Knockdown or knockout of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP and RFXANK to reduce T cell recognition of allogeneic cell products

Abstract

Provided herein are engineered immune cells and populations thereof for administration to patients to treat cancer (e.g., solid or liquid tumors) and other conditions. The cells are engineered to functionally express reduced levels of one or more of RFX5, NLRC5, TAP2, β2m, TRAC, RFXAP, CIITA, and RFXANK. Optionally, the cells are further engineered to express one or more additional proteins, such as antigen binding proteins (e.g., chimeric antigen receptors (CARs) or T cell receptors) to target tumor cells or other damaged cells in the patient, and / or to express other genes at reduced levels. Also provided are methods of making and using the engineered cells, compositions, and kits comprising them, as well as methods of treatment by administering the cells and compositions.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 143,748, filed January 29, 2021, U.S. Provisional Patent Application No. 63 / 176,818, filed April 19, 2021, and U.S. Provisional Patent Application No. 63 / 267,041, filed January 21, 2022, the contents of all of which are hereby incorporated by reference in their entireties.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, and is hereby incorporated by reference in its entirety. The ASCII copy, created on January 27, 2022, is named AT-041_04WO_SL.txt and is 17,262 bytes in size.

[0003] The present disclosure relates generally to the use of engineered immune cells (e.g., T cells) for use in therapeutic applications. [Background technology]

[0004] Adoptive transfer of immune cells genetically modified to recognize malignant tumor-associated antigens has shown promise as a new approach to treat cancer (see, e.g., Brenner et al., Current Opinion in Immunology, 22(2): 251-257 (2010); Rosenberg et al., Nature Reviews Cancer, 8(4): 299-308 (2008)). Immune cells can be genetically modified to express chimeric antigen receptors (CARs), fusion proteins consisting of an antigen recognition moiety and a T cell activation domain (see, e.g., Eshhar et al., Proc. Natl. Acad. Sci. USA, 90(2): 720-724 (1993)). CAR-containing immune cells, e.g., CAR-T cells (CAR-T), are engineered to have antigen specificity while retaining or enhancing their ability to recognize and kill target cells.

[0005] However, the generation of CAR-modified autologous cell therapies is expensive, requires a multi-week process and quality testing, and results in a product of variable potency depending on the initial quality and quantity of patient-specific T cells employed. Allogeneic CAR-modified cell therapies, in which cells from healthy donors are modified with CARs and then administered to multiple patients, promise a cheaper and more robust product than autologous therapies that can be delivered immediately on demand (see, for example, Graham et al., Cells 2018, 7, 155; doi:10.3390 / cells7100155). In addition, allogeneic therapies allow for the selection of desirable product characteristics (e.g., gene editing efficiency, integration site, lack of deleterious non-specific gene editing, haplotype, etc.) and facilitate more sophisticated cell engineering (e.g., multiple gene edits to improve potency, persistence, homing, etc.). A major hurdle to implementing allogeneic CAR-modified cell therapies is the potential rejection of the product (donor) by the patient's immune system (host).

[0006] Killer lymphocytes, such as CD8+ T cells and natural killer (NK) cells, identify and kill cancer cells, virus-infected cells, and foreign cells (including allogeneic cells) that deviate from self. The central determinants of self-nonself discrimination are the major histocompatibility complex (MHC) molecules expressed on the surface of all nucleated cells. Each MHC class I molecule is a non-covalent trimeric complex of highly multi-allelic MHC class I heavy chains (the most common of which is HLA-A2), invariant β2 microglobulin (β2m), and presented peptides derived from proteolysis from endogenously expressed proteins. Collectively, MHC class I molecules are loaded with peptides that represent the entire protein diversity expressed within the cell, enabling cancer and infected cells to "signal" their difficulties to the immune system. CD8+ T cells recognize these non-self peptides with the T cell receptor (TCR) that is unique to each newborn T cell and initiate killing upon recognition of non-self peptide-MHC (see, e.g., Dembic, Z. et al. Nature 320, 232-238 (1986)). Recognition of non-self by T cells is complemented by recognition of "selflessness" by NK cells, i.e., inhibitory receptors on the surface of NK cells allow NK cell-mediated killing in the absence of MHC (see, e.g., K. Karre et al., Nature 319, 675-678 (1986)) (see Figures 1 and 3). Experimental ablation of MHC class I presentation, achieved via CRISPR / Cas9-mediated genomic knockout (KO) of the b2m gene, which encodes the universal β2m component of MHC class I, results in potent NK activation and selective killing of MHC-lacking T cells in both auto- and alloreactive contexts (see Figure 2 ).

[0007] Although allogeneic cell therapy has many advantages over autologous cell therapy, allogeneic cells also face rejection by host or recipient immune system cells that react with T and NK epitope determinants on the surface of the allogeneic cell product that differ from the host. The present disclosure provides the advantage of improved allogeneic therapy resulting in increased persistence of administered cells despite the recipient's natural defenses. Summary of the Invention

[0008] Provided herein are immune cells that have been engineered, e.g., genetically engineered, to reduce rejection by a host or recipient into which the cells have been introduced, methods for reducing rejection and / or recognition by the host or recipient's immune system (e.g., T cells and / or NK cells), and compositions and populations comprising the engineered cells and methods of using same to treat cancer in a patient. The immune cells of the present disclosure are engineered to functionally express reduced levels of one or both of two genes whose products are involved in antigen presentation by the cells, NLRC5 and TAP2, or any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK, compared to corresponding cells that have not been so engineered. The engineered cells can be further engineered to enhance resistance to rejection and / or provide a therapeutic effect, for example, the cells can be engineered to include or express additional proteins, e.g., antigen binding proteins, such as chimeric antigen receptors (CARs) and / or T cell receptors, where the antigen binding proteins or T cell receptors target the engineered immune cells to tumor cells expressing the cognate antigen and / or other undesirable (e.g., diseased) cells. Thus, the present disclosure provides a method of increasing the persistence of allogeneic cells in a recipient, the method comprising engineering the cells to functionally express reduced levels of one or both of NLRC5 and TAP2, one or both of RFX5 and NLRC5, one or both of RFX5 and TAP2, or any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK, compared to unengineered cells.

[0009] In certain aspects, the disclosure provides engineered immune cells that functionally express any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at reduced levels. In some embodiments, the reduced expression level, presented as compared to the expression level in a corresponding but unengineered immune cell, is, for example, 0% when both chromosomal copies of the gene are knocked out, or, for example, 50% when one of the two chromosomal copies of the gene is knocked out and there is no compensatory increase in expression of the other chromosomal copy of the gene (i.e., 50% of the level in an unengineered control immune cell). In some embodiments, the cell expresses any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at a level that is 90% or less, 75% or less, 50% or less, 25% or less, or 10% or less of the expression level in an unengineered immune cell. In some embodiments, the expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in engineered immune cells is anywhere between 0%-90% of the level in a control cell that is not engineered for the corresponding gene. In some embodiments, the expression level in engineered cells is, for example, 10%-90%, 25%-90%, 25%-75%, 10%-50%, 25%-50%, 50%-90%, or 50%-75% of the level in a control cell.In some embodiments, a reduced expression level other than 0% or 50% is obtained, for example, when only one chromosomal copy of a gene is knocked out and compensatory mechanisms cause an increased expression level of the remaining chromosomal copy, or when reduced expression is achieved by methods other than gene knockout, such as known knockdown methods, for example, using any of a variety of RNA-based technologies (e.g., antisense RNA, miRNA, siRNA; see, e.g., Lam et al., Mol. Ther.-Nucleic Acids 4:e252 (2015), doi:10.1038 / mtna.2015.23; Sridharan and Gogtay, Brit. J. Clin. Pharmacol. 82: 659-72 (2016)). In some embodiments, the engineered immune cells disclosed herein exhibit reduced expression levels of MHC class I proteins or complexes at the cell surface compared to a suitable control. In various embodiments, the cell is a T cell, e.g., a human T cell. In some embodiments, the cell comprises a mutation in any one or more of the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK loci or genes, and / or a disruption in any one or more of the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK loci or genes, which causes a decrease in functional expression of the disrupted loci or genes. In one embodiment, the mutation or disruption is introduced by any one or combination of gene mutation or gene editing techniques, including but not limited to known homologous recombination techniques, and techniques using any one or more of meganucleases, TALENs, zinc fingers, shRNA, Cas-CLOVER, and CRISPR / Cas systems (e.g., Cas9, Cas12, and MAD7). In some embodiments, the cell is a non-human cell, such as a primate cell or a non-primate mammalian cell. In some embodiments, the cell is a human cell.In some embodiments, the mutation or disruption occurs by knocking in a nucleic acid, such as, for example, a nucleic acid encoding one or more proteins or gene products expressed in the cell. In some embodiments, the nucleic acid encodes either or both of the membrane glycoprotein UL18 (see, e.g., UniProtKB - P08560 (UL18_HCMVA), accessed at https: / / www.uniprot.org / uniprot / P08560) and ADR. In various embodiments, the ADR (allogeneic immune defense receptor) comprises the same components or domains as the ADRs disclosed in Feiyan Mo et al., Nature Biotechnol. (2021) 39(1): 56-63. doi:10.1038 / s41587-020-0601-5 ("Mo et al. 2021") and / or U.S. Patent Application Publication No. 2021 / 0077530 (March 18, 2021) ("the '530 Publication"), the contents of both of which are incorporated herein in their entireties. In some embodiments, the ADR is a 4-1BB ADR, an OX40 ADR, or a CD40L ADR, such as those disclosed in the '530 Publication.

[0010] In various embodiments, the engineered immune cells further express an antigen binding protein, e.g., the engineered immune cells comprise a nucleic acid encoding an antigen binding protein. In one embodiment, the antigen binding protein is a chimeric antigen receptor (CAR). In one embodiment, a nucleic acid encoding an antigen binding protein (e.g., a CAR) is inserted into or is inserted into a disrupted TAP2, NLRC5, β2M, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, thereby disrupting the locus. In various embodiments, the antigen binding protein is a T cell receptor (TCR). In one embodiment, a nucleic acid encoding a TCR is inserted into or is inserted into a disrupted TAP2, NLRC5, β2M, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, thereby disrupting the locus. In one embodiment, the engineered immune cells further comprise one or more genomic modifications, such as modifications of an endogenous locus, e.g., one or more of the endogenous CD70 gene, the endogenous TCRa gene, and the endogenous CD52 gene. In various embodiments, the one or more genomic modifications cause a reduction or absence of functional expression of the gene that comprises the modification.

[0011] The engineered immune cells can be derived from cells from any of a variety of sources. The engineered immune cells can be prepared or derived from cells, such as stem cells or immune cells, from a person other than the person to whom the engineered immune cells are administered, such as a donor other than the recipient (e.g., a healthy volunteer), or from cells, such as stem cells or immune cells, from the person to whom the engineered immune cells are administered (the recipient), or can be derived from one or more induced pluripotent stem cells (iPSCs). In one embodiment, the immune cells are immune cells obtained from a healthy volunteer, obtained from a patient, or derived from iPSCs.

[0012] In another aspect, the disclosure provides a method of making the engineered immune cells disclosed herein. In one embodiment, the method includes the use of any gene editing technology, such as TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems, and / or any known gene knockdown method, such as, for example, reducing the functional expression of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK using any of a variety of RNA-based technologies (e.g., shRNA, antisense RNA, miRNA, siRNA, see, e.g., Lam et al., Mol. Ther.-Nucleic Acids 4:e252 (2015), doi:10.1038 / mtna.2015.23; Sridharan and Gogtay, Brit. J. Clin. Pharmacol. 82: 659-72 (2016)). In one embodiment, the method comprises or further comprises the introduction of a nucleic acid encoding an antigen binding protein, such as a CAR or TCR, into the engineered immune cell. In one embodiment, the method comprises or further comprises the introduction of one or more genomic modifications of one or more of the endogenous TCRa gene and the endogenous CD52 gene into the genome of the engineered immune cell. In one embodiment, the one or more genomic modifications completely or partially disrupt and / or prevent the functional expression of one or more of the endogenous TCRa gene and the endogenous CD52 gene.

[0013] In various embodiments of the disclosure, the functional expression level of any one or more of TAP2, NLRC5, β2M, TRAC, CIITA, RFX5, RFXAP, and RFXANK is measured by determining the surface expression level of one or more HLA proteins (such as HLA-A proteins or HLA-B proteins), or beta 2 microglobulin (B2M), or both one or more HLA proteins and B2M, on the surface of the engineered immune cells, or by flow cytometry. In some embodiments, expression of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in engineered immune cells of the disclosure is assayed by measuring the degree to which the engineered immune cells survive in the presence of effector cells (e.g., T cells) compared to the degree to which corresponding non-engineered but otherwise comparable (e.g., identical) immune cells survive under the same conditions.

[0014] In some embodiments, immune cells engineered to functionally express reduced levels of one or both of NLRC5 and TAP2 compared to corresponding cells not so engineered are further engineered to express one or more proteins selected from the group consisting of HLA-E, HLA-E single chain trimer, HLA-G, HLA-G single chain trimer, UL18, UL18 single chain trimer, HLA-A2, HLA-A2 single chain trimer, human cytomegalovirus (HCMV) US11, and / or to express reduced levels of any one or more of β2m, TRAC, CIITA, RFXANK, RFXAP, and RFX5, as achieved by knockout or knockdown as described herein.

[0015] In another aspect, the present disclosure provides a population of engineered immune cells comprising the engineered immune cells provided herein. In one embodiment, the population of engineered immune cells comprises the engineered immune cells provided herein. 4 ~10 10In various embodiments, the population of engineered immune cells comprises at least one of the 10 engineered immune cells provided herein. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 The engineered immune cells include

[0016] In another aspect, the disclosure provides a population of engineered immune cells, where, for example, 75% or less of the cells functionally express one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK. In one embodiment, 75% or less of the cells of the population functionally express TAP2. In one embodiment, 75% or less of the cells of the population functionally express NLRC5. In one embodiment, 75% or less of the cells of the population functionally express RFX5.

[0017] In another aspect, the disclosure provides a population of engineered immune cells, wherein at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 75%, 90%, 95%, or 100% of the engineered immune cells functionally express any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at a reduced level. In some embodiments, the reduced expression level, as presented relative to an appropriate control (e.g., expression level in a corresponding non-engineered immune cell), is, for example, 0% when both chromosomal copies of the gene are knocked out (e.g., by methods using TALEN, zinc finger, Cas-CLOVER, and / or CRISPR / Cas systems), or, for example, 50% when one of two chromosomal copies of the gene is knocked out and there is no compensatory increase in expression of the other chromosomal copy of the gene. In some embodiments, the reduced expression level exhibited compared to the expression level in an unmanipulated immune cell is between 0% and 90%, or between any two values ​​intermediate between 0% and 90%, for example, between 10% and 90%, between 25% and 90%, between 25% and 75%, between 10% and 50%, between 25% and 50%, between 50% and 90%, and between 50% and 75%. Values ​​within one or more of such intermediate ranges can be obtained, for example, when only one chromosomal copy of a gene is knocked out and compensatory mechanisms cause increased expression levels of the remaining chromosomal copy, or when reduced expression is achieved by methods other than gene knockout, such as known knockdown methods, for example using any of a variety of RNA-based technologies (e.g., shRNA antisense RNA, miRNA, siRNA; see, e.g., Lam et al., Mol. Ther.-Nucleic Acids 4:e252 (2015), doi:10.1038 / mtna.2015.23; Sridharan and Gogtay, Brit. J. Clin. Pharmacol. 82: 659-72 (2016)).In some embodiments of the populations of engineered immune cells disclosed herein, some or all of the engineered cells, e.g., 5-10%, 10-25%, 25-50%, 50-90%, or 90-100%, exhibit reduced expression levels of MHC class I and / or MHC class II proteins or complexes at the cell surface compared to a suitable control.

[0018] In various embodiments, a population of engineered immune cells or a population of immune cells comprising engineered immune cells disclosed herein comprises at least 10% engineered T cells, at least 20% engineered T cells, at least 30% engineered T cells, at least 40% engineered T cells, at least 50% engineered T cells, at least 75% engineered T cells, at least 90% engineered T cells, or 100% engineered T cells. Also provided herein are cell populations, wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 90%, or 100% of the cell population are engineered immune cells, e.g., engineered T cells, as disclosed herein.

[0019] In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, or at least 90% of the engineered cells of the population further express an antigen binding protein. In some embodiments, the antigen binding protein is a chimeric antigen receptor (CAR). In some embodiments, the nucleic acid encoding the CAR is inserted into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, and / or such insertion disrupts the locus. In some embodiments, the antigen binding protein is a T cell receptor (TCR). In some embodiments, the nucleic acid encoding the TCR is inserted into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, and / or such insertion disrupts the locus.

[0020] In certain embodiments of the population of engineered immune cells disclosed herein, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, or at least 90% of the engineered cells further comprise one or more genomic modifications of one or more of the endogenous TCRa gene and the endogenous CD52 gene.

[0021] In one embodiment, the population of engineered immune cells is derived from one or more immune cells obtained from a person, e.g., from a person other than the person to whom they are administered, e.g., obtained from a donor other than the recipient or from a healthy volunteer, or is derived from one or more immune cells obtained from a patient, e.g., the person to whom they are administered, or is derived from one or more iPSCs.

[0022] In another aspect, the disclosure provides a method of making a population of engineered immune cells as described herein, the method comprising reducing functional expression of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP and RFXANK using a gene editing technique, e.g., a gene editing technique selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas system.

[0023] In another aspect, the disclosure provides a method of determining or measuring the functional expression level of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP and / or RFXANK in cells of a population of engineered immune cells disclosed herein, wherein the functional expression level is measured by determining the surface expression level of an HLA protein, beta 2 microglobulin (B2M), or both an HLA protein and B2M, on the surface of the engineered immune cells, and / or by flow cytometry.

[0024] In various embodiments of the engineered immune cells described herein, and of the populations of engineered immune cells disclosed herein, the engineered immune cells, or one or more of the engineered immune cells of the population, e.g., at least 10%, 20%, 30%, 40%, 50%, 75%, 90% or 100% of the engineered immune cells of the population, are further engineered (e.g., by any method disclosed herein or by any other method known to one of skill in the art) to express one or more proteins selected from the group consisting of HLA-E, HLA-E single chain trimer, HLA-G, HLA-G single chain trimer, UL18, UL18 single chain trimer, HLA-A2, HLA-A2 single chain trimer, and human cytomegalovirus (HCMV) US11, by any method described herein or by any other method known to one of skill in the art.

[0025] In another aspect, the present disclosure provides a pharmaceutical composition comprising an engineered immune cell as disclosed herein, wherein the composition further comprises one or more pharma- ceutically acceptable carriers or excipients.In another aspect, the present disclosure provides a pharmaceutical composition comprising a population of engineered immune cells as disclosed herein, wherein the composition further comprises one or more pharma- ceutically acceptable carriers or excipients. In various embodiments of the composition, the engineered immune cells, or one or more of the engineered immune cells of the population, e.g., at least 10%, 20%, 30%, 40%, 50%, 75%, 90% or 100% of the engineered immune cells of the population, express one or more proteins selected from the group consisting of HLA-E, HLA-E single chain trimer, HLA-G, HLA-G single chain trimer, UL18, UL18 single chain trimer, HLA-A2, HLA-A2 single chain trimer, and human cytomegalovirus (HCMV) US11, and / or do not express or express reduced levels of any one or more of CIITA, RFXANK, RFXAP, and RFX5, as achieved by knockout or knockdown as described herein.

[0026] In another aspect, the disclosure provides a method of treating a condition in a patient comprising administering to the patient an engineered immune cell disclosed herein, a population of engineered immune cells disclosed herein, or a pharmaceutical composition disclosed herein, In one embodiment, the condition is selected from the group consisting of solid tumors and liquid tumors.

[0027] In another aspect, the disclosure provides a method of reducing the surface expression level of an MHC class I protein in an engineered immune cell, in some embodiments to about 75% or less of the expression level of the MHC class I protein in a non-engineered immune cell, the method comprising reducing the functional expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP and RFXANK, for example, to about 75% or less of the expression level in a non-engineered immune cell. In one embodiment, the engineered immune cell functionally expresses TAP2 at a level that is 75% or less of the expression level in a non-engineered immune cell. In one embodiment, the engineered immune cell functionally expresses NLRC5 at a level that is 75% or less of the expression level in a non-engineered immune cell. In one embodiment, the engineered immune cell disclosed herein exhibits a reduced expression level of an MHC class I protein or complex at the cell surface compared to a suitable control.

[0028] In one embodiment, the engineered immune cells disclosed herein are engineered T cells. In certain embodiments, the engineered immune cells disclosed herein, e.g., the engineered T cells disclosed herein, further express an additional protein, e.g., a protein encoded by exogenous DNA or a protein whose expression is brought about by further engineering of the cell. In some embodiments, the additional protein is an antigen binding protein. In some embodiments, the antigen binding protein is a chimeric antigen receptor (CAR). In some embodiments, a nucleic acid encoding an additional protein, e.g., an antigen binding protein (e.g., a CAR), is introduced into the cell by the methods described herein. In some embodiments, the nucleic acid is introduced into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, or the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus is disrupted by insertion of a nucleic acid encoding an additional protein, e.g., an antigen binding protein (e.g., a CAR).

