Compounds for preventing or treating viral infections

JP2023528196A5Active Publication Date: 2026-02-03INST NAT DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM) +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022568654
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-05-11
Filing Date
2021-05-11
Publication Date
2026-02-03
Estimated Expiration
2041-05-11

AI Technical Summary

Technical Problem

Current antiviral treatments for viral infections, particularly those caused by retroviruses like HIV, are inadequate in completely curing the infection and are becoming resistant, and long-term use of existing agents like Q-VD-OPh can lead to toxicity and adverse events.

Method used

Development of a compound, Q-VE-OPh, which inhibits viral replication independently of caspase inhibition, offering a broad-spectrum antiviral effect without caspase-inhibitory activity, thus reducing toxicity and enhancing safety for long-term therapy.

Benefits of technology

Q-VE-OPh effectively inhibits viral replication of HIV and SARS-CoV-2 without affecting caspase activity, demonstrating antiviral efficacy in vitro and potentially reducing the risk of long-term toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2021228846000001
    Figure 2021228846000001
  • Figure 2021228846000002
    Figure 2021228846000002
  • Figure 2021228846000003
    Figure 2021228846000003
Patent Text Reader

Abstract

The present invention relates to the use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the prevention and / or treatment of viral infections. The present invention also relates to an antiviral composition comprising or consisting of at least a compound of formula (I) or one of its pharmaceutically acceptable salts and at least one other antiviral agent; and to a product comprising or consisting of at least a compound of formula (I) or one of its pharmaceutically acceptable salts and at least one antiviral agent as a combined preparation for simultaneous, separate or sequential use in antiviral therapy or for simultaneous, separate or sequential use for the prevention and / or treatment of viral infections.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the treatment of viral infections, and more particularly to a medicament for the prevention and / or treatment of viral infections, especially riboviral infections, particularly retroviruses and / or coronavirus infections.

Background Art

[0002] Viral replication is a process in which a virus (DNA or RNA) hijacks the machinery of an infected cell and uses it to proliferate. For example, the main steps in the replication of retroviruses, particularly the HIV virus, are as follows.

[0003] (1) Immobilization of the virus on the cell surface of an animal or human body by recognition between the viral surface protein and a receptor on the cell surface (e.g., CD4 receptor), (2) Entry of the virus into the cytoplasm by fusion of the viral envelope and the cell membrane, (3) Uncoating of the virus (the virus separates from the matrix and capsid, and two copies of the viral genome are released), (4) Reverse transcription of viral RNA into proviral DNA by reverse transcriptase (a viral enzyme), (5) Nuclear translocation of proviral DNA and integration into the host cell DNA by the action of integrase (a viral enzyme), (6) Transcription of the cell's DNA into genomic RNA (unspliced messenger RNA (mRNA)) by the action of the cell's RNA polymerase, (7) Splicing of mRNA by removing introns, leaving only exons (encoding the Gag, Pol, and Env proteins), (8) Translation of mRNA into polypeptide form in the rough endoplasmic reticulum, (9) Maturation of the polypeptide in the Golgi apparatus to obtain a functional polypeptide, (10) Aggregation of viral particles on the membrane surface due to the accumulation of multimerized structural polyproteins (Gag, p55), non-structural viral proteins (reverse transcriptase, integrase, protease), and viral RNA. (11) Release of the virus by budding on the surface of infected cells, and finally, (12) Virus maturation.

[0004] Coronaviruses utilize a similar mechanism, with the exception of the reverse transcription, migration, and transcription steps, where they are immobilized on the cell surface through recognition between surface proteins in animal and human organisms and receptors on the cell surface (in this case, particularly ACE2 and / or TMPRSS2).

[0005] Viruses have devised various strategies to evade the immune system and facilitate transmission during infection. The HIV virus, in particular, has the unique characteristic of attacking auxiliary T lymphocytes (CD4+ T lymphocytes), which are important immune system cells that express the CD4 molecule, the specific receptor for HIV, on their surface, causing complete destruction of the immune system. Monocytes, macrophages, dendritic cells, Langerhans cells, and brain microglia are also targets of HIV. The gradual disappearance of these lymphocytes leads to a loss of control over viral replication by the immune system, destruction of lymphatic organs where immune responses occur, and the development of severe opportunistic infections, ultimately resulting in acquired immunodeficiency syndrome (AIDS). The mechanism by which CD4+ T lymphocytes disappear during HIV infection is complex and only partially understood.

[0006] HIV virus particles consist of a nucleocapsid, which is a positively polarized single-stranded RNA dimer, a nucleocapsid protein, lysine-tRNA, and viral enzymes (reverse transcriptase, protease, integrase). The nucleocapsid is enclosed in a matrix protein membrane and covered with a lipid membrane borrowed from the host cell during budding. The membrane contains spikes made up of envelope glycoprotein oligomers. A key characteristic of retroviruses is the stage in the viral cycle where RNA is converted to double-stranded DNA under the action of the viral enzyme reverse transcriptase.

[0007] All retroviruses retain the gag, pol, and env viral genes. All products derived from these viral genes are present within the viral particle. These products originate from the cleavage of precursor polyproteins. gag and env encode structural proteins, while pol encodes numerous enzyme proteins.

[0008] The Gag protein is obtained when the polyprotein Pr55gag is cleaved by a viral protease. This cleavage releases the matrix protein, capsid protein, nucleocapsid protein, and a 6kDa protein.

[0009] The envelope precursor gp160 is cleaved into the surface glycoprotein gp120 (gp130 in SIVmac) and the transmembrane protein gp41, derived from the C-terminal region of the precursor. During the maturation process, the precursor gp160 is glycosylated, cleaved by cellular proteases in the Golgi apparatus, and transported to the cytoplasmic membrane. The two glycoproteins derived from the cleavage remain bound by a non-covalent bond. These form a heteromer of the envelope glycoprotein and bind as oligomers to form the spike of the viral particle.

[0010] The gene pool encodes three enzyme proteins: proteases, reverse transcriptases, and integrases. These enzyme proteins originate from the cleavage of the polyprotein Gag-Pol (Pr160 gag-pol) during the morphogenesis process of viral particles. Intracellular dimerization of the polyprotein Gag-Pol reveals the protease activity encoded by the 5' region of pol. The mature protease released by autocatalytic cleavage remains in the dimer p11 / p11 state and is subsequently capable of cleaving other sites present in the polyproteins Pr160 gag-pol and Pr55 gag.

[0011] Reverse transcriptase originates from the two-step cleavage of the polyprotein Pr160gag-pol by the viral protease during the assembly of viral particles.

[0012] Integrases are located at the C-terminus of the Pol region of the polyprotein Gag-Pol and are released as a 32kDa protein by the action of viral proteases. Integrases require oligomerization to be incorporated into viral particles and to exhibit the activity of integrating linear double-stranded viral DNA into the cellular genome.

[0013] All of these studies emphasize that proteases play a major role in the generation of infectious viral particles. Therefore, in addition to retrotransscriptase inhibitors and nucleoside analogs, HIV treatments today, known as highly active antiretroviral therapy (HAART), include one or more HIV protease inhibitors. This therapy inhibits viral replication, increases the number of CD4 T lymphocytes, and results in significant clinical improvement.

[0014] However, given that current treatments cannot completely cure patients with AIDS, and that the HIV virus is developing or becoming resistant to existing therapies, discovering antiviral molecules that can more effectively treat viral infections in general, especially retroviral infections such as HIV, is a major concern.

[0015] Many viral infections are associated with a disruption of the mechanisms that control cell death. Apoptosis (or programmed cell death, or cell suicide) is a process in which cells self-destruct in response to a signal (apoptosis-promoting signal). Apoptosis is a morphologically and biochemically defined form of cell death, characterized in vivo by the absence of an inflammatory response, activation of caspases and cleavage of numerous proteins, DNA fragmentation, chromatin condensation, cell shrinkage, and the formation of vesicles (apoptotic bodies) on the membrane due to the degradation of cellular structures. In vivo, this process is completed when the apoptotic bodies are phagocytosed by other cells.

[0016] The early onset of apoptosis in virus-infected cells is one of the host's defense mechanisms, and by inhibiting viral replication, it can limit the number of viral particles released. Intracellular enzymes produced during apoptosis act on viral DNA, inhibiting the synthesis of viruses, structural and regulatory proteins, and the formation of infectious viral particles, thereby suppressing the spread of viral particles within the host.

[0017] Therefore, many viruses act to regulate apoptotic intracellular signaling in order to survive themselves, keep infected cells alive, or prevent attack by effector cells of the immune system, thereby increasing the efficacy of viral replication and enabling the production of more viral particles.

[0018] Meanwhile, other viruses have also developed strategies to kill infected cells, causing cellular failures in particular, such as immunodeficiency (associated with AIDS), neuronal failure (associated with rabies), and epithelial failure (associated with hemorrhagic fever). In cases of immunodeficiency alone, the virus can then replicate. Some viruses can induce apoptosis in the later stages of infection, allowing them to evade the host's inflammatory and immune responses while transmitting the virus to neighboring cells.

[0019] One of the main components of the apoptosis mechanism is a group of cysteine ​​proteases called caspases (derived from the English terms cysteinyl aspartate-specific proteases or cysteine ​​aspartate proteases). Caspases have been found in many organisms, from nematodes to humans. To date, more than 12 types of caspases have been identified. These intracellular enzymes play important roles in apoptosis, inflammation, activation, and cell differentiation.

