAAGTCGTTGGCACT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 91 CAAGCAGAAGACGGCATACGAGAT CAATCAGCCGTATGGTCGGAGACACTCCTTATGCACC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 92 CAAGCAGAAGACGGCATACGAGAT TATCAACATGCTTGCTTTACGGCCAACATGGAGATTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 93 CAAGCAGAAGACGGCATACGAGAT TATGGAGCGTTGCTTAATCAGAGCAACTTCCGATAAC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 94 CAAGCAGAAGACGGCATACGAGAT TGCATTAGTTCGCACTCTGCCTATACTCGGAAGTTCC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 95 CAAGCAGAAGACGGCATACGAGAT TGAATGGATAGGAGCCATTGCCTTCCGATGCTTCAGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 96 CAAGCAGAAGACGGCATACGAGAT ATCTATGCTATGGCAGGTTCTTAACCGACGTGACAGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 97 CAAGCAGAAGACGGCATACGAGAT CGGCTATGGTTAGAACGTAACGTGGTAGGTACCGTCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 98 CAAGCAGAAGACGGCATACGAGAT TTAGCGGACAATCTCCTTTAACGCATGGTTACAAGCC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 99 CAAGCAGAAGACGGCATACGAGAT CCACAATTCTCTAAGACGGTCGCGTACAAGATCGAAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 96 100 CAAGCAGAAGACGGCATACGAGAT CAACCACGACTACTGCGTTGAACTGAGGAGGTTCGTT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T SEQ i5 / P5 primer ID NO AATGATACGGCGACCACCGAGATCTACAC ACAAGCGTCCACTATAGGGAGCAAGAAGCTTGCAGTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 101 AATGATACGGCGACCACCGAGATCTACAC TACAGTCGCACCGAACATGTATCACACGTGTGTCTAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 102 AATGATACGGCGACCACCGAGATCTACAC GAGTATCCACATATAGCTTCTGACGGCGAGTATGGAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 103 AATGATACGGCGACCACCGAGATCTACAC CTTCAAGATGTCTGCCGTCGCGGAGTTACAGAGTGGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 104 AATGATACGGCGACCACCGAGATCTACAC ATCAATACTTGTGGCTGTCAACCACTTGACTTACTGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 105 AATGATACGGCGACCACCGAGATCTACAC AGTCTTGCAAGTACGCCTGTGTATTGGACTCATGAGC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 106 AATGATACGGCGACCACCGAGATCTACAC TGCCTATAGACCACCGATTGCGCCTGACTGCCATCTT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 107 AATGATACGGCGACCACCGAGATCTACAC AGAGATGCGGCGTACTATTCTGCCACGCTTAGCTTGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 108 AATGATACGGCGACCACCGAGATCTACAC ATTGCATTATTACGAGGTTGATTAGGAGGAGTGCATC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 109 AATGATACGGCGACCACCGAGATCTACAC GTAGTAGAGTACAGACACCACAGGCATTATCGTTCGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 110 AATGATACGGCGACCACCGAGATCTACAC CGCAATTTCCGCATTATAACCACGGAGGTGGAACAAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 111 AATGATACGGCGACCACCGAGATCTACAC CGAGCTGCATCAGGCGTTCATGCATGAACACCTCGTT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 112 AATGATACGGCGACCACCGAGATCTACAC GAACGGTTCAACTCGCGTTACGGTGCTATTTGCGTGT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 113 AATGATACGGCGACCACCGAGATCTACAC TGTCTCCGCAACAACGCTTCTCCATTACGAGTTGCCA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 114 AATGATACGGCGACCACCGAGATCTACAC TTCGCCACGTTACGGTATTCGAGTCGGACGTGGTCAA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 115 AATGATACGGCGACCACCGAGATCTACAC TGTGCGACTCGCTAATCTTAGCCTGGTCCTTCAGACG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 116 AATGATACGGCGACCACCGAGATCTACAC AAGACGTGGACTAACGTTTACTGTATGCGGCTACTAG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 117 AATGATACGGCGACCACCGAGATCTACAC ATGGAGTCGGTAATAGTCCTCTAGAATGAATTCGTGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 118 AATGATACGGCGACCACCGAGATCTACAC AACGAGGTCGACGTTGTGACGAGCAGTTGCCTGATTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 119 AATGATACGGCGACCACCGAGATCTACAC AGCTTGCCGGACTTAGGTTCCTGGCTTCTAATGCCAG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 120 AATGATACGGCGACCACCGAGATCTACAC CCGATCGGTTAGTAGCTTTCGCATACTGTTCATCTCC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 121 AATGATACGGCGACCACCGAGATCTACAC TGCATCCTCCTCAGGAGTTCATGTCCATCGAACCGTT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 122 AATGATACGGCGACCACCGAGATCTACAC TTCTAGCTGGCCATAACTGAACAGGCACCCAGAATGC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 123 AATGATACGGCGACCACCGAGATCTACAC CATGATGCTTCAACGTGTGAGCGAATACATGTGACCT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 124 AATGATACGGCGACCACCGAGATCTACAC TTAGTCAGCGTTAGATTTCCACGGTTCCAGCATTGCT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 125 AATGATACGGCGACCACCGAGATCTACAC CAGTTGCGATTAGGTCCTCAGACTCCTCGCTTCTTGC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 126 AATGATACGGCGACCACCGAGATCTACAC ATCGGTTGTCCATGTTATGCGCTAAGTATGAGACATG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 127 AATGATACGGCGACCACCGAGATCTACAC AGTCTCGTCCGGCCAATTGGAGTTCTTCCCTGGTACA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 128 AATGATACGGCGACCACCGAGATCTACAC CAATCGAACAGTCACGCTTCTCTTCAGGATCTCGGAT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 129 AATGATACGGCGACCACCGAGATCTACAC ACGTGGTGACCGTAGACGAGGAATTCCGCACTTGAGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 130 AATGATACGGCGACGAGCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AGAGTCTAGTCCGGTGTTTCCTTGTGTACCTTGTGGT GTGATGGGCGCACTAGTTGCCAGCTAACACAGTAACC GTCCAGGTGGCTGAAGCTTCACCTAGGTTTCGTGCTT TCTCAGCGACACAGTGCGCTTGATCATTCAACGAGCT CGTAGGTGTATTGCCTATTGTTGAGATCGACTCCTGA TTCAGGTCCACGGTAACTAGCTGAAGAGTTCTGCCAT GAACCGACGTATCGCGATTCGACCACAACTCTCCAAG ACCTGCGCGACATCGACTCCGAAGAATAGTTGCCAAC CTCATAGTCCATATGCCCTCGTAATTGTCATCTGCAG AGGCCTGCGCTATTAAGGGCGTCCATTAACCTAGCTA ACAGAACTGCATTAGACTTCACTCTTAGCCGCAATTC CGTTAGGAGCATGTTGTTTGCCGGAAGACCGCTCTAA GAACACCTAATCTGGCTTTAATCGGTGAGGGCTTCTA CTTGCACACAGGATGGTTTCCGCAACCAACCTCAAGA GATCTTGGCTCTGTAGGTTCGGTTAGCTCTGGACGTT AGCACTTAGTTCTCAGGTTCGGAACTTCAACACGAAG GCCACTCTCAGCATAGCTCCAAGTCTCTTACGTACTC GGTATTGATAGAGAAGCTTAGTGGCGCCACCACAGAT GTATGCGGACCTCACCTTTCCACCGAAGGCCTAGAGT ACGATGATCGTCGATTATTGAGGCTCTACTCCTTGAC GTTGAACCTAGTACAAGTTAGGACACAGAGCAAGTCT AGCAGTCTCAACCGGTATGCGGATTCATATAAGCGTC GAAGCGGCGAAC CAGCAC CGGATGTAAGGAACATCCG TCGTCACCTCCATAGAATACGACAAGGCGCTCCAGTT ATCATCTCGCTGTACGTTTCTAGAGGAAGGTGTGAAG CCACTCCGTATCAAGCAGGCGATTGAGGTTCCGAACT GCAAGTTAGCACACGAGTTCGTACGCTAAACCGGATT TTACTTCATGACGAACATTCTTGTAACGGTATGGCCA GTTAATGATGCTCGGCATGTAAGGTGGCTGAGAACCA CTAACGGTCACTACGGAAACCGCTCCAACTCACACAC TACTTGGGCGATAGGAGTGCGGTGGATTCACCAAGGA GTTCACTGACATGACTAGTACAACTCGAGTTCACGCT TGAGAGTCGACATATCTTTGACACGGTGCACTCTGCT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 AATGATACGGCGACGAGCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC AATGATACGGCGACCACCGAGATCTACAC TCTTCGGGTCTAGTCTTTTCACGCGTCTGCTACCTAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CTAGAGATGTCCTCATATTGAATCCGGTTGGTATTCC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CATTCGGGCTGGCTGATACAGGAAGGAGAGAATCCTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CTGTATTCTGTAATCTCGCAATCAGATCATTCGGTCT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCTACCACATTAACGGCTGAGGTACTTGTAGTGAAGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCTCGTCCGCCAATACCTTACGTCGAGTAGATCTTCG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CTTACCTACGAACTTCATTCTTCTTCTCCCAGGTTGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CCACGGTGTCGAATCGCTGACAACCTCTCCTACCAGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCTACCGGCAAGACTCTTTCTCTCGAACTATCCTGTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TGTGCACGGCATATCCGTTCTCTGGCCAATAACTGCC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCGTCGTTCTCACACGGTTCCTTAAGCCTACCGTTGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T AGCTCTAGGCTTACACTTGCAACGTATTGCATCTGAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCGTAATTCCGGTACCTTGACACAACAGGACGCATAG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CCGTCTTCCACACAAGATTCTACAGACTCTGGTTGTG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ATGAGATGTTATGACGCTGCTACCTGTAATCGAATCG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TAGGACCGGAGTTGCTTCCATATTCGGAATTGAGCTG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TCTTATTCATACGTTCATTCCGCCAATTCCAAGGTAC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GGCTTCTGGTTGGTTCTTGGATAACGATCCAACCTTG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GAGCGGTCCACTGACAAGTCGGATAACCGATACGCTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GCCAGAACGATTGTCCGTACTAGGCGGTGGGCTGTAT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TAGACCAAGCCTAACCATTGCGTTATAGCATAAGGCG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GAGGAGATGCTCACATCTTCTCACCTCATTTGCAAGG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACACCTCCTCTGCGAGATGGCATATTACCGATTGGTC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TGGCAATCAGTCGCTGAGGAAGGACTCTGTTGCCTTG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TGTTGATTCAAGTGTCATAGGATGATGGCGGAAGAGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GCTGACACCTGATAGCCTTACACGTAACCCAATCGGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GAGGTTCTGTGTTCGTCGGAGATCCAACATGACATCC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACCTCAGGAAGTTACAGTCAAGAACCGTGCAGTGGAT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ACCTGACCACGACACCATTGGCTTCAACGGGATAGGT ACACTCTTTCCCTACACGACGCTCTTCCGATC*T TAAGATCACTGCGTCCATGGAGTGTGCATCTAGTGAG ACACTCTTTCCCTACACGACGCTCTTCCGATC*T CAAGAGGGGTGCCTATCTAGCAGCTCTTATTAGGTGC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ATCGAGAGGTGAATTCATTGGAGGTTAGATGGCATGA ACACTCTTTCCCTACACGACGCTCTTCCGATC*T GACACGTTATCAGCTGGTTATGAGTCACGTGCTTAGC ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 17 1025

[0065] Dual-use protocol for Illumina and nanopore sequencing platforms. Multiplexing barcodes on the Illumina platform typically have the lengths of 8 nt flanking the sequence read on both ends, but they are not ideal for multiplexing samples being sequenced on a nanopore instrument (Oxford Nanopore Technologies) due to the higher error rate of this platform. A dual-use barcode system was designed that contains, in an exemplary embodiment, a distinct 37 nucleotide (nt) barcode on each side of sequencing adaptor (the first 8 nt of which were used for Illumina multiplexing), which enables the multiplexed DNA library to be sequenced on both Illumina and nanopore platforms. The barcodes were designed using an inhouse developed R script to generate 8 nt and 29 nt barcodes that maximized the Levenshtein distance between any given pair of barcodes. Specifically, the DNA Barcodes package in BioConductor was first used to generate a set of 1,014 unique lOmers with minimum Levenshtein distance of 4 and a set of 283 unique 8mers with minimum Levenshtein distance of 3, as computational limitations prevented design of 37mers directly. An 8mer and three 1 Omers were then concatenated together with stripping of the last nt to generate a 37mer index primer. The final set of 192 37mer (Figure 12) index primers had a mean Levenshtein distance of 23 + / - 2.4 SD (range 14-31) between any two barcodes.

