Compositions for treating sensorineural hearing loss using an otoferlin dual vector system

Abstract

The present disclosure features compositions and methods for treating subjects 25 years of age or older who have a biallelic mutation in otoferlin (OTOF) by OTOF gene therapy. The present disclosure provides various compositions that include a first nucleic acid vector containing a polynucleotide encoding an N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding a C-terminal portion of the OTOF protein. These vectors can be used to treat hearing loss or auditory neuropathy in subjects who have a biallelic OTOF mutation.

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on February 18, 2022 has the name 51471-008WO2_Sequence_Listing_2_17_22_ST25 and is 366,491 bytes in size.

[0002] Described herein are compositions and methods for the treatment of sensorineural hearing loss and auditory neuropathy in human subjects aged 25 years or older, particularly forms of the disease associated with mutations in otoferlin (OTOF), by OTOF gene therapy. The present disclosure provides a dual vector system comprising a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an OTOF protein, and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an OTOF protein. These vectors can be used to increase or provide expression of wild-type OTOF in a subject, such as a human subject suffering from sensorineural hearing loss. [Background technology]

[0003] Sensorineural hearing loss is a type of hearing loss caused by defects in the cells of the inner ear or in the neural pathways that project from the inner ear to the brain. In many cases, sensorineural hearing loss is acquired and can be caused by noise, infection, head trauma, ototoxic drugs, or aging, but there is also congenital sensorineural hearing loss associated with autosomal recessive mutations. One such form of autosomal recessive sensorineural hearing loss is associated with mutations in the otoferlin (OTOF) gene, which is implicated in prelingual nonsyndromic hearing loss. In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a possible solution. However, OTOF is too large to be treated using standard gene therapy approaches. New therapies are needed to treat OTOF-related sensorineural hearing loss. Summary of the Invention

[0004] The present invention provides compositions and methods for treating human subjects aged 25 years or older who have biallelic otoferlin (OTOF) mutations known to cause hearing loss and auditory neuropathy. The compositions described herein can be used to deliver wild-type (WT) OTOF to a subject by gene therapy, and thus can be used to treat hearing loss and auditory neuropathy in a subject. Gene therapy for treating biallelic OTOF mutations is believed to be necessary during the first year of life to restore hearing. However, the inventors have discovered that gene therapy can restore hearing lost due to biallelic OTOF mutations even if the treatment is initiated much later in life. Additionally, the compositions described herein can be used to treat subjects identified as having biallelic OTOF mutations and having detectable otoacoustic emissions, detectable cochlear microphonic potentials, and / or detectable collection potentials.

[0005] In a first aspect, the present invention provides a method for treating a human subject 25 years of age or older having a biallelic otoferlin (OTOF) mutation by administering to the subject a therapeutically effective amount of a dual vector system comprising a first nucleic acid vector comprising a promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of an OTOF protein, and a second nucleic acid vector comprising a second coding polynucleotide encoding a C-terminal portion of the OTOF protein and a polyadenylation (poly(A)) sequence located 3' of the second coding polynucleotide, wherein neither the first nucleic acid vector nor the second nucleic acid vector encodes a full-length OTOF protein.

[0006] In another aspect, the present invention provides a method of treatment comprising administering to a human subject identified as having a biallelic otoferlin (OTOF) mutation and having detectable otoacoustic emissions, detectable cochlear microphonic potentials, and / or detectable collection potentials a therapeutically effective amount of a dual vector system; the dual vector system comprising a first nucleic acid vector comprising a promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of an OTOF protein, and a second coding polynucleotide encoding a C-terminal portion of the OTOF protein, and a second nucleic acid vector comprising a polyadenylation (poly(A)) sequence located 3' of the second coding polynucleotide, wherein neither the first nor the second nucleic acid vector encodes a full-length OTOF protein.

[0007] In some embodiments of any of the aforementioned aspects, the first coding polynucleotide and the second coding polynucleotide do not overlap. In some embodiments of any of the above aspects, the first nucleic acid vector comprises a splice donor signal sequence located 3' of the first coding polynucleotide, and the second nucleic acid vector comprises a splicing acceptor signal sequence located 5' of the second coding polynucleotide. In some embodiments, the first nucleic acid vector comprises a first recombination region located 3' of the splice donor signal sequence, and the second nucleic acid vector comprises a second recombination region located 5' of the splice acceptor signal sequence. In some embodiments, the first and second recombination regions are identical. In some embodiments, the first and / or second recombination region is an AP gene fragment or an F1 phage AK gene. In some embodiments, the F1 phage AK gene comprises or has the sequence of SEQ ID NO: 19. In some embodiments, the AP gene fragment comprises or has the sequence of any one of SEQ ID NOs: 62-67. In some embodiments, the AP gene fragment comprises or has the sequence of SEQ ID NO: 65. In some embodiments, the splice donor sequence comprises or has the sequence of SEQ ID NO:20 or SEQ ID NO:68. In some embodiments, the splice acceptor sequence comprises or has the sequence of SEQ ID NO:21 or SEQ ID NO:69. In some embodiments, the first nucleic acid vector further comprises a degradation signal sequence located 3' of the recombination gene region and the second nucleic acid vector further comprises a degradation signal sequence located between the recombination region and the splice acceptor signal sequence. In some embodiments, the degradation signal sequence comprises or has the sequence of SEQ ID NO:22.

[0008] In some embodiments of any of the preceding aspects, the first and second coding polynucleotides are split at an OTOF exon boundary, hi some embodiments, the OTOF exon boundary is not internal to the first coding polynucleotide or the second coding polynucleotide that encodes the C2 domain.

[0009] In some embodiments of any of the foregoing aspects, the first coding polynucleotide overlaps in part with the second coding polynucleotide. In some embodiments, the first coding polynucleotide overlaps with the second coding polynucleotide by at least 1 kilobase (kb). In some embodiments, the overlap region between the first and second coding polynucleotides is centered on an OTOF exon boundary. In some embodiments, the first coding polynucleotide encodes an N-terminal portion of the OTOF protein and includes the OTOF N-terminus 500 bp 3' to the exon boundary in the center of the overlap region; and the second coding polynucleotide encodes a C-terminal portion of the OTOF protein and includes the OTOF C-terminus 500 bp 5' to the exon boundary in the center of the overlap region. In some embodiments, the OTOF exon boundary in the center of the overlap region is not in the portion of the first coding polynucleotide or the second coding polynucleotide that encodes the C2 domain.

[0010] In some embodiments of any of the foregoing aspects, the OTOF exon boundaries are selected such that the first coding polynucleotide encodes the entire C2C domain and the second coding polynucleotide encodes the entire C2D domain, in some embodiments, the OTOF exon boundaries are the exon 19 / 20 boundary, the exon 20 / 21 boundary, or the exon 21 / 22 boundary.

[0011] In some embodiments of any of the foregoing aspects, the OTOF exon boundaries are selected such that the first coding polynucleotide encodes the entire C2D domain and the second coding polynucleotide encodes the entire C2E domain, hi some embodiments, the OTOF exon boundary is the exon 26 / 27 boundary or the exon 28 / 29 boundary.

[0012] In some embodiments of any of the foregoing aspects, the OTOF exon boundary is in a portion of the first coding polynucleotide and the second coding polynucleotide that encodes the C2D domain. In some embodiments, the OTOF exon boundary is the exon 24 / 25 boundary or the exon 25 / 26 boundary.

[0013] In some embodiments of any of the aforementioned aspects, each of the first and second coding polynucleotides encodes about half of the OTOF protein sequence. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector and the second nucleic acid vector do not include an OTOF untranslated region (UTR).

[0014] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises an OTOF 5'UTR. In some embodiments of any of the aforementioned aspects, the second nucleic acid vector comprises an OTOF 3'UTR.

[0015] In some embodiments of any of the aforementioned aspects, the first and second coding polynucleotides encoding the OTOF protein do not include introns.

[0016] In some embodiments of any of the aforementioned aspects, the first and second coding polynucleotides encoding the OTOF protein do not contain introns.

[0017] In some embodiments of any of the aforementioned aspects, the OTOF protein is a mammalian OTOF protein. In some embodiments of any of the aforementioned aspects, the OTOF protein is a mouse OTOF protein. In some embodiments of any of the aforementioned aspects, the mouse OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9. In some embodiments of any of the aforementioned aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO:6.

[0018] In some embodiments of any of the aforementioned aspects, the OTOF protein is a human OTOF protein. In some embodiments of any of the aforementioned aspects, the human OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5. In some embodiments of any of the aforementioned aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO:1. In some embodiments of any of the aforementioned aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO:2. In some embodiments of any of the aforementioned aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO:3. In some embodiments of any of the aforementioned aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO:4. In some embodiments of any of the foregoing aspects, the OTOF protein comprises or consists of the sequence of SEQ ID NO: 5. In some embodiments of any of the foregoing aspects, the human OTOF protein comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the OTOF protein variant are conservative amino acid substitutions.

[0019] In some embodiments of any of the foregoing aspects, the OTOF protein is encoded by any one of SEQ ID NOs: 10-14. In some embodiments, the OTOF protein is encoded by SEQ ID NO: 10. In some embodiments, the OTOF protein is encoded by SEQ ID NO: 14.

[0020] In some embodiments of any of the aforementioned aspects, the OTOF protein is encoded by any one of SEQ ID NOs:15-18. In some embodiments of any of the foregoing aspects, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO:1 or SEQ ID NO:5, and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO:1 or SEQ ID NO:5. In some embodiments, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO:1, and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO:1. In some embodiments, the first coding polynucleotide encodes amino acids 1-802 of SEQ ID NO:5, and the second coding polynucleotide encodes amino acids 803-1997 of SEQ ID NO:5.

[0021] In some embodiments of any of the foregoing aspects, the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73, or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF protein variant are conservative amino acid substitutions. In some embodiments, the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 73. In some embodiments, the N-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 71.

[0022] In some embodiments of any of the foregoing aspects, the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74, or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF protein variant are conservative amino acid substitutions. In some embodiments, the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74. In some embodiments, the C-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 72.

[0023] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a Kozak sequence located 3' of the promoter and 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF protein.

[0024] In some embodiments of any of the foregoing aspects, the promoter is a ubiquitous promoter. In some embodiments, the ubiquitous promoter is a CAG promoter, a cytomegalovirus (CMV) promoter, a chicken β-actin promoter, a deleted CMV-chicken β-actin promoter (smCBA), a CB7 promoter, a hybrid CMV enhancer / human β-actin promoter, a human β-actin promoter, an elongation factor-1 alpha (EF1 alpha) promoter, or a phosphoglycerate kinase (PGK) promoter. In some embodiments, the ubiquitous promoter is a CAG promoter. In some embodiments, the ubiquitous promoter is a smCBA promoter. In some embodiments, the smCBA promoter has the sequence of SEQ ID NO: 70.

[0025] In some embodiments of any of the above aspects, the promoter is a cochlear hair cell specific promoter. In some embodiments, the cochlear hair cell specific promoter is a myosin 15 (Myo15) promoter, a myosin 7A (Myo7A) promoter, a myosin 6 (Myo6) promoter, a POU class 4 homeobox 3 (POU4F3) promoter, an atonal BHLH transcription factor 1 (ATOH1) promoter, a LIM homeobox 3 (LHX3) promoter, an alpha 9 acetylcholine receptor (alpha 9AChR) promoter, or an alpha 10 acetylcholine receptor (alpha 10AChR) promoter. In some embodiments, the cochlear hair cell specific promoter is a Myo15 promoter.

[0026] In some embodiments of any of the preceding aspects, the promoter is an inner hair cell specific promoter. In some embodiments, the inner hair cell specific promoter is a fibroblast growth factor 8 (FGF8) promoter, a vesicular glutamate transporter 3 (VGLUT3) promoter, an OTOF promoter, or a calcium binding protein 2 (CABP2) promoter. In some embodiments, the inner hair cell specific promoter is a CABP2 promoter.

[0027] In some embodiments of any of the foregoing aspects, the promoter is a short promoter (e.g., a promoter that is 1 kb or less, e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less). In some embodiments, the short promoter is a CAG promoter. In some embodiments, the short promoter is a CMV promoter. In some embodiments, the short promoter is a smCBA promoter. In some embodiments, the short promoter is a Myo15 promoter of 1 kb or less (e.g., a Myo15 promoter having a sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to any one of SEQ ID NOs: 38, 39, or 49-60).

[0028] In some embodiments of any of the foregoing aspects, the promoter is a long promoter (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb, or more in length). In some embodiments, the long promoter is a Myo15 promoter longer than 1 kb (e.g., a Myo15 promoter that includes or consists of a sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence of SEQ ID NO:36).

[0029] In some embodiments of any of the aforementioned aspects, the first and second nucleic acid vectors are a pair of nucleic acid vectors listed in Table 4. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 75. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 75.

[0030] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 182 to 3949 of SEQ ID NO: 77. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 19 to 4115 of SEQ ID NO: 77.

[0031] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 79. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 79.

[0032] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 177 to 3924 of SEQ ID NO: 80. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 19 to 4090 of SEQ ID NO: 80.

[0033] In some embodiments of any of the preceding aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 76. In some embodiments of any of the preceding aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 76.

[0034] In some embodiments of any of the aforementioned aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 187 to 4396 of SEQ ID NO: 78. In some embodiments of any of the aforementioned aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 19 to 4589 of SEQ ID NO: 78.

[0035] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 235 to 4004 of SEQ ID NO: 81. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4227 of SEQ ID NO: 81.

[0036] In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 230 to 3977 of SEQ ID NO: 83. In some embodiments of any of the aforementioned aspects, the first nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4200 of SEQ ID NO: 83.

[0037] In some embodiments of any of the aforementioned aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes the sequence of nucleotides 229 to 4438 of SEQ ID NO: 72. In some embodiments of any of the aforementioned aspects, the second nucleic acid vector comprises a polynucleotide sequence that includes, or consists of, the sequence of nucleotides 12 to 4655 of SEQ ID NO: 82.

[0038] In some embodiments of any of the foregoing aspects, the first and second nucleic acid vectors comprise inverted terminal repeats (ITRs) at both ends of the nucleic acid sequence. In some embodiments, the first vector comprises a first ITR sequence 5' of the promoter, an ITR sequence 3' of the recombination region, and a second ITR sequence 3' of the poly(A) sequence. In some embodiments, the ITRs in the first and second vectors are AAV2 ITRs. In some embodiments, the ITRs in the first and second vectors have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to the AAV2 ITRs.

[0039] In some embodiments of any of the aforementioned aspects, the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence. In some embodiments of any of the foregoing aspects, the second nucleic acid vector comprises a Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE). In some embodiments, the WPRE comprises or consists of the sequence of SEQ ID NO:23 or SEQ ID NO:61.

[0040] In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a redundant dual vector. In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a trans-splicing duplex vector.

[0041] In some embodiments of any of the aforementioned aspects, the nucleic acid vector is a two-hybrid vector. In some embodiments of any of the foregoing aspects, the nucleic acid vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has a DJ / 9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has an AAV2quad(YF) capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has an AAV8 capsid.

[0042] In some embodiments of any of the foregoing aspects, the first and second nucleic acid vectors have the same capsid (e.g., both the first and second nucleic acid vectors are AAV vectors having an AAV1 capsid or an AAV9 capsid). In some embodiments of any of the foregoing aspects, the first and second nucleic acid vectors have different capsids (e.g., the first nucleic acid vector is an AAV having an AAV1 capsid and the second nucleic acid vector is an AAV having an AAV9 capsid).

[0043] In some embodiments of any of the aforementioned aspects, the subject is 30 years of age or older. In some embodiments of any of the aforementioned aspects, the subject is 35 years of age or older. In some embodiments of any of the aforementioned aspects, the subject is 40 years of age or older.

[0044] In some embodiments of any of the aforementioned aspects, the subject is 45 years of age or older. In some embodiments of any of the aforementioned aspects, the subject is 50 years of age or younger. In some embodiments of any of the aforementioned aspects, the subject has been identified as having a biallelic OTOF mutation.

[0045] In some embodiments of any of the aforementioned aspects, the method further comprises identifying the subject as having a biallelic OTOF mutation prior to administering the dual vector system. In some embodiments of any of the aforementioned aspects, the subject has been identified as having detectable otoacoustic emissions.

[0046] In some embodiments of any of the aforementioned aspects, the method further includes identifying the subject as having detectable otoacoustic emissions prior to administering the dual vector system. In some embodiments of any of the aforementioned aspects, the subject has been identified as having detectable cochlear microphonic potentials.

[0047] In some embodiments of any of the aforementioned aspects, the method further comprises identifying the subject as having a detectable cochlear microphonic potential prior to administering the dual vector system.

[0048] In some embodiments of any of the aforementioned aspects, the subject has been identified as having a detectable collection potential. In some embodiments of any of the aforementioned aspects, the method further includes identifying the subject as having a detectable aggregation potential prior to administering the dual vector system.

[0049] In some embodiments of any of the aforementioned aspects, the method further comprises assessing the subject's hearing prior to administering the dual vector system. In some embodiments of any of the aforementioned aspects, the subject has, or has been identified as having, deafness, autosomal recessive 9 (DFNB9).

[0050] In some embodiments of any of the aforementioned aspects, the method further comprises assessing the subject's hearing prior to administering the dual vector system. In some embodiments of any of the foregoing aspects, the dual vector system is administered locally to the middle or inner ear, hi some embodiments, the dual vector system is administered by injection via the round window, injection into the semicircular canal, canalotomy, insertion of a catheter via the round window, transtympanic injection, or intratympanic injection.

[0051] In some embodiments of any of the aforementioned aspects, the method further includes assessing the hearing of the subject after administering the dual vector system. In some embodiments of any of the aforementioned aspects, the method enhances OTOF expression in cochlear hair cells. In some embodiments of any of the aforementioned aspects, the cochlear hair cells are inner hair cells.

[0052] In some embodiments of any of the foregoing aspects, the dual vector system increases OTOF expression in cells (e.g., cochlear hair cells), improves hearing (e.g., as assessed by standard tests such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions), prevents or reduces hearing loss, delays the onset of hearing loss, slows the progression of hearing loss, improves speech discrimination, or improves hair cell function.

[0053] In some embodiments of any of the foregoing aspects, the dual vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing (e.g., as assessed by standard tests such as audiometry, ABR, ECOG, and otoacoustic emissions), improve speech discrimination, or improve hair cell function.

[0054] In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered simultaneously. In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered sequentially.

[0055] In some embodiments of any of the preceding aspects, the first vector and the second vector are at least 1×10 7 Vector genome (VG) / ear ~ approx. 2 × 10 15 VG / ear (e.g. 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×109 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 It is administered at a concentration of 100 mg / ear.

