Antisense oligonucleotides for inhibiting alpha-synuclein expression.

Abstract

The present disclosure provides antisense oligonucleotides for modulating the expression of alpha-synuclein and their use for treating synucleinopathies.

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy was created on March 6, 2021, is named 027628_WO002_SLfinal.txt, and is 718,553 bytes in size.

[0002] 2. Background of the Invention Alpha-synuclein is a protein encoded by the SNCA gene that is expressed primarily in the central nervous system, including the neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. In neurons, alpha-synuclein expression is localized to presynaptic terminals, and this protein is thought to be a chaperone involved in the assembly and function of the SNARE complex. At least three different isoforms of alpha-synuclein are known, which result from alternative splicing of the SNCA gene transcript. Alpha-synuclein may be involved in regulating many different neuronal functions and properties, including synaptic transmission, synaptic vesicle density, and neuronal plasticity.

[0003] In some cases, alpha-synuclein aggregates to form insoluble fibrils. Alpha-synuclein aggregates are believed to be involved in the pathology of many different neurological diseases, including Parkinson's disease, dementia with Lewy bodies, Alzheimer's disease, and multiple system atrophy. The pathogenic role of alpha-synuclein in disease progression has been genetically verified. For example, missense mutations in the SNCA gene lead to rare familial Parkinson's disease. It has been demonstrated that overexpression of wild-type alpha-synuclein protein alone is sufficient to cause disease, although duplication or triplication of wild-type genes can also cause rare cases of Parkinson's disease.

[0004] Disorders caused by misfolding or aggregation of alpha-synuclein are collectively called synucleinopathies. Multiple system atrophy (MSA) is a synucleinopathic disease with rapid clinical progression, resulting from the misfolding and accumulation of alpha-synuclein, leading to the formation of glial cytoplasmic inclusions (GCIs) in oligodendrocytes. GCIs are widely distributed in the nervous system of MSA patients, but some areas are more affected than others, including the basal ganglia, cerebellum, pons, and spinal cord. At the microscopic level, the neuropathological features of MSA include moderate gliosis, myelin loss, and neuronal loss and axonal degeneration within the striatonigral and olivopontocerebellar systems.

[0005] Alpha-synuclein protein is found in tissues in several different forms, including monomers, oligomers, or fibrillar complexes, and can be phosphorylated. It is currently unclear which of these protein species is responsible for synucleinopathies. Therefore, it is difficult to know which form of the protein to target in order to develop drugs to treat synucleinopathies at the protein level.

[0006] Currently, acceptable options for treating synucleinopathies are lacking, and thus there remains a need for compounds, methods, and pharmaceutical compositions for the treatment of these disorders.

[0007] Summary of the Invention The present disclosure provides antisense oligonucleotides (ASOs) that reduce the amount or activity of RNA transcribed from the SNCA gene. By reducing the level of SNCA RNA, the compounds of the present disclosure reduce the abundance of alpha-synuclein protein in cells. The ASOs described herein therefore reduce alpha-synuclein protein, their accumulation and aggregation, which can alleviate symptoms and / or slow disease progression.

[0008] In some aspects, the disclosure provides an oligonucleotide comprising a nucleotide sequence of 15-30 (e.g., 16-20) contiguous nucleotides, the nucleotide sequence being the nucleotide sequence of SEQ ID NO:1. a) 16350~16450, b) 18926~19030, c) 22250~22471, d) 22933~23079, e) 23408~23700, f) 29753~29819, g) 38128~38158, h) 39852~39906, i) 53762 to 53799, or j) is complementary to a region of the same length found in SEQ ID NOs: 59754-59865. In certain embodiments, the nucleotide sequence contains more than 3 mismatches to the region. For example, the nucleotide sequence may contain 0, 1, or 2 mismatches to the region. In certain embodiments, the nucleotide sequence is single stranded. The nucleotide sequence may be selected from, for example, SEQ ID NOs: 18-40.

[0009] In some embodiments, the oligonucleotides described herein may contain one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.

[0010] In some embodiments, the oligonucleotides described herein may include one or more modified nucleotides. Such modified nucleotides may include, for example, 2'-O-methoxyethyl (2'-MOE) nucleotides, locked nucleic acid (LNA) nucleotides, bridged nucleic acid (BNA) nucleotides, or any combination thereof.

[0011] In some embodiments, all cytosines in the oligonucleotides described herein are 5-methylcytosines.

[0012] In some embodiments, the oligonucleotides described herein may contain phosphodiester internucleoside linkages and / or phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotides may contain at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages. In certain embodiments, at least 1, 2, 3, 4, or 5, or all, internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.

[0013] In some embodiments, the oligonucleotides described herein include: i) 5-10-5 MOE gapmer; ii) 4-10-4MOE gapmer; iii) 3-10-3 LNA gapmer; iv) 3-11-3 LNA gapmer; v) 3-2-10-2-3 LNA / MOE gapmer; vi) 2-3-10-3-2 BNA / MOE gapmer; vii) 3-2-10-2-3 BNA / MOE gapmer; or viii) 2-3-10-3-2LNA / MOE gapmer.

[0014] In certain embodiments, the oligonucleotide comprises: i) 3-2-10-2-3 LNA / MOE gapmer; ii) 2-3-10-3-2BNA / MOE gapmer; iii) 3-2-10-2-3 BNA / MOE gapmer; or iv) 2-3-10-3-2LNA / MOE gapmer; Here, nucleosides v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19; vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 between are phosphodiester internucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages.

[0015] In certain embodiments, the oligonucleotides described herein comprise the formula: [ka] TIFF2024508956000002.tif220165 where A is adenine, mC is 5-methylcytosine, G is guanine, T is thymine, e is 2'-MOE modified ribose, d is 2'-deoxyribose, b is BNA, l is the LNA, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.

[0016] In some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula: [ka]

[0017] In some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula: [ka]

[0018] In some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula: [ka]

[0019] In some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula: [ka]

[0020] The present disclosure also provides oligonucleotide conjugates comprising the oligonucleotides described herein.

[0021] In some aspects, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide as described herein or an oligonucleotide conjugate as described herein, and a pharma- ceutically acceptable excipient.

[0022] Also provided is a method of reducing alpha-synuclein expression in a mammalian cell, comprising contacting the cell with an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein, thereby reducing alpha-synuclein expression in the cell. In some embodiments, the cell is a central nervous system cell, such as a cell in the human brain. In some embodiments, the present disclosure provides a method for treating a synucleinopathy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein. In certain embodiments, the synucleinopathy is Parkinson's disease, dementia with Lewy bodies, Alzheimer's disease, or multiple system atrophy. The oligonucleotide may be, for example, injected intrathecally or intracranially into the subject. In certain embodiments, the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in mouse primary cortical neurons engineered to express human alpha-synuclein.

[0023] It will be understood that any of the oligonucleotides, oligonucleotide conjugates, and pharmaceutical compositions described herein may be used in any of the methods of treatment described herein, may be for use in any of the treatments described herein, and / or may be for use in the manufacture of a medicament for any treatment as described herein.

[0024] Other features, objects, and advantages of the present invention will be apparent from the detailed description which follows. It should be understood, however, that the detailed description, while indicating embodiments and aspects of the present invention, is given by way of illustration only, and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Brief description of the drawings]

[0025] [Figure 1] FIG. 1 is a diagram illustrating the knock-in of the human SNCA gene at the endogenous mouse SNCA locus in the hSNCA mouse model (hSNCA+ / +). [Figure 2A] Figure 2A is a bar graph showing quantification of human alpha-synuclein protein (hSNCA protein) in cortical tissue from 3-month-old hSNCA+ / + (n=5), hSNCA+ / - (n=5), and hSNCA- / - (n=2) mice. Alpha-synuclein protein levels were assessed by mass spectrometry and normalized to GADPH protein levels. [Figure 2B] Figure 2B is a bar graph showing quantification of mouse alpha-synuclein protein (mSNCA protein) in the cortex of 3-month-old hSNCA+ / + (n=5), hSNCA+ / - (n=5), and hSNCA- / - (n=2) mice. Alpha-synuclein protein levels were assessed by mass spectrometry and normalized to GADPH protein levels. [Figure 2C]Figure 2C is a bar graph showing the levels of human alpha-synuclein protein (hSNCA protein) in different brain regions (cortex, cerebellum, hippocampus, striatum, spinal cord) and peripheral organs (liver, spleen, kidney) in 3-month-old hSNCA+ / + mice (n=5). Alpha-synuclein protein levels were assessed by mass spectrometry and normalized to GADPH protein levels. [Diagram 3] FIG. 3 is a table showing the tolerability scoring system for mice utilized in the in vivo assays described herein. [Figure 4] Figure 4 is a bar graph showing the efficacy and tolerability of a given ASO in mice. The left Y-axis and solid bars depict the expression levels of SNCA mRNA expressed in mouse neurons in vivo 2 weeks after treatment with a given ASO compared to PBS-treated samples. The right Y-axis and filled circles depict the Functional Observational Outcome (FOB) absolute scores observed in mice 1 hour after treatment with a given ASO. [Diagram 5] 5 is a bar graph showing the efficacy and tolerability of a given 3LNA-2MOE-10DNA-2MOE-3LNA gapmer ASO. Axes are as described in FIG. [Figure 6] 6 is a bar graph showing the efficacy and tolerability of a given 2BNA-3MOE-10DNA-3MOE-2BNA gapmer ASO. Axes are as described in FIG. [Figure 7] 7 is a bar graph showing the efficacy of SNCA_ASO_1613, SNCA_ASO_1617, and SNCA_ASO_1625 at doses of 1, 5, 10, 30, and 100 nmol. The left Y-axis and solid bars depict the expression levels of SNCA mRNA expressed in mouse neurons in vivo 4 weeks after treatment with a given ASO compared to PBS-treated samples. [Figure 8]8 is a bar graph showing the efficacy of SNCA_ASO_1613, SNCA_ASO_1617, and SNCA_ASO_1625 at doses of 1, 5, 10, 30, and 100 nmol. The left Y-axis and solid bars depict the expression levels of alpha-synuclein protein expressed in mouse neurons in vivo 4 weeks after treatment with a given ASO compared to PBS-treated samples. [Figure 9] FIG. 9 is a dot graph showing concentrations of SNCA_ASO_1613, SNCA_ASO_1617, and SNCA_ASO_1625 quantified by HPLC fluorescence in cortical tissue homogenates 4 weeks after a single injection at 1, 5, 10, 30, and 100 nmol ASO. [Figure 10] FIG. 10 is a table showing the tolerability scoring system for rats utilized in the in vivo assay described herein. [Figure 11] FIG. 11 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR. [Figure 12] FIG. 12 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR. [Figure 13] FIG. 13 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR, as described above. [Figure 14] FIG. 14 illustrates the experimental protocol for the measurement of alpha-synuclein pathology in ASO-treated neuronal cultures. [Figure 15]Figure 15 is a bar graph showing the levels of alpha-synuclein pathology (phosphorylated form) in primary neuronal cultures treated with SNCA_ASO_01613, SNCA_ASO_01617 and the non-targeting control Malat1_ASO and measured using a TR-FRET-based immunoassay. [Figure 16] Figure 16 is a bar graph showing the levels of alpha-synuclein pathology (phosphorylated form) in primary neuronal cultures treated with SNCA_ASO_01613 before, during, and after PFF treatment, measured by using a TR-FRET-based immunoassay (mean ± SEM). PFF: human alpha-synuclein preformed fibrils.

[0026] Detailed Description of the Invention The present disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting RNA transcribed from the SNCA gene can effectively reduce the amount of the target SNCA gene transcript and / or the translation of alpha-synuclein polypeptide from the transcript. The ASOs of the present disclosure comprise a sequence that is complementary to the SNCA transcript and binds to a defined nucleotide sequence within the transcript.

[0027] By reducing the level or translation activity of SNCA target transcripts in cells, ASOs mediate a decrease in the expression and accumulation of alpha-synuclein protein in cells, reducing the severity or progression of neurodegenerative diseases. The ASOs of the present disclosure are expected to be particularly useful in the treatment of synucleinopathies, which are caused by the accumulation or aggregation of alpha-synuclein protein. The protein can be expressed in cells, for example, as a monomer or oligomer, and can be phosphorylated or non-phosphorylated. As such, it has been difficult to develop effective therapeutics that target alpha-synuclein expression or activity at the protein level, since it is unclear which of these alpha-synuclein species is the cause of the disease. The ASOs of the present disclosure are highly advantageous in that they have the ability to target alpha-synuclein expression at the SNCA transcript level, thus reducing the expression of all of the above forms of alpha-synuclein protein.