[0066] Pipeline for Designing 37mer Barcodes for Dual Use of Illumina and Oxford Nanopore Technologies (Nanopore) Sequencing Instruments. 37mer barcodes that could effectively be used for both Illumina and Nanopore were designed with the following goals in mind: generate 192 37mer barcodes such that unique dual indexes (UDIs) can be used for all 96 samples on a 96-well plate; maximizing Levenshtein distance between each pair of barcodes in order to minimize barcode “crosstalk”; Ensuring a minimum Levenshtein distance between each pair of 8mers (the first 8 nt (nucleotides) of each 37mer) for Illumina sequencing; and ensuring a minimum Levenshtein distance between each pair of 37mers for nanopore sequencing on Oxford Nanopore Technologies (ONT) instruments. It was determined that it was too computationally expensive to determine DNA barcodes that maximize the Levenshtein distance between them for barcodes of >12 nt in length. Instead, the strategy was to design a set of 8mer barcodes and 3 sets of unique lOmer barcodes that are concatenated together to form 37mer barcodes.

[0067] A custom algorithm was developed in python to carry out the above strategy. For the python code, the following scripts were utilized: Run the R script “generate_8mer_barcodes.R”. This script uses the DNABarcodes tool in the Bioconductor software package (v.3.1.1). These scripts were run in R v4.0. Required additional R packages 17 1025 include Matrix and parallel. Note that setting the Levenshtein distance threshold to 3 will not yield a sufficient number of candidate barcodes (n=187). Thus, barcodes generated from setting the Levenshtein distance threshold to 3 and then rerunning the R script with the Hamming distance threshold set to 3 were combined.

[0068] This R script generates a total of 914 candidate barcodes at a Levenshtein or Hamming distance threshold of 3. Note that the DNABarcodes algorithm is non-coordinated, meaning that it will not generate identical results when the program is rerun. The pairwise distances between any two barcodes can be calculated using Linux commands that will also auto-generate an R script.

[0069] The in-house Python script “parse_lev_distance.py” can then be used to pull out all barcodes at a predefined minimum Levenshtein distance threshold of 3.

[0070] It was found that there were 283 8mer barcodes at a Levenshtein threshold cutoff of 3 generated in total (“8mer_barcodes.txt”). The minimum Levenshtein distance for any given set of barcodes can be separately checked with a Bash shell script ‘ ‘check_dis tance_lev. sh”.

[0071] Next, to generate the remaining 29 nt stretch of the 37mer barcodes, the DNABarcodes tool was used to generate 12mer (“generate_12mer_barcodes.R”) and lOmer (“generate_10mer_barcodes.R”) barcodes and then concatenate 1 12merand2 lOmer barcodes to generate a 32mer barcode, from which 3 nucleotides can be stripped to generate 29mer barcodes.

[0072] This R script generated 232 12mer barcodes and 1,014 lOmer barcodes. The pairwise distances between any two barcodes can be calculated using Linux commands, and which also auto-generate an R script.

[0073] An in-house Python script “parse_lev_distance.py” can then be used to pull out all barcodes at a predefined minimum Levenshtein distance threshold of 4.

[0074] Use of the script results in 232 12mer barcodes (“12mer_barcodes.txt”) and 1,014 lOmer barcodes (“10mer_barcodes.txt”). Note the minimum Levenshtein distances cannot be increased by 1 to 6 and 5, because this will decrease the number of usable barcodes to less than 192 (45 and 72, respectively).

[0075] Next, randomly from the pool of 232 12mer barcodes (“12mer_barcodes.txt”) and 1,014 lOmer barcodes (“10mer_barcodes.txt”), barcodes were selected and concatenated these chosen barcodes to generate 232 32mer barcodes (12mer - 10 mer - 10 mer) (“32mer_barcodes.txt”). 3 nucleotides were stripped off of the 3’ end and then concatenated to 17 1025 a random 8mer barcode from the pool of 238 8mer barcodes (“8mer_barcodes.txt”) to the 5’ end to generate 37mer barcodes. Finally, 192 of the “best” 37mer barcodes (“37mer_barcodes.txt”) were selected on the basis of maximum pairwise Levenshtein distance selected using similar Linux commands as described above. The minimum pairwise Levenshtein distance for this set of 192 37mer barcodes is 14 using the “check_distance_lev.sh” shell script.

[0076] Illumina sequencing. DNA libraries were pooled in equal volumes and the sequencing library pool was quantified using the Qubit fluorometer (ThermoFisher). Illumina sequencing was performed on MiSeq (2 x 150 nt paired-end)(with capacity for up to 5 samples per run) or HiSeq 1500 / 2500 instruments (140 nt single or 2 x 140 nt paired-end, with capacity for up to 40 samples per lane), according to the manufacturer’s protocol.

[0077] Nanopore sequencing. Stringent procedures were adopted to prevent crosscontamination between samples during the library preparation steps, including unidirectional workflow, separating pre-PCR and post-PCR workspaces, and regular cleaning of the workbenches and biosafety cabinets with 5% sodium hypochlorite. Amplified DNA libraries were prepared for nanopore sequencing using the ID library preparation kit (Oxford Nanopore Technologies) either manually or on an epMotion 5075 liquid handler biorobot (Eppendorf), with the processing of 8-16 samples per batch. The input DNA ranged from 200-1000 ng. The DNA was then sequenced using either R9.4 or R9.5 flow cells on a MinlON or GridlON X5 instrument (Oxford Nanopore Technologies). The MinlON has a single flow cell position for processing of a single sample at a time, while the GridlON has 5 flow cell positions for processing of up of 5 samples simultaneously. Up to five individually barcoded samples per flow cell were sequentially loaded on the nanopore instrument for sequencing. Between each sample, flow cells were washed according to the manufacturer’s instructions to minimize carryover contamination. The estimated cost for reagents per sample (excluding labor) was $27.20 - $61.40 and $269.70 for Illumina and nanopore sequencing, 589 respectively.

[0078] Positive and negative external controls. Negative controls were from the same batch of pooled plasma from healthy donors (Golden West Biologicals, CA). Positive controls consist of the negative control plasma spiked with sheared (to 150-200 base pair range) DNA extracted from cultured non-pathogenic microorganisms (American Type Culture Collection, VA): Koi herpesvirus (virus, VT-1592D), Streptococcus uberis (gram-positive bacterium, ATCC strain 0140J BAA-854D-5), Rhodobacter sphaeroides (gram-negative bacterium, ATCC BAA-808D-5), Millerozyma farinosa (yeast, ATCC MYA-4447D-5), Aspergillus oryzae (mold, ATCC 42149D-2), and Neospora caninum (parasite, ATCC 50843D) (see Table 3). All controls underwent the same wet lab procedure and bioinformatics analysis as the clinical samples.

[0079] Table 3. Positive and negative external controls. 17 1025 Sample Platform Reads Organism detected Reads (>2) RPM Ct nRPM Titer of spiked organism in + control (cp / mL) NC-1 Illumina 6,415,971 No hits n / a n / a 10.5 n / a n / a NC-2 Illumina 12,520,990 Thermus scotoductus 20 1.6 10.5 0.141 n / a Propionibacterium acnes 14 1.1 10.5 0.099 n / a Methylobacterium radiotolerans 12 1.0 10.5 0.085 n / a Variovorax paradoxus 10 0.8 10.5 0.071 n / a NC-3 Illumina 7,545,060 Propionibacterium acnes 18 2.4 10.5 0.211 n / a Achromobacter xylosoxidans 14 1.9 10.5 0.164 n / a Pseudomonas pseudoalcaligenes 7 0.9 10.5 0.082 n / a Thermus scotoductus 4 0.5 10.5 0.047 n / a NC-4 Illumina 1,244,108 Verminephrobacter eiseniae 3 2.4 10.5 0.213 n / a Comamonas testosteroni 3 2.4 10.5 0.213 n / a NC-5 Illumina 11,598,931 No hits n / a n / a 10.5 n / a n / a NC-6 Illumina 13,599,694 No hits n / a n / a 10.5 n / a n / a NC-7 Nanopore 702,446 Achromobacter xylosoxidans 26 37.0 10.5 3.272 n / a Cutibacterium acnes 6 8.5 10.5 0.755 n / a Pseudomonas fluorescens 5 7.1 10.5 0.629 n / a NC-8 Nanopore 1,188,000 No hits n / a n / a 10.5 0.000 n / a PC-1 Illumina 8,602,231 Cyprinid herpesvirus 3 9483 1102.4 12 34.450 6076 Streptococcus uberis 10084 1172.3 12 36.633 26430 Rhodobacter sphaeroides 7827 909.9 12 28.434 159002 Millerozyma farinosa 15276 1775.8 12 55.494 27309 17 1025 Aspergillus oryzae 4502 523.4 12 16.355 40 Neospora caninum 2926 340.1 12 10.630 202 Thermus scotoductus 8 0.9 12 0.029 Achromobacter xylosoxidans 7 0.8 12 0.025 Propionibacterium acnes 6 0.7 12 0.022 Pseudomonas pseudoalcaligenes 7 0.8 12 0.025 PC-2 Nanopore 3,119,414 Cyprinid herpesvirus 3 6,907 2,214 12 69.194 6076 Streptococcus uberis 6,606 2,118 12 66.178 26430 Rhodobacter sphaeroides 4,494 1,441 12 45.020 159002 Millerozyma farinosa 3,851 1,235 12 38.579 27309 Aspergillus oryzae 269 86 12 2.695 40 Neospora caninum 1,058 339 12 10.599 202 Cutibacterium acnes 9 3 12 0.090 Thermus scotoductus 6 2 12 0.060

[0080] Limits of Detection and Linearity. To evaluate the limit of detections for bacteria and fungi for this assay, DNA was spiked from non-pathogenic microorganisms acquired from ATCC into healthy donor negative plasma in a series of 4-fold dilutions from 1:1 (no dilution) to 1:4096 (see Table 4). Each concentration of microorganism was tested on mNGS with 4 replicates for reproducibility. The bacteria and fungi tested include Streptococcus uberis, Rhodobacter sphaeroides, Millerozyma farinosa, and Aspergillus oryzae. Thresholds were chosen based on the nPRM corresponding to Youden’s index on the training data ROC curve and using the composite standard. The bacterial nRPM thresholds were 2.6 and 0.54 for Illumina and nanopore sequencing, respectively; the fungal nRPM was 0.10 for Illumina and nanopore sequencing. The LoD was defined as the dilution at which mNGS testing detected the pathogen at levels above the nRPM threshold in 4 of 4 replicates. To evaluate assay linearity, a linear regression was performed on the same four sets of 615 serially diluted positive controls used in the LoD. The nRPM values were plotted against the input concentration (copies, or genome equivalents per mL). The best fit regression line along with the linear equation and R2 value was added to the plotted values (see FIG. 7).

