Methods and uses for determining the efficiency of a genetic editing procedure

Abstract

The present invention relates to a method and use for determining the efficiency of a genetic editing procedure, comprising the steps of: (i) providing a sample from a genetic editing procedure, wherein the sample comprises one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences, (ii) performing rolling circle amplification to generate RCA products from the one or more polynucleotide sequences in the sample, and (iii) determining the efficiency of the genetic editing procedure based on the presence of the RCA products generated in step (ii).

Description

[Technical field]

[0001] The present invention relates to methods and uses for determining the efficiency of a genetic editing procedure and / or for identifying the product of a genetic editing procedure. [Background technology]

[0002] The ability to perform targeted gene modification with high efficiency is a key step in drug discovery, personalized medicine, and agricultural productivity.

[0003] Gene editing has produced many breakthroughs because it allows precise genome engineering using specialized nucleases. Numerous gene editing tools have been developed, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the currently popular CRISPR / Cas9-based system (CRISPR, clustered regularly interspaced short palindromic repeats; Cas9, CRISPR-associated protein 9). Many of these tools and systems are now widely used and technically simple to implement.

[0004] However, despite their practical simplicity, the efficiency of such systems can be variable, resulting in a low percentage of correctly edited genetic products. For example, the efficiency of the CRISPR / Cas9 system depends on the design of the single guide RNA ("sgRNA") used. Therefore, to ensure maximum editing efficiency using CRISPR-based systems, the sgRNA used must be carefully screened and optimized.

[0005] One important step in the development of genome engineering is to pre-screen the efficiency and specificity of the system used.Accurate quantification and identification of targeted genetic editing events are therefore important for the development, characterization, and broader application of genetic editing technology.

[0006] A range of approaches have been developed to detect and quantify the outcomes of genetic editing procedures.

[0007] Current strategies for screening and validating editing efficiency are based on polymerase chain reaction ("PCR"), a multi-step method that requires specialized laboratory equipment to perform. PCR is used in Sanger and next-generation sequencing, which provide high resolution and accuracy, but also require complex and expensive sequencing equipment. Digital droplet PCR ("ddPCR") provides high accuracy, but its implementation is hindered by the cost of instrumentation and tedious optimization steps required to achieve optimal results before it can be used. PCR-based "T7 endonuclease I" or "Surveyor" screening approaches are technically simpler than sequencing and ddPCR, but suffer from lower accuracy. These methods are described in more detail below.

[0008] The most accurate, but also the most time-consuming (often taking days) and most expensive methods are sequencing-based, these mainly include Sanger sequencing and NGS. Sanger sequencing requires an input of a single clone, increasing the amount of work required for this type of method. New in silico methods such as "tracking of indels by decomposition" (TIDE) allow the analysis of mixed cell populations (Brinkman, EK; Chen, T.; Amendola, M.; Van Steensel, B. Easy Quantitative Assessment of Genome Editing by Sequence Trace Decomposition. Nucleic Acids Res. 2014, 42(22), e168).

[0009] Sanger sequencing combined with TIDE requires high-quality DNA and reads, otherwise errors easily occur. NGS can perform highly multiplexed deep sequencing to identify rare mutations in cell populations that are introduced by gene editing (Schmitt, MW; Kennedy, SR; Salk, JJ; Fox, EJ; Hiatt, JB; Loeb, LA Detection of Ultra-Rare Mutations by next-Generation Sequencing. Proc. Natl. Acad. Sci. USA 2012, 109(36), 14508-14513). Nevertheless, its main drawback is that the error rate, cost per run makes it uneconomical as a pre-screening tool for gene editing experiments.

[0010] The ddPCR method allows for more accurate measurement of the efficiency of gene editing events and uses fluorescent probes for quantification (see, for example, Miyaoka, Y.; Mayerl, SJ; Chan, AH; Conklin, BR Detection and Quantification of HDR and NHEJ Induced by Genome Editing at Endogenous Gene Loci Using Droplet Digital PCR. In Methods in Molecular Biology; Humana Press Inc., 2018; Vol. 1768, pp 349-362). A drawback of ddPCR is the need for specialized equipment to perform the digitization of target DNA into droplets, perform the droplet PCR reaction, and finally read the results on a droplet reader.

