Dumbbell PCR for methylated small non-coding RNA detection
Patent Information
- Authority / Receiving Office
- HK · HK
- Patent Type
- Applications
- Current Assignee / Owner
- HUMMINGBIRD DIAGNOSTICS GMBH
- Filing Date
- 2026-05-21
- Publication Date
- 2026-07-17
AI Technical Summary
Current methods are inadequate for detecting and quantifying 2′-O-methylation on small non-coding RNAs, particularly those between 18 to 50 nucleotides in length, due to limitations in existing PCR and sequencing techniques which struggle with reverse transcription and ligation efficiency under limiting conditions.
A Dumbbell PCR method using a combination of 5' and 3' adapters capable of forming stem-loop structures, with a double-stranded stem, for the detection and quantification of methylated small non-coding RNAs, employing RNA ligase 2 for ligation and TaqMan probes for specificity, under both limiting and non-limiting reverse transcription conditions.
Enables specific and efficient detection and quantification of methylated small non-coding RNAs by forming ligated RNA templates for cDNA synthesis, allowing for direct absolute quantification of methylation stoichiometry through digital PCR, overcoming previous limitations in reverse transcription and ligation efficiency.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[0001]Our Ref.: 505-90 PCT Hummingbird Diagnostics GmbH DUMBBELL PCR FOR METHYLATED SMALL NON-CODING RNA DETECTION The present invention relates to the use of a combination of a 5’adapter and a 3’adapter for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA. Further, the present invention relates to a method of detecting methylated small non-coding RNA. Furthermore, the present invention relates to a method of quantifying a methylation status of small non-coding RNA. BACKGROUND OF THE INVENTION Small non-coding RNAs, particularly with a length of between 18 to 50 nucleotides (nt), are found intracellularly and in extracellular environments, including body fluids such as blood. A subclass of small non-coding RNAs, so called microRNAs (miRNAs) or their variants having specific terminal sequences (isomiRs), possess regulatory functions such as gene expression regulation of protein-encoding messenger RNAs (mRNAs). In the last two decades, other short fragments of RNAs with regulatory functions were described, such as fragments of ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), and others. A plethora of short fragments with no described regulatory function can be readily found in biological RNA samples. This is likely the result of (active or passive) fragmentation of longer precursor RNAs. RNAs can be post-transcriptionally edited by chemical modifications such as methylation, oxidation, pseudouridylation, etc., which can target a nucleotide base (e.g. methyl- 6-adenine, pseudouridine) or a ribose ring (2′-O-m). Especially, rRNA is known to contain many pseudouridylation and 2′-O-m sites and these modifications contribute to the folding, stability, and RNase resistance of the ribosome. It has been previously shown that the 2′-O-m sites are modified to various extents (40-100% stoichiometry). Detection and quantification of 2′-O-m methylation was described previously at two levels - either as a) a targeted approach, studying one 2′-O-m site of interest at a time, using a low-throughput method such as quantitative reverse transcription PCR (qRTPCR), or as b) high through-put approach, detecting many 2′-O-m sites in parallel employing either next generation sequencing (NGS) or mass spectrometry. In case of qRT-PCR, a longer portion of target RNA is pre-amplified first, followed by the use of a reverse transcription (RT) primer binding downstream of the 2′-O-m site and performing the RT under limiting conditions. Typically, the concentration of deoxynucleotides (dNTPs) in the RT reaction is reduced, which causes pause or stopping of RT at the 2′-O-m site. A control reaction at normal dNTPs concentration is performed, and a difference of the detection levels of the two reactions is indicative of 2′-O-m presence. This approach, however, cannot be used for small non-coding RNA, specifically small non-coding RNA being between 18 to 50 nucleotides long. The NGS method uses as template a full-length RNA (such as ribosomal RNA) that is first fragmented using alkaline hydrolysis and undergoes ligation to an adapter with known sequence. Because 2′-O-m site affects the ligation efficacy on +1 nucleotide position, an under- representation of the reads starting at +1 nucleotide suggests a presence of 2′-O-m site immediately downstream. Yet, this method also requires that the studied RNA is present at full length, or at least in long fragments that allow stochastic fragmentation to shorter fragments and their subsequent ligations. Again, this approach cannot be used for small non-coding RNA, specifically small non-coding RNA being between 18 to 50 nucleotides long, because prior fragmentation leads to very short nt sequences, of which reads are then not amenable for subsequent mapping to genome. Despite the establishment of the above-mentioned methods, a method that evaluates the presence and stoichiometry of methylations such as 2′-O-m on small non-coding RNA, specifically small non-coding RNA being between 18 to 50 nucleotides long, has not yet been described. In view of the above, there is a need to develop a new method for the detection and quantification of small non-coding RNA methylations such as 2′-O-m. The present inventors have previously developed a Dumbbell PCR (DB PCR) based method, which exploits the ability of a double stranded RNA ligase, particularly RNA ligase 2 (Rnl2), to specifically join the nicks in a hybridized double stranded RNA molecule. Only correctly hybridized adaptors both to the 5’ and the 3’end of the target RNA such as miRNAs or isomiRs enable the formation of the ligated RNA that can be used as template for cDNA synthesis. This method is able to specifically and efficiently determine and quantify the expression of target RNA (e.g. miRNA) as well as of target RNA variants having specific terminal sequences (e.g. isomiR). Second layer of specificity is introduced by a TaqMan probe, that can align to a user-defined region of a cDNA sequence. The present inventors have now adapted this method to limiting reverse transcription (RT) conditions and used it for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). In addition, they performed digital PCR to detect the small non-coding RNAs by DB-PCR. The advantage of digital PCR is the direct absolute quantification of the copy numbers of the RNA of interest in the cDNA and, thus, allows linear quantification of methylation stoichiometry. SUMMARY OF THE INVENTION In a first aspect, the present invention relates to the use of a combination of (i) a 5’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and (ii) a 3’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). In a second aspect, the present invention relates to a method of detecting methylated small non-coding RNA (in a sample) comprising the steps of: (i) providing a ligation product comprising small non-coding RNA to which the 5’adapter as defined in the first aspect and the 3’adapter as defined in the first aspect are ligated, (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product, (iii) amplifying the first cDNA product and the second cDNA product, and (iv) determining a difference between the first cDNA product and the second cDNA product, wherein the difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non-coding RNA (in the sample). In a third aspect, the present invention relates to a method of quantifying a methylation status of small non-coding RNA (in a sample) comprising the steps of: (i) carrying out the method of the second aspect, and (ii) determining a ratio between the first cDNA product and the second cDNA product. This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description. DETAILED DESCRIPTION OF THE INVENTION Definitions Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kölbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland). Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence. The term “comprise” or variations such as “comprises” or “comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term “consisting essentially of” according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of” or variations such as “consists of” according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers. The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The term “nucleotide”, as used herein, refers to an organic molecule consisting of a nucleoside and a phosphate. In particular, a nucleotide is composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine. The nucleotide serves as monomeric unit of nucleic acid polymers, such as deoxyribonucleotide acid (DNA) or ribonucleotide acid (RNA). Thus, the nucleotide is a molecular building-block of DNA and RNA. The term “nucleoside”, as used herein, refers to a glycosylamine that can be thought of as nucleotide without a phosphate group. A nucleoside consists simply of a nucleobase (also termed a nitrogenous base) and a five-carbon sugar (ribose or 2'-deoxyribose) whereas a nucleotide is composed of a nucleobase, a five-carbon sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked through a glycosidic bond to the N9 of a purine or the N1 of a pyrimindine. The terms “nucleotide sequence” or “polynucleotide” are interchangeably used herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including without limitation, 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, or internucleotide analogs, and associated counter ions, e.g., H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A nucleotide sequence or polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof and may include nucleotide analogs. The nucleotide monomer units may comprise any of the nucleotides described herein, including, but not limited to, nucleotides and / or nucleotide analogs. The term “analog”, as used herein, includes synthetic analogs having modified base moieties, modified sugar moieties, and / or modified phosphate ester moieties. Phosphate analogs generally comprise analogs of phosphate wherein the phosphorous atom is in the +5 oxidation state and one or more of the oxygen atoms is replaced with a non-oxygen moiety, e.g. sulfur. Exemplary phosphate analogs include: phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, boronophosphates, including associated counterions, e.g. H+, NH4+, Na+. Exemplary base analogs include: 2,6-diaminopurine, hypoxanthine, pseudouridine, C-5- propyne, isocytosine, isoguanine, 2-thiopyrimidine. Exemplary sugar analogs include: 2’- or 3’-modifications where the 2’- or 3’-position is hydrogen, hydroxy, alkoxy, e.g., methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy and phenoxy, azido, amino or alkylamino, fluoro, chloro, and bromo. In one embodiment, modified ribonucleotides are present in / part of the adapters described herein. In one preferred embodiment, the modified ribonucleotides are 2’-o-methyl ribonucleotides. The term “target RNA”, as used herein, refers to a ribonucleotide sequence that is sought to be detected. The target RNA may be obtained from any source and may comprise any number of different compositional components. For example, the target RNA is isolated from organisms, tissues, cells, or bodily fluids such as blood. Specifically, the target RNA encompasses non-coding RNA. Preferably, the target RNA is small non-coding RNA. Particularly, the small non-coding RNA has a length of < 200 ribonucleotides, more particularly a length of between 10 and < 200 ribonucleotides, even more particularly a length of between 10 and 100 ribonucleotides, and still even more particularly a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. More preferably, the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. Further, it will be appreciated that the term “target RNA” may refer to the target RNA itself as well as to surrogates thereof, for example, amplification products (e.g. cDNA derived therefrom) and native sequences. In certain embodiments, the target RNA lacks a poly-A tail. The target RNA described herein may be derived from any number of sources, including without limitation, humans and animals. These sources may include, but are not limited to, whole blood, a tissue biopsy, lymph, bone marrow, amniotic fluid, hair, skin, semen, biowarfare agents, anal secretions, vaginal secretions, perspiration, saliva, or buccal swabs. However, various environmental samples (for example, agricultural, water, and soil), research samples generally, purified samples generally, cultured cells and lysed cells may also be used as samples. Furthermore, it will be appreciated that target RNAs may be isolated from samples using any of a variety of procedures known in the art, for example, the Applied Biosystems ABI Prism® 6100 Nucleic Acid PrepStation (Life Technologies, Foster City, CA) and the ABI Prism® 6700 Automated Nucleic Acid Workstation (Life Technologies, Foster City, CA), Ambion® mirVana™ RNA isolation kit (Life Technologies, Austin, TX), and the like. The term “small non-coding RNA”, as used herein, refers to functional RNA that is not translated into protein. Small non-coding RNA has diverse functionally important roles, which involve, particularly in conjunction with other molecules, gene regulation through RNA interference, RNA modification, or spliceosome involvement. Preferably, the small non-coding RNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment and similar. The term “miRNA” (the designation “microRNA” is also possible), as used herein, refers to a single-stranded RNA. Preferably, the miRNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. The miRNAs regulate gene expression and are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (i.e. miRNAs are non-coding RNAs). The genes encoding miRNAs are longer than the processed mature miRNA molecules. The miRNA is initially transcribed as a longer precursor molecule (>1000 nucleotides long) called a primary miRNA transcript (pri-miRNA). Pri-miRNAs have hairpin structures that are processed by the Drosha enzyme (as part of the microprocessor complex). After Drosha processing, the pri-miRNAs are only 60-100 nucleotides long, and are called precursor miRNAs (pre-miRNAs). At this point, the pre-miRNA is exported to the cytoplasm, where it encounters the Dicer enzyme. Dicer cuts the miRNA in two, resulting in duplexed miRNA strands. Traditionally, only one of these miRNA arms was considered important in gene regulation: the arm that is destined to be loaded into the RNA-induced silencing complex (RISC), and occurs at a higher concentration in the cell. This is often called the “guide” strand and is designated as miR. The other arm is called the “minor miRNA” or “passenger miRNA”, and is often designated as miR*. It was thought that passenger miRNAs were completely degraded, but deep sequencing studies have found that some minor miRNAs persist and in fact have a functional role in gene regulation. Due to these developments, the naming convention has shifted. Instead of the miR / miR* name scheme, a miR-5p / miR-3p nomenclature has been adopted. By the new system, the 5’ arm of the miRNA is always designated miR-5p and the 3’ arm is miR-3p. The present nomenclature is as follows: The prefix “miR” is followed by a dash and a number, the latter often indicating order of naming. For example, hsa-miR-16 was named and likely discovered prior to hsa-miR-342. A capitalized “miR-” refers to the mature forms of the miRNA (e.g. hsa-miR-16-5p and hsa-miR-16-3p), while the uncapitalized “mir-” refers to the pre-miRNA and the pri-miRNA (e.g. hsa-mir-16), and “MIR” refers to the gene that encodes them. However, as this is a recent change, literature will often refer to the original miR / miR* names. After processing, the duplexed miRNA strands are loaded onto an Argonaute (AGO) protein to form a precursor to the RISC. The complex causes the duplex to unwind, and the passenger RNA strand is discarded, leaving behind a mature RISC carrying the mature, single stranded miRNA. The miRNA remains part of the RISC as it silences the expression of its target genes. While this is the canonical pathway for miRNA biogenesis, a variety of others have been discovered. These include Drosha-independent pathways (such as the mirtron pathway, snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as one that relies on AGO for cleavage, and another which is dependent on tRNaseZ). The term “miRBase”, as used herein, refers to a well-established repository of validated miRNAs. The miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotation. Each entry in the miRBase Sequence database represents a predicted hairpin portion of a miRNA transcript (termed mir in the database), with information on the location and sequence of the mature miRNA sequence (termed miR). Both hairpin and mature sequences are available for searching and browsing, and entries can also be retrieved by name, keyword, references and annotation. All sequence and annotation data are also available for download. In October 2018, miRbase version 22.1 was released. This is the current version. The term “isomiR” (or “miRNA isoform”), as used herein, refers to a miRNA that varies slightly in sequence, which results from variations in the cleavage site during miRNA biogenesis or by processes which affect the mature miRNA after the biogenesis has occurred, such as oligouridylation. In particular, imprecise cleavage of Drosha and Dicer or the turnover of miRNAs can result in miRNAs that are heterogeneous in length and / or sequence. IsomiRs (miRNA isoforms) can be divided into three main categories: 3′ isomiRs (trimmed or addition of one or more nucleotides at the 3′ position), 5′ isomiRs (trimmed or addition of one or more nucleotides at the 5′ position), and polymorphic isomiRs (some nucleotides within the sequence are different from the wild type mature miRNA sequence). It could be envisioned that the increased expression of miRNA variants, or individual isomiRs, lead to the loss or weakening of the function of the corresponding wild-type mature miRNA or result in the regulation of a different transcriptome. Recent studies suggest that isomiRs probably play vital roles in a variety of cancers, tissues, and cell types. The detection of miRNAs as well as isomiRs is, thus, absolutely required to accurately reflect the underlying biological situation and to make the right decisions. The term “ribosomal RNA fragment (rRNA fragment)”, as