[0081] Table 4. Fungal true positives (TP), false positives (FP), false negatives (FN) using Illumina and nanopore sequencing: 17 1025 Illumina sequencing - Gold Standard Case Sample Type Training or Validation Pathogen Species RPM Normalized RPM % of all Microbes # Reads NGS call S58 Pleural Fluid Validation Aspergillus fumigatus 6.82 4.82 0.22 237 TP S26 Pleural Fluid Training Candida albicans 0.00 0.00 0.00 0 FN S27 Abscess Validation Candida glabrata 25.26 25.26 0.28 161 TP S27 Abscess Validation Candida albicans 9.57 9.57 0.11 61 FP S29 Abscess Training Candida albicans 0.00 0.00 0.00 0 FN S37 Perihepatic Fluid Training Candida krusei 0.37 0.74 0.00 2 FN S49 Swab Training Candida albicans 130.07 65.03 0.08 563 TP S51 BAL Training Aspergillus fumigatus 1.06 4.22 0.07 8 TP S72 Peritoneal Fluid Training Candida albicans 1.59 9.02 0.65 15 TP S77 Peritoneal Fluid Training Candida albicans 0.13 0.72 0.03 1 FN S59 Peritoneal Fluid Validation Candida glabrata 504.19 178.26 0.08 3585 TP S59 Peritoneal Fluid Validation Pichia kluyveri 0.42 0.15 0.00 3 FP S59 Peritoneal Fluid Validation Candida krusei 0.14 0.03 0.00 1 FN S79 Chest mass Validation Coccidioides immitis 83.77 41.89 0.44 341 TP S80 Chest mass fluid Training Coccidioides immitis 2.97 2.10 0.23 15 TP S83 BAL Validation Aspergillus terreus 9.50 1.19 0.52 214 TP S83 BAL Validation Aspergillus fumigatus 2.98 0.19 0.16 67 TP S85 Abscess Validation Talaromyces marneffei 0.11 0.11 0.01 3 FP S4 CSF Validation Candida parapsilosis 28.97 1.81 0.77 10 TP S5 Joint Fluid Validation <A series of fungi that is cross-over from a high titer of Saccharomyces cerevisiae, which was determined to be clinically n / a n / a n / a n / a FP 17 1025 non-patho genic > S22 Peritoneal Fluid Validation Candida albicans 18.26 584.34 0.20 9 TP S22 Peritoneal Fluid Validation Candida glabrata 16.23 519.41 0.17 8 TP S127 CSF Validation Coccidioides immitis 88.27 15.60 0.49 444 TP S127 CSF Validation Blastomyces dermatitidis 0.60 0.11 0.00 3 FP S167 Peritoneal Fluid Validation Lodderomyces elongisporus 0.14 0.14 0.03 1 FP S3 Joint Fluid Validation Lodderomyces elongisporus 0.16 0.44 0.00 1 FP S79 Chest mass Validation Aspergillus fumigatus 0.25 0.12 0.00 1 FP S94 CSF Validation Coccidioides immitis 64.42 0.50 0.58 546 TP S116 BAL Validation Cryptococcus neoformans 116.75 3.65 0.33 986 TP S121 CSF Validation Coccidioides immitis 437.20 38.64 0.49 4799 TP S141 Perigastric Fluid Validation Candida parapsilosis 0.00 0.00 0.00 0 FN S142 Abscess Validation Candida tropicalis 4.40 1.56 0.12 3 TP S97 CSF Validation Candida glabrata 9.57 9.57 0.44 60 TP S101 Back Fluid Validation Candida albicans 0.29 0.50 0.06 2 TP S103 CSF Validation Candida sp. WT-2012 0.14 0.19 0.00 1 FP S104 Peritoneal Fluid Validation Candida glabrata 10.28 10.28 0.57 78 TP S105 CSF Validation Cryptococcus neoformans 4262.78 33.30 0.95 31493 TP S106 CSF Validation Candida parapsilosis 22302.21 2787.78 0.99 163078 TP S107 CSF Validation Candida parapsilosis 29.15 14.58 0.79 189 TP S108 CSF Validation Candida parapsilosis 47.69 33.72 0.90 296 TP S109 CSF Validation Cryptococcus neoformans 122.20 43.20 0.69 1214 TP S110 BAL Validation Aspergillus spp 0.72 1.02 0.10 6 TP S110 BAL Validation Aspergillus oryzae 0.48 0.53 0.07 4 FP S123 CSF Validation Cryptococcus gattii 1.07 0.27 0.03 12 TP S153 Peritoneal Fluid Validation Malassezia globosa 0.12 0.16 0.01 3 FP S114 Abscess Validation Coccidioides immitis 81.02 114.58 0.30 839 TP 17 1025 S114 Abscess Validation Penicillium rubens 0.77 1.09 0.00 8 FP S119 Peritoneal Fluid Validation Candida sp. WT-2012 0.41 0.58 0.00 1 FP S120 Urine Validation Candida albicans 15.60 31.20 0.01 65 TP S136 BAL Validation Aspergillus fumigatus 21.85 2.73 0.70 62 TP S145 Pleural Fluid Validation Tetrapisispora blattae 0.18 0.13 0.00 1 FP S124 CSF Validation Coccidioides immitis 144.47 6.38 0.47 1467 TP S125 BAL Validation Histoplasma capsulatum 3.44 0.02 0.08 16 FN S126 BAL Validation Pneumocystis jirovecii 4991.82 19.50 0.79 13533 TP Nanosequencing - Gold Standard Case Sample Type Pathogen Species RPM Normalized RPM % of all Microbes # Reads NGS call S4 CSF Validation Candida parapsilosis 8.70 0.54 0.26 10 TP S22 Peritoneal Fluid Validation Candida glabrata 7.38 236.16 0.62 8 TP S22 Peritoneal Fluid Validation Candida albicans 1.85 59.04 0.15 2 TP S58 Pleural Fluid Validation Aspergillus fumigatus 5.89 4.16 0.85 11 TP S83 BAL Validation Aspergillus terreus 5.75 0.72 0.60 9 TP S83 BAL Validation Aspergillus fumigatus 1.92 0.13 0.20 3 TP S26 Pleural Fluid Training Candida albicans 0.00 0.00 0.00 0 FN S29 Abscess Training Candida albicans 0.00 0.00 0.00 0 FN S37 Perihepatic fluid Training Candida krusei 0.00 0.00 0.00 0 FN S51 BAL Training Aspergillus fumigatus 0.00 0.00 0.00 0 FN S72 Peritoneal Fluid Training Candida albicans 1.97 11.16 1.00 11 TP S77 Peritoneal Fluid Training Candida albicans 0.00 0.00 0.00 0 FN S80 Chest mass fluid Training Coccidioides immitis 0.97 0.69 0.50 1 TP S27 Abscess Validation Candida glabrata 4.72 4.72 0.83 5 TP S49 Swab Validation Candida albicans 108.50 54.25 0.13 138 TP S59 Peritoneal Fluid Validation Candida glabrata 116.44 41.17 0.02 174 TP S59 Peritoneal Fluid Validation Candida krusei 5.35 0.00 0.00 8 FN S79 Chest mass Validation Coccidioides immitis 60.14 30.07 0.69 101 TP 17 1025

[0082] Bioinformatics analysis. Illumina sequencing data were analyzed for pathogens using the clinically validated SURPI+ (sequence based ultra-rapid pathogen identification) computational pipeline vl.0.63-dev 7,20,58. SURPI+ uses the entirety of the NCBI GenBank nt database (March 2015 distribution) as the reference database and incorporates taxonomic classification algorithms for accurate identification of pathogens as described in Miller et al. (Genome Res 29:831-842 (2019)). Nanopore sequencing data were analyzed using SURPIrt (SURPI “real-time”) software (SURPIrt research 1.0.14-build.86). Raw fast5 files were base called using MinKNOW software v3.1.20 installed on the GridlON in real-time mode without polishing. The base called reads were run through in-house developed scripts for sample demultiplexing using the BLASTn (v2.7.1+) aligner at a significance E-value threshold of 10-2. After trimming adapters and removing low-quality and low-complexity sequences, the first 450 nt of the preprocessed read was partitioned into three 150 nt segments, followed by rapid low-stringency identification of candidate pathogen reads using SNAP (version l.OdevlOO) alignment to microbial reference databases (viral portion of 2019 NCBI nt; bacterial RefSeq; fungal and parasitic pathogens in the fungal RefSeq and parasitic RefSeq databases), using an edit distance of 5059. Candidate reads were then filtered and taxonomically classified as described in Miller et al. Real-time analysis was performed by running the SURPIrt pipeline in continuously looping mode, with ~ 100k-200k nanopore reads analyzed per batch.

[0083] Computational algorithm for pathogen identification. A pathogen identification algorithm that was applicable for both Illumina and 642 nanopore datasets outputted by SURPI or SURPIrt (see above) was developed to assess and optimize performance accuracy. An initial reference database was manually tabulated based on pathogens detected in body fluids by culture and / or PCR testing. The algorithm calculated a nRPM pathogen count, filtered out taxonomically related microorganisms, and defined criteria for pathogen detection, as explained in detail below.

[0084] (1) Calculating a normalized RPM. A nRPM metric was developed to standardize microorganisms across samples with uneven sequencing depths and input DNA concentrations. For Illumina sequencing, the RPM was defined as the number of pathogen reads divided by the number of preprocessed reads (reads remaining after adapter trimming, 59 17 1025 low-quality filtering, and low-complexity filtering), while for nanopore sequencing, the RPM was defined as the number of pathogen reads divided by the number of base called reads. A nRPM was calculated that adjusted the RPM with respect to background based on the Ct value (to the nearest 0.5 increment) during the PCR amplification step of library preparation. As the average Ct value across all samples was 7, the nRPM was defined as nRPM = RPM / 2(Ct-7). Receiver-operating characteristic (ROC) and precision-recall curves were plotted using the Python software package and pandas data analysis library. The optimal nRPM threshold was obtained by plotting the ROC curve at varying nRPM values and determining the nRPM at Youden’s Index. The incorporation of a nRPM metric is based on a previous observation of a log-linear relationship between the qPCR Ct value and the RPM of representative, presumed background contaminant microorganisms such as Achromobacter xylosoxidans (see FIG. 51). Thus, assuming a constant background level of Achromobacter xylosoxivdans, measured RPM would be inversely correlated with the input concentration. In the current study, better performance was achieved using the nRPM versus the RPM metric (see FIG. 11B and E).

[0085] (2) Filtering out closely-related microorganisms. Taxonomic classification using metagenomics data commonly yields a minority fraction of reads that map to related taxa with the same family or genus as the microorganism truly present in the sample. In order to minimize cross-species misalignments for closely related microorganisms, the nRPM of microorganisms that share a genus or family designation was penalized (reduced). A penalty of 10% and 5% was used for genus and family respectively, based 675 on the empirical maximization of specificity from the ROC curve of the training set. For example, 676 if Escherichia coli had an nRPM of 100 and Shigella sonnei (from same Enterobacteriaceae 677 family) had an nRPM of 5, the nRPM of Shigella sonnei would be reduced to zero. In the current study, better performance was achieved in the training dataset using this filter.

[0086] (3) Criteria for pathogen detection. Two criteria were developed for pathogen detection. The candidate pathogen was required to 683 (i) have a minimum number of pathogen-specific reads identified (>3 for bacteria and >1 for fungi) (see FIG. 11A and D), and (ii) meet an optimal nRPM threshold. Optimal nRPM thresholds using composite standards were set to the maximum Youden’s index (bacterial nRPM of 2.6 and 0.54 for Illumina and nanopore sequencing, respectively; fungal RPM of 0.10 and 0.10 for Illumina and nanopore sequencing, respectively), as determined from the ROC curve of the training set. The clinical gold standard (culture / 16S PCR) used the same thresholds except that the bacterial nRPM threshold for Illumina sequencing was 3.2.

[0087] Statistical methods. To evaluate accuracy, two criteria were applied: (i) a clinical gold standard based on culture and 16S PCR results obtained through routine clinical care, and (ii) a composite standard based on a combination of clinical testing (culture and 16S / 28S-ITS PCR), orthogonal testing (e.g., digital PCR, serology), and clinical adjudication. The specific scoring algorithm is outlined as follows (see Table 5): Based on the clinical or composite standard, true positives (TP) or false negatives (FN) were scored for each microorganism that was detected or not detected by mNGS, respectively. For each sample, a true-negative (TN) was scored if no other microorganism(s) other than the expected ones based on the clinical or composite standard were detected by mNGS; otherwise, a false-positive (FP) was scored. Multiple FP results in a sample were counted as one FP overall, p-values were calculated using a two-sided Welch’s t-test at a significance p-value threshold of 0.05. All data points in the study were performed once, except the LoD studies which were performed in four replicates at each dilution.

[0088] Table 5. Scoring system for the mNGS accuracy evaluation. 17 1025 Negative Negative 1 TN an organisms net d«ecl«d. Ncrtalive Posdive for any org^s^x®) 1 FP for the organises} found on mNGS Pss&ve for 1 ogw&ffi PasWe lee the IctaM rvgamsm 1 TPfmhat organism 1 TH For aS rAhsr organisms nN dstacfed. PsasUmfcv 1 tor a d^terent organism dafestsd by fee gold standard 1 FP for different dtaeeled by mNGS P«s^v«- for 2 argarhsme Po^ive for only 1 1 TP Far the detested Aim FN for the organhm not detacfed. 1 TN fer eti q^isr organism nN detected. Po^ve- for 3 organism Po^efiorS^S organisms and passim far 2 different orgafesms 2 TP try fee two esgsfefem datneted ANSI FN for few organism not dafeetad d^seted by mNGS

[0089] Confidence intervals for the ROC curves. To evaluate the reliability of the validation set data, a custom python script was coded that bootstrapped the dataset by randomly resampled the dataset with replacement to generate a replicate dataset of the same size for 2000 61 17 1025 iterations. The resultant distribution was used to produce a 95% confidence interval (CI) for the ROC curve (see FIG. 6).

[0090] Orthogonal confirmation of mNGS results. Digital PCR (dPCR) for orthogonal confirmation of mNGS results was performed using the Biorad QX200 Droplet Digital PCR System. The advantages of dPCR include the ability for absolute quantification, improved detection of very low-abundance nucleic acids with high precision, and higher tolerance to the presence of inhibitors and / or contaminants in the body fluid samples. Thus, the use of dPCR was deemed to be a more robust indicator for the presence of pathogen-specific DNA in the body fluids than conventional PCR. All primer and probe pairs were synthesized by Integrated DNA Technologies, Inc. and first validated using positive control microorganisms (see Table 6). Genomic DNA from positive control microorganisms was purchased from ATCC and mechanically sheared (MiniTUBE, Covaris) to an average of 200-300 base pairs. For Sanger sequencing, DNA was first cloned into colonies using a TOPO TA Cloning Kit (ThermoFisher). Sanger sequencing of the clones was then performed at Elim Biopharmaceuticals, Inc. Sequencing traces were analyzed on Geneious software (version 10.2.3) and aligned to the National Center for Technology Information nt database using BLAST. Serology confirmation of the Bartonella case was performed by Quest Diagnostics. 17 1025 Table 6. PCR primers used for orthogonal validation. (SEQ ID Nos:197-225) C&gan&m Assay PrimaH Frsm«r2 Psc&« P?s4fcWJ Wltai Lon^ IM A^fij-seAs .......... WL MrATCGTGCAGC<WSGTG CCSeK^CACCATATPCT MC^X^rA5T€rTC«ACrT SA ACGCWASGCTn-CMgAAT 7?2^m£5CWCWAS7CS C7€A<^£A@GnrCA£MC^ & PCR A^JAAJ««CACA?3OCAA^CA eg CCGACAGA rCCTr<mXAAO <y> CCG77X5ASCCA7X; ft&vb&zt&'iirfi! 4W ^CR T ^KvAAC7CCCA7TAAA7A7C7 78 ^IPCR TOAACCGa^rCATTTATTAHT 82 7ACCT7'W«GC€C7GC7G 82 ............. 4 W PCR C«7WCG7GAACGC7AAC 8S Z40a&Pmm® {wwtte O^CGA^7AAGCA7rGA m i^i 82 ................................ ^zA F€R ATATCCCATMTCtaSGCAGA CCGATGAAATA^CGCCTGAT 88 63 17 1025

[0091] Analysis of pathogen and human DNA lengths. Pathogen-specific length distributions in mNGS data were obtained by aligning paired-end Illumina reads or single-end nanopore reads to individual pathogen genomes (see FIG. 10). For Illumina sequencing data, unaligned, human-depleted FASTQ reads were extracted using the bamtofastq function in the bedtools software package, followed by alignment to species-specific microbial reference genomes using BWA. An in-house developed Python program and Linux shell scripts were used to extract read lengths from resultant paired-end SAM files. For nanopore sequencing data, read lengths were directly extracted from SAM-formatted pathogen reads outputted from the SURPIrt pipeline. Histograms of the read lengths were plotted using the software package Matplotlib as implemented in Python.