[0056] In some embodiments of any of the aforementioned aspects, the first vector and the second vector are administered in amounts sufficient to, together, transduce at least 20% of the subject's inner hair cells with both the first vector and the second vector (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the subject's inner hair cells are transduced with both vectors).

[0057] In some embodiments of any of the aforementioned aspects, the dual vector is administered in a composition that includes a pharma- ceutically acceptable excipient. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises a sequence of SEQ ID NO:26 and / or SEQ ID NO:27 operably linked to a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:24, or a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:25, or a functional part or derivative thereof comprising the sequence of SEQ ID NO: 31 and / or SEQ ID NO: 32, optionally including a linker comprising 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 24. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 25.

[0058] In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 36. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 36. In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 38. In some embodiments of any of the preceding aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 38. In some embodiments of any of the preceding aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 39. In some embodiments of any of the preceding aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 39. In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:53. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO:53. In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:54.In some embodiments of any of the preceding aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 54. In some embodiments of any of the preceding aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 59. In some embodiments of any of the preceding aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 59. In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 60. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 60.

[0059] In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises a sequence of SEQ ID NO:31 and / or SEQ ID NO:32 operably linked to a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:25, or a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:24. The nucleic acid sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27 may be optionally provided, and may include a functional part or derivative thereof, or a linker comprising 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 25. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 24.

[0060] In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 37. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 37. In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 58. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of SEQ ID NO:58.

[0061] In some embodiments of any of the foregoing aspects, the Myol5 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:24, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:26 and / or SEQ ID NO:27. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:24.

[0062] In some embodiments of any of the foregoing aspects, the Myol5 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:25, or a functional portion or derivative thereof, including the sequence of SEQ ID NO:31 and / or SEQ ID NO:32. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO:25.

[0063] In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:27. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:26 and the sequence of SEQ ID NO:27. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:28. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:29. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:30. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:24 comprises the sequence of SEQ ID NO:50.

[0064] In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:31. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:32. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:51. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:51. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:31 and the sequence of SEQ ID NO:32. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:33. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:34. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:35. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:25 comprises the sequence of SEQ ID NO:55.

[0065] In some embodiments of any of the foregoing aspects, the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of any one of SEQ ID NOs: 50-58. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 50. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 51. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 52. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 53. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 54. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 55. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 56. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 57. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 58.

[0066] In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:40, or a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% or more sequence identity) to SEQ ID NO:41. 42 linked (e.g. operably linked) to a second region having a sequence identity (e.g., 96%, 97%, 98%, 99% or more) with the first region; or, optionally, a functional portion or derivative thereof comprising 1 to 400 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 250, 1 to 300, 1 to 400, 1 to 500, 1 to 600, 1 to 700, 1 to 800, 1 to 900, 1 to 1000, 1 to 1250, 1 to 1500, 1 to 1750, 1 to 2000, 1 to 2500, 1 to 3000, 1 to 4000, 1 to 5000, 1 to 6000, 1 to 7000, 1 to 8000, 1 to 9000, 1 to 1000, 1 to 1250, 1 to 1500, 1 to 2500, 1 to 3000, 1 to 4000, 1 to 5000, 1 to 6000, 1 to 7000, 1 to 8000, 1 to 9000, 1 to 1000, 1 to 12 , 1~225, 1~250, 1~275, 1~300, 1~325, 1~350, 1~375, 1~400, 10~20, 10~30, 10~40, 10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 20~30, 20~40, 20~50, 20~60, 20~70, 20~80, 20~90, 20~100, 30~100, 40~100, 50~100, 50~150, 50~200, 50~250, 50~300, 50~350, 50~400, 100~150, 1 The nucleic acid sequence of SEQ ID NO: 43 and / or SEQ ID NO: 44, comprising a linker containing a linker of 00-200, 100-250, 100-300, 100-350, 100-400, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-300, 250-350, 250-400, 300-400, or 350-400 nucleotides, or comprising a functional part or derivative thereof. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 40. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 41.

[0067] In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 48. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 48.

[0068] In some embodiments of any of the aforementioned aspects, the Myol5 promoter has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 49. In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises or consists of the sequence of SEQ ID NO: 49.

[0069] In some embodiments of any of the aforementioned aspects, the Myol5 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:41, or a second region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:40. 5%, 96%, 97%, 98%, 99% or more sequence identity) to a second region having the sequence of SEQ ID NO: 43 and SEQ ID NO: 44 linked (e.g. operably linked) to the second region having the sequence identity (e.g. 5%, 96%, 97%, 98%, 99% or more), or a functional part or derivative thereof comprising 1 to 400 nucleotides (e.g. 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1~175, 1~200, 1~225, 1~250, 1~275, 1~300, 1~325, 1~350, 1~375, 1~400, 10~20, 10~30, 10~40, 10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 20~30, 20~40, 20~50, 20~60, 20~70, 20~80, 20~90, 20~100, 30~100, 40~100, 50~100, 50~150, 50~200, 50~250, 50~300, 50~350, 50~4 In some embodiments, the first region comprises or consists of a sequence of SEQ ID NO: 42, a functional part or derivative thereof, including a linker comprising a linker comprising a linker of a sequence of SEQ ID NO: 42, a functional part or derivative thereof, including ...

[0070] In some embodiments of any of the foregoing aspects, the Myol5 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 40, or a functional portion or derivative thereof including the sequence of SEQ ID NO: 42. In some embodiments, the region comprises or consists of the sequence of SEQ ID NO: 40.

[0071] In some embodiments of any of the foregoing aspects, the Myol5 promoter comprises or consists of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 41, or a functional portion or derivative thereof, including the sequence of SEQ ID NO: 43 and / or SEQ ID NO: 44. In some embodiments, the region comprises or consists of the sequence of SEQ ID NO: 41.

[0072] In some embodiments of any of the aforementioned aspects, the functional portion of SEQ ID NO:40 comprises the sequence of SEQ ID NO:42. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:43. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:44. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:43 and the sequence of SEQ ID NO:44. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:45. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:46. In some embodiments of any of the preceding aspects, the functional portion of SEQ ID NO:41 comprises the sequence of SEQ ID NO:47.

[0073] In some embodiments of any of the aforementioned aspects, the Myol5 promoter is operably linked to the transgene and drives transgene expression when introduced into a hair cell. definition As used herein, the term "about" refers to a value within 10% above or below the stated value.

[0074] As used herein, "administration" refers to providing or giving a therapeutic agent (e.g., a composition comprising a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an otoferlin protein, and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an otoferlin protein) to a subject by any effective route. Exemplary administration routes are described herein below.

[0075] As used herein, the term "biallelic OTOF mutation" refers to a condition in which a mutation is present in both alleles (copies) of the OTOF gene. A subject with a biallelic OTOF mutation may have two OTOF alleles with the same mutation, or may have a different mutation in each allele.

[0076] As used herein, the phrase "administering to the inner ear" refers to providing or giving a therapeutic agent described herein to a subject by any route that allows for transduction of inner ear cells. Exemplary routes of administration to the inner ear include the perilymph or endolymph, e.g., or the oval window, round window, or semicircular canal (e.g., the horizontal semicircular canal), or transtympanic or intratympanic injection, e.g., administration to hair cells.

[0077] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or operational characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include cells isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or a common organ, tissue system, blood vessel, or other structure and / or region in the body.

[0078] As used herein, the term "cochlear hair cells" refers to a specialized group of cells in the inner ear that are involved in the detection of sound. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and genetic mutations that disrupt the function of cochlear hair cells are associated with hearing loss and hearing loss.

[0079] As used herein, the terms "conservative mutation," "conservative substitution," and "conservative amino acid substitution" refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric bulk, as summarized in Table 1 below for each of the 20 naturally occurring amino acids.

[0080] [Table 1]

[0081] According to this table, it is understood that the families of conservative amino acids include: (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Thus, a conservative variation or substitution is one that replaces an amino acid with a member of the same amino acid family (e.g., Ser for Thr, or Lys for Arg).

[0082] As used herein, the term "degradation signal sequence" refers to a sequence (e.g., a nucleotide sequence that can be translated into an amino acid sequence) that mediates degradation of a polypeptide that contains it. Inclusion of a degradation signal sequence in the nucleic acid vector of the present invention can reduce or prevent expression of the otoferlin protein in portions that are not reached by recombination and / or splicing. An exemplary degradation signal sequence for use in the present invention is GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO: 22).

[0083] As used herein, the terms "effective amount", "therapeutically effective amount" and "sufficient amount" of a composition, vector construct, or viral vector described herein refer to an amount sufficient to produce beneficial or desired results, including clinical results, when administered to a subject in need thereof, including a mammal, e.g., a human, and thus the "effective amount" or its synonyms depend on the context in which it is applied. For example, with respect to the treatment of sensorineural hearing loss, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to the response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that corresponds to such an amount will vary depending on various factors, such as the given drug, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject (e.g., age, sex, weight) or host to be treated, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition, vector construct, or viral vector of the present disclosure is an amount that produces beneficial or desired results in a subject compared to a control. It should be noted that when active ingredients are administered in combination, the effective amount of the combination may or may not include the amount of each ingredient that would be effective when administered individually.As defined herein, the therapeutically effective amount of the composition, vector construct, or viral vector of the present disclosure can be easily determined by those skilled in the art by routine methods known in the art.Dosage regimen can be adjusted to provide optimal therapeutic response.

[0084] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell).

[0085] As used herein, the term "express" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0086] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell). Exogenous material includes materials provided from an external source to an organism or a culture extracted therefrom.

[0087] As used herein, the term "hair cell-specific expression" refers to the production of an RNA transcript or polypeptide primarily in hair cells (e.g., cochlear hair cells) compared to other cell types of the inner ear (e.g., spiral ganglion neurons, glia, or other inner ear cell types). Hair cell-specific expression of a transgene can be confirmed by comparing expression of the transgene (e.g., RNA or protein expression) among various cell types of the inner ear (e.g., in hair cells versus non-hair cells) using any standard technique (e.g., quantitative RT PCR, immunohistochemistry, Western blot analysis, or fluorescence measurement of a reporter (e.g., GFP) operably linked to a promoter). A hair cell specific promoter induces expression (e.g., RNA or protein expression) of a transgene to which it is operably linked, and the induced expression is at least 50% (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) greater in hair cells (e.g., cochlear hair cells) than in at least three (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) of the following inner ear cell types: border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, first row Deiters cells, second row Deiters cells, third row Deiters cells, Hensen cells, Claudius cells, inner sulcus cells, outer sulcus cells, spiral ridge cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, spiral ganglion neurons, and Schwann cells.

[0088] As used herein, the terms "increase" and "decrease" refer to the modulation of function, expression, or activity, resulting in a greater or lesser amount, respectively, of a baseline value, as compared to a reference. For example, following administration of a composition in the manner described herein, the amount of a quantification marker described herein (e.g., OTOF expression or auditory brainstem response) may be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more in a subject relative to the amount of the marker before administration. Generally, the baseline value is measured at a time when administration produces the described effect, e.g., at least 1 week, 1 month, 3 months, or 6 months after starting a treatment regimen.

[0089] As used herein, the term "intron" refers to a region in the coding region of a gene whose nucleotide sequence is not translated into the amino acid sequence of the corresponding protein. The term intron also refers to the corresponding region of the RNA transcribed from the gene. Introns are transcribed into pre-mRNA but are removed during processing and are not included in the mature mRNA.

[0090] As used herein, "local" or "local administration" refers to administration at a particular site of the body for a local rather than a systemic effect. Examples of local administration are onto the skin of a subject, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional, lymph node, intratumor, to the inner ear, and to mucous membranes, where administration is intended to produce a local rather than a systemic effect.

[0091] As used herein, the term "operably linked" refers to a first molecule that can bind to a second molecule, positioning the molecules such that the first molecule affects the function of the second molecule. The term "operably linked" includes juxtaposing two or more components (e.g., a promoter and another sequence element) such that both components function normally and can mediate the function of at least one component acting on at least one other component. The two molecules may or may not be part of a single unbroken molecule, and may be adjacent or non-adjacent. For example, a promoter is operably linked to a transcribable polynucleotide molecule of interest if it regulates the transcription of the transcribable polynucleotide molecule of interest in a cell. In further embodiments, two portions of a transcriptional regulatory element are operably linked to each other when they are linked such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without the presence of an intervening nucleotide.

[0092] As used herein, the terms "otoferlin" and "OTOF" refer to a gene associated with nonsyndromic recessive hearing loss DNFB9. The terms "otoferlin" and "OTOF" also refer to mutants of wild-type OTOF proteins and the nucleic acid sequences encoding them, and, for example, a mutant protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 163%, 164%, 165%, 166%, 167%, 168%, 169%, 170%, 171%, 17 OTOF refers to a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the nucleic acid sequence of the wild-type OTOF gene. As used herein, OTOF can refer to a protein localized in inner hair cells or a gene encoding this protein, depending on the context, as will be understood by those skilled in the art.

[0093] As used herein, the terms "otoferlin isoform 5" and "OTOF isoform 5" refer to an isoform of the gene associated with non-syndromic recessive hearing loss DFNB9. The human isoform of the gene is related to reference sequence NM_001287489, and the transcript contains exons 1-45 and 47 of human otoferlin, but lacks exon 46 of the OTOF gene. Human OTOF isoform 5 protein is also known as otoferlin isoform e. The terms "otoferlin isoform 5" and "OTOF isoform 5" refer to variants of wild-type OTOF isoform 5 protein, and polynucleotides encoding same, that have at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) to the amino acid sequence of wild-type OTOF isoform 5 protein (e.g., SEQ ID NO:1). It refers to a mutant protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity or more) to the polynucleotide sequence of the wild-type OTOF isoform 5 gene, provided that the encoded OTOF isoform 5 analog retains the therapeutic function of wild-type OTOF isoform 5. OTOF isoform 5 protein variants can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) conservative amino acid substitutions relative to wild-type OTOF isoform 5 (e.g., SEQ ID NO:1), provided that the OTOF isoform 5 variant retains the therapeutic function of wild-type OTOF isoform 5 and has no more than 10% amino acid substitutions in the N-terminal portion of the amino acid sequence and no more than 10% amino acid substitutions in the C-terminal portion of the amino acid sequence.As used herein, OTOF isoform 5 may refer to a protein localized to inner hair cells or to the gene encoding this protein, depending on the context, as will be understood by those of skill in the art. OTOF isoform 5 may refer to human OTOF isoform 5, or to a homologue in another mammalian species. Mouse otoferlin contains one additional exon compared to human otoferlin (48 exons in mouse otoferlin), and the exons in mouse otoferlin that correspond to those encoding human OTOF isoform 5 are 1-5, 7-46, and 48. The exon numbering rules used herein are based on the exons currently understood to be present in the consensus transcript of human OTOF.

[0094] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule that can transport another nucleic acid to which it is linked. Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Certain plasmids can induce the expression of genes to which they are operatively linked.

[0095] As used herein, the terms "nucleic acid" and "polynucleotide", which are used interchangeably herein, refer to a polymeric form of nucleosides of any length. Generally, polynucleotides are composed of nucleosides naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. However, the term encompasses molecules containing nucleosides or nucleoside analogs with chemically or biologically modified bases, modified backbones, and the like, whether or not found in natural nucleic acids, and such molecules may be preferred for certain applications. When the application refers to polynucleotides, it is understood that both DNA, RNA, and in each case both single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" can refer to the polynucleotide material itself and / or to the sequence information (i.e., the series of letters used as abbreviations for bases) that biochemically characterize a particular nucleic acid. Polynucleotide sequences presented herein are shown in the 5' to 3' orientation unless otherwise indicated.

[0096] As used herein, the term "complementarity" or "complementary" of a nucleic acid means that a nucleotide sequence of one strand of a nucleic acid forms hydrogen bonds with another sequence on an opposite nucleic acid strand due to the orientation of its nucleobases. Complementary bases in DNA are usually A and T, and C and G. In RNA, they are usually C and G, and U and A. Complementarity can be complete or substantial / sufficient. Complete complementarity between two nucleic acids means that the two nucleic acids can form a duplex, in which all bases in the duplex bind to complementary bases by Watson-Crick pairing. "Substantially" or "fully" complementary means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but that sufficient binding occurs between the bases of the two strands under a set of hybridization conditions (e.g., salt concentration and temperature) to form a stable hybrid complex. Such conditions can be predicted by predicting the Tm (melting temperature) of the hybridized strands using the sequences and standard mathematical calculations, or by empirically determining the Tm using routine methods. The Tm comprises the temperature at which 50% of the population of hybridization complexes formed between two nucleic acid strands denatures (i.e., half of the population of double-stranded nucleic acid molecules dissociates into single strands). At temperatures below the Tm, the formation of hybridization complexes is favored, while at temperatures above the Tm, melting or separation of the strands in the hybridization complexes is favored. The Tm of a nucleic acid may be estimated using a known G+C content in 1M NaCl aqueous solution, for example, Tm=81.5+0.41(%G+C), although other known Tm calculations take into account the structural properties of the nucleic acid.

[0097] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase promotes transcription of the transgene. Exemplary promoters suitable for use in the compositions and methods described herein include ubiquitous promoters (e.g., CAG promoter, cytomegalovirus (CMV) promoter, and deleted versions of the chimeric CMV-chicken β-actin promoter (CBA), referred to as the hybrid chicken β-actin / rabbit β-globin intron, smCBA), cochlear hair cell specific promoters (e.g., myosin 15 (Myo15) promoter, myosin 7A (Myo7A) promoter, myosin 6 (Myo6) promoter, POU class 4 homeobox 3 (POU4F3) promoter), and inner hair cell specific promoters (e.g., fibroblast growth factor 8 (FGF8) promoter, vesicular glutamate transporter 3 (VGLUT3) promoter, and OTOF promoter) that have been extensively deleted to generate compact versions.

[0098] "Percentage of amino acid sequence identity" to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of measuring percentage of nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software, such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to obtain maximum alignment over the full length of the sequences being compared. For example, percentage of sequence identity values ​​can be generated using the sequence comparison computer program BLAST. By way of illustration, the percentage of sequence identity of a given nucleic acid or amino acid sequence A to or with a given nucleic acid or amino acid sequence B (which can alternatively be referred to as a given nucleic acid or amino acid sequence A having a particular percentage of identity to or with a given nucleic acid or amino acid sequence B) is calculated as follows:

[0099] 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in a programmatic alignment of A and B, and Y is the total number of nucleic acids in B. If the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percentage of sequence identity of A to B will not be equal to the percentage of sequence identity of B to A.