[0020] The function of a caspase is determined by its substrate specificity, prodomain length, and prodomain sequence. Caspases are classified into inflammatory caspases (Group I), initiator (or regulatory) caspases (Group II), and effector (or executor) caspases (Group III) (Lavrik et al., 2005). Inflammatory caspases include caspases-1, -4, -5, -11, -12, -13, and -14. These are involved in inflammatory processes and play a central role in the activation of certain cytokines. Initiator caspases include caspases-2, -8, -9, and -10. These are located upstream of the apoptotic signaling pathway and are activated by an autoproteolytic mechanism in response to pro-apoptotic signals. They then cleave and activate effector caspases downstream of the signaling cascade, amplifying the apoptotic signal. Effector caspases include caspases-3, -6, and -7. When activated by initiator caspases, they cleave many cellular proteins, leading to cell breakdown and inactivation of other proteins. The proteins inactivated by the action of these caspases (approximately 2000-3000 substrates) include proteins that protect cells from apoptosis (anti-apoptotic proteins), such as the Bcl-2 family.

[0021] Peptides have been developed that effectively compete for caspase binding to its substrates by utilizing the preferences and substrate specificity of individual caspases. These caspase inhibitors can penetrate cells and irreversibly bind to the active site of caspases (however, inhibitors containing an aldehyde group bind reversibly). Therefore, they act as proteolytic decoys by inhibiting the proteolytic cleavage of caspases, which is necessary for caspase activation and the production of active caspases.

[0022] Among the various commercially available caspase inhibitors, the caspase inhibitor Q-VD-OPh (N-(2(quinolyl)valyl-aspartyl-(2,6-difluorophenoxy)methyl ketone; ab141421 of caspase inhibitor abcam or 1170 of Biovision) is interesting because, compared to inhibitors with fluoromethyl ketone (fmk) type carboxy-terminated groups, it exhibits higher efficacy, greater stability and penetration, and reduced toxicity (even when used daily at high concentrations for 4 months; see Chanel LI Keoni and Thomas L. Brown, Journal of Cell Death, 2015). The inhibitor Q-VD-OPh has been shown to inhibit various caspases, particularly caspases-1, -3, -8, -9, -10, and -12.

[0023] Furthermore, International Publication No. 2009 / 092897 discloses that the compound Q-VD-OPh not only inhibits the apoptotic phenotype (caspase inhibition, DNA condensation, and fragmentation) of HIV-infected cells, but also inhibits their death and, in particular, inhibits viral replication. Because the compound Q-VD-OPh possesses both properties that inhibit viral replication and properties that inhibit caspases, it can be used as an antiviral agent.

[0024] Recently, Laforge et al (Journ Clin Invest, Volume 128, Number 4, April 2018, 1627-1640) showed that treatment with the compound Q-VD-OPh prevents the progression of AIDS disease in SIV-infected rhesus monkeys, and that the caspase inhibitor properties of the molecule enable long-term control of viral replication. When six monkeys were treated with five injections of this compound at the time of primary infection, none of the animals developed cancer even after 4-5 years had passed since treatment.

[0025] As a result, the development of antiviral agents that focus on the action on caspases, and ultimately on apoptosis, such as Q-VD-OPh, has been advanced. However, the types of such drugs are limited.

[0026] Furthermore, long-term administration or treatment with Q-VD-OPh may be harmful. In fact, administering it for several years and repeating it may lead to other pathological conditions such as severe adverse events and cancer. The beneficial effect of Q-VD-OPh treatment on apoptosis has been shown at the time of primary infection in a non-human primate model infected with SIV (i.e., when apoptosis is at its maximum level).

Summary of the Invention

Problems to be Solved by the Invention

[0027] Therefore, there is a need for antiviral agents with a broad spectrum of action. In particular, there is a need for antiviral agents that inhibit viral replication independently of caspase inhibition. Such drugs would likely be specific in their antiviral activity. Furthermore, there is a need for safe antiviral agents that do not have caspase inhibition, i.e., effects on apoptosis, i.e., antiviral agents that do not have toxicity from long-term administration. Such antiviral agents are particularly effective in long-term treatment, and are thought to be especially effective due to their penetration into different lymphatic organs, such as peripheral lymphatic organs and mesenteric ganglia, which are repositories of the virus. In addition, antiviral agents can cross the blood-brain barrier and reach the brain, which is also a repository of the virus. [Means for solving the problem]

[0028] To solve this problem, the inventors surprisingly discovered that a specific molecule structurally very similar to Q-VD-OPh inhibits viral replication without affecting caspase inhibition. The compound is therefore specific in its antiviral activity and does not act on caspase inhibition, nor on apoptosis. The compound is the compound of formula (I) shown below. As shown in Example 1, the compound of formula (I) inhibits viral replication, particularly HIV replication, and this mechanism is independent of caspase inhibition. As shown in Example 2, the compound of formula (I) can also control SARS-CoV-2 infection, inhibiting intracellular SARS-CoV-2 viral replication and preventing viral generation and new infections without toxicity.

[0029] Therefore, the present invention relates to compounds of formula (I) and pharmaceutically acceptable salts thereof for use as antiviral agents, more particularly antiriboviral agents:

[0030] [ka]

[0031] The present invention relates to compounds selected from the following. These compounds are used, in particular, for the prevention and / or treatment of viral infections in animals or humans, and more specifically, for the inhibition of viral replication in animals or humans infected with a virus.

[0032] The compound of formula (I) is also referred to in this application as "Q-VD-OPh negative control" or "Q-VE-OPh". The chemical name of the compound is N-(2(quinolyl)-L-valyl-L-glutamyl-(2,6-difluorophenoxy)methyl ketone. It is also called Quinolyl-Val-Glu-OPh and is commercially available under the names Q-VD-OPh negative control, ab141389 in the caspase inhibitor abcam, or 1171 in Biovision.

[0033] The present invention also relates to a composition comprising a compound according to the present invention as an active ingredient, and further comprising one or more carriers, diluents, adjuvants, or combinations thereof for use in the prevention and / or treatment of viral infections.

[0034] Furthermore, the present invention is (i) At least one compound selected from the compounds of formula (I) and a pharmaceutically acceptable salt thereof

[0035] [ka]

[0036] (ii) An antiviral composition comprising or comprising at least one antiviral agent or anti-inflammatory agent, particularly at least one antiretroviral agent, wherein the antiviral agent is different from that in (i).

[0037] Furthermore, the present invention relates to a combination formulation for simultaneous, separate, or sequential use in antiviral therapy; or for simultaneous, separate, or sequential use for the prevention and / or treatment of viral infections. (i) At least one compound selected from the compounds of formula (I) and a pharmaceutically acceptable salt thereof

[0038] [ka]

[0039] (ii) A product comprising or comprising at least one antiviral agent or anti-inflammatory agent, in particular at least one antiretroviral agent, wherein the antiviral agent is different from that in (i).

[0040] Unless otherwise specified, each embodiment described herein is applicable independently and / or in combination with other embodiments described herein.

[0041] "Pharmacologically acceptable salt" means any pharmaceutically acceptable salt of a compound of formula (I) derived from various organic and inorganic counterions known in the art, and includes, but only illustratively, sodium, potassium, calcium, magnesium, ammonium, and tetraalkylammonium. If the molecule contains basic functionality, examples of salts include organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, and oxalate. Preferred salts are those described in P. Heinrich Stahl, Camille G. Wermuth (Eds.), Handbook of Pharmaceutical Salts Properties, Selection, and Use; 2002. Preferably, the pharmaceutically acceptable salt is a hydrochloride salt. Such salts can be obtained by using HCl. More preferably, one of the nitrogen atoms of the molecule is complexed with HCl.

[0042] The compound of formula (I) may also be tagged with a fluorescent dye or a tag known in the art. The fluorescent dye may be any known in the art, particularly rhodamine and its derivatives, or green fluorescent protein (GFP). The tag is a short amino acid sequence specifically designed to interact with and bind to a metal ion, and a preferred tag is a histidine tag (HIS-tag or biotin).

[0043] In this application, the term “caspase” means any cysteine ​​protease as defined above. “Caspase inhibitor” is understood to mean any compound that can inhibit the activation of at least one caspase, in particular any compound that prevents or inhibits the process of proteolytic cleavage that would allow the caspase to be obtained in an active form. In particular, the caspase inhibitor prevents or inhibits the production of the apotogenized form of the caspase. Demonstration of the inhibition of one or more caspases can be carried out, for example, by immunotransfer (Western blotting) using antibodies specific to different forms and proforms of the caspase that are expected to be inhibited by the inhibitor. Inhibition of one or more caspases may be total (in which case the active form of the caspase is not detected) or partial (the caspase is subsequently detected in an active form, but in a reduced amount compared to the amount detected in the absence of the inhibitor).

[0044] The compound of formula (I) according to the present invention (Q-VD-OPh negative control) is not a caspase inhibitor. In fact, it is typically used as a negative control for potent broad-spectrum caspase inhibitors.

[0045] The compound of formula (I) is structurally very similar to the compound Q-VD-OPh of formula (II) below.

[0046] [ka]

[0047] The compound of formula (I) according to the present invention has a glutamic acid (Glu or E) side chain instead of an aspartic acid (Asp or D) side chain (similar to the compound of formula (II)).

[0048] Surprisingly, the compound of formula (I) according to the present invention inhibits viral replication and is a negative control for caspase inhibition, meaning it does not exhibit caspase inhibitory activity. Conversely, Q-VD-OPh (the compound of formula (II)) inhibits viral replication and is a broad-spectrum caspase inhibitor.