used herein, refers to a fragment derived from a ribosomal RNA (rRNA). Ribosomal RNAs (rRNAs) form a group that includes four (5S, 5.8S, 18S, 28S) rRNAs encoded by the human nuclear genome and two (12S, 16S) by the mitochondrial genome. rRNAs constitute the most abundant RNA type in eukaryotic cells. Preferably, the rRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. The term “transfer RNA fragment (tRF)”, as used herein, refers to a fragment derived from a transfer RNA. A transfer RNA (tRNA) is a ribonucleic acid which mediates the correct amino acid to the corresponding codon on the mRNA during translation. Transfer RNAs (tRFs) are produced from pre-tRNAs or mature tRNAs. Based on the incision loci, tRFs are classified into several types: tRF-1, tRF-2, tRF-3, tRF-5, and i-tRF. Some tRFs participate in posttranscriptional regulation through microRNA-like actions or by displacing RNA binding proteins and regulating protein translation by promoting ribosome biogenesis or interfering with translation initiation. Other tRFs prevent cell apoptosis by binding to cytochrome c or promoting virus replication. Preferably, the tRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. The term “small nucleolar RNA (snorRNA) fragment”, as used herein, refers to a fragment derived from a small nucleolar RNA. Small nucleolar RNA molecules are a class of small RNA molecules that primarily guide chemical modifications of other RNAs, mainly ribosomal RNA, transfer RNA, and small nuclear RNAs. There are two main classes of snoRNA, the C / D box snoRNAs and the H / ACA box snoRNAs. The C / D box snoRNAs are associated with methylation. SnoRNAs are commonly referred to as guide RNAs but should not be confused with the guide RNAs that direct RNA editing in trypanosomes. Preferably, the snorRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. In the present invention, a combination of a 5’adapter and 3’adapter is used for the detection of methylated small non-coding RNA (in a sample), and / or for the quantification of a methylation status of small non-coding RNA (in a sample). In the context of the present invention, the term “adapter” refers to a polynucleotide that can be ligated to the 5’end of small non-coding RNA (i.e. “5’adapter”) or to the 3’end of small non-coding RNA (i.e. “3’adapter”). The nucleotides of the 5’adapter and the 3’adapter may be standard or natural (i.e. adenosine, guanosine, cytidine, thymidine, and uridine) as well as non- standard nucleotides. Non-limiting examples of non-standard nucleotides include inosine, xanthosine, isoguanosine, isocytidine, diaminopyrimidine and deoxyuridine. The adapters may comprise modified or derivatized nucleotides. Non-limiting examples of modifications in the ribose or base moieties include the addition, or removal, of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups and thiol groups. In particular, included are 2’-0-methyl and locked nucleic acids (LNA) nucleotides. Suitable examples of derivatized nucleotides include those with covalently attached dyes, such as fluorescent dyes or quenching dyes, or other molecules such as biotin, digoxygenin, or magnetic particles or microspheres. The adapters may also comprise synthetic nucleotide analogs such as morpholinos or peptide nucleic acids (PNA). Phosphodiester bonds or phosphothioate bonds may link the nucleotides or nucleotide analogs of the linkers. The length of the 5’ and 3’adapter can vary depending upon, for example, the desired length of the ligation product and the desired features of the adapter. In general, the 5’adapter or 3’adapter may range from 15 to 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 5’adapter as described herein comprises a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, (random) deoxynucleotides, wherein said 6 to 15 (random) deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non- coding RNA. In addition, the 3’adapter as described herein comprises a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, (random) deoxynucleotides, wherein said 6 to 15 (random) deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA. The 5’adapter and the 3’adapter can be present as linear polynucleotide, e.g. after denaturation / when denatured. In this form, the 5’adapter and the 3’adapter is single-stranded. This primary structure may be converted into a secondary structure. In particular, the 5’adapter and the 3’adapter is further capable of forming a stem-loop structure. Thus, the 5’adapter and the 3’adapter can also have a stem-loop structure, e.g. after re-naturation / when re-natured. Generally, the term “stem-loop structure” refers to a pattern that can occur in single-stranded RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. In particular, the 5’adapter and the 3’adapter that is capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. The first stem sequence and the second stem sequence form the “double-stranded region” or “double-stranded stem” of the stem-loop adaptor. In one embodiment, the stem is between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides in length. In one preferred embodiment, the stem is between 5 and 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides in length. It should be noted that a portion of a primer may be encoded in the stem. As a general matter, in those embodiments in which a portion of a primer is encoded in the stem, the stem may be longer. In those embodiments in which a portion of a primer is not encoded in the stem, the stem may be shorter. As used herein, the term “loop” refers to the single-stranded region of the stem-loop structure. In particular, the loop is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. In other words, the loop is located between the two reverse complementary strands of the stem and typically the loop comprises single-stranded nucleotides, although other moieties such as modified DNA or RNA molecules are also possible. In one embodiment, the loop sequence comprises between 10 and 40 nucleotides, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. In one preferred embodiment, the loop sequence comprises between 12 and 20 nucleotides, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. The nucleotides of the loop structure are preferably deoxynucleotides but also ribonucleotides are possible. It should be noted that a portion of a primer may be encoded in the loop. As a general matter, in those embodiments in which a primer is encoded in the loop, the loop may be longer. In those embodiments in which a primer is not encoded in the loop, the loop may be shorter. In addition, it should be noted that the 5’adapter as described herein comprises a 5’-terminal sequence that is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. Moreover, it should be noted that the 3’adapter as described herein comprises a 3’-terminal sequence that is configured such that it forms a single stranded 3’protrusion after formation of the stem-loop structure. The adapter, e.g.5’adapter and / or 3’adapter, may comprise one or more blocking nucleotides. The term “blocking nucleotide”, as used herein, refers to a nucleotide comprising a chemical moiety which prevents or minimizes nucleotide addition by a DNA polymerase. For example, by adding a blocking group to the terminal 3’-OH, the nucleotide is no longer able to participate in phosphodiester bond formation catalyzed by the DNA polymerase. Some non-limiting examples include, an alkyl group, non-nucleotide linkers, phosphorothioate, alkane-diol residues, PNA, LNA, nucleotide analogs comprising a 3’-amino group in place of the 3’-OH group, nucleotide analogs comprising a 5‘-OH group in place of the 5’-phosphate group, nucleotide derivatives lacking a 3’-OH group, or biotin. These nucleotides are generally not chain extendable. Other examples of non-extendable nucleotides that can be used include nucleotides that have modified ribose moieties. In certain embodiments, ribonucleotides may serve as non-extendable nucleotides because oligonucleotides terminating in ribonucleotides cannot be extended by certain DNA polymerases. The ribose can be modified to include 3'- deoxy derivatives including those in which the 3'-hydroxy is replaced by a functional group other than hydrogen, for example, as an azide group. In certain embodiments, a non-extendible nucleotide comprises a dideoxynucleotide (ddN), for example but not limited to, a dideoxyadenosine (ddA), a dideoxycytosine (ddC), a dideoxyguanosine (ddG), a dideoxythymidine (ddT), or a dideoxyuridine (ddU). In particular, the adapter, e.g. 5’adapter and / or 3’adapter, may comprise locked nucleic acids (LNAs). The term “locked nucleic acids (LNAs)”, as used herein, refers to modified nucleotides, specifically ribonucleotides, in which the 2’-O and 4’-C atoms of the ribose are joined through a methylene bridge. This additional bridge limits the flexibility normally associated with the ring, essentially locking the structure into a rigid conformation. These nucleic acid analogs are also referred to in some circles as “inaccessible ribonucleotides”. LNA nucleotides can be mixed with DNA or RNA residues in the polynucleotide, in effect hybridizing with DNA or RNA according to Watson-Crick base-pairing rules. The inflexible nature of these molecules greatly enhances hybridization stability. Further, polynucleotides containing LNAs offer tremendous discriminatory power, allowing these molecules to distinguish between exact match and mismatched complementary target sequences with very little difficulty. In one embodiment, the 5’adapter and / or the 3’adapter comprise(s) locked nucleotides, in particular ribonucleotides. In one preferred embodiment, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced. In one another preferred embodiment, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3’adapter is (are) LNA enhanced. The 3’adapter may comprise a 3’inverted deoxynucleotide. The term “inverted deoxynucleotide”, as used herein, refers to a deoxynucleotide creating a 3’-3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3’end of the adapter, e.g. during reverse transcriptase (RT) PCR. In addition, the 3’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. In one embodiment, the 3’adapter comprises a 3’inverted deoxynucleotide. In one preferred embodiment, the 3’adapter comprises a 3’inverted deoxynucleotide, wherein the deoxynucleotide is inverted dT, dA, dC, or dG. The 5’adapter may further comprise in the loop a base lacking spacer, specifically at the 5’-end of the loop. The term “base lacking spacer”, as used herein, refers to a moiety allowing the termination of the reverse transcription in a subsequent step. In particular, the reaction terminates at the nucleotide preceding the base lacking spacer in the loop region of the 5’adapter, which prevents the reaction from continuing to the end of the 5’adapter and, thus, generating highly structured cDNAs, which may impair subsequent PCR steps. Particularly, the base lacking spacer is a 2’-dideoxyribose spacer. More particularly, the base lacking spacer is a 1’2’-dideoxyribose spacer. In one embodiment, the 5’adapter comprises in the loop a base lacking spacer, preferably at the 5’-end of the loop. In one preferred embodiment, the 5’adapter comprises in the loop a 2’-dideoxyribose spacer, preferably at the 5’-end of the loop. In one more preferred embodiment, a 5’adaper, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced and a 3’adapter, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3’adapter is (are) LNA enhanced are combined / part of a combination. In one even more preferred embodiment, a 5’adaper, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced and a 3’adapter, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3’adapter is (are) LNA enhanced and wherein the the 3’adapter comprises a 3’inverted deoxynucleotide, e.g. inverted dT, dA, dC, or dG, are combined / part of a combination. The methods of the present invention are directed to the detection of methylated small non-coding RNA (in a sample), and / or to the quantification of a methylation status of small non-coding RNA (in a sample). These methods require the annealing and the ligation of adapters to the small non-coding RNA (present in a sample). First, the adapters, in particular 5’ and 3’adapters, are annealed to the small non-coding RNA. Before the adapters, in particular 5’ and 3’adapters, are annealed to the small non-coding RNA, the small non-coding RNA is denatured. In addition, the adapters, in particular 5’ and 3’adapters, are denatured and subsequently renatured. The term “annealing”, as used herein, refers to a process of heating and cooling two single- stranded polynucleotides with complementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds to form between the sequences. During this process, the adapters, in particular 5’ and 3’adapters, attach to the small non-coding RNA, and form their characteristic stem-loop structure. In particular, the 5’adapter attaches to the 5’end of the small non-coding RNA and the 3’adapter attaches to the 3’end of the small non-coding RNA. In this respect, it should be noted that the denaturation / renaturation of the adapters, in particular 5’ and 3’adapters, preferably takes place separately and in the absence of the small non-coding RNA. Second, the adapters, in particular 5’ and 3’adapters, are then ligated to the small non- coding RNA, using / with a double stranded RNA ligase, thereby producing a ligation product. As used herein, the term “ligation product” refers to a (DNA / RNA) hybrid molecule comprising at least one adapter and small non-coding RNA. For example, the ligation product may comprise a 5’adapter and small non-coding RNA. Further, the ligation product may comprise a 3’adapter and small non-coding RNA. Furthermore, the ligation produced may comprise a 5’adapter, a 3’adapter and small non-coding RNA. Specifically, the annealing of the 5’adapter with the small non-coding RNA, generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the small non-coding RNA. This is an efficient substrate for ligation by a double-stranded RNA ligase. In addition, the annealing of the 3’adpater with the small non-coding RNA generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the small non-coding RNA, and the 5’end of the adapter. This is also an efficient substrate for ligation by a double-stranded RNA ligase. Generally, any double stranded RNA ligase capable of ligating double stranded RNA nicks / RNA structures may be used for this purpose. In one preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In one more preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2). The conditions of the ligation reaction are typically adjusted so that the ligase functions near its optimal activity level. A buffering agent may be used to adjust and maintain the pH at the desired level. Representative examples of suitable buffers include, but are not limited to, MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, sodium acetate and Tris buffer. As used herein, the term “extension reaction” refers to an elongation reaction in which the 3’adapter ligated to the 3’end of the small non-coding RNA is extended, in particular in 5’ to 3’ direction, to form an “extension reaction product” comprising a strand reverse complementary to the small non-coding RNA. In the context of the present invention, the extension reaction can also be designated as “reverse transcription”. In some embodiments, the small non-coding RNA is a miRNA, and the extension reaction is a reverse transcription reaction comprising a reverse transcriptase, whereby a DNA (in particular cDNA) copy of the ligation product is made. In certain embodiments, the extension reaction is a reverse transcription reaction comprising a polymerase, such as a reverse transcriptase. The term “reverse transcriptase”, as used herein, refers to any enzyme having reverse transcriptase activity. In particular, the term “reverse transcriptase”, as used herein, refers to an enzyme used to generate DNA (cDNA) from an RNA template in a process termed reverse transcription. The reverse transcriptase has an RNA-dependent DNA polymerase activity. By means of this activity, a hybrid double strand of RNA and DNA is first built up after presentation of a single-stranded RNA by linking complementary paired DNA building blocks (deoxyribonucleotides). Afterwards, its RNA portion is largely degraded by means of an RNase H activity of a special section of the protein. The remaining DNA single strand is finally completed to the DNA double strand, catalyzed by an additional inherent DNA-dependent DNA polymerase activity of reverse transcriptase. To initiate reverse transcription, the reverse transcriptase requires a primer which serves as a starting point for the reverse transcriptase to synthesize a new strand. This primer is also called RT-primer sequence. The RT-primer depends on the 3’ adapter sequence. The RT-primer is reverse complementary to said sequence. In one preferred embodiment, the reverse transcriptase is Maxima H-RT, Tth polymerase, Protoscript II RT, or Luna RT. In one more preferred embodiment, the reverse transcriptase is Maxima H-RT or Luna RT. To detect methylations and to quantify the status of methylations in the methods of the present invention, the reverse transcription of the ligation product is conducted under limiting conditions (test reaction) as well as under non-limiting conditions (control reaction). In the context of the present invention, the reverse transcription of the ligation product “under limiting conditions” means performing the reverse transcription (RT) with a desoxynucleosidetriphosphate (dNTP) concentration which is lower than “under non-limiting (normal) conditions. Preferably, said reverse transcription of the ligation product is conducted with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less, e.g.1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. More preferably, said reverse transcription of the ligation product is conducted with a dNTP concentration which is between 1 / 10 and 1 / 50, e.g.1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, or 1 / 50, of the dNTP concentration under non-limiting (normal) conditions. Even more preferably, said reverse transcription of the ligation product is conducted with between 20 µM and 50 µM dNTPs, e.g. with 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 µM dNTPs. Still even more preferably, said reverse transcription of the ligation product is conducted with between 20 µM and 30 µM dNTPs, e.g. with 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 µM dNTPs. Most preferably, said reverse transcription of the ligation product is conducted with 25 µM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting (normal) conditions” is preferably conducted with between 200 µM and 500 µM dNTPs, more preferably with between 200 µM and 300 µM dNTPs, and even more preferably with 250 µM dNTPs. Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed with 25 µM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is specifically performed with 250 µM dNTPs. In the above embodiment, the reverse transcriptase is preferably Maxima RT. Alternatively, it is even more preferred, that said reverse transcription of the ligation product is conducted with between 500 µM and 1200 µM dNTPs, e.g. with 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or 1200 µM dNTPs. Still even more preferably, said reverse transcription of the ligation product is conducted with between 800 µM and 1100 µM dNTPs, e.g. with 800, 850, 900, 950, 1000, 1050, or 1100 µM dNTPs. Most preferably, said reverse transcription of the ligation product is conducted with 1000 µM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting (normal) conditions” is, in an alternative, preferably conducted with between 5000 µM and 12000 µM dNTPs, more preferably with between 8000 µM and 11000 µM dNTPs, and even more preferably with 10000 µM dNTPs. Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed with 1000 µM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is specifically performed with 10000 µM dNTPs. In the above alternative embodiment, the reverse transcriptase is preferably Luna RT. In this respect, it should be noted that methylated nucleotides such as 2′-O-methylated nucleotides induce reverse transcription stops / pauses at low concentrations of desoxynucleosidetriphosphates (dNTPs) (i.e. under limiting conditions), while at high dNTP concentrations (i.e. under non-limiting conditions) reverse transcriptase can bypass methylated sites such as 2′-O-methylated sites. It appears that the methylated group such as 2′-O-methyl group acts as a conformational “bump” which hinders the passage of the reverse transcriptase, whose effect is minimized at high dNTP concentrations (i.e. under non-limiting conditions). A difference between the cDNA products produced via reverse transcription at low concentrations of dNTPs (i.e. under limiting conditions) and high concentrations of dNTPs (i.e. under non-limiting conditions) indicates the presence of methylated small non-coding RNA (in a sample). According to the methods of the present invention, the cDNA product produced with the reverse transcription at low dNTP concentrations (i.e. under limiting conditions) is designated as first cDNA product. In addition, the cDNA product produced with said reverse transcription at high dNTP concentrations (i.e. under non-limiting conditions) is designated as second cDNA product. In the methods of the present invention, methylated small non-coding RNA (in a sample) is detected, and / or a methylation status of mall non-coding RNA (in a sample) is quantified. For these purposes, the cDNA product (and consequently the small non-coding RNA based thereon) is detected. Described herein is an amplification method to detect the cDNA product (and consequently the methylated small non-coding RNA based thereon). In particular, the amplification is carried out using a polymerase chain reaction (PCR). The PCR may be selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably Taq-man qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. Preferably, the digital PCR is digital droplet PCR or digital partition PCR. The terms “amplicon” and “amplification product”, as used herein, generally refer to the product of an amplification reaction. An amplicon may be double-stranded or single-stranded, and may include the separated component strands obtained by denaturing a double-stranded amplification product. In certain embodiments, the amplicon of one amplification cycle can serve as a template in a subsequent amplification cycle. The term “amplifying”, as used herein, refers to any means by which at least a part of the small non-coding RNA, small non-coding RNA surrogate, or combinations thereof, is reproduced, typically in a template-dependent manner, including without limitation, a broad range of techniques for amplifying nucleic acid sequences, either linearly or exponentially. Any of several methods can be used to amplify the target polynucleotide. Any in vitro means for multiplying the copies of a target sequence of nucleic acid can be utilized. These include linear, logarithmic, or other amplification methods. Exemplary methods include polymerase chain reaction (PCR), isothermal procedures (using one or more RNA polymerases, strand displacement, partial destruction of primer molecules, ligase chain reaction (LCR), Q RNA replicase systems, RNA transcription- based systems (e.g., TAS, 3SR), or rolling circle amplification (RCA). In the context of the present invention, the cDNA product of the small non-coding RNA is amplified. The term “methylated small non-coding RNA”, as used herein, refers to RNA which has been post-transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2′-O-methylated nucleotide (2′-O-m)). The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1-methyladenosine (m1A), and 1-methylguanosine (m1G), or is a combination thereof. The 2′-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3′-end 2′-O-methyladenosine (Am), 2′-O-methyluridine (Um), 2′-O- methylguanosine (Gm), and 2′-O-methylcytidine (Cm), or is a combination thereof. The method of the present invention allows the “detection of methylated small non- coding RNA”. Methylated small non-coding RNA such as 2′-O-methylated small non-coding RNA induce reverse transcription stops / pauses at low concentrations of desoxynucleosidetriphosphates (dNTPs) (i.e. under limiting conditions), while at high dNTP concentrations (i.e. under non- limiting conditions) reverse transcriptase can bypass methylated sites such as 2′-O-methylated sites. It appears that the methylated group such as 2′-O-methyl group acts as a conformational “bump” which hinders the passage of the reverse transcriptase, whose effect is minimized at high dNTP concentrations (i.e. under non-limiting conditions). The cDNA product produced with said reverse transcription at low dNTP concentrations (i.e. under limiting conditions) is designated as first cDNA product. In addition, the cDNA product produced with said reverse transcription at high dNTP concentrations (i.e. under non-limiting conditions) is designated as second cDNA product. A difference between the cDNA products produced via reverse transcription at low concentrations of dNTPs (i.e. under limiting conditions) and high concentrations of dNTPs (i.e. under non-limiting conditions) indicates the presence of methylated small non-coding RNA (in the sample). If there is no (significant) difference, the small non-coding RNA is not methylated. A significant difference in this respect preferably means that the experiment is conducted three times and that in all three experiments, a difference could be detected. The difference may reside in different levels of the cDNA products. The term “level”, as used herein, refers to an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads per million (RPM), NGS counts, copies per µl, or cycle thresholds) of the small non-coding RNA or cDNA product derived therefrom. The term “level”, as used herein, also comprises scaled, normalized, or scaled and normalized amounts or values (e.g. RPM). Particularly, the level of the small non-coding RNA or cDNA product derived therefrom is determined by sequencing, preferably next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g. microarray or beads), nucleic acid amplification (e.g. polymerase chain reaction (PCR)), polymerase extension, mass spectrometry, flow cytometry (e.g. LUMINEX), or any combination thereof. More particularly, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. The digital PCR may be digital droplet PCR or digital partition PCR. Specifically, the difference between the cDNA products produced via reverse transcription is based on a difference in expression levels determined by (i) cycle thresholds in case of semiquantitative PCR reaction, or (ii) copies per µl in case of digital PCR such as digital droplet PCR or digital partition PCR. The method of the present invention further allows the “quantification of a methylation status of small non-coding RNA”. In this case, the difference between the first cDNA product and the second cDNA product is quantified (and not only determined). Therefore, a ratio between the first cDNA product and the second cDNA product is determined. The following formula particularly applies: methylation ratio = copies with a dNTP concentration under limiting conditions / copies with a dNTP concentration under non-limiting conditions, wherein ratio low ^ high methylation, and ratio low methylation. Especially, dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. For example: methylation ratio = copies at 25 μM dNTP (limiting conditions) / copies at 250 μM dNTP (non-limiting conditions), wherein ratio low ^ high methylation, and ratio high ^ low methylation. methylation ratio = copies at 1000 μM dNTP (limiting conditions) / copies at 10000 μM dNTP (non-limiting conditions), wherein ratio low ^ high methylation, and ratio low methylation. More specifically, the ratio between the first cDNA product and the second cDNA product is determined / calculated by determining the level (e.g. the number of copies) of the first cDNA product and the level (e.g. the number of copies) of the second cDNA product, and determining a ratio between the level (e.g. the number of copies) of the first cDNA product and the level (e.g. the number of copies) of the second cDNA product, wherein a ratio of lower than 0.5 (e.g.0, 0.1, 0.2, 0.3, or 0.4) indicates a high degree of small non-coding RNA methylation, and wherein a ratio of higher than or equal to 0.5 (e.g.0.5, 0.6, 0.7, 0.8, 0.9, or 1) indicates a low degree of small non-coding RNA methylation (in the sample). Additionally, the methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at a dNTP concentration under limiting conditions / copies per µl at a dNTP concentration under non-limiting conditions)) * 100. Especially, the dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. For example, the methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at 25 µM dNTP / copies per µl at 250 µM dNTP)) * 100. In one alternative, the methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at 1000 µM dNTP / copies per µl at 10000 µM dNTP)) * 100. In one another alternative, an exact % methylation (status / degree) can be determined using a calibration curve (as shown in Figure 16). The term “low degree of small non-coding RNA methylation”, as used herein, means that between 0% and 50%, e.g.0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50%, of the small non-coding RNA (molecules) in a sample is (are) methylated. The term “high degree of small non-coding RNA methylation”, as used herein, means that between more than 50% and 100%, e.g. more than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, of the small non-coding RNA (molecules) in a sample is (are) methylated. Thus, a low degree of small non-coding RNA methylation may mean no methylation (i.e. methylation of 0% or no small non-coding RNA entities in a sample are methylated). In addition, a high degree of small non-coding RNA methylation may mean complete methylation (i.e. methylation of 100% or all small non-coding RNA entities in a sample are methylated). The term “quantifying the methylation status”, as used herein, means estimating the ratio of small non-coding RNA (molecules) which are methylated in a sample. Specifically, the status of methylation of small non-coding RNA (molecules) ranges between 0 (i.e. fully methylated, or all detected RNA entities are fully methylated) and 1 (i.e. not methylated, or all detected RNA entities are not methylated). The term “Dumbbell PCR (DB-PCR)”, as used herein, refers to an efficient and convenient method to distinctively quantify specific individual small RNA such as miRNA as well as specific individual small RNA variants such as isomiRs. In Db-PCR, 5’- and 3’ adapters are specifically hybridized and ligated to the 5’- and 3’-ends of target small non-coding RNAs, respectively, by a double stranded RNA ligase, e.g. T4 RNA ligase 2 (Rnl2). The resultant ligation products with ‘dumbbell-like’ structures are subsequently quantified, e.g. by TaqMan RT-PCR. The present inventors found that the use of the proprietary 5’ and 3’adapters as described herein as well as high specificity of Rnl2 ligation and TaqMan RT-PCR toward target small non-coding RNAs assured both 5’- and 3’-terminal sequences of target small non-coding RNAs with single nucleotide resolution so that Db-PCR specifically detected target small non- coding RNAs but not their corresponding terminal variants. Db-PCR described herein has broad applicability for the quantification of various small RNAs in different cell types. Therefore, Db- PCR provides a much-needed simple method for analyzing RNA terminal heterogeneity. Residues in two or more polynucleotides are said to “correspond” to each other if the residues occupy an analogous position in the polynucleotide structures. It is well known in the art that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art and can be, for example, obtained on the World Wide Web, for example, ClustalW or Align using standard settings, preferably for Align EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. The term “sample”, as used herein, refers to any sample comprising small non-coding RNA. Said sample is specifically derived from the body of a subject. Said sample specifically comprises small non-coding RNA isolated from organisms, tissues, cells, or bodily fluids such as blood. Thus, the sample is particularly a biological sample. The sample may also be a processed sample which is originated from a biological sample. In other words, the sample may also be a processed sample which has its origin in a biological sample. The term “biological sample”, as used herein, refers to any sample having a biological origin and / or comprises biological material. The biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The term “body fluid sample”, as used herein, refers to any liquid sample comprising small non-coding RNA. Said sample is specifically derived from the body of a patient / subject. Said body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. The term “blood sample”, as used herein, encompasses whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. In particular the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA- tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. Embodiments of the invention The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary. The present inventors have previously developed a Dumbbell PCR (DB PCR) based method, which exploits the ability of a double stranded RNA ligase, particularly RNA ligase 2 (Rnl2), to specifically join the nicks in a hybridized double stranded RNA. Only correctly hybridized adaptors both to the 5’ and the 3’end of the isomiRs enable the formation of the ligated RNA that can be used as template for cDNA synthesis. This method is able to specifically and efficiently determine and quantify the expression of target RNA (e.g. miRNA) as well as of target RNA variants having specific terminal sequences (e.g. isomiR). Second layer of specificity is introduced by a TaqMan probe, that can align to a user-defined region of a cDNA sequence. The present inventors have now adapted this method to limiting reverse transcription (RT) conditions and used it for the detection of methylated small non-coding RNA (in a sample), and / or for the quantification of a methylation status of small non-coding RNA (in a sample). In addition, they performed digital PCR to detect the small non-coding RNAs by DB- PCR. The advantage of digital PCR is the direct absolute quantification of the copy numbers of the RNA of interest in the cDNA and, thus, allows linear quantification of methylation stoichiometry. Thus, in a first aspect, the present invention relates to the use of a combination of (i) a 5’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and (ii) a 3’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). Preferably, the small non-coding RNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non- coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. In one embodiment, the 5’adapter comprises in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides. The 5’adapter may range from 15 to 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 5’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5’end of small non-coding RNA. When attached / ligated to the 5’end of small non-coding RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non- coding RNA. The small non-coding RNA is preferably a miRNA or an isomiR comprised in / part of miRbase version 22.1. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides. In one another embodiment, the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. As mentioned above, a preferred 5’adapter comprises in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced. Alternatively or additionally to (ii) said 6 to 15 deoxynucleotides in (i) which are reverse complementary to a 5’-terminal sequence of small non-coding RNA comprise one or more locked nucleotide- (LNA-) enhanced and / or other modified nucleotides. Thus, in one example, the above described 5’adapter comprises in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and / or otherwise modified, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotides. Specifically, in one example, the above described 5’adapter comprises in the following order from 5’ to 3’: (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are otherwise modified (than LNA-enhanced), or (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and otherwise modified, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotides. Thus, in one another example, the above described 5’adapter comprises in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and / or otherwise modified, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotide and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced. Specifically, in one another example, the above described 5’adapter comprises in the following order from 5’ to 3’: (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are otherwise modified (than LNA-enhanced), or (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and otherwise modified, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotide and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced. The above-mentioned one or more otherwise modified (than LNA-enhanced) nucleotides are preferably 2’-ortho-methylated ribonucleotides. Thus, in one particular example, the above described 5’adapter comprises in the following order from 5’ to 3’: (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, or (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotides. Thus, in one another particular example, the above described 5’adapter comprises in the following order from 5’ to 3’: (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, or (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3’end are ribonucleotides or modified ribonucleotide and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced. Especially, the one or more 2’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In one more preferred embodiment, the 5’adapter has the following sequence from 5’ to 3’: (6-15x)NCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence. For example, every, every second, or every third nucleotide may be LNA enhanced in the underlined portion and / or in the double underlined portion specified above. In one even more preferred embodiment, the 5’adapter has the following sequence from 5’ to 3’: (6-15x)NCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, and wherein one or more (e.g. 1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, or is a variant of this sequence. Specifically, the LNA enhanced nucleotides are ribonucleotides. The 5’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 1. Such a 5’adapter variant still comprises the at least 2 nucleotides at its 3’end which are ribonucleotides or modified ribonucleotides. In addition, such a 5’ adapter variant is still LNA enhanced (if this is not an optional feature). Moreover, such a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect. In one particular embodiment, the 5’adapter as described above comprises a base- lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region. A 5’adapter having a base-lacking spacer in the loop region has preferably the following sequence from 5’ to 3’: (6-15x)NCGTGGCG / idSp / TGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence. Specifically, the LNA enhanced nucleotides are ribonucleotides. In one more particular embodiment, the 5’adapter comprising a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region has the following sequence from 5’ to 3’: (6-15x)NCGTGGCG / idSp / TGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more (e.g. 1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, or is a variant of this sequence. Alternatively, the 5’adapter having a base-lacking spacer has preferably the following sequence from 5’ to 3’: (6-15x)NCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 13), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence. Specifically, the LNA enhanced nucleotides are ribonucleotides. The 5’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 6 or SEQ ID NO: 13. Such a 5’adapter variant still comprises the at least 2 nucleotides at its 3’end which are ribonucleotides or modified ribonucleotides. Further, such a 5’ adapter variant is still LNA enhanced (if this is not an optional feature). Furthermore, such a 5’adapter still comprises a base lacking spacer. In addition, such a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect. In one another particular embodiment, the 5’adapter as described above does not comprise a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region. It is preferred that, in the 5’adapter having a nucleotide sequence according to SEQ ID NO: 1, 6, or 13 as described above, one or more of the 6 to 15 deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA are LNA-enhanced and / or replaced by a 2’-ortho-methylated ribonucleotide. The 5’adapter as described above can bind to any small non-coding RNA target (specifically to the 5’end of any small non-coding RNA target) just by exchanging the variable protrusions. In particular, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides in the 5’terminal nucleotide sequence of the 5’adapter have only to be selected in a way that they are reverse complementary to the small non-coding RNA target (specifically to the 5’end of the small non-coding RNA target) to be detected. The 5’adapter is especially used jointly with the 3’adapter. The 5’ adapter as described above may be present in denatured or renatured form. In one embodiment, the 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides. The 3’adapter may range from about 15 to about 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 3’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3’end of small non-coding RNA. When attached / ligated to the 3’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non- coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version 22.1. In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one another embodiment, the 3’-terminal sequence is configured such that it forms a single stranded 3’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3’inverted deoxynucleotide creates a 3’- 3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3’end of the adapter, e.g. during RT-PCR. In addition, the 3’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. As mentioned above, a preferred 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Alternatively or additionally to (i) said 6 to 15 deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA comprise one or more locked nucleotide- (LNA-) enhanced and / or other modified nucleotides. Thus, in one example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and / or otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Specifically, in one example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated, and (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are otherwise modified (than LNA-enhanced), and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Thus, in one another example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and / or otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Specifically, in one another example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are otherwise modified (than LNA-enhanced), and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. The above-mentioned one or more otherwise modified (than LNA-enhanced) nucleotides are preferably 2’-ortho-methylated ribonucleotides. Thus, in one particular example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated, and (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Thus, in one another particular example, the above described 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Especially, the one or more 2’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In one more preferred embodiment, the 3’adapter has the following sequence from 5’ to 3’: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6-15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein “(6-15x)N” designates the sequence reverse complementary to a 3’terminal sequence of small non-coding RNA, and wherein “ / 3InvdT / ” stands for 3’inverted deoxynucleotide, or is a variant of this sequence. For example, every, every second, or every third nucleotide may be LNA enhanced in the underlined portion and / or in the double underlined portion specified above. In one even more preferred embodiment, the 3’adapter has the following sequence from 5’ to 3’: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6-15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more (e.g.1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, wherein “(6- 15x)N” designates the sequence reverse complementary to a 3’terminal sequence of small non- coding RNA, and wherein “ / 3InvdT / ” stands for 3’inverted deoxynucleotide, or is a variant of this sequence. Specifically, the LNA enhanced nucleotides are ribonucleotides. The 3’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 2. Such a 3’ adapter variant is still LNA enhanced (if this is not an optional feature). Further, the 5’-terminal nucleotide is still phosphorylated in such a 3’adapter variant. Furthermore, the 3’terminal deoxynucleotide is still an inverted deoxynucleotide in such a 3’adapter variant. Moreover, such a 3’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 3’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect. It is preferred that, in the 3’adapter having a nucleotide sequence according to SEQ ID NO: 2 as described above, one or more of the 6 to 15 deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non-coding RNA are LNA-enhanced and / or replaced by a 2’-ortho-methylated ribonucleotide. The 3’adapter as described above can bind to any small non-coding RNA target (specifically to the 3’end of any small non-coding RNA target) just by exchanging the variable protrusions. In particular, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides in the 3’terminal nucleotide sequence of the 3’adapter have only to be selected in a way that they are reverse complementary to the small non-coding RNA target (specifically to the 3’end of the small non-coding RNA target) to be detected. The 3’adapter is especially used jointly with the 5’adapter. The 3’ adapter as described above may be present in denatured or renatured form. The 5’adapter as described above and the 3’adapter as described above can bind / anneal to any small non-coding RNA. After the ligation of the adapters to the small non-coding RNA, they allow the generation of a cDNA product of said small non-coding RNA via reverse transcription. When a small non-coding RNA is methylated, a limited number of cDNA products is produced compared to small non-coding RNA which is not methylated. In this way, the adapters allow the determination of methylation of small non-coding RNA and / or the quantification of the methylation status of small non-coding RNA. Specifically, the combination of said adapters allows for the detection of methylation of small non-coding RNA, and / or for the quantification of a / the methylation status of small non-coding RNA (in a sample). Usually, methylated small non-coding RNA is RNA which has been post- transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2′-O-methylated nucleotide (2′-O-m)). The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1-methyladenosine (m1A), and 1-methylguanosine (m1G), or is a combination thereof. The 2′-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3′-end 2′-O-methyladenosine (Am), 2′-O-methyluridine (Um), 2′-O- methylguanosine (Gm), and 2′-O-methylcytidine (Cm), or is a combination thereof. As to the detection of methylated small non-coding RNA, and / or the quantification of a / the methylation status of small non-coding RNA (present in a sample), it is further referred to the second and third aspect of the present invention. In the first aspect of the present invention, the sample is preferably a biological sample. The sample may also be a processed sample which is originated from a biological sample. In other words, the sample may also be a processed sample which has its origin in a biological sample. The biological sample may be any sample having a biological origin. For example, the biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. More preferably, the biological sample is a blood sample. Even more preferably, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from a subject via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. In the first aspect of the present invention, the sample may also be a sample containing total RNA. Particularly, total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). Specifically, the sample used in the first aspect of the present invention contains cellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes. In a second aspect, the present invention relates to a (an in vitro) method of detecting methylated small non-coding RNA (in a sample) comprising the steps of: (i) providing a ligation product comprising small non-coding RNA to which the 5’adapter as defined in the first aspect and the 3’adapter as defined in the first aspect are ligated, (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product, (iii) amplifying the first cDNA product and the second cDNA product, and (iv) determining a difference between the first cDNA product and the second cDNA product, wherein the difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non-coding RNA (in the sample). This method allows the detection of methylated small non-coding RNA (in a sample). In other words, this method allows to determine, whether methylated small con-coding RNA is present (in a sample) or not. Methylated small non-coding RNA is RNA which has been post- transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2′-O-methylated nucleotide (2′-O-m)). The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1-methyladenosine (m1A), and 1-methylguanosine (m1G), or is a combination thereof. The 2′-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3′-end 2′-O-methyladenosine (Am), 2′-O-methyluridine (Um), 2′-O- methylguanosine (Gm), and 2′-O-methylcytidine (Cm), or is a combination thereof. The determination of small non-coding RNA methylation requires a ligation product comprising the small non-coding RNA to which the 5’adapter as defined in the first aspect and the 3’adapter as defined in the first aspect are ligated. In step (i) of the method of the second aspect, a ligation product is provided comprising small non-coding RNA to which the 5’adapter as defined in the first aspect and the 3’adapter as defined in the first aspect are ligated. Said ligation product is preferably produced by (i) providing a composition comprising denatured small non-coding RNA, the renatured 5’adapter as defined in the first aspect, and the renatured 3’adapter as defined in the first aspect, wherein the 5’adapter and the 3’adapter are annealed to the small non-coding RNA, and (ii) ligating the 5’adapter and the 3’adapter to the small non-coding RNA using / with a double stranded RNA ligase. The annealing of the adapters, in particular 5’ and 3’adapters, to the small non-coding RNA requires that the small non-coding RNA is present in denatured form. In one embodiment, the denatured small non-coding RNA is produced by heating the small non-coding RNA at between 65°C and 75°C, e.g.65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75°C, preferably at 70°C, for between 1 to 3 minutes, e.g.1, 2, or 3, minutes, preferably for 2 minutes. For example, the denatured small non-coding RNA is produced by heating the small non-coding RNA at 70°C for 2 minutes. It is preferred that the small non-coding RNA is immediately placed on ice after denaturation. For the denaturation step, the small non-coding RNA is preferably given to an aqueous solution, e.g. water, or to a buffer solution. It is particularly preferred that the small non-coding RNA is treated after the denaturation with a polynucleotide kinase (to restore or introduce the 5’ phosphate). As to the adapters, in particular 5’ and 3’adapters, a denaturation and a renaturation step is required so that they can from a stem-loop structure which allows annealing to the small non- coding RNA. Annealing is a process of heating and cooling adapters with complementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds to form between the sequences. During this process, the adapters, in particular 5’ and 3’adapters, attach to the denatured small non-coding RNA and form their characteristic stem-loop structure. In particular, the 5’adapter attaches to the 5’end of the small non-coding RNA and the 3’adapter attaches to the 3’end of the small non-coding RNA. It is preferred that the adapters, in particular 5’ and 3’adapters, are denatured and renatured together, i.e. in a common reaction vessel. It is further preferred that the denaturation / renaturation of the adapters, in particular 5’ and 3’adapters, takes place separately and in the absence of the small non-coding RNA. In one embodiment, the renatured 5’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, e.g.75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. For example, the renatured 5’adapter is produced by denaturing the 5’adapter at 82°C for 2 minutes and by renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. In one additional or alternative embodiment, the renatured 3’adapter is produced by denaturing the 3’adapter at between 75°C and 85°C, e.g.75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. For example, the renatured 3’adapter is produced by denaturing the 3’adapter at 82°C for 2 minutes, and by renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. For the denaturation and renaturation step, the adapters, in particular 5’ and 3’adapters, are preferably given to an aqueous buffer, e.g. TNE annealing buffer. In other words, the denaturing and renaturing of the adapters, in particular 5’ and 3’adapters, is preferably carried out in an aqueous buffer, e.g. TNE annealing buffer. The above-mentioned composition, i.e. the composition comprising denatured small non-coding RNA, the renatured 5’adapter as defined in the first aspect, and the renatured 3’adapter as defined in the first aspect, wherein the 5’adapter and the 3’adapter are annealed to the small non-coding RNA, is preferably produced by mixing the denatured small non-coding RNA, the renatured 5’adapter as defined in the first aspect, and the renatured 3’adapter as defined in the first aspect with each other, thereby annealing the 5’adapter and the 3’adapter to the small non-coding RNA. The annealing of the 5’adapter with the small non-coding RNA particularly generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the small non-coding RNA. This is an efficient substrate for ligation by a double stranded RNA ligase. In addition, the annealing of the 3’adpater with the small non-coding RNA particularly generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the small non-coding RNA and the 5’end of the adapter. This is a substrate for ligation by a double stranded RNA ligase. The ligation, to produce the ligation product provided in step (i) of the method of the second aspect, is usually carried out in a ligation buffer. An exemplarily ligation buffers is described in the experimental section of the present patent application. In one preferred embodiment, the ligation buffer comprises polyethylene glycol (PEG), e.g. PEG 