[0029] In one embodiment of the methods disclosed herein, the antigen binding protein is a T cell receptor (TCR) component, such as TCR α (TCR alpha), TCR β (TCR beta), TCR γ (TCR gamma), or TCR δ (TCR delta). In one embodiment, a nucleic acid encoding a TCR component is inserted into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, or the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus is disrupted by insertion of a nucleic acid encoding a TCR component.

[0030] In further embodiments of the methods disclosed herein, the engineered immune cells further comprise one or more genomic modifications (e.g., knockout, deletion, knockdown, insertion) of one or more of the endogenous TCR alpha gene and the endogenous CD52 gene. In some embodiments, the genomic modification partially or completely eliminates functional expression of the modified gene. In further embodiments of the methods disclosed herein, the immune cells are obtained from a person, e.g., from a donor other than the person to whom the cells are administered, e.g., from a healthy volunteer, or obtained from a patient, e.g., the person to whom the cells are administered, or are immune cells derived from iPSCs.

[0031] In another aspect, the disclosure provides a method of making a population of engineered immune cells as disclosed herein, the method comprising using a gene editing technique, e.g., a gene editing technique selected from the group consisting of TALEN, zinc finger, shRNA, Cas-CLOVER, and CRISPR / Cas system, to reduce the functional expression of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in a cell, e.g., an immune cell. In one embodiment, the gene editing technique introduces a mutation in one or more of the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK loci. In one embodiment, the mutation is any one or more of an insertion (e.g., an insertion of one or more nucleotides or base pairs, e.g., an insertion of a sequence encoding a protein), a deletion of one or more nucleotides or base pairs, and a substitution of one or more nucleotides or base pairs.

[0032] In one embodiment of the methods disclosed herein, the functional expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is measured by determining the surface expression level of an HLA protein, beta 2 microglobulin (B2M), or both HLA and B2M, on the surface of the engineered immune cells, or by flow cytometry. In one embodiment, the degree of reduction in surface expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is determined relative to the corresponding expression level in a cell of the same type that is not gene-edited.

[0033] In one embodiment of the methods disclosed herein, the engineered immune cells express an additional protein, which may be any desired protein, including an antigen binding protein. In one embodiment, the antigen binding protein comprises a CAR. In one embodiment, a nucleic acid encoding a CAR is inserted into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, or such an insertion disrupts the locus. In another embodiment, the antigen binding protein is a T cell receptor (TCR) component. In one embodiment, a nucleic acid encoding a TCR is inserted into a disrupted TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, or RFXANK locus, or such an insertion disrupts the locus. In one embodiment, the method comprises reducing the functional expression level of the disrupted locus. In one embodiment, the method comprises reducing the functional expression level of TAP2. In one embodiment, the method comprises reducing the functional expression level of NLRC5. In one embodiment, the method comprises reducing the functional expression level of RFX5. In one embodiment, the method comprises reducing the functional expression level of CIITA. In certain embodiments, the method further comprises introducing into the engineered immune cell one or more genomic modifications in one or more of the genes encoding TCR components (e.g., the TCRa gene and the CD52 gene).

[0034] In another aspect, the disclosure provides a method of reducing peptide diversity presented on a cell surface, for example by MHC class I, comprising reducing the functional expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK, in some embodiments, to about 90% or less (in other words, at least about a 10% reduction, e.g., to a level of about 90 or less compared to a control level of 100) or to about 75% or less of a correspondingly unaltered equivalent cell. In various embodiments, reducing the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK comprises the use of a gene editing technique selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems (e.g., including Cas9, Cas12, and MAD7). In one embodiment, the method comprises reducing the functional expression level of TAP2. In one embodiment, the method comprises reducing the functional expression level of NLRC5. In one embodiment, the method comprises reducing the functional expression level of RFX5. In one embodiment, the method comprises reducing the functional expression level of CIITA. In one embodiment, the degree of reduction in the expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is determined relative to the corresponding expression level in a cell of the same type that is not gene-edited. In one embodiment, the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is measured by determining the surface expression level of HLA, beta 2 microglobulin (B2M), or both HLA and B2M on the surface of the engineered immune cells.

[0035] In another aspect, the disclosure provides a method of decreasing T cell-mediated killing of allogeneic cells, comprising reducing the functional expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in an engineered immune cell, such as an engineered T cell. In some embodiments, the method results in a reduced expression level, presented as compared to the expression level in a non-engineered immune cell, which is, for example, 0% when both chromosomal copies of the gene are knocked out, or, for example, 50% when one of two chromosomal copies of the gene is knocked out without a compensatory increase in expression of the other chromosomal copy of the gene. In some embodiments, the method results in a reduced expression level, presented as compared to the expression level in an unmanipulated immune cell, which is 0%-90% or between any two values ​​in between 0%-90%, such as 10%-90%, 25%-90%, 25%-75%, 10%-50%, 25%-50%, 50%-90%, and 50%-75%. In some embodiments, reducing the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK includes the use of gene editing techniques, such as any one or more of TALEN, zinc finger, Cas-CLOVER, and / or CRISPR / Cas systems, and / or any one or more known knockdown methods, such as those employing any of a variety of RNA-based techniques (e.g., shRNA, antisense RNA, miRNA, siRNA). In one embodiment, the method includes reducing the functional expression level of TAP2. In one embodiment, the method comprises reducing the functional expression level of NLRC5. In one embodiment, the method comprises reducing the functional expression level of RFX5. In one embodiment, the method comprises reducing the functional expression level of CIITA.In one embodiment, the degree of reduction in expression levels of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP and RFXANK is determined relative to the corresponding expression levels in a cell of the same type that has not been so altered and / or engineered.

[0036] In one embodiment of the method of reducing T cell-mediated killing of allogeneic cells disclosed herein, the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is measured by determining the surface expression level of HLA, beta 2 microglobulin (B2M), or both HLA and B2M on the surface of the engineered immune cells. In one embodiment, the surface expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK is measured by flow cytometry. In one embodiment, the method includes introducing one or more genomic modifications in one or more of the genes encoding the TCR components (e.g., the TCRa gene and the CD52 gene).

[0037] In some embodiments of the methods of reducing T cell-mediated killing of allogeneic cells disclosed herein, the functional expression level of any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in an engineered immune cell of the disclosure is assayed by measuring the degree to which the engineered immune cell survives in the presence of an effector cell (e.g., a T cell) compared to the degree to which a non-engineered but otherwise comparable (e.g., identical) immune cell survives under the same conditions.

[0038] In certain aspects, the disclosure provides engineered immune cells that functionally express one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK at reduced levels. In various embodiments, TRAC and RFX5 are functionally expressed at reduced levels. In various embodiments, the cell exhibits reduced expression levels of MHC class I proteins or complexes at the cell surface, reduced expression levels of MHC class II proteins or complexes at the cell surface, or reduced expression levels of MHC class I proteins or complexes at the cell surface and reduced expression levels of MHC class II proteins or complexes at the cell surface. In various embodiments, the cell is a T cell.

[0039] In various embodiments, the engineered immune cells disclosed herein further express an additional protein. In some embodiments, the additional protein is an antigen binding protein. In some embodiments, the antigen binding protein is a chimeric antigen receptor (CAR). In some embodiments, the antigen binding protein is a T cell receptor (TCR). In certain embodiments, the engineered immune cells comprise a nucleic acid encoding the additional protein. In some embodiments, the nucleic acid encoding the additional protein is located within a disrupted TAP2, NLRC5, CIITA, RFX5, RFXANK, β2m, or RFXAP locus and / or causes or results in a disruption within such locus.

[0040] In various embodiments, the engineered immune cells disclosed herein comprise, or further comprise, one or more genomic modifications of one or more of the endogenous TCRa (TCRα or TCR alpha) gene and the endogenous CD52 gene.

[0041] In various embodiments, the engineered immune cells disclosed herein are or are derived from immune cells obtained from healthy volunteers or patients, or are derived from iPSCs.

[0042] In one aspect, the disclosure provides a method of making an engineered immune cell as disclosed herein, comprising reducing functional expression of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK using a gene editing technology selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems. [Brief description of the drawings]

[0043] [Figure 1] FIG. 1 shows a non-comprehensive view of the interactions between peptide-MHC complexes on allogeneic CAR-T cells (center) and receptors on host T cells (top) and NK cells (left, right, bottom). Through the TCR, T cells kill foreign cells by recognizing non-self peptides presented by MHC (labeled "HLA" in FIG. 1). Through a myriad of inhibitory receptors (KIR2DL and KIR3DL, NKG2A, LILRB1), NK cells recognize "loss of self" as the absence of MHC interaction. In FIG. 1, T cell killing is activated because the HLA complexes of the allogeneic cells present foreign antigens (elongated rectangles) and the TCR / CD3 complex of the T cells recognizes the antigen as foreign. As shown, there is no "loss of self" because the allogeneic cells present HLA complexes classical HLA, HLA-E, and HLA-G (each of which presents a peptide), and therefore NK cell killing is not activated. [Figure 2A] Figures 2A-2B. T cells lacking surface MHC induce degranulation and selective killing of NK cells. Figure 2A: Quantification of flow cytometry data measuring NK cell degranulation after 3 hours of incubation in the presence of monensin (GolgiStop) and anti-CD107a antibody, alone or with autologous or allogeneic T cells ± b2m KO. [Figure 2B]Figure 2B. Composition of surface MHC+ (b2m WT) and surface MHCneg (b2m KO) targets incubated with NK cells over time. The composition of b2m WT:b2m KO was 1:1 (50%:50%) at the start of incubation. Mean + SD is shown for three experiments. WT, wild type. KO, knockout. [Diagram 3] Figure 3 shows the biosynthetic and peptide loading pathways of MHC class I in nucleated mammalian cells. Multiple MHC-related genes (MHC class I, b2m, TAP, proteasome components) are under the transcriptional control of IFN-γ (IFN gamma)-inducible NLRC5. The major pathway by which MHC class I molecules are loaded with diverse proteasome-generated peptides is TAP-dependent. Alternatively, a relatively small number of less diverse signal peptides released by signal peptide peptidase (SPP) can be loaded onto MHC class I molecules independently of the proteasome and TAP. [Figure 4A] Figures 4A-4B. Pseudocolor flow cytometry plots measuring β2m levels on the surface of T cells after CRISPR / Cas9-mediated knockout of the TAP2 or b2m genes (in cells from an HLA-A2+ donor) in Figure 4A, and the NLRC5 gene (in cells from an HLA-A2- donor) in Figure 4B. KO, knockout. [Figure 4B] Figures 4A-4B. Pseudocolor flow cytometry plots measuring β2m levels on the surface of T cells after CRISPR / Cas9-mediated knockout of the TAP2 or b2m genes (in cells from an HLA-A2+ donor) in Figure 4A, and the NLRC5 gene (in cells from an HLA-A2- donor) in Figure 4B. KO, knockout. [Diagram 5]Figure 5. Gene-edited (β2m, TAP2, or NLRC5 KO) T cells exposed to IFN-γ experience minimal changes in surface MHC class I expression. Primary T cells were edited via CRISPR / Cas9 with either TRAC sgRNA and β2m, TAP2, or NLRC5 sgRNA and purified by TCR αβ depletion. Cells were then treated with recombinant IFN-γ for 72 hours and then analyzed by flow cytometry for MHC class I expression using anti-HLA-A, B, C antibody (clone W6 / 32). Mean + SD of MFI for three technical replicates is shown. KO, knockout; TRAC, T cell receptor α constant. [Figure 6A] Figures 6A-6C. T cells lacking β2m, TAP2, or NLRC5 are protected from T cell-mediated antigen-specific killing. Figure 6A. Primary T cells from HLA-A2+ donors (left bar of each pair) or from HLA-A2- donors (right bar of each pair) were edited via CRISPR with mock, TAP2, or b2m sgRNA and then transduced with BFP-P2A-MART1 antigen. Unpurified edited cells were then incubated alone (no effector) or with autologous effector T cells transduced with MART1-specific F5 TCR (effector) for 72 hours. Data are gated on unedited (surface β2m+), antigen-expressing (BFP+) cells, and plotted for % viability of unedited BFP+ cells in the presence vs. absence of effector cells (mean + SD of three technical replicates). [Figure 6B] Figure 6B. Same experiment as in Figure 6A, except data is gated on edited (surface β2mneg), antigen-expressing (BFP+) cells and plotted for % viability of edited BFP+ cells in the presence vs. absence of effector cells (mean + SD of 3 technical replicates). NA, not applicable as "no KO" control has no edited cells. [Figure 6C]Figure 6C. Similar experiment to Figure 6A and 6B, but performed independently with the addition of NLRC5 KO. Data are gated on edited (surface β2mneg), antigen-expressing (BFP+) cells and plotted for % viability of edited BFP+ cells in the presence vs. absence of effector cells (mean + SD of two technical replicates). NA, not applicable as there are no edited cells in the "no KO" control; KO, knockout. [Figure 7] Figure 7: b2m, TAP2, or NLRC5 KO reduces T cell alloreactivity. Pan T cells were isolated and gene edited for TRAC KO and b2m, TAP2, or NLRC5 KO and co-incubated with effector pan T cells primed against irradiated target PBMCs for 1 week. After 48 h of co-incubation at a 1:1 E:T ratio, viable targets were counted via flow cytometry. % Viability is calculated as the absolute number of persisting targets at a fixed volume / time acquisition and normalized to the effector-free condition. Mean ± SD of 2-3 technical replicates for each effector donor is shown. Three allogeneic donors were tested. [Figure 8A] Figures 8A-8C. TAP2 KO and NLRC5 KO T cells are less susceptible to NK-mediated killing than b2m KO T cells. Pan T cells edited to be TRAC KO and b2m, TAP2, or NLRC5 KO were co-incubated with allogeneic effector NK cells at 0:1, 1:1, or 5:1 NK:T cell ratios in the presence of 1000 U / mL IL-2 for 72 hours. Viable targets were counted by flow cytometry. Figure 8A. Pseudocolored flow cytometry plots show viable target T cells under the indicated conditions. Data are from incubations with NK cells from a single allogeneic donor. [Figure 8B] Figure 8B. Measurement of the percentage of viable cells that are surface b2m negative (i.e., b2m, TAP2, or NLRC5 KO) normalized to the lack of NK effector cells. Mean ± SD of four data points is shown (two technical replicates for each of two allogeneic NK donors). [Figure 8C] FIG. 8C. Representative histogram of surface β2m staining T cells in the experiment from FIG. 8B. NK1054 and NK1241 are the two allogeneic NK donors. The vertical dotted line approximates the mean fluorescence intensity of surface β2m on TRAC KO T cells (without MHC-related modifications) and is included as a visual reference throughout the histogram plots. Coinc, co-incubation; KO, knockout; [Figure 9A] Figures 9A-9B. Preliminary manufacturability assessment of the disclosed gene editing strategies. Figure 9A. Primary T cells gene-edited for TRAC KO in combination with β2m, TAP2, or NLRC5 KO can be transduced with 10G1K DLL3 CAR at rates comparable to unedited cells. Pan T cells were gene-edited via CRISPR / Cas9 and transduced with lentivirus to enable DLL3 CAR expression. Transduction efficiency was determined by flow for the percentage of cells expressing the BFP reporter gene co-expressed on the CAR lentiviral vector. [Figure 9B] Figure 9B. Proliferation of engineered CAR T cells was determined by counting viable cells on a ViCell cell counter and normalizing to the initial seeding density on day 0. [Figure 10A] Figures 10A-10C. NLRC5 KO does not impair DLL3 CAR-mediated cytotoxicity. Figure 10A. Short-term killing of DLL3high-expressing WM266.4 tumor cells and (Figure 10B) DLL3low-expressing DMS273 tumor cells. Tumor cell growth curves generated via live cell imaging with anti-DLL3 CAR+ T cells at various E:T ratios. Figure 10C. Continuous killing of DLL3high-expressing WM266.4 tumor cells. Mean ± SD of technical triplicates are shown. [Figure 10B]Figures 10A-10C. NLRC5 KO does not impair DLL3 CAR-mediated cytotoxicity. Figure 10A. Short-term killing of DLL3high-expressing WM266.4 tumor cells and (Figure 10B) DLL3low-expressing DMS273 tumor cells. Tumor cell growth curves generated via live cell imaging with anti-DLL3 CAR+ T cells at various E:T ratios. Figure 10C. Continuous killing of DLL3high-expressing WM266.4 tumor cells. Mean ± SD of technical triplicates are shown. [Figure 10C] Figures 10A-10C. NLRC5 KO does not impair DLL3 CAR-mediated cytotoxicity. Figure 10A. Short-term killing of DLL3high-expressing WM266.4 tumor cells and (Figure 10B) DLL3low-expressing DMS273 tumor cells. Tumor cell growth curves generated via live cell imaging with anti-DLL3 CAR+ T cells at various E:T ratios. Figure 10C. Continuous killing of DLL3high-expressing WM266.4 tumor cells. Mean ± SD of technical triplicates are shown. [Figure 11A] Figures 11A-11B. Screening of sgRNAs for RFX complex KO. Validation of RFX5 KO for reduced dual MHC-I / II expression. Mean fluorescence intensity (MFI) of MHC-I (Figure 11A) and MHC-II (Figure 11B) assessed by flow cytometry 7 days after gene editing. [Figure 11B] Figures 11A-11B. Screening of sgRNAs for RFX complex KO. Validation of RFX5 KO for reduced dual MHC-I / II expression. Mean fluorescence intensity (MFI) of MHC-I (Figure 11A) and MHC-II (Figure 11B) assessed by flow cytometry 7 days after gene editing. [Figure 12A] 12A-12B. Downregulation of MHC-I / II expression. Mean fluorescence intensity (MFI) of (FIG. 12A) MHC-I and (FIG. 12B) MHC-II in gene-edited T cells assessed by flow cytometry 5 days after gene editing for three independent T cell donors. Means ± SD of biological triplicates are shown. [Figure 12B]12A-12B. Downregulation of MHC-I / II expression. Mean fluorescence intensity (MFI) of (FIG. 12A) MHC-I and (FIG. 12B) MHC-II in gene-edited T cells assessed by flow cytometry 5 days after gene editing for three independent T cell donors. Means ± SD of biological triplicates are shown. [Figure 13A] Figures 13A-13B. Expansion of immune evasion T cells. Figure 13A. Expansion of T cells with TRAC KO + / - immune evasion KO modifications in three independent donors. Fold expansion compared to gene edited cell numbers on day 2. Mean ± SD of two technical replicates is shown. [Figure 13B] FIG. 13B. Proliferation of graft T cells in the absence of IL-2. 20K cells were seeded in 96-well plates with 20 IU / mL IL-2. On day 4, medium was changed without IL-2. Medium was refed every 2-3 days thereafter. Means ± SD of 6 technical replicates are shown. [Figure 14A] Figures 14A-14C. Downregulation of MHC-I / II expression reduces T cell alloreactivity. T cells from two allogeneic donors were primed for 1 week against irradiated cells from the graft donor. Figure 14A: CD4+ cells, Figure 14B: CD8+ cells, or Figure 14C: pan T cells were subsequently purified and co-cultured with graft T cells at a 1:1 E:T ratio for 48 hours. Unidirectional killing of graft T cells assessed by flow cytometry. Mean ± SD of technical triplicates is shown. % Viability = cell number / (effector-free cell number) x 100. Graft cells were edited to generate KO cells (TRAC, β2m, NLRC5, or RFX5) and KO graft cells were co-cultured with primed CD4+, CD8+, and pan T cells. The number of graft KO cells that survived co-culture with primed T cells was determined. A significantly higher percentage of RFX5 KO cells survived coculture with primed cells than TRAC KO cells. [Figure 14B]Figures 14A-14C. Downregulation of MHC-I / II expression reduces T cell alloreactivity. T cells from two allogeneic donors were primed for 1 week against irradiated cells from the graft donor. Figure 14A: CD4+ cells, Figure 14B: CD8+ cells, or Figure 14C: pan T cells were subsequently purified and co-cultured with graft T cells at a 1:1 E:T ratio for 48 hours. Unidirectional killing of graft T cells assessed by flow cytometry. Mean ± SD of technical triplicates is shown. % Viability = cell number / (effector-free cell number) x 100. Graft cells were edited to generate KO cells (TRAC, β2m, NLRC5, or RFX5) and KO graft cells were co-cultured with primed CD4+, CD8+, and pan T cells. The number of graft KO cells that survived co-culture with primed T cells was determined. A significantly higher percentage of RFX5 KO cells survived coculture with primed cells than TRAC KO cells. [Figure 14C] Figures 14A-14C. Downregulation of MHC-I / II expression reduces T cell alloreactivity. T cells from two allogeneic donors were primed for 1 week against irradiated cells from the graft donor. Figure 14A: CD4+ cells, Figure 14B: CD8+ cells, or Figure 14C: pan T cells were subsequently purified and co-cultured with graft T cells at a 1:1 E:T ratio for 48 hours. Unidirectional killing of graft T cells assessed by flow cytometry. Mean ± SD of technical triplicates is shown. % Viability = cell number / (effector-free cell number) x 100. Graft cells were edited to generate KO cells (TRAC, β2m, NLRC5, or RFX5) and KO graft cells were co-cultured with primed CD4+, CD8+, and pan T cells. The number of graft KO cells that survived co-culture with primed T cells was determined. A significantly higher percentage of RFX5 KO cells survived coculture with primed cells than TRAC KO cells. [Figure 15A]Figures 15A-15B. Minimal killing of NLRC5 KO and RFX5 KO T cells by allogeneic NK cells. Figure 15A. NK cells were isolated from allogeneic PBMCs and co-cultured with graft T cells at a 1:1 E:T ratio in the presence of 1000 IU / mL IL-2 for 48 hours. Unidirectional killing of graft T cells assessed by flow cytometry. Graft cells were edited to generate KO (TRAC) or double KO (TRAC and one of β2m, NLRC5, or RFX5) and KO graft cells were co-cultured with NK cells. The number of graft KO cells that survived co-culture with NK cells was determined. Approximately half or more of the TRAC+NLRC5 KO cells and approximately half or more of the TRAC+RFX5 KO cells survived co-culture with NK cells. Mean ± SD of biological triplicates is shown. NK cells were obtained from PBMCs from three different donors. Each data point represents killing by cells from one of the donors. % Viability = cell number / (effector-free cell number) x 100. [Figure 15B] FIG. 15B. Allogeneic NK cell proliferation after co-culture of allo-PBMCs with graft T cells at an E:T ratio of 10:1 for 7 days. Mean ± SD of 6 biological replicates is shown. The data shows that TRAC KO + / - RFX5 KO or NLRC5 KO does not induce significant NK cell proliferation. Allogeneic NK cell numbers were measured after co-culture with gene-edited graft cells and compared to cell numbers in the absence of graft cells. A fold change means that NK cells were essentially not activated / expanded. In this assay, PBMCs were cultured with graft T cells and NK cells were counted based on NK-specific markers. *: p<0.05; ****: p<0.001, one-way ANOVA Holm-Sidak. [Figure 16]Figure 16. Survival of graft T cells with various gene knockouts (KO) after co-culture with allogeneic PBMCs from either of two donors. Allogeneic PBMCs were co-cultured with TRAC KO graft T cells with various gene editing modifications (TRAC KO alone or with one of β2m, NLRC5, and RFX5 KO) at an E:T ratio of 10:1 for 9 days. Graft T cell survival was determined by flow cytometry and normalized to graft T cells cultured without any effectors. Mean ± SD of technical triplicates is shown. [Figure 17A] Figures 17A-17D. US11 overexpression enhances alloreactive T cell avoidance. Figure 17A. US11 overexpression reduces MHC-I expression and can be combined with NLRC5 KO to significantly reduce MHC-I levels. [Figure 17B] Figure 17B. US11 overexpression reduces killing by primed alloreactive T cells. US11 can be combined with NLRC5 KO to further reduce killing. Graft cells were cultured with primed T cells at a 1:1 E:T ratio for 48 hours and survival was determined by flow cytometry. Mean ± SD of three donors tested is shown. [Figure 17C] FIG 17C. US11 overexpression minimally increases NK screening. When combined with NLRC5 KO, NK reactivity is increased, but not to the same extent as b2m KO. Graft cells were cultured with allogeneic NK cells at a 1:1 E:T ratio with 1000 IU / mL IL-2 for 48 hours and survival was determined by flow cytometry. Mean ± SD of 3 donors tested is shown. [Figure 17D] Figure 17D. US11 and US11+NLRC5 KO T cells persist better than TRAC KO alone. Graft cells were cultured with allogeneic PBMC cells at an E:T ratio of 10:1 with 20 IU / mL IL-2 for 9 days and survival was determined by flow cytometry. Mean ± SD of 3 donors tested is shown. % survival = cell number / (effector-free cell number) x 100. [Figure 18]FIG. 18 is a schematic diagram showing a lentiviral vector (LVV) encoding HCMV US11. [Figure 19A] Figures 19A-19B. Gene-edited T cells were cultured with various concentrations of recombinant IFN-γ for 72 hours. Surface expression of MHC-I (Figure 19A) and MHC-II (Figure 19B) was assessed by flow cytometry. Changes in MHC-I and MHC-II expression were determined relative to vehicle (0 U / mL IFN-γ). Means ± SD of technical triplicates are shown. [Figure 19B] Figures 19A-19B. Gene-edited T cells were cultured with various concentrations of recombinant IFN-γ for 72 hours. Surface expression of MHC-I (Figure 19A) and MHC-II (Figure 19B) was assessed by flow cytometry. Changes in MHC-I and MHC-II expression were determined relative to vehicle (0 U / mL IFN-γ). Means ± SD of technical triplicates are shown. [Figure 20A] Figures 20A-20D. Generation and analysis of stealth modified CD19 CAR T cells. The percentage of CD19 CAR+ cells with TRAC KO±additional stealth modifications is shown in Figure 20A. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The kinetics of cell expansion during manufacturing is shown in Figure 20B. Mean ± SD of n=4 donors. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The CD4 / CD8 ratio of one representative donor is shown in Figure 20C. The T cell memory phenotype of one representative donor is shown in Figure 20D. [Figure 20B] Figures 20A-20D. Generation and analysis of stealth modified CD19 CAR T cells. The percentage of CD19 CAR+ cells with TRAC KO±additional stealth modifications is shown in Figure 20A. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The kinetics of cell expansion during manufacturing is shown in Figure 20B. Mean ± SD of n=4 donors. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The CD4 / CD8 ratio of one representative donor is shown in Figure 20C. The T cell memory phenotype of one representative donor is shown in Figure 20D. [Figure 20C] Figures 20A-20D. Generation and analysis of stealth modified CD19 CAR T cells. The percentage of CD19 CAR+ cells with TRAC KO±additional stealth modifications is shown in Figure 20A. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The kinetics of cell expansion during manufacturing is shown in Figure 20B. Mean ± SD of n=4 donors. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The CD4 / CD8 ratio of one representative donor is shown in Figure 20C. The T cell memory phenotype of one representative donor is shown in Figure 20D. [Figure 20D] Figures 20A-20D. Generation and analysis of stealth modified CD19 CAR T cells. The percentage of CD19 CAR+ cells with TRAC KO±additional stealth modifications is shown in Figure 20A. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The kinetics of cell expansion during manufacturing is shown in Figure 20B. Mean ± SD of n=4 donors. Control: TRAC KO CD19 CAR T cells; NTD: TRAC KO non-transduced T cells. The CD4 / CD8 ratio of one representative donor is shown in Figure 20C. The T cell memory phenotype of one representative donor is shown in Figure 20D. [Figure 21A]Figures 21A-21B. Proliferation of host CD8 T cells and survival of graft CD19 CAR T cells with various KOs after co-culture with allogeneic PBMCs. Five unique graft / PBMC pairs are shown. Allogeneic PBMCs were co-cultured with TRAC KO CD19 CAR T cells with various gene editing modifications (TRAC KO alone or with one of the following KOs: β2m, NLRC5, RFX5, or CIITA) at an E:T ratio of 10:1 for 9 days. Proliferation of host CD8 T cells (Figure 21A) was determined by flow cytometry using anti-CD8 antibody (BioLegend, Cat. No. 344709) and anti-HLA-A2 antibody (BioLegend Cat. No. 343326) and normalized to PBMCs cultured without graft cells. Survival of graft CAR T cells (Figure 21B) was determined by flow cytometry and normalized to graft CD19 CAR T cells cultured without effector cells. Each point represents each unique PBMC / graft pair and shows the mean±SEM for five pairs. [Figure 21B] Figures 21A-21B. Proliferation of host CD8 T cells and survival of graft CD19 CAR T cells with various KOs after co-culture with allogeneic PBMCs. Five unique graft / PBMC pairs are shown. Allogeneic PBMCs were co-cultured with TRAC KO CD19 CAR T cells with various gene editing modifications (TRAC KO alone or with one of the following KOs: β2m, NLRC5, RFX5, or CIITA) at an E:T ratio of 10:1 for 9 days. Proliferation of host CD8 T cells (Figure 21A) was determined by flow cytometry using anti-CD8 antibody (BioLegend, Cat. No. 344709) and anti-HLA-A2 antibody (BioLegend Cat. No. 343326) and normalized to PBMCs cultured without graft cells. Survival of graft CAR T cells (Figure 21B) was determined by flow cytometry and normalized to graft CD19 CAR T cells cultured without effector cells. Each point represents each unique PBMC / graft pair and shows the mean±SEM for five pairs. [Figure 22A]Figures 22A-22C. The persistence and anti-tumor activity of CD19 CAR T cells with different gene knockouts (KO) were evaluated in vivo in an allogeneic T cell rejection model. CD19 CAR T cells with different gene editing modifications (TRAC KO alone or with one of β2m, NLRC5, or RFX5 KO) were injected into NSG mice previously implanted with human T cells from an allogeneic donor and Raji tumor cells (Figure 22A). The persistence (Figure 22B) and anti-tumor activity (Figure 22C) of CAR T cells in peripheral blood were determined by flow cytometry and whole body bioluminescence, respectively. NT: non-transduced T cells with TRAC KO. Mean ± SEM is shown. [Figure 22B] Figures 22A-22C. The persistence and anti-tumor activity of CD19 CAR T cells with different gene knockouts (KO) were evaluated in vivo in an allogeneic T cell rejection model. CD19 CAR T cells with different gene editing modifications (TRAC KO alone or with one of β2m, NLRC5, or RFX5 KO) were injected into NSG mice previously implanted with human T cells from an allogeneic donor and Raji tumor cells (Figure 22A). The persistence (Figure 22B) and anti-tumor activity (Figure 22C) of CAR T cells in peripheral blood were determined by flow cytometry and whole body bioluminescence, respectively. NT: non-transduced T cells with TRAC KO. Mean ± SEM is shown. [Figure 22C] Figures 22A-22C. The persistence and anti-tumor activity of CD19 CAR T cells with different gene knockouts (KO) were evaluated in vivo in an allogeneic T cell rejection model. CD19 CAR T cells with different gene editing modifications (TRAC KO alone or with one of β2m, NLRC5, or RFX5 KO) were injected into NSG mice previously implanted with human T cells from an allogeneic donor and Raji tumor cells (Figure 22A). The persistence (Figure 22B) and anti-tumor activity (Figure 22C) of CAR T cells in peripheral blood were determined by flow cytometry and whole body bioluminescence, respectively. NT: non-transduced T cells with TRAC KO. Mean ± SEM is shown. [Figure 23A]Figures 23A-23C. NK cell rejection of graft T cells with various gene knockouts (KO) was evaluated in a syngeneic mouse model (Figure 23A). In vitro expanded control (unedited) or gene edited (β2m or NLRC5 KO) mouse T cells were injected into syngeneic host mice with or without depletion of host NK cells. Graft T cells in peripheral blood were identified as CD45.1-CD45.2+ T cells by flow cytometry. Surface expression of MHC-1 (Figure 23A) and survival of graft cells (Figure 23C) were evaluated. [Figure 23B] Figures 23A-23C. NK cell rejection of graft T cells with various gene knockouts (KO) was evaluated in a syngeneic mouse model (Figure 23A). In vitro expanded control (unedited) or gene edited (β2m or NLRC5 KO) mouse T cells were injected into syngeneic host mice with or without depletion of host NK cells. Graft T cells in peripheral blood were identified as CD45.1-CD45.2+ T cells by flow cytometry. Surface expression of MHC-1 (Figure 23A) and survival of graft cells (Figure 23C) were evaluated. [Figure 23C] Figures 23A-23C. NK cell rejection of graft T cells with various gene knockouts (KO) was evaluated in a syngeneic mouse model (Figure 23A). In vitro expanded control (unedited) or gene edited (β2m or NLRC5 KO) mouse T cells were injected into syngeneic host mice with or without depletion of host NK cells. Graft T cells in peripheral blood were identified as CD45.1-CD45.2+ T cells by flow cytometry. Surface expression of MHC-1 (Figure 23A) and survival of graft cells (Figure 23C) were evaluated. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] The present disclosure provides a gene editing strategy to provide a therapeutic allogeneic cell product that does not induce or induces a reduced rejection response by the recipient's immune system. This allows the cell product to persist longer in the recipient, thus promoting and / or improving the therapeutic effect. The strategy minimizes the diversity of peptides presented by the allogeneic cell product while also minimizing perturbation of the level of MHC on the cell surface. This is achieved by genomic knockout of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK, whose products function in peptide presentation by cells.