[0049] In this application, “antiviral agent,” “antiriboviral agent,” and “antiretroviral agent” are understood to mean any agent having antiviral, antiriboviral, or antiretroviral activity, respectively. Riboviruses are RNA viruses, that is, viruses whose genetic material is RNA. Such agents include, in particular, antiviral agents, in particular antiriboviral agents, and in particular antiretroviral agents, which act on at least one step of viral replication. In particular, such agents can prevent, reduce, or inhibit viral replication.

[0050] The compound of formula (I) or a salt thereof according to the present invention may be administered to any animal or human that may benefit from such administration, in particular any animal or human that is infected with or may be infected with a virus as described in this specification.

[0051] As used in this application, the term “animal” defines any non-human animal, in particular any non-human mammal, more specifically a monkey or a cat.

[0052] As used in this application, the expressions “viral infection” and “infected with a virus” mean that the animal or human is exposed to a pathogenic RNA or DNA virus, the virus attaches to one or more cells of the host, and subsequently penetrates (or is likely to penetrate) those cells and has (or will likely have) adverse effects on at least one cell of the animal or human. In particular, such a viral infection may develop into an induced pathology or clinical signs of a pathology associated with the infection. Therefore, “viral infection” within the scope of this invention includes not only the earliest stages of viral contamination, but also the latest and intermediate stages of viral contamination. For example, in the case of HIV, infection can progress through several stages, which may progress sequentially over time. It is particularly divided into four stages: (1) Primary infection, which corresponds to the seroconversion stage following contamination, and may or may not be symptomatic (in 50-75% of cases); (2) Incubation period; (3) Stage with mild symptoms; and finally (4) Stage of severe immunosuppression or AIDS, which generally presents with symptoms and is generally accompanied by numerous opportunistic infections.

[0053] Therefore, the term “viral infection” also includes any clinical signs, symptoms, or diseases that occur in an animal or human (patient) following contamination of the animal or patient with a virus as described in this application. Thus, “viral infection” includes both the viral contamination and the various pathological conditions resulting from the viral contamination.

[0054] Viral infections that fall within the scope of the present invention include, in particular, respiratory viral infections such as viral encephalitis, viral meningitis, aphthous fever, influenza, yellow fever, SARS or SARS-CoV-2 infections (especially coronavirus-19 (COVID-19)), childhood diarrhea, especially childhood diarrhea caused by rotavirus, hemorrhagic fever, especially hemorrhagic fever caused by Ebola virus, dengue virus and Lassa virus, polio, rabies, measles, rubella, varicella, smallpox, herpes zoster, genital herpes, hepatitis, especially A, B, C, D and E, leukemia and paralysis caused by HTLV-1 (human T-lympatropic virus type 1), and infections caused by HIV virus, more specifically HIV-1 or HIV-2, or SIV virus (especially AIDS (acquired immunodeficiency syndrome)).

[0055] Preferably, viral infections include infections caused by SARS (Severe Acute Respiratory Syndrome) or SARS-CoV-2 virus (Severe Acute Respiratory Syndrome Coronavirus-2), particularly SARS-CoV-2, especially coronavirus-19 (COVID-19); and infections caused by HIV virus, more particularly HIV-1 or HIV-2, especially AIDS (Acquired Immunodeficiency Syndrome).

[0056] The term “prophylaxis” or “prevention” refers to the degree of delay in the onset of clinical signs or symptoms of a viral infection, and the degree of suppression of the severity of clinical signs or symptoms of a viral infection, and includes, but is not limited to, complete prevention of viral infection. Therefore, it is necessary to administer the compound of formula (I) or a salt thereof, or a composition or combination containing said compound, to animals or patients who are likely to be contaminated with the virus before the clinical signs or symptoms of the disease appear. Prophylactic administration of the compound of formula (I) or a salt thereof, or a composition or combination containing said compound, can be performed before or at the time of exposure of said animals or humans to the virus causing the viral infection. Such prophylactic administration is useful in preventing and / or reducing the severity of any subsequent infections.

[0057] "Treatment" is understood to mean the therapeutic effect produced in an animal or human when the active substance is administered to the animal or human at the time of or after contamination with the virus. When a compound of formula (I) or a salt thereof, or a composition or combination containing said compound, is administered to an animal or human after contamination with the virus, it may be administered during the primary infection period, the asymptomatic period, or after the appearance of clinical signs or symptoms of the disease. According to one embodiment, the compound of formula (I) or a salt thereof is administered during the primary infection period. According to another embodiment, the compound of formula (I) or a salt thereof is administered after the primary infection period, i.e., during the chronic period (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease). According to a particular embodiment, administration is carried out as quickly as possible, within 24 or 48 hours after the animal or human is exposed to the virus.

[0058] The aforementioned treatment includes any therapeutic effect obtained by a compound of formula (I) or a salt thereof, or a composition or combination containing said compound, as well as improvement of clinical signs or symptoms observed in an animal or patient, and improvement of the condition of the animal or patient. This term particularly includes the effects obtained as a result of inhibiting viral replication and / or inhibiting virus-induced cell death. Accordingly, the term “treatment” includes the slowing, reduction, interruption and cessation of viral infection and / or the adverse consequences of viral infection, and treatment does not necessarily require the complete elimination of all clinical symptoms and symptoms of disease of viral infection, or the complete elimination of the virus.

[0059] Therefore, the compound of formula (I) or a salt thereof can be administered (preventively) to animals or humans at risk of developing a viral infection, or administered (therapeutically) after viral contamination has occurred, particularly after the onset of the first clinical symptoms or signs of the disease, for example, after a virus-specific protein or antibody has been detected in the blood of the animal or patient.

[0060] Accordingly, according to certain embodiments, the compound of formula (I) or a salt thereof is administered to the animal or human before, during, or after exposure to the virus. Post-exposure administration can be carried out at any time, but is preferably carried out as soon as possible after exposure, in particular within 48 hours of the animal or human's exposure to the virus.

[0061] Furthermore, to enhance the beneficial effects of the treatment, multiple consecutive administrations of the compound of formula (I) or a salt thereof may be considered. To increase the chances of cure, or at least to extend the lifespan of animals or humans, or to enhance the preventive effect, one or more consecutive administrations of the compound may be performed, particularly before and / or during and / or after exposure to the virus, especially within 48 hours after the animal or human is exposed to the virus.

[0062] Viruses that fall within the scope of the present invention include DNA viruses and RNA viruses (riboviruses), particularly viruses that cause cellular defects such as immunodeficiency (e.g., AIDS), respiratory failure (e.g., SARS and SARS-CoV-2), neuronal cell failure (e.g., rabies), or epithelial failure (e.g., hemorrhagic fever).

[0063] More specifically, the aforementioned viruses are selected from the following families: - Coronavirus family, especially coronavirus genus, for example, SARS virus or SARS-CoV-2 virus, - Retroviruses, especially those of the lentivirus and oncovirus genera, such as the HTLV-1 virus, -Viruses belonging to the Flaviviridae family, especially the Flavivirus genus, particularly dengue virus, yellow fever virus, and viruses that cause viral encephalitis such as West Nile virus, Japanese encephalitis virus, and Saint Louis encephalitis virus, or especially those belonging to the Hepacivirus genus, such as hepatitis C virus. - Orthomyxoviruses, including influenza virus, - Paramyxoviridae, especially Morbillivirus, especially measles virus, and respiratory viruses, especially Pneumovirus, such as human respiratory syncytial virus and metapneumovirus. -Viruses of the Reoviridae family, especially the rotavirus genus, -Viruses of the Picornaviridae family, especially Enteroviruses including poliovirus and viruses that cause viral meningitis, viruses of the Aphthous virus family, especially aphthous fever virus and viruses of the Rhinovirus family; or viruses of the Hepatovirus family, especially hepatitis A virus. - Filoviridae, especially Ebola virus or Marburg virus, - Arenaviridae, especially Lassa virus, - Rhabdoviridae, especially those of the genus Rhabdovirus, which includes rabies virus, and those of the genus Becyclovirus, which includes vesicular stomatitis virus. -Togaviridae family, especially those of the rubivirus genus, which includes rubella virus. - Poxviridae, especially vaccinia virus and bariola virus, - Herpesviridae, particularly herpesviruses, varicella-zoster viruses, and herpes zoster viruses, and, - Hepatitis B virus and other Hepadnaviridae viruses, hepatitis D virus, or hepatitis E virus.

[0064] Preferably, the viruses that fall within the scope of the present invention are RNA viruses (riboviruses).

[0065] More specifically, the RNA viruses mentioned above are viruses selected from the following families. - Coronaviruses belonging to the Coronavirus family, particularly those of the Coronavirus genus, such as the SARS virus or SARS-CoV-2 virus. - Retroviruses, especially those of the lentivirus and oncovirus genera, such as the HTLV-1 virus. - Viruses belonging to the Flaviviridae family, particularly the Flavivirus genus, especially dengue virus, yellow fever virus, viruses that cause viral encephalitis, such as West Nile virus, Japanese encephalitis virus, and Saint Louis encephalitis virus, or especially those belonging to the Hepacivirus genus, such as hepatitis C virus. - Orthomyxoviruses, including influenza viruses. - Paramyxoviridae, especially those of the Morbillivirus genus, especially measles virus, and respiratory viruses, especially those of the Pneumovirus genus, such as human respiratory syncytial virus and metapneumovirus. -Viruses belonging to the Reoviridae family, particularly the rotavirus genus. -Viruses of the Picornaviridae family, particularly Enteroviruses including poliovirus and viruses that cause viral meningitis; viruses of the Aphthous virus family, particularly Aphthous fever virus and rhinoviruses; or viruses of the Hepatovirus family, particularly hepatitis A virus. - Filoviridae, especially Ebola virus or Marburg virus. - Arenaviridae family, especially Lassa virus. - Rhabdoviridae, particularly the genus Rhabdovirus, which includes rabies virus, and the genus Becyclovirus, which includes vesicular stomatitis virus. -Togaviridae, especially those of the rubivirus genus, including rubella virus. - Hepatitis B virus and other Hepadnaviridae viruses, hepatitis D virus, or hepatitis E virus.