8000 (5%), and / or adenosine triphosphate (ATP), e.g. 1 mM ATP. The present inventors have noted that PEG had the effect on the ligation reaction such that it functions as molecular crowding agent and / or ATP had the effect on the ligation reaction such that increased concentrations facilitate the ligation reactions. In one embodiment, the ligation is carried out between 36°C and 38°C, e.g. 36, 37, or 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, e.g.30, 35, 40, 45, 50, 55 minutes, 1, 1.25, or 1.5 hour(s), preferably for 1 hour. For example, the ligation is carried out at 37°C for 1 hour. The double stranded RNA ligase can be any ligase capable of ligating double stranded RNA nicks / RNA structures. Preferably, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In this respect, it should be noted that only a perfectly hybridized molecule provides a substrate for the double stranded RNA ligase, in particular Rnl2. Also, in case of protrusion of either strand or a gap that is 2 nucleotides or longer, the Rnl2 will ligate the molecule with much lower efficiency. The adapters, in particular 5’ and 3’adapters, described herein provide a dsRNA context with a 6 to 15 nucleotide protrusion that hybridizes to the small non-coding RNA. Finally, a 5’ phosphate moiety on the small non-coding RNA is also of advantage for efficient ligation by Rnl2. By ligating the adapters, in particular 5’ and 3’adapters, to the small non-coding RNA using / with a double stranded RNA ligase, a ligation product is produced. The ligation product can be described as a (DNA / RNA) hybrid molecule comprising at least one adapter and small non-coding RNA. For example, the ligation product may comprise a 5’adapter and small non- coding RNA such as miRNA or isomiR. The ligation product may comprise a 3’adapter and small non-coding RNA such as miRNA or isomiR. In addition, the ligation produced may comprise a 5’adapter, a 3’adapter and small non-coding RNA such as miRNA or isomiR. Methylated small non-coding RNA such as 2′-O-methylated small non-coding RNA induce reverse transcription stops / pauses at low concentrations of desoxynucleosidetriphosphates (dNTPs) (i.e. under limiting conditions), while at high dNTP concentrations (i.e. under non-limiting conditions) reverse transcriptase can bypass methylated sites such as 2′-O-methylated sites. It appears that the methylated group such as 2′-O-methyl group acts as a conformational “bump” which hinders the passage of the reverse transcriptase, whose effect is minimized at high dNTP concentrations (i.e. under non-limiting conditions). Thus, in step (ii) of the method of the second aspect, the ligation product is reverse transcribed under limiting conditions, thereby obtaining a first cDNA product. In addition, the (same) ligation product is reverse transcribed under non-limiting conditions, thereby obtaining a second cDNA product. In both cases, the reverse transcription of the ligation product is preferably carried out by (iia) annealing a primer for reverse transcription (RT-primer) with the ligation product, and (iib) reverse transcribing the ligation product by using a reverse transcriptase (RT). In one preferred embodiment, said annealing of a primer for reverse transcription (RT- primer) with the ligation product in step (iia) is carried out at between 60°C and 80°C, e.g.60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 65°C or 75°C, for between 2 and 7 minutes, e.g.2, 3, 4, 5, 6, or 7 minutes, preferably 3 or 5 minutes. For example, said annealing is carried out at 65°C for between 2 and 7 minutes, e.g.2, 3, 4, 5, 6, or 7 minutes, preferably 5 minutes. Alternatively, said annealing is carried out at 75°C for between 2 and 7 minutes, e.g.2, 3, 4, 5, 6, or 7 minutes, preferably 3 minutes. In one (additional or alternative) preferred embodiment, said reverse transcribing of the ligation product by using a reverse transcriptase (RT) in step (iib) is carried out at between 40°C and 65°C, e.g.40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65°C, preferably at 50°C, 55°C, 58°C, or 62°C, for between 10 and 40 minutes, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 minutes, preferably 15 or 30 minutes, and subsequently at between 75°C and 90°C, e.g.75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90°C, preferably at 85°C, for between 2 and 4 minutes, e.g. 2, 3, or 4 minutes, preferably 3 minutes. Specifically, the reverse transcriptase (RT) is Maxima H-RT or Tth polymerase. In one another (additional or alternative) preferred embodiment, said reverse transcribing of the ligation product by using a reverse transcriptase (RT) in step (iib) is carried out at between 40°C and 65°C, e.g.40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65°C, preferably at 50°C, for between 40 and 80 minutes, e.g. 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 minutes, preferably 60 minutes, and subsequently at between 65°C and 80°C, e.g.65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 70°C, for between 10 and 20 minutes, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes, preferably 15 minutes. Specifically, the reverse transcriptase (RT) is Luna RT. In any case, the reverse transcriptase (RT) can be selected from the group consisting of Maxima H-RT, Tth polymerase, Protoscript II RT, and Luna RT for the above method. In the reverse transcription reaction, the 3’adapter ligated to the 3’end of the small non- coding RNA is extended, in particular in 5’ to 3’ direction, to form a strand reverse complementary to the small non-coding RNA. Especially, a cDNA copy of the ligation product is produced in the reverse transcription reaction. For this process, the reverse transcriptase (RT) requires a RT primer. The RT-primer is particularly reverse complementary to the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem of the 3’adapter. Thus, the RT-primer sequence depends on the 3’ adapter sequence. In one particular embodiment, the RT-primer has the following sequence from 5’ to 3’: CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3) or is a variant of this sequence. The RT-primer is, thus, reverse complementary to at least a part of the 3’adpater sequence as described above. In particular, the RT-primer is reverse complementary to nucleotides in the 3’positioned second stem sequence and / or in the loop sequence. In one another particular embodiment, the RT-primer has the following sequence from 5’ to 3’: CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 18) or is a variant of this sequence. The RT-primer is, thus, reverse complementary to at least a part of the 3’adpater sequence as described above. In particular, the RT-primer is reverse complementary to nucleotides in the 3’positioned second stem sequence and / or in the loop sequence. In one another particular embodiment, the RT-primer has the following sequence from 5’ to 3’: ACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 19) or is a variant of this sequence. The RT-primer is, thus, reverse complementary to at least a part of the 3’adpater sequence as described above. In particular, the RT-primer is reverse complementary to nucleotides in the 3’positioned second stem sequence and / or in the loop sequence. As mentioned above, the 3’adapter sequence is preferably the following from 5’ to 3’: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6-15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein (6-15x)N designates the sequence reverse complementary to a 3’terminal sequence of a target RNA, and wherein “ / 3InvdT / ” stands for 3’inverted deoxynucleotide. Specifically, the LNA enhanced nucleotides are ribonucleotides. The RT-primer variant has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 3, SEQ ID NO: 18, or SEQ ID NO: 19. Such a RT-primer variant is still capable of binding the 3’adapter sequence and allowing reverse transcription which is performed by a reverse transcriptase (RT), e.g. Maxima H-RT, Tth polymerase, Protoscript II RT, or Luna RT. The skilled person can readily assess whether a RT primer variant is still capable of binding the 3’adapter sequence and allowing reverse transcription. For example, the experimental section provides sufficient information in this respect. Preferably, said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting conditions. More preferably, said reverse transcription of the ligation product is conducted with a dNTP concentration which is between 1 / 10 and 1 / 50, e.g.1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, or 1 / 50, of the dNTP concentration under non-limiting conditions. Even more preferably, said reverse transcription of the ligation product is conducted with between 20 µM and 50 µM dNTPs, e.g. with 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 µM dNTPs. Still even more preferably, said reverse transcription of the ligation product is conducted with between 20 µM and 30 µM dNTPs, e.g. with 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 µM dNTPs. Most preferably, said reverse transcription of the ligation product is conducted with 25 µM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting conditions” is preferably conducted with between 200 µM and 500 µM dNTPs, more preferably with between 200 µM and 300 µM dNTPs, and even more preferably with 250 µM dNTPs. Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed with 25 µM dNTPs and the reverse transcription reaction under non-limiting conditions (control reaction) is specifically performed with 250 µM dNTPs. In the above embodiment, the reverse transcriptase is preferably Maxima RT. Alternatively, it is even more preferred, that said reverse transcription of the ligation product is conducted with between 500 µM and 1200 µM dNTPs, e.g. with 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or 1200 µM dNTPs. Still even more preferably, said reverse transcription of the ligation product is conducted with between 800 µM and 1100 µM dNTPs, e.g. with 800, 850, 900, 950, 1000, 1050, or 1100 µM dNTPs. Most preferably, said reverse transcription of the ligation product is conducted with 1000 µM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting (normal) conditions” is, in an alternative, preferably conducted with between 5000 µM and 12000 µM dNTPs, more preferably with between 8000 µM and 11000 µM dNTPs, and even more preferably with 10000 µM dNTPs. Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed, in the alternative, with 1000 µM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is specifically performed with 10000 µM dNTPs. In the above alternative embodiment, the reverse transcriptase is preferably Luna RT. For detecting the methylation of the small non-coding RNA, the cDNA products derived therefrom have to be amplified in step (iii) of the method of the second aspect. The amplification requires a DNA polymerase, e.g. a Taq polymerase. The cDNA is preferably diluted for the PCR, specifically digital PCR, e.g.1:10. In one particular embodiment, the amplification reaction, is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) or with a variant of this sequence and a Reverse primer having the following sequence from 5’ to 3’: GTGCGAATACCTCGGACC (SEQ ID NO: 5) or with a variant of this sequence (see above). Any amplification method may be used. Specifically, the amplification is carried out using a polymerase chain reaction (PCR). More specifically, the PCR is selected from the group consisting of digital PCR, real- time PCR (quantitative PCR or qPCR), preferably Taq-man qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. The digital PCR is preferably a digital droplet PCR or a digital partition PCR. Even more specifically, the digital PCR or the TaqMan qPCR is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) or with a variant of this sequence and a Reverse primer having the following sequence from 5’ to 3’: GTGCGAATACCTCGGACC (SEQ ID NO: 5) or with a variant of this sequence. While the forward primer is derived from the 5’adapter, the reverse primer is derived from the 3’adapter. These primer designs render the amplification completely dependent on ligation of both the 5’ and 3’adapters to exclusively amplify the ligation product. The amplification using a Taq-man qPCR may be carried out as follows: 95°C for 20 seconds, followed by 40 cycles at 95°C for 1 second and 60°C for 20 seconds. The amplification sample is subsequently hold at 4°C. The Forward primer variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g.80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 4. Such a Forward primer variant is still capable of binding the DNA product produced from the 5’adapter in the reverse transcription reaction. In other words, the Forward primer variant must have at least in part, e.g. over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or of 21 nucleotides, the same sequence as the 5’adapter. In particular, the sequences are identical, e.g. over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or of 21 nucleotides, in the loop region and in the 3’positioned second stem sequence of the 5’adapter. The skilled person can readily assess whether a Forward primer variant is still capable binding the DNA product produced from the 5’adapter in the reverse transcription reaction. For example, the experimental section provides sufficient information in this respect. In addition, the Reverse primer variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 5. Such a Reverse primer variant is still capable of binding the 3’adapter sequence and allowing cDNA preamplification / amplification. The skilled person can readily assess whether a Reverse primer variant is still capable of binding the 3’adapter sequence and allowing cDNA preamplification / amplification. For example, the experimental section provides sufficient information in this respect. Still even more specifically, the TaqMan qPCR is carried out in the presence of a TaqMan probe. The sequence of the TaqMan probe depends on the sequence of the RNA target. The TaqMan probe is a hydrolysis probe that is designed to increase the specificity of quantitative PCR. In general, the TaqMan probe principle relies on the 5’-3’ exonuclease activity of the Taq polymerase to cleave a dual-labeled probe during hybridization to the complementary target sequence and fluorophore-based detection. As in other quantitative PCR methods, the resulting fluorescence signal permits quantitative measurements of the accumulation of the product during the exponential stages of the PCR. However, the TaqMan probe significantly increases the specificity of the detection. Preferably, the TaqMan probe has the following sequence: / 6-FAM / TGAGGTAGTGGT ATTTCACCGGCGGCCGT / BHQ-1 / (SEQ ID NO: 7). In step (iv) of the method of the second aspect, a difference between the first cDNA product and the second cDNA product is determined, wherein a difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non- coding RNA (in the sample). If there is no difference, the small non-coding RNA (in the sample) is not methylated. Preferably, the difference is significant. A significant difference in this respect preferably means that the experiment is conducted three times and that in all three experiments, a difference could be detected. The difference may reside in different levels of the cDNA products. The level may be an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads per million (RPM), NGS counts, copies per µl, or cycle thresholds). In one embodiment, the difference between the first cDNA product and the second cDNA product is determined by comparing the first cDNA product with the second cDNA product. In one preferred embodiment, the difference between the first cDNA product and the second cDNA product is determined / calculated by determining the level, preferably the number of copies, of the first cDNA product and the level, preferably the number of copies, of the second cDNA product, and comparing the level, preferably the number of copies, of the first cDNA product with the level, preferably the number of copies, of the second cDNA product, wherein a lower level, preferably a lower number of copies, of the first cDNA product compared to the level, preferably the number of copies, of the second cDNA product indicates the methylation of the small non-coding RNA (in the sample). In one more preferred embodiment, the difference is based on a difference in expression values determined by (i) cycle thresholds in case of semiquantitative PCR reaction, (ii) copies per µl in case digital droplet PCR or digital partition PCR. The small non-coding RNA analyzed (in a sample) in the second aspect of the present invention has preferably a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. In a third aspect, the present invention relates to a method of quantifying a / the methylation status of small non-coding RNA (in a sample) comprising the steps of: (i) carrying out the method of the second aspect, and (ii) determining a ratio between the first cDNA product and the second cDNA product. By determining the ratio between the first cDNA product and the second cDNA product, a / the methylation status of small non-coding RNA (in the sample) is quantified (and not only determined). The following formula particularly applies: methylation ratio = copies with a dNTP concentration under limiting conditions / copies with a dNTP concentration under non-limiting conditions, wherein ratio low ^ high methylation, and ratio low methylation. Especially, the dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions (see second aspect of the present invention for other specific embodiments). For example: methylation ratio = copies 25 μM dNTP (limiting conditions) / copies 250 μM dNTP (non- limiting conditions), wherein ratio low ^ high methylation, and ratio low methylation. Alternatively: methylation ratio = copies 1000 μM dNTP (limiting conditions) / copies 10000 μM dNTP (non- limiting conditions), wherein ratio low ^ high methylation, and ratio low methylation. In one preferred embodiment, the ratio between the first cDNA product and the second cDNA product is determined by determining the level (e.g. the number of copies) of the first cDNA product and the level (e.g. the number of copies) of the second cDNA product, and determining a ratio between the level (e.g. the number of copies) of the first cDNA product and the level (e.g. the number of copies) of the second cDNA product, wherein a ratio of lower than 0.5 (e.g.0, 0.1, 0.2, 0.3, or 0.4) indicates a high degree of small non-coding RNA methylation, and wherein a ratio of higher or equal to 0.5 (e.g.0.5, 0.6, 0.7, 0.8, 0.9, or 