[0100] As used herein, the term "derivative" refers to a nucleic acid, peptide, or protein, or a variant or analog thereof, that contains one or more mutations and / or chemical modifications compared to the corresponding full-length wild-type nucleic acid, peptide, or protein. Non-limiting examples of chemical modifications involving nucleic acids include, for example, modifications to the base moiety, sugar moiety, phosphate moiety, phosphate-sugar backbone, or combinations thereof.

[0101] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharma- ceutically acceptable excipients, diluents, and / or carriers, for administration to a subject, such as a mammal, e.g., a human, to prevent, treat, or control a particular disease or condition that affects or may affect the subject.

[0102] As used herein, the term "pharmaceutical acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without undue toxicity, irritation, allergic response, and other problematic hazards, and with a reasonable benefit / risk ratio. Preferably, the term "pharmaceutical acceptable" means approved by a federal or state government regulatory agency, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias, for use in mammals, and more specifically, in humans.

[0103] As used herein, the term "recombinogenic region" refers to a region of homology that mediates recombination between two distinct sequences. As used herein, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of a polynucleotide encoding OTOF. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990), which is incorporated herein by reference.

[0104] As used herein, the term "sample" refers to a specimen isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villus samples, and cells).

[0105] As used herein, the term "transfection" refers to any of a wide variety of techniques commonly used for the introduction of foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, Nucleofection, squeezeporation, sonoporation, phototransfection, magnetofection, imparefection, and the like.

[0106] As used herein, the terms "subject" and "patient" refer to animals (e.g., mammals such as humans), veterinary subjects (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), and experimental animal models of disease (e.g., mice, rats). Subjects treated according to the methods described herein may be subjects who have been diagnosed with hearing loss (e.g., hearing loss associated with a mutation in OTOF) or who are at risk for developing these conditions. Diagnosis may be performed by any method or technique known in the art. Those skilled in the art will understand that subjects treated according to the present disclosure may have undergone standard testing or may not have undergone testing but have been identified as at risk due to the presence of one or more risk factors associated with a disease or condition.

[0107] As used herein, the terms "transduction" and "transducing" refer to a method of introducing a vector construct or a portion thereof into a cell. When the vector construct is contained in a viral vector, such as, for example, an AAV vector, transduction refers to viral infection of a cell and the subsequent transfer and integration of the vector construct or a portion thereof into the cellular genome.

[0108] As used herein, "treatment" and "treating" of a condition, disorder or condition can include: (1) preventing, delaying, or reducing the incidence and / or likelihood of at least one clinical or asymptomatic symptom of the condition, disorder or condition developing in a subject who may be afflicted with or predisposed to the condition, disorder or condition, but who has not yet experienced or exhibited clinical or asymptomatic symptoms; or (2) inhibiting the condition, disorder or condition, i.e., preventing, reducing, or delaying the onset of the disease or its recurrence or the onset of at least one clinical or asymptomatic symptom; or (3) relieving the disease, i.e., regressing the condition, disorder or condition, or at least one clinical or asymptomatic symptom thereof. The benefit to a subject being treated is statistically significant or at least perceptible to the patient or physician.

[0109] As used herein, the term "vector" includes nucleic acid vectors (e.g., DNA vectors such as plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). A variety of vectors have been developed to deliver polynucleotides encoding foreign proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO94 / 011026, which is incorporated herein by reference as it relates to vectors suitable for expressing genes of interest. Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express the OTOFs described herein include vectors that include regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other vectors useful for expressing OTOFs include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of genes incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0110] As used herein, the term "wild type" refers to the most frequently occurring genotype for a particular gene in a given organism. [Brief description of the drawings]

[0111] [Figure 1]Figure 1 shows ABR threshold recovery in homozygous OTOF-Q828X mutant mice treated at 32 or 52 weeks of age. Animals were administered vehicle (n=5 / age group) or dual hybrid AAV-Myo15-hOTOF vector (n=10 / age group) through the round window under isoflurane anesthesia. ABR recovery was observed 10 / 10 in 32 week old animals treated with OTOF dual vectors and 9 / 10 in 52 week old animals 4 weeks after treatment was terminated. [Figure 2A-1] FIG. 1 is a series of graphs showing the number of inner and outer hair cells over time in homozygous (Otof-Q828X hom) and heterozygous (Otof-Q828X het) Otof-Q828X mice. IHC counts were counted in 50 mouse ears between 5 and 42 weeks of age. Counts are shown for cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz. In Otof-Q828X hom mice, there was a statistically significant decrease in IHC counts with age at all frequencies tested. Similar trends in IHC counts were observed in het mice at even lower frequencies (Kendall's rank correlation). IHC counts in Otof-828X hom and het animals remained stable through 16 weeks. Starting at 16 weeks, Otof-Q828X hom animals began to show a decline in IHC counts at 22.6-45.2 kHz, and at low frequencies (8-16 kHz) showed a decrease after 24 weeks. The decline in IHC counts in Otof-Q828X het mice began at 24 weeks at 16 and 32 kHz. After 32 weeks, >75% of IHCs were preserved at most frequencies tested (<45.2 kHz). [Figure 2A-2] Same as above. [Figure 2B-1]A-B are a series of graphs showing inner and outer hair cell counts over time in homozygous (Otof-Q828X hom) and heterozygous (Otof-Q828X het) Otof-Q828X mice. The number of OHCs was counted in 50 mouse ears between 5 and 42 weeks of age. Counts are shown in cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz. Outer hair cell counts in Otof-Q828X hom and het mice were consistent over the 6-month study period at all frequencies (Kendall's rank correlation) except for 8 kHz, where het mice showed a decrease in counts with age. OHC counts at 5.6 kHz and 45.2 kHz were associated with greater variability, indicating scattered counting differences between het and hom at the ages tested. The majority of OHCs remained after 32 weeks. [Figure 2B-2] Same as above. [Diagram 3] Graph showing ABR threshold recovery in homozygous OTOF-Q828X mutant mice. ABR thresholds measured at 22.6 kHz were plotted against the percentage of inner hair cells (IHCs) expressing otoferlin for multiple studies of adult homozygous OTOF-Q828X mutant mice treated with the OTOF dual vector system. Measurements were performed after ≥4 weeks of treatment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0112] A first nucleic acid vector containing a promoter and a polynucleotide encoding an N-terminal portion of an otoferlin (OTOF) protein (e.g., a wild-type (WT) OTOF protein) and a second nucleic acid vector containing a polynucleotide encoding a C-terminal portion of the OTOF protein and a polyadenylation (poly(A)) sequence are administered to a subject, thereby improving the quality of life of a subject who is at least 25 years of age (e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, Described herein are compositions and methods for treating sensorineural hearing loss or auditory neuropathy due to biallelic otoferlin (OTOF) mutations in a human subject aged 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years, e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years. When introduced into a mammalian cell, such as a cochlear hair cell, the polynucleotides encoded by the two nucleic acid vectors can combine to form a polynucleotide encoding a full-length OTOF protein. Thus, the compositions and methods described herein can be used to induce or increase expression of WT OTOF in cochlear hair cells of subjects with OTOF deficiency (e.g., homozygous or compound heterozygous mutations in OTOF). The compositions and methods described herein can also be used to treat subjects identified as having a biallelic OTOF mutation and having detectable otoacoustic emissions, detectable cochlear microphonic potentials, and / or detectable collection potentials.

[0113] Otoferin OTOF is a 230 kDa membrane protein that contains at least six C2 domains that are involved in calcium, phospholipid, and protein binding. Human OTOF is encoded by a gene containing 48 exons, and the full-length protein consists of 1,997 amino acids. OTOF is located at the ribbon synapse of inner hair cells and is thought to function as a calcium sensor for synaptic vesicle fusion, triggering the fusion of neurotransmitter-containing vesicles with the plasma membrane. It has also been implicated in vesicle recruitment and clathrin-mediated endocytosis, and has been shown to interact with myosin VI, Rab8b, SNARE proteins, calcium channels Cav1.3, Ergic2, and AP-2. The mechanism by which OTOF mediates exocytosis and the physiological significance of its interactions with binding partners remain to be elucidated.

[0114] Otoferlin-related hearing loss OTOF was first identified by a study investigating the genetics of autosomal recessive deafness 9 (DFNB9), a form of nonsyndromic hearing loss. Mutations in OTOF have since been found to cause sensorineural hearing loss in patients worldwide. Many patients with OTOF mutations suffer from auditory neuropathy, a disorder in which the inner ear detects sound but fails to properly transmit sound from the ear to the brain. These patients suffer from abnormal auditory brainstem responses (ABRs) and speech discrimination with initially normal otoacoustic emissions. Patients with homozygous or compound heterozygous mutations often develop hearing loss during early childhood, and the severity of hearing impairment has been found to vary depending on the location and type of mutation in OTOF. At least 220 mutations have been identified in OTOF, including mutations that result in deletions and mutations that do not result in deletions.

[0115] The present invention is based, in part, on the discovery that administration of a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an OTOF protein and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an OTOF protein to adult (32 weeks old) and middle-aged (52 weeks old) otoferlin-deficient mice is effective in treating hearing loss. These data indicate that delivery of otoferlin to adult and middle-aged otoferlin-deficient mice can restore hearing regardless of the hair cell loss that occurs with age in otoferlin-deficient mice, and suggest that otoferlin gene therapy can also be used to treat human subjects of similar ages (32-week old and 52-week old mice correspond to human subjects of approximately 30-50 years old). Humans also experience an age-dependent loss of hair cells, which may limit the effectiveness of gene therapy approaches in the elderly. However, the inventors also found that hearing was restored in otoferlin-deficient mice when approximately 20% of the inner hair cells expressed otoferlin, indicating that hearing was treated even when a relatively small percentage of the inner hair cells were transduced. Taken together, these data indicate that adult human subjects (e.g., human subjects aged 25 years or older, e.g., 25-50, 25-45, 25-40, 25-35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 years old, e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years old) with biallelic OTOF mutations can be treated using a dual vector system encoding OTOF.

[0116] The compositions and methods described herein can be used to treat sensorineural hearing loss or auditory neuropathy caused by biallelic OTOF mutations by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF protein. The full-length OTOF coding sequence is too large to be included in the types of vectors commonly used for gene therapy (e.g., adeno-associated virus (AAV) vectors, which are believed to have a packaging limit of 5 kb). The compositions and methods described herein overcome this problem by splitting the OTOF coding sequence between two different nucleic acid vectors that can combine in cells to reconstitute the full-length OTOF sequence. These compositions and methods can be used to treat subjects with one or more mutations in the OTOF gene, such as OTOF mutations that reduce OTOF expression, reduce OTOF function, or are associated with hearing loss. When the first nucleic acid vector and the second nucleic acid vector are administered in a composition, the polynucleotides encoding the N-terminal and C-terminal portions of OTOF combine within a cell (e.g., a human cell, e.g., a cochlear hair cell) to form a single nucleic acid molecule containing the full-length OTOF coding sequence (e.g., via homologous recombination and / or splicing).

[0117] Nucleic acid vectors used in the compositions and methods described herein include nucleic acid sequences encoding wild-type OTOF or variants thereof, such as nucleic acid sequences that, when combined, encode a protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the amino acid sequence of wild-type human or mouse OTOF. Polynucleotides used in the nucleic acid vectors described herein can encode the N-terminal and C-terminal portions of the OTOF amino acid sequence in Table 2 below (e.g., two portions that, when combined, encode the full-length OTOF amino acid sequence set forth in Table 2, e.g., any one of SEQ ID NOs: 1-5).

[0118] According to the methods described herein, a polynucleotide sequence encoding an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 5, or a polynucleotide sequence encoding an amino acid sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the ... (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) is administered to a subject. A composition comprising a first nucleic acid vector and a second nucleic acid vector, each comprising an N-terminal portion and a C-terminal portion of a polynucleotide sequence encoding an amino acid sequence containing one or more conservative amino acid substitutions for OTOF1, OTOF2, OTOF3, OTOF4, OTOF5, OTOF6, OTOF7, OTOF8, OTOF9, OTOF10, OTOF11, OTOF12, OTOF13, OTOF14, OTOF15, OTOF16, OTOF17, OTOF18, OTOF19, OTOF20, OTOF21, OTOF22, OTOF23, OTOF24, OTOF25, OTOF26, OTOF27, OTOF28, OTOF29, OTOF30, OTOF31, OTOF32, OTOF33, OTOF34, OTOF35, OTOF36, OTOF37, OTOF38, OTOF39, OTOF39, OTOF40, OTOF41, OTOF42, OTOF43, OTOF44, OTOF45, OTOF46, OTOF47, OTOF48, OTOF49, OTOF49, OTOF49, OTOF48, OTOF49, OTOF41, OTOF42, OTOF43, OTOF44, OTOF45, OTOF46, OTOF47, OTOF48, OTOF49 ... The OTOF protein can be a human OTOF protein or can be a homologue of the human protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal). In some embodiments, the encoded OTOF protein has the sequence of SEQ ID NO: 1 (OTOF isoform 1). In some embodiments, the encoded OTOF protein has the sequence of SEQ ID NO: 5 (OTOF isoform 5).

[0119]

Table 2-1

[0120]

Table 2-2

[0121]

Table 2-3

[0122]

Table 2-4

[0123]

Table 2-5

[0124]

Table 2-6

[0125]

Table 2-7

[0126]

Table 2-8

[0127]

Table 2-9

[0128]

Table 2-10

[0129]

Table 2-11

[0130]

Table 2-12

[0131]

Table 2-13

[0132]

Table 2-14

[0133]

Table 2-15

[0134]

Table 2-16

[0135]

Table 2-17

[0136]

Table 2-18

[0137]

Table 2-19

[0138]

Table 2-20

[0139]

Table 2-21

[0140]

Table 2-22

[0141]

Table 2-23

[0142]

Table 2-24

[0143]

Table 2-25

[0144]

Table 2-26

[0145]

Table 2-27

[0146]

Table 2-28

[0147]

Table 2-29

[0148]

Table 2-30

[0149]

Table 2-31

[0150]

Table 2-32

[0151]

Table 2-33

[0152]

Table 2-34

[0153]

Table 2-35

[0154]

Table 2-36

[0155]

Table 2-37

[0156]

Table 2-38

[0157]

Table 2-39

[0158]

Table 2-40

[0159]

Table 2-41

[0160] [Table 2-42]

[0161] [Table 2-43]

[0162] Expression of OTOF in mammalian cells Mutations in OTOF are associated with sensorineural hearing loss and auditory neuropathy. The compositions and methods described herein increase the expression of WT OTOF protein through administration of a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of OTOF protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of OTOF protein. To utilize nucleic acid vectors for therapeutic use in the treatment of sensorineural hearing loss and auditory neuropathy, they can be directed to the interior of cells, particularly to specific cell types. A wide range of methods have been established for delivering proteins to mammalian cells and for stably expressing genes encoding proteins in mammalian cells.

[0163] Polynucleotide encoding OTOF One platform that can be used to achieve therapeutically effective intracellular concentrations of OTOF in mammalian cells is by stably expressing a gene encoding OTOF (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells, or by episomal concatemer formation in the nucleus of mammalian cells). A gene is a polynucleotide that encodes the primary amino acid sequence of a corresponding protein. To introduce an exogenous gene into a mammalian cell, the gene can be incorporated into a vector. The vector can be introduced into the cell by a variety of methods, including transformation, transfection, transduction, direct uptake, particle bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in further detail in, for example, Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.

[0164] OTOF can also be introduced into mammalian cells by targeting a vector containing a part of the gene encoding OTOF protein to cell membrane phospholipids.For example, the vector can be targeted to phospholipids on the extracellular surface of cell membrane by binding the vector molecule to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids.Such constructs can be generated using methods well known to those skilled in the art.

[0165] It is important for gene expression that the polynucleotide encoding OTOF protein is recognized and bound by mammalian RNA polymerase.Therefore, the polynucleotide may contain sequence elements that show high affinity for the transcription factor that recruits RNA polymerase and promotes the assembly of the transcription complex at the transcription start site.Such sequence elements include, for example, mammalian promoters, whose sequence can be recognized and bound by specific transcription start factors and ultimately by RNA polymerase.

[0166] Polynucleotides suitable for use in the compositions and methods described herein also include those that encode an OTOF protein downstream of a mammalian promoter (e.g., a polynucleotide that encodes the N-terminal portion of an OTOF protein downstream of a mammalian promoter). Useful promoters for expressing an OTOF protein in mammalian cells include ubiquitous promoters, cochlear hair cell-specific promoters, and inner hair cell-specific promoters. Examples of ubiquitous promoters include the CAG promoter, the cytomegalovirus (CMV) promoter (e.g., the CMV immediate early enhancer and promoter, the CMV minipromoter, the minCMV promoter, the CMV-TATA+INR promoter, or the min CMV-T6 promoter), the chicken β-actin promoter, the smCBA promoter, the CB7 promoter, the hybrid CMV enhancer / human β-actin promoter, the CASI promoter, the dihydrofolate reductase (DHFR) promoter, the human β-actin promoter, the β-globin promoter (e.g., the minimal β-globin promoter), the HSV promoter (e.g., the minimal HSV ICP0 promoter, or the deleted HSV ICP0 promoter), the SV40 promoter (e.g., the SV40 minimal promoter), the EF1α promoter, and the PGK promoter. Cochlear hair cell specific promoters include myosin 15 (Myo15) promoter, myosin 7A (Myo7A) promoter, myosin 6 (Myo6) promoter, POU4F3 promoter, atonal BHLH transcription factor 1 (ATOH1) promoter, LIM homeobox 3 (LHX3) promoter, α9 acetylcholine receptor (α9AChR) promoter, and α10 acetylcholine receptor (α10AChR) promoter. Inner hair cell specific promoters include FGF8 promoter, VGLUT3 promoter, OTOF promoter, and calcium binding protein 2 (CABP2) promoter (described in International Patent Application Publication No. WO2021 / 091940, incorporated herein by reference). On the other hand, promoters derived from viral genomes can also be used to stably express these agents in mammalian cells.Examples of operable viral promoters that can be used to drive mammalian expression of these agents include the adenovirus late promoter, the vaccinia virus 7.5K promoter, the SV40 promoter, the HSV tk promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV LTR promoter, the Moloney virus promoter, the Epstein-Barr virus (EBV) promoter, and the Ruth sarcoma virus (RSV) promoter.