[0045] In one embodiment of the present disclosure, the target of gene editing is the TAP2 component of the transporter associated with antigen processing (TAP). The major pathway by which peptides are loaded onto MHC class I molecules is TAP-dependent, i.e., peptides generated by the proteasome (or IFN-γ-induced immunoproteasome) are imported into the endoplasmic reticulum (ER) via TAP and then loaded onto MHC class I. A small number of peptides, which are substantially derived from signal peptides, are loaded via an alternative TAP and proteasome-independent pathway after cleavage of the signal sequence by ER-localized signal peptide peptidase (SPP). Knockout of TAP2 reduces surface β2m modestly (2-fold reduction after selection of KO cells) compared to the large (10-100-fold) reduction of surface β2m in β2m KO cells (see Figure 4A).

[0046] In a second embodiment of the present disclosure, the gene editing target is a member of the nucleotide-binding domain and leucine-rich repeat-containing receptor (NLR) family, called NLR caspase recruitment domain containing 5 (NLRC5). CRISPR / Cas9-mediated knockout of NLRC5 results in a 2.5-fold reduction in surface β2m levels (see FIG. 4B).

[0047] The gene editing strategy disclosed herein surprisingly reduces peptide presentation sufficiently to reduce cell death caused by recipient T cell response, while not reducing peptide presentation so much that killing by recipient NK cells is induced.Thus, the strategy provided herein represents a significant advance in allogeneic CAR-T therapy and other allogeneic cell therapy.The gene editing strategy provided herein provides an additional advantage that the NLRC5 knockout effect of suppressing MHC class I presentation should occur in the presence or absence of IFN-γ.This conclusion is supported by the observation that IFN-γ-induced MHC class I upregulation depends on NLRC5. general technology

[0048] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) Cold Spring Harbor Press, Oligonucleotide Synthesis (MJ Gait, ed., 1984), Methods in Molecular Biology, Humana Press, Cell Biology: A Laboratory Notebook (JECellis, ed., 1998) Academic Press, Animal Cell Culture (RIFreshney, ed., 1987), Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press, Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JBGriffiths, and DG Newell, eds., 1993-1998) J. Wiley and Sons, Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.), Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987), Current Protocols in Molecular Biology (FMAusubel et al., eds., 1987), PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (JE Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995). Gene editing techniques using, for example, TALEN, CRISPR / Cas9, and megaTAL nucleases are within the skill of the art and are described extensively in such publications as T. Gaj et al. This is explained thoroughly in the literature, including references such as, for example, U.S., et al., Genome-Editing Technologies: Principles and Applications, Cold Spring Harb Perspect Biol 2016;8:a023754, and the references therein. definition

[0049] As used herein, "autologous" refers to a cell, cell line, or cell population obtained from a subject that is used to treat said subject.

[0050] As used herein, "allogeneic" means that the cells or cell population used to treat a subject do not originate from the subject, but rather from a donor.

[0051] As used herein, the term "endogenous" refers to any material that is produced from or within an organism, cell, tissue, or system.

[0052] As used herein, the term "exogenous" refers to any material that is introduced from or produced outside an organism, cell, tissue, or system.

[0053] As used herein, "immune cells" refer to cells of hematopoietic origin that are functionally involved in the initiation and / or execution of innate and / or adaptive immune responses. Examples of immune cells include T cells, such as alpha / beta T cells and gamma / delta T cells, regulatory T (Treg) cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

[0054] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0055] As used herein, "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to a nucleotide sequence to be expressed. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate a recombinant polynucleotide.

[0056] The engineered immune cells of the present disclosure express, e.g., functionally express, one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at reduced levels as described herein, and optionally further comprise additional features. For example, they can functionally express an antigen binding protein from an exogenous nucleic acid encoding the antigen binding protein that has been introduced into the cell by the techniques described herein, and / or they can include a genomic modification, e.g., a mutation in an endogenous gene such as TCRa and / or CD52 that reduces or eliminates functional expression of the gene, and / or they can express one or more additional proteins from an exogenous nucleic acid encoding an antigen binding protein that has been introduced into the cell by the techniques described herein. As described herein, the engineered immune cells of the present disclosure can be derived, e.g., prepared, from cells, e.g., immune cells obtained from a variety of sources.

[0057] As used herein, "functionally expressing" a gene means that the gene is expressed and that the expression results in a functional gene end product. For example, if the gene codes for a protein, a cell functionally expresses the gene if the expression of the gene ultimately produces a properly functioning protein. Thus, a gene is not functionally expressed if it is not transcribed, or if the expression of the gene ultimately produces RNA that is not translated, or if the translation produces only a non-functional protein, e.g., the protein is not folded correctly or transported to its site of action (e.g., the membrane for membrane-bound proteins). Functional expression can be measured directly (e.g., by assaying the gene product itself) or indirectly (e.g., by assaying the effect of the gene product).

[0058] As used herein, "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence if it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).

[0059] As used herein, "expression control sequence" refers to a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or inducible promoter, or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed.

[0060] "Promoter" and "promoter sequence" are used interchangeably and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. It is understood by those skilled in the art that different promoters can induce the expression of a gene in different tissues or cell types, or at different developmental stages, or in response to different environmental or physiological conditions.

[0061] In any of the vectors of the present disclosure, the vector optionally comprises a promoter as disclosed herein.

[0062] A "host cell" includes an individual cell or cell culture that can be or has been a recipient of a vector for incorporation of a polynucleotide insert. A host cell includes the progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected in vivo with a polynucleotide of the disclosure.

[0063] As used herein, the term "extracellular ligand-binding domain" refers to an oligopeptide or polypeptide capable of binding to a ligand. Preferably, the domain is capable of interacting with a cell surface molecule. For example, the extracellular ligand-binding domain can be selected to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state. The term "stalk domain" is used herein to refer to any oligopeptide or polypeptide that functions to link a transmembrane domain to an extracellular ligand-binding domain. In particular, the stalk domain is used to provide additional flexibility and accessibility to the extracellular ligand-binding domain.

[0064] The term "intracellular signaling domain" refers to the portion of a protein that transduces effector functional signals and induces the cell to carry out a specialized function.

[0065] As used herein, a "costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors. Examples of costimulatory molecules include ligands that specifically bind to CD27, CD28, CD8, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and CD83, etc.

[0066] "Costimulatory ligand" refers to a molecule on an antigen-presenting cell that specifically binds to a cognate co-stimulatory signal molecule on a T cell, thereby providing a signal that mediates T cell responses, including, but not limited to, proliferation activation, differentiation, etc., in addition to the primary signal provided by, for example, engagement of the TCR / CD3 complex with a peptide-loaded MHC molecule. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1 BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, M1 CB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, agonists or antibodies that bind to the Toll ligand receptor, and ligands that specifically bind B7-H3. Costimulatory ligands may also include, but are not limited to, CD27, CD28, 4-1 These include antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, ligands that specifically bind to BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LTGHT, NKG2C, B7-H3, and CD83.

[0067] An "antibody" is an immunoglobulin molecule capable of specific binding to a target, such as a carbohydrate, polynucleotide, lipid, or polypeptide, via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term encompasses intact polyclonal or monoclonal antibodies, as well as antigen-binding fragments thereof (such as Fab, Fab', F(ab')2, and Fv), and any other modified configuration of an immunoglobulin molecule that contains an antigen recognition site, including, for example, but not limited to, single chain (scFv) and domain antibodies (including, for example, shark antibodies and camelid antibodies), and fusion proteins that contain antibodies. Antibodies include antibodies of any class (or subclass thereof), such as IgG, IgA, or IgM, and an antibody need not be of any particular class. Depending on the antibody amino acid sequence of the constant region of its heavy chain, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, several of which can be further divided into subclasses (isotypes), e.g., lgG1, lgG2, lgG3, lgG4, lgA1, and lgA2. The heavy chain constant regions that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0068] As used herein, the term "antigen-binding fragment" or "antigen-binding portion" of an antibody refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen. The antigen-binding function of an antibody can be performed by a fragment of an intact antibody. Examples of binding fragments encompassed within the term "antigen-binding fragment" of an antibody include Fab, Fab', F(ab')2, an Fd fragment consisting of the VH and CH1 domains, an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, a single-domain antibody (dAb) fragment (see, e.g., Ward et al., Nature 341:544-546, 1989), and isolated complementarity-determining regions (CDRs).

[0069] An antibody, antibody conjugate, or polypeptide that "specifically binds" to a target is a term well understood in the art, and methods for determining such specific binding are also well known in the art. A molecule is said to exhibit "specific binding" if it reacts or associates with a particular cell or substance more frequently, more rapidly, with a longer duration, and / or with a higher affinity than with another cell or substance. An antibody "specifically binds" to a target if it binds with higher affinity, avidity, more readily, and / or with a longer duration than it binds to other substances. By reading this definition, it is also understood that, for example, an antibody (or moiety or epitope) that specifically binds to a first target may or may not specifically bind to a second target. Thus, "specific binding" does not necessarily require (although it can include) exclusive binding.

[0070] The "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. As known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three complementarity determining regions (CDRs), also known as hypervariable regions. The CDRs in each chain are held together in close proximity by the FRs and, together with the CDRs from the other chain, contribute to the formation of the antigen-binding site of the antibody. There are several techniques for determining CDRs, for example, approaches based on interspecies sequence variability (i.e., Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda MD)), and approaches based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al., 1997, J. Molec. Biol. 273:927-948), the Chothia system (i.e., Chothia and Lesk, J. Mol. Biol. (1987) 196(4):901-917). As used herein, CDRs may refer to CDRs defined by either approach or by a combination of both approaches.