[0028] I. The SNCA gene and the alpha-synuclein protein. The ASOs of the present disclosure bind to transcripts of the SNCA gene, which encodes the alpha-synuclein protein, also named SNCA protein. The SNCA gene is also known as the alpha-synuclein, NACP, non-A-beta component of AD amyloid, PARK1, PARK4, or PDI gene. In some embodiments, the ASOs described herein target transcripts of a mammalian SNCA gene (e.g., a mouse or human SNCA gene).

[0029] The sequence for the human SNCA gene is publicly available under GenBank Accession No. NC_000004.12. The gene is 137,980 bp long and is located on chromosome 4:89700345..89838324 (SEQ ID NO:2). A portion of the human genomic SNCA sequence is shown in SEQ ID NO:1, and a partial sequence for the pre-mRNA transcript can be found under GenBank Accession No. NG_011851.1 (residues 6001-8400). The mature mRNA transcript is shown in SEQ ID NO:3. In some embodiments, the ASO of the disclosure binds to an SNCA sequence selected from those under chromosome 4:89,700,345-89,838,315 (reverse strand) and GenBank accession numbers NM_000345.3, NT_016354.20 TRUNC 30800000-30919000, JN709863.1, BC013293.2, NM_001146055.1, HQ830269.1, and NC_000004.12 (89724099..89838324, supplement), or a transcript thereof. In some embodiments, the ASOs of the disclosure bind to SNCA transcripts encoding alpha-synuclein proteins, e.g., as found under UniProt accession numbers P37840, A8K2A4, Q13701, Q4JHI3, or Q6IAU6. In certain embodiments, the ASOs of the disclosure comprise a sequence that may be at least 60, 70, 80, 85, 90, or 95%, or 100% complementary to a sequence of the same length in the target SNCA transcript.

[0030] In some embodiments, the ASOs of the present disclosure can bind to transcripts of a wild-type SNCA gene (e.g., a wild-type human, non-human primate, or mouse gene). In some embodiments, the ASOs of the present disclosure bind to variants of the wild-type SNCA gene, such as known variants. Known variants include, for example, versions of the human SNCA gene in which a G209A substitution results in an A53T mutation in the alpha-synuclein protein encoded by that gene. Additional known variants have nucleotide mutations resulting in mutant alpha-synuclein proteins that include A30P, E46K, H50Q, and G51D amino acid substitutions. These substitutions can be found alone or in combination with other mutations. The ASOs of the present disclosure can be designed to reduce or inhibit expression of wild-type or variant SNCA transcripts. In certain embodiments, the ASOs described herein may reduce or inhibit expression of SNCA transcripts encoding alpha-synuclein proteins with one or more mutations selected from A30P, E46K, H50Q, G51D, and A53T.

[0031] The ASO of the present invention comprises a sequence that is complementary to a sequence of the same length in a target transcript encoded by the SNCA gene (wherein the genomic SNCA sequence may, for example, comprise SEQ ID NO: 1). In certain embodiments, the ASO described herein comprises a sequence that is complementary to a sequence in a hotspot region in a target SNCA nucleic acid. The term "hotspot region" refers to a region of a target nucleotide sequence where binding of a sequence in the region by a complementary ASO tends to result in a decrease in the abundance or translation activity of the target RNA transcript. A hotspot region may be entirely within an intron, entirely within an exon, or may span an intron / exon junction; or may be located entirely or partially in the 5' or 3' untranslated region (UTR) of an RNA transcript.

[0032] In some embodiments, the ASOs described herein may comprise sequences that bind to target sequences within or overlapping any of several different hotspot regions of the SNCA gene transcript. Table A lists exemplary hotspots in the human SNCA gene and identifies the ASOs of the present disclosure that are designed to be complementary to them. The table also shows the minimal reduction in SNCA gene transcript observed in vitro when neurons from humanized SNCA knock-in mice are treated with selected ASOs that target the hotspots (see, e.g., the section entitled "Materials and Methods for In Vitro Assays" below). Throughout this disclosure, compounds are referred to interchangeably as SNCA_ASO_[Compound Number] and [Compound Number]. For example, compound number SNCA_ASO_01608 and compound number 01608 represent the same antisense oligonucleotide compound. In certain embodiments, binding of a sequence in a hotspot region by an ASO described herein reduces SNCA RNA levels in a cell (e.g., in an in vitro assay, such as those described below in the section entitled "Materials and Methods for In Vitro Assays") by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100%. In certain embodiments, an ASO of the disclosure can be an ASO listed in Table A, or an ASO with a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. [Table 1]

[0033] II. Antisense Oligonucleotides The term "antisense oligonucleotide" or "ASO" refers to an oligonucleotide capable of hybridizing to a sequence in a target transcript. It will be understood by those of skill in the art that the ASOs described herein do not occur in nature (i.e., they are "isolated" ASOs).

[0034] The term "transcript" refers to any RNA transcribed from a gene (e.g., the SNCA gene). A gene may be wild-type or a mutant or variant (e.g., polymorphic) form. An RNA transcript may be a primary RNA transcript, a precursor messenger RNA (pre-mRNA), or a messenger RNA (mRNA), and may contain exons, introns, 5' UTRs, and 3' UTRs. Unless otherwise indicated, transcript and ASO sequences provided herein represent the nucleotide sequence from the 5' end (left) to the 3' end (right).

[0035] The term "oligonucleotide," as used in this disclosure, refers to a compound comprising a chain of about 5-100 nucleosides, e.g., 5-50 nucleosides, e.g., 8-30 nucleosides, connected via internucleoside linkages. Each nucleoside and internucleoside linkage of an oligonucleotide of this disclosure may be modified or unmodified from natural nucleotides and linkages. Modified oligonucleotides may contain one or more modified sugar moieties, one or more modified nucleobases, and / or one or more modified internucleoside linkages.

[0036] The ASOs described herein may comprise sequences that are substantially or fully complementary to sequences of the same length in a target transcript. Full complementarity occurs when a first strand of adjacent nucleotides (modified or unmodified) and a second strand of adjacent nucleotides (modified or unmodified) are completely complementary to each other over the entire length of the shorter strand (or both strands, if they are the same length). Two strands are considered to be substantially complementary to each other when they base pair with each other over 80% or more (e.g., 90% or more) over the length of the shorter strand (or both strands, if they are the same length), with 20% or less (e.g., 10% or less) mismatched base pairs (e.g., for a 20 nucleotide double strand, 4 or less or 2 or less mismatched base pairs). In some embodiments, the sequences in the ASOs of the present disclosure are 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the target RNA transcript. In some embodiments, an ASO of the invention contains no more than 1, 2, or 3 mismatches to its target sequence.

[0037] The term "identical" or "identity" in the context of comparing two nucleotide sequences refers to identical nucleobases. The term "percent identity" in this context refers to the percentage of nucleobases that are identical when the two compared sequences are aligned (introducing gaps, if necessary) for maximum correspondence over the length of the shorter compared sequence (or both sequences, if the compared sequences are the same length).

[0038] In certain embodiments, reduced, inhibited, or suppressed expression or activity of the target transcript is observed compared to a control sample not treated with the ASO. In some embodiments, the ASO of the present disclosure reduces the abundance and / or translation activity of the target SNCA transcript in a treated sample, for example, by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, compared to a control sample not exposed to the ASO. In some cases, the ASO reduces the level of the target transcript in vivo by that percentage, and administration of the ASO optionally results in a tolerability score (Functional Observational Outcome or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 (e.g., 0). The terms "reduce" and "inhibit" do not necessarily refer to complete elimination of the total amount and / or activity of the transcript. In some embodiments, an ASO is considered active if it reduces the amount or activity of a target RNA by 25% or more in an in vitro assay. The ASO of the invention may cause a detectable or measurable change in the level or activity of alpha-synuclein protein encoded by the target RNA.

[0039] Without wishing to be bound by theory, it is believed that ASOs may inhibit the expression of alpha-synuclein by recruiting the RNase H1 enzyme to the duplex formed between the ASO and the target SNCA transcript. The RNase H1 family of enzymes are endonucleases that typically target RNA:DNA duplexes and catalyze the hydrolytic cleavage of the RNA in the duplex.

[0040] In some embodiments, the ASO has minimal off-target effects and does not hybridize to any non-SNCA transcripts in a manner that results in a significant reduction in the abundance or activity of the non-SNCA transcript.

[0041] A. Length of Antisense Oligonucleotide In some embodiments, the ASOs of the invention are between 8 and 30 nucleotides in length (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length). In some embodiments, the ASOs described herein can comprise sequences complementary to SNCA transcript sequences of the same length, i.e., any of a range of nucleotide lengths having an upper limit of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0042] In certain embodiments, the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In certain embodiments, the complementary sequence in the ASO is 16, 17, 18, or 20 nucleobases in length.

[0043] B. Modification of Antisense Oligonucleotides In some embodiments, the ASOs of the present disclosure may include one or more modifications, e.g., to increase binding affinity to a target transcript, to increase the stability of the ASO (e.g., to increase resistance to degradation by nucleases, for example), and / or to increase the ease of ASO transport into a cell. Modifications may include any modification known in the art, including, for example, terminal modifications, nucleobase modifications, sugar modifications or substitutions, and backbone modifications. Terminal modifications may include, for example, 5' and / or 3' terminal modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and inverted ligation). Base modifications may include, for example, substitution with a stabilizing base, removal of a base, or conjugate base. Sugar modifications or substitutions may include, for example, modifications at the 2' and / or 4' positions of the ribose moiety, or substitution of the ribose moiety. Backbone or internucleoside linkage modifications can include, for example, modification or replacement of phosphodiester linkages with one or more phosphorothioates, phosphorodithioates, phosphotriesters, methyl and other alkyl phosphonates, phosphinates, and phosphoramidates.

[0044] In some embodiments, the ASO of the present invention may have one or more modified nucleosides. The term "nucleoside" refers to a compound that includes a nucleic acid base and a sugar moiety. Natural nucleosides include DNA and RNA nucleosides. In non-natural nucleosides (also referred to as "modified nucleosides" or "nucleoside analogs"), the base and / or sugar are modified. The modification of the nucleoside may be "silent", in which case the modified nucleoside has the same or equivalent function in terms of oligonucleotides compared to natural nucleosides. In other cases, the modified nucleoside may increase the efficacy of the ASO in reducing the abundance or activity of the target transcript. The term "efficacy" encompasses target association with SNCA mRNA.

[0045] The term "nucleotide", as used herein, refers to a nucleoside covalently linked to one or more modified or unmodified internucleoside linkages. Exemplary nucleotides include monophosphates, diphosphates, triphosphates, and thiophosphates. As used herein, the term "nucleotide" encompasses unmodified nucleotides (i.e., natural nucleotides) and modified nucleotides (i.e., nucleotide analogs). The term "nucleoside" encompasses unmodified nucleosides (i.e., natural nucleosides) and modified nucleosides (i.e., nucleoside analogs); the term "nucleobase" encompasses unmodified nucleobases (i.e., natural nucleobases) and modified nucleobases (i.e., nucleobase analogs).