[0066] This invention is particularly directed towards coronaviruses or lentiviruses, as they cause multiple organ failure.

[0067] According to certain embodiments, the virus is a human retrovirus, particularly a human lentivirus, and more specifically a human immunodeficiency (HIV) virus such as HIV-1 or HIV-2, preferably HIV-1.

[0068] According to another specific embodiment, the virus is a Simian retrovirus, in particular a Simian lentivirus, and more specifically a Simian immunodeficiency virus (SIV) such as SIVmac251 or SIVmac239 virus.

[0069] According to a particular embodiment, the virus is a human coronavirus, in particular SARS-CoV-2.

[0070] The compound of formula (I) or a salt thereof according to the present invention can be used to prevent, reduce, and / or inhibit viral replication in animals or humans infected with the virus defined above.

[0071] As used in this application, the term “viral replication” encompasses the entirety of the stages in the viral replication cycle. In particular, the term includes the major stages of retroviral replication described in this application, including the entry of the virus into a cell, the integration of the viral genome into the host cell’s DNA, and the maturation of the virus.

[0072] "Viral maturation," or "viral maturation," in the case of lentiviruses, particularly the HIV virus, refers to the process by which the Gag polyprotein is cleaved by the viral protease into four structural proteins (p17, p24, p7, and p6), and the assembly of these proteins into the matrix (p17), capsid (TCD4+ p24), and nucleocapsid (p7). After maturation, the viral particles, which were not mature before cleavage, become infectious, that is, ready to infect new cells.

[0073] Preventing or inhibiting the replication of the virus can be done partially or entirely.

[0074] Typically, compounds of formula (I) or salts thereof according to the present invention have the ability to prevent, reduce, and / or inhibit viral replication in vitro.

[0075] The ability of the compound of formula (I) or a salt thereof according to the present invention to prevent or inhibit viral replication can be evaluated in vitro by flow cytometry after intracellular labeling with a viral antigen such as p24, as described in the examples below.

[0076] According to certain embodiments, the compound of formula (I) or a salt thereof according to the present invention is used to prevent, reduce and / or inhibit the synthesis of viral proteins in a virus-infected animal or human, as described in this application.

[0077] The term "viral protein" refers to at least one protein of a virus, in particular at least one structural protein of a virus. Examples of viral proteins whose synthesis can be blocked, slowed down, reduced and / or inhibited under the action of the active ingredient according to the present invention, in particular under the action of the compound according to the present invention include, in particular, envelope, capsid, and nucleocapsid proteins, in particular lentiviruses, proteins such as Gag, Pol, and Env, and in particular coronaviruses, proteins such as S (spike), M (membrane protein), E (envelope protein), and N (capside phosphorylated protein).

[0078] The prevention or inhibition of viral protein synthesis may be partial or complete, or it may be partial for some viral proteins and complete for the remaining viral proteins. When the prevention or inhibition is partial for all viral proteins, or partial for some viral proteins, the expression "preventing or inhibiting viral protein synthesis" means that, under the action of the compound of formula (I) or a salt thereof according to the present invention, one or more viral proteins are synthesized in the host cell in smaller amounts and are therefore present in the host cell or cell supernatant in smaller amounts compared to the synthesis of the same viral proteins in the absence of the active substance(s). When viral protein synthesis is completely prevented or inhibited, viral proteins are not synthesized in a detectable manner.

[0079] Compounds of formula (I) or salts thereof can further be used to prevent and / or inhibit viral replication and / or viral protein synthesis without significantly affecting cell death. In particular, they can be used in animals or humans infected with the virus to prevent and / or inhibit viral replication, especially viral protein synthesis, without significantly affecting the death of T lymphocytes, more specifically CD4+ T cells, induced by the virus described herein.

[0080] The phrase "does not have a significant effect on cell death" means that, in animals or humans infected with the virus described in this specification, the cell death of cells infected with the virus and treated with the compound of formula (I) or a salt thereof is not significantly different from that of uninfected cells. In other words, the cell death of a sample of animal or human cells infected with the virus and treated with the compound of formula (I) or a salt thereof is not significantly different from that of a sample of uninfected cells from the same animal or human.

[0081] Typically, in vitro, cell death in samples of animal or human cells infected with the virus and treated with a compound of formula (I) or a salt thereof is not significantly different from that in samples of uninfected animal or human cells.

[0082] The rate of cell death can be demonstrated in vitro using any conventional experimental technique. For example, a simple direct cell count using a microscope would suffice. Furthermore, cell death can be analyzed by flow cytometry after performing annexin V surface staining on a predetermined number of days after infection, for example, on day 5 or later.

[0083] Compounds of formula (I) or salts thereof according to the present invention can be used for the prevention and / or treatment of viral infections in the primary infection phase and / or chronic phase (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease). Animals or humans infected with the virus may be in the primary infection phase or the chronic phase. Compounds of formula (I) or salts thereof according to the present invention can also be used in animals or humans infected with the virus to prevent, reduce and / or inhibit viral replication in the primary infection phase and / or chronic phase (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease).

[0084] According to certain embodiments, the compound of formula (I) or a salt thereof, like other active substances, can be prepared in the form of a pharmaceutical composition further comprising one or more carriers, diluents and / or adjuvants, or combinations thereof. For injectable administration, aqueous, non-aqueous, or isotonic formulations can be selected in particular.

[0085] In this application, the term “carrier” refers to any substrate that does not impede the biological activity of the compound of formula (I) (i.e., one capable of transporting at least one active ingredient). Numerous carriers are known in the prior art. Carriers used may be, for example, water, saline, serum albumin, Ringer's solution, polyethylene glycol, water-miscible solvents, sugars, binders, excipients, pigments, vegetable or mineral oils, water-soluble polymers, surfactants, thickeners or gelling agents, cosmetics, solubilizers, stabilizers, preservatives, alkalizing or acidifying agents, or combinations thereof. Formulations of such carriers in the form of pharmaceutical compositions are described in particular in Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa.

[0086] In this application, "diluent" means a diluent, and includes both soluble and insoluble diluents. Generally, an insoluble diluent is used when the active ingredient is soluble, and a soluble diluent is used when the active ingredient is insoluble. An "insoluble" active ingredient may not dissolve completely in an aqueous medium, or its solubility in an aqueous medium may be limited (i.e., solubility in 250 ml of water at a pH of 1.0 to 7.5 is less than 10 mg / ml). Examples of insoluble diluents include microcrystalline cellulose, silicified microcrystalline cellulose, hydroxymethylcellulose, dicalcium phosphate, calcium carbonate, calcium sulfate, magnesium carbonate, and tricalcium phosphate. Examples of soluble diluents include mannitol, glucose, sorbitol, maltose, dextrose, dextrin, and dextrose.

[0087] Adjuvants that can be used within the scope of the present invention are, in particular, nucleic acids, peptidoglycans, carbohydrates, peptides, cytokines, hormones, or other small molecules. The adjuvants used may be, for example, adjuvants of the unmethylated CpG dinucleotide (CpG) family, adjuvants of the polyIC family, and adjuvants of the monophosphoryl lipid A (MPL) family or analogs thereof.

[0088] In preferred embodiments, the carriers or diluents used in the present invention, or combinations thereof, are pharmaceutically acceptable substances or combinations of pharmaceutically acceptable substances. A substance or combination of substances is said to be "pharmaceutically acceptable" if it is suitable for administration to an organism (e.g., a human or animal) for therapeutic or preventive purposes. Therefore, it is preferable that it is nontoxic to the host to which it is administered.

[0089] As used in this application, the terms “administer” and “administer” include all administrations, regardless of the chosen route of administration.

[0090] The route of administration and dosage may vary depending on various parameters, such as the patient's condition, the type of infection, and the severity of the infection to be treated, or depending on the compound of formula (I) or its salt and other antiviral agents used.

[0091] Compounds of formula (I) or salts thereof can be administered to animals or humans, in particular in dry form, solid form, especially tablets, powders, gelatin capsules, pills, granules, suppositories, polymer capsules or compressed tablets, more precisely accelerated-release tablets, enteric-coated tablets or sustained-release tablets; gel form; or in solution or liquid suspension, especially syrup, injectable, infusion or drinking solution, microvesicles or liposomes. The compounds can also be administered in dry form, such as powder or lyophilized, for reconstitution at the time of use with a suitable diluent.

[0092] According to those Galenic forms, the compositions according to the present invention, in particular the antiviral compositions of the present invention, can be administered by enteral, parenteral (intravenous, intramuscular, subcutaneous), percutaneous (or percutaneous, percutaneous), skin, oral, mucosal, particularly permucosal—cheek, nose, eye, ear (in the ear), esophagus, vagina, rectal route, or alternatively by intragastric, intracardiac, intraperitoneal, intrapulmonary, or intratracheal route.