[0071] The "CDRs" of a variable domain are the amino acid residues in the variable region identified according to the Kabat, Chothia definition, the combined Kabat and Chothia, AbM, contact, and / or structural definition, or any method of CDR determination known in the art. Antibody CDRs can be identified as hypervariable regions as originally defined by Kabat et al. See, e.g., Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington DC. The locations of CDRs may also be identified as structural loop structures as originally described by Chothia et al. See, e.g., Chothia et al., Nature 342:877-883, 1989. Other approaches to CDR identification include the "AbM definition," a compromise between Kabat and Chothia, derived using Oxford Molecular's AbM antibody modeling software (now Accelrys®), or the "contact definition" of CDRs based on observed antigen contacts as described in MacCallum et al., J. Mol. Biol., 262:732- 745, 1996. In another approach, referred to herein as the "structural definition" of CDRs, the positions of CDRs may be identified as residues that contribute enthalpic wise to antigen binding. See, e.g., Makabe et al., Journal of Biological Chemistry, 283:1 156-1 166, 2008. Still other CDR boundary definitions may not strictly follow one of the above approaches, but they may nevertheless be shortened or extended in light of predictions or experimental findings that certain residues or groups of residues, or even the entire CDR, do not significantly affect antigen binding, but overlap with at least a portion of the Kabat CDR. As used herein, CDR may refer to a CDR defined by any approach known in the art, including a combination of approaches.The methods used herein may utilize CDRs defined according to any of these approaches. In any given embodiment containing two or more CDRs, the CDRs may be defined according to any of the Kabat, Chothia, extended, AbM, contact, AHo and / or structural definitions.

[0072] Antibodies of the disclosure can be produced using techniques well known in the art, such as recombinant techniques, phage display techniques, synthetic techniques, or a combination of such techniques or other techniques readily known in the art (see, e.g., Jayasena, SD, Clin. Chem., 45: 1628-50, 1999, and Fellouse, FA, et al, J. Mol. Biol., 373(4):924-40, 2007).

[0073] As known in the art, "polynucleotide" or "nucleic acid" as used interchangeably herein refers to a chain of nucleotides of any length, including DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the chain. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, "cap" substitutions with one or more analogs of naturally occurring nucleotides, internucleotide modifications, such as those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of polynucleotides. Additionally, any of the hydroxyl groups normally present in the sugar may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to provide for additional linkages to additional nucleotides, or conjugated to a solid support. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups.Polynucleotides can also contain similar forms of ribose or deoxyribose sugars commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, alpha or beta anomeric sugars, epimeric sugars such as arabinose, xylose, or lyxose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs, and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which phosphate is replaced by P(O)S ("thioate"), P(S)S ("dithioate"), (O)NR2 ("amidate"), P(O)R, P(O)OR', CO, or CH2 ("formacetal"), where each R or R' is independently H, or a substituted or unsubstituted alkyl (1-20C) optionally containing an ether (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need be identical. The foregoing description applies to all polynucleotides referred to herein, including RNA and DNA.

[0074] As used herein, "transfection" refers to the uptake of exogenous or heterologous RNA or DNA by a cell. A cell is "transfected" by exogenous or heterologous RNA or DNA when such RNA or DNA is introduced into the cell. A cell is "transformed" by exogenous or heterologous RNA or DNA when the transfected RNA or DNA affects a phenotypic change. The transforming RNA or DNA may be integrated (covalently linked) into chromosomal DNA constituting the genome of the cell.

[0075] As used herein, "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms.

[0076] As used herein, "substantially pure" refers to a material that is at least 50% pure (i.e., free from contaminants), more preferably at least 90% pure, more preferably at least 95% pure, even more preferably at least 98% pure, and most preferably at least 99% pure. The term "competes" as used herein with respect to antibodies means that a first antibody, or an antigen-binding fragment (or portion) thereof, binds to an epitope in a manner sufficiently similar to the binding of a second antibody or an antigen-binding portion thereof, such that the result of binding of the first antibody to its cognate epitope is detectably reduced in the presence of the second antibody, compared to the binding of the first antibody in the absence of the second antibody. The alternative possibility that binding of the second antibody to its epitope is also detectably reduced in the presence of the first antibody may, but need not, be the case. That is, a first antibody can inhibit binding of a second antibody to its epitope without that second antibody inhibiting binding of the first antibody to its respective epitope. However, if each antibody detectably inhibits the binding of the other antibody to its cognate epitope or ligand, whether to the same extent, a greater extent, or a lesser extent, the antibodies are said to "cross-compete" with each other for binding of their respective epitopes. Both competing and cross-competing antibodies are encompassed by the present disclosure. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or portion thereof), one of skill in the art will understand, based on the teachings provided herein, that such competing and / or cross-competing antibodies are encompassed and may be useful in the methods disclosed herein.

[0077] As used herein, "treatment" is an approach to obtain beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, one or more of the following: reduction (or destruction) of tumor or cancer cell proliferation, inhibition of metastasis of tumor cells, reduction or decrease in tumor size, amelioration of a disease (e.g., cancer), reduction of symptoms caused by a disease (e.g., cancer), improvement in the quality of life of a person suffering from a disease (e.g., cancer), reduction in the dosage of other drugs required to treat a disease (e.g., cancer), delay in progression of a disease (e.g., cancer), cure of a disease (e.g., cancer), and / or prolongation of survival of a subject with a disease (e.g., cancer).

[0078] "Ameliorating" refers to the alleviation or improvement of one or more symptoms compared to no treatment. "Ameliorating" also includes a shortening or reduction in the duration of symptoms. As used herein, an "effective dosage" or "effective amount" of a drug, compound, or pharmaceutical composition is an amount sufficient to produce any one or more beneficial or desired results. For prophylactic use, beneficial or desired results include eliminating or reducing the risk, reducing the severity, or delaying the onset of a disease, including biochemical, histological, and / or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes manifested during the development of the disease. For therapeutic use, beneficial or desired results include clinical results such as reducing or improving the incidence of one or more symptoms of various diseases or conditions (e.g., cancer, etc.), reducing the dose of other drugs required to treat the disease, enhancing the effect of another drug, and / or delaying the progression of the disease. An effective dosage may be administered in one or more administrations. For purposes of this disclosure, an effective dosage of a drug, compound, or pharmaceutical composition is an amount sufficient to achieve prophylactic or therapeutic treatment, either directly or indirectly. As understood in a clinical context, an effective dosage of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition. Thus, an "effective dosage" may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desired result can be or is achieved.

[0079] As used herein, a "subject" is any mammal, e.g., a human or a monkey. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, mice, and rats. In an exemplary embodiment, the subject is a human. In an exemplary embodiment, the subject is a monkey, e.g., a cynomolgus monkey.

[0080] As used herein, "vector" refers to a construct that can deliver and preferably express one or more genes or sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells such as production cells.

[0081] As used herein, "pharmaceutical acceptable carrier" or "pharmaceutical acceptable excipient" includes any material that, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers, such as phosphate buffered saline, water, emulsions such as oil / water emulsions, and various types of wetting agents. A preferred diluent for aerosol or parenteral administration is phosphate buffered saline (PBS) or normal (0.9%) saline. The compositions of the present disclosure that include such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, and Remington, The Science and Practice of Pharmacy 21 st Ed. Mack Publishing, 2005).

[0082] As used herein, "allo-reactivity" refers to the ability of T cells to recognize MHC complexes not present during thymic development. Alloreactivity is manifested clinically as host-versus-graft rejection and graft-versus-host disease.

[0083] References herein to "about" in conjunction with a value or parameter include (and describe) embodiments that are directed to plus or minus 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% of the value or parameter itself. For example, a reference to "about X" includes the reference to "X." Numeric ranges are inclusive of the numbers defining the range.

[0084] Wherever embodiments are described herein with the term "comprising," it is understood that otherwise similar embodiments are also provided that are described in terms of "consisting of" and / or "consisting essentially of."

[0085] When aspects or embodiments of the present disclosure are described in terms of a Markush group or other alternative grouping, the present disclosure encompasses not only the entire group recited as a whole, but also each individual member of the group and all possible subgroups of the main group, as well as the absence of one or more of the group members in the main group. The present disclosure also envisions the explicit exclusion of any one or more of the group members in the disclosed and / or claimed embodiments.

[0086] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification, including definitions, shall control. Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising" shall be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. Unless otherwise required by context, the singular shall include the plural, and the plural shall include the singular.

[0087] Exemplary methods and materials are described herein, although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure. The materials, methods, and examples are illustrative only and are not intended to be limiting.

[0088] An "antigen binding protein" comprises one or more antigen binding domains. As used herein, "antigen binding domain" refers to any polypeptide that binds to a specified target antigen. In some embodiments, the antigen binding domain binds to an antigen on a tumor cell. In some embodiments, the antigen binding domain binds to an antigen on a cell involved in a hyperproliferative disease, or to a viral or bacterial antigen.

[0089] Antigen-binding domains include, but are not limited to, antibody binding regions that are immunologically functional fragments. The term "immunologically functional fragment" (or "fragment") of an antigen-binding domain is a species of antigen-binding domain that contains a portion of an antibody that lacks at least some of the amino acids present in the full-length chain, but is still capable of specifically binding to a target antigen (regardless of how the portion is obtained or synthesized). Such fragments are biologically active in that they bind to the target antigen and can compete with other antigen-binding domains, including intact antibodies, for binding to a given epitope.

[0090] Immunologically functional immunoglobulin fragments include, but are not limited to, scFv fragments, Fab fragments (Fab', F(ab')2, etc.), one or more complementarity determining regions ("CDRs"), diabodies (a heavy chain variable domain and a light chain variable domain on the same polypeptide linked via a short peptide linker that is too short to allow pairing between the two domains on the same chain), domain antibodies, bivalent antigen-binding domains (comprising two antigen-binding sites), multispecific antigen-binding domains, and single-chain antibodies. These fragments may be derived from any mammalian source, including, but not limited to, human, mouse, rat, camelid, or rabbit. As will be appreciated by those skilled in the art, the antigen-binding domain may comprise non-proteinaceous components.

[0091] Variable regions typically exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions (CDRs). The CDRs of the two chains of each pair are typically aligned by the framework regions, which may allow binding to a specific epitope. From the N-terminus to the C-terminus, both light chain variable regions and heavy chain variable regions typically include the domains FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. By convention, the CDR regions in the heavy chain are typically referred to as HC CDR1, CDR2, and CDR3. The CDR regions in the light chain are typically referred to as LC CDR1, CDR2, and CDR3.

[0092] In some embodiments, an antigen-binding domain comprises one or more complementary binding regions (CDRs) present in a full-length light or heavy chain of an antibody, and in some embodiments comprises a single heavy and / or light chain or a portion thereof. These fragments may be produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of the antigen-binding domain comprising an intact antibody.

[0093] In some embodiments, the antigen-binding domain is an antibody or fragment thereof and comprises one or more of its complementarity determining regions (CDRs). In some embodiments, the antigen-binding domain is a single chain variable fragment (scFv) comprising light chain CDRs CDR1, CDR2, and CDR3, and heavy chain CDRs CDR1, CDR2, and CDR3.

[0094] The assignment of amino acids to each of the framework, CDR, and variable domains is typically based on the Kabat numbering (see, e.g., Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., NIH Publication 91-3242, Bethesda Md. 1991), Chothia numbering (see, e.g., Chothia & Lesk, (1987), J Mol Biol 196: 901-917; Al-Lazikani et al., (1997) J Mol Biol 273: 927-948; Chothia et al., (1992) J Mol Biol 227: 799-817; Tramontano et al., (1990) J Mol Biol 215(1): 175-82; and U.S. Pat. No. 7,709,226), contact numbering, the AbM scheme (Antibody The numbering scheme follows that of the AHo system (Honneger and Pluckthun, J Mol Biol (2001) 309(3):657-70), or the numbering scheme of the AHo system (Honneger and Pluckthun, J Mol Biol (2001) 309(3):657-70).

[0095] In some embodiments, the antigen-binding domain is a recombinant antigen receptor. As used herein, the term "recombinant antigen receptor" refers broadly to a non-naturally occurring surface receptor that includes an extracellular antigen-binding domain or an extracellular ligand-binding domain, a transmembrane domain, and an intracellular domain. In some embodiments, the recombinant antigen receptor is a chimeric antigen receptor (CAR). Chimeric antigen receptors (CARs) are well known in the art. A CAR is a fusion protein that includes an antigen recognition portion, a transmembrane domain, and a T cell activation domain (see, e.g., Eshhar et al., Proc. Natl. Acad. Sci. USA, 90(2): 720-724 (1993)).

[0096] In some embodiments, the intracellular domain of the recombinant antigen receptor comprises a costimulatory domain and an ITAM-containing domain, hi some embodiments, the intracellular domain of the recombinant antigen receptor comprises an intracellular protein or a functional variant thereof (e.g., truncation, insertion, deletion, or substitution).

[0097] As used herein, the term "extracellular ligand-binding domain" or "extracellular antigen-binding domain" refers to a polypeptide capable of binding to a ligand or antigen or interacting with a cell surface molecule such as a ligand or surface antigen. For example, an extracellular ligand-binding domain or antigen-binding domain may be selected to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state, e.g., a tumor-specific antigen. In some embodiments, the antigen-binding domain comprises an antibody, or an antigen-binding fragment or portion of an antibody. In some embodiments, the antigen-binding domain comprises an Fv or scFv, a Fab or scFab, a F(ab')2 or scF(ab')2, an Fd, a monobody, an affibody, a camelid antibody, a VHH antibody, a single domain antibody, or a DARPin. In some embodiments, the ligand-binding domain comprises a ligand that binds to a surface receptor, or a binding pair partner such as an ectodomain of a surface receptor that binds to the ligand.

[0098] The terms "stalk domain" or "hinge domain" are used interchangeably herein to refer to any polypeptide that functions to link a transmembrane domain to an extracellular ligand-binding domain. In particular, stalk domains are often used to provide additional flexibility and accessibility to the extracellular ligand-binding domain.

[0099] The term "intracellular signaling domain" refers to the portion of a protein that transduces effector functional signals and induces the cell to carry out a specialized function. vector

[0100] Expression vectors and methods for administration of polynucleotide compositions are known in the art and are further described herein.

[0101] In another aspect, the disclosure provides a method of making any of the polynucleotides described herein.

[0102] Polynucleotides complementary to any such sequences are also encompassed by the present disclosure. Polynucleotides may be single-stranded (coding or antisense) or double-stranded and may be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include HnRNA molecules, which contain introns and correspond one-to-one to DNA molecules, and mRNA molecules, which do not contain introns. Additional coding or non-coding sequences can, but need not, be present within the polynucleotides of the present disclosure, and polynucleotides can, but need not be, linked to other molecules and / or supporting materials.

[0103] The polynucleotide may comprise a native sequence (i.e., an endogenous sequence encoding an antibody or a portion thereof) or may comprise a variant of such a sequence. A polynucleotide variant contains one or more substitutions, additions, deletions, and / or insertions such that the immunoreactivity of the encoded polypeptide is not reduced compared to the native immunoreactive molecule. The effect on the immunoreactivity of the encoded polypeptide can generally be assessed as described herein. A variant preferably exhibits at least about 70% identity, more preferably at least about 80% identity, even more preferably at least about 90% identity, and most preferably at least about 95% identity to the polynucleotide sequence encoding the native antibody or a portion thereof. Two polynucleotide or polypeptide sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences are the same when aligned for maximum correspondence as described below. Comparison between two sequences is typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. As used herein, a "comparison window" refers to a segment of at least about 20, usually 30 to about 75, or 40 to about 50 contiguous positions, in which a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

[0104] Optimal alignment of sequences for comparison can be performed using the Megalign program of the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.) using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, MO, 1978, A model of evolutionary change in proteins-Matrices for detecting distant relationships. In Dayhoff, MO (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3, pp. 345-358; Hein J., 1990, Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, CA; Higgins, DG and Sharp, PM, 1989, CABIOS 5: 151-153; Myers, EW and Muller W., 1988, CABIOS 4: 11-17; Robinson, ED, 1971, Comb. Theor. 11:105, Santou, N., Nes, M., 1987, Mol. Biol. Evol. 4:406-425, Sneath, PHA and Sokal, RR, 1973, Numerical Taxonomy the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, CA, Wilbur, WJand Lipman, DJ, 1983, Proc. Natl. Acad. Sci. USA 80:726-730.

[0105] In some embodiments, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window of at least 20 positions, where the portion of the polynucleotide or polypeptide sequence within the comparison window can contain up to 20 percent, typically 5-15 percent, or 10-12 percent additions or deletions (i.e., gaps) compared to the reference sequence (no additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which identical nucleic acid bases or amino acid residues occur in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size), and multiplying the result by 100 to obtain the percentage of sequence identity.

[0106] Variants may also, or alternatively, be substantially homologous to a native gene, or a portion or complement thereof. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA sequence encoding a native antibody (or a complementary sequence).

[0107] Preferred "moderately stringent conditions" include a prewash in a solution of 5x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization overnight in 5x SSC at 50°C to 65°C, followed by two washes for 20 minutes each in 2x, 0.5x, and 0.2x SSC containing 0.1% SDS at 65°C.

[0108] As used herein, "highly stringent conditions" or "high stringency conditions" refers to (1) low ionic strength and high temperature for washing, e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50° C., and (2) the use of a denaturing agent such as formamide during hybridization, e.g., 50% (v / v) formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (3) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (4) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (5) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (6) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (7) or (3) 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg / m), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes in 0.2×SSC (sodium chloride / sodium citrate) at 42° C. and 50% formamide at 55° C., followed by a high stringency wash consisting of 0.1×SSC containing EDTA at 55° C. One of skill in the art will know how to adjust temperature, ionic strength, etc. as necessary to accommodate factors such as probe length.

[0109] It will be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that code for the polypeptides described herein. Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. Nevertheless, polynucleotides that differ due to differences in codon usage are specifically contemplated by this disclosure. Additionally, alleles of genes comprising the polynucleotide sequences provided herein are within the scope of this disclosure. An allele is an endogenous gene that is altered as a result of one or more mutations, such as deletions, additions, and / or substitutions of nucleotides. The resulting mRNA and protein can, but need not, have an altered structure or function. Alleles can be identified using standard techniques, such as hybridization, amplification, and / or database sequence comparison.

[0110] The polynucleotide of the present disclosure can be obtained by chemical synthesis, recombinant methods, or PCR.Methods of chemical polynucleotide synthesis are well known in the art and do not need to be described in detail herein.Those skilled in the art can use the sequences provided herein and commercially available DNA synthesis equipment to produce desired DNA sequences.

[0111] To prepare a polynucleotide using recombinant methods, as further described herein, a polynucleotide containing a desired sequence can be inserted into a suitable vector, and the vector can be introduced into a suitable host cell for replication and amplification. The polynucleotide can be inserted into the host cell by any means known in the art. The cell is transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, F-mating, or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or can be integrated into the host cell genome. The polynucleotide thus amplified can be isolated from the host cell by methods well known in the art. See, for example, Sambrook et al., 1989.

[0112] Alternatively, PCR allows the reproduction of DNA sequences. PCR techniques are well known in the art and are described, for example, in U.S. Patent Nos. 4,683,195, 4,800,159, 4,754,065 and 4,683,202, and in PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston, 1994.

[0113] RNA can be obtained by using the isolated DNA in an appropriate vector and inserting it into a suitable host cell. When the cell replicates and the DNA is transcribed into RNA, the RNA can be isolated using methods well known to those skilled in the art, for example, as described in Sambrook et al., 1989 (see above).

[0114] A suitable cloning vector can be constructed according to standard techniques or can be selected from the numerous cloning vectors available in the art. While the cloning vector selected may vary depending on the host cell intended to be used, useful cloning vectors are generally capable of autonomous replication, may have a single target for a specific restriction endonuclease, and / or may carry a marker gene that may be used to select clones containing the vector. Suitable examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Strategene, and Invitrogen.

[0115] An expression vector is generally a replicable polynucleotide construct containing a polynucleotide according to the present disclosure. It is implied that an expression vector must be replicable in a host cell, either as an episome or as an integral part of chromosomal DNA. Suitable expression vectors include, but are not limited to, plasmids, viral vectors including adenoviruses, adeno-associated viruses, retroviruses, cosmids, and expression vectors disclosed in International Publication WO 87 / 04462. Vector components may generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, suitable transcription control elements (such as promoters, enhancers, and terminators). For expression (i.e., translation), one or more translation control elements are also usually required, such as a ribosome binding site, a translation initiation site, and a stop codon.

[0116] A vector containing a polynucleotide of interest can be introduced into a host cell by any of a number of suitable means, including electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other agents, microprojectile bombardment, lipofection, and infection (e.g., where the vector is an infectious agent such as vaccinia virus). The choice of introduction vector or polynucleotide often depends on the characteristics of the host cell.