[0046] In some embodiments, the modified nucleoside comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine (5mC) nucleobase, as shown in the following structure (I), where R represents a sugar moiety. [ka]

[0047] In some embodiments, the sugar moiety can be a modified or unmodified sugar moiety. As used herein, an unmodified sugar moiety refers to a 2'-OH(H) ribosyl moiety found in natural RNA, and is also referred to as an unmodified RNA sugar moiety. In some embodiments, a modified sugar moiety can be a 2'-H(H) deoxyribose sugar moiety, which is found naturally in deoxyribonucleic acids, and may be referred to as an unmodified DNA sugar moiety or simply a DNA sugar moiety. The structure of a 2'-deoxynucleoside sugar moiety is shown below in structure (II), where R represents a nucleobase, and each of the 5'-hydroxyl and 3'-hydroxyl groups of the sugar are optionally included in the internucleoside linkage. [ka]

[0048] In some embodiments, the modified sugar moiety may include an O-methoxyethyl (MOE) moiety. In some embodiments, the O-methoxyethyl moiety is at the 2' position of the sugar, as shown in structure (III) below. R in the structure below represents a nucleobase. The 5'-hydroxyl and 3'-hydroxyl groups of the sugar are each optionally included in an internucleoside linkage. A 2'-MOE modified sugar or 2'-MOE modified nucleoside, or simply MOE sugar or nucleoside, is a ribose or nucleoside in which the naturally occurring 2' hydroxyl group in ribose has been replaced with a 2'OCH2CH2OCH3 group. [ka]

[0049] In some embodiments, the modified sugar moiety may comprise a bridged nucleic acid (BNA) moiety. A bridged nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4'-CH2-NH-O-2' linkage. The nitrogen of the bridged nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with a phenyl group). The structure of a BNA moiety is shown below in (IV), where R is a nucleobase and R' is, for example, an H group, an Me group, or a phenyl group, with each of the 5'-hydroxyl and 3'-hydroxyl groups of the sugar optionally included in the internucleoside linkage. In the ASO of the invention, R' is an Me group unless otherwise specified. A BNA modified nucleoside, or simply a BNA nucleoside, is a nucleoside that comprises a BNA sugar moiety. [ka]

[0050] In some embodiments, the modified sugar moiety may comprise a locked nucleic acid (LNA) moiety. A locked nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4'-CH2-O-2' linkage. The LNA moiety may be in the alpha-L or beta-D configuration, as described herein. In certain embodiments, the LNA moiety in the ASOs described herein is in the beta-D configuration. The structure of an LNA moiety is shown below (V), where R is a nucleobase, and each of the 5'-hydroxyl and 3'-hydroxyl groups of the sugar are optionally included in an internucleoside linkage. An LNA modified nucleoside, or simply an LNA nucleoside, is a nucleoside that comprises an LNA sugar moiety. [ka]

[0051] In certain embodiments, the ASOs described herein can contain one or more modified nucleotides known in the art, including, for example, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, 2'-O-methoxyethyl modified nucleotides, modified nucleotides allowing for alternative internucleoside linkages (e.g., nucleotides containing thiophosphates, phosphorothioates, and phosphotriesters), cholesterol derivatives or modified nucleotides terminally linked to lipophilic moieties, peptide nucleic acids, reverse deoxy or dideoxy modified nucleotides, abasic modifications of nucleotides, 2'-amino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides containing modifications at other sites on the sugar or base of the oligonucleotide, and modified nucleotides containing non-natural bases.

[0052] In some embodiments, an ASO can include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modified nucleosides. In certain embodiments, all of the nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) of the nucleosides in the ASO are modified nucleosides.

[0053] The ASOs of the present disclosure may contain natural and / or non-natural internucleoside linkages. The term "internucleoside linkage" as used in this disclosure refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In certain embodiments, the ASOs described herein may contain one or more modified nucleoside linkages known in the art, such as, for example, phosphate, phosphotriester, boranophosphate, methylphosphonate, phosphoramidate, phosphorothioate, phosphorodithioate linkages, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), dialkylsiloxane, N,N'-dimethylhydrazine (-CH2-N(CH3)- N(CH3)-), MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), amide-5 (3'-N(H)-C(=O)-CH2-5'), amide-6 (3'-C(=O)-N(H)-CH2-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, thioformacetal (3'-S-CH2-O-5'), carboxylate, carboxamide, sulfide, sulfonate, or amide linkers. See, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65.

[0054] In certain embodiments, the ASOs described herein may contain one or more modified nucleoside linkages known in the art, such as phosphonoacetate (PACE, P(CR'R'') n COOR) or thiophosphonoacetate (thioPACE, (S)-P(CR'R'') nCOOR) internucleoside linkages, where n is an integer from 0 to 6, and each of R' and R'' is independently selected from the group consisting of H, alkyl, and substituted alkyl. Examples of these internucleoside linkages include phosphonocarboxylate, phosphonocarboxylate, thiophosphonocarboxylate, and thiophosphonocarboxylate ester linkages, and in some embodiments are described in Yamada et al., J. Am. Chem. Soc. (2006) 128(15):5251-61, the contents of which are hereby incorporated by reference in their entirety.

[0055] In certain embodiments, the internucleoside linkage of the nucleotide can be a phosphate group or a thiophosphate group. Methods for the preparation of phosphorus-containing internucleoside linkages are well known to those skilled in the art. In certain embodiments, the ASO described herein can have a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a combination thereof. The term "phosphodiester internucleoside linkage" refers to an internucleoside linkage between two nucleosides formed by a phosphodiester group. The term "phosphorothioate internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0056] In certain embodiments, the internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Representative internucleoside linkages having chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. The ASOs of the present disclosure that include internucleoside linkages having one or more chiral centers can be prepared as a population of ASOs that include stereorandom internucleoside linkages or as a population of ASOs that include stereodefined internucleoside linkages.

[0057] The term "stereodefined internucleoside linkage" in this disclosure refers to an internucleoside linkage in which the stereochemical assignment of the phosphorus atom is controlled such that a particular amount of Rp or Sp of the internucleoside linkage is present within the ASO chain. The stereochemical assignment of a chiral linkage can be defined, for example, by asymmetric synthesis. An ASO having at least one stereodefined internucleoside linkage can be referred to as a stereodefined ASO.

[0058] In some embodiments, the ASOs of the invention are fully stereodefined. The term "fully stereodefined ASO," as used in this disclosure, refers to an ASO that has a defined chiral center (R p Or S p The term "partially stereodefined ASO," as used in this disclosure, refers to an ASO sequence that has a defined chiral center (R p Or S p ) refers to an ASO sequence having at least one stereodefined linkage. Thus, a partially stereodefined ASO may contain achiral or non-stereodefined linkages in addition to at least one stereodefined linkage.

[0059] In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in Oka et al., JACS(2003)125:8307, Wan et al., Nuc. Acid. Res.(2014)42:13456, and PCT Patent Publication WO 2017 / 015555.

[0060] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or in a specific stereochemical configuration.

[0061] C. Antisense Oligonucleotide Complex The present disclosure also provides an antisense oligonucleotide conjugate (ASO conjugate) comprising one or more ASOs described herein. The term "ASO conjugate" in the present disclosure refers to an oligomeric compound comprising an antisense oligonucleotide covalently linked to one or more non-nucleotide moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacological or pharmacokinetic properties of the ASO. For example, the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cellular distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and / or stability of the ASO. In particular, the conjugate moiety may help target the ASO to a specific region in the central nervous system. In some embodiments of the ASOs described herein, the conjugate moiety may be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and / or a lipid (e.g., a phospholipid).

[0062] PCT Patent Publications WO 1993 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties for use with the ASOs of the present disclosure. Certain conjugate groups and moieties have been previously described, for example, in the following references: thioether moieties, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et al., Bioorg. Med. Chem. Lett. (1993) 3:2765-70), phospholipids, such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett. (1995) 36:3651-4; Shea et al., Nucl. Acids Res. (1990) 18:3777-83), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides (1995) 14:969-73), or adamantane acetic acid, a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids (2015) 4:e220; and Nishina et al., Molecular Therapy (2008) 16:734-40), or a GalNAc moiety (e.g., PCT Patent Publications WO 2014 / 076196, WO 2014 / 207232, and WO 2014 / 179620).

[0063] In certain embodiments, the conjugation of the ASO of the present disclosure to a lipophilic moiety may increase the delivery of the ASO to cells of the central nervous system. The term "lipophilic moiety" in this disclosure refers broadly to any compound or chemical moiety that has an affinity for lipids. The lipophilic moiety may generally include a saturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may include various substituents and / or one or more heteroatoms, such as oxygen or nitrogen atoms. In certain embodiments, the lipophilic moiety is an aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound. In certain embodiments, the lipophilic moiety is a steroid (e.g., a sterol). Steroids include, but are not limited to, bile acids (e.g., cholic acid, deoxycholic acid, and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids such as cortisone.

[0064] Certain lipophilic conjugation groups and conjugation moieties have been previously described, for example, in the following references: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA (1989) 86:6553-6), cholic acid moieties (Manoharan et al., Bioorg. Med. Chem. Lett. (1994) 4:1053-60), thiocholesterol moieties (Oberhauser et al., Nucl. Acids Res. (1992) 20:533-8), aliphatic chains such as do-decane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J. (1991) 10:1111-8; Kabanov et al., FEBS Lett. (1990) 259:327-30; Svinarchuk et al., Biochimie (1993) 75:49-54), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta (1995) 1264:229-37), or an octadecylamine or hexylamino-5 carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther. (1996) 277:923-37).

[0065] D. Exemplary Antisense Oligonucleotide Compounds Certain abbreviations are used in this disclosure to describe each of the modifications of the nucleotides and internucleoside linkages of the ASOs described herein that are modified oligonucleotides. The abbreviations are as follows: A is an adenine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; mC is a 5-methylcytosine nucleobase; e is a 2'-MOE modified sugar; d is a 2'-deoxyribose sugar; l is a locked nucleic acid; b is a bridged nucleic acid; o is a phosphodiester internucleoside linkage; and s is a phosphorothioate internucleoside linkage.

[0066] In certain embodiments, the ASO of the present disclosure is a gapmer. The term "gapmer" as used in this disclosure refers to an oligonucleotide that comprises or consists of an internal region located between two external regions, where the sugar moieties of the nucleosides that comprise the internal region are chemically different from the sugar moieties of the nucleosides that comprise the external regions. The term "gap" refers to the internal region of the oligonucleotide, while the term "wing" refers to the external region. A gapmer has a 5'-wing, a gap, and a 3'-wing. The three regions form a contiguous sequence. The sugar moieties of each of the wing nucleosides are different from at least a portion of the sugar moieties of the gap nucleosides. Unless otherwise stated, the nucleosides of the gap region of the ASO of the present disclosure comprise fully 2'-deoxyriboxyl nucleosides. In some embodiments, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases that do not necessarily follow the gapmer pattern of sugar modifications.

[0067] In some embodiments, the oligonucleotides of the present disclosure are gapmers that include MOE, BNA, LNA, or DNA modifications, or any combination thereof. In some embodiments, the gapmers include MOE, DNA, and BNA, MOE, DNA, and LNA, or BNA, DNA, and LNA modified sugar moieties. In certain embodiments, the internucleoside linkages between the oligonucleosides are phosphodiester or phosphorothioate internucleoside linkages, or combinations thereof.

[0068] The lengths of the three gapmer regions may be expressed using the notation [number of nucleosides in the 5' wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3' wing]. Thus, a 4-10-4 gapmer contains 4 linked nucleosides in each wing and 10 linked nucleosides in the gap.

[0069] In some embodiments, the ASO of the present disclosure is a 3-10-3 LNA gapmer. The 3-10-3 LNA gapmer is 16 nucleobases long, where the central gap segment comprises 10 2'-deoxynucleosides and the 5' and 3' wing segments each comprise 3 LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.

[0070] In some embodiments, the ASO of the present disclosure is a 3-11-3 LNA gapmer. The 3-11-3 LNA gapmer is 17 nucleobases long, where the central gap segment comprises 11 2'-deoxynucleosides and the 5' and 3' wing segments each comprise 3 LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.

[0071] In some embodiments, the ASO of the present disclosure is a 4-10-4 MOE gapmer. A 4-10-4 gapmer is 18 nucleobases long, where the central gap segment comprises 10 2'-deoxynucleosides and the 5' and 3' wing segments each comprise 4 2'-MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 4-10-4 MOE gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.

[0072] In some embodiments, the ASO of the present disclosure is a 5-10-5 MOE gapmer. A 5-10-5 gapmer is 20 nucleobases long, in which a central gap segment comprises 10 2'-deoxynucleosides and is flanked at both the 5' and 3' ends by wing segments comprising five 2'-MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.

[0073] In certain embodiments, the ASO of the disclosure is a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer, where each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprises an LNA modification, each of the nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprises a 2'-MOE modification, and each of the nucleosides at positions 6-15 is a 2'-deoxynucleoside. In some embodiments, all internucleoside linkages are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.

[0074] In certain embodiments, the ASO of the disclosure is a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer, where the nucleosides at positions 1, 2, 19, and 20 each comprise a BNA modification, the nucleosides at positions 3, 4, 5, 16, 17, and 18 each comprise a 2'-MOE modification, and each of the nucleosides at positions 6-15 is a 2'-deoxynucleoside. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.

[0075] In certain embodiments, the ASO of the disclosure is a 3BNA-2MOE-10DNA-2MOE-3BNA gapmer, where each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprises a BNA modification, each of the nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprises a 2'-MOE modification, and each of the nucleosides at positions 6-15 is a 2'-deoxynucleoside. In some embodiments, all internucleoside linkages are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.

[0076] In certain embodiments, the ASO of the disclosure is a 2LNA-3MOE-10DNA-3MOE-2LNA gapmer, where the nucleosides at positions 1, 2, 19, and 20 each comprise an LNA modification, the nucleosides at positions 3, 4, 5, 16, 17, and 18 each comprise a 2'-MOE modification, and each of the nucleosides at positions 6-15 is a 2'-deoxynucleoside. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.