[0167] Mouse myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein comprises a nucleic acid sequence from a region of the mouse Myo15 locus capable of specifically expressing a transgene in hair cells, such as a nucleic acid sequence having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region of the mouse Myo15 locus capable of specifically expressing a transgene in hair cells, or a variant thereof. These regions include the nucleic acid sequence immediately preceding the mouse Myo15 translation start site and upstream regulatory elements located 5 kb or more away from the mouse Myo15 translation start site. The Myo15 promoter for use in the compositions and methods described herein may optionally include a linker that operably links regions of the mouse Myo15 locus capable of expressing a transgene specifically in hair cells, or the regions of the mouse Myo15 locus can be directly linked without an intervening linker.

[0168] In some embodiments, a Myo15 promoter for use in the compositions and methods described herein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a region that includes the first non-coding exon of the mouse Myo15 gene (the nucleic acid from -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 24), or a functional portion or derivative thereof. The functional portion of SEQ ID NO:24 may have a nucleic acid sequence from -7166 to -7091 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:26) and / or a nucleic acid sequence from -7077 to -6983 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:27). The first region can include the nucleic acid sequence of SEQ ID NO:26 fused to the nucleic acid sequence of SEQ ID NO:27 without the intervening nucleic acid set forth in SEQ ID NO:28, or the first region can include the nucleic acid sequence of SEQ ID NO:27 fused to the nucleic acid sequence of SEQ ID NO:26 without the intervening nucleic acid set forth in SEQ ID NO:29. Alternatively, the first region can include the sequences of SEQ ID NO:26 and SEQ ID NO:27 linked by an endogenous intervening nucleic acid sequence (e.g., the first region can have or include a nucleic acid sequence from -7166 to -6983 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO:30 and SEQ ID NO:50) or a nucleic acid linker.In a mouse Myo15 promoter in which the first region comprises both SEQ ID NO:26 and SEQ ID NO:27, the two sequences may be included in any order (e.g., SEQ ID NO:26 may be joined to (e.g., precede) SEQ ID NO:27, or SEQ ID NO:27 may be joined to (e.g., precede) SEQ ID NO:26). The functional portion of SEQ ID NO:25 may have a nucleic acid sequence from -590 to -509 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:31) and / or a nucleic acid sequence from -266 to -161 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:32). In some embodiments, the sequence that comprises SEQ ID NO:31 has a sequence of SEQ ID NO:51. In some embodiments, the sequence that comprises SEQ ID NO:32 has a sequence of SEQ ID NO:52. The second region may comprise the nucleic acid sequence of SEQ ID NO:31 fused to the nucleic acid sequence of SEQ ID NO:32 without the intervening nucleic acid set forth in SEQ ID NO:33, or the second region may comprise the nucleic acid sequence of SEQ ID NO:32 fused to the nucleic acid sequence of SEQ ID NO:31 without the intervening nucleic acid set forth in SEQ ID NO:34. The second region may comprise the nucleic acid sequence of SEQ ID NO:51 fused to the nucleic acid sequence of SEQ ID NO:52 without an intervening nucleic acid as set forth in SEQ ID NO:55, or the second region may comprise the nucleic acid sequence of SEQ ID NO:52 fused to the nucleic acid sequence of SEQ ID NO:51 without an intervening nucleic acid. Alternatively, the second region may comprise the sequences of SEQ ID NO:31 and SEQ ID NO:32 linked by an endogenous intervening nucleic acid sequence (e.g., the second region may have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation start site as set forth in SEQ ID NO:35) or a nucleic acid linker. In a mouse Myo15 promoter in which the second region comprises both SEQ ID NO:31 and SEQ ID NO:32, the two sequences may be included in any order (e.g., SEQ ID NO:31 may be linked to (e.g., preceded by) SEQ ID NO:32, or SEQ ID NO:32 may be linked to (e.g., preceded by) SEQ ID NO:31).

[0169] The first and second regions of the mouse Myo15 promoter can be directly linked or linked by a nucleic acid linker. For example, the mouse Myo15 promoter can comprise the sequence of SEQ ID NO:25 or a functional part or derivative thereof (e.g., any one or more of SEQ ID NOs:31-35, 51, 52, and 55, e.g., SEQ ID NOs:31 and 32) fused to the sequence of SEQ ID NO:24 or a functional part or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30 and 50, e.g., SEQ ID NOs:26 and 27) without an intervening nucleic acid. For example, the nucleic acid sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO:24 to SEQ ID NO:25 is shown in SEQ ID NO:36. Alternatively, a linker can be used to join a sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30 and 50, e.g., SEQ ID NOs:26 and 27) to a sequence of SEQ ID NO:25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:31-35, 51, 52 and 55, e.g., SEQ ID NOs:31 and 32). Exemplary Myo15 promoters containing functional portions of both SEQ ID NO:24 and SEQ ID NO:25 are provided in SEQ ID NOs:38, 39, 53, 54, 59, and 60.

[0170] The length of the nucleic acid linker for use with the mouse Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the mouse Myo15 promoter described herein does not interfere with the ability of the mouse Myo15 promoter of the present invention to induce expression of a transgene in hair cells.

[0171] In some embodiments, the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30 and 50, e.g., SEQ ID NOs:26 and 27) is linked (e.g., operably linked) to the sequence of SEQ ID NO:25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:31-35, 51, 52 and 55, e.g., SEQ ID NOs:31 and 32), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO:25 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:31-35, 51, 52 and 55, e.g., SEQ ID NOs:31 and 32) is linked (e.g., operably linked) to the sequence of SEQ ID NO:24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs:26-30 and 50, e.g., SEQ ID NOs:26 and 27). For example, the nucleic acid sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO:25 to SEQ ID NO:24 is shown in SEQ ID NO:37. An example of a mouse Myo15 promoter, in which a functional part or derivative of SEQ ID NO:25 precedes a functional part or derivative of SEQ ID NO:24, is provided in SEQ ID NO:58. Regardless of order, the sequence of SEQ ID NO:24 or a functional part or derivative thereof and the sequence of SEQ ID NO:25 or a functional part or derivative thereof can be linked by direct fusion or by a nucleic acid linker, as described above.

[0172] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region comprising the first non-coding exon of the mouse Myo15 gene (nucleic acid sequence from -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:24), or a functional portion or derivative thereof. The functional portion of SEQ ID NO:24 can have the nucleic acid sequence from -7166 to -7091 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:26) and / or the nucleic acid sequence from -7077 to -6983 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:27). The mouse Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO:26 fused to the nucleic acid sequence of SEQ ID NO:27 without the intervening nucleic acid as set forth in SEQ ID NO:28, or the mouse Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO:27 fused to the nucleic acid sequence of SEQ ID NO:26 without the intervening nucleic acid as set forth in SEQ ID NO:29. Alternatively, the mouse Myo15 promoter may comprise the sequences of SEQ ID NO:26 and SEQ ID NO:27 linked by an endogenous intervening nucleic acid sequence (e.g., the first region may have or include a nucleic acid sequence from -7166 to -6983 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO:30 and SEQ ID NO:50) or a polynucleotide linker. In a mouse Myo15 promoter that comprises both SEQ ID NO:26 and SEQ ID NO:27, the two sequences may be included in any order (e.g., SEQ ID NO:26 may be linked to (e.g., preceded by) SEQ ID NO:27, or SEQ ID NO:27 may be linked to (e.g., preceded by) SEQ ID NO:26).

[0173] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence immediately upstream of the mouse Myo15 translation start site (nucleic acids 1 to 1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:25) or a functional portion or derivative thereof. The functional portion of SEQ ID NO:25 can have the nucleic acid sequence of -590 to -509 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:31) and / or the nucleic acid sequence of -266 to -161 relative to the mouse Myo15 translation start site (set forth in SEQ ID NO:32). In some embodiments, the sequence comprising SEQ ID NO:31 has the sequence of SEQ ID NO:51. In some embodiments, the sequence comprising SEQ ID NO:32 has the sequence of SEQ ID NO:52. The mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO:31 fused to the nucleic acid sequence of SEQ ID NO:32 without an intervening nucleic acid as set forth in SEQ ID NO:33, or the mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO:32 fused to the nucleic acid sequence of SEQ ID NO:31 without an intervening nucleic acid as set forth in SEQ ID NO:34. The mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO:51 fused to the nucleic acid sequence of SEQ ID NO:52 without an intervening nucleic acid as set forth in SEQ ID NO:55, or the mouse Myo15 promoter can comprise the nucleic acid sequence of SEQ ID NO:52 fused to the nucleic acid sequence of SEQ ID NO:51 without an intervening nucleic acid. Alternatively, the mouse Myo15 promoter can comprise the sequences of SEQ ID NO:31 and SEQ ID NO:32, linked by an endogenous intervening nucleic acid sequence (e.g., the second region can have a nucleic acid sequence from -590 to -161 relative to the mouse Myo15 translation start site as set forth in SEQ ID NO:35) or a nucleic acid linker. In a mouse Myo15 promoter that includes both SEQ ID NO:31 and SEQ ID NO:32, the two sequences can be included in any order (e.g., SEQ ID NO:31 can be linked to (e.g., preceding) SEQ ID NO:32, or SEQ ID NO:32 can be linked to (e.g., preceding) SEQ ID NO:31).

[0174] In some embodiments, a mouse Myo15 promoter for use in the compositions and methods described herein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the nucleic acid sequence immediately upstream of the mouse Myo15 translation start site (the nucleic acid from -1 to -1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:24). The functional portion or derivative of the Myo15 gene includes a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region containing the first non-coding exon of the Myo15 gene (nucleic acid from -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO:25), flanked on either side by functional portions or derivatives of regions that correspond to the first non-coding exon. For example, a functional portion or derivative of SEQ ID NO:25, such as SEQ ID NO:31 or 51, can be fused or joined by a nucleic acid linker directly to a portion of SEQ ID NO:24, such as any one of SEQ ID NOs:26-30 and 50, which is fused or joined by a nucleic acid linker directly to a different functional portion of SEQ ID NO:25, such as SEQ ID NO:32 or 52. In other embodiments, a functional portion or derivative of SEQ ID NO:25, such as SEQ ID NO:32 or 52, may be fused or linked by a nucleic acid linker directly to a portion of SEQ ID NO:24, such as any one of SEQ ID NOs:26-30 and 50, which is fused or linked by a nucleic acid linker directly to a different functional portion of SEQ ID NO:25, such as SEQ ID NO:31 or 51. For example, a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of SEQ ID NO:51, 50, and 52 may be fused to a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%. 87%.In some embodiments, polynucleotides having 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity can be generated. In some embodiments, polynucleotides having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequences of SEQ ID NOs: 52, 50, and 51 can be fused to generate a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequence of SEQ ID NO: 57.

[0175] Human myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein also includes a nucleic acid sequence derived from a region of the human Myo15 locus capable of expressing a transgene specifically in hair cells, or a variant thereof, such as a nucleic acid sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to a region of the human Myo15 locus capable of expressing a transgene specifically in hair cells. The Myo15 promoter for use in the compositions and methods described herein can optionally include a linker that operably links the region of the human Myo15 locus capable of expressing a transgene specifically in hair cells, or the region of the human Myo15 locus can be directly linked without an intervening linker.

[0176] In some embodiments, the Myol5 promoter used in the methods and compositions described herein comprises a first region having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO:40, or a functional portion or derivative thereof, and a second region having at least 85% sequence identity (e.g., 85%, 86%. 87%. 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO:41, or a functional portion or derivative thereof, which is linked thereto (e.g., operably linked thereto). The functional portion of SEQ ID NO:40 may have the sequence set forth in SEQ ID NO:42. The functional portion of SEQ ID NO:41 may have the sequence shown in SEQ ID NO:43 and / or the sequence shown in SEQ ID NO:44. The second region may comprise the nucleic acid sequence of SEQ ID NO:43 fused to the nucleic acid sequence of SEQ ID NO:44 without the intervening nucleic acid as set forth in SEQ ID NO:45, or the second region may comprise the nucleic acid sequence of SEQ ID NO:44 fused to the nucleic acid sequence of SEQ ID NO:43 without the intervening nucleic acid as set forth in SEQ ID NO:46. Alternatively, the second region may comprise the sequences of SEQ ID NO:43 and SEQ ID NO:44 linked by an endogenous intervening nucleic acid sequence (as set forth in SEQ ID NO:47) or a nucleic acid linker. In a human Myol5 promoter in which the second region comprises both SEQ ID NO:43 and SEQ ID NO:44, the two sequences may be included in any order (e.g., SEQ ID NO:43 may be linked to (e.g., preceded by) SEQ ID NO:44, or SEQ ID NO:44 may be linked to (e.g., preceded by) SEQ ID NO:43).

[0177] The first and second regions of the human Myo15 promoter can be directly linked or linked by a nucleic acid linker. For example, the human Myo15 promoter can include the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42) fused to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NO: 43 and / or 44) without an intervening nucleic acid. Alternatively, a linker can be used to link the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42) to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NO: 43 and / or 44). Exemplary human Myo15 promoters that include functional portions of both SEQ ID NO: 40 and SEQ ID NO: 41 are provided in SEQ ID NOs: 48 and 49.

[0178] In some embodiments, the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42) is linked (e.g., operably linked) to the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and 44), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 43-47, e.g., SEQ ID NOs: 43 and / or 44) is linked (e.g., operably linked) to the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof (e.g., SEQ ID NO: 42)). Regardless of the order, the sequence of SEQ ID NO: 40 or a functional portion or derivative thereof and the sequence of SEQ ID NO: 41 or a functional portion or derivative thereof can be linked by direct fusion or by a nucleic acid linker, as described above.

[0179] In some embodiments, a human Myol5 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a region comprising the sequence set forth in SEQ ID NO:40, or a functional portion or derivative thereof. A functional portion of SEQ ID NO:40 can have the sequence of a nucleic acid set forth in SEQ ID NO:42.

[0180] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the sequence set forth in SEQ ID NO:41 or a functional portion or derivative thereof. The functional portion of SEQ ID NO:41 may have the sequence set forth in SEQ ID NO:43 and / or the sequence set forth in SEQ ID NO:44. The human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO:43 fused to the nucleic acid sequence of SEQ ID NO:44 without the intervening nucleic acid set forth in SEQ ID NO:45, or the human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO:44 fused to the nucleic acid sequence of SEQ ID NO:43 without the intervening nucleic acid set forth in SEQ ID NO:46. Alternatively, the human Myo15 promoter can include the sequences of SEQ ID NO:43 and SEQ ID NO:44, linked by an endogenous intervening nucleic acid sequence (e.g., as shown in SEQ ID NO:47) or a nucleic acid linker. In a human Myo15 promoter that includes both SEQ ID NO:43 and SEQ ID NO:44, the two sequences can be included in any order (e.g., SEQ ID NO:43 can be linked to (e.g., preceding) SEQ ID NO:44, or SEQ ID NO:44 can be linked to (e.g., preceding) SEQ ID NO:43).

[0181] The length of the nucleic acid linker for use with the human Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the human Myo15 promoter described herein does not interfere with the ability of the Myo15 promoter of the present invention to direct expression of a transgene in hair cells.

[0182] The aforementioned Myo15 promoters are summarized in Table 3 below.

[0183] [Table 3-1]

[0184] [Table 3-2]

[0185] [Table 3-3]

[0186] [Table 3-4]

[0187] [Table 3-5]

[0188] [Table 3-6]

[0189] [Table 3-7]

[0190] [Table 3-8]

[0191] [Table 3-9]

[0192] [Table 3-10]

[0193] [Table 3-11]

[0194] [Table 3-12]

[0195] Additional Myo15 promoters useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the nucleic acid sequences set forth in Table 3 and functional portions or derivatives of the nucleic acid sequences set forth in Table 3. The Myo15 promoters set forth in Table 3 are characterized in International Patent Application Publication Nos. WO2019210181A1 and WO2020163761A1, which are incorporated herein by reference.

[0196] In embodiments in which the smCBA promoter is included in a dual vector system described herein (e.g., in the first vector of the dual vector system), the smCBA promoter can have the sequence of the smCBA promoter described in U.S. Patent No. 8,298,818, which is incorporated herein by reference. In some embodiments, the smCBA promoter has the following sequence:

[0197] GGTACCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCA (SEQ ID NO: 70).

[0198] In some embodiments, the smCBA promoter has the following sequence: AATTCGGTACCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAG (SEQ ID NO: 84).

[0199] Once a polynucleotide encoding an OTOF has been incorporated into the nuclear DNA of a mammalian cell or stabilized in an episomal monomer or concatemer, transcription of the polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of transcription factors and / or RNA polymerase to the mammalian promoter, thus modulating gene expression. The chemical reagent can function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent can function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, thereby increasing the rate of transcription of genes located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to mammalian cells to promote gene expression according to established protocols.

[0200] Other DNA sequence elements that may be included in nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides, including genes of interest, such that the DNA adopts a three-dimensional orientation that favors the binding of transcription factors and RNA polymerase at the transcription start site. Thus, polynucleotides for use in the compositions and methods described herein include polynucleotides encoding OTOF, and further include mammalian enhancer sequences. Many enhancer sequences are now known from mammalian genes, including, for example, enhancers from genes encoding mammalian globin, elastase, albumin, alpha-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses capable of infecting eukaryotic cells. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Additional enhancer sequences that induce activation of eukaryotic gene transcription are disclosed in Yaniv, et al., Nature 297:17 (1982). The enhancer may be spliced ​​into the vector containing the polynucleotide encoding the OTOF protein, for example, at the 5' or 3' position of the gene. In a preferred orientation, the enhancer is placed 5' to the promoter, which is then placed 5' to the polynucleotide encoding the OTOF protein.

[0201] The nucleic acid vectors described herein may include a Woodchuck Post-Transcriptional Regulatory Element (WPRE). The WPRE acts at the mRNA level and increases the total amount of mRNA in the cell by facilitating nuclear export of the transcript and / or by increasing the efficiency of polyadenylation of the nascent transcript. The addition of the WPRE to the vector can result in substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo. The WPRE can be located in the second nucleic acid vector between the polynucleotide encoding the C-terminal portion of the OTOF protein and the poly(A) sequence. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0202] (Sequence number 23).

[0203] In another embodiment, the WPRE has the sequence: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTCTCCTGTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGCTGTGGGCACTGACAATTCCGTGGTGTTATTTGTGGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTCATGCTTATTTGTGTAAATTTGTGTAATTGCTATTGCTTTATTGTTAACCATTATAAGCTGCAATAAACAAGTTAACAACAATTGCATTCATTTTATGTTCAGGTTCAGGGGAGAGTGTGGAGGTTTTTTAAA (SEQ ID NO: 61).