[0117] A polynucleotide encoding an antigen binding protein (e.g., a CAR) can be present in an expression cassette or expression vector (e.g., a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transfection of a mammalian host cell). In some embodiments, the polynucleotide or vector can include a nucleic acid sequence encoding a ribosomal skipping sequence, such as, for example, but not limited to, a sequence encoding a 2A peptide. The 2A peptide, identified in the aphthovirus subgroup of picornaviruses, causes the ribosomal "skip" from one codon to the next without the formation of a peptide bond between the two amino acids encoded by the codon (see, e.g., Donnelly and Elliott 2001; Atkins, Wills et al. 2007; Doronina, Wu et al. 2008). By "codon" is meant three nucleotides on an mRNA (or on the sense strand of a DNA molecule) that are translated by the ribosome into one amino acid residue. Thus, two polypeptides can be synthesized from a single adjacent open reading frame in an imRNA if the polypeptides are separated by a 2A oligopeptide sequence that is in frame. Such ribosome skipping mechanisms are well known in the art and are known to be used by several vectors for the expression of several proteins encoded by a single messenger RNA.

[0118] To direct the transmembrane polypeptide to the secretory pathway of the host cell, in some embodiments, a secretory signal sequence (also known as a leader sequence, prepro sequence, or pre sequence) is provided in the polynucleotide sequence or vector sequence. The secretory signal sequence is operably linked to the transmembrane nucleic acid sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide to the secretory pathway of the host cell. Secretory signal sequences are generally positioned 5' to the nucleic acid sequence encoding the polypeptide of interest, although certain secretory signal sequences can be positioned elsewhere in the nucleic acid sequence of interest (see, e.g., Welch et al., U.S. Pat. No. 5,037,743; Holland et al., U.S. Pat. No. 5,143,830). Those skilled in the art will recognize that considerable sequence variation is possible among these polynucleotide molecules, given the degeneracy of the genetic code. In some embodiments, the nucleic acid sequences of the present disclosure are codon-optimized for expression in mammalian cells, preferably for expression in human cells. Codon optimization refers to the replacement in a sequence of interest of codons that are generally rare in highly expressed genes of a given species with codons that are generally frequent in highly expressed genes of such species, such codons encoding the same amino acid as the codons being replaced.

[0119] Provided herein are methods of preparing immune cells for use in immunotherapy. In some embodiments, the methods include introducing an antigen binding protein (e.g., a CAR) into one or more immune cells, or introducing a polynucleotide encoding an antigen binding protein (e.g., a CAR), and growing the cells. In some embodiments, the present disclosure relates to a method of engineering immune cells, the method including providing an immune cell and expressing at least one antigen binding protein (e.g., a CAR) on the surface of the cell. In some embodiments, the method includes transfecting the cell with at least one polynucleotide encoding an antigen binding protein (e.g., a CAR) and expressing the at least one polynucleotide in the cell.

[0120] In some embodiments, the polynucleotide encoding the antigen binding protein (e.g., CAR) is present in one or more expression vectors for stable expression in cells. In some embodiments, the polynucleotide is present in a viral vector for stable expression in cells. In some embodiments, the viral vector can be, for example, a lentiviral vector or an adenoviral vector.

[0121] In some embodiments, the polynucleotide encoding the polypeptide according to the present disclosure can be, for example, an mRNA that is directly introduced into cells by electroporation. In some embodiments, CytoPulse technology can be used to transiently permeabilize live cells to deliver materials into cells. Parameters can be modified to determine conditions for high transfection efficiency with minimal mortality.

[0122] Also provided herein is a method for transfecting immune cells, such as T cells. In general, any conventional method known to those skilled in the art can be used, such as introducing either RNA, DNA or protein into cells by electroporation. See, for example, Luft and Ketteler, J. Biomolec Screening 20(8): 932 (2015) (DOI: 10.1177 / 1087057115579638). In some embodiments, the method includes contacting a T cell with RNA and applying to the T cell an agile pulse sequence consisting of: (a) an electrical pulse having a voltage range of about 2250-3000 V / centimeter; (b) a pulse width of 0.1 ms; (c) a pulse interval of about 0.2-10 ms between the electrical pulses of steps (a) and (b); (d) an electrical pulse having a voltage range of about 2250-3000 V / centimeter, with a pulse width of about 100 ms and a pulse interval of about 100 ms between the electrical pulse of step (b) and the first electrical pulse of step (c); and (e) four electrical pulses having a voltage of about 325 V, with a pulse width of about 0.2 ms and a pulse interval of 2 ms between each of the four electrical pulses.In some embodiments, a method of transfecting a T cell includes contacting the T cell with RNA and administering to the T cell (a) an electrical pulse having a voltage of about 1600, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2400, 2450, 2500, 2600, 2700, 2800, 2900, or 3000 V / centimeter, (b) a pulse width of 0.1 ms, (c) and a pulse interval of about 0.2, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ms between the electrical pulses of steps (a) and (b), (d) a pulse width of 100 ms, and and applying an agile pulse sequence including one electrical pulse of, for example, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2400, 2450, 2500, 2600, 2700, 2800, 2900, or 3000 V / centimeter having a voltage range of about 2250 to 3000 V / centimeter, with a pulse interval of 100 ms between the pulse and the first electrical pulse of step (c), and (e) four electrical pulses having a voltage of about 325 V, with a pulse width of about 0.2 ms, and a pulse interval of about 2 ms between each of the four electrical pulses. Any value included in the above value range is disclosed in the present application. The electroporation medium can be any suitable medium known in the art. In some embodiments, the electroporation medium has a conductivity ranging from about 0.01 to about 1.0 millisiemens.

[0123] In some embodiments, the method may further comprise genetically engineering the cells by inactivating or reducing the expression level of at least one gene expressing, for example, but not limited to, TAP2, NLRC5, β2m, CIITA, RFX5, RFXAP and RFXANK, components of the TCR, targets of immunosuppressants, HLA genes, and / or immune checkpoint proteins, such as, for example, PDCD1 or CTLA-4. By inactivating a gene, it is intended that the gene of interest is not expressed in the form of a functional protein. In some embodiments, the gene to be inactivated is one or more genes selected from the group consisting of, for example, but not limited to, NLRC5, TAP2, TCR alpha, TCR beta, β2-microglobulin ("β2m" or b2m), CD52, CIITA, RFX5, RFXAP, RFXANK, GR, deoxycytidine kinase (DCK), PD-1, and CTLA-4. In some embodiments, the method includes inactivating or reducing the expression level of one or more genes by introducing into the cell a rare-cutting endonuclease that can selectively inactivate genes by selective DNA cleavage. In some embodiments, the rare-cutting endonuclease can be, for example, a Transcription Activator-Like Effector Nuclease (TALE-nuclease or TALEN®), a megaTAL nuclease, or a Cas9 endonuclease.

[0124] In another aspect, the step of genetically modifying or engineering immune cells, e.g., T cells, can include modifying immune cells, e.g., T cells, by inactivating at least one gene expressing a target of an immunosuppressant, and optionally growing the cells in the presence of an immunosuppressant. Immunosuppressants are drugs that suppress immune function by one of several mechanisms of action. Immunosuppressants can reduce the extent and / or voracity of an immune response. Non-limiting examples of immunosuppressants include calcineurin inhibitors, target of rapamycin, interleukin-2 alpha chain blockers, inhibitors of inosine monophosphate dehydrogenase, inhibitors of dihydrofolate reductase, corticosteroids, and immunosuppressant antimetabolites. Some cytotoxic immunosuppressants act by inhibiting DNA synthesis. Other cytotoxic immunosuppressants may act via activation of T cells or by inhibiting activation of helper cells. The method according to the present disclosure allows for conferring immunosuppression resistance to T cells for immunotherapy, e.g., by inactivating the target of the immunosuppressant in the T cells. As non-limiting examples, the target of an immunosuppressant may be a receptor for the immunosuppressant, such as, but not limited to, CD52, glucocorticoid receptor (GR), FKBP family gene members, and cyclophilin family gene members.

[0125] Provided herein are compositions and methods for expression of antigen binding proteins (e.g., CAR) in conjunction with downregulation of functional expression of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK. Also provided are uses of such compositions and methods for improving the functional activity of immune cells, e.g., T cells, such as CAR-T cells. The methods and compositions provided herein are useful for improving the in vivo persistence and therapeutic efficacy of engineered immune cells, e.g., engineered T cells, such as CAR-T cells.

[0126] The engineered immune cells, e.g., the engineered T cells provided herein, express an antigen binding protein, e.g., a chimeric antigen receptor (CAR), and express any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at levels that are 75% or less, 50% or less, 25% or less, or 10% or less than the expression levels in non-engineered immune cells. Advantageously, the engineered immune cells provided herein exhibit improved persistence in vivo and / or increased resistance to rejection by the recipient's immune system compared to non-engineered cells.

[0127] In some embodiments, immune cells, such as, for example, T cells provided herein, are further modified, e.g., genetically modified, to express one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK at reduced levels compared to comparable cells that have not been so modified. For example, immune cells can be genetically modified to knock out all or a portion of one or more of the TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK loci such that the corresponding functional protein is not expressed at the cell surface, e.g., by deleting genomic DNA that includes part or all of the entire coding sequence of the locus, and / or genomic DNA that includes the transcriptional control, and / or promoter, and / or activation elements of the locus, and / or by introducing an insertion, deletion, or substitution mutation that prevents production of the functional protein.

[0128] In some embodiments, the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK in an immune cell (e.g., a T cell) of the disclosure may be reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to the functional expression level in a comparable cell that has not been engineered to reduce the corresponding expression level.

[0129] One or more antigen binding proteins, e.g., one or more CARs, can be synthesized in situ in the cell after introducing a polynucleotide construct encoding the protein into the cell. Alternatively, the antigen binding protein (e.g., CAR) can be produced outside the cell and then introduced into the cell. Methods for introducing a polynucleotide construct into a cell are known in the art. In some embodiments, stable transformation methods can be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, transient transformation methods can be used to transiently express the polynucleotide construct and the polynucleotide construct that is not integrated into the genome of the cell. In other embodiments, viral-mediated methods can be used. The polynucleotide can be introduced into the cell by any suitable means, such as, for example, a recombinant viral vector (e.g., retrovirus (including lentivirus), adenovirus), liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or particle bombardment. The polynucleotide can be included in a vector, such as, for example, a plasmid vector or a viral vector.

[0130] In some embodiments, the engineered immune cells (e.g., T cells) of the present disclosure may comprise at least one antigen binding protein (e.g., CAR). The engineered immune cells, e.g., T cells, are further modified, e.g., engineered, to express reduced levels of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK. In some embodiments, the engineered immune cells, e.g., engineered T cells, may comprise two or more different antigen binding proteins, e.g., two or more different CARs, each CAR comprising a different extracellular ligand binding domain.

[0131] In some embodiments of the engineered immune cells (e.g., T cells) provided herein, the CAR expressed by the cell can include an extracellular ligand binding domain (e.g., a single chain variable fragment (scFv)), a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular ligand binding domain, the transmembrane domain, and the intracellular signaling domain are in one polypeptide, i.e., in a single chain. Multi-chain CARs and polypeptides are also provided herein. In some embodiments, the multi-chain CAR contains a first polypeptide that includes a transmembrane domain and at least one extracellular ligand binding domain, and a second polypeptide that includes a transmembrane domain and at least one intracellular signaling domain, where the polypeptides are assembled together to form the multi-chain CAR.

[0132] The extracellular ligand binding domain specifically binds to a target of interest. In some embodiments, the target of interest may be any molecule of interest, including, but not limited to, BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD23, CD30, CD38, CD70, CD33, CD133, WT1, TSPAN10, MHC-PRAME, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2, or Claudin 18 isoform). 2), DLL3 (Delta-like protein 3, Drosophila delta homolog 3, Delta3), Muc17, Muc3, Muc3, Muc16, FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43), specifically including the human form of any of the exemplary targets listed.

[0133] In some embodiments, the antigen binding domain is selected from the group consisting of BCMA, MUC16 (also known as CA125), EGFR, EGFRvIII, MUC1, Flt-3, WT-1, CD20, CD23, CD30, CD38, CD70, CD33, CD133, MHC-WT1, TSPAN10, MHC-PRAME, MHC-NY-ESO1, HER2 (ERBB2), CAIX (carbonic anhydrase IX), LIV1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2, or Claudin 18 isoform 2), PSCA, DLL3 (Delta-like protein 3, Drosophila delta homolog 3, Delta 3), Mud 7 (mucin 17, Muc3, Muc3), FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), PSMA, MSLN, or RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43).CARs and / or antibodies targeting antigens are disclosed, for example, in: BCMA - WO2016 / 16630, WO2020 / 150339, WO2019 / 196713, WO2016 / 014565, WO2017 / 025038; MUC16: US9,169,328, WO2016 / 149368, WO2020 / 023888; EGFRvIII: WO2017 / 125830, WO2016 / 016341; Flt3: WO2018 / 222935, WO2020 / 010284, WO2017 / 173410; CD20: WO2018 / 145649, WO2020 / 010235, WO2020 / 123691;CD38: WO2017 / 025323;CD70: WO2019 / 152742, WO2018 / 152181;CD33: WO2016 / 014576;CD133: WO2018 / 072025;CS1: WO2019 / 030240;ROR1: WO2016 / 115559;CD19: WO2002 / 077029, US11,077,144;Claudin: WO2018 / 006882, WO2021 / 008463;DLL3: WO2020 / 180591;WT1: US2016 / 0152725A1, US7622119B2;CD23: US6011138A, CN1568198A;CD30: US10815301B2, US10808035B2;PRAME: US2018 / 0148503A1, WO2020 / 186204A1;LIV1: US2020 / 0231699A1;NKG2D: WO2021 / 179353A1, US2021 / 0269501A1;FAP alpha: US2020 / 0246383A1, US2021 / 0115102A1;PSMA: US2021 / 0277141A1, WO2020 / 108646A1;MSLN: CN109680002A, CN109628492A.

[0134] In some embodiments, the extracellular ligand binding domain comprises an scFv containing the light chain variable (VL) and heavy chain variable (VH) regions of a monoclonal antibody specific for a target antigen, which are linked by a flexible linker. Single chain variable region fragments are generated by linking the light and / or heavy chain variable regions by using a short linking peptide (Bird et al., Science 242:423-426, 1988). One example of a linking peptide is the GS linker, which has the amino acid sequence (GGGGS)3 (SEQ ID NO:22), which bridges approximately 3.5 nm between the carboxy terminus of one variable region and the amino terminus of the other variable region. Linkers of other sequences have been designed and used (Bird et al., 1988, supra). In general, the linker may be a short flexible polypeptide, preferably consisting of about 20 or fewer amino acid residues. Furthermore, the linker may be modified for additional functions, such as, for example, attachment of a drug or attachment to a solid support. Single chain variants can be produced recombinantly or synthetically. For synthetic production of scFvs, an automated synthesizer can be used. For recombinant production of scFvs, a suitable plasmid or other vector containing a polynucleotide encoding the scFv can be introduced into a suitable host cell, either a eukaryotic cell such as a yeast cell, a plant cell, an insect cell, or a mammalian cell, or a prokaryotic cell such as E. coli. A polynucleotide encoding the desired scFv can be produced by routine manipulations such as polynucleotide ligation. The resulting scFv can be isolated using standard protein purification techniques known in the art.

[0135] The intracellular signaling domain of the CAR according to the present disclosure is involved in intracellular signaling after the binding of the extracellular ligand binding domain to the target, resulting in the activation of immune cells and immune responses. The intracellular signaling domain has the ability to activate at least one of the normal effector functions of the immune cell in which the CAR is expressed. For example, the effector function of a T cell may be a cytolytic activity or a helper activity including cytokine secretion.

[0136] In some embodiments, the intracellular signaling domain for use in the CAR may be, for example, but not limited to, the cytoplasmic sequences of T cell receptors and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences, and any synthetic sequences with the same function. The intracellular signaling domain contains two distinct classes of cytoplasmic signaling sequences: sequences that initiate antigen-dependent primary activation, and sequences that act in an antigen-independent manner to generate secondary or costimulatory signals. Primary cytoplasmic signaling sequences can include signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs. ITAMs are well-defined signaling motifs found in the intracytoplasmic tails of various receptors that serve as binding sites for the syk / zap70 class of tyrosine kinases. Examples of ITAMs used in the present disclosure can include, by way of non-limiting example, ITAMs derived from ΤCRζ, FcRγ, FcRβ, FcRε, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In some embodiments, the intracellular signaling domain of a CAR may contain a CD3ζ signaling domain. In some embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a domain of a costimulatory molecule.

[0137] In some embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a portion of a costimulatory molecule selected from the group consisting of fragments of 4-1BB (GenBank: AAA53133) and CD28 (NP_006130 and its isoforms).

[0138] CARs are expressed on the surface membrane of cells. Thus, CARs can contain a transmembrane domain. Suitable transmembrane domains for CARs disclosed herein have the ability to (a) be expressed on the surface of a cell, e.g., an immune cell, such as, but not limited to, a lymphocytic cell (e.g., T cell) or a natural killer (NK) cell, and (b) interact with a ligand binding domain and an intracellular signaling domain to induce a cellular response of the immune cell against a given target cell. The transmembrane domain can be derived from either natural or synthetic sources. The transmembrane domain can be derived from any membrane-bound or transmembrane protein. As non-limiting examples, the transmembrane polypeptide can be a domain of the T cell receptor, such as the α, β, γ, or δ polypeptides that make up the CD3 complex, the IL-2 receptor, e.g., p55 (α chain), p75 (β chain or γ chain), the Fc receptor, particularly a subunit chain of the Fcγ receptor III, or a CD protein. Alternatively, the transmembrane domain can be synthetic and contain primarily hydrophobic residues such as leucine and valine. In some embodiments, the transmembrane domain is derived from the human CD8 α chain (e.g., NP_001139345.1). The transmembrane domain may further comprise a stalk domain between the extracellular ligand binding domain and said transmembrane domain. The stalk domain may comprise up to 300 amino acids, e.g., 10-100 amino acids or 25-50 amino acids. The stalk region may be derived from all or a portion of a naturally occurring molecule, such as all or a portion of the extracellular region of CD8, CD4, or CD28, or all or a portion of an antibody constant region. Alternatively, the stalk domain may be a synthetic sequence that corresponds to a naturally occurring stalk sequence, or may be an entirely synthetic stalk sequence. In some embodiments, the stalk domain is a portion of the human CD8 α chain (e.g., NP_001139345 and its isoforms). In another particular embodiment, the transmembrane domain comprises a portion of the human CD8 α chain.In some embodiments, the CAR disclosed herein may comprise an extracellular ligand binding domain that specifically binds to BCMA, CD8α human stalk and transmembrane domains, CD3ζ signaling domain, and 4-1BB signaling domain. In some embodiments, the CAR may be introduced into an immune cell as a transgene via a vector (e.g., a plasmid vector). In some embodiments, the vector, e.g., a plasmid vector, may also contain a selection marker, e.g., to provide for identification and / or selection of cells that have received the vector.

[0139] The CAR polypeptide may be synthesized in situ within the cell after introduction of a polynucleotide encoding the CAR polypeptide into the cell. Alternatively, the CAR polypeptide may be produced outside the cell and then introduced into the cell. Methods for introducing a polynucleotide construct into a cell are known in the art. In some embodiments, stable transformation methods may be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, transient transformation methods may be used to transiently express the polynucleotide construct and the polynucleotide construct that is not integrated into the genome of the cell. In other embodiments, viral-mediated methods may be used. The polynucleotide may be introduced into the cell by any suitable means, such as, for example, a recombinant viral vector (e.g., a retrovirus (e.g., a lentivirus), an adenovirus), a liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or particle bombardment. The polynucleotide may be included in a vector, such as, for example, a plasmid vector or a viral vector.

[0140] Also provided herein are immune cells, such as T cells, such as isolated T cells obtained according to any one of the methods described herein. Any immune cell capable of expressing heterologous DNA can be used to express an antigen binding protein of interest (e.g., CAR), and also engineered to have reduced levels of expression of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell can be derived from, for example, but not limited to, stem cells. The stem cell can be an adult stem cell, a non-human embryonic stem cell, more particularly, a non-human stem cell, an umbilical cord blood stem cell, a progenitor cell, a bone marrow stem cell, an induced pluripotent stem cell, a totipotent stem cell, or a hematopoietic stem cell. A representative human cell is a CD34+ cell. The isolated cells may also be dendritic cells, killer dendritic cells, mast cells, NK cells, B cells, or T cells selected from the group consisting of inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or helper T lymphocytes. In some embodiments, the cells may originate from the group consisting of CD4+ T-lymphocytes and CD8+ T-lymphocytes. In some embodiments, immune cells (e.g., T cells), such as isolated T cells, are further engineered, e.g., engineered by the methods described herein (e.g., known gene editing techniques employing, e.g., TALEN, CRISPR / Cas9, or megaTAL nucleases, to partially or entirely delete or disrupt one or more of the TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK loci), such that they express reduced levels of the corresponding proteins compared to comparable cells that have not been engineered to express reduced or modified levels of the corresponding proteins.

[0141] The engineered immune cells provided herein can include one or more mimotope sequences that allow for cell sorting to enrich for a population of cells engineered as described herein, e.g., cells expressing an antigen binding protein, and / or provide a safety switch mechanism to inactivate the immune cells, e.g., limit adverse effects, after the cells are administered to a patient or recipient. Such mimotope sequences and their use in cell sorting and as safety switches are known in the art and are described, for example, in US2018 / 0002435, which is incorporated herein by reference in its entirety.