[0077] In certain embodiments, the disclosure provides ASOs as listed in the table below and described in more detail below. [Table 2]

[0078] D.1. Representative BNA / MOE Gapmer Compounds In some embodiments, the ASO of the disclosure is a BNA / MOE gapmer compound, such as a compound described below.

[0079] The compound SNCA_ASO_01608 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of GCAGTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, nucleosides 6-15 each are 2'-deoxynucleosides, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0080] The compound SNCA_ASO_01608 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (modified oligonucleotide SEQ ID NO: 18), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0081] The compound SNCA_ASO_01608 is characterized by the following chemical structure (VI): [ka]

[0082] The compound SNCA_ASO_01613 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO:5), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0083] The compound SNCA_ASO_01613 is characterized by the following chemical notation: Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (modified oligonucleotide SEQ ID NO: 19), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0084] The compound SNCA_ASO_01613 is characterized by the following chemical structure (VII): [ka]

[0085] The compound SNCA_ASO_01615 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0086] The compound SNCA_ASO_01615 is characterized by the following chemical notation: Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 20), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0087] The compound SNCA_ASO_01615 is characterized by the following chemical structure (VIII): [ka]

[0088] The compound SNCA_ASO_01609 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0089] The compound SNCA_ASO_01609 is characterized by the following chemical notation: mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (modified oligonucleotide SEQ ID NO: 21), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0090] The compound SNCA_ASO_01609 is characterized by the following chemical structure (IX): [ka]

[0091] The compound SNCA_ASO_01611 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of TTGCAGATAAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0092] The compound SNCA_ASO_01611 is characterized by the following chemical notation: Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (modified oligonucleotide SEQ ID NO: 22), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0093] The compound SNCA_ASO_01611 is characterized by the following chemical structure (X): [ka]

[0094] The compound SNCA_ASO_01614 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0095] The compound SNCA_ASO_01614 is characterized by the following chemical notation: Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds mCeo Aeo Tes Tbs Ab (modified oligonucleotide SEQ ID NO: 23), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0096] The compound SNCA_ASO_01614 is characterized by the following chemical structure (XI): [ka]

[0097] The compound SNCA_ASO_01610 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0098] The compound SNCA_ASO_01610 is characterized by the following chemical notation: mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (modified oligonucleotide SEQ ID NO: 24), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0099] The compound SNCA_ASO_01610 is characterized by the following chemical structure (XII): [ka]

[0100] The compound SNCA_ASO_01612 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of GCAGATAAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0101] The compound SNCA_ASO_01612 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 25), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase group, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0102] The compound SNCA_ASO_01612 is characterized by the following chemical structure (XIII): [ka]

[0103] The compound SNCA_ASO_01616 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0104] The compound SNCA_ASO_01616 is characterized by the following chemical notation: mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 26), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0105] The compound SNCA_ASO_01616 is characterized by the following chemical structure (XIV): [ka]

[0106] The compound SNCA_ASO_01790 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of GAACTGATGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0107] The compound SNCA_ASO_01790 is characterized by the following chemical notation: Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (modified oligonucleotide SEQ ID NO: 27), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0108] The compound SNCA_ASO_01790 is characterized by the following chemical structure (XV): [ka]

[0109] The compound SNCA_ASO_01791 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence 5' to 3' ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 23), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0110] The compound SNCA_ASO_01791 is characterized by the following chemical notation: Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (modified oligonucleotide SEQ ID NO: 28), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0111] The compound SNCA_ASO_01791 is characterized by the following chemical structure (XVI): [ka]

[0112] The compound SNCA_ASO_01792 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0113] The compound SNCA_ASO_01792 is characterized by the following chemical notation: Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 29), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0114] The compound SNCA_ASO_01792 is characterized by the following chemical structure (XVII): [ka]

[0115] The compound SNCA_ASO_01793 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0116] The compound SNCA_ASO_01793 is characterized by the following chemical notation: Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (modified oligonucleotide SEQ ID NO: 30), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0117] The compound SNCA_ASO_01793 is characterized by the following chemical structure (XVIII): [ka]

[0118] The compound SNCA_ASO_01789 is characterized as a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having a 5' to 3' sequence of TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), where nucleosides 1-2 and 19-20 each contain a BNA modification, nucleosides 3-5 and 16-18 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0119] The compound SNCA_ASO_01789 is characterized by the following chemical notation: Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (modified oligonucleotide SEQ ID NO: 31), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, b is a bridged nucleobase, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0120] The compound SNCA_ASO_01789 is characterized by the following chemical structure (XIX): [ka]

[0121] D.2. Representative LNA / MOE Gapmer Compounds In some embodiments, the ASO of the disclosure is an LNA / MOE gapmer compound, such as a compound described below.

[0122] The compound SNCA_ASO_01618 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0123] The compound SNCA_ASO_01618 is characterized by the following chemical notation: Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (modified oligonucleotide SEQ ID NO: 32), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0124] The compound SNCA_ASO_01618 is characterized by the following chemical structure (XX): [ka]

[0125] The compound SNCA_ASO_01623 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO:5), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0126] The compound SNCA_ASO_01623 is characterized by the following chemical notation: Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds mCds mCds Ads mCeo Aes mClo mCls Al (modified oligonucleotide SEQ ID NO: 33), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0127] The compound SNCA_ASO_01623 is characterized by the following chemical structure (XXI): [ka]

[0128] The compound SNCA_ASO_01625 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0129] The compound SNCA_ASO_01625 is characterized by the following chemical notation: Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 34), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0130] The compound SNCA_ASO_01625 is characterized by the following chemical structure (XXII): [ka]

[0131] The compound SNCA_ASO_01619 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0132] The compound SNCA_ASO_01619 is characterized by the following chemical notation: mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls Tl (modified oligonucleotide SEQ ID NO: 35), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0133] The compound SNCA_ASO_01619 is characterized by the following chemical structure (XXIII): [ka]

[0134] The compound SNCA_ASO_01621 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of TTGCAGATAAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0135] The compound SNCA_ASO_01621 is characterized by the following chemical notation: Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (modified oligonucleotide SEQ ID NO: 36), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0136] The compound SNCA_ASO_01621 is characterized by the following chemical structure (XXIV): [ka]

[0137] The compound SNCA_ASO_01624 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0138] The compound SNCA_ASO_01624 is characterized by the following chemical notation: Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds mCeo Aes Tlo Tls Al (modified oligonucleotide SEQ ID NO: 37), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0139] The compound SNCA_ASO_01624 is characterized by the following chemical structure (XXV): [ka]

[0140] The compound SNCA_ASO_01620 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0141] The compound SNCA_ASO_01620 is characterized by the following chemical notation: mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls Al (modified oligonucleotide SEQ ID NO: 38), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0142] The compound SNCA_ASO_01620 is characterized by the following chemical structure (XXVI): [ka]

[0143] The compound SNCA_ASO_01622 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of GCAGATAAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0144] The compound SNCA_ASO_01622 is characterized by the following chemical notation: Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCeo Aes mClo Tls Tl (modified oligonucleotide SEQ ID NO: 39), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0145] The compound SNCA_ASO_01622 is characterized by the following chemical structure (XXVII): [ka]

[0146] The compound SNCA_ASO_01626 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0147] The compound SNCA_ASO_01626 is characterized by the following chemical notation: mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 40), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0148] The compound SNCA_ASO_01626 is characterized by the following chemical structure (XXVIII): [ka]

[0149] The compound SNCA_ASO_01823 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0150] The compound SNCA_ASO_01823 is characterized by the following chemical notation: Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Ads mCeo mCes Tlo mCls mCl (modified oligonucleotide SEQ ID NO: 41), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0151] The compound SNCA_ASO_01823 is characterized by the following chemical structure (XXIX): [ka]

[0152] The compound SNCA_ASO_01824 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 13), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0153] The compound SNCA_ASO_01824 is characterized by the following chemical notation: Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (modified oligonucleotide SEQ ID NO: 42), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0154] The compound SNCA_ASO_01824 is characterized by the following chemical structure (XXX): [ka]

[0155] The compound SNCA_ASO_01825 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0156] The compound SNCA_ASO_01825 is characterized by the following chemical notation: Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls Tl (modified oligonucleotide SEQ ID NO: 43), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0157] The compound SNCA_ASO_01825 is characterized by the following chemical structure (XXXI): [ka]

[0158] The compound SNCA_ASO_01826 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0159] The compound SNCA_ASO_01826 is characterized by the following chemical notation: Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als Al (modified oligonucleotide SEQ ID NO: 44), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0160] The compound SNCA_ASO_01826 is characterized by the following chemical structure (XXXII): [ka]

[0161] The compound SNCA_ASO_01822 is characterized as a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having a 5' to 3' sequence of TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), where nucleosides 1-3 and 18-20 each contain an LNA modification, nucleosides 4-5 and 16-17 each contain a 2'-MOE modification, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0162] The compound SNCA_ASO_01822 is characterized by the chemical designation Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als Al (modified oligonucleotide SEQ ID NO: 45), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2'-deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.

[0163] The compound SNCA_ASO_01822 is characterized by the following chemical structure (XXXIII): [ka]

[0164] III. Methods for Making Antisense Oligonucleotides The antisense oligonucleotides of the present disclosure can be synthesized by any method known in the art. For example, ASOs can be synthesized by in vitro transcription and purification (e.g., using commercially available in vitro RNA synthesis kits), by transcription and purification from cells (e.g., cells containing expression cassettes / vectors encoding ASOs) using automated solid-phase synthesizers, and the like. In solid-phase oligonucleotide synthesis, monomeric nucleoside units are repeatedly added to a growing oligonucleotide chain that is covalently linked to a solid support. In the case of phosphodiester linkages, electrophilic 3' phosphoramidite monomeric units can be used. However, any suitable electrophilic group can be used to covalently link two nucleosides.

[0165] The ASO of the present invention may be purified after solid-phase synthesis by any method known in the art.For example, oligonucleotides may be precipitated from solution by treating the solution with ethanol and divalent cations.The ASO of the present invention may also be purified using, for example, sizing columns, reverse phase chromatography, high performance liquid chromatography, and polyacrylamide gel electrophoresis.

[0166] Exemplary methods for synthesizing antisense oligonucleotides using solid supports and purifying the oligonucleotides are described, for example, in Ellington et al., Introduction to the synthesis and purification of oligonucleotides. Curr. Protoc. Nucleic Acid Chem. (2001) Appendix 3C.

[0167] IV. Composition of Antisense Oligonucleotides In some embodiments, the disclosure relates to compositions (e.g., pharmaceutical compositions) comprising the ASOs described herein. In some embodiments, the compositions are useful for treating diseases or disorders associated with expression or overexpression of alpha-synuclein, e.g., synucleinopathies. The compositions of the disclosure may be formulated based on the mode of delivery.

[0168] The pharmaceutical compositions described herein may include pharmaceutically acceptable excipients. The pharmaceutically acceptable excipients may be liquid or solid, but may be selected with the planned mode of administration in mind to provide the desired volume, consistency, and other relevant transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline, buffers, preservatives, and the like. For example, the ASO of the present disclosure may be administered to a patient as a formulation in phosphate buffered saline (PBS). Examples of pharmaceutically acceptable excipients include water, saline, buffers, or artificial cerebrospinal fluid. The pharmaceutically acceptable excipients are preferably sterile.

[0169] The ASO of the present disclosure can be administered as a pharmaceutically acceptable salt. A pharmaceutically acceptable salt is a salt of the ASO of the present disclosure that is physiologically acceptable and retains the desired biological activity of the ASO without having undesired toxic effects. As used herein, the term "ASO" includes both the free acid form and the salt form (e.g., sodium salt form) of an oligonucleotide.

[0170] The ASOs of the disclosure may be mixed, encapsulated (e.g., in lipid nanoparticles), complexed, or otherwise associated with mixtures of other molecules, molecular structures, or nucleic acids.

[0171] U.S. Patent Publication No. 2020 / 0385723 provides suitable pharmaceutical compositions for use with the ASOs of the present disclosure.

[0172] V. Methods of Using Antisense Oligonucleotides The ASO of the present disclosure typically inhibits the activity of the transcript encoded by the SNCA gene in mammalian cells, such as human cells.In some embodiments, the cell is a neuronal cell.In certain embodiments, the cell is a cell of the central nervous system (CNS), including the cell of motor cortex, frontal cortex, caudate nucleus, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, mammillary body, dorsal cochlear nucleus (DCN), entorhinal cortex (Ent cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulmonary vertebrate, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculus, and basal forebrain.