[0093] Furthermore, the compound of formula (I) or its salt can be packaged for administration in single-dose or multi-dose forms. To enhance the therapeutic effect, administration can also be carried out in the form of multiple consecutive doses, repeated once or multiple times at specific time intervals. For example, multiple doses can be administered per day or per week.

[0094] The amount of the active ingredient administered to an animal or human is a therapeutically effective amount. A "therapeutically effective amount" is a sufficient amount to produce a significant effect, particularly to bring a significant benefit to a human or animal, within the range of preventive or therapeutic administration as defined in this application. A therapeutically effective amount is also an amount in which the beneficial effect outweighs the toxic or harmful effects of the active ingredient. Such an amount may correspond to an amount sufficient to significantly inhibit viral replication or to bring about the disappearance, reduction, or improvement of any pre-existing infection caused by the virus. The therapeutically effective amount varies depending on factors such as the state of infection, the age, sex, or weight of the individual animal or human. The dosage can also be adjusted to obtain the optimal therapeutic effect. For example, the compound according to the present invention can be administered up to 15-50 mg / kg body weight. More specifically, for a human weighing approximately 60 kg, the therapeutically effective amount of the compound according to the present invention is 100-300 mg / day, which can be administered in one to three doses.

[0095] The present invention also relates to the use of compounds of formula (I) or salts thereof in conjunction with other antiviral agents, in particular other riboviral agents, in particular other antiretroviral agents, in the prevention and / or treatment of viral infections. Examples of antiviral agents include combined antiretroviral agents within the scope of highly active antiretroviral therapy (or "HAART") in relation to HIV infection.

[0096] Therefore, the specific pharmaceutical composition according to the present invention further comprises at least one other antiviral agent.

[0097] Accordingly, the present invention also relates to novel antiviral compositions comprising, or comprising: (i) at least one compound selected from compounds of formula (I) and pharmaceutically acceptable salts thereof:

[0098] [ka]

[0099] (ii) at least one antiviral agent or anti-inflammatory agent, in particular at least one antiretroviral agent, wherein the antiviral agent is different from (i).

[0100] Therefore, the present invention also relates to novel antiviral compositions for use in the prevention and / or treatment of viral infections in animals or humans, and more particularly for inhibiting viral replication in animals or humans infected with a virus.

[0101] Therefore, a compound of formula (I) or a salt thereof can be used in conjunction with an antiviral agent or a plurality of antiviral agents (ii), particularly at least two other antiviral agents. The other antiviral agents or agents (ii) may, in particular, be antiretroviral agents.

[0102] The expression "essentially consisting of" as used in this application means that other trace components or molecules may be present together with the explicitly stated active ingredient without affecting the activity of the said active ingredient.

[0103] Antiviral and antiretroviral agents (ii) that can be used within the scope of this application include, in particular, the following: -Retroviral transcriptase inhibitors, particularly reverse transcriptase inhibitors, intended to act at the very beginning of the viral replication cycle, especially reverse transcriptase inhibitors intended to act before viral DNA is incorporated into the host cell's DNA, to prevent or inhibit the synthesis of proviral DNA from viral RNA. - Viral RNA-dependent RNA polymerase modulators (such as nucleotide analogs), - Viral protease inhibitors (or antiproteases), generally those that act at the end of the viral cycle, during the maturation of newly synthesized viral proteins. - This device inhibits the fusion of the viral envelope and the cell membrane, aiming to prevent the virus from entering the cell. - Inhibitors of receptors and co-receptors such as CD4 and BOB, - Antisense oligonucleotide, -Integrase inhibitors, and - Molecules that target other steps in the replication of the virus (address, integration port).

[0104] According to a particular embodiment, the other antiviral agent or drug comprises at least one transcriptase inhibitor and / or at least one viral protease inhibitor.

[0105] According to a particular embodiment, the antiviral composition according to the present invention comprises, essentially comprises, or consists of the following: (i) A compound of at least formula (I) or a salt thereof according to the present invention. (ii) at least one transcriptase inhibitor, and (iii) At least one type of viral protease inhibitor.

[0106] As used in this application, the term "transcriptase inhibitor" includes, in particular, nucleoside analogs, non-nucleoside analogs, and nucleotide analogs of reverse transcriptase.

[0107] According to certain embodiments, the transcriptase inhibitor is a reverse transcriptase inhibitor, particularly an HIV virus reverse transcriptase inhibitor, and more specifically, a reverse transcriptase inhibitor selected from the group comprising the following: -HIV nucleoside reverse transcriptase inhibitors, particularly zidovudine or azidothymidine (AZT), didanosine or ddl, zalcitabine or ddC, stabudine or d4T, lamivudine or 3TC, abacavir or ABC, and emcitabine or FTC, - HIV non-nucleoside reverse transcriptase inhibitors, particularly nevirapine, efavirenz, and delavirdin, and - Nucleotide analogs of HIV reverse transcriptase, particularly tenofovir or bisPOC-PMPA.

[0108] According to a particular embodiment, one of the transcriptase inhibitors used is AZT.

[0109] According to one embodiment, the viral RNA-dependent RNA polymerase modulator is a nucleotide analog such as remdesivir.

[0110] As used in this application, the term "protease inhibitor" includes, in particular, peptide-mimicking molecules and non-peptide-type molecules. A "peptide-mimicking molecule" is a peptide that mimics a natural enzyme substrate and is immobilized at a protease substrate binding site, preventing the cleavage of protein precursors (e.g., Gag and Gag-Pol of HIV or SIV), thereby resulting in the production of defective, non-infectious viral particles.

[0111] According to a particular embodiment, the viral protease inhibitor is an HIV virus protease inhibitor, and more particularly, a viral protease inhibitor selected from the group consisting of the following peptide mimetic molecules: indinavir or IDV, nelfinavir or NLFN, saquinavir or SQN, ritonavir or RTN, amprenavir, and lopinavir. According to a particular embodiment, one of the HIV virus protease inhibitors used is indinavir.

[0112] According to certain embodiments, at least one other antiviral agent according to the present invention is a fusion inhibitor, in particular an HIV virus fusion inhibitor, such as enfvirtide or umifenovir. A "fusion inhibitor" is understood to be an inhibitor that acts in the first step of viral replication by preventing fusion between the viral envelope and the cell membrane, for example, through competitive inhibition.

[0113] In the cases of Ebola virus, SARS and SARS-CoV-2, MERS coronavirus (MERS-CoV), and influenza virus, membrane fusion and host cell entry are mediated by transmembrane protease / serine subfamily 2 (TMPRSS2), which are serine proteases of the respiratory and alveolar cells. Therefore, such fusion inhibitors may be camostat mesylate or nafamostat mesylate.

[0114] Furthermore, the fusion inhibitor may be an angiotensin-converting enzyme 2 (ACE2) inhibitor or an antimalarial / parasitic drug inhibitor. ACE2 inhibitors can be used to inhibit the entry of viruses that use ACE2 as a receptor and perform S protein-driven host cell entry, such as SARS-CoV-2. ACE2 inhibitors and antimalarial / parasitic drugs can be selected from chloroquine phosphate, hydroxychloroquine, cepharanthine, selamectin, mefloquine, and their salts (such as mefloquine hydrochloride).

[0115] Examples of anti-inflammatory agents that can be used within the scope of the present invention include monoclonal antibodies in particular.

[0116] In particular, the present invention therefore also relates to novel antiviral compositions comprising, or consisting of, the following: (i) At least one compound selected from the compounds of formula (I) and pharmaceutically acceptable salts thereof.

[0117] [ka]

[0118] (ii) At least one anti-inflammatory agent selected particularly from monoclonal antibodies.

[0119] The monoclonal antibody may be directed against inflammatory interleukins and their receptors, such as IL-6 and its receptor. Preferably, the monoclonal antibody is an anti-IL6 receptor such as tocilizumab or sarilumab; or an anti-IL-6, preferably siltuximab.

[0120] Such antiviral compositions can be used for the prevention and / or treatment of coronavirus infections, such as SARS-CoV-2 infection.

[0121] According to a particular embodiment, the antiviral composition may further comprise one or more carriers, diluents and / or adjuvants as defined in this application, or a combination thereof.

[0122] Another aspect of the present invention relates to compounds of formula (I) or salts thereof, for use in enhancing the prophylactic or therapeutic effects of one or more other antiviral or anti-inflammatory agents as defined in this application, and / or reducing the amount of other antiviral or anti-inflammatory agents administered to humans or animals.

[0123] According to another aspect of the present invention, the active ingredients are formulated in combination for use in antiviral therapy.

[0124] Therefore, the present invention relates to a combination formulation for simultaneous, separate, or sequential use in antiviral therapy; or for simultaneous, separate, or sequential use for the prevention and / or treatment of viral infections, comprising (i) at least one compound selected from the compound of formula (I) and its pharmaceutically acceptable salts:

[0125] [ka]

[0126] (ii) The product also includes or comprises at least one antiviral or anti-inflammatory agent, particularly at least one antiretroviral agent, different from compound (i).

[0127] Components (i) and (ii) form a functional unit through a common indication: the implementation of antiviral therapy.

[0128] Such combination therapies are most particularly intended for the prevention and / or treatment of viral infections in humans or animals infected with the virus as defined in this application.