[0092] For characterization of human DNA length distributions from Illumina data, FASTQ files were first trimmed for Illumina adapters with cutadapt (vl.16), followed by alignment with BWA 742 (vO.7.12) to the hg38 human reference genome. This revealed a previously described peak of -160 nt that corresponds to nuclear DNA wrapped around a single histone (see FIG. 10A).

[0093] Length distributions were assessed from 58 bacterial and 10 fungal pathogens by histogram analysis, with the inclusion criteria of at least 10 paired-end reads aligned to each pathogen genome (see FIG. 10B). The average distribution skewed towards shorter length fragments with a long tail extending to -700 nt, and no significant size differences between bacterial and fungal DNA were observed. This range of pathogen DNA sizes was similar to what had been previously observed in plasma and urine. Bacterial length distributions from nanopore sequencing were longer on average (356 nt) than from Illumina sequencing (177 nt) (see FIG. 10C).

[0094] Data availability. Metagenomic sequencing data (FASTQ files) after removal of human genomic reads have been deposited into the NCBI Sequence Read Archive (SRA) (PRJNA558701, under umbrella project PRJNA234047).

[0095] Software and code accessibility. SURPI+ vl.O (github.com / chiulab / SURPI-plus-dist) and SURPIrt vl.O software 761 (github.com / chiulab / SURPIrt-dist) have been deposited on GitHub and are available for download for research use only. Linux (Ubuntu 16.04.6) and Python (python 2.7.12) scripts used for construction of dual-use Illumina and nanopore barcodes are provided below. Other custom scripts for ROC curve and read length analysis have been deposited on Github (github.com / wei2gu / 2020-NGSInfectedBodyFluids / ). 17 1025

[0096] Sample Collection. A total of 182 body fluid samples from 160 patients, including 25 abscess, 21 joint, 32 pleural, 27 peritoneal, 35 cerebrospinal, 13 bronchoalveolar lavage (BAL), and 29 other body fluids (see Table 7 and Table 1), were collected as residual samples after routine clinical testing in the microbiology laboratory. Among the 182 samples, 170 were used to evaluate the accuracy of mNGS testing by Illumina sequencing (see FIG. 1A, and Table 1). These accuracy samples included 127 positives by culture (with pathogen(s) identified to genus or species level), 9 culture-negative but positive by 16S or 28S-ITS PCR, and 34 negative controls from patients with alternative non-infectious diagnoses (e.g., cancer, trauma) (see FIG. IB). Out of the 170 samples used for evaluation of accuracy, the first 87 consecutively collected samples were used to compare the accuracy of nanopore relative to Illumina sequencing. The remaining 12 body fluid samples out of 182 total were collected from patients with negative direct microbiological testing of the body fluid but highly suspected or orthogonally proven infection, as described in the case series section below (see FIG. IB, Table 11, and Clinical Vignettes in the Examples). These 12 body fluids were analyzed to demonstrate the diagnostic utility of mNGS testing for detecting pathogens in cases of unknown infectious etiology. Negative external controls (pooled donor plasma matrix) and positive external controls (donor plasma matrix spiked with known quantities of DNA from organisms considered non-pathogenic to humans) were run in parallel with body fluid samples (see Table 3).

[0097] Study Patients. Among 158 patients out of 160 with available clinical data, 144 (91%) were hospitalized, of whom 61 (39%) required intensive care unit (ICU) management and 45 (28%) met clinical criteria for sepsis (32%) were immunocompromised due to organ transplantation, recent chemotherapy, human immunodeficiency virus (HIV) infection, or drug-induced immunosuppression, and 71 (45%) were on antibiotics at the time of body fluid collection (Table 7). According to usual standard-of-care practices, bacterial cultures were obtained for all body fluids, with 63 (35%) and 81 (45%) having additional cultures done for acid-fast bacilli (AFB) and fungi, respectively.

[0098] Table 7. Patient and Sample Characteristics Patient Demographics (n = 158) Age - years Median (interquartile range) 54 (34-65) Range (0-92) Gender Female - no. (%) 75 (47%) Male - no. (%) 83 (53%) 17 1025 Hospitalization Patients Total - no. (%) 158 (100%) In hospital 144 (91%) In intensive care unit 61 (39%) Days Hospitalized - no. (IQR) 14 (7-26) 30-day mortality - no. (%) 9 (6%) Immunocompromised - no. (%) 51 (32%) On empiric antibiotics at time of body fluid collection - no. (%) 71 (45%) Sepsis according to SIRS criteria (>2) - no. (%)a 45 (28%) Presumed Illness - no. (%) Septic arthritis 21 (13%) Respiratory infection 39 (25%) Gastrointestinal abscess 15 (9%) Soft Tissue abscess 18 (11%) Peritonitis 26 (16%) CNS infection 32 (20%) Urinary Tract Infection 3 (2%) Eye Infection 1 (0.6%) Other 3 (2%) Sample Characteristics (n = 182) Sample Type - no. (%) Abscess 25 (14%) Cerebrospinal Fluid 35 (19%) Joint Fluid 21 (12%) Peritoneal Fluid 27 (14%) Pleural Fluid 32 (18%) Bronchoalveolar Lavage 13 (7%) Otherb 29 (16%) WBC count of body fluid - median 106 / L (interquartile range) 963 (161-11,925) Range 1-382,000 Time to Final Culture Result - median days (interquartile range) 4.8 (3.8-14.0) Range - 106 / L 1.3-35.7 Organism cultured - no. (%) Staphylococcus aureus 40 (22%) Streptococcus sp. 15 (8%) Enterococcus sp. 10 (5%) Gram Negative Rods 30 (15%) Fungi 46 (23%) Other 20 (10%) Negative 35 (18%) aSIRS, systemic inflammatory response syndrome bvitreous fluid, perihepatic fluid, surgical swab, subgaleal fluid, heel fluid swab, peri-graft fluid swab, anterior mediastinal fluid, chest fluid, chest wall mass, wound swab, synovial 17 1025 fluid, breast fluid, back fluid, fine needle aspirate (FNA), left thigh bursal fluid, peri-gastric fluid, thoracic spine seroma, peri-tonsillar drainage, knee swab, ililpsoas collection fluid, iliac wing fluid, retrogastric fluid, and urine

[0099] Metagenomic Sequencing Analysis. A dual-use barcoding protocol was developed for mNGS testing that was cross-compatible on both nanopore and Illumina sequencing platforms, suitable for all body fluids, and automated in the clinical microbiology laboratory on liquid handling workstations. The amount of input DNA varied over 6 logs from approximately 100 pg / mL in low cellularity fluids such as CSF to 100 pg / mL in purulent fluids. The median read depths for Illumina and nanopore sequencing were 7.2M (interquartile range or IQR 4.0-8.3M, range 0.15-35M) and 1.1M (IQR 1.0-1.5M, 137 range 0.29-6.7M), respectively (see Table 1). Metagenomic analysis for pathogen detection from Illumina data was performed using clinically validated SURPI+ software. Nanopore sequencing yielded 1 million reads per hour on average, with real-time data analysis performed using SURPIrt software, a new in-house developed bioinformatics pipeline for pathogen detection from metagenomic nanopore sequence data. After a 5-hour library preparation, nanopore sequencing detected pathogens in a median time of 50 minutes (IQR 23 143 - 80 minutes; range 21- 320 minutes) (see FIG. IC; and Table 1), with an overall sample-to-answer turnaround time of ~6 hours, whereas the turnaround time for Illumina sequencing was ~24 hours. The time to pathogen detection on the nanopore platform was independent of body fluid type (see FIG. 5A), but was inversely correlated with estimated pathogen DNA titers based on reads per million (RPM) (see FIG. 5B). [ 00100 ] Test Accuracy. The accuracy evaluation focused on the performance of mNGS relative to gold standard culture and / or PCR testing for pathogen detection (see FIG. 1A). For bacterial pathogen detection, two reference standards were applied in the evaluation: a clinical gold standard consisting of available culture and 16S PCR results and a composite standard that incorporated additional results from: (i) orthogonal clinical testing of other sample types collected concurrently from the same patient, (ii) confirmatory research-based digital PCR (dPCR) testing, and (iii) 156 adjudication independently by an infectious disease specialist (CYC) and clinical pathologist (WG). Adjudication was performed after mNGS results were available by integrating all sources of information, including longitudinal patient chart review and dPCR testing (see FIG. 1A). Clinical samples were randomly divided into a training set (n=43 samples, 36 bacterial organisms, 8 fungal organisms) and validation set (n=127 samples, 85 bacteria, 32 fungi) for Illumina sequencing; and training set (n=42 samples, 34 bacteria, 7 fungi) and validation set (n=43 samples, 43 bacteria, 11 fungi) for nanopore sequencing, 67 respectively. Receiver operator characteristic (ROC) and precision-recall curves for the training set were generated relative to the clinical and composite standards (see FIG. 2A-B; FIG. 5C-E; and Table 8)). The curves were plotted using a normalized read per million (nRPM) metric that adjusts the RPM according to PCR cycle threshold. [ 00101 ] Table 8. Differences between clinical gold standard and composite 17 1025 standards. Case # Sample Type Training or Validation Clinical Gold Standard* (Bacteria only) Composite Standards (Bacteria only) Reason S8 BAL Validation Staphylococcus aureus Staphylococcus aureus, Pseudomonas aeruginosa Past BAL culture has the same organism found on NGS S17 Pleural Fluid Validation Serratia sp. SCBI (marcescens) Serratia sp. SCBI (marcescens), Enterococcus faecium Past blood culture positive for same organism and dPCR was positive S19 Pleural Fluid Validation Serratia sp. SCBI (marcescens) Serratia sp. SCBI (marcescens), Enterococcus faecium Past blood culture was positive for the same organism S31 Pleural Fluid Validation Streptococcus mitis Klebsiella pneumoniae Positive dPCR for K. pneumoniae. Negative dPCR for S. mitis in this sample and the contralateral pleural fluid, in concordance with Illumina and nanopore sequencing (no reads to this organism) S50 Peritoneal Fluid Training Escherichia coli Escherichia coli, Klebsiella pneumoniae Past peritoneal fluid was positive for the same organism S57 Peritoneal Fluid Training Enterococcus faecium Enterococcus faecium, Klebsiella pneumoniae Positive dPCR for this organism S74 Peritoneal Fluid Validation Staphylococcus aureus Staphylococcus aureus, Enterococcus faecalis, Escherichia coli Positive dPCR for the two additional organisms S59 Peritoneal Fluid Validation Pseudomonas aeruginosa, Candida Pseudomonas aeruginosa, Candida glabrata, Past body fluid was positive for the additional organism glabrata, Candida krusei Candida krusei, Staphylococcus epidermidis S110 BAL Validation Aspergillus spp (mixed morphotypes present) Pseudomonas aeruginosa, Aspergillus spp (mixed morphotypes present) Two BALs 3 days later positive for Pseudomonas aeruginosa and was treated 17 1025

[00102] At the optimal Youden’s index (nRPM threshold of 2.6 and 0.54 for Illumina and nanopore sequencing, respectively) derived from the training set ROC curve, the sensitivity and specificity of mNGS testing for bacterial detection based on the validation set using the clinical gold standard were 79.2% (95% confidence interval CI 73.5-85.2%), and 90.6% (95% CI 87.3-93.8%), respectively, for Illumina sequencing, compared to 75.0% (95% CI 65.0-85.7%) and 81.4% (95% CI 74.1-89.3%), respectively, for nanopore sequencing (see FIG. 2C). When using the composite standard, the positive percent agreement (PPA) and negative percent agreement (NPA) were 80.0% (95% CI 74.1-86.3%) and 95.3% (95% CI 92.9-97.6%), respectively, for Illumina sequencing, compared to 81.0% (95% CI 72.4-89.7%) and 93.0% (95% CI 88.5-176 96.7%), respectively, for nanopore sequencing (see FIG. 2C; and FIG. 6A-B). Excluding plasma, the performance of mNGS testing was comparable overall among different body fluid types (see FIG. 2D), with the highest accuracy of detection from CSF. Nanopore sequencing yielded similar normalized read counts to Illumina sequencing (p=0.59) (see FIG. 2E). Stratification based on semi-quantitation of culture colonies revealed significantly lower nRPM values for cultures grown from enrichment broth compared to other higher-titer cultures (rare, few, moderate, numerous colonies) (p=0.006) (see FIG. 5F-G).