[0173] The present disclosure provides a method of downregulating the abundance or activity of an SNCA gene transcript in a cell or tissue, comprising contacting the cell or tissue with an effective amount of one or more ASOs or compositions of the present disclosure. The method can be performed in vitro or in vivo.

[0174] In some embodiments, the ASO of the present disclosure can be used for treatment or prevention. The ASO of the present disclosure can be used as a therapeutic agent in an animal suspected of having a disease or disorder that can be treated by regulating the expression of SNCA gene transcript and / or alpha-synuclein protein. The animal may also be prone to have a disease or disorder associated with the expression of SNCA gene, but is not necessarily suspected of having the disease or disorder. The animal is treated by administering a therapeutically or prophylactically effective amount of one or more ASO compounds or pharmaceutical compositions of the present disclosure. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human.

[0175] In some embodiments, the ASOs described herein may be used to treat neurodegenerative diseases, such as Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuropathic Gaucher disease, and Alzheimer's disease. Generally, neurodegenerative diseases result in the death of neurons.

[0176] In some embodiments, the ASO of the present disclosure ameliorates the symptoms of a disease or disorder associated with the expression of the SNCA gene. Amelioration may refer to a decrease in the severity or frequency of occurrence of a symptom. Amelioration may also refer to a delay in the onset or progression of a symptom. In some embodiments, the symptoms that are alleviated by treatment with ASO are motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, or dementia. Amelioration of these symptoms may result in improved motor function, decreased alpha-synuclein aggregation, decreased neurodegeneration, decreased or reversed cognitive decline, and / or decreased or reversed dementia.

[0177] A "therapeutically effective amount" of the ASO disclosed herein is an amount sufficient to perform a specifically described purpose. Such an amount can be empirically determined in a routine manner in relation to the described purpose. Certain factors can affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and one or more other diseases currently being treated. Furthermore, treatment of a subject with a therapeutically effective amount of a pharmaceutical composition can include a single treatment or a series of treatments. Estimation of effective dosages and in vivo half-lives for the ASO of the present disclosure may be performed using conventional methodology or based on in vivo tests using suitable animal models. A therapeutically effective amount can reduce symptoms of a disease.

[0178] In certain embodiments, the ASO or pharmaceutical composition of the disclosure is prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracranial, and the like). In a preferred embodiment, the pharmaceutical composition is injected intrathecally or intracranially into the subject.

[0179] In some embodiments, the ASO of the present disclosure can be used for research purposes.For example, ASO can be used to specifically inhibit the synthesis of alpha-synuclein protein in cells and experimental animals.ASO-mediated inhibition of alpha-synuclein synthesis can be used to perform functional analysis of alpha-synuclein protein.

[0180] VI. Kits and Articles of Manufacture The present disclosure also provides kits and articles of manufacture comprising the ASOs described herein. The kits or articles of manufacture comprising the ASOs of the present disclosure can be used to carry out the methods described herein. The kits or articles of manufacture comprise at least one ASO in one or more containers.

[0181] In some embodiments, the kits or articles of manufacture described herein may be used for the treatment and / or prevention of diseases associated with the expression of the SNCA gene (e.g., synucleinopathies). The kits or articles of manufacture may further comprise a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, and the like. The containers may be formed from a variety of materials, such as glass or plastic, may hold the composition by itself or in combination with another composition effective for treating or preventing a disease, and may have a sterile access port (e.g., the container may be an intravenous solution bag, or a vial with a stopper pierceable by a hypodermic needle). The kits or articles of manufacture may further comprise a package insert indicating that the composition can be used to treat a particular disease. Alternatively, or additionally, the articles of manufacture or kits may further comprise a second (or third) container comprising a pharma- ceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and / or user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0182] In some embodiments, the kit contains all of the necessary and / or sufficient components to perform a detection assay, including all controls, instructions for performing the assay, and any necessary software for analysis and presentation of results. One of skill in the art will readily recognize that the disclosed ASOs can be readily incorporated into one of the established kit formats that are well known in the art.

[0183] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this disclosure. In case of conflict, the present specification, including definitions, will control. In general, the nomenclature used in connection with, and techniques of, neurology, medicine, medical and pharmaceutical chemistry, and cell biology described herein are those well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Furthermore, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise", or variations such as "has", "having", "comprises", or "comprising", will be understood to mean the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. As used herein, the term "approximately" or "about" applied to one or more values ​​of interest refers to a value that is similar to a stated reference value. In certain embodiments, the term refers to a range of values ​​that are within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% in either direction (greater or less) of a stated reference value, unless otherwise stated or otherwise clear from the context.

[0184] All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0185] In order that this invention may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any manner.

[0186] Working Example The materials and methods used in the experiments described below are as follows.

[0187] Building an ASO The ASO was constructed to be complementary to the sense strand of the genomic SNCA sequence (SEQ ID NO:1) as well as to the sequence of the mRNA transcribed from the SNCA gene (NC_000004.12::89724099..89838324, SEQ ID NO:2).

[0188] SK-Mel-2 cell culture Sk-Mel-2 cells were cultured in Eagle's minimum essential medium (EMEM) supplemented with 10% fetal bovine serum (FBS).

[0189] Transgenic human SNCA mice and recovery of neurons C57BL / 6Tac mice (Taconic) were genetically engineered to introduce the entire wild-type human SNCA gene, starting from its 5'UTR (SEQ ID NO: 1), into the mouse genome under the control of the mouse SNCA promoter, in place of the mouse SNCA gene. C57BL / 6Tac mice (Taconic) were genetically engineered to introduce the entire human SNCA gene, starting from its 5'UTR (SEQ ID NO: 1), mutated at A53T position, into the mouse genome under the control of the mouse SNCA promoter, in place of the mouse SNCA gene. Primary cortical neurons were collected from embryos removed from pregnant homozygous human SNCA knock-in mice at embryonic day 17.5. The cortical tissue of each embryo was dissected on ice-cold Hank's balanced salt solution. The pooled tissue was minced and digested with papain for 12 minutes at 37°C. Digestion was then stopped by the addition of 10% FBS / DMEM. Cells were triturated and resuspended in Neurobasal™ Plus medium supplemented with GlutaMAX™, 2% penicillin / streptomycin, and B-27™ Plus supplement. Cells were seeded on 384-well poly-L-lysine + boric acid coated plates at a density of 15,000 cells / well in 40 μL of Neurobasal™ medium (containing B-27™ supplement and GlutaMAX). Neurons were then incubated at 37° C. in a 5% CO2 atmosphere for 4 days.

[0190] Male Winstar rat Male Wistar rats weighed 200-225 g on arrival and were housed in groups of 2 animals per cage at room temperature with food and water available ad libitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide for the Care and Use of Laboratory Animals.

[0191] In vitro ASO screening in neurons For single dose screening, neurons were treated with 300 nM of a given ASO. For multiple dose screening, neurons were treated with serial dilutions of a given ASO starting at 3 μM (1 / 2 log dilution, total 11 concentrations). 7 days after treatment with ASO, the culture medium was replaced with fresh Neurobasal™ medium. 15 days after treatment, RNA was extracted from cells using TaqMan™ Fast Advanced Cells-to-CT Kit (ThermoFisher). Cells were then washed in PBS and lysed in solution for 5 minutes at room temperature with simultaneous DNase treatment. Lysis was terminated by treatment of the mixture with stop solution, followed by incubation for 2 minutes at room temperature. Reverse transcription was performed immediately after cell lysis using Fast Advanced RT Enzyme Mix (ThermoFisher). cDNA samples were then used for quantitative real-time PCR measurements using TaqMan™ genotyping assays. A specific probe and primers were used for SNCA mRNA quantification (Hs00240906_m1 SNCA; ThermoFisher). SNCA mRNA levels were adjusted to the measured level of the housekeeping gene PPIA (probe / primer PPIA_Mm02342430_g1; ThermoFisher).

[0192] In qPCR reactions, the quantification cycle value (Ct) is defined as the number of cycles required for the fluorescence signal to exceed background fluorescence. This threshold is set by the QuantStudio™ real-time PCR software program (Applied Biosystems, Foster City, CA) at 10 standard deviations above the mean baseline fluorescence. The comparative Ct method normalized the Ct value of the target gene to a housekeeping gene before comparison was made between samples. First, the difference (ΔCt) between the Ct values ​​of the target gene and the housekeeping gene was calculated for each sample, and then the difference in ΔCt (ΔΔCt) was calculated between two samples (e.g., control and treatment). The fold change in expression of two samples was calculated as 2-ΔΔCt. The percentage reduction was calculated by subtracting the value 1 from 2-ΔΔCt of the ASO group mean value of interest and multiplying by 100: reduction % (1-2-ΔΔCt ASO group mean value) x 100.

[0193] Mouse model The entire wild-type (WT) human SNCA gene (SEQ ID NO: 1) was introduced into the mouse genome in place of the mouse SNCA locus in C57BL / 6Tac mice (Taconic) as shown in Figure 1. Expression of human and mouse SNCA proteins in different brain regions and peripheral organs was analyzed by mass spectrometry (Figures 2A-2C). Three- to four-month-old homozygous male mice expressing the WT human SNCA gene ("hSNCA") were cultured in vitro and cultured in vivo. + / + The mice (hereafter referred to as "KI mice" or "hSNCA mice") were housed in groups of up to three per cage at room temperature and allowed free access to food and water. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide for the Care and Use of Laboratory Animals.

[0194] hSNCA A53T neurons The entire human A53T SNCA gene was introduced into the mouse genome in place of the mouse SNCA locus in C57BL / 6Tac mice (Taconic) as depicted in Figure 1. Homozygous female mice expressing the human A53TSNCA gene (hA53TSNCA + / + The mice (referred to as KI) were housed in isolation, one per cage, at room temperature with free access to food and water. All procedures were approved by the Institut de Recherches SERVIER ethical committee, in accordance with the principles of the Guide for the Care and Use of Laboratory Animals.

[0195] Intracerebroventricular (ICV) injection Dosing solutions were prepared using sterile saline syringes and nuclease-free centrifuge tubes. The tubes containing the ASO powder were briefly centrifuged before adding the saline, then recentrifuged for 10 minutes to completely dissolve the ASO powder. The solutions were vortexed for approximately 1 minute and stored at 4°C until use.

[0196] hSNCA mice received a single unilateral bolus injection of oligonucleotide at a dose of 30 nmol. Mice were anesthetized with isoflurane at a concentration of 4.5-5% and maintained at 1.5-2% isoflurane during surgery. Buprenorphine at a dose of 0.04 mg / kg was administered subcutaneously at least 30 min prior to injection for pain management. The scalp of the mouse was shaved and after loss of pedal reflex, the mouse was placed in a stereotaxic frame (David Kopf Instruments, CA). The scalp was sterilized using three alternating wipes of betadine and 70% ethanol. An incision was made in the scalp to expose the skull surface and clearly identify the bregma. A hole was drilled in the skull at 0.5 mm AP, 1.1 mm ML relative to the bregma. ASO was injected through a cannula (31 g) connected to a microsyringe pump controller. Dorsal-ventral DV coordinates were measured 1 mm below the skull surface. Once the cannula was positioned, the ASO solution was administered in 5 μL of saline vehicle for 30 seconds. The cannula was left in place for an additional 3 minutes after injection to allow diffusion of the solution in the brain. After slow removal of the cannula, the scalp was sutured and the mice were injected subcutaneously with 1 mL of warm sterile saline to aid in hydration and placed in their warm home cages. Mice in the control group were similarly administered saline control. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerance was scored 1 hour after administration. Animals administered with non-tolerated compounds (tolerance score >8) were euthanized immediately after the 1 hour evaluation.

[0197] The antisense oligonucleotides were synthesized using the hSNCA + / +The ASOs were tested in KI (knock-in) mice to evaluate their tolerability profile. ASO SNCA_00033, previously described in PCT patent publication WO 2012 / 068405, was also tested as a control drug. In all cases, ASO SNCA_00033 has a 5-10-5 MOE gapmer pattern in which all internucleoside linkages are phosphorothioate internucleoside linkages and all cytosine residues are 5-methylcytosine.