[0011] Denaturation-based methods are considered the most low-tech solution since they do not require any specialized instrumentation in terms of a standard molecular biology laboratory. However, the information content provided by these methods is very limited since it is based solely on the differences of the edited genome relative to the unedited genome (Germini, D.; Tsfasman, T.; Zakharova, VV; Sjakste, N.; Lipinski, M.; Vassetzky, YA Comparison of Techniques to Evaluate the Effectiveness of Genome Editing. Trends in Biotechnology. Elsevier Ltd February 1, 2018, pp 147-159). These differences are most often measured by band intensity after gel electrophoresis, such as in the "T7 Endonuclease I" or "Surveyor" assays (Vouillot, L.; Thelie, A.; Pollet, N. Comparison of T7E1 and Surveyor Mismatch Cleavage Assays to Detect Mutations Triggered by Engineered Nucleases. G3 Genes, Genomes, Genet. 2015, 5(3), 407-415.). Thus, these methods can only estimate the editing activity without giving any information on gene editing efficiency.

[0012] Figure 1 shows the differences in workflow between these methods. A more detailed comparison of the different available methods can be found in (Germini, D.; Tsfasman, T.; Zakharova, VV; Sjakste, N.; Lipinski, M.; Vassetzky, YA Comparison of Techniques to Evaluate the Effectiveness of Genome Editing. Trends in Biotechnology. Elsevier Ltd February 1, 2018, pp147-159). Summary of the Invention

[0013] Against this background, the present inventors have developed an improved approach for identifying the products of genetic editing procedures and determining the efficiency of such procedures, which is also useful for determining the specificity of genetic editing procedures.

[0014] Unlike prior art, our approach does not rely on PCR-based detection, and therefore avoids the multiple steps and expensive, specialized laboratory equipment required to perform PCR and subsequent steps, such as reading droplets in ddPCR or sending PCR amplicons to an external service for sequencing. As described below and in the accompanying examples, despite its simplicity, our technique is able to rapidly and accurately detect the products of genetic editing procedures and determine the efficiency of such procedures.

[0015] In a first aspect, the present invention provides a method for determining the efficiency of a genetic editing procedure, the method comprising: (i) providing a sample from a genetic editing procedure, the sample comprising one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences; (ii) performing rolling circle amplification to generate an RCA product from one or more polynucleotide sequences in the sample; and (iii) determining the efficiency of the genetic editing procedure based on the presence of the RCA product generated in step (ii).

[0016] Thus, unlike prior art approaches, our method uses rolling circle amplification ("RCA") as a tool to analyze the polynucleotide sequences produced by the genetic editing procedure. Specifically, following the genetic editing procedure, RCA is used to selectively generate RCA-Products (also referred to herein as "RCA products", "RCP" or "RCPs") from the correctly edited and unedited polynucleotide sequences produced. After RCA, the RCA products are present in a liquid sample, which undergoes further processing steps, and the RCA products can be analyzed either as a liquid sample or as a dried solid sample.

[0017] RCA is a well-known single molecule amplification method that allows digital quantification without compartmentalization. After labeling the RCA products with molecules of predetermined optical properties, such as fluorophores, the amplified molecules can be detected as single dots that can be individually quantified. Circular oligonucleotide templates for performing RCA can be designed and produced by several highly target-specific means, and these targets can be virtually any nucleotide sequence. The assay can be adjusted to detect edited and unedited variants from genomic material subjected to gene editing techniques (e.g., CRISPR / Cas9), thereby estimating their efficiency in a simple but accurate way.