[00103] Among the 34 negative control samples that were negative by culture and 16S-PCR (see FIG. 5H), only one was a false-positive for a bacterial pathogen above the nRPM detection threshold by mNGS (Propionibacterium acnes). Other reads from background contaminating organisms in negative control samples were observed at levels below detection thresholds. Additional bacteria consisting of human commensal organisms, designated mNGS false positives relative to clinical gold standard testing, were also detected in 44% (7 of 16) and 20% (2 of 10) positive control samples by Illumina and nanopore sequencing, respectively. The proportion of reads from each of these presumptive false-positive cases was <5% of the total number of microbial reads in the sample. [ 00104 ] Among false-negative cases from both the training and validation sets using the composite threshold, the most common missed organism was Staphylococcus aureus (see Table 1). Illumina sequencing missed 10 of 40 (25%) cases of Staphylococcus aureus, but this was not statistically significant compared to missed cases of infection from other bacteria (12 of 81,18%) (p=0.21, Fisher’s Exact Test). Nanopore sequencing missed 10 of 26 (38.5%) cases of Staphylococcus aureus, statistically significant compared to missed cases from other bacteria (4 of 50, 8%) (p=0.0034, Fisher’s Exact Test) (see Table 9). 17 1025 Table 9. Bacterial false positives and false negatives using Illumina and nanopore sequencing Ulumina sweating ~ using ths Standard Case Training or Sample Type Validation Rornudized % of alt Pathogen Species RPM RPM Microbes # Reads NG$ call (nRPB: SB Joint Fluid Training Uttphyhcomts aur^s 2.55b 1.278040202 1 2 FN 2 62 $24 Pleural Fluid Txnmhg Stay>hylnc&ccnn moens 0 0 0 0 FN 2.00 $39 Joint Fluid Teaming Staphy^ aiwats 0.227 9 521 0.943 ? FN 2.09 $48 Abscess Teaming SunkyUcoctnis 0 0 0 0 Wi 2.69 $59 Joint Fluid Training U&chnnoJAa colt 14,714 9513 0343 7b FN 2.60 $51 BAL Pentoneal Training ynonntow# 3.108 0.049 6 FP 2.60 2..0O $57 Fluid Teaming BnUrooaccns 3.147 0.278 0.039 14 FN $5 Joint Fluid Validation $uphylvooocit$ aimns I.S12 0.033 0.000 w FN 2.00 SB b Validation 2 217 141.850 0.167 1 FN 2.60 SB BAL Validation Unpfyhcaoons anrons 0 0 0 0 FN 2.60 $12 foist Fluid Validation. Stnpkyi^ aidi 0.050 0.095 2 FN 2.69 $23 Abscess Validation E&chstlchin c&h 0 0 0 0 FN 2,00 $53 Abscess Validation J>odiwn&do notoncn 2 $71 2.845 0,027 23 FP 2 62 $55 Joint Fluid Pentoueal 'Validation Staphyhcacais am® 3.904 9.999 0.491 25 FN 2.69 2,69 $50 Fluid Validation 3..215 9.094 0.002 2b FP $63 Joint Fluid Validation Sinyhykcoitctis h^wintixis 9.571 0.423 0.77 b 66 FN 2 69 $11 Perimeal Validation Sispnyhoct-nnz aiirons 2,30 239 0.31 4 FN 2.69 $96 Lvwhocdc Validation Ent&ncoocus fit&atiis 3.2$ 4.04 0.09 20 F? 2.00 $140 Setunui - Validation St&niiilacocens ^nndm&isit 3..35 103.99 0.11 FN 2.69 $114 Pleural Fluid Validation JU fit vubaountnin IS 44 20.08 0.07 191 FP 2.60 593 Peritoneal VshdUiou bardic.farctnk& 0.00 0.00 0 0 FN 2..00 $87 Abscess Validation %art&wlfa GTS 2.49 0.13 0 FN 2.69 SISI Peiwaeal Vahchtion Myrjbticx&rnim ttibsrcMtosfy 0 G Q 0 FN 2 ® $144 Fluid right Vahdatioii Ah €.J:bi3Cf 0 0 0 S FN 2.® SI 52 Perifeaeal Validation Ah cobscieFum rvbercut&m '"> 0 9 9 FN 2.® $122 BAL Validation tocac'' aa tw'3 76 99 10S 88 6.14 1683 FP 2.® SM5 Pietual Fluid Validawn i,^>i 0 IS 0 13 0:00 1 FN 7 60 SU3 ENA right Validation Altcabacxenmn avium 0 0 0 0 FA 2.® SI® Fieiwal Fkud Ehud left heel Validation PrawambacterM?}! aoi&s 5157 6.45 07 998 TP 2.® S86 I swab j Validation St^ryteoC^^^ 75,026 335785554 0.2728558 579 F77 2.® Nawpm e - wng th* Campsite Standard Case Sample Type Trajuius m Vahdativii Paiii*ggji S^ecfe? RPM Jiurmaiized RPM '3 «f rtl Mitiobes 4 Ksads XGS call (uRPMi $24 Pleural Fluid T13 min g 5^apby 'i^posi'S 0 0 V 0 FN 03368 S3S Abscess Tiuming ^kiyhy ■.rar^i^ 2 81998 8.C799 W313 i 2. EN 0.5368 839 Joint Fluid I raining SiJp'Ci aiirem 0 .0 9 0 F>i 0 5368 S4S Abscess T i'smme i'&phv&C&i ??15 0 0 0 0 F3 0 5368 846 Pleural Flirid Training A y.y hsoxidans 66.498 0 945281Q13 2:43448276 63 F? 0.5368 >50 Joint Fluid Tramnif gschwcbict cab 12.365 9430337206 0.17391304 12 0 5358 85 Ji?ait Fluid Vahdstsoa Smpciy-cn-t'C-:^5 0 9 0 0 FN Q 5368 $8 BAL Validation &f^pbv'iacce na a i: r^U5 0 9 0 FX 0.53 68 $12 Joint Ehud Validadon Stap>sy aura'll 0 0 0 0 F>i 0.5368 S23 Abscess VaEdation 5tavby '.ccoccia <ruy^s Q 0 :& 9 FN C 5308 $23 Abscess VaUdaftoii Eschencbia coli 0 0 3 0 FN 0.5368 $36 Abscess Validation Axap's^'lscsecus Circus 1 15669 4 62674327 1 I F?7 6.5308 841 Pleural F1W P-e^aneal VaEd^ion faez iam 2 42234 4.844673705 0 05 4 FP 0.53^8 356 Fluid Penweal Validabon E^icr&c&c&3.faesiscm 2.55493 8357799893 Q3G3663 3 F? 03368 859 Fliud Peiitoueul VaEtiatic® Ateisz&ria siscp. 4.01521 1.419592873 0 00G027S1 6 FP 03368 Peritoneal 570 £55 VI Fluid Join? Fluid Joint Fluid Pleural Flusd Pleural Fimd Validation. Validation Validatictn Vahdatiou Validation ■Staphylococci lugduncns Swpfy Iococcks anrom KlebsicHa pytmirnGniss Streptococcus mitts 2 87581 9 4256 J S0027 144 752 Q 0946395249 0.416556769 9 450067447 12 79439235 0.0005513« I 8 £3333333 0 34023669 0 4 10 10: 142 0 extra FP FN FP FN 0.536S 0.5368 0.5368 0.5308 9.5368 Mqaesicmg - us Cs^ Sample Type the Gold S Ti af.ii5.iig or Vatidfid&K itsmdard Pathogen Fpedes RPM Nsrinsiszed RPM % of "dl Miciobes 4 WS call Th old friRPM) £13 Joint Fluid T nuning Staphylococci curens 1 536 I 278045202 •J W 2.&I B24 Pleural Fluid Training Sttiphy iazacctiS aarons !<X 0 0 0 FV 2 60 539 Joint Fluid Training Sta^ cczIczgczls aureus '5 227 0 321 0.043 -•^ 2.60 S43 Abscess Training Swpfa loCOCCi SliYSVS 0 0 0 FN 2 60 3:9 Joint Fluid Training Esihe:7..hM ooh 14 714 0 513 0.143 76 FN 2.60 550 Joint Fluid Training Klebsiella ptiewncoiwc 62.1472 2 74S55448J7 0.69338346 t 1 FP 2 60 £51 BAL T raining Stnsptocdzcia: pnoamowde 0..792 3.16S 0.049 FP 2.60 S57 Peritoneal Fluid Training 3.147 0 27S 4.039 14 ,FN 2:60 £57 Peritoneal Fluid I r .lining KHobsiolls pueum omae 39.5573 7 49^'32302 0.3826087 176 FP 2.68 55 Joint Fluid Validation Staphylococcus oureus 1.512 G O33 9.000 2 FN 2.60 £8 HAL Vahdauss Staphylococcus aura Q 0 0 0 FI4 2.60 512 Joist Fluid Validation Staphylococ a a u reus 0 281 8.050 0.095 T FN 2..60 S3 3 Abscess \ alid-asieii Eszhcrtthit'; coh n 9 9 0 FN 2 60 553 Abscess Validation SchnoY; si I a an nca 2 571 2.®4g 9.027 23: F? 2 60 555 Joint Fluid Valid atls?n St^phyi&zocciis aura 3 994 0 99? 0 491 X FN 2.60 5.56 Peritoneal Fluid Validatisn EnTerocccmisjaocttott 3.215 9.:.094 0.00.2 26 FP 2 60 S65 fouit Fluid Vahdatou 9.571 0.423 Q176 66 FN 2.6D SM Peiitoueal Validation Srapdyfacacttis aureus 2 30 2.30 0.31 4 FS 2.6G S9o Lymphocde Validation Znt^zcacctis faea^ 3 28 4.64 G.GG 2G Fp 2.60 SMC Seforna - Validation W" bo'^WSlS 3.25 W3.96 0.11 >> FbJ 2.60 SU4 Pleural Fluid Validation. M^hvabactzmim 18.44 Z6.&& C',07 191 FP 2.60 $93 Peritoneal Validatio^i Nacardia farcv’dca Q&b 0.00 Q 0 FN 2.6b $151 Peixtoueal Validation Mycobacterium tuberculosis Q 0 0 0 FN .2.60 $144 Flusd right pw Vahdaaon My^ab^ct^iam ccvium 0 b 0 FN 2,60 $152 Pentoseal Validation Mycobacterium tabgr’miosis 0 0: 0 0 FI9 2.63 $122 BAL Validation Striph, >1acoccus epid&trnidis 76.99 IQS55 0.14 1983 Fp 2.63 $145 Pkui'A Fluid Validation liocordte. 7t&v& 0 18 b:i3 0.09 I FM 2.60 $143 FNA fight Validation Mycabactemrm rndw? Q 0 0 0 FN 2.60 SI 67 Pleural Fluid Validation 51.57 0.45 0.77 598 FP 2.6b Fluid left heel .2.60 226 (swab f Validation Siaphplac^CL ',s 75 02 d 1:657^5554 O 2728558 579 FS S17 Pleural Fluid Validation 12 2439 48 97550888 0 03322259 89 FP 2.60 S19 Pleural Fluid Validation. 12 37^3 4 3 7074412? 006299213 g FP 2.60 S3! Pleural Fluid Validation KJehrt& pw^y;ow.ae 204 842 18 \ ')Sb^9 C 81829733 644 FP 2.60 17 1025

[00105] For fungal pathogen detection, a clinical gold standard consisting of available culture and 28S-ITS PCR results was used. On average, fungal DNA was at a significantly lower concentration based on nRPM counts than bacterial DNA (p=0.0049) (see FIG. 2F). At the optimal Youden’s index derived from the training set ROC curve (nRPM = 0.1 for both Ilumina and nanopore sequencing), the sensitivity and specificity of mNGS detection of fungi using an independent validation set were 90.6% (95% CI 84.2-100%) and 89.0% (95% CI 85.7-92.5%), respectively, for Ilumina sequencing (n=127 samples), compared to 90.9% (95% CI 80.0-100%) and 100%, respectively, for nanopore sequencing (n=43 samples) (see FIG. 2C; FIG. 6C-D; and Table 4). Among the false-negative cases in the training and validation sets, at least 1 read corresponding to the fungal pathogen was detected in 57% (4 of 7) and 17% (1 of 6) samples by Illumina and nanopore sequencing, respectively, suggesting that sensitivity could potentially be boosted at greater depths of sequencing. The majority of fungal organisms (11 of 14, 79%) designated false-positives by Illumina sequencing were found in <5% of all sequenced microbial reads in the sample.