[0142] Prior to expansion and genetic modification, the cell source can be obtained from a subject through a variety of non-limiting methods. Cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, any number of T cell lines available and known to those skilled in the art can be used. In some embodiments, the cells can be derived from a healthy donor, a subject diagnosed with cancer, or a subject diagnosed with an infectious disease. In some embodiments, the cells can be part of a mixed population of cells that exhibit different phenotypic characteristics.

[0143] Also provided herein are cell lines derived from immune cells, e.g., engineered T cells, that have been modified, e.g., transformed or engineered according to any of the methods described herein. In some embodiments, the engineered immune cells, e.g., engineered T cells according to the present disclosure, comprise a polynucleotide that encodes an antigen binding protein (e.g., a CAR) and has been further modified or engineered, e.g., genetically modified, to express, e.g., functionally express, at a reduced level, one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK.

[0144] Immune cells, e.g., T cells, of the present disclosure can be derived from, or can be expressed in, any of the manner described in, for example, but not limited to, U.S. Patent Nos. 6,352,694, 6,534,055, 6,905,680, 6,692,964, 5,858,358, 6,887,466, 6,905,681, 7,144,575, 7,067,318, 7,172, 7,182, 7,183, 7,184, 7,185, 7,186, 7,187, 7,188, 7,189, 7,203, 7,204, 7,205, 7,206, 7,207, 7,208, 7,209, 7,303, 7,304, 7,305, 7,306, 7,307, 7,308, 7,309, 7,401, 7,402, 7,403 ... The cells can be activated and expanded either before or after modification using methods generally described in U.S. Patent Application Publication Nos. 20060121005, 20060121005, 200702223, 20070 ... For example, chemicals such as calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitogenic lectins such as phytohemagglutinin (PHA) can be used to generate activation signals for immune cells, e.g., T cells.

[0145] In some embodiments, a population of T cells may be stimulated in vitro, for example, by contact with an anti-CD3 antibody or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in combination with a calcium ionophore. Co-stimulation of an accessory molecule on the surface of the T cells uses a ligand that binds to the accessory molecule. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions appropriate to stimulate proliferation of the T cells. Suitable conditions for T cell culture include an appropriate medium (e.g., Minimum Essential Medium, RPMI Medium 1640, or X-VIVO™ 5, (Lonza)) that can contain factors necessary for growth and survival, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGFβ, and TNF, or any other additives for cell growth known to those of skill in the art. Other additives for cell growth include, but are not limited to, detergents, Plasmanate®, and reducing agents such as N-acetyl-cysteine ​​and 2-mercaptoethanol. The medium can include RPMI 1640 (as described herein), AIM V, DMEM, MEM, alpha-MEM, F-12, X-VIVO™ 10, X-VIVO™ 15 and X-VIVO™ 20, OpTmizer™, with additional amino acids, sodium pyruvate and vitamins, and is serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones and / or cytokines in sufficient amounts for the growth and proliferation of T cells. Antibiotics, such as penicillin and streptomycin, are included only in the experimental cultures and not in the cultures of cells injected into the subject. Target cells are maintained under conditions necessary to support proliferation, such as, for example, an appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air+5% CO2). Immune cells, such as T cells, exposed to various stimulation times can exhibit different characteristics.

[0146] In some embodiments, the cells of the present disclosure can be expanded by co-culturing with tissue or cells. The cells can also be expanded in vivo, for example, in the blood of a subject after administration of the cells to the subject.

[0147] In another aspect, the disclosure provides a composition (such as a pharmaceutical composition) comprising any of the cells of the disclosure. In some embodiments, the composition comprises a T cell comprising a polynucleotide encoding an antigen binding protein (e.g., a CAR). The cell is further engineered to express reduced levels of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK. The composition comprises, for example, an engineered immune cell (e.g., a T cell) of the disclosure, e.g., an immune cell that expresses an antigen binding protein (e.g., a CAR) and functionally expresses one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK at a reduced level compared to a comparable cell that has not been engineered to functionally express a reduced or altered level of the corresponding protein, or a cell population comprising an engineered immune cell, e.g., a T cell of the disclosure, and one or more pharma- ceutically acceptable carriers or excipients.

[0148] In some embodiments, primary cells isolated from a donor are manipulated as described herein to provide a cell population in which a resulting subpopulation of cells (e.g., a percentage less than 100%, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) contains all of the desired modifications. Such resulting populations, including a mixture of cells that contain and do not contain all of the modifications, can be used in the therapeutic methods and to prepare the compositions of the disclosure. Alternatively, this cell population ("starting population") can be manipulated by known methods, e.g., by cell sorting and / or expansion of cells having the desired modifications, to provide a cell population enriched for cells containing one or more desired modifications (e.g., enriched for cells expressing a desired antigen binding protein and / or enriched for cells expressing one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK at a reduced level compared to comparable cells not manipulated for the expression level of the corresponding protein), i.e., containing a higher percentage of such modified or engineered cells than the starting population. The population enriched for modified cells can then be used in the therapeutic methods of the disclosure and, e.g., to prepare compositions of the disclosure. In some embodiments, the enriched cell population contains, or contains at least, e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of cells having one or more of the modifications. In other embodiments, the percentage of cells in the enriched cell population that contain one or more of the modifications is at least 30% higher than the percentage of cells in the starting population of cells that contain the desired modifications. Treatment method

[0149] The immune cells, e.g., T cells, or cell lines derived from such immune cells or T cells obtained by the above method can be used as medicines. In some embodiments, such medicines can be used to treat disorders such as, for example, viral diseases, bacterial diseases, cancer, inflammatory diseases, immune diseases, or age-related diseases. In some embodiments, the cancer can be selected from the group consisting of gastric cancer, sarcoma, lymphoma (including non-Hodgkin's lymphoma), leukemia, head and neck cancer, thymic cancer, epithelial cancer, salivary gland cancer, liver cancer, stomach cancer, thyroid cancer, lung cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, leukemia, multiple myeloma, renal cell carcinoma, bladder cancer, cervical cancer, choriocarcinoma, colon cancer, oral cancer, skin cancer, and melanoma. In some embodiments, the subject is a previously treated adult subject with locally advanced or metastatic melanoma, squamous cell head and neck cancer (SCHNC), ovarian cancer, sarcoma, or relapsed or refractory classical Hodgkin lymphoma (cHL).

[0150] In some embodiments, immune cells, e.g., T cells, or cell lines derived from immune cells, e.g., engineered T cells, according to the present disclosure may be used in the manufacture of a medicament for treating a disorder in a subject in need thereof. In some embodiments, the disorder may be, for example, cancer, an autoimmune disorder, or an infectious disease.

[0151] Also provided herein are methods for treating a subject. In some embodiments, the methods include administering or providing immune cells, e.g., engineered T cells, of the present disclosure to a subject in need thereof. In some embodiments, the methods include administering immune cells, e.g., T cells, of the present disclosure to a subject in need thereof.

[0152] In some embodiments, the immune cells of the present disclosure, e.g., engineered T cells, can undergo robust in vivo cell proliferation and can persist for extended periods of time. The therapeutic methods of the present disclosure can be ameliorative, curative, or preventative. The methods of the present disclosure can be part of either an autoimmunotherapy or an allogeneic immunotherapeutic treatment. The present disclosure is particularly suitable for allogeneic immunotherapy. Donor-provided immune cells, e.g., engineered T cells, can be transformed into non-allo-reactive cells using standard protocols and regenerated as needed, thereby producing CAR-T cells, which can be administered, for example, to one or more subjects. Such CAR-T cell therapy can be made available as an allogeneic ALLO CAR T™ therapeutic product.

[0153] In another aspect, the disclosure provides a method of inhibiting tumor growth or progression in a subject having a tumor, the method comprising administering to the subject an effective amount of engineered immune cells, e.g., engineered T cells described herein. In another aspect, the disclosure provides a method of inhibiting or preventing metastasis of cancer cells in a subject, the method comprising administering to a subject in need thereof an effective amount of engineered immune cells, e.g., engineered T cells described herein. In another aspect, the disclosure provides a method of inducing tumor regression in a subject having a tumor, the method comprising administering to the subject an effective amount of engineered immune cells, e.g., engineered T cells described herein.

[0154] In some embodiments, the immune cells provided herein, such as T cells, can be administered parenterally to a subject. In some embodiments, the subject is a human.

[0155] In some embodiments, the method can further include administering an effective amount of a second therapeutic agent, e.g., crizotinib, palbociclib, an anti-CTLA4 antibody, an anti-4-1 BB antibody, a PD-1 antibody, or a PD-L1 antibody.

[0156] Also provided is the use of any of the immune cells, e.g., T cells, provided herein in the manufacture of a medicament for treating cancer or inhibiting tumor growth or progression in a subject in need thereof.

[0157] In certain embodiments, in an engineered immune cell of the present disclosure, the functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK, or any other gene knocked down or knocked out according to the present disclosure, is reduced by or at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to the corresponding expression level in an equivalent but not so genetically modified engineered immune cell. Expression levels may be determined by any known method, such as FACS or MAC. In some embodiments, the engineered immune cells disclosed herein functionally express any one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK, or any other gene knocked down or knocked out according to the present disclosure, at a level of 75% or less, 50% or less, 25% or less, 10% or less, or 0% of the expression level in a non-engineered immune cell (that is otherwise the same as the engineered immune cell, e.g., contains the same components as the engineered immune cell). In some embodiments, both alleles of a gene are knocked out, such that the expression level of the gene in an engineered immune cell disclosed herein is 0% of that of the corresponding non-engineered cell. In some embodiments, one of the two alleles of a gene is knocked out, such that the expression level of the gene in an engineered immune cell disclosed herein is 50% or about 50% of that of the corresponding non-engineered cell (e.g., where a compensatory mechanism results in greater than normal expression of the remaining allele). As described herein, for example, intermediate expression levels may be observed when expression is reduced by some means other than knockout.

[0158] In some embodiments, the expression levels of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK, or any other genes whose expression levels are engineered according to the present disclosure, in engineered cells of the present disclosure can be measured directly by assaying the cells for gene products and their properties using standard techniques known to those of skill in the art (e.g., RT-qPCR, nucleic acid sequencing, antibody staining, or any combination of techniques). In some embodiments, the functional expression levels of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP, and RFXANK are measured by determining the surface expression levels of one or more HLA proteins (such as HLA-A proteins or HLA-B proteins), or of beta 2 microglobulin (B2M), or of both B2M and one or more HLA proteins, on the surface of the engineered immune cells by standard techniques known in the art, such as flow cytometry. These measurements can be compared to corresponding measurements made on equivalent cells that have not been engineered to reduce the corresponding functional expression levels. In a cell population that includes engineered cells, e.g., engineered immune cells of the invention, the pooled sample of material (e.g., RNA or protein or cells) that is measured will reflect the fact that some cells do not express the gene of interest and have both alleles knocked out, e.g., some cells express the gene of interest at 50% or about 50%, whereas if only one allele has been knocked out and the population includes cells that are not engineered, some cells express normal levels of the gene of interest.

[0159] The functional expression level of one or more of TAP2, NLRC5, β2m, TRAC, CIITA, RFX5, RFXAP and RFXANK expression in engineered immune cells of the disclosure can also be assayed, for example, by measuring the degree of survival of the engineered immune cells in the presence of effector cells (e.g., T cells or NK cells) compared to the degree of survival of non-engineered but otherwise comparable (e.g., identical) immune cells under the same conditions. See, e.g., Figures 6A-6C and Example 1.

[0160] In some embodiments, administering engineered T cells, e.g., engineered T cells disclosed herein, or administering a cell population comprising such engineered immune cells (e.g., engineered T cells), reduces host rejection of the administered cell or cell population compared to comparable but non-engineered cells or a comparable population not comprising such engineered cells. In some embodiments, administering engineered immune cells, e.g., engineered T cells of the present disclosure, or administering a cell population comprising such engineered immune cells, e.g., engineered T cells, that comprise an antigen binding protein (e.g., a CAR) and have reduced expression levels, e.g., functional expression levels of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK, reduces host rejection of the administered cell or cell population compared to comparable but non-engineered cells or population not comprising such engineered cells. For example, such administration reduces host rejection by 1%-99%, e.g., by 5%-95%, 10%-90%, 50%-90%, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, as compared to host rejection of identical but cells not engineered to express the corresponding protein at reduced levels. In some embodiments, host rejection is reduced by more than 90%.

[0161] In some embodiments, administering an immune cell, e.g., a T cell of the disclosure, that comprises an antigen binding protein (e.g., a CAR) and has a reduced level of functional expression of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK, or administering a cell population that comprises such an immune cell, e.g., a T cell, enhances or improves persistence and / or increases the persistence of the cells compared to the persistence of an identical cell that has not been engineered to express the corresponding protein at a reduced level. In some embodiments, the persistence is increased by, for example, 1-7 days, 1-12 weeks (e.g., 1-4 weeks, 4-8 weeks, or 8-12 weeks), or 1-12 months, or a particular length of time that falls within these ranges. In some embodiments, the difference in persistence is measured by comparing the half-life of the administered cells in the population or composition, e.g., the half-life is increased by, e.g., 1-7 days, 1-12 weeks (e.g., 1-4 weeks, 4-8 weeks, or 8-12 weeks), or 1-12 months, or a particular length of time falling within these ranges. In some embodiments, the difference in persistence is measured by comparing the length of time that the administered cells can be detected after administration. In some embodiments, the improvement in persistence is measured in vitro, e.g., by comparing the survival of engineered cells to unengineered cells in the presence of immune cells, such as T cells or NK cells, e.g., at about 72 hours, 5 days, 7 days, or 13 days after mixing. In some embodiments, in such in vitro assays, the engineered cells survive about 1.5-10 times longer than the unengineered cells at the time of measurement.

[0162] In some embodiments, the reduction in host rejection and / or increased persistence of the administered cells disclosed herein is determined by any of a variety of techniques known to those of skill in the art. In some embodiments, any one or combination of flow cytometry, PCR (e.g., quantitative PCR), and ex vivo co-incubation with patient tumor material or with a model tumor cell line expressing the antigen targeted by the CAR-T cells is used. In some embodiments, qPCR is used to assess the number of CAR T cells with and without a knockout of interest to determine the extent to which the knockout provides a survival advantage.

[0163] In some embodiments, the treatment may be in combination with one or more therapies for cancer selected from the group of antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser phototherapy, and radiation therapy.

[0164] In some embodiments, the treatment may be administered to a subject undergoing immunosuppressive therapy. Indeed, the present disclosure may rely on a cell or cell population that is rendered resistant to at least one immunosuppressive agent due to inactivation of a gene encoding a receptor for such an immunosuppressive agent. In this aspect, the immunosuppressive therapy may assist in the selection and expansion of T cells according to the present disclosure in the subject.

[0165] Administration of cells or cell populations according to the present disclosure may be by any convenient method, including aerosol inhalation, injection, ingestion, infusion, injection, implantation, or transplantation. The compositions described herein may be administered to a subject subcutaneously, intradermally, intratumorally, intranodal, intramedullary, intramuscularly, intravenously or intralymphatically, or intraperitoneally. In one embodiment, the cell composition of the present disclosure is administered by intravenous injection.

[0166] In some embodiments, administration of cells or cell populations according to the present disclosure may be, for example, at a dose of about 10 3Or 10 4 pieces ~ about 10 9 In some embodiments, the administration of a cell or cell population is about 10 / kg body weight or more, including all integer values ​​of the number of cells within those ranges. 5 ~about 10 6 cells (including all integer cell numbers within this range), or 0.1 x 10 engineered immune cells of the invention per kg of body weight. 6 ~5×10 6 or 0.1 × 10 total engineered immune cells 8 ~5×10 8 The administration of the cells or cell population may include administration of one or more doses. In some embodiments, an effective amount of cells may be administered as a single dose. In some embodiments, an effective amount of cells may be administered as two or more doses over a period of time. The timing of administration is within the judgment of the attending physician and depends on the clinical condition of the subject. The cells or cell population may be obtained from any source, such as a blood bank or a donor. While individual needs vary, the determination of the optimal range of effective amounts of a given cell type for a particular disease or condition is within the skill of the art. By effective amount is meant an amount that provides a therapeutic or prophylactic benefit. The dosage administered depends on the age, health, and weight of the recipient, the type of concomitant treatment, if any, frequency of treatment, and the nature of the desired effect. In some embodiments, an effective amount of the cells or a composition comprising the cells is administered parenterally. In some embodiments, administration may be intravenous. In some embodiments, administration may be by injection directly into the tumor.

[0167] In some embodiments of the present disclosure, the cells are administered to a subject in conjunction with (e.g., prior to, concurrently with, or subsequent to) any number of relevant therapeutic modalities, including, but not limited to, treatment with agents such as monoclonal antibody therapy, CCR2 antagonists (e.g., INC-8761), antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or nataliziimab treatment for MS subjects, or efaliztimab treatment for psoriasis subjects, or other treatments for PML subjects. In some embodiments, the BCMA-specific CAR-T cells are administered to the subject in combination with one or more of an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody (e.g., avelumab, atezolizumab, or durvalumab), an anti-OX40 antibody, an anti-4-1 BB antibody (e.g., Utolimumab), an anti-MCSF antibody, an anti-GITR antibody, and / or an anti-TIGIT antibody. In further embodiments, the immune cells, e.g., T cells, of the present disclosure may be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolic acid, and FK506, antibodies, or other immunoablative agents such as CAMPATH (alemtuzumab), anti-CD3 antibodies, or other antibody therapies, cytoxan, fludarabine, cyclophosphamide, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and / or irradiation. These drugs either inhibit the calcium-dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit p70S6 kinase, which is important in growth factor-induced signal transduction (rapamycin) (Henderson, Naya et al. Immunology. 1991 Jul;73(3):316-321; Liu, Albers et al. Biochemistry 1992 Apr 28;31(16):3896-901; Bierer, Hollander et al. Curr Opin Immunol. 1993 Oct;5(5):763-73).

[0168] In further embodiments, the cell composition of the present disclosure is administered to the subject in conjunction with (e.g., before, simultaneously with, or after) a T cell ablative therapy using either a bone marrow transplant, a chemotherapeutic agent such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or an antibody such as CAMPATH. In some embodiments, the cell composition of the present disclosure is administered after a B cell ablative therapy, such as an agent that reacts with CD20, e.g., Rituxan. For example, in one embodiment, the subject can receive standard treatment with high-dose chemotherapy followed by a peripheral blood stem cell transplant. In certain embodiments, after transplant, the subject receives an infusion of the expanded immune cells of the present disclosure. In some embodiments, the expanded cells are administered before or after surgery. kit

[0169] The present disclosure also provides kits for use in the methods. The kits of the present disclosure include one or more containers containing the compositions of the present disclosure, or immune cells of the present disclosure, e.g., T cells, or cell populations including immune cells of the present disclosure, e.g., engineered T cells. In various embodiments, the immune cells (e.g., T cells) contain one or more polynucleotides encoding an antigen binding protein, e.g., a CAR as described herein, and are further engineered to express reduced levels of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK as described herein. The kits further include instructions for use with any of the methods of the present disclosure described herein. Generally, these instructions include instructions for administration of the compositions, immune cells, e.g., T cells, or cell populations for the therapeutic treatment described above.

[0170] The instructions for use of the kit components generally include information regarding dosages, dosing schedules, and routes of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages), or sub-unit doses. The instructions supplied with kits of the present disclosure are typically written instructions on a label or insert (e.g., a paper sheet included with the kit), although machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.

[0171] The kit of the present disclosure is in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. Packages for use in combination with specific devices, such as inhalers, nasal administration devices (e.g., atomizers), or injection devices, such as mini-pumps, are also contemplated. The kit may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). At least one active agent in the composition is an immune cell, e.g., T cell, according to the present disclosure. The container may further comprise a second pharmacologic active agent.

[0172] The kit may optionally be provided with additional components, such as buffers and interpretive information. Typically, the kit includes a container and a label or package insert on or associated with the container. Sorting and depletion methods

[0173] In some embodiments, a method is provided for in vitro sorting of a population of immune cells, a subset of which comprises immune cells engineered to express one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, and RFXANK at reduced levels and / or to express an antigen binding protein (e.g., a CAR) as described herein. In various embodiments, the method comprises contacting the population of immune cells with a monoclonal antibody specific for an epitope (e.g., a mimotope such as those described in US2018 / 0002435) unique to the engineered cells (e.g., an epitope of the antigen binding protein, or a mimotope incorporated into the antigen binding protein) and selecting immune cells that bind the monoclonal antibody to obtain a cell population enriched for engineered immune cells expressing the antigen binding protein.

[0174] In some embodiments, the monoclonal antibody specific for the epitope is optionally conjugated to a fluorophore, in which case the step of selecting cells that bind to the monoclonal antibody can be performed by fluorescence activated cell sorting (FACS).

[0175] In some embodiments, the monoclonal antibody specific for the epitope is optionally conjugated to a magnetic particle. In this embodiment, the step of selecting cells that bind to the monoclonal antibody can be performed by magnetic activated cell sorting (MACS).