[0129] The terms “simultaneously” and the expression “simultaneous use” mean that the compounds (i) and (ii) of the aforementioned combination are administered to a human or animal at the same time, at the same moment.

[0130] According to a particular embodiment, compounds (i) and (ii) of the combination are administered separately or sequentially. They are then administered and used separately in several (at least two) dosage forms (e.g., two different capsules) without prior mixing. Thus, the combination corresponds to the presentation of compound (i) in one composition and compound (ii) in the other, in different compositions.

[0131] When compound (i) and compound (ii) are administered sequentially in time, the order of administration is not important, and the administration of compound (i) may precede or follow the administration of compound (ii). According to certain embodiments, compound (i) or at least one of compound (i) is administered before compound (ii) or at least one of compound (ii) is administered. Alternatively, compound (ii) or at least one of compound (ii) may be administered before compound (i) or at least one of compound (i) is administered.

[0132] The expression "sequential use" means that compound (i) or one of the compounds of the combination according to the present invention and compound (ii) or one of the compounds are administered separately in time, not simultaneously, after the other.

[0133] The terms “preceding” or “following” are used when a compound (or a group of compounds) of the combination according to the present invention is administered several minutes, several hours, or several days prior to the administration of the other compounds in the combination. Conversely, the terms “following” or “following” are used when a compound (or a group of compounds) of the combination according to the present invention is administered several minutes, several hours, or several days after the administration of the other compounds in the combination.

[0134] Furthermore, according to certain embodiments, the combination compounds (i) and (ii) of the present invention are formulated for administration at intervals of one hour or several hours, preferably at intervals of 1-, 2-, 3-, or 4 hours, more preferably at intervals of 1- or 2 hours, and even more preferably at intervals of 1 hour.

[0135] Compounds (i) and (ii) of the combination may be formulated to facilitate their ingestion, and in particular may be formulated with one or more carriers, diluents or adjuvants as defined above, or a combination thereof.

[0136] Furthermore, compound (i) and compound (ii) of the combination according to the present invention may be administered by the same route of administration, or one may be administered by a different route of administration. The possible Galenic forms and routes of administration are as described above.

[0137] The present invention also relates to antiviral compositions according to the present invention for use as pharmaceuticals, particularly as antiviral agents, and more particularly as antiretroviral agents. More precisely, the antiviral compositions or combinations can be used in the prevention and / or treatment of viral infections in mammals or humans, particularly infections caused by viruses as defined herein, and more particularly to inhibit viral replication.

[0138] The present invention also relates to the use of antiviral compositions according to the present invention in the manufacture of pharmaceutical compositions for the prevention and / or treatment of viral infections in mammals or humans, in particular infections caused by viruses as defined herein.

[0139] The present invention also relates to a method for treating an animal or human infected with the virus described herein, the method comprising at least one step of administering a compound of formula (I) or a salt thereof according to the present invention.

[0140] The aforementioned treatment method is particularly suitable for, and intended for, the prevention and / or treatment of viral infections, especially in humans or animals infected with viruses as defined herein.

[0141] More specifically, the therapeutic method can be used to prevent and / or inhibit viral replication in animals or humans infected with the virus. [Brief explanation of the drawing]

[0142] The compound Q-VE-OPh of the present invention is also referred to as "QVG" (where G represents glutamic acid) in Figures 1 and 2. [Figure 1] Figure 1 shows that the compound Q-VE-OPh of the present invention has an antiviral effect against HIV-1 replication in vitro: Flow cytometry analysis was performed after intracellular staining of viral capsid protein P24 for two days each in the presence of various molecules added at a concentration of 20 μM in CD4 T lymphocytes infected with the laboratory virus strain HIV-1 lai. Uninfected CD4 T cells were used as a negative control. Staining was performed on days 5 and 6 post-infection (PI). [Figure 2] Figure 2 shows that the Q-VE-OPh molecule of the present invention inhibits HIV-1 viral replication and therefore saves CD4 T cells from death: Flow cytometry analysis of CD4 T lymphocytes infected with the laboratory virus strain HIV-1 lai, performed for 2 days each in the presence of various molecules added at a concentration of 20 μM. Uninfected CD4 T cells were used as a control. Staining was performed on day 5 post-infection (PI). [Figure 3]Figure 3 shows the toxicity test of Q-VE-OPh on Vero E6 cells: Vero E6 cells, either uninfected (NI) or infected with the virus at MOI 0.05, were incubated with different concentrations of Q-VE-OPh (25 μM, 50 μM, 100 μM) and collected from each well 72 hours post-infection. They were washed twice with PBS and then stained with viability-fixing dyes at 4°C for 30 minutes. The cells were then washed, fixed with 2% paraformaldehyde (FPA), and analyzed using a Fortessa Flux cytometer. 30,000 events were recorded three times for each condition. Analysis was performed using FlowJo software, and the percentage of viability was calculated from three times the results for each condition according to the analysis report. Results represent the mean + SD (n=4) from three independent experiments for each condition. [Figure 4]Figure 4 shows the effect of Q-VE-OPh on SARS-CoV-2 infection and mortality (full treatment). Expression of the Sars-CoV-2 spike (S) protein in infected cells was detected by flow cytometry, and expression of both the Sars-CoV-2 spike (S) and nucleocapsid (N) proteins was detected by Western blotting: A) Uninfected (NI) or Vero E6 cells infected with the virus at MOI 0.05 were incubated with different concentrations of Q-VE-OPh (25 μM, 50 μM, 100 μM) or remdesivir (Rem 10 μM) for 1 hour, and then infected with the virus at MOI=0.05 for 72 hours. The cells were then cultured in drug-containing medium without removing the virus from the culture medium until the end of the experiment (full treatment). Cells were harvested 72 hours after infection, stained, and analyzed for mortality and infection rates. Infection rates are shown in each plot of the analysis. B) Results represent the mean ± SEM of the percentage of suppression of Spike protein expression compared to the untreated control group (n=3). C) Vero E6 cells were pretreated with Q-VE-OPh or remdesivir (Remd 10 μM) at the indicated concentration under the same conditions as described in A). Wells containing uninfected cells were used as a negative control for infection. 72 hours post-infection, cells were lysed with RIPA buffer and Western blot analysis was performed to detect the expression of Spike protein (S), full-length and S1 domain, and nucleocapsid protein (N). GAPDH was used as a loading control. Results represent the mean ± SD from four independent experiments with three points for each condition. [Figure 5]Figure 5 shows the in vitro antiviral activity of Q-VE-OPh against SARS-CoV-2 under complete treatment conditions. Viral yield in infected cell supernatant was quantified by qRT-PCR: AB) Vero E6 cells were pretreated with Q-VE-OPh peptide ("QVE") for 1 hour before infection with the virus at MOI=0.05. They were then cultured in drug-containing medium until the end of the experiment (complete treatment). Supernatant was collected 72 hours post-infection, and viral RNA was extracted. Real-time PCR analysis was performed on the supernatant using probes for either the SARS-CoV-2 N or NSP6 gene. Results are shown as mean + SEM (n=3). Differences between means were examined using one-way ANOVA and Dunnett's post-hoc test. ***p<0.001 indicates comparison with the untreated group. (Remdesivir) [Figure 6]Figure 6 shows the effect of Q-VE-OPh on SARS-CoV-2 infection and mortality after entry. Flow cytometry analysis to detect the expression of the Sars-CoV-2 spike (S) protein in infected cells and Western blot analysis to detect the expression of the Sars-CoV-2 spike (S) and nucleocapsid (N) proteins: A) Vero E6 cells were infected with the virus at MOI 0.05 for 2 hours, and then the virus was removed from the culture medium. The cells were then cultured for 72 hours with different concentrations of Q-VE-OPh (25 μM, 50 μM, 100 μM) or remdesivir (Remd 10 μM) (post-entry). These drugs were added to the culture medium at different concentrations daily until the end of the experiment. After 72 hours, post-infection cells were collected, stained, and the mortality and infection rates were analyzed. The infection rates are shown in each analysis plot. B) Results represent the mean + SEM of the suppression rate of spike protein staining compared to the untreated control group (n=3). C) Vero E6 cells were infected and then treated with Q-VE-OPh at the indicated concentration or remdesivir (Remd 10 μM) under the same conditions as A). Wells containing uninfected cells were used as a negative control for infection. 72 hours post-infection, cells were lysed in RIPA buffer and Western blot analysis was performed to detect the expression of spike protein (S), full-length and S1 domain, and nucleocapsid protein (N). GAPDH was used as a load control. Results represent the mean ± SD from four independent experiments with three independent points for each condition. [Figure 7]Figure 7 shows the antiviral activity of Q-VE-OPh against SARS-CoV-2 in vitro under post-entry conditions. Virus yield in infected cell supernatant was quantified by qRT-PCR: AB) Vero E6 cells were infected with virus at MOI=0.05 for 2 hours. The virus was then removed from the culture medium. The cells were then incubated for 72 hours with different concentrations of Q-VE-OPh (QVE, 25 μM, 50 μM, 100 μM) or remdisivir (Remdisivir, 10 μM) (post-entry). The drug was added daily in different concentrations of culture medium until the end of the experiment. 72 hours post-infection, the supernatant was collected and viral RNA was extracted. Real-time PCR analysis was performed on the supernatant using probes for either the SARS-CoV-2 N or NSP6 gene. Results are shown as mean + SEM (n=3). Differences between means were examined using one-way ANOVA and Dunnett's post-hoc test. Compared to the untreated group, ***p<0.001. [Figure 8]Figure 8 shows the effect of Q-VE-OPh on SARS-CoV-2 infection and mortality. Flow cytometry analysis to detect the expression of the Sars-CoV-2 spike (S) protein in infected cells, and Western blot analysis to detect the expression of the Sars-CoV-2 spike (S) and nucleocapsid (N) proteins: A) Uninfected (NI) or Vero E6 cells infected with the virus at MOI 0.05 were incubated with different concentrations of Q-VE-OPh (25 μM, 50 μM, 100 μM) or remdesivir (Remd 10 μM) for 1 hour, and then infected with the virus at MOI=0.05 for 2 hours. The medium containing the virus and drug was then removed and replaced with fresh medium without any treatment until the end of the experiment (Entry). Cells were harvested 72 hours post-infection, stained, and analyzed for mortality and infection rates. Infection rates are shown in each plot of the analysis. B) Vero E6 cells were pre-treated for 1 hour with the indicated concentration of Q-VE-OPh or remdesivir (Remd 10 μM) under the same conditions as A) before infection. A well containing uninfected cells was used as a negative control for infection. 72 hours post-infection, cells were lysed with RIPA buffer and Western blot analysis was performed to detect the expression of Spike protein (S), full-length and S1 domain, and nucleocapsid protein (N). GAPDH was used as a loading control. Results represent the mean ± SD from four independent experiments with three points per condition. [Examples]