[0198] Intrathecal (IT) injection Male Wistar rats received a single intrathecal bolus injection of oligonucleotides at a dose of 2.5 mg. Rats were anesthetized with 4% isoflurane and maintained with 2-2.5% isoflurane during surgery. For pain management, carprofen 5 mg / kg and buprenorphine 0.05 mg / kg were administered subcutaneously at least 20 min prior to injection. Rats were shaved and after loss of pedal reflex, an incision was made between lumbar vertebrae 5 and 6. The muscles surrounding this area were dissected to allow access of the spinal canal to insert the catheter used for ASO injection. Once the catheter was positioned, ASO solution was administered in 30 μL of artificial CSF over approximately 30 seconds. The catheter was left in place and sealed to avoid diffusion of CSF fluids. The muscles and skin were sutured and the rats were injected subcutaneously with 1 mL of warm sterile saline to aid hydration and placed in their warm home cages. A control group of mice was similarly administered artificial CSF. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerability was scored 1, 3, and 24 hours after administration. Animals administered non-tolerable compounds (tolerance score >8) were euthanized immediately after the 1-hour evaluation.

[0199] ASO Acute Tolerability Assessment At 1 and 3 hours after injection, adverse effects were monitored and scored in administered mice according to the criteria shown in Figure 3. At 1, 3, and 24 hours after injection, adverse effects were monitored and scored in administered rats according to the criteria shown in Figure 10. Normal tolerability score is 0, and high toxicity score is equivalent to 16. Final tolerability score was calculated based on the sum of all criteria. For some oligonucleotides, intolerable acute toxicity was observed without reaching the first observation time point. In these cases, the ASO was scored with an acute toxicity score of 14, and the mouse was immediately euthanized. If a score higher than 6 was measured at the 1 hour time point, the mouse was monitored more closely over the course of the experiment.

[0200] Long-term tolerability evaluation of ASO Mice were weighed on the day of injection and three times weekly until completion of the experiment. All mice that exhibited unacceptable health conditions, behavioral observations, or weight loss greater than 20% of their initial body weight were immediately euthanized.

[0201] Tissue sampling All mice were euthanized by an overdose of anesthetic. Animals were transcardially perfused with 0.9% saline into the left ventricle. The thoracic aorta between the lungs and liver was clamped with a hemostat to block blood flow from the heart to the abdomen, but allow blood to flow to the brain. The right ventricle was cut open with scissors. A constant pressure of 100-120 mmHg was maintained with the perfusion solution by connecting the solution bottle to a manometer-controlled air compressor. Perfusion was continued until the skull surface turned pale and the perfusion solution exited the right ventricle. Following perfusion, brain tissue (cortex) and peripheral tissues (kidney and liver) were collected. Samples were cut into small pieces, mixed and dispensed into three equal portions. All samples were frozen in liquid nitrogen and stored at -80°C until use for the measurement of RNA, protein, and ASO. For some studies, blood and cerebrospinal fluid (CSF) were also collected.

[0202] mRNA measurement by qRT-PCR RNA extraction and mRNA quantification by qPCR were performed. From right cortical biopsies, RNA was extracted using the RNeasy Mini Kit (Qiagen) with DNase treatment. Total RNA samples were quantified using a Nanodrop™ spectrophotometer and analyzed using a TapeStation to determine the quality of the RNA (RIN). For qPCR quantification experiments, RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™). Reactions were performed in a final reaction volume of 100 μL starting with 1000 ng of total RNA (to a final RNA concentration of 10 ng / μL). Quantification of the human SNCA gene and mouse PPIA housekeeping gene was performed from 40 ng of total cDNA using QuantStudio 7 Flex (Applied Biosystems™), TaqMan™ Universal PCR Master Mix (Applied Biosystems™, Ref. 4324020), and TaqMan™ Gene Expression Assay Duplex (Hs00240906_m1 in FAM fluorescent dye and Mm02342430_g1 in VIC fluorescent dye). qPCR analysis was performed in triplicate using fast running mode. Ct values ​​of each qPCR plate were analyzed using Excel software. Technical replicates (n=3) were combined and averaged to a geometric mean. Relative expression was generated for each ASO group using mouse control PBS condition.

[0203] hSNCA protein expression by mass spectrometry Mouse brain tissue was homogenized with Pecelys® (2×20s, 5000tr) in 150 mg / mL lysis buffer (PBS, Sigma protease and phosphatase inhibitor cocktail, 1% deoxycholate). Brain homogenates were then centrifuged (27000 g, 4° C., 20 min) and the supernatant was collected. Brain samples were diluted in denaturing buffer (ammonium bicarbonate 50 mM, deoxycholate 1%) and then heated at 95° C. for 5 min. Trypsin (10 μg) was then added into each sample. Trypsin digestion was carried out in an ultrasonic bath (Branson 1200) for 1 min, followed by incubation at 52° C. for 30 min. The reaction was stopped by the addition of 1 μL TCEP (0.5 M) and 1 μL 100% formic acid, followed by incubation at 95° C. for 5 min. The samples were then centrifuged at 30,000 g for 15 min. The peptide digests were analyzed by reversed-phase liquid chromatography tandem mass spectrometry (LC-MS / MS) using a Shimadzu LC system (Shimadzu) online coupled to a triple quadrupole mass spectrometer (Shimadzu 8060) operated in MRM mode. The specific peptides used to measure the abundance of alpha-synuclein protein were TVEGAGSIAAATGFVK (SEQ ID NO: 46) and TVEGAGNIAAATGFVK (SEQ ID NO: 47). The specific peptide used to measure the abundance of GAPDH protein was VGVNGFGR (SEQ ID NO: 48). A single 10 μL injection of each brain sample digest was injected onto a Waters™ XBridge Peptide BEH C18 column (130A; 3.5 μM; 150 mm×2.1 mm). Peptides were eluted using a linear gradient (2-40%) of acetonitrile in 0.1% formic acid over 30 min. Chromatograms were analyzed using Shimadzu LabSolutions software. The signal intensities obtained for each peptide were normalized by the GAPDH signal obtained in each sample and are expressed in arbitrary units (AU).

[0204] Expression of hSNCA or alpha-synuclein protein by ELISA. Mouse brain tissue was homogenized with Pecelys® (2×20s, 5000tr) in 150 mg / mL lysis buffer (PBS, Sigma protease and phosphatase inhibitor cocktail, 1% deoxycholate). The brain homogenate was then centrifuged (27000 g, 4° C., 20 min) and the supernatant was collected. Quantification of α-synuclein in brain lysates was performed by using the U-PLEX Human α-synuclein Kit (K151WKK) according to the manufacturer's instructions. Quantification of total α-synuclein in brain lysates was performed using an ELISA commercial kit from MSD®, the U-PLEX Human α-synuclein Kit (K151WKK). The provided plates were pre-coated with a capture antibody for α-synuclein. The sample (brain lysate) was added to a solution containing a detection antibody (anti-α-synuclein) conjugated to an electroluminescent compound label (MSD SULFO-TAG). The analyte in the sample bound to the capture antibody immobilized on the working electrode surface. Recruitment of the conjugated detection antibody by the bound analyte completed the sandwich. MSD® Read Buffer was added to provide a suitable chemical environment for electroluminescence, and the plate was loaded into an MSD SECTOR® Imager for analysis. Inside the SECTOR Imager, a voltage applied to the plate electrode causes the probes bound to the electrode surface to emit light. The instrument measured the intensity of the emitted light, providing a quantitative measurement of the α-synuclein present in the sample.

[0205] High Performance Liquid Chromatography (HPLC)Fluorescence Samples were analyzed against a set of calibration standards prepared in water. No matrix effects were observed, so quantification of all samples (plasma, CSF, and tissue) was performed using a set of water standards. Frozen tissues were weighed and ground in Masterpure™ / Proteinase K 97 / 3 (V / V) buffer using a Precellys device at 6500 rpm for 2 x 30 seconds. Plasma samples (5 μL) were diluted in Masterpure™ / Proteinase K 97 / 3 (70 μL). Plasma and tissue homogenates were incubated at 55°C for 30 minutes under gentle agitation. Then, 10 μL of KCl 3M solution was added into 50 μL of tissue homogenate or plasma dilution, vortexed quickly, and sonicated for 5 minutes. Tubes were centrifuged for 10 minutes (20000 g) at +4°C. CSF samples (10 μL) were diluted in hybridization buffer (Tris HCl 50 mM pH 8.5 / ACN 90 / 10) (45 μL) and proteinase K (1 μL) and incubated at 55° C. for 15 min. Prior to analysis, a hybridization step was performed with a fluorescently labeled peptide nucleic acid oligomer complementary to the quantified oligonucleotide. For calibration standards and tissue homogenates, 40 μL of hybridization buffer was mixed with 10 μL of fluorescent complementation probe and 10 μL of supernatant of calibration standards, quality control samples and test samples. For plasma samples, 30 μL of hybridization buffer was mixed with 10 μL of fluorescent complementation probe and 60 μL of supernatant of quality control samples and test samples. For CSF analysis, 10 μL of fluorescent complementation probe was added directly to the previous dilution. This mixture was first incubated at 95° C. for 15 min and then at 55° C. for 15 min. Finally, the samples were centrifuged (20000g) for 5 min at 4°C. The samples were analyzed under a RP-HPLC system with fluorescence detection. The injection volume was 50 μL, excluding plasma (90 μL). The amount of fluorescence due to hybridized oligonucleotides to the fluorescent probe was measured and compared with a calibration curve. The oligonucleotide concentration in the samples was calculated taking into account the different dilutions used during sample preparation.

[0206] Example 1: In vitro mRNA reduction following a single dose of ASO Modified oligonucleotides complementary to the human SNCA nucleotide sequence were designed and tested in cultured Sk-Mel-2 cells for their selective effectiveness in reducing SNCA mRNA levels. Cultured Sk-Mel-2 cells at a density of 15,000 cells per well were transfected using Lipofectamine 2000 (Invitrogen) with modified antisense oligonucleotides (ASOs) at 20 nM or 2 nM concentrations. After 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by branched DNA assay (QuantiGene Singleplex Assay Kit, ThermoFisher). This method relies on the signal amplification of branched DNA (bDNA) probes that bind to specific nucleotide sequences. The probe sets used were XM_005555421 (reactive to canine and human SNCA) and NM_002046 (reactive to human GapDH), which were designed by Affymetrix Inc. / ThermoScientific and synthesized by Metabion International. SNCA-RLU was normalized to the GapDH relative light units (RLU) of each well. Values ​​were normalized to wells treated with a nonspecific (Ahsa1) ASO.

[0207] The modified oligonucleotides tested in the above experiments are shown in Table C below. Each modified oligonucleotide listed in Table C is complementary to the human SNCA nucleic acid sequence (SEQ ID NO:1) and is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases long, where the central gap segment contains 10 2'-deoxynucleosides and each of the wing segments contains five 2'MOE nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0208] The positions identified in Table C correspond to the "start site", ie, the 5' nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO:1). [Table 3] TIFF2024508956000043.tif246165 TIFF2024508956000044.tif209165

[0209] Each modified oligonucleotide listed in Table D is complementary to the human SNCA nucleic acid sequence (SEQ ID NO:1) and is a 4-10-4 MOE gapmer. The gapmer is 18 nucleobases long, in which the central gap segment contains 10 2'-deoxynucleosides and the wing segments at both the 5' and 3' ends contain four 2'-MOE nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0210] The positions specified in Table D correspond to the "start site," ie, the 5' nucleoside to which the gapmer is complementary in the human SNCA nucleic acid sequence (SEQ ID NO:1). [Table 4] TIFF2024508956000046.tif219165

[0211] Each modified oligonucleotide listed in Table E is complementary to the human SNCA nucleic acid sequence (SEQ ID NO:1) and is a 3-10-3 LNA gapmer. The gapmer is 16 nucleobases long, where the central gap segment contains 10 2'-deoxynucleosides and each wing segment at the 5' and 3' ends contains three LNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0212] The positions identified in Table E correspond to the "start site," ie, the 5' nucleoside to which the gapmer is complementary in the modified human nucleic acid sequence (SEQ ID NO:1). [Table 5] TIFF2024508956000048.tif173165

[0213] The modified oligonucleotides listed in Table F are complementary to the human SNCA nucleic acid sequence (SEQ ID NO:1) and are 3-11-3 LNA gapmers. The gapmers are 17 nucleobases long, in which a central gap segment contains 11 2'-deoxynucleosides and is flanked by wing segments containing three LNA nucleosides at both the 5' and 3' ends. All cytosine residues throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0214] The positions specified in Table F correspond to the "start site", ie, the 5' nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO:1). [Table 6] TIFF2024508956000050.tif229165

[0215] Example 2: In vitro mRNA reduction following a single dose of MOE-modified ASO Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were designed and tested in vitro in primary cortical neurons for their selective effectiveness in reducing SNCA mRNA levels. Neurons were treated with 300 nM of each antisense oligonucleotide. mRNA levels were quantified using qRT-PCR (TaqMan™) with the following probes: TGGCAACAGTGGCTGAGAAGACCAA (SEQ ID NO: 248) with primer Hs00240906_m1 SNCA (ThermoFisher), and CCAAGACTGAATGGCTGGATGGCAA (SEQ ID NO: 249) (Control) with primer PPIA_Mm02342430_g1 (ThermoFisher)