[0176] In some embodiments, the mAb used in the method for sorting immune cells expressing an antigen binding protein (such as a CAR) is alemtuzumab, ibritumomab tiuxetan, muromonab-CD3, tositumomab, abciximab, basiliximab, brentuximab Selected from vedotin, cetuximab, infliximab, rituximab, bevacizumab, certolizumab pegol, daclizumab, eculizumab, efalizumab, gemtuzumab, natalizumab, omalizumab, palivizumab, ranibizumab, tocilizumab, trastuzumab, vedolizumab, adalimumab, belimumab, canakinumab, denosumab, golimumab, ipilimumab, ofatumumab, panitumumab, QBEND-10 and / or ustekinumab. In some embodiments, the mAb is rituximab. In another embodiment, the mAb is QBEND-10.

[0177] In some embodiments, the population of CAR-expressing immune cells obtained when using the methods for in vitro sorting of CAR-expressing immune cells described above comprises at least 70%, 75%, 80%, 85%, 90%, 95% CAR-expressing immune cells. In some embodiments, the population of CAR-expressing immune cells obtained when using the methods for in vitro sorting of CAR-expressing immune cells comprises at least 85% CAR-expressing immune cells.

[0178] In some embodiments, the population of CAR-expressing immune cells obtained when using the above-described methods for in vitro sorting of CAR-expressing immune cells exhibits increased in vitro cytotoxic activity compared to the initial (unsorted) cell population. In some embodiments, said cytotoxic activity is increased by 10%, 20%, 30%, or 50% in vitro. In some embodiments, the immune cells are T cells.

[0179] The CAR-expressing immune cells administered to the recipient can be enriched in vitro from a source population. Methods for expanding the source population can include using a combination of density centrifugation, immunomagnetic bead purification, affinity chromatography, and fluorescence-activated cell sorting to select cells that express an antigen, such as the CD34 antigen.

[0180] Flow cytometry can be used to quantify specific cell types in a cell population.Generally, flow cytometry is a method for quantifying the components or structural features of cells mainly by optical means.By quantifying structural features, different cell types can be distinguished, so that flow cytometry and cell sorting can be used to count and sort cells of different phenotypes in a mixture.

[0181] Flow cytometry analysis involves two major steps: 1) labeling a selected cell type with one or more labeling markers, and 2) determining the number of labeled cells relative to the total number of cells in a population. In some embodiments, the method of labeling a cell type involves binding a labeled antibody to a marker expressed by a particular cell type. The antibody can be directly labeled with a fluorescent compound or indirectly labeled, for example, using a fluorescently labeled second antibody that recognizes the first antibody.

[0182] In some embodiments, the method used to sort T cells expressing CAR is magnetic activated cell sorting (MACS). Magnetic activated cell sorting (MACS) is a method for separating different cell populations according to their surface antigens (CD molecules) by using superparamagnetic nanoparticles and columns. Using MACS, pure cell populations can be obtained. Cells in single cell suspension can be magnetically labeled with microbeads. The sample is applied to a column made of ferromagnetic spheres, covered with a cell-friendly coating, allowing for a fast and gentle separation of cells. Unlabeled cells pass through, while magnetically labeled cells are retained in the column. The flow-through can be collected as the unlabeled cell fraction. After a washing step, the column is removed from the separator and the magnetically labeled cells are eluted from the column.

[0183] Detailed protocols for the purification of specific cell populations such as T cells can be found in Basu S et al. (2010). (Basu S, Campbell HM, Dittel BN, Ray A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (41): 1546). EXAMPLES

[0184] Common methods Generation of KO T cells Primary human T cells were isolated from frozen healthy donor peripheral blood mononuclear cells (PBMCs) using magnetic activated cell sorting (MACS) negative selection (Miltenyi, Human Pan T Cell Isolation Kit, Cat. No. 130-096-535) and activated with 1:100 (v:v) T cell TransAct (Miltenyi, Cat. No. 130-111-160) + 100 IU / mL IL-2 (Miltenyi, Cat. No. 130-097-746) in R10 (RPMI-1640 + 10% FBS + 25 mM HEPES + sodium pyruvate + non-essential amino acids). Two days later, T cells were gene edited using the Neon Transfection System (Invitrogen). Briefly, ribonucleoprotein (RNP) complexes were generated by mixing cas9 enzyme (IDT, Cat. No. 1081059) and sgRNAs in a 1:1 molar ratio for 10 min at room temperature. When two sgRNAs were used, incubation was performed with cas9 in a 0.5:0.5:1 ratio (sgRNA1:sgRNA2:cas9). Cells were pulsed a total of three times at 1600V, 10 ms width, and immediately recovered in R10 medium supplemented with 100IU / mL IL-2 + 10ng / mL IL-7 (Miltenyi, Cat. No. 130-095-363). Edited T cells were incubated at 37°C, 5% CO2. Fresh R10 with 100IU / mL IL-2 was added to the cells the next day. KO efficiency was assessed via flow cytometry 5–7 days after gene editing. KO efficiency ranged from about 50% to as high as about 100%. KO efficiency was assessed in various ways: for TRAC, CD3 / TCRab expression was assessed, and for b2m, NLRC5 and RFX5, anti-b2m or anti-HLA antibodies were used. Lower editing efficiencies are acceptable because edited cells are purified, as described below. KO was checked around day 22 and found to be relatively stable.

[0185] TRAC KO cells were purified using MACS negative selection (Stem Cell Technologies, EasySep Human TCR alpha / beta depletion kit, catalog number 17847) according to the manufacturer's recommendations. Purified T cells were either used immediately or frozen in 5e6 cell aliquots in 90% FBS + 10% DMSO.

[0186] Table 1. List of sgRNA sequences [Table 1] In vitro allogeneic rejection assay Primed T mixed lymphocyte reaction (MLR) (Figures 7, 14A-14C, 17B)

[0187] Human PBMCs (host) were primed against irradiated PBMCs from the donor used to generate the graft T cells above to promote the expansion of alloreactive T cell clones. Briefly, graft PBMCs were irradiated at 30 Gy and co-cultured with host PBMCs at a 1:1 ratio in R10 + 20 IU / mL IL-2 + 10 ng / mL IL-7 + 10 ng / mL IL-15 (Miltenyi, Cat. No. 130-095-765) for 4 days. The medium was replaced with R10 without cytokines and the cells continued to be cultured for another 3 days. Pan T cells were then isolated using MACS negative selection (Miltenyi, Human Pan T Cell Isolation Kit, Cat. No. 130-096-535) according to the manufacturer's recommendations. 20,000 graft T cells were seeded together with 20,000 primed host T cells in 96-well plates and cultured in R10 + 20 IU / mL IL-2 at 37°C, 5% CO2 for 2 days. Graft T cell survival was determined by flow cytometry using absolute counts by gating on viable TCRαβ-CD4+CD8+. NK MLR (Figures 8A-8B, 15A, 17C)

[0188] Human NK cells were isolated from freshly isolated human PBMCs via MACS purification (Miltenyi, Human Pan NK Cell Isolation Kit, Cat. No. 130-092-657). 20,000 graft T cells were seeded together with host NK cells in a 96-well plate and cultured in R10 + 1000IU / mL IL-2 at 37°C, 5% CO2 for 2 days. Graft T cell survival was determined by flow cytometry using absolute counts by gating on viable TCRαβ-CD56-CD4+CD8+. PBMC MLR (Figure 16)

[0189] In 96-well plates, 20,000 graft T cells were seeded with 200,000 host PBMC cells (10:1 E:T ratio) and cultured in R10 + 20 IU / mL IL-2 at 37 °C, 5% CO2 for 4–13 days. Cells were fed with fresh R10 + IL-2 every 2–3 days. Graft T cell survival was determined by flow cytometry using absolute counts by gating on viable TCRαβ-CD56-CD4+CD8+. Effector NK cell proliferation was determined by absolute counts of live cells gated on TCRαβ-CD56+. Effector T cell proliferation was determined by absolute counts of live cells gated on TCRαβ+CD56-CD4+CD8+. Example 1. TAP2 KO or NLRC5 KO protects T cells in an autoantigen-specific killing assay A. Dependence of MHC Class I Presentation

[0190] NLRC5 is induced by interferon-γ (IFN-γ) and regulates the expression of components of the IFN-γ-inducible immunoproteasome (i.e., LMP2 and LMP7). IFN-γ-induced MHC class I upregulation is dependent on NLRC5, suggesting that NLRC5 KO stably suppresses MHC class I presentation in the presence or absence of IFN-γ. Indeed, when NLRC5 KO primary T cells were incubated with various amounts of recombinant IFN-γ, there was a minimal increase in MHC class I expression compared to TRAC KO alone (Figure 5). B. TAP2 KO and NLRC5 KO each protect against effector cell killing.

[0191] It was determined whether the modest MHC downregulation achieved by TAP2 KO or NLRC5 KO (see Figures 4A, 4B) would protect T cells in an autoantigen-specific killing assay. Primary T cells (mock product cells) were electroporated with Cas9-complexed sgRNA to TAP2 or β2m and transduced with the melanocyte-derived tissue differentiation antigen MART1 / MelanA (BFP-P2A-MART1). In parallel, mock effector T cells from the same donor were transduced with the HLA-A2-restricted, MART1-specific T cell receptor, F5 TCR. Mock product cells and effector cells were co-incubated for 72 h and then the extent of antigen-specific killing was analyzed by quantifying the remaining BFP+ (MART1-expressing) T cells via flow cytometry (see Figures 6A-6C). Antigen-expressing cells that retained surface β2m (i.e., unedited) were not killed by effector cells when they were HLA-A2- (HLA-A2-minus) (Figure 6A, right bar of each pair), but were eradicated by effectors when they were HLA-A2+ (Figure 6A, left bar of each pair), confirming that effector cells bearing the F5 TCR were capable of killing MART1 antigen-expressing cells, subject to the constraint that HLA-A2 present the peptide.

[0192] In contrast to unedited cells, TAP2 or β2m (and thus surface β2m, respectively) low Or β2m - ), were fully protected from effector cell killing (Figure 6B). Similarly, in independent experiments, HLA-A2+ cells edited for either NLRC5 or β2m were also protected from effector cell killing (Figure 6C). Thus, knockout of β2m, TAP2, or NLRC5 protects edited T cells from T cell-mediated antigen-specific killing, but TAP2 KO and NLRC5 KO achieve this without reducing surface MHC more than β2m KO. Example 2. Protective Effect of NLRC5 KO in a Polymorphic Epitope Context

[0193] To evaluate the protective effect of NLRC5 KO in a polymorphic epitope context, these targets were tested in a one-way T cell mixed lymphocyte reaction (MLR) with freshly isolated pan T cells from allogeneic donors. First, pan T cells were gene-edited via CRISPR / Cas9 for TRAC KO with or without β2m, TAP2, or NLRC5 KO. Targets were then purified to remove all TCR α / β expressing cells. Effector PBMCs were co-cultured with irradiated PBMCs isolated from the same target donor for one week to promote the growth and proliferation of alloreactive T cells. Effector pan T cells were purified and co-incubated with targets at a 1:1 ratio for two days. The extent of killing was determined by analyzing the absolute number of surviving targets (Figure 7). No killing was observed for any of the modification strategies in the autologous environment. In an allogeneic environment, significant alloreactivity was observed against TRAC KO modified target cells, which was significantly attenuated by either β2m, TAP2, or NLRC5 KO. Thus, in a polyclonal allogeneic environment, these MHC class I downregulation modifications attenuate alloreactive T cell recognition. Example 3. TAP2 KO and NLRC5 KO T cells are less sensitive to NK-mediated killing than β2m KO T cells

[0194] Ablation of surface MHC by β2m KO results in NK-mediated killing (Figures 2A-2B). To determine whether the modest downregulation of surface MHC resulting from TAP2 KO or NLRC5 KO (Figures 4A-4B) similarly results in NK-mediated killing, pan T target cells were edited via CRISPR / Cas9 for TRAC KO and either β2m, TAP2, or NLRC5 KO. TCR-negative target T cells were co-incubated with freshly isolated NK cells from allogeneic donors at NK effector:T target ratios of 0:1, 1:1, or 5:1 for 72 hours. NK-mediated killing was assessed by flow cytometry (see Figures 8A-8C). As previously observed, b2m KO T cells were efficiently killed by allogeneic NK cells at either 1:1 or 5:1. In contrast, the majority of TAP2 KO T cells that survived 1:1 incubation with NK:T and NLRC5 KO T cells were almost completely preserved at 5:1 NK:T (Figure 8A). Identical incubations with NK cells from two additional allogeneic donors yielded similar results, indicating that TAP2 KO and, especially, NLRC5 KO T cells exhibited less NK-mediated killing than b2m KO T cells (Figure 8B). Because editing efficiency is not 100%, the T cells used in this experiment include unedited cells as well as cells edited at the β2m, TAP2, or NLRC5 locus. If NK-mediated killing affects selection against edited cells, the addition of NK cells would result in a shift from MHC null / low (edited) cells to MHC-replete (unedited) cells. Indeed, the addition of 1:1 NK cells resulted in near-complete selection of unedited cells over β2m KO cells, whereas 5:1 NK cells were required for comparable selection of unedited cells over TAP2 KO cells (Figure S4C). T cells edited at the NLRC5 locus did not show this selection even in 5:1 NK cells, further demonstrating their apparent exclusion from NK-mediated killing by loss of self. Example 4. NLRC5 KO does not impair DLL3 CAR-mediated cytotoxicity

[0195] It was also shown that NLRC5 KO does not impair exemplary DLL3 CAR-mediated cytotoxicity (see Figures 10A-10B). Exemplary DLL3 CAR sequences are shown in Table 3. Anti-DLL3 CARs containing TRAC KO (closed triangles) or TRAC KO+NLRC5 KO (inverted triangles) + T cells express DLL3 high expressing WM266.4 tumor cells (Fig. 10A, showing three different effector:target ratios), and DLL3 low When co-incubated with IgG1-expressing DMS273 tumor cells (Figure 10B), they displayed similar short-term cytotoxicity. When target cells were grown alone (dots) or in the presence of non-transduced T cells (squares), the number of target cells exponentially increased and declined at similar rates to each other. In this experiment, the following method was used. Short term kill: method

[0196] Cytotoxicity was determined by measuring the number of tumor target cells over time using the Incucyte platform (Sartorius). Briefly, WM266.4 tumor cells were engineered with lentivirus to stably express NucLight Green (Sartorius catalogue no. 4475), a nuclear-restricted GFP, and used as target cells. Target cells were seeded at a density of 5,000 cells per well in 96-well plates. DLL3 CAR T cells were thawed and added to the seeded target cells at various effector:target (E:T) ratios. Target cell numbers (GFP+) were counted every 6 hours for a total of 132 hours.

[0197] Anti-DLL3 CAR with TRAC KO (black triangles) or TRAC KO+NLRC5 KO (inverted triangles) + T cells also exhibited similar cytotoxicity when incubated with target cells for longer periods (FIG. 10C). In these experiments, the following method was used. Sequential killing: Methods

[0198] Cytotoxicity was determined by measuring the reduction in luminescence signal from live target cells. WM266.4 tumor cells were engineered with lentivirus to stably express luciferase and used as target cells. Target cells were seeded at a density of 5,000 cells per well in 96-well plates. DLL3 CAR T cells were thawed and added to the seeded target cells at an E:T ratio of 3:1. Every 2–4 days, half of the cells were transferred to white-walled 96-well plates and incubated with OneGlo substrate (Promega, Cat. No. E6110) at a 1:1 ratio (v:v) for 2 min at room temperature with shaking. Relative luminescence units were measured using a SpectraMax M3 plate reader (Molecular Devices) and background subtracted against wells without cells. % cytotoxicity = 100 × [1-(RLUtest / RLUcontrol)]. Untreated target cells were used to determine RLUcontrol. Example 5. Manufacturability

[0199] To test the manufacturability of these engineering strategies, we assessed the efficiency of proliferation and transduction in combination with a DLL3-specific CAR. Pan T cells were simultaneously gene-edited and transduced for CAR expression and negatively selected for TCR αβ expression. Gene-edited cells were transduced with comparable efficiency compared to CAR transduction alone (Figure 9A). Furthermore, proliferation of cells expressing the DLL3 CAR in combination with TRAC KO and NLRC5 KO showed similar growth rates compared to the DLL3 CAR and TRAC KO alone (Figure 9B). Example 6. Activity of immune evasion genes KO Effects of RFX and other KOs on MHC expression

[0200] Knockout T cell lines were prepared, each of which included a knockout for one of β2m, NLRC5, RFX5, CIITA, RFXANK, and RFXAP using the corresponding sgRNAs of SEQ ID NOs: 1-11 to generate the knockouts, as described above. The effect of each knockout on cell surface expression levels of HLA-ABC (MHC-I) and HLA-DR, DP, DQ (MHC-II) was assessed by flow cytometry 7 days after gene editing and compared to the effect of mock gene editing (see Figures 11A-11B). The data show, inter alia, that knocking out either RFX5 or RFXANK significantly reduces cell surface expression levels of both HLA-ABC (MHC-I) and HLA-DR, DP, DQ (MHC-II).

[0201] Similar experiments were performed to compare TRAC+β2m double KO, TRAC+NLRC5 double KO, and TRAC+RFX5 double KO prepared from three independent T cell donors (see Figures 12A-12B). TRAC single KO was used as a control. For cells from all three donors, it was observed that expression levels of both MHC-II and, surprisingly, MHC-I were significantly lower in RFX5 KO than in TRAC KO (see Figures 12A-12B). Expansion of immune evasive T cells

[0202] The proliferation capabilities of β2m+TRAC, NLRC5+TRAC, and RFX5+TRAC double knockouts, each prepared from three independent T cell donors, were evaluated (see Figures 13A-13B). After gene editing, over a period of about 11 days, cell proliferation reached more than 30-fold, more than 70-fold, and more than 40-fold, with no significant difference between the RFX5 double knockout, the NLRC5 double knockout, and the TRAC single knockout (see Figure 13A).

[0203] Cell persistence was also assessed by maintaining the knockout cells in medium lacking IL-2. Cell numbers remained essentially the same 3 days after removal of IL-2 and dropped by approximately 50% 5 days after removal of IL-2. No differences were observed between NLRC5 + TRAC double KO, RFX5 + TRAC double KO, and control TRAC KO. 20K cells were seeded in 96-well plates with 20 IU / mL IL-2. On day 4, medium was replaced without IL-2. Medium was re-fed every 2-3 days thereafter (see FIG. 13B). Downregulation of MHC-I / II expression reduces alloreactivity a. In vitro allogeneic rejection assay: primed T mixed lymphocyte reaction (MLR)

[0204] Double KO T cells were co-cultured with primed T cells to determine whether the KO T cells had a different survival rate than the control TRAC KO cells. Specifically, T cells from two allogeneic donors were primed for one week against irradiated cells from the graft donor. T cells from the graft donor were edited to generate KO cells (KO for TRAC (control), TRAC+β2m, TRAC+NLRC5, or double KO for TRAC+RFX5), and the KO graft cells were co-cultured with primed CD4+, CD8+, and pan T cells. The number of graft KO cells that survived co-culture with primed T cells was determined. A significantly higher percentage of TRAC+RFX5 KO cells than TRAC KO cells survived co-culture with primed cells for both donors and for all three T cell populations (CD4+, CD8+, and pan T cells) (see Figure 14A: CD4+ cells, Figure 14B: CD8+ cells, and Figure 14C: pan T cells).

[0205] Methods: T cells from two allogeneic donors were primed for 1 week against irradiated cells from the graft donor. CD4+, CD8+, or pan T cells were then purified and co-cultured with graft T cells at a 1:1 E:T ratio for 48 hours. Unidirectional killing of graft T cells was assessed by flow cytometry. Figures 14A-14C show the mean ± SD of technical triplicates. % viability = cell number / (effector-free cell number) × 100. Knockouts were prepared as described above. b. TRAC + NLRC5 and TRAC + RFX5 double KO T cells with allogeneic NK cells The casualties are minimal.

[0206] Graft cells from three different donors were edited to create KO (TRAC) or double KO (TRAC and one of β2m, NLRC5, or RFX5), and the KO graft cells were co-cultured with NK cells. The number of graft KO cells that survived co-culture with NK cells was determined. More than half of the NLRC5 KO cells and more than half of the RFX5 KO cells survived co-culture with NK cells (see FIG. 15A).

[0207] Brief description of the method: NK cells were isolated from allogeneic PBMC and co-cultured with graft T cells at a 1:1 E:T ratio in the presence of 1000 IU / mL IL-2 for 48 hours. Unidirectional killing of graft T cells assessed by flow cytometry. See also below for a description of an additional or alternative method, the NK mixed lymphocyte reaction (MLR).

[0208] Methods for FIG. 15B: Allogeneic PBMCs were co-cultured with TRAC KO graft T cells with various gene editing modifications for 7 days at an E:T ratio of 10:1. Allogeneic NK cell proliferation was monitored by TCRαβ - CD56 + Absolute cell counts gated on cells were determined by flow cytometry and normalized to allogeneic NK cells cultured in the absence of graft cells. Means ± SD of six biological replicates are shown.