[0143] Example 1 The compound Q-VE-OPh of the present invention has undergone comparative testing with other molecules to assess its antiviral effect against the HIV virus.

[0144] The test molecule in this assay is: -Q-VE-OPh (Q-VD-OPh negative control): The compound of formula (I) of the present invention. -Q-VD-OPh (unmethylated form, "QVD-unmethylated") (caspase inhibitor): Comparison. -Q-VD-OPh (methylated form, "QVD-methylated") (caspase inhibitor): comparative product, and -VX-765 (caspase-1 inhibitor): Comparison.

[0145] protocol CD4 T lymphocytes, isolated from the blood of healthy donors and sorted using magnetic beads (Miltenyi's TCD4 isolation kit), were cultured in the absence or presence of HIV-1 lai virus (the strain used in the laboratory). 24 hours after infection, the cells were activated for 6 days with 5 μg / ml Concanavalin A (ConA) and IL-2 (100 U / ml). Different molecules were added directly to the post-infection cell cultures under each condition at a concentration of 20 μM. The same amount of each molecule was added to the cells every two days.

[0146] result To detect the effect of the present invention's Q-VE-OPh on viral replication in CD4T lymphocytes, the inventors evaluated flow cytometry analysis using intracellular staining of viral capsid protein and P24 on days 4, 5, and 6 post-infection. Furthermore, a mortality test for apoptosis using Annexin V-FITC was performed on day 5.

[0147] I. The Q-VE-OPh of the present invention inhibits viral replication of the HIV virus. The antiviral effect of Q-VE-OPh was measured by assessing the amount of P24 capsid protein produced within cells. Different molecules, QVD-methylated, QVD-unmethylated, Q-VE-OPh, and VX-765, were added to cultured T CD4-activated cells at a dose of 20 μM every two days starting from the first day of infection, and their effects were measured.

[0148] Flow cytometry analysis was performed to detect the capsid virus protein P24. The experimental results showed that the Q-VE-OPh molecule of the present invention, which lacks anticaspase activity, possesses the same antiviral effect as the comparative Q-VD-OPh molecule (methylated or unmethylated). This is the first time these tests have been conducted and these results presented.

[0149] This is a very interesting result, as it demonstrates that the antiviral activity of the QVD molecule is independent of its anticaspase activity. VX-765, a specific caspase-1 inhibitor, does not affect HIV virus replication. The compound Q-VE-OPh of the present invention exhibits antiviral activity against HIV-1 replication in vitro (Figure 1).

[0150] II. The Q-VE-OPh of the present invention reduces cell death or apoptosis in CD4 T cells. Since the HIV-1 virus kills infected CD4 T cells through apoptosis, we performed annexin V surface staining five days post-infection under all conditions, followed by flow cytometry analysis of cell mortality. The results showed that it suppresses apoptosis of CD4 T cells.

[0151] As a result, cells in the presence of the Q-VE-OPh molecule of the present invention showed significantly lower mortality rates than infected cells or cells in the presence of the caspase-1 inhibitor VX-765, and were even better than uninfected cells. The results were the same for QVD-nonmethylation, in contrast to QVD-methylation.

[0152] These results demonstrate that because the Q-VE-OPh molecule of the present invention does not possess anti-caspase activity, CD4 T lymphocytes are saved from cell death because they are not infected (protection due to the molecule's antiviral effect), and not because of caspase inhibition. The Q-VE-OPh molecule of the present invention can save CD4 T cells from death because it inhibits HIV-1 viral replication (Figure 2).

[0153] conclusion These results represent the first demonstration that the Q-VE-OPh of the present invention inhibits the replication of the HIV-1 virus. These results are highly significant because they demonstrate for the first time that Q-VE-OPh is a negative control of the caspase activity of the Q-VD-OPh molecule, and that the antiviral effect of Q-VD-OPh is not due to its caspase-inhibiting function. In fact, these results indicate that this antiviral activity is maintained by a negative control molecule (Q-VE-OPh of the present invention) that does not possess caspase-inhibiting activity.

[0154] Example 2 Materials and methods Cells, viruses, drugs The Vero E6 cell line from African green monkey kidneys was obtained courtesy of Dr. Andreola Marie-Aline of the University of Bordeaux and maintained in Eagle medium (Dulbeccoo's modified Eagle medium; Gibco Invitrogen supplemented with 10% heat-inactivated FBS and 1% PS (penicillin 10,000 U / ml, streptomycin 10,000 μg / ml)) at 37°C and 5% humidity in CO2. The BetaCoV / France / IDF0372 / 2020 strain was provided by the National Reference Centre for Respiratory Viruses, run by the Institut Pasteur (Paris, France), under the supervision of Pr. Sylvie van der Werf. The human sample from which the BetaCoV / France / IDF0372 / 2020 strain was isolated was provided by Dr. X. Lescure and Pr. Y. Yazdanpanah (Bichat Hospital, Paris, France). Furthermore, the BetaCoV / France / IDF0372 / 2020 strain was provided through the European Virus Archive goes Global (Evag) platform, a project funded under grant agreement number 653316 from the European Union's Horizon 2020 Research & Innovation program. The viral titer used in all experiments was 4 × 10⁶. 6The concentration was PFU / mL. All infection experiments were conducted in a biosafety level 3 (BLS-3) laboratory at the Cordelier Research Center (CRC). Q-VE-OPh was purchased from Cliniciens (Cat no. 1171, Biovision), and remdesivir was purchased from COGER (Cat no. AG--CR1-3713-M005).

[0155] Evaluation of antiviral activity, toxicity, and infection control. To evaluate the toxicity and antiviral effects of Q-VE-OPh on Vero E6 cells, the inventors measured mortality % and cell infection % by flux cytometry. Cells were stored in a 24-well cell culture dish at 75 × 10⁴ 4Cells were cultured overnight at a density of cells / well. The following day, cells were pretreated for 1 hour with either the indicated Q-VE-OPh or remdesivir dose. Subsequently, the virus was added at an MOI of 0.05 and infected at 250 μl / well for 1 hour. After 1 hour, complete medium was added to the cell culture to a final volume of 500 μl / well. The drug was added to the cell culture daily at the same concentration. 72 hours post-infection, the cell supernatant was collected and immediately frozen at -80°C for virus extraction and q-PCR amplification. Cells were harvested, and a portion were used for flux cytometry analysis. Infection inhibition was measured by intracellular staining for the spike protein (SARS-CoV-2 Spike Protein-Alexa 647, Cat no. 51-6490-82, eBioscience) using the Cytofix / cytoperm fixation permeabilization kit (Cat no. 554714, BD) according to the manufacturer's instructions. Toxicity was analyzed using viability 405 / 452 fixative dye (Cat no. 130-109-814, Miltenyi Biotec) according to the manufacturer's instructions. In short, cells were washed twice with PBS and then stained with the viability fixative dye at 4°C for 30 minutes. Subsequently, the cells were permeabilized with Cytofix / cytoperm buffer for 20 minutes, washed twice with permawash buffer, and then stained with anti-spike Alexa 647 at 4°C for 30 minutes. After staining, the cells were fixed with 2% paraformaldehyde (FPA) and analyzed using a Fortessa Flux Cytometer. 30,000 events were recorded three times for each condition. Analysis was performed using FlowJo Software. Other parts of the cells were lysed in RIPA lysis buffer (Invitrogen, catalog number 10230544) containing a protease (Roche) and a phosphatase inhibitor (Invitrogen) for further quantification and immunoblotting analysis. Each condition was performed three times (n=3) in the same experiment, and three independent experiments were repeated.