[00106] Limits of Detection (LoD) and Linearity. DNA was spiked from a mixture of 4 organisms that were non-pathogenic to humans (Streptococcus uberis, Rhodobacter sphaeroides, Millerozyma farinosa, and Aspergillus oryzae) into healthy donor plasma matrix for LoD evaluation. Samples were spiked in 4-fold dilutions, ranging from 1:1 (no dilution) to 1:4096 dilution, with 4 replicates at each dilution. The LoD for bacterial detection using this assay was estimated to be between 400-700 genome equivalents (GE) per mL for bacteria and 4 GE per mL for fungi (see Table 10). A strong linear correlation between the organism titer (GE / mL) and nRPM values by mNGS was observed (R2=0.89-0.98; see FIG. 7). Table 10. LoD expressed in genome equivalents per mL (GE / mL) Orgssam Copies (GEM.) Genome Sase (Mb) mNGS Result [PestevONegatfce, A of Pestle Resite, Copte m GEM4 QiWos Rotor 1 4 IS 84 288 1824 «5 1.S POSG:VE (4 04) 27,388 POSITIVE HO K 8^38 GEM. POSITIVE (4 Of 4) vw GEM pasrnvE (4 04) 427 GEM, NEGATIVE <80 4) WGSM NEGATIVE (304) M ? GSM NEGATIVE (SO 41 &3 GEM. 4E positive <404) W GEM. POSITIVE (4 ©14) GEM. POSITIVE H 0 4) 88S GEM. NEGATIVE (804) 172 GEM. NEGATIVE MG 43 GEM. NEGATIVE (004) IGE GEM, NEGATIVE (804) 2.7 GEM. fMsosa 14 POSIWE <404) 4» SEteL POSITIVE (4 04) 1,128 GEM. POSITIVE (4 041 238 GEM. posmve (4 0'4) 73 GEM, POSITIVE <4 ¢4 4) 17,4 GEM NEGATIVE (GO 4) 4.4 GEM, NEGATIVE (304) 1.1 GEM, 3? positive <4O4) 1.® GEM. POSITIVE <404) 273 GEM.. POSGIVE ONO 288 GEM. wwg (4 O 4) 17.4 GEM. NEGATIVE (8 04) 4.3 GEM, NEGATIVE $04) 1.1 GEM. NEGATIVE (004) 8.3 GEM. Abbreviations: GE, genome equivalents; LoD, limit of detection; Mb, megabases. 17 1025

[00107] Case Series. To assess the potential clinical utility of body fluid mNGS for diagnosis of infection, 12 patients were selectively enrolled with clinically probable or established infection despite negative culture and / or PCR testing of the body fluid (see Table 11). An infectious diagnosis had been made by direct detection from a different body fluid / tissue or by serology / chemistry in 8 and 3 cases respectively. A peritoneal fluid from a patient with bowel perforation and suspected abdominal infection was also included. Presumptive causative pathogens (Klebsiella aerogenes, Aspergillus fumigatus, Streptococcus pneumoniae, Streptococcus pyogenes, Cladophialophora psammophila, Candida parapsilosis, and anaerobic gastrointestinal microbiota) were identified in 7 of 12 cases using mNGS (see Table 11; and Clinical Vignettes in the Examples). Two additional cases of Treponema pallidum (neurosyphilis) and Coccidioides immitis (coccidioidomycosis), diagnosed by serology, had reads detected but present at levels below pre-established nRPM reporting thresholds. Among the remaining 3 cases, mNGS testing was unable to detect Cryptococcus neoformans in pleural fluid (diagnosis made from a culture-positive BAL fluid), Mycobacterium tuberculosis in pleural fluid (diagnosis made from a positive lymph node culture), and Sporothrix sp. in CSF (diagnosis made from serum and CSF IgM antibody positivity), presumably due to a lack of DNA representation from absent or very low pathogen titers and / or high human host background in the body fluid. [ 00108 ] Table 11. Case series of body fluid mNGS testing in patients with 17 1025 probable or established infection but negative clinical microbiological testing. Case Body Fluid Sample Type Presentation Body Fluid mNGS Result Body Fluid 16S / 28S-ITS PCR Results3 Clinical Microbiological Diagnosis S88 CSF Encephalopath y without known cause; has a brain implant Positive (Klebsiella aerogenes') Negative Klebsiella aerogenes: Same organism grown in culture from surgically removed deep brain stimulator. Concordant dPCR. Matches clinical context. S89 Retrouterine fluid Abdominal fluid collection and elevated white blood cell count; a history of abdominal surgery Positive (multiple GI anaerobes)b ND None: mNGS results consistent with clinical context S90 Pleural Fever, cough, bacteremia, loculated pleural effusion Positive (Streptococ cus pneumonia e) ND Streptococcus pneumoniae'. Concordant positive blood culture matches the clinical context S91 Pleural Fever, bacteremia, pneumonia, pleural effusion Positive (Streptococ cus pyogenes) ND Streptococcus pyogenes: Concordant positive blood culture matches the clinical context S92 BAL Pulmonary nodules postchemotherapy Positive (Aspergillu s fumigatus) ND Aspergillus fumigatus: Probable invasive aspergillosis matches clinical context. Serum beta-D-glucan and serum galactomannan positive. S176 BAL Cavitary lesion of the lung Positive -below threshold (Coccidioid es immitis) ND Coccidioides immitis: Serum coccidioides antibody positive, 1:16 titer on complement fixation. S177 CSF Chronic meningoencep halitis Positive -(Cladophia Negative Cladophialophora bantiana: Brain tissue culture: rare 17 1025 lophora bantiana) Cladophialophora bantiana S178 Pleural Fluid Cavitary lung lesions and pleural effusion Negative0 ND Cryptococcus neoformans: BAL and bronchial wash fluid culture positive for Cryptococcus neoformans. Serum CrAg positive. S179 CSF Headache, vision changes, and optic disc edema Positive -Treponema pallidum (below threshold) Negative Treponema pallidum'. serum RPR, VDRL, and treponemal antibody positive S180 Pleural Fluid Lymphadenopa thy, lymphocytic pleural effusion Negative0 ND Mycobacterium tuberculosis: Positive PPD. Lymph node biopsy: Necrotizing granulomas, AFB stain positive, and MTB PCR positive. S181 CSF Headaches, blurred vision, night sweats, neck stiffness Candida parasilopsi s Negative Candida parasilopsis: Serum beta-D-glucan: >500. CSF culture 24 days later positive for Candida parasilopsis. S182 CSF Headache, photophobia, blurry vision, hydrocephalus. Negative0 Negative Sporothrix schenkii: CSF (>1:16) and serum (1:32) Sporothrix antibody positive. aBacterial 16S PCR or fungal 28S-ITS PCR bThe top 5 anaerobes were Faecalibacterium prausnitzii, Eubacterium rectale, Akkermansia muciniphila, Acidaminococcus intestini, and Bifidobacterium adolescentis. infectious diagnosis missed by mNGS testing Abbreviations: dPCR: digital PCR; ND, not done; MTB, Mycobacterium tuberculosis

[00109] Comparison of mNGS with bacterial 16S and fungal 28S-ITS PCR. Out of the 160 patients, the performance of mNGS relative to bacterial 16S PCR or fungal 28S-ITS PCR was compared in 14 cases that had 16S or 28S-ITS PCR testing performed out of 160 (see FIG. 3, and Table 12). At the hospital, bacterial 16S and fungal 28S-248 ITS PCR testing of body fluids and tissue are routinely ordered for culture-negative cases with high clinical suspicion for infection. Concordant results between mNGS testing and PCR were obtained in 8 of 14 cases (see FIG. 3A-B and D). Of the 6 discordant cases, 5 were found only by mNGS and 1 only by 16S PCR. 17 1025 Table 12. Comparison of bacterial 16S and fungal 28S-ITS PCR and mNGS results. Cases’ Sarosis Type Syndrome Pathogen Spedes Body Ftdd -Btetmattzetf RPM* PCR result Ofibogciiai; testing 813 BAL 'aK< Re^dsary Wecto -rewstery Ws ssS&sasae 22. 792 HsenxyMts adteizse ¢183 FOR) N& forth® ted®? Retad Res^sdcr / srsfecSson -necrsSssg 16.12 S^repfococc^ Jfsb® J’WS (185 PCR) Cigitai PCR, S.ans®' EUT '1 - W.S fl S3 336 ifesces® AS;®cess sf EsireetSy 4.33 Sae^tecoccss assess (185 PCR) N&fortiwr testing 341 PSeasi P5*£?ge??e£ 7324 .^e^oc&ssKS pgajgeRes ft6S PCR) forthaf teadsg 3S5 Psttaed Sdd Pebta^ss 6.4 asgpfccssxjs pyegewa ¢188 PCR) N&forther testes 369 Abscess. iSsstroirstssSrssi aiscsss Kfyceteierafm KiteCSjiLSS 8.79 {163 PCR? N® forther iestisg Abscess C?® abscess -A.J. ?!5«>geFaes ¢188 PCR) ftoforther testwg OSF CNS tjsfecta - ides&as K^siaSa serc^enes 79 Nd sAtecieb Cdfore d a^icaiiy removed ORS ssipM; aigasii PCR 351 BAL 'fesi Resps-dssy sdecto A^esgta 3..17 &ws&s ¢233478 PCRi Lia forth® ieds^s Si 27 CSF Lyaphscyts ssetisagisis 188 Nd cstssted Cdfor&pas&re SI 77 CSf ^sw^^encepMife as® hy&gcej&afas £S3 Nd Ledets Cdfore d sstgtcd das bisgsy raddies NGS 3131 CSF Cfowsc sTisssKiijs arsd fotraaraaiai CaaStfe pacssAops.s 1W Nd sisedeid CsirurepEsstise fo CSF 24 says ■ate: aall samples in this table had negative testing results by culture, but the pathogen was detected by 16S PCR, mNGS, and / or orthogonal testing, and all were clinically adjudicated if there was a discrepancy between tests. Moes not take into account any dilution of DNA extract prior to library preparation. ^Klebsiella pneumoniae pathogen was detected by mNGS, but not by 16S PCR. To resolve the discrepancy, this sample was also confirmed positive for the pathogen by digital PCR (dPCR) and Sanger sequencing from the original pleural fluid and the contralateral pleural fluid. See Figure 3B and Clinical Vignettes in the Examples for further details. Abbreviations: BAL, bronchoalveolar lavage. 17 1025

[00110] The first of 3 discordant bacterial cases was a case of an immunocompromised child with necrotizing pneumonia (see case S31 in Table 12, see FIG. 3C, see Clinical Vignettes in the Examples). 16S PCR testing of the pleural fluid was positive for an organism in the Streptococcus mitis group, whereas mNGS testing identified Klebsiella pneumoniae (see FIG. 3C). The finding of Klebsiella pneumoniae by mNGS was orthogonally validated as correct using 5 approaches: (i) dPCR of the DNA extract, (ii) dPCR of the sequencing library, (iii) Sanger sequencing of PCR amplicons from the DNA extract, (iv) mNGS (Illumina) sequencing of the contralateral pleural fluid showing Klebsiella pneumoniae, and (v) dPCR of the contralateral pleural fluid (see FIG. 8). In the second case, although culture and 16S PCR testing of the body fluid (CSF) were both negative, a subsequent culture from a neurosurgically removed deep brain stimulator (DBS) was positive for Klebsiella aerogenes (see case S88 of Table 12, see FIG. 3C, and Clinical Vignettes in the Examples). mNGS testing of CSF was also positive for Klebsiella aerogenes, a finding that was orthogonally validated with dPCR (see FIG. 9). The length distribution was analyzed of the pathogens detected by mNGS for these two cases using paired-end sequencing. The mean lengths of species-specific pathogen reads were 77 and 71 nucleotides (nt), with nearly all lengths <300 nt. The third discordant case was an abscess fluid that was positive by 16S PCR for Mycobacterium avium complex but negative by mNGS testing. [ 00111 ] In all 3 discordant fungal cases, body fluid mNGS was able to find the causative organism, whereas fungal 28S-ITS PCR testing was negative (see FIG. 3D). The causative organism had been clinically confirmed by culture of the same body fluid (n=l), culture done 24 days later (n=l), or testing of brain biopsy tissue (n=l).

[00112] Comparison of diagnostic yield of mNGS testing from body fluids versus plasma. Seven patients in the study harboring a total of 9 pathogens had paired body fluid and plasma samples available for comparative mNGS testing (See Table 13). Pathogen cfDNA burden based on nRPM was a median 160-fold higher (IQR 34-298) in the local body fluid than in plasma from the same patient (see FIG. 4 and Table 13). 17 1025 Table 13. Comparison of results from mNGS of paired plasma and body fluids. Csses Paftogsn Species 3<%«5 . RFM* BssV f isM: Pfesrss Titf» MW5 »s} W gswslssS ^«60« ■ 22122 27» $8.44 •121 SS2 Sesjs sissy fetation ■ saSassaasy assies i.is i 333§ 421 S42 544 2.43 232.84 523 343 | Ax^^S- 3872 «.3 22?J» 323 SS2 § 3342? U.M 14.44 -3.19 USss Lislsssy Tsset iaissss» «88 SSS..1S <44 w ww •U i 3.8 8.64 w Aissssss Ssssss&s teM’ 2.4 i w U2 A>S&y Assess s.vx i SS&SS® ...............) ............................. ...................................... ..................................... .........................j .............................. .............. Moes not take into account any dilution of DNA extract prior to library preparation. bdifference in days between plasma and body fluid collection; for example, 4.51 refers to plasma collection done 4.51 days before the body fluid collection Abbreviations: RPM, reads per million.