[0209] Methods for Figure 16: Allogeneic PBMCs were co-cultured with TRAC KO graft T cells with various immune evasion modifications for 9 days at an E:T ratio of 10:1. Graft T cell survival was determined by flow cytometry and normalized to graft T cells cultured without any effectors. Means ± SD of technical triplicates are shown. Example 7. Overexpression of US11

[0210] It was also shown that US11 overexpression enhances alloreactive T cell evasion and can be combined with NLRC5 knockout to provide greater efficacy than either provides alone (see Figures 17A-17D). The following methods were used for the experiments shown in Figure 17B (and were also used for the experiments shown in Figures 7 and 14A-14C): Generation of US11-overexpressing T cells: Methods

[0211] To generate lentivirus encoding US11, HEK-293T cells were seeded at 750,000 cells per mL of DMEM (Gibco) supplemented with 10% FBS (HyClone), non-essential amino acids (Gibco), and sodium pyruvate (Gibco) in 10 cm dishes pre-coated with poly-L-lysine (R and D Systems). The next day, plasmids encoding US11 on a pLVX backbone (SEQ ID NOs: 8-12, FIG. 18) were mixed with lentiviral packaging vectors psPAX2 and pMD2G in a 3:4:1 mass ratio. Lipid-DNA complexes were formed after adding Lipofectamine 2000 (Invitrogen) and incubating for 20 min at room temperature according to the manufacturer's recommendations. The mixture was added dropwise to the HEK-293T monolayer (approximately 70-90% confluent) and the cells were incubated overnight at 37°C, 5% CO2. After 16–20 h, the medium was replaced with R10. After 48 h, the supernatant was collected and filtered through a 0.45 μm filter. The virus was concentrated 20X using Lenti-X (Takara Bio) and added at a 1:10 dilution to one million T cells that had been activated with TransAct (1:100) 2 days prior. The efficiency of transduction was assessed by measuring the transduction efficiency using blue fluorescent protein (BFP) + ) expression was assessed by flow cytometry. Primed T-mixed lymphocyte reaction (MLR)

[0212] Human PBMCs (host) were primed against irradiated PBMCs from the donor used to generate the graft T cells above to promote the expansion of alloreactive T cell clones. Briefly, graft PBMCs were irradiated at 30 Gy and co-cultured with host PBMCs at a 1:1 ratio in R10 + 20 IU / mL IL-2 + 10 ng / mL IL-7 + 10 ng / mL IL-15 (Miltenyi, Cat. No. 130-095-765) for 4 days. The medium was replaced with R10 without cytokines and the cells continued to be cultured for another 3 days. Pan T cells were then isolated using MACS negative selection (Miltenyi, Human Pan T Cell Isolation Kit, Cat. No. 130-096-535) according to the manufacturer's recommendations. 20,000 graft T cells were seeded together with 20,000 primed host T cells in 96-well plates and cultured in R10 + 20 IU / mL IL-2 at 37°C, 5% CO2 for 2 days. Graft T cell survival was determined by flow cytometry using absolute counts by gating on viable TCRαβ-CD4+CD8+.

[0213] The following methods were used for the experiments shown in FIG. 17C (and also for the experiments shown in FIGS. 8A-8B and 15A): NK mixed lymphocyte reaction (MLR)

[0214] Human NK cells were isolated from freshly isolated human PBMCs via MACS purification (Miltenyi, Human Pan NK Cell Isolation Kit, Cat. No. 130-092-657). 20,000 graft T cells were seeded together with host NK cells in a 96-well plate and cultured in R10 + 1000IU / mL IL-2 at 37°C, 5% CO2 for 2 days. Graft T cell survival was determined by flow cytometry using absolute counts by gating on viable TCRαβ-CD56-CD4+CD8+.

[0215] Table 2. US11 lentiviral vector (LVV) [Table 2-1] [Table 2-2] [Table 2-3] Example 8 Stealth knockout T cells were insensitive to IFN

[0216] We tested the effect of IFNγ on MHC surface expression levels in T cells modified with various gene knockouts. T cells with various gene KOs (TRAC KO alone (control) or TRAC KO+B2M KO, NLRC5 KO, RFX5 KO, or CIITA KO) were cultured at 3×10 cells in 96-well plates. 4 Cells were seeded at 1000 / well with various concentrations of recombinant human IFN-γ (R&D Systems) for 72 h. Expression of MHC-I and MHC-II was determined by staining with anti-HLA-ABC and anti-HLA-DR, DP, DQ antibodies (e.g., BioLegend, Cat. Nos. 311404, 361708) and analysis by flow cytometry.

[0217] The results in Figures 19A-19B show that MHC-I and MHC-II expression in control T cells (TRAC KO alone) increased with increasing concentrations of IFN-γ, while MHC-I expression in B2M KO, NLRC5 KO, or RFX5 KO T cells, and MHC-II expression in RFX5 KO or CIITA KO T cells remained low despite the addition of IFN-γ, suggesting that the levels of MHC expression in stealth engineered T cells were relatively insensitive to IFN-γ. Example 9. Production of stealth CD19 CAR T cells

[0218] The same methods described above, e.g., in Examples 4 and 5, were used to generate exemplary CD19 CAR T cells with various gene KOs, except that T cells were transduced with a lentivirus for expression of the CD19 CAR. Exemplary CD19 CAR sequences are as shown in Table 3. Gene editing was performed using the Neon Transfection System (Invitrogen) or Nucleofector 4D (Lonza) on day 2 (data shown in Figures 20-21) or day 5 (data shown in Figure 23) after thawing and activation of the T cells. TCR depletion (Stem Cell Technologies, EasySep Human TCR Alpha / Beta Depletion Kit, Catalog No. 17847) was typically performed between days 14-16. TCR depleted T cells were cryopreserved and thawed for additional assays at later time points. Cell proliferation during production was tracked by counting live cells with a Vi-CELL counter (Beckman Coulter). Fold expansion was calculated by comparing the number of viable cells at various time points up to day 2 (the time of gene editing). + The percentage of T cells, CD4 / CD8 ratios, and T cell subsets were determined by flow cytometry. CD19 CAR T cells were identified by anti-idiotypic antibodies (Acro Biosystems, Cat. No. FM3HPY53). CAR + CD4 + Cells or CARs + CD8 + The phenotype of the cells is determined by CD62L and CD45RO expression, with stem cell memory (CD62L + / CD45RO - ), Central Memory (CD62L + / CD45RO + ), Effector Memory (CD62L - / CD45RO + ), or effector (CD62L - / CD45RO - ) cell population.

[0219] The manufacturability of CD19 CAR T cells with various gene KOs was evaluated in a similar manner as DLL3 CAR T cells. Gene-edited cells were transduced with comparable efficiency and showed similar kinetics compared to control CAR T cells throughout production (Figure 20A). Furthermore, the cell proliferation (Figure 20B), CD4 / CD8 ratio (Figure 20C), and memory phenotype (Figure 20D) of CAR T cells expressing CD19 CAR in combination with TRAC KO and various additional KOs were comparable to CD19 CAR T cells with TRAC KO alone.

[0220] Table 3. Exemplary CAR sequences [Table 3] Example 10 PBMC MLR assay using CD19 CAR T cells as grafts

[0221] We next investigated the survival of graft CD19 CAR T cells with various gene knockouts (KOs) after co-culture with allogeneic PBMCs from different donors. The impact of various gene editing modifications of CAR T cells on reducing allogeneic immune cell recognition was evaluated with the PBMC MLR assay described in Example 6 above. The results in Figure 21A show that knocking out β2m, NLRC5, or RFX5 in CD19 CAR T cells resulted in a decrease in host CD8 T cell proliferation, suggesting that reducing MHC-I expression on CD19 CAR T cells effectively reduces allogeneic CD8 T cell recognition. The viability of CD19 CAR T cells was also quantified. Knocking out NLRC5, RFX5, and CIITA resulted in a survival rate comparable to that of control CD19 CAR T cells, while knocking out β2m reduced the survival rate of CD19 CAR T cells compared to control CD19 CAR T cells (Figure 21B). Example 110 T cell rejection in the NSG mouse model

[0222] The persistence and antitumor activity of CD19 CAR T cells with various gene knockouts (KOs) was evaluated in an in vivo allogeneic T cell rejection model. Eight- to 12-week-old NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice were obtained from Jackson Laboratories (Bar Harbor, ME). NSG mice were irradiated with 1 Gy on day -6 and injected with 7 × 10 6 10 in vitro expanded allogeneic human T cells were administered. Briefly, allogeneic T cells were activated immediately after recovery from cryopreservation using T cell TransAct™ (Miltenyi Biotec, Auburn, CA; 1:100 dilution) in X-Vivo15 medium (Lonza, Basel, Switzerland) supplemented with 5% human AB serum (Gemini Bio-Products, West Sacramento, CA) and 100 IU / mL IL-2 (Miltenyi Biotec, Auburn, CA). See Figure 22A. Two days after activation, T cells were centrifuged to remove TransAct and then resuspended in fresh XVivo-15 medium supplemented with 5% human AB serum and 100 IU / ml IL-2 for 6-8 days before being administered to animals via intravenous injection. On day -4, mice were dosed with 1 × 10 5 Mice were randomized based on whole body bioluminescence on day -1. On day 0, 3x10 CD19 CAR T cells generated from HLA-A2- donors with various gene editing modifications (TRAC KO alone or with KO of one of β2m, NLRC5, or RFX5) were administered intravenously. 6 CAR +CAR T cells were injected intravenously with 100 μg / mL of T cell markers. The total number of T cells was kept constant across all groups by normalizing with non-transduced T cells. Raji tumor growth was followed by whole body bioluminescence at the indicated time points. To track CAR T cell persistence in vivo, 40 μL of peripheral blood was obtained by cheek bleeding on days 2, 9, and 16 after CAR T administration. After red blood cell lysis, samples were stained with anti-human CD45, HLA-A2, and anti-idiotypic antibodies to identify CD19 CAR T cells. CAR T cell numbers were normalized using counting beads (123count eBeads, Thermo Fisher). N=8 mice per group.

[0223] CD19 CAR T cells with genetic modifications to reduce MHC-I expression (B2m, NLRC5, or RFX5 KO) showed higher CAR T cell numbers and persisted longer in peripheral blood compared to control CD19 CAR T cells (TRAC KO alone), suggesting that CAR T cells with reduced MHC-I expression were better at mitigating allogeneic T cell rejection (Figure 22B). Consistent with the superior CAR T cell persistence, B2M KO, NLRC5 KO, and RFX5 KO CD19 CAR T cells also showed better antitumor activity compared to control CD19 CAR T cells (Figure 22C). Example 12 NK rejection in a syngeneic mouse model

[0224] Generation of gene-edited mouse T cells: Spleens of C57BL / 6 mice carrying the CD45.2 allele were harvested and single cell suspensions were obtained by gentleMAC Dissociator (Miltenyi). Mouse T cells were then purified with Mouse T Cell Isolation Kit II and then activated with Mouse T Cell Activation / Proliferation Kit according to the manufacturer's protocol (Miltenyi). One day after activation, mouse T cells were gene-edited with CRISPR / Cas9 via electroporation (Nucleofector 4D, Lonza) in the same way as human T cells. The sgRNA sequences used are 5' to 3': ugaguauacuugaauuugag (B2m, SEQ ID NO: 20) and gccucacaagccaggcccac (Nlrc5, SEQ ID NO: 21). Gene-edited mouse T cells were expanded in vitro for 6 days in the presence of IL-2 (40 ng / ml) and IL-7 (40 ng / ml) before administration to animals.

[0225] Adoptive transfer of graft T cells: 8-12 week old C57BL / 6 mice carrying the CD45.1 or CD45.2 allele were obtained from Jackson Laboratories (Bar Harbor, ME). C59BL / 6 mice carrying the CD45.1 allele were irradiated with 2.5 Gy on day -3 and 1 × 10 T cells from C57BL / 6 mice carrying the CD45.2 allele were transferred to the graft T cells on day 0. 7 Control (non-gene edited) or gene edited (B2m or Nlrc5 KO) in vitro expanded T cells were administered via intravenous injection. See Figure 23A. Some C57BL / 6 mice carrying the CD45.1 allele were also administered NK depleting antibody (anti-NK1.1 antibody, BioXcell) via intraperitoneal injection at 200ug / mouse for each injection on days -3 and 0, and designated as the "+NK depleted" cohort. Cell counts of host immune cells and graft T cells in peripheral blood were tracked by flow cytometry. 40μL of peripheral blood was obtained by cheek bleeding at the indicated time points after graft T cell administration. After red blood cell lysis, samples were analyzed for CD45.1, CD45.2, CD3, CD4, CD8, CD19, CD335, CD11b and H2-K.b Graft T-cell and host immune cell subsets were identified by staining with anti-mouse antibodies for . Counting beads (123count eBeads, Thermo Fisher) were used to normalize cell numbers. N=5 mice per group. Mean ± SEM is shown.

[0226] Sublethal irradiation was used to transiently deplete host immune cells in C57BL / 6 mice prior to graft administration. Some mice also received an NK-depleting antibody to thoroughly deplete remaining NK cells. Gene-edited (B2m or NLRC5 KO) or non-edited control graft T cells from syngeneic mice were then adoptively transferred into the host. Engraftment of adoptively transferred T cells was tracked at various time points by flow cytometry. T cells transplanted with either B2m or Nlrc5 KO expressed anti-mouse H2-K b (BioLegend, Cat. No. 116508) showed lower MHC-1 expression (Figure 23B). Graft T cell survival with NLRC5 KO was comparable to control grafts with or without NK depletion, suggesting that knocking out Nlrc5 did not result in NK cell rejection in mice (Figure 23C). Conversely, B2m KO graft cells did not survive unless host NK cells were depleted, suggesting that knocking out B2m increased the susceptibility of graft T cells to NK rejection (Figure 23C).

[0227] All references cited herein, including patents, patent applications, articles, textbooks, and the like, and the references cited therein, to the extent not already cited, are hereby incorporated by reference in their entirety.

[0228] Although the teachings of the present disclosure have been described with reference to various applications, methods, kits, and compositions, it will be understood that various changes and modifications can be made without departing from the teachings herein and the invention as set forth in the claims below. The foregoing examples are provided to better illustrate the disclosed teachings and are not intended to limit the scope of the teachings presented herein. Although the present teachings have been described in terms of these exemplary embodiments, those skilled in the art will readily appreciate that numerous variations and modifications of these exemplary embodiments are possible without undue experimentation. All such variations and modifications are within the scope of the present teachings.

Claims

1. 1. An engineered immune cell, wherein the cell has been engineered such that (a) one or more of RFX5, NLRC5, TAP2, β2m, RFXAP, CIITA and RFXANK are functionally expressed at a reduced level, and (b) TRAC is functionally expressed at a reduced level, and / or the engineered immune cell comprises a nucleic acid encoding an antigen binding protein.

2. The engineered immune cell of claim 1 , wherein TRAC and RFX5 or TRAC and NLRC5 are functionally expressed at a reduced level.

3. The cells, (a) a reduced expression level of an MHC class I protein or complex at the cell surface, or (b) a reduced expression level of an MHC class II protein or complex at the cell surface; or (c) a reduced expression level of an MHC class I protein or complex at the cell surface and a reduced expression level of an MHC class II protein or complex at the cell surface; or (d) reduced peptide diversity presented by MHC class I at the cell surface and minimal perturbation of the levels of MHC on the cell surface; or (e) minimized diversity of peptides presented at the cell surface and minimal perturbation of the levels of MHC on the cell surface; The engineered immune cell of claim 1 or 2, which exhibits:

4. The engineered immune cell of any one of claims 1 to 3, wherein the cell is a T cell.

5. The engineered immune cell of any one of claims 1 to 4, wherein the cell further expresses an antigen binding protein.

6. The engineered immune cell of any one of claims 1 to 5, wherein the antigen binding protein is a chimeric antigen receptor (CAR).

7. The engineered immune cell of claim 5 , wherein the antigen-binding protein is a T cell receptor (TCR).

8. 8. The engineered immune cell of any one of claims 1 to 7, wherein the nucleic acid encoding the antigen binding protein is located within a locus selected from the group consisting of RFX5, NLRC5, TAP2, β2M, TRAC, CIITA, RFXANK and RFXAP.

9. The engineered immune cell of any one of claims 1 to 8, wherein the engineered immune cell further comprises one or more genomic modifications of an endogenous TCRa gene.

10. The engineered immune cell of any one of claims 1 to 9, wherein the engineered immune cell further comprises one or more genomic modifications of an endogenous CD52 gene.

11. The engineered immune cell of any one of claims 1 to 10, wherein the cell is engineered to functionally express RFX5 and TRAC at reduced levels.

12. The engineered immune cell of any one of claims 1 to 10, wherein the cell is engineered to functionally express NLRC5 and TRAC at reduced levels.

13. The engineered immune cell of any one of claims 1 to 12, wherein the cell is engineered to functionally express RFX5 and NLRC5 at reduced levels.

14. 14. The engineered immune cell of any one of claims 1 to 13, wherein the immune cell is or is derived from an immune cell obtained from a healthy volunteer, obtained from a patient, or derived from an iPSC.

15. 15. The engineered immune cell of any one of claims 1 to 14, wherein the cell exhibits reduced expression levels of MHC class I proteins or complexes at the cell surface and MHC class II proteins or complexes at the cell surface.

16. The engineered immune cell of any one of claims 1 to 15, wherein the functional expression level of RFX5 and / or NLRC5 is measured by determining the surface expression levels of HLA, beta 2 microglobulin (β2M), or both HLA and β2M on the surface of the engineered immune cell, or by flow cytometry.

17. The method of claim 17, wherein: (a) the engineered immune cells are further engineered to express one or more proteins selected from the group consisting of HLA-E, HLA-E single chain trimer, HLA-G, HLA-G single chain trimer, UL18, UL18 single chain trimer, HLA-A2, HLA-A2 single chain trimer, and human cytomegalovirus (HCMV) US11; and / or (b) the engineered immune cells are further engineered to not express, or to express at reduced levels, any one or more of CIITA, RFXANK, RFXAP, and RFX5; The engineered immune cell of any one of claims 1 to 16.

18. A method for producing an engineered immune cell according to any one of claims 1 to 17, comprising reducing functional expression of one or more of TAP2, NLRC5, β2m, TRAC, RFX5, RFXAP, CIITA, CD52 and RFXANK using a gene editing technology selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas system.

19. A population of engineered immune cells, wherein 75% or less of the engineered immune cells functionally express one or both of RFX5 and NLRC5 and exhibit reduced expression levels of MHC class I proteins or complexes and / or MHC class II proteins or complexes at the cell surface.

20. 20. The population of engineered immune cells of claim 19, wherein at least 50% of the engineered immune cells exhibit reduced expression levels of MHC class I proteins or complexes and MHC class II proteins on the cell surface.

21. The population of engineered immune cells of claim 19 or 20, wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, or at least 90% of the engineered cells further express an antigen-binding protein.

22. 22. The population of engineered immune cells of claim 21 , wherein the antigen binding protein is a chimeric antigen receptor (CAR).

23. The population of engineered immune cells of any one of claims 19 to 22, wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, or at least 90% of the engineered cells further comprise one or more genomic modifications of an endogenous TCRa gene.

24. 24. The population of engineered immune cells of any one of claims 19 to 23, wherein the population of engineered immune cells is derived from one or more immune cells obtained from a healthy volunteer, from one or more immune cells obtained from a patient, or from one or more iPSCs.

25. The population of engineered immune cells of any one of claims 19 to 24, wherein the functional expression level of RFX5 and / or NLRC5 is measured by determining the surface expression levels of HLA, beta 2 microglobulin (B2M), or both HLA and B2M on the surface of the engineered immune cells, or by flow cytometry.

26. A method for producing a population of engineered immune cells according to any one of claims 19 to 25, comprising reducing functional expression of one or both of RFX5 and NLRC5 using a gene editing technology selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems.

27. 27. A pharmaceutical composition comprising an engineered immune cell according to any one of claims 1 to 17, or said engineered immune cell produced by the method of claim 18 or 26, or a population of engineered immune cells according to any one of claims 19 to 25, further comprising at least one pharma- ceutically acceptable carrier or excipient.

28. 28. A pharmaceutical composition according to claim 27 for use in a method of treating a condition in a patient.

29. 29. The pharmaceutical composition of claim 28, wherein the condition is a solid tumor or a liquid tumor.

30. A method for reducing the surface expression level of endogenous MHC class I protein and / or MCH class II protein in an engineered immune cell to about 75% or less of the expression level of endogenous MHC class I protein and / or MCH class II protein in a non-engineered immune cell, the method comprising reducing the functional expression level of one or both of RFX5 and NLRC5 to about 75% or less of the expression level in a non-engineered immune cell.

31. 31. The method of claim 30, wherein the cell further expresses an antigen binding protein.

32. 32. The method of claim 31 , wherein the antigen binding protein is a chimeric antigen receptor (CAR).

33. 33. The method of claim 32, wherein the nucleic acid encoding the CAR is inserted into the disrupted RFX5 or NLRC5 locus, or the RFX5 or NLRC5 locus is disrupted by insertion of the nucleic acid encoding the CAR.

34. 34. The method of any one of claims 30 to 33, wherein the engineered immune cells further comprise one or more genomic modifications of one or more of an endogenous TCRa gene and an endogenous CD52 gene.

35. The method of any one of claims 30 to 34, wherein the immune cells are immune cells obtained from a healthy volunteer, obtained from a patient, or derived from iPSCs.

36. The method described in any one of claims 30 to 35, wherein the immune cell is a T cell.

37. The method of any one of claims 30 to 36, comprising reducing the functional expression of one or both of RFX5 and NLRC5 using a gene editing technology selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems.

Images