[0156] Q-VE-OPh addition time experiment The present invention's Q-VE-OPh (25, 50, 100 μM) and remdesivir (10 μM) were used in time-based treatment experiments. Vero E6 cells (5 × 10⁴ cells / well) were treated with Q-VE-OPh, remdesivir, or DMSO at different stages of viral infection. In the "full-time" treatment, Vero E6 cells were pre-treated with the drug for 1 hour before viral infection, and then incubated with the virus in the presence of the drug for 2 hours until the end of the experiment. In the "entry" treatment, the drug was added to the cells 1 hour before viral infection and maintained throughout the 2-hour viral attachment process. The virus-drug mixture was then replaced with fresh culture medium without the drug until the end of the experiment. In the "post-entry" experiment, the virus was added to the cells and infected for 2 hours, after which the virus-containing supernatant was replaced with drug-containing medium until the end of the experiment. The experimental conditions for the DMSO-administered group were the same as those for the "full-time" group. For all experimental groups, cells were infected with the virus at an MOI of 0.05, and after 72 hours of pi incubation, the cell supernatant and cell lysates were collected for qRT-PCR and Western blot analysis, respectively. In addition, intracellular expression of the spike protein was analyzed by flux cytometry to confirm mortality and viral replication.

[0157] Viral RNA extraction and quantitative real-time RT-PCR (qRT-PCR) 200 μL of cell culture supernatant was collected, and viral RNA was extracted using the MiniBEST Viral RNA / DNA Extraction Kit (Takara, Cat no. 9766) according to the manufacturer's instructions. The RNA was eluted with 30 μL of RNAase-free water. Total RNA was converted to cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) according to the manufacturer's recommended procedure. Quantitative PCR was performed using TB Green Premix Ex Taq II (Takara, Cat no. RR820A). Each reaction consisted of a total volume of 25 μL, including 1 μL of each primer [0.4 μM / μL], 2 μl of cDNA (5 ng / μL), 12.5 μl of TB Green Premix Ex Taq II, and 8.5 μL of RNAase-free water.

[0158] Real-time PCR was performed using a Bio Rad CFX384 Real-Time system PCR Machine. The thermal cycling conditions used were as follows: Initial denaturation: 95°C, 30 seconds, followed by amplification at 96°C, 5 seconds, and 60°C, 30 seconds for 40 cycles. Primers for the SARS-CoV-2 N and NSP6 genes, designed and described by Abdel-Sater et al (January 29, 2021; A Rapid and Low-Cost protocol for the detection of B.1.1.7 lineage of SARS-CoV-2 by using SYBR Green-Based RT-qPCR. medRxiv preprint doi: https: / / doi.org / 10.1101 / 2021.01.27.21250048), were purchased from Eurofins. N-qF:CGTTTGGTGGACCCTCAGAT(Sequence ID 1) N-qR:CCCCACTGCGTTCTCCATT(Sequence ID 2) NSP6-qF:GGTTGATACTAGTTTGTCTGGTTTT(Sequence ID 3) NSP6-qR:AACGAGTGTCAAGACATTCATAAG (Sequence ID 4).

[0159] SARS-CoV-2 cDNA (Ct ~20 of N and NSP6 genes) was used as a positive control. The calculated Ct values ​​were converted to the reduction in the treated sample relative to the control using the ΔCt method (change in viral RNA = 2^ΔCt).

[0160] Western blot analysis For Western blot analysis, protein samples were separated using 4-12% NUPAGE SDS-PAGE (Invitrogen) and transferred to a nitrocellulose membrane (Amersham Bioscience). After blocking with 5% BSA in TBS buffer containing 0.05% Tween® 20, the blots were prepared using mouse anti-spike antibody (S1-NTD) (E7M5X) (1 / 2000, Ozyme, Cat. No. 42172S) and anti-N antibody (1:10000 dilution, Fisher Scientific, Cat. MA536086) as primary antibodies, and horseradish peroxidase (HRP) labeled Goat-Anti-Mouse IgG or Goat-Anti-Rabbit IgG (Invitrogen) as secondary antibodies. Protein bands were detected using an ECL chemiluminescent substrate (Pierce) with a CCD camera (Syngene Pxi-4).

[0161] statistical analysis Statistical analysis between means was performed using GraphPad Prism software (GraphPad Software Inc., USA), following a one-way ANOVA test, followed by Dunnett's posthoc test to determine significance. Values ​​were given as mean ± SEM, and a p-value < 0.05% was considered statistically significant.

[0162] result When treated with different concentrations of Q-VE-OPh peptide, Vero E6 cells showed no toxic effects for 72 hours post-infection, regardless of whether they were infected with the virus or not, at an MOI of 0.05 (Figure 3).

[0163] The antiviral activity and mortality of different concentrations of Q-VE-OPh were evaluated by intracellular staining for SARS-CoV-2 spike protein and flux cytometry analysis using viability dyes to measure mortality. Remdesivir was used as a positive control during the study.

[0164] The results showed that Q-VE-OPh inhibited viral replication after SARS-CoV-2 entry into cells at a dose of 25 μM (post-entry antiviral effect) (inhibition rate approximately 70%), and completely inhibited it at a concentration of 50 μM (inhibition rate approximately 99%). This effect was observed with daily administration of 50 μM over 72 hours after infection. Q-VE-OPh treatment significantly reduced the expression of viral spike protein and nucleocapsid protein in infected cells. This reduction was comparable to that obtained with remdesivir (Figures 4 and 6). In fact, Q-VE-OPh treatment significantly reduced the relative expression of nucleocapsid (N) protein (structural protein) and accessory protein ORF6 (NSP6) gene in the supernatant of infected cells under complete treatment and post-infection conditions (Figures 5 and 7).

[0165] However, Q-VE-OPh did not show any significant effect on the entry of the virus into cells during infection, regardless of the dose used (Figure 8).

[0166] From the above, it has been shown that Q-VE-OPh according to the present invention is non-toxic even when added at a concentration of 100 μM for 3 days, inhibits intracellular viral replication, and prevents viral production and new infections, thereby demonstrating a high effectiveness in suppressing SARS-CoV-2 infection in vitro.

Claims

1. A compound of formula (I): 【Chemistry 1】 A composition comprising a compound selected from the group consisting of the compounds of formula (I) and pharmaceutically acceptable salts thereof.

2. The composition for use according to claim 1 , wherein the viral infection is caused by a DNA virus or an RNA virus.

3. 3. The composition for use according to claim 2, wherein the virus is a virus selected from the following families: - Coronaviridae, - retroviruses, -Flaviviridae, - Orthomyxoviruses, including influenza viruses; - Paramyxoviridae, - Reoviridae, - Picornaviridae, - Filoviridae, - Arenaviridae, - Rhabdoviridae, - Togaviridae, - Poxviridae, - Herpesviridae, and - Hepadnaviridae, or Hepeviridae.

4. 4. The composition for use according to claim 2 or 3, wherein the virus is a human retrovirus.

5. 5. The composition for use according to any one of claims 1 to 4, wherein the viral infection is selected from the group consisting of viral encephalitis, viral meningitis, aphthous fever, influenza, yellow fever, respiratory viral infections such as infections with SARS or SARS-CoV-2, childhood diarrhea, hemorrhagic fever, polio, rabies, measles, rubella, chickenpox, smallpox, shingles, genital herpes, hepatitis, leukemia and paralysis due to HTLV-1 (human T-lymphotropic virus type 1), and infections caused by HIV or SIV viruses.

6. A composition for use according to any one of claims 1 to 5 for use in preventing and / or reducing and / or inhibiting viral replication in animals or humans infected with said virus.

7. A composition for use according to any one of claims 1 to 6 for use in preventing and / or reducing and / or inhibiting viral protein synthesis in an animal or human infected with said virus.

8. 8. The composition for use according to claim 6 or 7, wherein the compound has no significant effect on cell death.

9. The composition for use according to any one of claims 6 to 8, wherein the animal is a non-human mammal.

10. A composition for use in the prevention and / or treatment of a viral infection, comprising the compound according to any one of claims 1 to 9 as an active ingredient, and further comprising one or more carriers, diluents or adjuvants, or combinations thereof.

11. 11. The composition of claim 10, characterized in that it is formulated for administration by enteral, intravenous, intramuscular, subcutaneous, transdermal, cutaneous, oral, mucosal, transmucosal-buccal, nasal, ocular, otic, vaginal, or rectal route, or by intragastric, intracardiac, intraperitoneal, intrapulmonary, or intratracheal route.

12. (i) at least one compound selected from compounds of formula (I) and pharmaceutically acceptable salts thereof: 【Chemistry 2】 (ii) A composition for antiviral use, comprising or consisting of at least one antiviral or anti-inflammatory agent, wherein said antiviral agent is different from (i).

13. The composition according to claim 12 for use in the prevention and / or treatment of viral infections.

14. As a combined preparation for simultaneous, separate or sequential use in antiviral therapy or for simultaneous, separate or sequential use for the prevention and / or treatment of viral infections, (i) at least one compound selected from the compounds of formula (I) and pharmaceutically acceptable salts thereof 【Transformation 3】 (ii) A product comprising or consisting of at least one antiviral or anti-inflammatory agent, wherein said antiviral agent is different from (i).

15. 15. The composition of claim 12, or the composition for use of claim 13, or the product of claim 14, wherein the antiviral or anti-inflammatory agent (ii) is selected from: - transcriptase inhibitors, - viral RNA-dependent RNA polymerase modulators, such as nucleotide analogues; - viral protease inhibitors or antiproteases, - inhibitors of viral envelope and cell membrane fusion, - receptor or co-receptor inhibitors, - antisense oligonucleotides, - integrase inhibitors, - molecules that target other stages of viral multiplication, and - an anti-inflammatory agent selected from monoclonal antibodies against inflammatory interleukins and their receptors, such as IL-6 and its receptor, preferably monoclonal antibodies anti-IL6 receptor, such as tocilizumab or sarilumab, or anti-IL-6, preferably siltuximab.