[0204] In some embodiments, the nucleic acid vectors for use in the compositions and methods described herein contain a reporter sequence, which may be useful, for example, to verify the expression of the OTOF gene in specific cells and tissues (e.g., cochlear hair cells). Reporter sequences that may be provided in a transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters known in the art. When associated with regulatory elements that drive their expression, reporter sequences provide a signal that can be detected by conventional means, including enzyme assays, radioassays, colorimetric assays, fluorescent assays or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is a LacZ gene, the presence of a vector incorporating the signal is detected by assaying β-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, vectors that have incorporated a signal may be measured visually by color or light production in a luminometer.

[0205] Overlapping double vector One approach for expressing large proteins in mammalian cells involves the use of overlapping double vectors. This approach is based on the use of two nucleic acid vectors, each of which contains a portion of the polynucleotide encoding the protein of interest and has a defined region of sequence overlap with the other polynucleotide. Homologous recombination can occur at the region of overlap and result in the formation of a single nucleic acid molecule that encodes the full-length protein of interest.

[0206] The overlapping double vectors used in the methods and compositions described herein contain at least 1 kilobase (kb) of overlapping sequence (e.g., 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, or more overlapping sequence). The nucleic acid vector is designed such that the overlapping region is centered on an OTOF exon boundary, with equal overlap on both sides of the boundary. The boundary is selected based on the size of the promoter and the location of the portion of the polynucleotide encoding the OTOF C2 domain. The overlapping region is centered on an exon boundary that occurs outside the portion of the polynucleotide encoding the C2C domain (e.g., after the portion of the polynucleotide encoding the C2C domain). An exon boundary within the portion of the polynucleotide encoding the C2D domain can be selected as the center of the overlapping region, or an exon boundary located after the portion of the polynucleotide encoding the C2D domain and before the portion of the polynucleotide encoding the C2E domain can serve as the center of the overlapping region. Additionally, the nucleic acid vectors used in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein).

[0207] One exemplary overlapping dual vector system includes a first nucleic acid vector including a CAG promoter operably linked to exons 1-28 and 500 base pairs (bp) 3' proximal to exon 28 / 29 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a second nucleic acid vector including 500 bp 5' proximal to the exon 28 / 29 boundary and the remaining exons (exons 29-48 for mouse OTOF, exons 29-45 and 47 or exons 29-46 for human OTOF) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., bovine growth hormone (bGH) poly(A) signal sequence). In this overlapping dual vector system, the overlapping sequence is centered on the exon 28 / 29 boundary after the portion of the polynucleotide encoding the C2D domain. Another exemplary overlapping dual vector system includes a first nucleic acid vector including a CAG promoter operably linked to exons 1-24 and 500 bp 3' proximal to exon 24 / 25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a second nucleic acid vector including 500 bp 5' proximal to the exon 24 / 25 boundary and the remaining exons (exons 25-48 for mouse OTOF, exons 25-45 and 47 for human OTOF, or exons 25-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). In this overlapping dual vector system, the overlapping sequence is centered around the exon 24 / 25 boundary within the portion of the polynucleotide encoding the C2D domain.The two exon boundaries described above can be used with any promoter (e.g., CMV promoter, or smCBA promoter) having a similar size to the CAG promoter, such as a promoter of 1 kb or less in length (e.g., about 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less). For example, in any of the dual vector systems described above, the CMV promoter or smCBA promoter can be used in place of the CAG promoter. A Myo15 promoter having a sequence of 1 kb or less (e.g., a Myo15 promoter as described herein above, e.g., a Myo15 promoter having a sequence of any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in place of the CAG promoter. Alternatively, different exon boundaries can be selected that are within or after the polynucleotide portion encoding the C2D domain and before the polynucleotide portion encoding the C2E domain. A nucleic acid vector that includes a promoter of this size can optionally include an OTOF UTR. For example, in the above-mentioned overlapping double vector system in which the overlapping region is centered on the exon 28 / 29 boundary of OTOF, the second nucleic acid vector can include a full-length OTOF 3'UTR (e.g., 1035bp human OTOF 3'UTR in the double vector system encoding human OTOF, or 1001bp mouse OTOF 3'UTR in the double vector system encoding mouse OTOF). In the above-mentioned overlapping double vector system in which the exon 24 / 25 boundary of OTOF is centered, neither the first nor the second nucleic acid vector includes an OTOF UTR.

[0208] In some embodiments, the first nucleic acid vector in the overlapping dual vector system comprises a long promoter (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb, or more). In such overlapping dual vector systems, the overlapping region can be centered on an exon boundary located after the polynucleotide portion encoding the C2C domain and before the polynucleotide portion encoding the C2D domain. For example, a duplicated dual vector system for use in the methods and compositions described herein includes a first nucleic acid vector that includes a Myo15 promoter longer than 1 kb (e.g., SEQ ID NO:36) operably linked to exons 1-21 and 500 bp 3' proximal to exon 21 / 22 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a second nucleic acid vector that includes 500 bp 5' proximal to the exon 21 / 22 boundary and the remaining exons (exons 29-48 for mouse OTOF, exons 22-45 and 47 for human OTOF, or exons 25-46) and poly(A) sequence (e.g., bGH poly(A) signal sequence) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6). The exon 20 / 21 boundary is also selected as the center of the duplicated region. In such overlapping dual vector systems, neither the first nor the second nucleic acid vector may contain an OTOF UTR. Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having any one of the sequences of SEQ ID NOs: 38, 39, or 49-60) can also be used in these dual vector systems (e.g., dual vector systems in which the overlapping region is centered around the exon 21 / 22 or exon 20 / 21 boundary).When a short promoter is used, additional elements such as a 5' OTOF UTR can be included in the first vector (e.g., a vector containing exons 1 to 21 of the polynucleotide encoding the OTOF protein and 500 bp 3' to the exon 21 / 22 boundary, or exons 1 to 20 and 500 bp 3' to the exon 20 / 21 boundary).

[0209] Trans-splicing dual vector A second approach for expressing large proteins in mammalian cells involves the use of trans-splicing dual vectors. In this approach, two nucleic acid vectors are used that contain separate nucleic acid sequences, and the polynucleotides encoding the N-terminal portion of the protein of interest do not overlap with the polynucleotides encoding the C-terminal portion of the protein of interest. Instead, the first nucleic acid vector contains a splice donor sequence 3' of the polynucleotide encoding the N-terminal portion of the protein of interest, and the second nucleic acid vector contains a splice donor sequence 5' of the polynucleotide encoding the C-terminal portion of the protein of interest. When the first and second nucleic acids are present in the same cell, their ITRs can link to form a single nucleic acid structure in which the linked ITRs are located between the splice donor and splice acceptor. Trans-splicing then occurs during transcription to produce a nucleic acid molecule in which the polynucleotides encoding the N-terminal and C-terminal portions of the protein of interest are adjacent, thereby forming a full-length coding sequence.

[0210] The trans-splicing dual vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein). The determination of how to split the polynucleotide sequence between the two nucleic acid vectors is based on the size of the promoter and the location of the portion of the polynucleotide that encodes the OTOF C2 domain. In a trans-splicing dual vector system, when a short promoter (e.g., a promoter of 1 kb or less (e.g., 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less)) is used, such as a CAG promoter, a CMV promoter, a smCBA promoter, or a Myo15 promoter of 1 kb or less in length (e.g., a Myo15 promoter described herein above, e.g., a Myo15 promoter having a sequence set forth in any one of SEQ ID NOs: 38, 39, or 49-60), the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at an exon boundary that occurs after the portion of the polynucleotide encoding the C2D domain and before the portion of the polynucleotide encoding the C2E domain, e.g., the exon 26 / 27 boundary. A nucleic acid vector containing a promoter of this size can optionally include an OTOF UTR (eg, both a 5' and a 3' OTOF UTR, eg, a full-length UTR).In a trans-splicing dual vector system, when a long promoter is used (e.g., a promoter greater than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, or more), such as the Myol5 promoter (SEQ ID NO: 36) which is greater than 1 kb in length, the OTOF polynucleotide sequence can be split between the two nucleic acid vectors at an exon boundary that occurs either after the portion of the polynucleotide encoding the C2C domain and before the portion of the polynucleotide encoding the C2D domain, such as the exon 19 / 20 boundary, the exon 20 / 21 boundary, or the exon 21 / 22 boundary, or within the portion of the polynucleotide encoding the C2D domain, such as the exon 25 / 26 boundary. Short promoters (e.g., a CMV promoter, a smCBA promoter, a CAG promoter, or a Myo15 promoter having a sequence of 1 kb or less, e.g., a Myo15 promoter having a sequence of any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in a dual vector system designed for large promoters, in which case additional elements (e.g., an OTOF UTR sequence) can be included in the first vector (e.g., a vector including a portion of the polynucleotide encoding the C2C domain).

[0211] One exemplary trans-splicing dual vector system using a short promoter includes a first nucleic acid vector comprising a CAG promoter operably linked to exons 1-26 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6) and a splice donor sequence 3' of a polynucleotide sequence, and a second nucleic acid vector comprising a splice acceptor sequence 5' of the remaining exons (e.g., exons 27-48 for mouse OTOF, or exons 27-45 or exons 27-46 for human OTOF) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). Another trans-splicing dual vector system includes a first nucleic acid vector comprising a CAG promoter operably linked to exons 1-28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a splice donor sequence 3' of the polynucleotide sequence, and a second nucleic acid vector comprising a splice acceptor sequence 5' of the remaining exons (e.g., exons 29-48 for mouse OTOF, or exons 29-45 and 47 for human OTOF, or exons 29-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). A CMV promoter, a smCBA promoter, or a Myo15 promoter having a sequence of 1 kb or less in length (e.g., a Myo15 promoter described herein above, e.g., a Myo15 promoter having the sequence of any one of SEQ ID NOs: 38, 39, or 49-60) can be used in place of the CAG promoter in any of the dual vector systems described above.These nucleic acid vectors can also include full-length 5' and 3' OTOF UTRs in the first and second nucleic acid vectors, respectively (e.g., the first nucleic acid vector can include the 5' human OTOF UTR (127 bp) in a dual vector system encoding human OTOF, or the 5' mouse UTR (134 bp) in a dual vector system encoding mouse OTOF, and the second nucleic acid vector can include the 3' human OTOF UTR (1035 bp) in a dual vector system encoding human OTOF, or the 3' mouse OTOF UTR (1001 bp) in a dual vector system encoding mouse OTOF).

[0212] One exemplary trans-splicing dual vector system using a long promoter includes a first nucleic acid vector comprising a splice donor sequence 3' of a polynucleotide sequence and greater than 1 kb of the Myo15 promoter (e.g., SEQ ID NO:36) operably linked to exons 1-19 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a second nucleic acid vector comprising a splice acceptor sequence 5' of the remaining exons (e.g., exons 20-48 for mouse OTOF, or exons 20-45 and 47 for human OTOF, or exons 20-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6) and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). Another trans-splicing dual vector system can include a first nucleic acid vector comprising more than 1 kb of a Myo15 promoter (e.g., SEQ ID NO:36) operably linked to exons 1-20 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6) and a splice donor sequence 3' of the polynucleotide sequence, and a second nucleic acid vector comprising a splice acceptor sequence 5' and a poly(A) sequence (e.g., bGH poly(A) signal sequence) of the remaining exons (e.g., exons 21-48 for mouse OTOF, or exons 21-45 and 47 for human OTOF, or exons 21-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6). The first and second nucleic acid vectors do not comprise an OTOF UTR in any of the Myo15 promoter trans-splicing dual vector systems described above.Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having a sequence of any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in the dual vector systems designed for large promoters described above. These dual vector systems, when they contain a short promoter, can also contain a 5'OTOF UTR or another element of similar size in the first vector.

[0213] To accommodate the OTOF UTRs, the OTOF coding sequence can be split into different locations. For example, in a trans-splicing dual vector system, in which a first nucleic acid vector comprises a Myo15 promoter (e.g., SEQ ID NO:36) of greater than 1 kb in length operably linked to exons 1-25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a splice donor sequence 3' of the polynucleotide sequence, and a second nucleic acid vector comprises a splice acceptor sequence 5' of the remaining exons (e.g., exons 26-48 for mouse OTOF, or exons 26-45 and 47, or 26-46 for human OTOF) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6) and a poly(A) sequence (e.g., a bGH poly(A) signal sequence), the second nucleic acid comprises a full-length OTOF 3'UTR (e.g., the 1035 bp human OTOF For mouse OTOF, the trans-splicing dual vector system can also include a 3'UTR, if the first nucleic acid vector includes a Myo15 promoter (e.g., SEQ ID NO:36) operably linked to exons 1-24 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO:6) and a splice donor sequence 3' of a polynucleotide sequence greater than 1 kb in length, and the second nucleic acid vector includes a splice acceptor sequence 5' of exons 25-48 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO:6) and a poly(A) sequence (e.g., bGH poly(A) signal sequence). In this dual vector system, the second nucleic acid can also include a full-length OTOF 3'UTR (e.g., 1001 bp mouse OTOF 3'UTR).Short promoters (e.g., CMV promoter, smCBA promoter, CAG promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in the dual vector systems designed for large promoters. When a short promoter is included in these dual vector systems, the first vector can also include a 5'OTOF UTR.

[0214] Double hybrid vectors A third approach to express large proteins in mammalian cells involves the use of double hybrid vectors. This approach combines elements of the overlapping double vector strategy and the trans-splicing strategy in that it features both an overlapping region capable of homologous recombination and splice donor and splice acceptor sequences. In the double hybrid vector system, the overlapping region is not part of the polynucleotide sequence encoding the protein of interest, but rather a recombinogenic region contained in both the first and second nucleic acid vectors, and the polynucleotide encoding the N-terminal portion of the protein of interest and the polynucleotide encoding the C-terminal portion of the protein of interest do not overlap in this approach. The recombinogenic region is 3' of the splice donor sequence of the first nucleic acid vector and 5' of the splice acceptor sequence of the second nucleic acid vector. The first and second polynucleotide sequences can then combine to form a single sequence based on one of two mechanisms: 1) recombination at the overlapping region, or 2) concatemerization of the ITRs. The remaining recombinogenic region(s) and / or the concatemerized ITRs can be removed by splicing, resulting in the formation of a contiguous polynucleotide sequence encoding the full-length protein of interest.

[0215] Recombination regions that can be used in the compositions and methods described herein include the F1 phage AK gene having the following sequence: GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAAT (SEQ ID NO: 19), and the alkaline phosphatase (AP) gene fragment, described in U.S. Patent No. 8,236,557, which is incorporated herein by reference. In some embodiments, the AP gene fragment has the following sequence:

[0216] CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA(SEQ ID NO: 62).

[0217] In some embodiments, the AP gene fragment has the following sequence. CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGA (SEQ ID NO: 63).

[0218] In some embodiments, the AP gene fragment has the following sequence. GCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 64).

[0219] In some embodiments, the AP gene fragment has the sequence: CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCG AACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTC (SEQ ID NO: 65).

[0220] In some embodiments, the AP gene fragment has the sequence: CGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTG AGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGG (SEQ ID NO: 66).

[0221] In some embodiments, the AP gene fragment has the sequence: CGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCC ACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGCCTCCA (SEQ ID NO: 67).

[0222] An exemplary splice donor sequence for use in the methods and compositions described herein (e.g., trans-splicing and two-hybrid approaches) is: GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCT (SEQ ID NO: 20). An exemplary splice acceptor sequence for use in the methods and compositions described herein (e.g., trans-splicing and two-hybrid approaches) is: GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 21). The splice donor sequence GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGA (SEQ ID NO: 68) and the splice acceptor sequence TAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 69) can also be used in the methods and compositions described herein. Further examples of splice donor and splice acceptor sequences are known in the art.

[0223] The double hybrid vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide that encodes approximately half of the OTOF protein). The decision as to how to divide the polynucleotide sequence between the two nucleic acid vectors is made based on the size of the promoter and the location of the portion of the polynucleotide that encodes the OTOF C2 domain. In the case of using a short promoter such as CAG, CMV, smCBA, or Myo15 promoter having a sequence of 1 kb or less (e.g., a Myo15 promoter described above, e.g., a Myo15 promoter having a sequence of any one of SEQ ID NOs: 38, 39, or 49-60) in a dual hybrid vector system (e.g., a promoter of 1 kb or less, e.g., about 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less), the OTOF polynucleotide sequence is split between the two nucleic acid vectors at an exon boundary, e.g., exon 26 / 27 boundary, that occurs after the portion of the polynucleotide encoding the C2D domain and before the portion of the polynucleotide encoding the C2E domain. A nucleic acid vector containing a promoter of this size can optionally include an OTOF UTR (e.g., full-length 5' and 3' UTRs). In a double hybrid vector system, when a long promoter (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb, or more), such as the Myol5 promoter (e.g., SEQ ID NO: 36), which is longer than 1 kb, is used, the OTOF polynucleotide sequence is split between the two nucleic acid vectors at an exon boundary that occurs after the portion of the polynucleotide encoding the C2C domain and before the portion of the polynucleotide encoding the C2D domain, e.g., at the exon 19 / 20 boundary, exon 20 / 21 boundary, or exon 21 / 22 boundary, or within the portion of the polynucleotide encoding the C2D domain, e.g., the exon 25 / 26 boundary.Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in dual vector systems designed for large promoters. In this case, additional elements (e.g., OTOF UTR sequence) can be included in the first vector (e.g., a vector containing a portion of the polynucleotide encoding the C2C domain).

[0224] One exemplary two-hybrid vector system using a short promoter includes a first nucleic acid vector comprising a CAG promoter operably linked to exons 1-26 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a second nucleic acid vector comprising a polynucleotide 3' of the splice acceptor sequence comprising the recombinogenic region, a splice acceptor sequence 3' of the recombinogenic region, the remaining exons (e.g., exons 27-48 of mouse OTOF, or exons 27-45 and 47 of human OTOF, or exons 27-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). The first and second nucleic acid vectors may also contain full-length 5' and 3' OTOF UTRs, respectively (e.g., a 127 bp human OTOF 5' UTR may be included in the first nucleic acid vector, and a 1035 bp human OTOF 3' UTR may be included in the second nucleic acid vector).Another exemplary two-hybrid vector system using a short promoter includes a first nucleic acid vector comprising a CAG promoter operably linked to exons 1-28 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a second nucleic acid vector comprising a polynucleotide 3' of the splice acceptor sequence comprising the recombinogenic region, a splice acceptor sequence 3' of the recombinogenic region, the remaining exons (e.g., exons 29-48 of mouse OTOF, or exons 29-45 and 47 of human OTOF, or exons 29-46) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). The first and second nucleic acid vectors can also include full-length 5' and 3' OTOF UTRs, respectively (e.g., a 134 bp mouse OTOF 5'UTR can be included in the first nucleic acid vector and a 1001 bp mouse OTOF 3'UTR can be included in the second nucleic acid vector). A CMV promoter, a smCBA promoter, or a Myo15 promoter having a sequence of 1 kb or less (e.g., a Myo15 promoter as described herein above, e.g., a Myo15 promoter having a sequence set forth in any one of SEQ ID NOs: 38, 39, or 49-60) can be used in place of the CAG promoter in any of the dual vector systems described above.