1) indicates a low degree of small non-coding RNA methylation (in the sample). Thereby, a low degree of small non-coding RNA methylation preferably means that between 0% and 50%, e.g.0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50%, of the small non-coding RNA (molecules) in a sample are methylated. In addition, a high degree of small non-coding RNA methylation preferably means that between more than 50% and 100%, e.g. more than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, of the small non-coding RNA (molecules) in a sample are methylated. The methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at a dNTP concentration under limiting conditions / copies per µl at a dNTP concentration under non-limiting conditions)) * 100. Especially, the dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions (see second aspect of the present invention for other specific embodiments). For example, the methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at 25 µM dNTP / copies per µl at 250 µM dNTP)) * 100. In one alternative, the methylation of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation (%) = (1- (copies per µl at 1000 µM dNTP / copies per µl at 10000 µM dNTP)) * 100. In one another alternative, an exact % methylation (status / degree) can be determined using a calibration curve (as shown in Figure 16). Thus, a low degree of small non-coding RNA methylation may mean no methylation (i.e. methylation of 0% or no small non-coding RNA entities in a sample are methylated). In addition, a high degree of small non-coding RNA methylation may mean complete methylation (i.e. methylation of 100% or all small non-coding RNA entities in a sample are methylated). Specifically, the status of methylation of small non-coding RNA (molecules) ranges between 0 (i.e. fully methylated, or all detected RNA entities are fully methylated) and 1 (i.e. not methylated, or all detected RNA entities are not methylated). The above-mentioned level may be an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads per million (RPM), NGS counts, copies per µl, or cycle thresholds). In an alternative approach, a ratio-based curve indicative of methylation stoichiometry is calculated on the basis of the data achieved with the method of the third aspect of the present invention. The small non-coding RNA analyzed in the third aspect of the present invention has preferably a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. In the methods of the second and / or third aspect of the present invention, the sample is preferably a biological sample. The sample may also be a processed sample which is originated from a biological sample. In other words, the sample may also be a processed sample which has its origin in a biological sample. The biological sample may be any sample having a biological origin. For example, the biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample. More preferably, the biological sample is a blood sample. Even more preferably, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from a subject via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed. In the methods according to the second and / or third aspect of the present invention, the sample may also be a sample containing total RNA. Particularly, total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). Specifically, the sample used in the methods according to the second and / or third aspect of the present invention contains cellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes. An example of the method of the second / third aspect of the present invention can be described as follows: First, DB-PCR adapters are denaturated and renaturated so that they form the required stem loop-like structures. The source RNA is denaturated separately, treated with the polynucleotide kinase (to restore the 5'phosphate), mixed with adapters and used for the ligation by T4 RNA ligase 2. Subsequently, a RT primer aligning to the 3' adapter is used for the cDNA production under limiting conditions and non-limiting conditions. Next, diluted cDNA is used for digital PCR with a reverse primer aligning to the 5'end of first strand cDNA and forward primer complementary to the 3'end of the first strand cDNA. Finally, a TaqMan probe is used for the detection of the specific signal in digital PCR. The ratio is calculated from: cDNA level under limiting conditions / cDNA level under non-limiting conditions. This ratio is indicative for the methylation status. Subsequently, a ratio-based curve indicative of 2-o-m stoichiometry can be calculated. In one example (see also experimental section) of the first aspect of the present invention, a combination comprising a 5’adapter having a nucleotide sequence according to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 16, or SEQ ID NO: 17, and a 3’adapter having a nucleotide sequence according to SEQ ID NO: 12 is used for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). In one specific example (see also experimental section) of the first aspect of the present invention, a combination comprising a 5’adapter having a nucleotide sequence according to SEQ ID NO: 17, and a 3’adapter having a nucleotide sequence according to SEQ ID NO: 12 is used for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). The above combinations can specifically be used to study the methylation profile of the 28S rRNA fragment. The methylation / methylation status of this fragment is obvious from SEQ ID NO: 8 (no methylation), SEQ ID NO: 9 (methylation status: Cm4032), SEQ ID NO: 14 (methylation status: Gm4020), and SEQ ID NO: 15 (methylation status: Gm4020 and Cm4032). Especially, the methylation / methylation status of the site Gm4020 of the 28S rRNA fragment, which is more variable in comparison to the site Cm4032 of the 28S rRNA fragment, can be detected / quantified with the above combination (see also Figure 8). In one example (see also experimental section) of the second aspect of the present invention, the method of detecting methylated small non-coding RNA (in a sample) comprises the steps of: (i) providing a ligation product comprising small non-coding RNA to which a 5’adapter having a nucleotide sequence according to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 16, or SEQ ID NO: 17 and a 3’adapter having a nucleotide sequence according to SEQ ID NO: 12 are ligated, (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product, (iii) amplifying the first cDNA product and the second cDNA product, and (iv) determining a difference between the first cDNA product and the second cDNA product, wherein the difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non-coding RNA (in the sample). As reverse transcriptase (RT), Maxima H-RT, Tth polymerase, Protoscript II RT, or Luna RT can be used. Specifically, the reverse transcriptase (RT) is Maxima H-RT or Luna RT. As primer for reverse transcription (RT-primer), an RT primer having a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 18, or SEQ ID NO: 19 can be used. Specifically, the reverse transcription (RT-primer) has a nucleotide sequence according to SEQ ID NO: 18. More specifically, the reverse transcriptase (RT) is Luna RT and the reverse transcription (RT- primer) has a nucleotide sequence according to SEQ ID NO: 18. In one specific example (see also experimental section) of the second aspect of the present invention, the method of detecting methylated small non-coding RNA (in a sample) comprises the steps of: (i) providing a ligation product comprising small non-coding RNA to which a 5’adapter having a nucleotide sequence according to SEQ ID NO: 17 and a 3’adapter having a nucleotide sequence according to SEQ ID NO: 12 are ligated, (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product, (iii) amplifying the first cDNA product and the second cDNA product, and (iv) determining a difference between the first cDNA product and the second cDNA product, wherein the difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non-coding RNA (in the sample). In the above method, the reverse transcription of the ligation product is further carried out by (iia) annealing an RT-primer having a nucleotide sequence according to SEQ ID NO: 18 with the ligation product, and (iib) reverse transcribing the ligation product by using the reverse transcriptase (RT) Luna. The above method can specifically be used to study the methylation profile of the 28S rRNA fragment. The methylation / methylation status of this fragment is obvious from SEQ ID NO: 8 (no methylation), SEQ ID NO: 9 (methylation status: Cm4032), SEQ ID NO: 14 (methylation status: Gm4020), and SEQ ID NO: 15 (methylation status: Gm4020 and Cm4032). Especially, the methylation / methylation status of the site Gm4020 of the 28S rRNA fragment, which is more variable in comparison to the site Cm4032 of the 28S rRNA fragment, can be detected / quantified in the above method (see also Figure 8). In the above method, the reverse transcription reaction under limiting conditions (test reaction) is ideally performed with 1000 µM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is ideally performed with 10000 µM dNTPs. In a fourth aspect, the present invention relates to a 5’adapter comprising in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5’- terminal sequence of small non-coding RNA is replaced by a 2’-ortho-methylated ribonucleotide, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides. The 5’adapter may range from 15 to 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 5’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5’end of small non-coding RNA. When attached / ligated to the 5’end of small non-coding RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non- coding RNA. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides. In one another embodiment, the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. In one more preferred embodiment, the at least one 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non- coding small RNA (molecule) that is presumed to be methylated. Alternatively, the at least one 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) base- pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In one even more preferred embodiment, the 5’adapter as described above comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region. In this specific case, the 5’adapter comprises, for example, in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5’- terminal sequence of small non-coding RNA is replaced by a 2’-ortho-methylated ribonucleotide, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3’end are ribonucleotides or modified ribonucleotides, wherein the nucleotide sequence comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer), and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. In a fifth aspect, the present invention relates to a 3’adapter comprising in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non-coding RNA is replaced by a 2’-ortho- methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides. The 3’adapter may range from about 15 to about 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 3’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3’end of small non-coding RNA. When attached / ligated to the 3’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non- coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version 22.1. In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one another embodiment, the 3’-terminal sequence is configured such that it forms a single stranded 3’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3’inverted deoxynucleotide creates a 3’- 3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3’end of the adapter, e.g. during RT-PCR. In addition, the 3’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. In one more preferred embodiment, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non- coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) base- pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In a sixth aspect, the present invention relates to a combination of the 5’adapter of the fourth aspect and the 3’adapter of the fifth aspect. In a seventh aspect, the present invention relates to a kit comprising the 5’adpater of the fourth aspect, the 3’adapter of the fifth aspect, and / or the combination of the sixth aspect. The 5’adpater of the fourth aspect, the 3’adapter of the fifth aspect, and / or the combination of the sixth aspect can be used for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). The 5’adpater of the fourth aspect, the 3’adapter of the fifth aspect, and / or the combination of the sixth aspect can also be used in a method for detecting methylated small non-coding RNA (in a sample) or in a method for quantifying a methylation status of small non-coding RNA (in a sample). The small non-coding RNA referred to in the fourth or fifth aspect of the present invention has preferably a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. As to preferred embodiments of the sample, it is referred to the first to third aspect of the present invention. In an eighth aspect, the present invention relates to a 5’adapter comprising in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5’- terminal sequence of small non-coding RNA is LNA-enhanced, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides. The 5’adapter may range from 15 to 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 5’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5’end of small non-coding RNA. When attached / ligated to the 5’end of small non-coding RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non- coding RNA. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides. In one another embodiment, the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. In one more preferred embodiment, the at least one 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non- coding small RNA (molecule) that is presumed to be methylated. Alternatively, the at least one 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) base- pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In one even more preferred embodiment, the 5’adapter as described above comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region. In this specific case, the 5’adapter comprises, for example, in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5’- terminal sequence of small non-coding RNA is LNA-enhanced, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3’end are ribonucleotides or modified ribonucleotides, wherein the nucleotide sequence comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer), and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. In a ninth aspect, the present invention relates to a 3’adapter comprising in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminal sequence of small non-coding RNA, wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non-coding RNA is LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide. Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides. In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides. The 3’adapter may range from about 15 to about 60, e.g.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 3’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3’end of small non-coding RNA. When attached / ligated to the 3’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non- coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version 22.1. In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem. The double stranded stem may have a length of between 5 and 20, e.g.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides. Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g.5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides. More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g.1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA- guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence. Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced. In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g.10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g.12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one another embodiment, the 3’-terminal sequence is configured such that it forms a single stranded 3’protrusion after formation of the stem-loop structure. In one preferred embodiment, the 6 to 15, e.g.6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non- coding RNA encompass G and C but not more than 4, e.g.1, 2, 3, or 4, in a row. In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3’inverted deoxynucleotide creates a 3’- 3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3’end of the adapter, e.g. during RT-PCR. In addition, the 3’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. In one more preferred embodiment, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non- coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) base- pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated. In a tenth aspect, the present invention relates to a combination of the 5’adapter of the eights aspect and the 3’adapter of the ninth aspect. In an eleventh aspect, the present invention relates to a kit comprising the 5’adpater of the eighth aspect, the 3’adapter of the ninth aspect, and / or the combination of the tenth aspect. The 5’adpater of the eighth aspect, the 3’adapter of the ninth aspect, and / or the combination of the tenth aspect can be used for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample). The 5’adpater of the eighth aspect, the 3’adapter of the ninth aspect, and / or the combination of the tenth aspect can also be used in a method for detecting methylated small non-coding RNA (in a sample) or in a method for quantifying a methylation status of small non-coding RNA (in a sample). The small non-coding RNA referred to in the eighth or ninth aspect of the present invention has preferably a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. As to preferred embodiments of the sample, it is referred to the first to third aspect of the present invention. Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention. BRIEF DESCRIPTION OF THE FIGURES The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way. Figure 1: Schematic hybrid structure of 5’adapter, 3’adapter and the 28S rRNA fragment. The 28S rRNA fragment sequence is underlined, wherein the nucleotide in bold represents a methylated Cytosine (Cm4032) present in the methylated positive control. “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated and “ / 3InvdT / ” stands for 3’inverted deoxynucleotide. Sequences: 28S rRNA fragment with methylated Cytosine (Cm4032) (SEQ ID NO: 9), 5’adapter (SEQ ID NO: 10), and 3’adapter (SEQ ID NO: 12) Figure 2: Dilution curve of a synthetic 28S fragment where calculated copy numbers are plotted against measured dPCR copies. Figure 3: Dilution curve of a PAXgene RNA sample where RNA input is plotted against dPCR copies. Figure 4: dNTP gradient for the un-methylated negative control and a methylated positive control as measured on the dPCR. Figure 5: dNTP gradient for un-methylated negative control and methylated positive control. Ratios were calculated using appropriate value divided by 250µM value. Figure 6: Linearity of 2-o-m detection. Decreasing percentage of un-methylated negative control results in lower ratio values at 25µM dNTPs. Ratios were calculated by dividing 25µM value by 250µM value. Figure 7: Assay results for 12 clinical samples indicated by ratios of 25µM / 250µM. Figure 8: Schematic hybrid structure of 5’adapter, 3’adapter and the 28S miLung#1 fragment. The 28S rRNA fragment sequence is underlined, wherein the nucleotides in bold represent the possible methylation sites (mG4020 and mC4032) present in the miLung#1 fragment. A spacer in the 5’adapter is indicated with a grey dot. “ / 5Phos / ” indicates that the 5’- terminal nucleotide is phosphorylated and “ / 3InvdT / ” stands for 3’inverted deoxynucleotide. Figure 9: Schematic design of the DB structure of miLung#1 and RT primers 1 (SEQ ID NO: 3), 2 (SEQ ID NO: 18), and 3 (SEQ ID NO: 19). Figure 10: dNTP gradients of the mGmC miLung#1 synthetic with all three RT primers. This assay was performed with a 5’ adapter containing a spacer (see Figure 8) and Maxima H Minus RT. Figure 11: Detection of 2-o-m using different 5’adapters. Synthetic mGC of miLung#1 was added to a background of unmethylated (GC) fragment. This assay was performed with RT2 primer and Maxima H Minus RT. Ratios were calculated using 25 / 250 µM. Figure 12: Detection of 2-o-m using different RT enzymes. Synthetic mGC of miLung#1 was added to a background of unmethylated (GC) fragment. This assay was performed with RT2 primer and +spacer 5’ adapter. Figure 13: Detection of 2-o-m with the RT enzyme Luna RT using different RT adapters. Synthetic mGC of miLung#1 was added to a background of unmethylated (GC) fragment. Figure 14: Detection of miLung#1 NTC with different dNTPs concentrations with Luna RT using different 5’adapters using only water as input for RNA ligation. Figure 15: Gm4020 detection with the 2-o-m 5’ adapter and Luna RT at different dNTP molarities. Synthetic mGC of miLung#1 was added to a background of unmethylated (GC) fragment. Ratios were calculated using 10mM. Figure 16: Dilution curve of Gm in miLung#1. dNTP ratios are plotted against % of Gm. Linearity of the detection was calculated at 0.973. Figure 17: Methylation percentage in HCC-827 wildtype and SNORD102 knockout cell lines. Methylation percentages were calculated using the linear regression (Figure 16). Figure 18: Assay results for 16 clinical samples. Methylation percentages were calculated using the linear regression (Figure 16). Figure 19: Expression of miLung#1 in copies / µl for three PAXgene RNA samples using two different protocols (original and improved). EXAMPLES The examples given below are for illustrative purposes only and do not limit the invention described above in any way. EXAMPLE 1 A) Protocol Details The following process steps were carried out by the present inventors: 1. Adapter preparation Adapter (100µM) 5 µl 10xTNE annealing buffer 10 µl Nuclease-free water 85 µl Total 100 µl - Heat the mixture to 82°C for 2 min - Ramp-down rate of 0.1°C / sec to 4°C - Store at -20°C 2. RNA denaturation - Denature RNA for 2 min at 70°C - Immediately place on ice 3. PNK treatment of the RNA Volume (µl) 96 RNA 7 - T4 PNK Buffer (10X) 1 110.4 ATP (10mM) 1 110.4 T4 PNK (10 units) 0.2 22.1 Nuclease-free water 0.8 88.3 Total 10 µl 3 µL / well - Incubate 20 min at 37°C - Denature at 65°C for 10 min 4. Ligation of the adapters to RNA Volume (µl) 96 Denatured RNA 10 - 5' Adapter (5µM) 1 110.4 3' Adapter (5µM) 1 110.4 PEG8000 (50%) 2 220.8 10x RNA ligation buffer 2 220.8 T4 Rnl2 (10U / µl) 1 110.4 ATP 10mM 2 220.8 Nuclease-free water 1 110.4 Total 20 µl 10 µL / well - Incubate 1 hour at 37°C with the lid heated to 45°C - Store at -20°C Reverse transcription - Prepare the RT reaction at two different dNTP molarities (250µM and 25µM): 96 96 Volume (µl) 250µM 25µM Ligated RNA 6 - - dNTPs 0.5 55.2 55.2 RT Primer 1 110.4 110.4 (5µM) 1.5 1.5 Total 7.5 µl µL / well µL / well - Incubate 5 min at 65°C and cool immediately on ice - Add following to the previous mixture Volume (µl) 192 5x Maxima RT Buffer 2 441.6 RI 0.25 55.2 Maxima H- RT (200U / µl) 0.25 55.2 Total 10 µl 2.5 µl / well - Incubate at 55°C for 30 min, followed by 3 min incubation at 85°C and store at 4°C - Store at -20°C QIAcuity dPCR - Dilute cDNA accordingly - Prepare the following mixture for each per well Volume (µl) 96 4x Probe PCR Mastermix 3 345.6 TaqMan probe (4 µM in premix) Forward primer (8 µM in 1.2 138.24 premix) Reverse primer (8 µM in premix) Nuclease-free water 6.6 760.32 Total 10.8 Template (diluted) 1.2 - Transfer 12µl to the 96-well-plate dPCR plate B) Results For this example, the linearity of the DB-PCR method was first tested on negative control RNA using digital PCR. An instance of the 28S fragment DB structure is shown in Figure 1. Dry synthetic RNA was reconstituted to known molarity and a dilution curve with estimated copy numbers was prepared. RT reaction was prepared with standard concentration of dNTPs (1 mM) and PCR performed on digital PCR platform. Determined dPCR copies were then plotted against calculated copies input and a linearity detection threshold (ca 50 copies) was estimated (Figure 2). Linearity of the detection was calculated at 0.996. Next, a similar experiment was performed using PAXgene RNA samples with previously established high concentration of the rRNA fragment, as estimated by NGS measurement. This showed similar threshold of linearity for the digital PCR measurements (at ca 50 copies) as was shown for the synthetic RNA (Figure 3). Next, a RT under limiting conditions was prepared using a gradient of dNTPs (1mM-5µM). Both synthetic fragments were used, that is un-methylated negative control and methylated positive control as RNA templates. It was observed that the detection of negative control RNA was unhindered under conditions down to 50 µM of dNTPs, while a steady decrease was observed for the methylated RNA (Figure 4). The low starting values at 1mM are likely saturating effects of the RT reaction. Thus, the presence of 2’-o-m hinders the processivity of the RT in the reaction as expected. In order to overcome the different copy numbers for the highest dNTP concentration samples in the analysis, ratios of each dNTPs dilutions to 250 µM were calculated, where the pattern of decrease is exacerbated (Figure 5). This representation is then used in next experiments, as it diminishes the effect of different expression levels. Next, the linearity of the 2-o-m detection was tested. For this purpose, positive, methylated RNA was mixed into negative RNA in amounts with 20% increments. 25 µM dNTPs concentration was used in addition to the previous dilutions for the evaluation for the 2-o-m sites presence. A steady decrease of the ratios was observed, establishing linearity of the method for the detection of 2-o-m on small RNAs (Figure 6). Finally, the method was applied to 12 clinical samples and the methylation profiles thereof were inspected (Figure 7). A variability of ratio values (0.269-0.096) was observed, suggesting a stoichiometry of methylation in the order of ca 78-91%, which is corresponding well to published literature on rRNA 2-o-m stoichiometries (Motorin et al, 2021). C) Adapters and primers sequences (5’ -> 3’ orientation) used herein Name Sequence Negative control synthetic / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrArCrUrArC RNA (SEQ ID NO: 8) Positive control synthetic RNA (2’-o-methyl are / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrAmCrUrArC bold) (SEQ ID NO: 9) CACCGGCGGCCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 10) 5’ Adapter alternatively CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 11) can be used 3’ Adapter / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGT AGTGGTA / 3InvdT / (SEQ ID NO: 12) RT primer CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3) Forward primer TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) Reverse primer GTGCGAATACCTCGGACC (SEQ ID NO: 5) Taqman Probe / 6-FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-1 / (SEQ ID NO: 7) EXAMPLE 2 A) Protocol Details 1. Adapter preparation Adapter (100µM) 5 µl 10xTNE annealing buffer 10 µl Nuclease-free water 85 µl Total 100 µl - Heat the mixture to 82°C for 2 min. - Ramp-down rate of 0.1°C / sec to 4°C. - Store at -20°C. 2. RNA denaturation - Denature RNA for 2 min at 70°C. - Immediately place on ice. 3. PNK treatment of the RNA Volume (µl) 96 RNA 6.25 - T4 PNK Buffer (10X) 0.8 88.3 ATP (10mM) 0.8 88.3 T4 PNK (10 units) 0.16 17.7 Total 8 µl 1.76 µL / well - Incubate 20 min @37°C. - Denature at 65°C for 10 min. 4. Ligation of the adapters to RNA Volume (µl) 96 Denatured RNA 8 - 5' Adapter (5µM) 0.7 77.28 3' Adapter (5µM) 0.7 77.28 PEG8000 (50%) 1.4 154.56 10x RNA ligation buffer 1.4 154.56 T4 Rnl2 (10U / µl) 0.7 77.28 ATP 10mM 1.1 121.44 Total 14 µl 6 µL / well - Incubate 1 hour at 37°C with the lid heated to 45°C. - Store at -20°C everse transcription - Prepare the RT reaction at two different dNTP molarities (250µM and 25µM): 96 96 Volume (µl) 10mM 1mM Ligated RNA 6 - - dNTPs 0.5 55.2 55.2 RT Primer 1 110.4 110.4 (5µM) 1.5 1.5 Total 7.5 µl µL / well µL / well - Incubate 5 min at 65°C and cool immediately on ice. - Add following to the previous mixture. Volume (µl) 192 5X ProtoScript II buffer 2.5 552 H20 0.9 198.72 DTT (0.1M) 1 220.8 RI (40U / µl) 0.1 22.08 LUNA (200U / µl) 0.5 110.4 Total 12.5 µl 5 µl / well - Incubate at 50°C for 1h, followed by 15 min incubation at 70°C and store at 4°C. - Store at -20°C. IAcuity dPCR - Dilute cDNA accordingly. - Prepare the following mixture for each well. Volume (µl) 96 4x Probe PCR Mastermix 3 345.6 TaqMan probe (4 µM in premix) Forward primer (8 µM in 1.2 138.24 premix) Reverse primer (8 µM in premix) Nuclease-free water 6.6 760.32 Total 10.8 Template (diluted) 1.2 - Transfer 12µl to the 96-well-plate dPCR plate. B) Results 1. DB-PCR design and assay linearity For this example, the linearity of the DB-PCR method on unmethylated 28S_11957-78 synthetic RNA fragment (GC) were first tested using digital PCR. An instance of the 28S fragment RNA sequence, further referred as “miLung#1”, and its DB structure is shown in Figure 8. Dry synthetic RNA (unmethylated miLung#1) was reconstituted to known molarity and a dilution curve with estimated copy numbers was created. RT reaction was prepared with standard concentration of dNTPs (1 mM), Maxima H Minus RT enzyme, and PCR was performed on digital PCR platform (dPCR). Determined dPCR copies were then plotted against calculated copies input and a linearity detection threshold (ca 50 copies) was estimated (Figure 2). Linearity of the detection was calculated at 0.996. Next, a similar experiment was performed using PAXgene RNA samples with previously established high concentration of the miLung#1 fragment, as estimated by NGS measurement. This showed similar threshold of linearity for the digital PCR measurements (at ca 50 copies) as was shown for the synthetic RNA (Figure 3). 2. Maxima RT conditions for 2’-o-m detection Next, an RT under limiting conditions using a gradient of dNTPs (1mM-5µM) was prepared. Two synthetic fragments were used: unmethylated miLung#1 (GC) as a negative control and methylated miLung#1 (mGmC) as a positive control. It was observed that the detection of unmethylated miLung#1 was unhindered under conditions down to 50 µM of dNTPs, while a steady decrease was observed for the methylated miLung#1 (Figure 4). The low values at 1mM are likely due to saturating effects of the RT reaction. Thus, as expected, the presence of 2’-o- m hinders the processivity of the RT when dNTPs are limited. In order to overcome the different copy numbers for the highest dNTP concentration samples in the analysis, ratios of each dNTP dilution using the 250 µM value were calculated (Figure 5). This calculation is then used in next experiments, as it allows the easy comparison of different expression levels. Next, the linearity of the 2-o-m detection was tested. For this purpose, we mixed methylated (mGmC) into unmethylated (GC) RNA with 20% increments.25 µM dNTPs concentration was used in addition to the previous established plateau concentration (250µM) for the evaluation of the methylated sites. A steady decrease of the ratios was observed, establishing linearity of the method for the detection of 2-o-m on small RNAs (Figure 6). C) Adapters and primers sequences (5’ -> 3’ orientation) used herein Name Sequence Unmethylated synthetic / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrArCrUrArC miLung#1 (GC) (SEQ ID NO: 8) Methylated synthetic / 5Phos / rGrCrCrGrCrCmGrGrUrGrArArArUrArCrCrAmCrUrArC miLung#1 (mGmC) (SEQ ID NO: 15) 5’ Adapter-spacer CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCAr CrG (SEQ ID NO: 11) 3’ Adapter / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTA GTGGTA / 3InvdT / (SEQ ID NO: 12) RT primer 1 CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3) dPCR Forward primer TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) dPCR Reverse primer GTGCGAATACCTCGGACC (SEQ ID NO: 5) / 6-FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-1 / dPCR Probe (SEQ ID NO: 7) EXAMPLE 3 Once the assay was defined, all the crucial steps and possible modifications were examined that could be considered to create the most accurate mer-idPCR protocol. Those steps are explained below, and they encompass the selection of a reliable RT primer, 5’ adapter, RT enzyme, and dNTP concentration. A) Protocol Details and Results 1. Methylation study of Gm4020 Exemplarity, the methylation / methylation status of the 28S rRNA fragment (in the following designated as 28S miLung#1 fragment) is detected / quantified herein. Figure 8 shows a schematic hybrid structure of 5’adapter, 3’adapter and the 28S miLung#1 fragment. The 28S rRNA fragment sequence is underlined, wherein the nucleotides in bold represent the possible methylation sites (mG4020 and mC4032) present in the miLung#1 fragment. An optional spacer in the 5’adapter is indicated with a black dot. “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated and “ / 3InvdT / ” stands for 3’inverted deoxynucleotide. In the context of full-length ribosomal RNA, the site mG4020 was shown to be more variable in comparison to the site mC4032. Considering that, three different RT primers were designed, from now on referred to as RT1 (SEQ ID NO: 3), RT2 (SEQ ID NO: 18), and RT3 (SEQ ID NO: 19). The first one allows the distinction and specific study of methylation profiles in mC4032. The latter two extend over the mC4032 and allow the distinction and specific study of methylation profiles in mG4020 (Figure 9). All three RT primers were tested to establish the one that better differentiates between dNTPs gradients in the suspected most common form of the miLung#1 fragment: mGmC (mG4020 and mC4032) (Figure 10). All three RT primers displayed very similar results. Because of the steeper curve and higher R2value of RT2 over RT3, this RT primer was used for the final assay (see section 7). The RT1 primer was included as a control and shows a drop of copies under 50µM, presumably caused by the combined effect of both methylation sites. 2.5’ Adapter selection for optimized 2-o-m detection Next, 4 different 5’adapters with different chemical modifications were compared: without (base-lacking) spacer (SEQ ID NO: 10), with (base-lacking) spacer (SEQ ID NO: 11), with LNA (SEQ ID NO: 16), and with 2-o-m (SEQ ID NO: 17) (see section B below). The LNA and 2’-o-m adapters also contain a (base-lacking) spacer. Although all 4 adapters worked, the 2’-o- m adapter was the most consistent and mG-sensitive adapter of all 4 adapters (Figure 11). The adapters -spacer and +spacer showed moderate variability between RT duplicates although the latter did exhibit a good sensitivity for the methylated G (R2=0.881). On the other hand, the LNA adapter showed very low variability between duplicates. However, it had less sensitivity for the methylated G. 3. RT enzyme selection for optimized 2’-o-m detection Because reverse transcriptases can have various processing activities, a head-to-head comparison of three reverse transcriptases were performed: Maxima H Minus RT, Protoscript II RT, and Luna RT. First of all, all three reverse transcriptases worked. However, the results showed that Luna RT exhibits less variability between RT duplicates and, therefore, offers more reliable results (Figure 12). However, instead of a uniform number of copies expected between different percentages of methylation in high dNTPs concentrations (250µM), a steady decrease of copies was observed as the G methylation increases. So much so, that the 250µM dNTPs concentration curve would be ideal for the limiting condition in the Luna RT assay. For that reason, one of the consequent steps was to find appropriate dNTP Plateau as well as limiting concentrations for the Luna RT enzyme. Next, the two most promising adapters (+ spacer (SEQ ID NO: 11) and 2’-o-m (SEQ ID NO: 17)) were tested with Luna RT. It was observed that both adapters had a constant decrease of copies as the G methylation percentage increases (Figure 13). Moreover, a lot more copies were detected with the +spacer adapter. A closer investigation of the background noise (using only water as input sample for RNA ligation) of these assays made us realize that the difference in copy number might have been caused by this (Figure 14). While the +spacer adapter displayed a decreasing curve in NTC (no template control), all the 2’-o-m samples have a lower and stable number of copies making the 2-o-m adapter a more suitable option for the final assay (see section 7) (Figure 14). 4. Luna RT conditions for 2-o-m detection In order to find the ideal dNTP concentrations for the detection of the mG4020 in the miLung#1 fragment using the 2’-o-m adapter and Luna RT, a dNTP dilution series was performed. The goal was to find a plateau concentration equal for all percentages of mG. The dNTP gradient was from 10mM to 250µM (Figure 15). A good linearity was observed with 1mM and 500µM dNTPs concentrations when the plateau was set at 10mM. The fact that 1mM had bigger separation steps between 60% and 100% Gm, which was to be expected according to the literature, a 1mM dNTPs concentration was chosen as the limiting condition for the final assay. 