[00113] Detection of Anaerobic Bacteria and Viruses. Anaerobic bacteria were not included in the accuracy assessment, as anaerobic culture was not always performed and cultured anaerobes were typically not speciated. However, the one sample in the accuracy study that was culture-positive for an anaerobic bacterium (Finegoldia magna from a soft tissue abscess, Case S87 of Table 13) was successfully detected by mNGS testing (See Table 14).

[00114] 17 1025 Table 14. Anaerobic bacteria detected by mNGS in the accuracy study. Species RPM ttomsaiszed Reads Reads Sample T ype SIG 5.28 W.S7 8.69048 4 BM S3? 1.67 3.34 3 Pssgsepa6c Fiaid S74 0.51 2.36 4 Pertaseai S5S 1.8S 5.25 9.301 15 PeRtoesI R^d S37 2.6 5.13 14 Pesshep^lc flsd S56 gsssws Anms&asfeam IW 2.23 ¢.3 3.0012 18 Pedtaaal R^d 859 WjSfose&s 7.74 2.73 0.:9312 55 Pe8toesl Fh&d S58 3.71 13.49 0.302 30 Pedtoeai R^d S5 GsssSsate s^. 139.87 2.71 30023 185 Ri«d 834 0.45 2.59 0.8052 3 Ptersi Fksd 35 Bacfes c®©g«lSs?ss 34173 7.55 3.9357 452 Jssl Fluid 859 51.85 18 35 0.338 383 PePtcresi Fluid 874 Bsto&sd afoi? &eve 18.44 S2.98 0.029 130 Perlifiesl Fluid 837 gassm 77.89 155.78 0.03 420 883 4.24 107 0.041 34 Ais-cess 859 Lactejcssis iseiss 416.57 147.28 0965 2982 PerSoReal Rtsd 837 688.42 1378.33 3.2® 3712 Per&epmsc. Fluid 351 4.62 16.48 0.2S 35 BAL. 886 877.79 1917.38 0 3® 5451 PerlsRssl Flisd 342 ■ 35.97 932.59 344 59 Abscess >87 2 83 7.59 341 19 Abscess SI IS $6 to 2.70 325 731 BAL 3149 3.73 2.S4 0.00 32 Pati^eal R^d 8178 7® 30 7.84 8.1® 1108 BAL 8178: 110.45 4.38 0.10 738 BAL SI 37 $4?to?e»$s psm?& 8.83 218.54 9.01 1 Fe&cgsslRC Flaild Abbreviations: BAL, bronchoalveolar lavage; RPM, reads per million.

[00115] DNA viruses were also excluded in the accuracy assessment due to lack of routine clinical testing for viruses. Applying previously validated clinical mNGS thresholds of 3 non-overlapping reads for viral detection viruses were detected from the Anelloviridae (n=5), Herpesviridae (n=9), and Adenoviridae (n=2) families (See Table 15). Four of the 5 (80%) anellovirus detections were from immunocompromised patients, consistent with the reported association of anelloviruses as non-pathogenic markers of active inflammation in this population. Among the 11 remaining viruses detected by body fluid mNGS, 6 of 6 (100%) were orthogonally confirmed as true-positive cases by virus-specific PCR. 17 1025 Sao^e Type mNGS Detected Virus Se.sds Cisssrts! Vrsii Testing +:- 7 days PCS resting in Cfinteai idicradirtEW Labor story (Research Lise Comnserts Lavage f3 Bronchia! Lsvsge CW (HHV5J t sites: positive. CW pSa^a PCR: Detected: Sew positive, <137 iLdteL. 5989 SIMmL CW irtertisn was diagnssed and seated with vaigancakW 322 Peritarsesi HWSBB S Ns testing Ns terting 327 Atecsss HHV6S I® No testing No testing S37 PerSiepaac 53:6 rry. sew 93B. 5-u J4s testing Ns testing Asxteiin® Siiid 3333 TTY 435 No tested No testing 351 BrotscM Lawage icwHW* 12. 2 EBV quatit rtegrtrve. Na tested ter Branch^ Lavage Passive HSV1 (PHVIL Positive EBV 737 captesifrL HSVi infect rse4 dssgnsaed and not tested siirtfiaiiy. Patent is s 16-yaspc^d ssih an .autemrnvine disejds' on szstbiepme nos ri n "1 -.de^ctensys^» »te * - teedss rt cough, te 1 ' xi fever Bust j rrt-ve _ epsis, bSsterdi ufrre n "niyocsrtjgs v tested [SrtrtNe x i tv -r v" ~®ters>&i&)with xix xii^ feconigensaSon jt J - i - ■-UassJhy. Paftaseat Raid HNVS, htestedencMrus C. nv 13¾ CW pSassna PCR: Detected: 8,8® OaL. Passive Atienovrts: 641 oa^es.drL V n t -r "fee 7 days inter ' t" f <■ investigation - ig disease csf < -.. S58 Pieara! - rtd rtv NHV5 1 CW atessna PCR: Detested: 4S4 Ooi. Negative CW Patient was seen fey as infestdeiss siisssse ptsyoiesrs sori not treated ter CW st tiie context ot a diagrvjsis rt tevsws gatesoaaFy Essgsrgiiiosrt 864 TTY 13 No testing NS testing 353 Lsvage HHVS 4 Ns testing: Ns testing: srssrtScieni NSV 1 infecSsr. net dis-jnosest and act tested; siinKS®;;:. 365 Access TTV 4 Ns tes&ig Ns testing 384 Pteurs! Raid 'X TTV •7 Md No testing S175 Raid NHV4 4 NS testing NS testing 3178 Bronshiai Lasage 4 Na testing No testing :3123 FiiSKi: EBV quart; negative. 9 days later, EBV quart: 5368 coptestaL NS testing 3'136 Bronchia! Lavage HHV1 3 CW sui&rre aega^ve. Bteod gaatsit 7 days Ste was positive. NS testing

[00117] Clinical Vignettes. The first set of clinical vignettes comprised 5 cases where both culture and 16S PCR was negative, but a clinical diagnosis was made through other means (also shown in Table 11). The cases were sourced from a combination of physician referral and positive microbiological results. 17 1025

[00118] The second set of clinical vignettes is comprised of 7 cases from the accuracy study where mNGS was able to find incidental new bacteria and fungi that were not known at the time of testing. In each case, follow-up orthogonal testing using 16S / ITS PCR or digital PCR was performed and clinical adjudication after mNGS was able to subsequently confirm the new organism.

[00119] Set 1: Prospective case series of body fluid mNGS testing in patients with probable infection but negative clinical microbiological testing

[00120] CaseS88 CSF (2 days prior to surgical removal of the implant): • Culture and 16S rDNA PCR: negative • CSF mNGS Illumina: Klebsiella aerogenes • CSF mNGS Nanopore: Klebsiella aerogenes • dPCR: Klebsiella aerogenes Deep brain stimulator implant material removed from the brain: • Culture: Klebsiella aerogenes Clinical adjudication: Klebsiella aerogenes

[00121] Case S88 is a man in his 70s with a background of Parkinson’s disease, deep brain stimulator (DBS) placement, and mechanical aortic valve replacement on warfarin. The DBS was placed 3 years prior to admission and the electrode was repositioned 9 months prior to admission. The patient was admitted for fever and reduced consciousness with a history of recent traumatic head injury and a scalp wound. He was treated for meningitis with empirical vancomycin, ceftriaxone, and ampicillin, with clinical improvement after six days of treatment. A prompt lumbar puncture was not possible due to the anticoagulation, but this was performed four days into antibiotic treatment. CSF bacterial culture and 16S rDNA PCR were both negative at the time. Fourteen days after stopping antibiotic treatment, the patient was readmitted to the hospital for reduced consciousness.

[00122] As fever was noted, meningeal doses of vancomycin, cefepime, and ampicillin were commenced. Once again, a lumbar puncture could not be immediately performed due to anticoagulation. The scalp wound he previously sustained was noted to be close to the DBS lead. A brain CT with contrast showed streak artifact associated with DBS leads, but no acute intracranial pathology.

[00123] The CSF was hazy macroscopically, with a high WBC of 760 xlO6 / L (63% lymphocytes, 11% lymphocytes, 25% monocytes / histiocytes, 1% basophils), RBC 28 xlO6 / L, 17 1025 protein 58 mg / dL, glucose 48 mg / dL (corresponding serum glucose 75 mg / dL). CSF culture, HSV / VZV PCR, and 16S rDNA PCR were all negative. Three days after admission, the DBS was removed surgically, and bacterial culture of the prosthetic material was positive for Klebsiella aerogenes. The patient had complete resolution of the infection and a good clinical outcome.

[00124] At this point, a CSF sampled 2 days before the surgery removal of the infected hardware was retrospectively enrolled. CSF testing by mNGS was positive for Klebsiella aerogenes, which was further confirmed by digital PCR of the sequencing library (see FIG. 8A-B). Therefore, despite negative culture and 16S rDNA PCR, mNGS on the CSF was positive for the pathogen that was found to be infecting the DBS prosthetic material.

[00125] CaseS89

[00126] Retrouterine fluid: • Culture (including anaerobic culture): negative • mNGS: multiple; top 5: Faecalibacterium prausnitzii, Eubacterium rectale, Akkermansia muciniphila, Acidaminococcus intestini, and Bifidobacterium adolescentis Clinical adjudication: predominately anaerobic GI flora

[00127] A woman in her 20s with inflammatory bowel disease and past GI surgery presents with free air seen on an abdominal CT and was confirmed to have small bowel perforation during corrective surgery. One week after her operation, the patient continued to have leukocytosis and a CT scan showed a rectouterine fluid collection that was drained the next day. The rectouterine fluid was visually purulent (cloudy) and thick, but was negative on culture, including anaerobic culture. Testing by mNGS of this fluid drainage shows multiple, anaerobic, gastrointestinal bacteria: Faecalibacterium prausnitzii, Eubacterium rectale, Akkermansia muciniphila, Acidaminococcus intestini, and Bifidobacterium adolescentis as the top 5 most common organisms, whereas anaerobic culture results were negative. The primary surgical team started empiric antibiotics (piperacillin / tazobactam only) after drainage. CT imaging showed persisting rectouterine fluid collection a few days later, although slightly decreased and the patient’s elevated white count normalized. Antibiotics were discontinued after nearly a week and the patient was discharged. In this case, mNGS could have suggested the addition of metronidazole to cover the undocumented anaerobic organisms. 17 1025

[00128] CaseS92 Bronchoalveolar lavage (BAL) fluid: • Gram stain and culture (including fungal culture): negative • BAL fluid mNGS: Aspergillus fumigatus (56 reads, 1.19 normalized RPM) Blood: • Plasma mNGS: Aspergillus fumigatus (1 read, 0.035 normalized RPM) • Serum beta-D-glucan: 316 picograms / mL (reference: <60) • Serum aspergillus galactomannan index: 4.5 (reference: <0.5) Clinical adjudication: Aspergillus fumigatus (Probable by EORTC / MGS* international standards)

[00129] A man in his 60s with anaplastic large cell lymphoma and bladder cancer was admitted electively for chemotherapy. His clinical course was complicated by MRSA bacteremia and endocarditis from a PICC line source (treated with vancomycin) and ischemic bowel requiring primary resection and anastomosis.

[00130] A CT chest (without contrast) performed for persistent fevers and streaky opacities on CXR revealed multiple bilateral pulmonary nodules, nodular areas of consolidation, and a left pleural effusion, with unchanged supraclavicular, mediastinal, and hilar lymphadenopathy. Serum beta-D-glucan was raised at 316 picograms / mL (reference range <60) and serum aspergillus galactomannan index was raised at 4.501 (reference range <0.5). [ 00131 ] The patient met the EORTC / MGS* criteria for probable invasive aspergillosis, and voriconazole was commenced. [ 00132 ] *European Organization for Research and Treatment of Cancer

[00133] BAL and FNA of a pulmonary nodule were collected 3 days into voriconazole treatment. BAL Gram stain and cultures were negative. FNA revealed malignant lymphoma cells on cytology, consistent with the patient’s known lymphoma, but also negative cultures.

[00134] At this point, the BAL sample was included in this series given that the patient was culture-negative but had a clinically probable invasive Aspergillus infection. mNGS of the BAL demonstrated the presence of Aspergillus fumigatus.

[00135] Voriconazole was changed to posaconazole after 8 days due to liver toxicity concerns. Follow-up of serum galactomannan index demonstrated a treatment response (falling to 0.24 mg / mL at 15 weeks of posaconazole treatment) and follow-up CT scans showed a continued decrease in size of the multiple pulmonary nodules representing resolving infection. 17 1025 The patient was subsequently discharged from the hospital with hematology and infectious diseases clinic follow-up.

[00136] CaseS90 Blood culture: Streptococcus pneumoniae Pleural fluid: • Culture: no growth • mNGS: Streptococcus pneumoniae Clinical adjudication: Streptococcus pneumoniae

[00137] A woman in her 50s, with a history of a hematopoietic stem cell transplant 1 year ago, presented with fever, productive cough, and tachycardia, and was subsequently found to be blood culture positive for Streptococcus pneumoniae. CT imaging showed a left loculated pleural effusion. The effusion was drained, but the culture results of the pleural fluid were negative. The sample was enrolled into this study and mNGS results of the same pleural fluid showed Streptococcus pneumoniae as the top species at a normalized RPM of 57,856 and were more than 99.99% of all the microbial reads not classified into the same family or genus.