[0225] One exemplary two-hybrid vector system using a long promoter includes a first nucleic acid vector including a Myo15 promoter (e.g., SEQ ID NO:36) of 1 kb or more in length operably linked to exons 1-19 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence; and a second nucleic acid vector comprising a splice acceptor sequence 3' of the guiding region, a polynucleotide 3' of the splice acceptor sequence including the remaining exons (e.g., exons 20 to 48 of mouse OTOF, and exons 20 to 45, and 47, or 20 to 46 of human OTOF) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). Another exemplary double hybrid vector system using a long promoter includes a first nucleic acid vector including a Myo15 promoter (e.g., SEQ ID NO:36) of 1 kb or more length operably linked to exons 1-20 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence; and a second nucleic acid vector comprising a splice acceptor sequence 3' of the region, a polynucleotide 3' of the splice acceptor sequence including the remaining exons (e.g., exons 21-48 of mouse OTOF, and exons 21-45, and 47, or 21-46 of human OTOF) of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6, or human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence).In the above-mentioned Myo15 promoter double hybrid vector system, neither the first nor the second nucleic acid vector contains an OTOF UTR. A short promoter (e.g., a CMV promoter, a smCBA promoter, a CAG promoter, or a Myo15 promoter having a sequence of 1 kb or less (e.g., a Myo15 promoter having a sequence set forth in any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in the above-mentioned double vector system designed for a large promoter. When these double vector systems contain a short promoter, they may also contain an additional element (e.g., a 5' OTOF UTR) in the first vector.

[0226] To accommodate OTOF UTRs, the OTOF coding sequence can be split into separate locations. For example, in a double hybrid vector system, a first nucleic acid vector includes a Myo15 promoter (SEQ ID NO:36) of over 1 kb operably linked to exons 1-25 of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5, or mouse OTOF, e.g., SEQ ID NO:6), a splice donor sequence 3' of the polynucleotide sequence, and a recombinogenic region 3' of the splice donor sequence, and a splice activator region 3' of the recombinogenic region. The second nucleic acid may also include a full-length OTOF 3'UTR (e.g., a 1035 bp human OTOF UTR), if it includes a second nucleic acid vector comprising a splice acceptor sequence, a polynucleotide 3' of the splice acceptor sequence including the remaining exons (e.g., exons 26-48 of mouse OTOF, and exons 26-45, and 47, or 26-46 of human OTOF) of a polynucleotide encoding an OTOF protein (e.g., human OTOF, e.g., SEQ ID NO: 1 or SEQ ID NO: 5, or mouse OTOF, e.g., SEQ ID NO: 6), and a poly(A) sequence (e.g., a bGH poly(A) signal sequence). In mouse OTOF, the double hybrid vector system can include a 3'UTR if the first nucleic acid vector is a Myo15 promoter (e.g., SEQ ID NO: 36) of greater than 1 kb in length operably linked to exons 1 to 24 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6) and includes a splice donor sequence 3' of the polynucleotide sequence and a recombinogenic region 3' of the splice donor sequence; and the second nucleic acid vector includes a splice acceptor sequence 3' of exons 25 to 48 of a polynucleotide encoding an OTOF protein (e.g., mouse OTOF, e.g., SEQ ID NO: 6), and a poly(A) sequence (e.g., bGH poly(A) signal sequence).In this dual hybrid vector system, the second nucleic acid vector can also contain a full-length OTOF 3'UTR (e.g., 1001 bp mouse OTOF UTR). Short promoters (e.g., CMV promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having a sequence set forth in any one of SEQ ID NOs: 38, 39, or 49-60) can also be used in the dual vector systems described above designed for large promoters. When these dual vector systems contain a short promoter, the first vector can also contain additional elements (e.g., 3'OTOF UTR).

[0227] The double hybrid vector used in the methods and compositions described herein can optionally include a degradation signal sequence in both the first and second nucleic acid vector. The degradation signal sequence can be included to prevent or reduce the expression of the portion of the OTOF protein from the polynucleotide that does not recombine and / or splice. The degradation signal sequence is located 3' of the recombination region of the first nucleic acid vector and between the recombination region and the splice acceptor in the second nucleic acid vector. The degradation signal sequence that can be used in the compositions and methods described herein has the sequence GCCTGCAAGAACTGGTTCAGCAGCCTGAGCCACTTCGTGATCCACCTG (SEQ ID NO: 22).

[0228] Exemplary pairs of overlapping, trans-splicing, and double hybrid vectors are set forth in Table 4 below.

[0229] [Table 4-1]

[0230] [Table 4-2]

[0231] [Table 4-3]

[0232] In some embodiments, the polynucleotide sequence encoding the OTOF protein may be a cDNA sequence (e.g., a sequence that does not contain introns). In some embodiments, the first nucleic acid vector and / or the second nucleic acid vector of the dual vector system may contain an intron sequence. The intron sequence may be included between one or more exons of the OTOF coding sequence, or the intron sequence may be included between an exon of the coding sequence and another component of the nucleic acid vector (e.g., between an exon of the OTOF coding sequence and a splice donor sequence in the first nucleic acid vector, or between an exon of the OTOF coding sequence and a splice acceptor sequence in the second nucleic acid vector).

[0233] In some embodiments, the polynucleotide encoding the OTOF protein is split between a first and a second nucleic acid vector (e.g., an AAV vector) of a dual vector system at the exon 20 / 21 boundary. When the polynucleotide encoding the OTOF protein encodes OTOF isoform 5 and is split between a first and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide sequence encoding the N-terminal portion of OTOF has the following sequence:

[0234]

[0235] The above sequence corresponds to exons 1 to 20 of OTOF isoform 1. In embodiments where the polynucleotide encoding the OTOF protein encodes OTOF isoform 5 and is split between the first and second nucleic acid vectors (e.g., AAV vectors) at the exon 20 / 21 boundary, the polynucleotide encoding the C-terminal portion of OTOF has the following sequence:

[0236] In embodiments where the polynucleotide encodes OTOF isoform 5 and is split between a first and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence: (Sequence number 73).

[0237] The above sequence corresponds to the N-terminal portion of the OTOF isoform 1 protein encoded by exons 1 to 20. In embodiments where the polynucleotide encodes OTOF isoform 5 and is split between a first and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence:

[0238] Table 5 provides transfer plasmids that can be used to generate nucleic acid vectors for use in the compositions and methods described herein. These transfer plasmids are designed for expression of OTOF isoform 5. The transfer plasmid (e.g., a plasmid containing a DNA sequence delivered by a nucleic acid vector, e.g., delivered by AAV) is co-delivered into producer cells with a helper plasmid (e.g., a plasmid providing proteins required for AAV production) and a rep / cap plasmid (e.g., a plasmid providing AAV capsid proteins and proteins that insert the transfer plasmid DNA sequence into the capsid shell, etc.) to generate a nucleic acid vector for administration. The nucleic acid vector (e.g., a nucleic acid vector) containing a polynucleotide encoding the N-terminal portion of OTOF and the nucleic acid vector containing a polynucleotide encoding the C-terminal portion of OTOF can be combined (e.g., into a single formulation) prior to administration. The following transfer plasmids: SEQ ID NO:75 and SEQ ID NO:76; SEQ ID NO:77 and SEQ ID NO:78; SEQ ID NO:79 and SEQ ID NO:76; SEQ ID NO:80 and SEQ ID NO:78; SEQ ID NO:81 and SEQ ID NO:82; and SEQ ID NO:83 and SEQ ID NO:82 are designed to produce nucleic acid vectors (e.g., AAV vectors) for co-formulation or co-administration (e.g., simultaneous or sequential administration) in a dual hybrid vector system.

[0239] [Table 5-1]

[0240] [Table 5-2]

[0241] [Table 5-3]

[0242]

Table 5-4

[0243]

Table 5-5

[0244]

Table 5-6

[0245]

Table 5-7

[0246]

Table 5-8

[0247]

Table 5-9

[0248]

Table 5-10

[0249]

Table 5-11

[0250]

Table 5-12

[0251]

Table 5-13

[0252]

Table 5-14

[0253]

Table 5-15

[0254]

Table 5-16

[0255]

Table 5-17

[0256]

Table 5-18

[0257]

Table 5-19

[0258]

Table 5-20

[0259]

Table 5-21

[0260]

Table 5-22

[0261]

Table 5-23

[0262]

Table 5-24

[0263]

Table 5-25

[0264]

Table 5-26

[0265]

Table 5-27

[0266]

Table 5-28

[0267]

Table 5-29

[0268]

Table 5-30

[0269]

Table 5-31

[0270]

Table 5-32

[0271]

Table 5-33

[0272]

Table 5-34

[0273]

Table 5-35

[0274]

Table 5-36

[0275]

Table 5-37

[0276]

Table 5-38

[0277]

Table 5-39

[0278]

Table 5-40

[0279]

Table 5-41

[0280]

Table 5-42

[0281]

Table 5-43

[0282]

Table 5-44

[0283] [Table 5-45]

[0284] [Table 5-46]

[0285] [Table 5-47]

[0286] [Table 5-48]

[0287] [Table 5-49]

[0288] [Table 5-50]

[0289] [Table 5-51]

[0290] [Table 5-52]

[0291] [Table 5-53]

[0292] Vectors for expression of OTOF In addition to achieving high rates of transcription and translation, stable expression of exogenous genes in mammalian cells can be achieved by integrating a polynucleotide containing the gene into the nuclear genome of the mammalian cell. Various vectors have been developed for delivering and integrating polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are disclosed, for example, in WO1994 / 011026, which is incorporated herein by reference. Expression vectors for use in the compositions and methods described herein include polynucleotide sequences encoding portions of OTOF, as well as additional sequence elements used, for example, to express these agents and / or integrate these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express OTOF include plasmids that contain regulatory sequences, such as promoter and enhancer regions, that direct gene transcription. Other vectors useful for OTOF expression include polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of genes integrated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also contain a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0293] AAV vectors for nucleic acid delivery In some embodiments, the nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and / or viral particles to facilitate their introduction into cells. rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding an N-terminal or C-terminal portion of an OTOF protein) and (2) viral sequences that promote the stability and expression of the heterologous gene. The viral sequences may include sequences of AAV required in cis for DNA replication and packaging into viral particles (e.g., operable ITRs). Such rAAV vectors may also include marker or reporter genes. In useful rAAV vectors, one or more AAV WT genes have been deleted in whole or in part, but operable flanking ITR sequences are retained. The AAV ITRs may be of any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITRs may be AAV2 ITRs. Methods for the use of rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated by reference herein as they pertain to AAV vectors for gene delivery.

[0294] The nucleic acids and vectors described herein can be incorporated into rAAV viral particles to facilitate the introduction of the nucleic acid or vector into cells. The capsid protein of AAV constitutes the external non-nucleic acid portion of the viral particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins VP1, VP2, and VP3, which are necessary for the assembly of viral particles. The construction of rAAV viral particles is described, for example, in US 5,173,414, US 5,139,941, US 5,863,541, US 5,869,305, US 6,057,152, and US 6,376,237, as well as Rabinowitz et al., J.Virol.76:791 (2002) and Bowles et al., J.Virol.77:423 (2003), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0295] rAAV viral particles useful in combination with the compositions and methods described herein include viral particles derived from various AAV serotypes, including nucleic acid, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, nucleic acid 0, nucleic acid 1, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. When targeting cochlear hair cells, nucleic acid, AAV2, AAV6, AAV9, Anc80, Anc80L65, DJ / 9, 7m8, and PHP.B may be particularly useful. Serotypes evolved for transduction of the retina may also be used in the methods and compositions described herein. The first nucleic acid vector and the second nucleic acid vector of the compositions and methods described herein may have the same serotype or different serotypes. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.

[0296] Useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., nucleic acid, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0297] AAV viral particles with mutations in the capsid of the viral particle can be used to infect specific cell types more effectively than non-mutated capsid viral particles. For example, suitable AAV mutants can have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV viral particles that can be used in the methods described herein include capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0298] In some embodiments, the use of an AAV vector to deliver an operable OTOF protein requires the use of a dual vector system, where a first member of the dual vector system encodes the N-terminal portion of the OTOF protein and a second member encodes the C-terminal portion of the OTOF protein, such that upon administration of the dual vector system to a cell, the polynucleotide sequences contained within the two vectors can combine to form a single sequence, resulting in the production of a full-length OTOF protein. In some embodiments, the protein is an OTOF isoform 5 protein. In some embodiments, the protein is an OTOF isoform 1 protein.

[0299] In some embodiments, the first member of the dual vector system also includes, in 5' to 3' order, a first inverted terminal repeat ("ITR"), a promoter (e.g., Myol5 promoter), a Kozak sequence, an N-terminal portion of the OTOF coding sequence, a splice donor sequence, an AP gene fragment (e.g., an AP start sequence), and a second ITR, and the second member of the dual vector system includes, in 5' to 3' order, a first ITR, an AP gene fragment (e.g., an AP start sequence), a splice acceptor sequence, a C-terminal portion of the OTOF coding sequence, a polyA sequence, and a second ITR. In some embodiments, the N-terminal portion of the OTOF coding sequence and the C-terminal portion of the OTOF coding sequence are non-overlapping and combine intracellularly (e.g., by recombination at the overlapping region (AP gene fragment) or by concatemerization of the ITRs) to generate a full-length OTOF amino sequence (e.g., OTOF isoform 1, the sequence set forth in SEQ ID NO: 1, or OTOF isoform 5, the sequence set forth in SEQ ID NO: 5). In certain embodiments, the N-terminal portion of the OTOF coding sequence encodes amino acids 1 to 802 of OTOF (e.g., amino acids 1 to 802 of SEQ ID NO:1 or SEQ ID NO:5, corresponding to SEQ ID NO:73), and the C-terminal portion of the OTOF coding sequence encodes amino acids 803 to 1997 of OTOF (e.g., amino acids 803 to 1997 of SEQ ID NO:1, or amino acids 803 to 1997 of SEQ ID NO:5, corresponding to SEQ ID NO:74).

[0300] In some embodiments, the first member of the dual vector system comprises the Myo15 promoter of SEQ ID NO:38 (also represented by nucleotides 235-1199 of SEQ ID NO:81) operably linked to nucleotides encoding the N-terminal 802 amino acids of the OTOF isoform 5 protein (amino acids 1-802 of SEQ ID NO:5), which are encoded by exons 1-20 of the native polynucleotide sequence encoding the protein. In certain embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5 protein is nucleotides 1222-3627 of SEQ ID NO:81. In some embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5N protein is any nucleotide sequence that encodes amino acids 1-802 of SEQ ID NO:5 due to redundancy in the genetic code. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or fully codon optimized for expression. In some embodiments, the first member of the dual vector system comprises a Kozak sequence corresponding to nucleotides 1216-1225 of SEQ ID NO:81. In some embodiments, a first member of the dual vector system comprises a splice donor sequence corresponding to nucleotides 3628-3711 of SEQ ID NO: 81. In some embodiments, a first member of the dual vector system comprises an AP start sequence corresponding to nucleotides 3718-4004 of SEQ ID NO: 81. In certain embodiments, a first member of the dual vector system comprises nucleotides 235-4004 of SEQ ID NO: 81 flanked on each of the 5' and 3' sides by inverted terminal repeats. In some embodiments, the flanking inverted terminal repeats are any variant of the AAV2 inverted terminal repeat that can be encapsidated by a plasmid harboring the AAV2 Rep gene. In certain embodiments, the 5'-proximal inverted terminal repeat has a sequence corresponding to nucleotides 12 to 141 of SEQ ID NO: 81, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity); andThe 3' adjacent inverted terminal repeats have a sequence corresponding to nucleotides 4098-4227 of SEQ ID NO: 81, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). One of skill in the art will appreciate that for any given pair of inverted terminal repeat sequences in a transfer plasmid used to generate a viral vector (usually by transfecting the plasmid into a cell with other plasmids carrying the AAV genes necessary for viral vector formation) (e.g., any of SEQ ID NOs: 75, 77, 79, 80, 81, or 83), the corresponding sequences in the viral vector may be altered as the ITRs adopt a "flip" or "flop" orientation upon recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as that found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4227 of SEQ ID NO:81.

[0301] In some embodiments, the second member of the dual vector system comprises nucleotides encoding the C-terminal 1195 amino acids of OTOF isoform 5 protein (amino acids 803-1997 of SEQ ID NO:5) immediately followed by a stop codon. In certain embodiments, the nucleotide sequence encoding the C-terminal amino acids of OTOF isoform 5 protein is nucleotides 587-4174 of SEQ ID NO:82. In some embodiments, the nucleotide sequence encoding the C-terminal amino acids of OTOF isoform 5 protein is any nucleotide sequence that encodes amino acids 803-1997 of SEQ ID NO:5 due to redundancy in the genetic code. The nucleotide sequence encoding the OTOF gastric asoform 5 protein can be partially or fully codon optimized for expression. In some embodiments, the second member of the dual vector system comprises a splice acceptor sequence corresponding to nucleotides 538-586 of SEQ ID NO:82. In some embodiments, the second member of the dual vector system comprises an AP start sequence corresponding to nucleotides 229-515 of SEQ ID NO:82. In some embodiments, the second member of the dual vector system comprises a poly(A) sequence corresponding to nucleotides 4217 to 4438 of SEQ ID NO: 82. In certain embodiments, the second member of the dual vector system comprises nucleotides 229 to 4438 of SEQ ID NO: 82, flanked on the 5' and 3' sides, respectively, by inverted terminal repeats. In some embodiments, the flanking inverted terminal repeats are any variant of the AAV2 inverted terminal repeat that can be encapsidated by a plasmid harboring the AAV2 Rep gene.In certain embodiments, the 5' proximal inverted terminal repeat has a sequence corresponding to nucleotides 12 to 141 of SEQ ID NO: 82, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). and the 3' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 4526 to 4655 of SEQ ID NO: 82, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). One of skill in the art will appreciate that for any given pair of inverted terminal repeat sequences in a transfer plasmid used to generate a viral vector (usually by transfecting that plasmid into a cell with other plasmids carrying the AAV genes necessary for viral vector formation) (e.g., any of SEQ ID NOs: 76, 78, or 82), the corresponding sequences in the viral vector may be altered due to the ITRs adopting a "flip" or "flop" orientation upon recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as that found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4655 of SEQ ID NO:82.