5. Methylation Serial regression Next, a combined 10%-step serial dilution of synthetics mGmC and GmC was prepared to test the linearity of the assay using the latest method (2-o-m 5’adapter, RT2 primer, and Luna RT) on dPCR. RT reaction was prepared with plateau concentration of dNTPs (10 mM) and limiting concentration (1mM), and dNTP ratios were determined accordingly (1mM / 10mM). A steady increase of the ratios (R2=0.973) was observed, establishing linearity of the method to determine 2'-O-methylation (Figure 16). This linear regression is then used in next experiments, as it also allows the easy calculation of methylation levels in biological samples. 6. Assay validation in biological samples 6.1. Cell lines SNORD102 is a small nucleolar RNA which directs the site-specific 2'-O-methylation of 28S rRNA residue G4020 (D’Souza et al., 2018). With the aim to test the method in biological samples, CRISPR / Cas9 was used to generate SNORD102 single-cell-colony knockouts from HCC-827 cells (DSMZ-German Collection of Microorganism and Cell Culture GmbH, no.: ACC 566). For two single-cell colonies, sanger data showed crucial deletions of the SNORD102 guide sequence (Table 1), and therefore methylation rates in the rRNA residue G4020 are expected to decrease. HCC-827 InDel Percentage SNORD102 sequence cell line (nt) 1 Wildtype 0 100% GAAGCAATGTGAAAAACACATTT^CACCGGCTCTGAA SNORD102- 2 -25 100% GAAGC------------------^-----GCTCTGAA KO1 SNORD102- 3 -7 100% GAAGCAATGTGAAAAACAC----^---CGGCTCTGAA KO2 Table 1: Wildtype and SNORD102-knockout HCC-827 cell lines included for validating our method. Insertion and deletion (InDel) rates are shown for each knockout cell line and their specific location within the SNORD102 gene. SNORD102 guide sequence is underlined. Subsequently, the method was tested on the SNORD102 knockouts and wildtype HCC-827 cell lines. A significant reduction in the methylation percentage of miLung#1 was observed for both SNORD102 knockout cell lines when comparing to wildtype HCC-827 (p < 0.001; Figure 17), demonstrating the sensitivity of the method also in biological samples. 6.2. Patient samples Finally, the method was applied to 16 random clinical PAXgene RNA samples and their methylation profiles were inspected (Figure 18). A high variability of ratios among patients (0.259-0.478) was observed, suggesting a stoichiometry of methylation in the order of ca 75- 93%, which is corresponding well to published literature on rRNA 2’-o-m stoichiometries. 7. Final protocol Some of the steps of the original protocol were modified and adapted for Luna RT as well as for a more efficient run of this procedure. As seen in Figure 19, very similar results were obtained between the original and the improved protocol. 7.1 PNK treatment and ligation of the adapters to RNA PNK and ligation steps of the protocol were adapted for a more efficient use of the extracted RNA. All the changes performed between the original and improved protocol are indicated in italic. PNK treatment of the RNA Original Improved RNA (up to 300 pmol of 5´ termini) 7 6.25 T4 PNK Reaction Buffer (10X) 1 0.8 ATP (10 mM) 1 0.8 T4 PNK (10 units) 0.2 0.16 Nuclease-free Water 0.8 0 Total 10µl 8µl Incubate 20 min @37°C Denature at 65°C for 10 min Ligation of the adapters to RNA Original Improved Denatured RNA 10 8.01 5’ Adapter-2-o-m (+ spacer) (5µM) (SEQ ID NO: 17) 1 0.7 3' Adapter (5µM) (SEQ ID NO: 12) 1 0.7 PEG8000 (50%) 2 1.4 10x RNA ligation buffer 2 1.4 T4 Rnl2 (10U / µl) 1 0.7 ATP 10mM 2 0 Water 1 1.1 Total 20µl 14µl Incubate 1 hour at 37°C with the lid heated to 45°C store in -20C 7.2. Reverse transcription The protocol was adapted for Luna RT. All the changes performed between the Maxima H Minus RT and Luna RT protocol are indicated in italic. Maxima RT Lunita RT Ligated RNA 6 6 dNTPs [25µM / 250µM or 1000µM / 10000µM] 0.5 0.5 RT Primer 2 (5µM) (SEQ ID NO: 18) 1 1 Total 7.5µl 7.5µl Incubate 5 min at 65°C and cool immediately on ice Add following to the previous mixture Maxima RT Lunita RT 5X ProtoScript II buffer 2.5 H20 0.9 DTT (0.1M) 1 RI (40 U / µl) 0.25 0.1 LUNA (200U / µl) 0.5 5x Maxima RT Buffer 2 Maxima H- RT (200U / µl) 0.25 Total 10µl 12.5µl Maxima RT: Incubate at 55°C for 30 min, followed by 3 min incubation at 85°C and store at 4°C Luna RT: Incubate at 50°C for 1h, followed by 15 min incubation at 70°C and store at 4°C Store at -20°C B) Adapters and primers sequences (5’ -> 3’ orientation) used herein: Name Sequence Unmethylated synthetic / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrArCrUrArC miLung#1 (GC) (SEQ ID NO: 8) / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrAmCrUrArC Synthetic miLung#1 (GmC) (SEQ ID NO: 9) Synthetic miLung#1 (mGC) / 5Phos / rGrCrCrGrCrCmGrGrUrGrArArArUrArCrCrArCrUrArC (SEQ ID NO: 14) Methylated synthetic / 5Phos / rGrCrCrGrCrCmGrGrUrGrArArArUrArCrCrAmCrUrArC miLung#1 (mGmC) (SEQ ID NO: 15) CACCGGCGGCCGTGGCGTGGAGTGTGTGCTTTGCCArCrG 5’ Adapter-without spacer (SEQ ID NO: 10) 5’ Adapter-spacer CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCAr CrG (SEQ ID NO: 11) 5’ Adapter-LNA (+ spacer) CAC+CGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 16) 5’ Adapter-2-o-m (+ spacer) CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 17) 3’ Adapter / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTA GTGGTA / 3InvdT / (SEQ ID NO: 12) RT primer 1 CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3) RT primer 2 CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 18) RT primer 3 ACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 19) dPCR Forward primer TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) dPCR Reverse primer GTGCGAATACCTCGGACC (SEQ ID NO: 5) / 6-FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-1 / dPCR Probe (SEQ ID NO: 7)
Claims
CLAIMS 1. Use of a combination of (i) a 5’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and (ii) a 3’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem for the detection of methylated small non-coding RNA, and / or for the quantification of a methylation status of small non-coding RNA (in a sample).
2. The use of claim 1, wherein the small non-coding RNA has a length of < 200 ribonucleotides, preferably a length of between 10 and < 200 ribonucleotides, more preferably a length of between 10 and 100 ribonucleotides, and even more preferably a length of between 10 and 50 ribonucleotides.
3. The use of claim 2, wherein the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.
4. The use of any one of claims 1 to 3, wherein the 5’adapter comprises in the following order from 5’ to 3’: (i) a 5’terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5’-terminal sequence of small non-coding RNA, and (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides at its 3’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.
5. The use of claim 4, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other.
6. The use of claim 5, wherein each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10 nucleotides.
7. The use of claim 6, wherein the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length.
8. The use of any one of claims 5 to 7, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced.
9. The use of claim 8, wherein the LNA enhanced sequence comprises between 1 to 5, preferably 3, locked nucleotides.
10. The use of any one of claims 5 to 9, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence.
11. The use of claim 10, wherein the loop sequence comprises between 12 and 20 nucleotides.
12. The use of claim 11, wherein the nucleotides are deoxynucleotides.
13. The use of any one of claims 4 to 12, wherein the 5’-terminal sequence is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure.
14. The use of any one of claims 4 to 13, wherein the 6 to 15 deoxynucleotides which are reverse complementary to the 5’-terminal sequence of small non-coding RNA encompass G and C but not more than 4 in a row.
15. The use of any one of claims 1 to 14, wherein the 5’adapter has the following sequence from 5’ to 3’: (6-15x)NCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced.
16. The use of any one of claims 1 to 15, wherein the 3’adapter comprises in the following order from 5’ to 3’: (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3’-terminalsequence of small non-coding RNA and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.
17. The use of claim 16, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other.
18. The use of claim 17, wherein each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10 nucleotides.
19. The use of claim 18, wherein the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length.
20. The use of any one of claims 16 to 19, wherein the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced.
21. The use of claim 20, wherein the LNA enhanced sequence comprises between 1 to 5, preferably 3, locked nucleotides.
22. The use of any one of claims 17 to 21, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence.
23. The use of claim 22, wherein the loop sequence comprises between 12 and 20 deoxynucleotides.
24. The use of any one of claims 16 to 23, wherein the 3’-terminal sequence is configured such that it forms a single stranded 3’protrusion after formation of the stem-loop structure.
25. The use of any one of claims 16 to 24, wherein the 6 to 15 deoxynucleotides which are reverse complementary to the 3’-terminal sequence of small non-coding RNA encompass G and C but not more than 4 in a row.
26. The use of any one of claims 16 to 25, wherein the inverted deoxynucleotide is inverted dT, dA, dC, or dG.
27. The use of any one of claims 1 to 26, wherein the 3’adapter has the following sequence from 5’ to 3’: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6-15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein (6-15x)N designates the sequence reverse complementary to a 3’terminal sequence of small non-coding RNA, and wherein “ / 3InvdT / ” stands for 3’inverted deoxynucleotide.
28. A method of detecting methylated small non-coding RNA (in a sample) comprising the steps of: (i) providing a ligation product comprising small non-coding RNA to which the 5’adapter as defined in any one of claims 1 to 27 and the 3’adapter as defined in any one of claim 1 to 27 are ligated, (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product, (iii) amplifying the first cDNA product and the second cDNA product, and (iv) determining a difference between the first cDNA product and the second cDNA product, wherein the difference between the first cDNA product and the second cDNA product indicates the presence of methylated small non-coding RNA (in the sample).
29. The method of claim 28, wherein the ligation product is produced by (i) providing a composition comprising denatured small non-coding RNA, the renatured 5’adapter as defined in any one of claims 1 to 27, and the renatured 3’adapter as defined in any one of claims 1 to 27, wherein the 5’adapter and the 3’adapter are annealed to the small non-coding RNA, and (ii) ligating the 5’adapter and the 3’adapter to the small non-coding RNA using / with a double stranded RNA ligase.
30. The method of claim 29, wherein the denatured small non-coding RNA is produced by heating the small non-coding RNA at between 65°C and 75°C, preferably at 70°C, for between 1 to 3 minutes, preferably for 2 minutes.
31. The method of claim 30, wherein the small non-coding RNA is treated after the denaturation with a polynucleotide kinase (to restore or introduce the 5’ phosphate).
32. The method of any one of claims 29 to 31, wherein the renatured 5’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, preferably at 82°C, for between 1 to 3 minutes, preferably for 2 minutes, andrenaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.
33. The method of any one of claims 29 to 32, wherein the renatured 3’adapter is produced by denaturing the 3’adapter at between 75°C and 85°C, preferably at 82°C, for between 1 to 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.
34. The method of any one of claims 29 to 33, wherein the renatured 5’ and 3’adapters are produced separately and in the absence of the small non-coding RNA.
35. The method of any one of claims 29 to 34, wherein the denaturing and renaturing is carried out in TNE annealing buffer.
36. The method of any one of claims 29 to 35, wherein the composition is produced by mixing the denatured small non-coding RNA, the renatured 5’adapter as defined in any one of claims 1 to 27, and the renatured 3’adapter as defined in any one of claims 1 to 27 with each other, thereby annealing the 5’adapter and the 3’adapter to the small non- coding RNA.
37. The method of any one of claims 29 to 36, wherein the ligation is carried out in a ligation buffer comprising polyethylene glycol (PEG).
38. The method of any one of claims 29 to 37, wherein the ligation is carried out between 36°C and 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, preferably for 1 hour.
39. The method of any one of claims 29 to 38, wherein the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase.
40. The method of any one of claims 28 to 39, wherein the reverse transcription of the ligation product is carried out by (iia) annealing a primer for reverse transcription (RT-primer) with the ligation product, and (iib) reverse transcribing the ligation product by using a reverse transcriptase (RT).
41. The method of claim 40, wherein said annealing is carried out at between 60°C and 80°C, preferably at 65°C or at 75°C, for between 2 and 7 minutes, preferably for 3 or 5 minutes.
42. The method of any one of claims 28 to 41, wherein said reverse transcribing is carried out at between 40°C and 65°C, preferably at 50°C, 55°C, 58°C, or 62°C, for between 10 and 40 minutes, preferably 15 or 30 minutes, and subsequently at between 75°C and 90°C, preferably at 85°C, for between 2 and 4 minutes, preferably 3 minutes.
43. The method of any one of claims 40 to 42, wherein the reverse transcriptase (RT) is Maxima H-RT, Tth polymerase, Protoscript II RT, or Luna RT.
44. The method of any one of claims 40 to 43, wherein the RT-primer is reverse complementary to the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem of the 3’adapter.
45. The method of any one of claims 40 to 44, wherein the RT-primer has the following sequence from 5’ to 3’: CTCAGTGCGAATACCTCGGACCCT (SEQ ID NO: 3), CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 18), or ACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 19).
46. The method of any one of claims 28 to 45, wherein said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less of the dNTP concentration under non-limiting conditions, preferably which is between 1 / 10 and 1 / 50 of the dNTP concentration under non-limiting conditions.
47. The method of claim 46, wherein said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with 25 µM dNTPs.
48. The method of any one of claims 28 to 47, wherein said reverse transcribing of the ligation product under non-limiting conditions means performing the reverse transcription with 250 µM dNTPs.
49. The method of any one of claims 28 to 48, wherein the amplification is carried out using a polymerase chain reaction (PCR).
50. The method of claim 49, wherein the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.
51. The method of claim 50, wherein the digital PCR or the TaqMan qPCR is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) and a Reverse primer having the following sequence from 5’ to 3’: GTGCGAATACCTCGGACC (SEQ ID NO: 5).
52. The method of claims 50 or 51, wherein the Taq-man qPCR is carried out in the presence of a TaqMan probe.
53. The method of any one of claims 28 to 52, wherein the difference between the first cDNA product and the second cDNA product is determined by comparing the first cDNA product with the second cDNA product.
54. The method of claim 53, wherein the difference between the first cDNA product and the second cDNA product is determined by determining the level, preferably the number of copies, of the first cDNA product and the level, preferably the number of copies, of the second cDNA product, and comparing the level, preferably the number of copies, of the first cDNA product with the level, preferably the number of copies, of the second cDNA product, wherein a lower level, preferably a lower number of copies, of the first cDNA product compared to the level, preferably the number of copies, of the second cDNA product indicates the methylation of the small non-coding RNA (in the sample).
55. The method of any one of claims 28 to 54, wherein the small non-coding RNA has a length of < 200 ribonucleotides, preferably has a length of between 10 and < 200 ribonucleotides, more preferably has a length of between 10 and 100 ribonucleotides, and even more preferably has a length of between 10 and 50 ribonucleotides.
56. The method of claim 55, wherein the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.
57. A method of quantifying a methylation status of small non-coding RNA (in a sample) comprising the steps of: (i) carrying out the method of claims 28 to 56, and (ii) determining a ratio between the first cDNA product and the second cDNA product.
58. The method of claim 57, wherein the ratio between the first cDNA product and the second cDNA product is determined bydetermining the level, preferably the number of copies, of the first cDNA product and the level, preferably the number of copies, of the second cDNA product, and determining a ratio between the level, preferably the number of copies, of the first cDNA product and the level, preferably the number of copies, of the second cDNA product, wherein a ratio of lower than 0.5 indicates a high degree of small non-coding RNA methylation, and wherein a ratio of higher or equal to 0.5 indicates a low degree of small non-coding RNA methylation (in the sample).
59. The use of any one of claims 1 to 27 and / or the method of any one of claims 28 to 58, wherein the sample is a biological sample.
60. The use or method of claim 59, wherein the biological sample is a blood sample.
61. The use or method of claim 60, wherein the blood sample is whole blood or a blood fraction, preferably blood cells, serum, or plasma.
62. The use of any one of claims 1 to 27 and / or the method of any one of claims 28 to 58, wherein the sample contains total RNA.
63. The use or method of claim 62, wherein the sample contains cellular total RNA.