[0216] Each modified oligonucleotide listed in Tables G and H is complementary to the human SNCA DNA (SEQ ID NO:1) or mRNA (SEQ ID NO:3) sequence. The sequences in Table G are complementary to an exon of the mRNA sequence, while the sequences in Table H are complementary to an intron of the mRNA sequence. Each ASO is a 5-10-5 MOE gapmer that is 20 nucleobases long, where the central gap segment contains 10 2'-deoxynucleosides and the wing segments at both the 5' and 3' ends contain five 2'-MOE nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0217] The positions identified in Tables G and H correspond to the "start site", i.e., the 5' nucleoside to which the gapmer is complementary in the modified human nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 3. "#N / A" means that the sequence does not align with SEQ ID NO: 1 (e.g., if the sequence spans an exon-exon junction that is only present in the mature mRNA). [Table 7] TIFF2024508956000052.tif246165 TIFF2024508956000053.tif246165 TIFF2024508956000054.tif247165 TIFF2024508956000055.tif246165 TIFF2024508956000056.tif246165 TIFF2024508956000057.tif246165 TIFF2024508956000058.tif245165 TIFF2024508956000059.tif246165 TIFF2024508956000060.tif247165 TIFF2024508956000061.tif55165

Table 8

[0218] Example 3: In vitro mRNA reduction following multiple doses of MOE-modified ASO Modified oligonucleotides complementary to human SNCA nucleic acid sequences were tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with multiple doses (3 μM; 1 / 2 log dilution; 11 concentrations) of a given antisense oligonucleotide. This assay provided the in vitro cellular potency (pIC50 = -Log(IC50)) and efficacy (Delta Inhib Obs(%)) of a given ASO in neurons. Also, the Hill coefficient, which is the slope of the line in the Hill plot, was measured to observe the shape of the dose-response curve for each ASO.

[0219] Each modified oligonucleotide listed in Tables I, J, and K is complementary to the human SNCA nucleic acid sequence SEQ ID NO: 1 and / or SEQ ID NO: 3. The ASOs in Table J are designed to be complementary to introns in the SNCA mRNA sequence, whereas the ASOs in Tables I and K are designed to be complementary to exons in the SNCA mRNA sequence.

[0220] Each of the ASOs in Tables I, J, and K is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases long in which the central gap segment contains 10 2'-deoxynucleosides and the flanking wing segments each contain five 2'-MOE nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0221] SNCA_ASO_01617 in Table J is a 5-10-5 MOE gapmer. The gapmer is 20 nucleobases long in which a central gap segment contains 10 2' deoxynucleosides and is flanked by wing segments containing five 2'-MOE nucleosides at both the 5' and 3' ends. All cytosine residues throughout each gapmer are 5-methylcytosines. All internucleoside linkages are phosphorothioate linkages except between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.

[0222] Each of the ASOs in Table L is a 3-2-10-2-3 LNA / MOE mixed gapmer. The gapmers are 20 nucleobases long, in which the central gap segment contains 10 2'-deoxynucleosides and each wing segment contains 3 LNA nucleosides and 2 2'-MOE nucleosides. The ASO thus contains, from 5' to 3', 3 LNA nucleosides, 2 2'-MOE nucleosides, 10 2'-deoxynucleosides, 2 2'-MOE nucleosides, and 3 LNA nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosines, and all internucleoside linkages are phosphorothioate (PS) linkages, except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages.

[0223] Each ASO listed in Table M is a 2-3-10-3-2 BNA / MOE gapmer. The gapmers are 20 nucleobases long, in which the central gap segment contains 10 2'-deoxynucleosides and each wing segment contains two BNA nucleosides and three 2'-MOE nucleosides. Each ASO thus contains, from 5' to 3', two BNA nucleosides, three 2'-MOE nucleosides, ten 2'-deoxynucleosides, three 2'-MOE nucleosides, and two BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines, and all internucleoside linkages are phosphorothioate linkages, except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester (PO) linkages.

[0224] The positions identified in Tables I, J, K, L, and M correspond to the "start site," i.e., the 5' nucleoside to which the gapmer is complementary in the human SNCA nucleic acid sequence SEQ ID NO:1 and / or SEQ ID NO:3. [Table 9] TIFF2024508956000095.tif227169 [Table 10] TIFF2024508956000097.tif243169 TIFF2024508956000098.tif243169 TIFF2024508956000099.tif243169 TIFF2024508956000100.tif36169 [Table 11] TIFF2024508956000102.tif22165 [Table 12] [Table 13]

[0225] Example 4: Tolerance and efficacy of modified oligonucleotides complementary to human SNCA in hSNCA mice Three-month-old hSNCA mice received a single bolus ICV injection at a dose of 30 nmol of the modified oligonucleotides listed in the table shown. Each modified oligonucleotide is complementary to the human SNCA genomic nucleic acid sequence (SEQ ID NO: 1). The position in the table indicates the 5' nucleoside to which the oligonucleotide is complementary in the human nucleic acid sequence (SEQ ID NO: 1).

[0226] For tolerability studies, tolerability scores are expressed as Functional Observation Board (FOB) scores at 1 hour post-injection.

[0227] For efficacy studies, most treatment groups consisted of 3 animals. Mice were sacrificed 2 or 6 weeks after injection, as indicated. Brain tissue was collected and hSNCA mRNA levels were measured as described above. Results are presented in the table as the percent reduction in SNCA mRNA levels compared to the vehicle control group. A value of 0% reduction indicates that the compound had no effect.

[0228] I. Tolerability of 5-10-5MOE Gapmer (PS) Each ASO in Table N is a 5-10-5 MOE gapmer, as described above, where all cytosine residues throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate (PS) linkages. Figure 4 is a bar graph comparing the tolerability of selected 5-10-5 MOE gapmers. Compounds with an FOB greater than 10 were excluded from further assays. The structure of SNCA_ASO_01617 is as described above. [Table 14] TIFF2024508956000106.tif243165 TIFF2024508956000107.tif246165 TIFF2024508956000108.tif87165

[0229] II. Efficacy of 5-10-5MOE Gapmer (PS) Each ASO listed in Table O is a 5-10-5 MOE gapmer as described above, where all cytosine residues throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages. Figure 4 is a bar graph comparing the efficacy of selected 5-10-5 MOE gapmers. The structure of SNCA_ASO_01617 is as described above.

[0230] As shown below, several of the ASOs reduced the amount of human SNCA mRNA in mice two weeks after injection. [Table 15] TIFF2024508956000110.tif73169

[0231] III. Tolerability of 3-2-10-2-3 LNA / MOE mixed gapmer (PS) Each ASO listed in Table P is a 3-2-10-2-3 LNA / MOE mixed gapmer, except for SNCA_ASO_00033, which is a 5-10-5 MOE gapmer described above, used as a control. The LNA / MOE mixed gapmers are 20 nucleobases long, in which the central gap segment contains 10 2'-deoxynucleosides and each wing segment contains 3 LNA nucleosides and 2 2'-MOE nucleosides. The ASO thus contains, from 5' to 3', 3 LNA nucleosides, 2 2'-MOE nucleosides, 10 2'-deoxynucleosides, 2 2'-MOE nucleosides, and 3 LNA nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.

[0232] Further experiments to determine the level of mRNA reduction were not performed for compounds 00937, 00938, 00941, and 00942 because they did not show promising FOB results. Mice treated with these compounds were sacrificed. [Table 16]

[0233] IV. Tolerability of 3-2-10-2-3 LNA / MOE gapmer (PS / PO) Each ASO listed in Table Q (apart from the control SNCA_ASO_00033) is a 3-2-10-2-3 LNA / MOE mixed gapmer. Figure 5 is a bar graph comparing the tolerability of selected 3-2-10-2-3 LNA / MOE mixed gapmers. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages. [Table 17]

[0234] Tolerability of V.3-2-10-2-3 LNA / MOE gapmer (PS / PO) Each ASO listed in Table R is a 3-2-10-2-3 LNA / MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine. All internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages. [Table 18]

[0235] VI. Tolerability of 3-2-10-2-3 LNA / MOE gapmer (PS / PO) Each ASO listed in Table S is a 3-2-10-2-3 LNA / MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages. [Table 19]

[0236] VII. Efficacy of 3-2-10-2-3 LNA / MOE gapmer (PS / PO) Each ASO listed in Table T (apart from the control SNCA_ASO_00033) is a 3-2-10-2-3 LNA / MOE mixed gapmer. Figure 5 is a bar graph comparing the efficacy of selected 3-2-10-2-3 LNA / MOE mixed gapmers. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester linkages.

[0237] As shown below, several of the ASOs reduced the amount of human SNCA mRNA in mice two weeks after injection. [Table 20]

[0238] VIII. Efficacy of 3-2-10-2-3 LNA / MOE gapmer (PS / PO) Each ASO in Table U is a 3-2-10-2-3 LNA / MOE gapmer. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, except for the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages.

[0239] As shown below, the ASO reduced the amount of human SNCA mRNA in mice two weeks after injection. [Table 21]

[0240] IX. Efficacy of 3-2-10-2-3LNA / MOE gapmer (PS / PO) Each ASO in Table V is a 3-2-10-2-3 LNA / MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages, except for the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.

[0241] As shown below, the ASO reduced the amount of human SNCA mRNA in mice two weeks after injection. [Table 22]

[0242] Tolerability of X.2-3-10-3-2BNA / MOE gapmer (PS / PO) Each ASO listed in Table W (apart from the control drug SNCA_ASO_00033) is a 2-3-10-3-2 BNA / MOE gapmer. Figure 6 is a bar graph comparing the tolerability of selected 2-3-10-3-2 BNA / MOE gapmers. The gapmers are 20 nucleobases long, where the central gap segment contains 10 2'-deoxynucleosides and each wing segment contains two BNA nucleosides and three 2'-MOE nucleosides. Each ASO thus contains, from 5' to 3', two BNA nucleosides, three 2'-MOE nucleosides, ten 2'-deoxynucleosides, three 2'-MOE nucleosides, and two BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages. [Table 23]

[0243] XI. Efficacy of 3-2-10-2-3BNA / MOE gapmer (PS / PO) Each ASO listed in Table X (apart from the control SNCA_ASO_00033) is a 3-2-10-2-3 BNA / MOE gapmer. Figure 6 is a bar graph comparing the efficacy of selected 2-3-10-3-2 BNA / MOE gapmers. The gapmers are 20 nucleobases long, where the central gap segment contains 10 2'-deoxynucleosides and each wing segment contains 3 BNA nucleosides and 2 2'-MOE nucleosides. Each ASO thus contains, from 5' to 3', 3 BNA nucleosides, 2 2'-MOE nucleosides, 10 2'-deoxynucleosides, 2 2'-MOE nucleosides, and 3 BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.

[0244] As shown below, the ASO significantly reduced the amount of human SNCA mRNA in mice as rapidly as two weeks after injection. [Table 24]

[0245] Example 5: Tolerability, efficacy, and biodistribution of multiple doses of modified oligonucleotides complementary to human SNCA in hSNCA mice Three-month-old hSNCA mice received a single bolus ICV injection of the modified oligonucleotides listed at the doses listed in the table shown. The hSNCA mice were divided into groups of six mice. The groups of six mice received PBS as a negative control for each experiment. For the tolerability test, the tolerability score is expressed as the Functional Observational Outcome (FOB) score at 1 hour after injection.

[0246] For efficacy testing, mice were sacrificed 4 weeks after injection, except for the numbers followed by an asterisk, where the analysis is 2 weeks after injection. Cortical brain tissue was collected, and the level of hSNCA mRNA was measured as described above, and the level of alpha-synuclein protein was measured by ELISA kit as described above. The results are presented in the table as the percentage reduction in the amount of SNCA mRNA and alpha-synuclein protein compared to the solvent (PBS) control group. A value of 0% reduction indicates that the compound had no effect.

[0247] For biodistribution studies, the concentration of SNCA_ASO in the cortex of hSNCA mice will be quantified by high performance liquid chromatography (HPLC) fluorescence. I. Tolerability and efficacy of multiple doses of 2-3-10-3-2 BNA / MOE, 3-2-10-2-3 LNA / MOE, and 5-10-5 MOE gapmer (PS / PO).