[00138] CaseS91 Blood culture: Group A Streptococcus Pleural fluid: • Culture: no growth • mNGS: Streptococcus pyogenes (Group A streptococcus) Clinical adjudication: Streptococcus pyogenes

[00139] A woman in her 50s who presented with fever, malaise, and syncope in the setting of sepsis, was admitted with Group A Streptococcus bacteremia and pneumonia. She placed on ceftriaxone and quickly improved. She developed a complicated parapneumonic effusion (LDH (lactate dehydrogenase) >2700 U / L). The effusion was drained, but the culture of the pleural fluid was negative. The sample was enrolled into this study and mNGS of the same pleural fluid showed that Streptococcus pyogenes was the top species identified at a normalized RPM of 57,856 and were more than 99.99% of all the microbial reads not classified into the same family or genus. 17 1025 [ 00140 ] Set 2: Additional pathogens incidentally detected by body fluid mNGS testing in patients with microbiologically proven infection

[00141] CaseS31 Pleural fluid: • Culture: negative • 16S rDNA PCR: Streptococcus mitis group • CSF mNGS Illumina: Klebsiella pneumoniae • CSF mNGS Nanopore: Klebsiella pneumoniae • Digital PCR: Klebsiella pneumoniae, negative for Streptococcus mitis • Sanger sequencing: Klebsiella pneumoniae Contralateral pleural fluid: • Culture: negative • mNGS Illumina: Klebsiella pneumoniae • mNGS Nanopore: Klebsiella pneumoniae • Digital PCR: Klebsiella pneumoniae, negative for Streptococcus mitis Clinical adjudication: Klebsiella pneumoniae

[00142] A child with congenital CMV and myelodysplastic syndrome was admitted for chemotherapy. He developed febrile neutropenia with septic shock and coagulopathy. Despite empirical cefepime, the sepsis worsened with the development of ARDS and worsening abdominal distension, leading to an intensive care admission. His antibiotics were changed empirically to meropenem, ciprofloxacin, and vancomycin. Caspofungin was also initiated for antifungal cover.

[00143] CT imaging revealed necrotizing pneumonia involving all lobes of both lungs and moderate bilateral pleural effusions. Asymmetric enhancement of the small intestine may have indicated bowel inflammation / infection or septic shock physiology. [ 00144 ] Blood, BAL, and pleural fluid were all negative on bacterial culture. The pleural fluid was exudative by Light’s criteria. 16S rDNA PCR of the pleural fluid was positive for Streptococcus mitis group, with no other organisms detected. [ 00145] Despite the specific 16S rDNA PCR result, a decision was made to continue the broad-spectrum antibiotic combination, including meropenem, to cover the range of possible organisms contributing to the necrotizing pneumonia. The patient improved clinically with no signs of sepsis after treatment. A chest CT verified resolution of the infection. 17 1025

[00146] Pleural fluid mNGS by both Illumina and Nanopore sequencing showed Klebsiella pneumoniae. This was subsequently confirmed by digital PCR of both the sequencing library and the original DNA extract and Sanger sequencing of the DNA extract (see FIG. 10B-E). Also, in a separate sample collection, library preparation, and sequencing run, the contralateral pleural fluid revealed only Klebsiella pneumoniae, which was similarly confirmed by digital PCR. Digital PCR of the original DNA extract from the bilateral pleural fluid targeting Streptococcus mitis was negative, suggesting that the organism was either a false positive contaminant in the 16S PCR or present at a low level for mNGS and digital PCR.

[00147] CaseS65 Ascitic fluid: • Culture: no growth • 16S rDNA PCR: Streptococcus pyogenes • Ascitic fluid mNGS: Streptococcus pyogenes

[00148] A previously healthy woman in her 30s presented to the hospital with diffuse abdominal pain, nausea, vomiting, watery diarrhea, fever, leukocytosis, and acute kidney injury four days after IUD placement. CT abdomen and pelvis demonstrated inflammation of the caecum, sigmoid colon, and rectum, with peritoneal enhancement and intra-abdominal ascites. Chlamydia and gonorrhea NAAT testing were negative.

[00149] A percutaneous drain was inserted five days into antibiotic treatment with piperacillin-tazobactam. The ascitic fluid showed WBC 14.375 x 109 / L (74% neutrophils, 5% lymphocytes, 21% others), a high total protein of 3.8 g / dL, and a serum albumin albumin gradient (SAAG) of 0.4 g / dL, consistent with infected ascites. Direct microbiological cultures of the ascitic fluid, however, yielded no growth. [ 00150 ] This case was referred by a hospitalist physician and mNGS on the same ascitic fluid was positive for Streptococcus pyogenes. 16S PCR of a later ascitic fluid was previously sent and it was negative. The same ascitic fluid was then sent for 16S PCR that underwent mNGS and the 16S test was also positive for Streptococcus pyogenes. The patient was treated with 14 days of piperacillin-tazobactam, along with percutaneous drainage of subsequent loculated collections. She clinically improved was discharged from the hospital 20 days after admission.

[00151] CaseS10 Blood: • Culture at the hospital: negative 17 1025 • Culture at the previous outside hospital: Haemophilus influenzae • Plasma mNGS: Haemophilus influenzae Bronchoalveolar lavage (BAL) fluid: • Culture: negative • 16S rDNA PCR: Haemophilus influenzae • BAL mNGS: Haemophilus influenzae • Second BAL 2 days after the first BAL: Haemophilus influenzae

[00152] A woman in her 30s who was a smoker and previous intravenous drug user presented with one week of productive cough and dyspnea. She developed type 1 respiratory failure and cardiogenic shock, requiring intubation, ventilation, and ECMO support. She was then transferred from the outside hospital to a tertiary care hospital. CT chest revealed bilateral upper lobe consolidation with patchy regions of nodular consolidation throughout the remaining lung fields, with diffuse mediastinal and hilar lymphadenopathy. The blood cultures and BAL cultures collected three days after the initiation of antibiotics at the outside hospital were all negative. [ 00153 ] This case was referred by an infectious disease specialist and mNGS of the BAL fluid was positive for Haemophilus influenzae. One of 2 blood cultures prior to antibiotics at an outside hospital was also positive for Haemophilus influenzae. Subsequent 16S rDNA PCR was positive for Haemophilus influenzae.

[00154] The patient was commenced empirically on ceftriaxone, vancomycin, and azithromycin. These were subsequently changed to ceftriaxone monotherapy based on Haemophilus influenzae sensitivity results. Her workup revealed a new diagnosis of B-cell acute lymphoblastic leukemia. The patient improved clinically, completed induction chemotherapy, and has been disease-free for over a year.

[00155] CaseS42 Blood: • Blood culture: Escherichia coli • Plasma mNGS: Fusobacterium nucleatum and Escherichia coli Abscess: • Culture: Escherichia coli • mNGS: Fusobacterium nucleatum and Escherichia coli [ 00156 ] A woman in her 30s with a history of chronic endometriosis and laparotomy for ruptured appendicitis and tubo-ovarian abscess two months prior to admission, was re-admitted 17 1025 for severe lower abdominal pain, vaginal bleeding, nausea, low-grade fevers, and chills. CT abdomen and pelvis showed multiple loculated abdominal and pelvic abscesses (the largest measuring 9x7x17 cm) interspersed between bowel loops and mesentery - these could not be surgically drained due to the dense adhesions and bowel loops surrounding the fluid collections. Piperacillin-tazobactam was commenced empirically and an abdominal drain was placed into the large abscess. Both blood cultures from admission and abscess fluid cultures grew pan-sensitive Escherichia coli only.

[00157] Plasma and abscess fluid mNGS both showed DNA reads to Fusobacterium nucleatum and Escherichia coli. Follow-up CT two weeks later showed resolution of multiple abscesses, with minimal residual collections remaining.

[00158] Fusobacterium nucleatum is an anaerobe commonly found in polymicrobial intra-abdominal abscesses. This was detected by mNGS and was not detected by conventional bacterial culture.

[00159] CaseS64 AV graft tissue culture: negative Peri-graft swab: • culture with follow-up 16S identification: Mycoplasma hominis (22 days time to result) • mNGS: Mycoplasma hominis

[00160] A woman in her 50s presented with fever and tenderness in the area over a Polytetrafluoroethylene (PTFE) arteriovenous graft. She had a background of end-stage renal failure with a renal transplantation two months prior to admission. Intra-operative findings during graft excision revealed that the graft was completely thrombosed, with surrounding purulent fluid and extension of the infection along the graft to disrupt the arterial anastomosis.

[00161] AV graft tissue cultures were negative, but a peri-graft swab grew pinpoint colonies of gram-negative rods after 6 days. Identification of the colonies was difficult as MALDI-ToF (matrix-associated laser desorption / ionization - time of flight) and biochemical testing were inconclusive. Send-out 16S sequencing eventually identified the colonies as Mycoplasma hominis 16 additional days later. mNGS from the original peri-graft swab (available on day 0) was also positive tor Mycoplasma hominis. Nanopore real-time sequencing took less than 10 minutes for organism identification after the initiation of sequencing.

[00162] The patient was discharged back to her referring hospital before final culture results were available, as the Mycoplasma hominis required 16S PCR for identification. This is a case where an earlier result (such as by mNGS) would have had an impact on clinical management as vancomycin is an ineffective treatment for Mycoplasma hominis. 17 1025

Claims

17 10251. A set comprising at least one pair of oligonucleotides, the oligonucleotides being Xmerbarcodes for use in multiple types of next generation sequencing technologies,each Xmer barcode being 37 nucleotides in length having a first nucleotide domain and a second nucleotide domain,wherein the first nucleotide domain is an 8mer located at the 5’ end of the Xmer barcode, and wherein the first nucleotide domain is compatible with a next generation sequencing technology that utilizes bridge amplification,wherein the second nucleotide domain is a 29mer and wherein the second nucleotide domain is compatible with a next generation sequencing that utilizes nanopores,wherein there is a Levenshtein distance of at least 3 between the first nucleotide domains of each pair of Xmer barcodes in the set, andwherein there is a Levenshtein distance of at least 4 between the second nucleotide domains of each pair of Xmer barcodes in the set; andwherein there are Levenshtein distances in the range 14 to 31 between each pair of Xmer barcodes.

2. The set of oligonucleotides of claim 1, further comprising a flow cell attachment domain.

3. The set of oligonucleotides of claim 2, wherein the flow cell attachment domain comprises a sequence selected from any one of SEQ ID NOs:l, 2, 3 and 4.

4. The set of oligonucleotides of claim 1, further comprising a sequencing primer binding domain.

5. The set of oligonucleotides of claim 1, further comprising a sequence selected from any one of SEQ ID Nos: 226-416 and 417.

6. The set of oligonucleotides of claim 1, wherein each oligonucleotide barcode sequence is located between a pair of sequencing adaptors.17 10257. The set of oligonucleotides of claim 6, wherein the pair of sequencing adaptors havesequences selected from (i) or (ii):(i) CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO:1), and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (SEQ ID NO:2); or(ii) AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NOG), and ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (SEQ ID NO:4),wherein * indicates a phosphorothioate bond between the nucleotides.

8. The set of oligonucleotides of claim 7, wherein the set of oligonucleotides are PCR primers used for sequencing library barcoding.

9. Use of a sequencing library comprising the set of oligonucleotides of claim 1 for an application selected from: pathogen discovery, environmental metagenomics, de novo genome assembly, whole-exome sequencing, transcriptomics sequencing, targeted gene panel sequencing and whole-genome resequencing.

10. A method for rapid pathogen detection in a sample using metagenomic next-generation sequencing (mNGS), comprising:obtaining one or more samples comprising cell-free DNA (cfDNA);generating a plurality of sequencing reads comprising a barcode from the set of oligonucleotides of claim 1 using next-generation sequencing;performing metagenomic analysis on the plurality of sequencing reads using a clinical bioinformatics software pipeline to analyze sequencing read data for pathogenic DNA;determining and identifying pathogen(s) in the one or more samples based upon the metagenomic analysis of the plurality of sequencing reads;wherein the next-generation sequencing comprises sequencing technology that utilizes bridge amplification; andwherein the next-generation sequencing further comprises sequencing technology that utilizes nanopores.

11. The method of claim 10, wherein the one or more samples further comprise a body fluidsample from a subject.

12. The method of claim 11, wherein the body fluid sample is an infected body fluid sample.

13. The method of claim 11, wherein the body fluid sample is selected from cerebrospinal fluid, urine, semen, pericardial fluid, pleural fluid, peritoneal fluid, synovial fluid, amniotic fluid, fetal fibronectin, saliva, sweat, eye vitreous humor, eye aqueous humor, bronchoalveolar lavage fluid, breast milk, bile, and ascites fluid.

14. The method of claim 11, wherein the one or more samples further comprise a blood serum sample.17 102515. The method of claim 10, wherein the pathogen(s) comprise one or more pathogenic bacteria.

16. The method of claim 10, wherein the pathogen(s) comprise one or more pathogenic fungi.

Images