[0302] In some embodiments, the dual vector system is an AAV1 dual vector system. In some embodiments, the dual vector system is an AAV9 dual vector system. Pharmaceutical Compositions The nucleic acid vectors (e.g., AAV vectors) described herein can be incorporated into vehicles for administration to patients, such as human patients suffering from biallelic OTOF mutations, as described herein. Pharmaceutical compositions containing vectors, such as viral vectors, that contain polynucleotides encoding a portion of an OTOF protein can be prepared using methods known in the art. For example, such compositions can be prepared in a desired form, such as a lyophilized formulation or an aqueous solution, using, for example, physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference).

[0303] Mixtures of the nucleic acid vectors (e.g., AAV vectors) described herein can be prepared in water, suitably mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. These preparations may contain a preservative to prevent the growth of microorganisms under ordinary conditions of storage and use. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (as described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulations may be sterile and may have a fluidity to the extent that they are easily syringable. The formulations may be stable under the conditions of manufacture and storage, and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be brought about by the use in the composition of agents that delay absorption, for example, aluminum monostearate and gelatin.

[0304] For example, the solution containing the pharmaceutical composition described herein may be appropriately buffered if necessary, and the liquid diluent may first be made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous medium that may be employed will be known to those skilled in the art in light of this disclosure. For example, one dose may be dissolved in 1 ml of NaCl isotonic solution and added to 1000 ml of subcutaneous injection solution or injected at the intended injection site. Depending on the condition of the subject to be treated, some variation in dose will necessarily occur. For local administration to the inner ear, the composition may be formulated to contain synthetic perilymph solution. An exemplary synthetic perilymph solution contains 20-200 mM NaCl, 1-5 mM KCl, 0.1-10 mM CaCl2, 1-10 mM glucose, and 2-50 mM HEPES, has a pH between about 6 and 9, and an osmolality of about 300 mOsm / kg. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Moreover, for human administration, formulations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0305] Treatment method The compositions described herein may be administered to subjects with biallelic OTOF mutations by a variety of routes, including, for example, local administration to the inner ear (e.g., administration to the perilymph or endolymph, e.g., administration to the oval window, round window, or horizontal semicircular canal, e.g., administration to cochlear hair cells), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most appropriate route for administration in a given case depends on the particular composition administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time of administration and route of administration), the patient's age, weight, sex, severity of the disease being treated, the patient's diet, and the patient's excretion rate. The compositions may be administered once, or more than once (e.g., once a year, twice a year, three times a year, bimonthly, monthly, or biweekly). In some embodiments, the first nucleic acid vector and the second nucleic acid vector are administered simultaneously (e.g., in one composition). In some embodiments, the first nucleic acid vector and the second nucleic acid vector are administered sequentially (e.g., the second nucleic acid vector is administered immediately after the first nucleic acid vector, or 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 8 hours, 12 hours, 1 day, 2 days, 7 days, 2 weeks, 1 month, or more after the first nucleic acid vector). The first nucleic acid vector and the second nucleic acid vector can have the same serotype or different serotypes (e.g., AAV serotypes).

[0306] Subjects who may be treated as described herein are 25 years of age or older (e.g., 25-50 years of age, 25-45 years of age, 25-40 years of age, 25-35 years of age, 25-30 years of age, 30-50 years of age, 30-45 years of age, 30-40 years of age, 30-35 years of age, 35-50 years of age, 35-45 years of age, 35-40 years of age, 40-50 years of age, 40-45 years of age, or 45-50 years of age, e.g., 25 years of age, 26 years of age, 27 years of age, 28 years of age, 29 years of age, 30 years of age, 31 years of age, 32 years of age, 33 years of age, 34 years of age, 35 years of age, 36 years of age, 37 years of age, 38 years of age, 39 years of age, 40 years of age, 41 years of age, 42 years of age, 43 years of age, 44 years of age, 45 years of age, 46 years of age, 47 years of age, 48 years of age, 49 years of age, 50 years of age, 51 years of age, 52 years of age, 53 years of age, 54 years of age, 55 years of age, 56 years of age, 57 years of age, 58 years of age, 59 years of age, 60 years of age, 61 years of age, 62 years of age, 63 years of age, 64 years of age, 65 years of age, 66 years of age, 67 years of age, 68 years of age, 69 years of age, 70 years of age, 71 years of age, 7 The subject may be treated as described herein if the subject has or is at risk of developing sensorineural hearing loss or auditory neuropathy due to a biallelic OTOF mutation at age 7, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years of age. The subject may also be treated as described herein if the subject has a biallelic OTOF mutation and has detectable indicators of outer hair cell integrity (presence of otoacoustic emissions and / or cochlear microphonic potentials) and / or inner hair cell integrity (presence of collective potentials) (e.g., identified as having detectable otoacoustic emissions, cochlear microphonic potentials, and / or collective potentials prior to treatment). Thus, the methods described herein may include a step of evaluating the integrity of outer hair cells and the integrity of inner hair cells prior to treatment of the subject. The compositions and methods described herein can be used to treat subjects with a mutation in OTOF (e.g., a mutation that reduces the function or expression of OTOF, or an OTOF mutation associated with sensorineural hearing loss or auditory neuropathy), a family history of autosomal recessive sensorineural hearing loss or auditory neuropathy (e.g., a family history of OTOF-associated hearing loss), or a subject whose OTOF mutation status and / or OTOF activity level is unknown. The methods described herein may include a step of screening the subject for a mutation in OTOF prior to treatment or administration with the compositions described herein. Standard methods known to those skilled in the art (e.g., genetic testing) can be used to screen the subject for an OTOF mutation. The methods described herein may also include a step of evaluating the hearing of the subject prior to administration or treatment with the compositions described herein.Hearing can be assessed using standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions. Additionally, the compositions and methods described herein can be administered as a preventative treatment to patients at risk of developing hearing loss or auditory neuropathy, such as those with a family history of inherited hearing loss, or those with OTOF mutations who do not yet exhibit hearing loss or impairment.

[0307] Treatment may include administration of a composition containing a nucleic acid vector (e.g., an AAV viral vector) as described herein in various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as the specific route of administration and formulation, are within the skill of those skilled in the clinical arts. The unit dose need not be administered as a single injection, but may include continuous infusion over a set period of time. Administration may be performed using a syringe pump to control the rate of infusion in order to minimize damage to the cochlea. When the nucleic acid vector is an AAV vector (e.g., an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the AAV vector can be, for example, about 1 × 10 9 Vector genome (VG) / mL ~ 1 x 10 16 VG / mL (e.g., 1×10 9 VG / mL, 2×10 9 VG / mL, 3×10 9 VG / mL, 4×10 9 VG / mL, 5×10 9 VG / mL, 6×10 9 VG / mL, 7×10 9 VG / mL, 8×10 9 VG / mL, 9×10 9 VG / mL, 1×10 10 VG / mL, 2×10 10 VG / mL, 3×10 10 VG / mL, 4×10 10 VG / mL, 5×1010 VG / mL、6×10 10 VG / mL、7×10 10 VG / mL、8×10 10 VG / mL、9×10 10 VG / mL、1×10 11 VG / mL、2×10 11 VG / mL、3×10 11 VG / mL、4×10 11 VG / mL、5×10 11 VG / mL、6×10 11 VG / mL、7×10 11 VG / mL、8×10 11 VG / mL、9×10 11 VG / mL、1×10 12 VG / mL、2×10 12 VG / mL、3×10 12 VG / mL、4×10 12 VG / mL、5×10 12 VG / mL、6×10 12 VG / mL、7×10 12 VG / mL、8×10 12 VG / mL、9×10 12 VG / mL、1×10 13 VG / mL、2×10 13 VG / mL、3×10 13 VG / mL、4×10 13 VG / mL、5×10 13 VG / mL、6×10 13 VG / mL、7×10 13 VG / mL、8×10 13 VG / mL、9×10 13 VG / mL、1×10 14 VG / mL、2×10 14 VG / mL、3×10 14 VG / mL、4×10 14 VG / mL、5×10 14 VG / mL、6×10 14 VG / mL、7×10 14 VG / mL、8×10 14 VG / mL、9×10 14 VG / mL、1×10 15 VG / mL、2×10 15 VG / mL、3×10 15VG / mL, 4×10 15 VG / mL, 5×10 15 VG / mL, 6×10 15 VG / mL, 7×10 15 VG / mL, 8×10 15 VG / mL, 9×10 15 VG / mL, or 1×10 16 The AAV vector may have a titer of about 1×10 7 VG / ear ~ approx. 2 x 10 15 VG / ear (e.g. 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×1010 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×1015 VG / ear) to the subject. In some embodiments, the nucleic acid vector (e.g., AAV vector) is administered in an amount sufficient to transduce at least 20% of the subject's inner hair cells with both the first vector and the second vector (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the subject's inner hair cells are transduced with both vectors of a dual vector system).

[0308] The compositions described herein are administered in an amount sufficient to improve hearing, improve speech discrimination, increase WT OTOF expression (e.g., expression in cochlear hair cells, e.g., inner hair cells), or increase OTOF function. Hearing may be assessed using standard hearing tests (e.g., audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to hearing measurements obtained before treatment. In some embodiments, the compositions are administered in an amount sufficient to improve the subject's ability to understand speech. The compositions described herein can also be administered in an amount sufficient to delay or prevent the onset or progression of sensorineural hearing loss or auditory neuropathy (e.g., in subjects with mutations in OTOF or with a family history of autosomal recessive hearing loss but not exhibiting hearing loss, or in subjects exhibiting mild to moderate hearing loss).The expression of OTOF can be assessed using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting protein or mRNA, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more) compared to the expression of OTOF before administration of the compositions described herein. OTOF function can be assessed directly (e.g., using electrophysiological or imaging methods to assess exocytosis) or indirectly based on hearing tests, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to the function of OTOF before administration of the compositions described herein. These effects can occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of the compositions described herein. Depending on the dose and route of administration used for treatment, patients may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the compositions.Depending on the results of the evaluation, the patient may receive additional treatment.

[0309] kit The compositions described herein can be provided in kits for use in treating subjects 25 years of age or older with biallelic OTOF mutations (e.g., for treating sensorineural hearing loss or auditory neuropathy in such subjects), or for use in treating subjects with biallelic OTOF mutations identified as having detectable otoacoustic emissions, detectable cochlear microphonic potentials, and / or detectable collection potentials (e.g., for treating sensorineural hearing loss or auditory neuropathy in such subjects). The compositions can include nucleic acid vectors (e.g., AAV vectors) described herein (e.g., a first nucleic acid vector comprising a polynucleotide encoding an N-terminal portion of an OTOF protein, and a second nucleic acid vector comprising a polynucleotide encoding a C-terminal portion of an OTOF protein), optionally packaged in an AAV viral capsid (e.g., AAV1, AAV9, AAV2, AAV8, Anc80, Anc80L65, DJ / 9, or 7m8). The kit may further include a package insert instructing a user of the kit, e.g., a physician, to practice the methods described herein. The kit may optionally include a syringe or other device for administering the composition. EXAMPLES

[0310] The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0311] Example 1 - Restoration of ABR in OTOF-deficient mice at 32 and 52 weeks of age treated with OTOF dual vectors Animals age and experience a gradual loss of hearing, due in part to a loss of outer hair cell function. Otoferlin-deficient animals lack ABRs (inner hair cell function) but exhibit distortion product otoacoustic emissions (DPOAEs) (outer hair cell function). Like other aging animals, otoferlin null animals lose outer hair cell function and DPOAEs as they age.

[0312] Aged OTOF homozygous mutant (OTOF-Q828X) animals up to 52 weeks of age were inoculated with the dual hybrid AAV1-Myo15-hOTOF vector at 3.9 × 10 10 The vectors were administered at a dose of 1000 vg / ear to test the therapeutic window of efficacy taking into account the potential loss of outer hair cells and subsequent DPOAE elevation at age. The first vector comprised the Myol5 promoter of SEQ ID NO:38 operably linked to a polynucleotide (SEQ ID NO:71) comprising exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein, 3' of a splice donor sequence of the polynucleotide sequence, and 3' of an AP recombination gene region (SEQ ID NO:65) of the splice donor sequence, and the second vector comprised the AP recombination gene region (SEQ ID NO:65), 3' of a splice acceptor sequence of the recombination gene region, 3' of a polynucleotide of a splice acceptor sequence comprising exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (SEQ ID NO:72), and a poly(A) sequence.

[0313] Baseline DPOAEs were recorded in animals at 32 (n=15) and 52 weeks of age (n=15). In 32 week old animals, 4 / 15 showed elevated baseline DPOAEs, whereas in 52 week old animals, 7 / 15 had elevated baseline DPOAEs.

[0314] Animals were administered vehicle (n=5 / age group) or dual hybrid AAV1-Myo15-hOTOF (n=10 / age group) via the round window under isoflurane anesthesia. Animals were allowed to recover after surgery according to the protocol. DPOAEs and ABRs were tested 4 and 8 weeks after birth.

[0315] ABR recovery was observed in 10 / 10 virus-treated animals at 32 weeks of age and 9 / 10 virus-treated animals at 52 weeks of age, including animals that showed baseline DPOAE elevations both 4 and 8 weeks after surgery. ABR recovery after 4 weeks of treatment is shown in Figure 1. Maximal recovery was observed at 22.6 kHz and was similar to that observed in younger animals.

[0316] Example 2 - Characterization of hair cell loss in the OTOF-Q828X mouse model We developed the OTOF-Q828X mouse model to mimic human congenital hearing loss caused by otoferlin loss. The human otoferlin Q829X mutation (canonical SNP rs80356593) is a well-studied stop-gain mutation in exon 22 that truncates the otoferlin protein after 828 amino acids of the 1997 amino acid coding sequence. Using CRISPR-mediated knock-in, we created the Otof-Q828X mouse strain on the FVB strain background that carries a targeted mutation in mouse OTOF (mOtof) that mimics this human allele.

[0317] Experiments were performed to evaluate hair cell loss in homozygous Otof-Q828X (Otof-Q828X hom) and heterozygous (Otof-Q828X het) mice. The numbers of IHCs (Figure 2A) and OHCs (Figure 2B) were counted in cochlear regions corresponding to 5.6 kHz, 8 kHz, 11.3 kHz, 16 kHz, 22.6 kHz, 32 kHz, and 45.2 kHz for Otof-Q828X het or hom mice over a period of 5 to 42 weeks. Individual IHCs and OHCs were stained with hair cell specific markers and counted. Five ears were evaluated in this analysis.

[0318] In Otof-Q828X hom mice, there was a statistically significant decrease in the number of IHCs with age at all frequencies tested. A similar trend in IHC counts was observed in het mice at lower frequencies (Kendall's rank correlation). IHC counts in Otof-828X hom and het animals remained stable up to 16 weeks (Figure 2A). From 16 weeks, the decrease in IHC counts in Otof-Q828X hom animals began at 22.6-45.2 kHz and, after 24 weeks, showed lower frequencies (8-16 kHz). The decrease in IHC counts in Otof-Q828X het mice began at 16 and 32 kHz after 24 weeks. After 32 weeks, more than 75% of the IHCs were retained for most frequencies tested (<45.2 kHz) (Figure 2A).

[0319] The number of outer hair cells in Otof-Q828X hom and het mice remained constant over the 6-month study period (Kendall's rank correlation) at all frequencies except 8 kHz, where het mice showed age-related declines. OHC counts at 5.6 kHz and 45.2 kHz were associated with large variability, indicating scattered counting differences between hets and homs across the ages tested. The majority of OHCs remained after 32 weeks (Figure 2B).

[0320] Example 3 - Relationship between ABR threshold recovery and number of otoferlin-expressing cells in homozygous OTOF-Q828X mutant mice The relationship between ABR threshold recovery and the number of otoferlin-expressing cells was examined across several studies in n=76 homozygous OTOF-Q828X mutant mice >4 weeks of age (4-34 weeks of age) and 1.0 × 10 9 and 6.4 x 10 10ABR thresholds were measured after 4-34 weeks when mice were between 10-44 weeks of age. The dual hybrid vector systems administered during these studies included AAV2quadYF-smCBA (SEQ ID NO: 70)-mOTOF (administered to mice between 34 and 29 weeks of age), AAV2quadYF-Myo15 (SEQ ID NO: 38)-mOTOF (administered to 29 week-old mice), AAV2quadYF-Myo15 (SEQ ID NO: 48)-mOTOF (administered to 29 week-old mice), AAV1-smCBA (SEQ ID NO: 70)-hOTOF (administered to 4 and 8 week-old mice), AAV1-Myo15 (SEQ ID NO: 38)-hOTOF (administered to 4 and 5 week-old mice), and AAV1-Myo15 (SEQ ID NO: 38)-mOTOF (administered to 9 week-old mice).

[0321] At 22 kHz, ABR thresholds were in the normal range (mean ± 2 SD) when approximately 20% of IHCs expressed otoferlin (Figure 3). Thresholds did not show any further improvement with increasing proportion of IHCs expressing otoferlin.

[0322] Example 4 - Administration of the OTOF dual vector system to subjects aged 25 years or older carrying a biallelic OTOF mutation According to the methods disclosed herein, the specialist determines whether a patient is 25 years of age or older (e.g., 25-50 years, 25-45 years, 25-40 years, 25-35 years, 25-30 years, 30-50 years, 30-45 years, 30-40 years, 30-35 years, 35-50 years, 35-45 years, 35-40 years, 40-50 years, 40-45 years, or 45-50 years, For example, the patient may be treated to prevent, reduce, or treat hearing loss or auditory neuropathy in a patient who is 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 years old. For this purpose, the specialist can administer to the human patient a composition comprising a first nucleic acid vector (e.g., an AAV1 or AAV9 vector) comprising a promoter operably linked to a polynucleotide encoding an N-terminal portion of an OTOF protein (e.g., the N-terminal portion of human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5), and a second nucleic acid vector (e.g., an AAV1 or AAV9 vector) comprising a polynucleotide encoding a C-terminal portion of an OTOF protein (e.g., the C-terminal portion of human OTOF, e.g., SEQ ID NO:1 or SEQ ID NO:5) and a poly(A) sequence. The dual vector can be an overlapping dual vector, a trans-splicing dual vector, or a dual hybrid vector as described herein.For example, these vectors can be double hybrid vectors, which comprise a Myo15 promoter (e.g., SEQ ID NOs: 36, 38, 39, 48, or 49) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., a polynucleotide having the sequence of SEQ ID NO: 5, e.g., SEQ ID NO: 71), a splice donor sequence 3' of the polynucleotide sequence, and an AP recombination induction region of the splice donor sequence (e.g., any one of SEQ ID NOs: 62-67, e.g., SEQ ID NO: 65). and a second vector comprising a polynucleotide 3' of a splice acceptor sequence comprising exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., a polynucleotide having the sequence of SEQ ID NO: 5, e.g., SEQ ID NO: 72), and a bGH poly(A) sequence. A composition containing the overlapping double AAV vector may be administered to a patient, for example, by local administration to the inner ear (e.g., injection through the round window membrane) to treat or prevent the development of sensorineural hearing loss or auditory neuropathy associated with biallelic OTOF mutations.