[0248] SNCA_ASO_01613 in Table Y is a 2-3-10-3-2 BNA / MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine. SNCA_ASO_01625 in Table Z is a 3-2-10-2-3 LNA / MOE gapmer as described above, where the internucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages, the remaining internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine. SNCA_ASO_01617 in Table AA (SEQ ID NO: 1264) is a 5-10-5 MOE gapmer, where a central gap segment comprises ten 2' deoxynucleosides and is flanked by wing segments comprising five 2' MOE nucleosides at both the 5' and 3' ends. In SNCA_ASO_01617, all cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages except between positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.

[0249] Figure 7 is a bar graph comparing the efficacy of SNCA_ASO_1613, SNCA_ASO_1617, and SNCA_ASO_1625 based on SNCA mRNA expression at different doses of 1, 5, 10, 30, or 100 nmol. Figure 8 is a bar graph comparing the efficacy of SNCA_ASO_1613, SNCA_ASO_1617, and SNCA_ASO_1625 based on alpha-synuclein protein expression at different doses of 1, 5, 10, 30, or 100 nmol. The reduction in mRNA and protein levels was analyzed 2 weeks after injection. [Table 25] [Table 26] [Table 27]

[0250] II. Dose effect of AS concentration in the cortex by ELISA analysis In Table AB, SNCA_ASO_01613 is a 2-3-10-3-2 BNA / MOE gapmer as described above, where the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine; SNCA_ASO_01625 is a 3-2-10-2-3 LNA / MOE gapmer as described above. SNCA_ASO_01617 is a 5-10-5 MOE gapmer where the internucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages and the other internucleoside linkages are phosphorothioate internucleoside linkages and each cytosine is a 5-methylcytosine; SNCA_ASO_01617 is a 5-10-5 MOE gapmer where all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosines, as described above.

[0251] FIG. 9 is a dot graph depicting the amount of ASO quantified per mg of cortex by HPLC fluorescence following a single ICV injection of multiple doses. [Table 28]

[0252] Example 6: Tolerance of modified oligonucleotides in rats Male Winstar rats received a single intrathecal bolus injection of oligonucleotide at a dose of 2.5 mg. A sterile saline syringe and a nuclease-free centrifuge tube were used to prepare the dosing solution. The tube containing the ASO powder was centrifuged briefly before adding the aCSF solution, and then recentrifuged for 10 minutes to completely dissolve the ASO powder. The solution was vortexed for approximately 1 minute, stored at 4°C, and filtered through a 0.22 μM filter until use.

[0253] For tolerability studies, tolerability scores are expressed as Functional Observation Global (FOB) scores at 1, 3, and 24 hours post-injection.

[0254] In Table AC, the tolerability profiles of SNCA_ASO_01617 and SNCA_ASO_01613 are compared as a function of time in rats at a dose of 2.5 mg. [Table 29]

[0255] Example 7: Duration of action for multiple doses of modified oligonucleotides in hSNCA mice Three-month-old hSNCA mice were divided into groups of 5-6 mice each and received a single unilateral bolus injection of oligonucleotides SNCA_ASO_1613 or SNCA_ASO_1617 at two doses of 10 and 50 nmol as described in Tables A-D below. Groups of 3 mice received PBS as a negative control for each experiment.

[0256] For efficacy testing, mice were sacrificed at different time points (2, 6, 12, 20 weeks) after injection. The brain tissues of cortex, cerebellum and striatum were collected, and the level of hSNCA mRNA was measured by qRT-PCR as described above, and the level of alpha synuclein protein was measured by ELISA kit as described above. The results are presented in the table as the percentage reduction of the amount of SNCA mRNA and alpha synuclein protein compared to the vehicle (PBS) control group. A value of 0% reduction indicates that the compound had no effect.

[0257] FIG. 11 is a dot graph comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR, as described above.

[0258] FIG. 12 is a dot graph comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR, as described above.

[0259] FIG. 13 is a dot graph comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR, as described above. [Table 30]

[0260] Example 8: Reduction of alpha-synuclein pathology in vitro At DIV0, primary neuronal cultures (35,000 cells per well) from hSNCA A53T mice as described above were cultured and then transfected with 200 nM human alpha-synuclein preformed fibrils (PFF, StressMarq Bioscience SPR-316) 7 days after primary neuronal culture and treated with 6, 20, 60, 200, or 170 nM SNCA_ASO_01613 or SNCA_ASO_01617 4 days (DIV4), 7 days (DIV7), or 10 days (DIV10) after primary neuronal culture as illustrated in diagram Figure 14. A control with a non-specific (Malat1) ASO was used. At 19 days after primary neuronal culture (DIV19), cells were lysed and alpha-synuclein pathology was analyzed by measuring the levels of the phosphorylated form of alpha-synuclein (pS129) using a commercial immunoassay kit (Cisbio, #6FSYNPEG) according to the manufacturer's instructions. The assay is based on a sandwich assay using two different specific antibodies, one that binds to the pS129 motif of alpha-synuclein and the other that recognizes alpha-synuclein protein labeled with a donor or acceptor dye. Their specific binding and proximity on phosphorylated alpha-synuclein produces a FRET (fluorescence resonance energy transfer) signal that is proportional to the protein level.

[0261] Figure 15 is a bar graph showing the levels of alpha-synuclein pathology (phosphorylated form) in primary neuronal cultures as measured by a TR-FRET-based immunoassay. The levels of phosphorylated alpha-synuclein were normalized by the levels of alpha-tubulin, and values ​​were relative to wells treated with vehicle (PBS). Seeded neurons were treated on DIV7 with a high dose (330 nM) of specific ASO (SNCA) or nonspecific ASO (Malat1) as described in Table AE below. [Table 31]

[0262] Figure 16 is a bar graph depicting the levels of alpha-synuclein pathology (phosphorylated form) in primary neuronal cultures as measured by a TR-FRET-based immunoassay (mean ± SEM). The levels of phosphorylated alpha-synuclein were normalized by the levels of alpha-tubulin, and values ​​were relative to wells treated with vehicle (PBS). Dose-response effects were assessed in seeded neurons treated with specific ASOs on days 4, 7, or 10, as described in Table AF. [Table 32]

Claims

1. An oligonucleotide comprising a nucleotide sequence of 15 to 30 contiguous nucleotides, said nucleotide sequence being the nucleotide sequence of SEQ ID NO:

1. a) 16350-16450, b) 18926-19030, c) 22250-22471, d) 22933-23079, e) 23408-23700, f) 29753-29819, g) 38128-38158, h) 39852-39906, i) 53762 to 53799, or j) 59754-59865 an oligonucleotide complementary to a region of the same length found in, and optionally, said nucleotide sequence contains no more than three mismatches to said region.

2. The oligonucleotide of claim 1, wherein the nucleotide sequence is 16 to 20 contiguous nucleotides in length.

3. The oligonucleotide of claim 1 or 2, wherein the nucleotide sequence contains 0, 1, or 2 mismatches to said region.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is single-stranded.

5. The oligonucleotide according to any one of claims 1 to 4, wherein the nucleotide sequence is selected from SEQ ID NOs: 18 to 40.

6. The oligonucleotide of any one of claims 1 to 5, comprising one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.

7. The oligonucleotide of any one of claims 1 to 6, wherein the oligonucleotide comprises one or more modified nucleotides.

8. 8. The oligonucleotide of any one of claims 1 to 7, wherein the one or more modified nucleotides comprise 2'-O-methoxyethyl (2'-MOE) nucleotides, locked nucleic acid (LNA) nucleotides, bridged nucleic acid (BNA) nucleotides, or any combination thereof.

9. The oligonucleotide according to any one of claims 1 to 8, wherein all cytosines in the oligonucleotide are 5-methylcytosines.

10. 10. The oligonucleotide of any one of claims 1 to 9, comprising at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages.

11. 11. The oligonucleotide of any one of claims 1 to 10, wherein at least 1, 2, 3, 4, or 5, or all, internucleoside linkages are phosphorothioate internucleoside linkages.

12. The oligonucleotide of claim 1, wherein: i) 5-10-5 MOE gapmer; ii) 4-10-4 MOE gapmer; iii) 3-10-3 LNA gapmer; iv) 3-11-3 LNA gapmer; v) 3-2-10-2-3 LNA / MOE gapmer; vi) 2-3-10-3-2 BNA / MOE gapmer; vii) 3-2-10-2-3 BNA / MOE gapmer; or viii) 2-3-10-3-2 LNA / MOE gapmer The oligonucleotide according to any one of claims 7 to 11, comprising:

13. The oligonucleotide of claim 12, wherein: i) 3-2-10-2-3 LNA / MOE gapmer; ii) 2-3-10-3-2 BNA / MOE gapmer; iii) 3-2-10-2-3 BNA / MOE gapmer; or iv) 2-3-10-3-2 LNA / MOE gapmer; Including, Nucleosides: v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19; vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 13. The oligonucleotide of claim 12, wherein: between the internucleoside linkages are phosphodiester internucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages.

14. The formula: i) Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 34); ii) Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 20); iii) Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls Al (SEQ ID NO: 33); iv) Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (SEQ ID NO: 19); v) Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (SEQ ID NO: 18); vi) mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (SEQ ID NO: 21); vii) Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (SEQ ID NO: 22); viii) Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab (SEQ ID NO: 23); ix) mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (SEQ ID NO: 24), x) Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 25); xi) mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 26); xii) Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (SEQ ID NO: 27); xiii) Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (SEQ ID NO: 28), xiv) Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 29); xv) Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (SEQ ID NO: 30); xvi) Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (SEQ ID NO: 31); xvii) Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (SEQ ID NO: 32); xviii) mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls Tl (SEQ ID NO: 35); xix) Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (SEQ ID NO: 36); xx) Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds mCeo Aes Tlo Tls Al (SEQ ID NO: 37); xxi) mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls Al (SEQ ID NO: 38); xxii) Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls Tl (SEQ ID NO: 39); xxiii) mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 40); xxiv) Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (SEQ ID NO: 41); xxv) Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (SEQ ID NO: 42); xxvi) Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls Tl (SEQ ID NO: 43); xxvii) Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als Al (SEQ ID NO: 44); xxviii) Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als Al (SEQ ID NO: 45) An oligonucleotide comprising: Where: A is adenine, mC is 5-methylcytosine; G is guanine, T is thymine, e is a 2'-MOE modified ribose, d is 2'-deoxyribose, b is BNA, l is the LNA, o is a phosphodiester internucleoside linkage, and An oligonucleotide wherein s is a phosphorothioate internucleoside linkage.

15. Structural formula: 【Chemical Formula 39】 An oligonucleotide comprising:

16. Structural formula: 【Chemistry 40】 An oligonucleotide comprising:

17. Structural formula: 【Chemistry 41】 An oligonucleotide comprising:

18. Structural formula: 【Chemistry 42】 An oligonucleotide comprising:

19. An oligonucleotide complex comprising the oligonucleotide according to any one of claims 1 to 18.

20. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 18 or an oligonucleotide conjugate according to claim 19, and a pharma- ceutically acceptable excipient.

21. A method for reducing alpha-synuclein expression in a mammalian cell, comprising contacting the cell with an oligonucleotide described in any one of claims 1 to 18, an oligonucleotide complex described in claim 19, or a pharmaceutical composition described in claim 20, thereby reducing alpha-synuclein expression in the cell.

22. 22. The method of claim 21, wherein the cell is a cell in the central nervous system, optionally a cell in the human brain.

23. 21. A method for treating a synucleinopathic disease in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the oligonucleotide according to any one of claims 1 to 18, the oligonucleotide conjugate according to claim 19, or the pharmaceutical composition according to claim 20.

24. 24. The method of any one of claims 21 to 23, wherein the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in mouse primary cortical neurons engineered to express human alpha-synuclein.

25. 25. The method of claim 23 or 24, wherein the oligonucleotide is injected intrathecally or intracranially into the subject.

26. A method according to any one of claims 23 to 25, comprising the use of an oligonucleotide according to any one of claims 1 to 18 or an oligonucleotide conjugate according to claim 19 for the manufacture of a medicament in the treatment of a synucleinopathic disease in a subject in need thereof.

27. The method according to any one of claims 23 to 25, comprising the oligonucleotide according to any one of claims 1 to 18, the oligonucleotide conjugate according to claim 19, or the pharmaceutical composition according to claim 20 for use in the treatment of a synucleinopathic disease in a subject in need thereof.

28. 28. The method, use, oligonucleotide for use, oligonucleotide conjugate for use or pharmaceutical composition for use according to any one of claims 23 to 27, wherein the synucleinopathic disease is Parkinson's disease, dementia with Lewy bodies, Alzheimer's disease or multiple system atrophy.

Images