[0323] After administering the composition to the patient, a specialist can monitor the development of OTOF and the improvement of the patient in response to the treatment in various ways. For example, the doctor can monitor the patient's hearing by performing standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions after administration of the composition. If it is found that the patient's hearing is improved (e.g., improved ABR) in one or more tests after administration of the composition compared to the hearing test results before administration of the composition, it indicates that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as necessary.

[0324] Exemplary embodiments of the present invention are described in the following enumerated paragraphs. E1. 1. A method of treating a human subject 25 years of age or older having a biallelic otoferlin (OTOF) mutation, comprising administering to the subject a therapeutically effective amount of a dual vector system, the dual vector system comprising: a first nucleic acid vector comprising a promoter operably linked to a first coding polynucleotide encoding the N-terminal portion of an OTOF protein; and a second nucleic acid vector comprising a second coding polynucleotide encoding a C-terminal portion of an OTOF protein and a poly(A) sequence located 3' of the second coding polynucleotide; The method, wherein neither of the first nor the second nucleic acid vector encodes a full-length OTOF protein.

[0325] E2. The method of E1, wherein said first coding polynucleotide and said second coding polynucleotide do not overlap.

[0326] E3. The method of E1 or 2, wherein the first nucleic acid vector comprises a splice donor signal sequence located 3' to the first coding polynucleotide and the second nucleic acid vector comprises a splice acceptor signal sequence located 5' to the second coding polynucleotide.

[0327] E4. The method of E3, wherein the first nucleic acid vector comprises a first recombination-inducing region located 3' to the splice donor signal sequence and the second nucleic acid vector comprises a second recombination-inducing region located 5' to the splice acceptor signal sequence.

[0328] E5. The method of E4, wherein said first and second recombinogenic regions are the same. E6. The method of E4 or E5, wherein said first or second recombinogenic region is an AP gene fragment, or an F1 phage AK gene.

[0329] E7. A method of E6, characterized in that the F1 phage AK gene comprises or consists of the sequence of SEQ ID NO:19.

[0330] E8. The method of E6, wherein the AP gene fragment comprises or consists of any one of the sequences set forth in SEQ ID NOs: 62 to 67.

[0331] E9. The method of E8, characterized in that the AP gene fragment comprises or consists of the sequence of SEQ ID NO:65.

[0332] E10. The method of any one of E3 to E9, wherein the splice donor sequence comprises or consists of the sequence of SEQ ID NO:20 or SEQ ID NO:68.

[0333] E11. Any one of the methods E3 to E10, wherein the splicing acceptor sequence comprises or consists of the sequence of SEQ ID NO: 21 or SEQ ID NO: 69.

[0334] E12. Any one of the methods E4 to E11, wherein the first nucleic acid vector further comprises a degradation signal sequence located 3' of the recombination induction region, and the second nucleic acid vector further comprises a degradation signal sequence located between the recombination induction region and the splicing acceptor signal sequence.

[0335] E13. The method of E12, wherein the degradation signal sequence comprises or consists of the sequence of SEQ ID NO:22.

[0336] E14. The method of any one of E1-E13, wherein said first and second coding polynucleotides are split at an OTOF exon boundary.

[0337] E15. The method of E14, wherein said OTOF exon boundary is not within said first coding polynucleotide or second coding polynucleotide encoding a C2 domain.

[0338] E16. The method of E1, wherein said first coding polynucleotide overlaps with said second coding polynucleotide.

[0339] E17. The method of E16, wherein the first coding polynucleotide overlaps with the second coding polynucleotide by at least 1 kilobase (kb).

[0340] E18. The method of E16 or 17, wherein the region of overlap between said first and second coding polynucleotides is centered around an OTOF exon boundary.

[0341] E19. The method of E18, wherein the first coding polynucleotide encodes an N-terminal portion of the OTOF protein and includes an OTOF N-terminus 500 bp 3' of the exon boundary in the center of the overlapping region, and the second coding polynucleotide encodes a C-terminal portion of the OTOF protein and includes an OTOF C-terminus 500 bp 5' of the exon boundary in the center of the overlapping region.

[0342] E20. The method of E18 or E19, wherein the OTOF exon boundary at the center of the overlapping region is not within the first coding polynucleotide or the second coding polynucleotide encoding a C2 domain.

[0343] E21. Any one of the methods, E14, E15, and E18 to E20, wherein the OTOF exon boundaries are selected such that the first coding polynucleotide encodes the entire C2C domain and the second coding polynucleotide encodes the entire C2D domain.

[0344] E22. Any one of methods E14, E15, and E18-E21, wherein the OTOF exon boundary is the exon 19 / 20 boundary, the exon 20 / 21 boundary, or the exon 21 / 22 boundary.

[0345] E23. Any one of the methods, E14, E15, and E18-E20, wherein the OTOF exon boundaries are selected such that the first coding polynucleotide encodes the entire C2D domain and the second coding polynucleotide encodes the entire C2E domain.

[0346] E24. Any one of methods E14, E15, E18-E20, and E23, wherein the OTOF exon boundary is the exon 26 / 27 boundary or the exon 28 / 29 boundary.

[0347] E25. Any one of the methods of E14, E18 and E19, wherein the OTOF exon boundaries are in a portion of the first coding polynucleotide and in a portion of the second coding polynucleotide that encodes a C2D domain.

[0348] E26. Any one of methods E14, E18, E19, and E25, wherein the OTOF exon boundary is the exon 24 / 25 boundary or the exon 25 / 26 boundary.

[0349] E27. The method of any one of E1-E26, wherein said first and second coding polynucleotides each encode approximately half of said OTOF protein sequence.

[0350] E28. The method of any one of E1 to E27, wherein the first nucleic acid vector and the second nucleic acid vector do not contain an OTOF untranslated region (UTR).

[0351] E29. The method of any one of E1 to E27, wherein said first nucleic acid vector comprises an OTOF 5'UTR.

[0352] E30. The method of any one of E1-E27 and E29, wherein said second nucleic acid vector comprises an OTOF 3'UTR.

[0353] E31. Any one of the methods of E1 to E30, wherein said first and second coding polynucleotides encoding said OTOF protein do not contain an intron.

[0354] E32. The method of any one of E1 to E31, wherein said OTOF protein is a mammalian OTOF protein.

[0355] E33. The method of E32, wherein said OTOF protein is a human OTOF protein. E34. Any one of the methods E1 to E33, wherein the OTOF protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5.

[0356] E35. The method of E34, wherein said OTOF protein has the sequence of SEQ ID NO:1. E36. The method of E34, wherein the OTOF protein has the sequence of SEQ ID NO:5.

[0357] E37. Any one of the methods E1 to E33, wherein the OTOF protein comprises the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, or a variant thereof, having one or more conservative amino acid substitutions.

[0358] E38. The method of E37, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less) of the amino acids in the OTOF protein variant are conservative amino acid substitutions.

[0359] E39. The method of any one of E1 to E33, wherein the OTOF protein is encoded by any one of SEQ ID NOs: 10 to 14.

[0360] E40. The method of any one of E1 to E33, wherein the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO:1 or SEQ ID NO:5, and the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO:1 or SEQ ID NO:5.

[0361] E41. Any one of the methods E1 to E33, wherein said N-terminal portion of said OTOF protein consists of the sequence of SEQ ID NO: 73 or a variant thereof having one or more conservative amino acid substitutions.

[0362] E42. The method of E41, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF protein variant are conservative amino acid substitutions.

[0363] E43. The method of E41, wherein the N-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO:73.

[0364] E44. The N-terminal portion of the OTOF protein is encoded by the sequence of SEQ ID NO: 71, and is any one of E1 to E33 and E43.

[0365] E45. Any one of the methods E1 to E33 and E41 to E44, wherein the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO: 74 or a variant thereof having one or more conservative amino acid substitutions.

[0366] E46. The method of E45, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF protein variant are conservative amino acid substitutions.

[0367] E47. The method of E45, wherein the C-terminal portion of the OTOF protein consists of the sequence of SEQ ID NO:74.

[0368] E48. The C-terminal portion of the OTOF protein is any one of E1 to E33, E41 to E44, and E47 encoded by the sequence of SEQ ID NO:72.

[0369] E49. Any one of the methods E1 to E48, wherein the first nucleic acid vector comprises a Kozak sequence located 3' of the promoter and 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF protein.

[0370] E50. Any one of the methods E1 to E49, wherein the promoter is a ubiquitous promoter.

[0371] E51. The method of E50, wherein the ubiquitous promoter is a CAG promoter, a cytomegalovirus (CMV) promoter, a chicken β-actin promoter, a deleted CMV-chicken β-actin promoter (smCBA), a CB7 promoter, a hybrid CMV enhancer / human β-actin promoter, a human β-actin promoter, an elongation factor-1 alpha (EF1α) promoter, or a phosphoglycerate kinase (PGK) promoter.

[0372] E52. Any one of the methods of E1-49, wherein the promoter is a cochlear hair cell specific promoter.

[0373] E53. The method of E52, wherein the cochlear hair cell specific promoter is a myosin 15 (Myo15) promoter, a myosin 7A (Myo7A) promoter, a myosin 6 (Myo6) promoter, a POU class 4 homeobox 3 (POU4F3) promoter, an atonal BHLH transcription factor 1 (ATOH1) promoter, a LIM homeobox 3 (LHX3) promoter, an alpha9 acetylcholine receptor (alpha9AChR) promoter, or an alpha10 acetylcholine receptor (alpha10AChR) promoter.

[0374] E54. The method of any one of E1-E49, wherein the promoter is an inner hair cell specific promoter.

[0375] E55. The method of E54, wherein the inner hair cell specific promoter is a fibroblast growth factor 8 (FGF8) promoter, a vesicular glutamate transporter 3 (VGLUT3) promoter, an OTOF promoter, or a calcium binding protein 2 (CABP2) promoter.

[0376] E56. The method of E1, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO:75.

[0377] E57. The method of E1 or E56, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6264 of SEQ ID NO:75.

[0378] E58. The first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3849 of SEQ ID NO: 77. Method E1.

[0379] E59. The method of E1 or E58, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of nucleotides 19 to 4115 of SEQ ID NO:77.

[0380] E60. The method of E1, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO:79.

[0381] E61. The method of E1 or E60, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6237 of SEQ ID NO:79.

[0382] E62. The method of E1, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO:80.

[0383] E63. The method of E1 or E62, wherein the nineteenth nucleic acid vector comprises a polynucleotide sequence comprising or consisting of nucleotides 19 to 4090 of SEQ ID NO:80.

[0384] E64. The method of any one of E1, E56, E57, E60, and E61, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO:76.

[0385] E65. The method of any one of E1, E56, E57, E60, E61, and E64, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6693 of SEQ ID NO:76.

[0386] E66. The method of any one of E1, E58, E59, E62, and E63, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO:78.

[0387] E67. The method of any one of E1, E58, E59, E62, E63, and E66, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4589 of SEQ ID NO:78.

[0388] E68. The method of E1, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 81. E69. The method of E1 or E62, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4227 of SEQ ID NO:81.

[0389] E70. The method of E1, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO:83.

[0390] E71. The method of E1 or E70, wherein the first nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4200 of SEQ ID NO:83.

[0391] E72. The method of any one of E1 and E68 to E71, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO:82.

[0392] E73. The method of any one of E1 and E68 to E72, wherein the second nucleic acid vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4655 of SEQ ID NO:82.

[0393] E74. The method of any one of E1 to E73, wherein said first and second nucleic acid vectors comprise inverted terminal repeats (ITRs) at each end of said nucleic acid sequence.

[0394] E75. The method of E74, wherein the ITR is an AAV2 ITR or has at least 80% sequence identity to an AAV2 ITR (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity).

[0395] E76. The method of any one of E1 to E75, wherein said poly(A) sequence is the bovine growth hormone (bGH) poly(A) signal sequence.

[0396] E77. The method of any one of E1 to E76, wherein said second nucleic acid vector comprises a Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE).

[0397] E78. The method of E77, wherein the WPRE comprises or consists of the sequence of SEQ ID NO:23 or SEQ ID NO:61.

[0398] E79. The method of any one of E1 to E78, wherein said first and second nucleic acid vectors are adeno-associated virus (AAV) vectors.

[0399] E80. The method of E79, wherein the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S capsid.

[0400] E81. Any one of methods E1 to E80, wherein the subject is 30 years of age or older. E82. Any one of methods E1 to E81, wherein the subject is 35 years of age or older.

[0401] E83. Any one of methods E1 to E82, wherein the subject is 40 years of age or older. E84. Any one of methods E1 to E83, wherein the subject is 45 years of age or older.

[0402] E85. Any one of methods E1 to E84, wherein the subject is 50 years of age or younger. E86. The method of any one of E1-E85, wherein the subject is identified as having a biallelic OTOF mutation.

[0403] E87. Any one of the methods of E1-E85, wherein the method further comprises identifying the subject for the presence or absence of a biallelic OTOF mutation prior to administering the dual vector system.

[0404] E88. The method of any one of E1-E87, wherein the subject is identified as having detectable otoacoustic emissions.

[0405] E89. The method of any one of E1-E88, wherein the subject is identified as having a detectable cochlear microphonic potential.

[0406] E90. The method of any one of E1-E89, wherein the subject is identified as having a detectable collection potential.

[0407] E91. The method of any one of E1-E90, wherein the subject has, or is identified as having, hearing loss, autosomal recessive 9 (DFNB9).

[0408] E92. The method of any one of E1-E91, wherein the method further comprises assessing the subject's hearing prior to administering the dual vector system.

[0409] E93. The method of any one of E1 to E92, wherein the dual vector system is administered to the inner ear. E94. The dual vector system is administered by injection through the round window, injection into the semicircular canal, canalotomy, insertion of a catheter through the round window membrane, transtympanic injection, or intratympanic injection.

[0410] E95. The method of any one of E1-E94, further comprising assessing the subject's hearing after administering the dual vector system.

[0411] E96. Any one of the methods E1-E95, wherein the dual vector system is administered in an amount sufficient to prevent or reduce hearing loss, delay the onset of hearing loss, delay the progression of hearing loss, improve hearing, improve speech discrimination, or improve hair cell function.

[0412] E97. The method of any one of E1 to E96, wherein said first vector and said second vector are administered simultaneously.

[0413] E98. The method of any one of E1 to E96, wherein said first vector and said second vector are administered sequentially.

[0414] E99. The first vector and the second vector were mixed at about 1×10 7 Vector genome (VG) / ear ~ approx. 2 x 10 15 Administer at a concentration of VG / ear, any one of E1 to E98.

[0415] E100. Any one of the methods E1-E99, wherein the first vector and the second vector are administered in amounts together sufficient to transduce at least 20% of the subject's inner hair cells with both the first vector and the second vector.

[0416] Other embodiments Various modifications and variations of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unnecessarily limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are apparent to those skilled in the art are intended to be within the scope of the invention. Other embodiments are within the scope of the claims.

Claims

1. 1. A pharmaceutical composition for use in treating a human subject 25 years of age or older carrying a biallelic otoferlin (OTOF) mutation, comprising: a first nucleic acid vector comprising a promoter operably linked to a first coding polynucleotide encoding the N-terminal portion of an OTOF protein; a second nucleic acid vector comprising a second coding polynucleotide encoding a C-terminal portion of an OTOF protein and a poly(A) sequence located 3' of the second coding polynucleotide; a dual vector system comprising: The pharmaceutical composition, wherein neither the first nor the second nucleic acid vector encodes a full-length OTOF protein.

2. The pharmaceutical composition of claim 1 , wherein the first coding polynucleotide and the second coding polynucleotide do not overlap.

3. 3. The pharmaceutical composition of claim 1, wherein the first nucleic acid vector comprises a splice donor signal sequence at the 3' position of the first coding polynucleotide and the second nucleic acid vector comprises a splice acceptor signal sequence at the 5' position of the second coding polynucleotide.

4. 4. The pharmaceutical composition of claim 3, wherein the first nucleic acid vector comprises a first recombinogenic region located 3' to the splice donor signal sequence and the second nucleic acid vector comprises a second recombinogenic region located 5' to the splice acceptor signal sequence.

5. The pharmaceutical composition of claim 4 , wherein the first and second recombinogenic regions are the same.

6. The pharmaceutical composition according to claim 4 or 5, wherein the first or second recombination-inducing region is an AP gene fragment or an F1 phage AK gene.

7. The pharmaceutical composition of any one of claims 1 to 6, wherein the first and second coding polynucleotides are separated by an OTOF exon boundary.

8. 8. The pharmaceutical composition of claim 7, wherein the OTOF exon boundary is the exon 19 / 20 boundary, the exon 20 / 21 boundary, or the exon 21 / 22 boundary.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein each of the first and second coding polynucleotides encodes approximately half of the OTOF protein sequence.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the first and second coding polynucleotides encoding the OTOF protein are intron-free.

11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the promoter is a cochlear hair cell-specific promoter.

12. The pharmaceutical composition of claim 11, wherein the cochlear hair cell-specific promoter is a myosin 15 (Myo15) promoter.

13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the first and second nucleic acid vectors are adeno-associated virus (AAV) vectors.

14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the subject is 50 years of age or younger.

15. The pharmaceutical composition of any one of claims 1 to 14, wherein the subject has been identified as having detectable otoacoustic emissions.

16. The pharmaceutical composition of any one of claims 1 to 15, wherein the subject has been identified as having detectable cochlear microphonic potentials.

17. The pharmaceutical composition of any one of claims 1 to 16, wherein the subject has been identified as having a detectable collective potential.

18. 18. The pharmaceutical composition of any one of claims 1 to 17, wherein the subject has or is identified as having hearing loss, autosomal recessive 9 (DFNB9).

19. The pharmaceutical composition according to any one of claims 1 to 18, wherein the dual vector system is administered to the inner ear.

20. 20. The pharmaceutical composition of any one of claims 1 to 19, wherein the first nucleic acid vector and the second nucleic acid vector are administered in amounts that together are sufficient to transduce at least 20% of the subject's inner hair cells with both the first nucleic acid vector and the second nucleic acid vector.