[0018] RCA uses highly processive polymerases on circular DNA targets to generate long ssDNA (i.e., single-stranded DNA) concatemers ranging from hundreds of nanometers to micrometers (Baner, J.; Nilsson, M.; Mendel-Hartvig, M.; Landegren, U. Signal Amplification of Padlock Probes by Rolling Circle Replication. Nucleic Acids Res. 1998, 26(22), 5073-5078). RCA is often combined with "padlock probes" (PLPs), sequence-specific oligonucleotides that bind to the target strands in a circular manner and can then be covalently linked by a ligation step. The PLP-based RCA assay provides stringent stringency with single-base accuracy (Nilsson, M.; Malmgren, H.; Samiotaki, M.; Kwiatkowski, M.; Chowdhary, BP; Landegren, U. Padlock Probes: Circularizing Oligonucleotides for Localized DNA Detection. Science. 1994, 265(5181), 2085-2088). Similar to PLP, "selector" probes can be combined with RCA and the target is circularized prior to RCA (Johansson, H.; Isaksson, M.; Sorqvist, EF; Roos, F.; Stenberg, J.; Sjoblom, T.; Botling, J.; Micke, P.; Edlund, K.; Fredriksson, S.; Kultima, HG; Ericsson, O.; Nilsson, M. Targeted Resequencing of Candidate Genes Using Selector Probes. Nucleic Acids Res. 2011, 39(2), e8).

[0019] Yet another probing mechanism uses molecular inversion probes, which have been demonstrated in highly multiplexed assays for single nucleotide polymorphism detection as well as for genotyping (Antson, DO; Isaksson, A.; Landegren, U.; Nilsson, M. PCR-Generated Padlock Probes Detect Single Nucleotide Variation in Genomic DNA. Nucleic Acids Res. 2000, 28(12), e58, and Krishnakumar, S.; Zheng, J.; Wilhelmy, J.; Faham, M.; Mindrinos, M.; Davis, RA Comprehensive Assay for Targeted Multiplex Amplification of Human DNA Sequences. Proc. Natl. Acad. Sci. USA 2008, 105(27), 9296-9301). The most commonly used ligases to seal the nicks in the above probes are T4 DNA and Tth ligase for ligation on DNA, and T4 RNA and SplintR ligase for ligation on RNA.

[0020] For amplification, phi29 DNA polymerase is most frequent because it has a 3' to 5' proofreading endonuclease activity as well as very high processivity. RCA has been applied to cancer profiling (Huang, R.; He, L.; Li, S.; Liu, H.; Jin, L.; Chen, Z.; Zhao, Y.; Li, Z.; Deng, Y.; He, N. A. Simple Fluorescence Aptasensor for Gastric Cancer Exosome Detection Based on Branched Rolling Circle Amplification. Nanoscale 2020, 12(4), 2445-2451), and pathogen detection (Neumann, F.; Hernandez-Neuta, I.; Grabbe, M.; Madaboosi, N.; Albert, J.; Nilsson, M. Padlock Probe Assay for Detection and Subtyping of Seasonal Influenza. Clin. Chem. 2018, clinchem. 2018.292979) for potential use in clinical diagnostics.

[0021] However, so far, RCA / probe-based assays have not been used to screen for gene editing. Our approach is the first to do so, and provides high specificity and a simple approach to do so.

[0022] The presentation of currently available methods clearly highlights the need for new methods that offer the same or greater information content as ddPCR in a ready-to-use manner, while providing the ease and requirements of denaturation-based methods.

[0023] This is provided by the present invention, which utilizes RCA to enable accurate determination of gene editing efficiency. The present invention shortens the time and cost required for gene editing analysis from days to just a few hours. Furthermore, the generated RCPs can be used in enrichment methods and, if necessary, can be used in sequencing applications. The advantages of the RCA-based approach of the present invention include: since one DNA target corresponds to one RCP, it does not require digitalization; it is highly specific by using a probe that contains two binding arms; the probe backbone can be kept constant while the arms are target specific, allowing multiplexing reactions without the need to switch fluorescent probes; and unlike ddPCR and sequencing-based methods, it does not require any specialized instrumentation, since RCA can be performed on standard equipment and can be easily read out by fluorescent microscope.

[0024] Despite its well-known nature, RCA has never been used in the context of the method of the present invention. Instead, as is evident from the above discussion, those in the field have focused on developing ever more complex methods of detecting gene editing events, such as ddPCR and DNA sequencing-based approaches.

[0025] Thus, our approach is conceptually distinct from and does not logically follow from the direction of development unfolding in the art. The present invention enables better methods for determining the efficiency and overall product of genetic editing procedures, and as shown in the examples and herein, offers several surprising advantages over current methods, including: - Simplicity of use, Low cost, - Faster turnaround times, Higher sensitivity, Higher specificity, and The possibility of using standard laboratory equipment rather than specialized techniques.

[0026] Thus, the improved method of the present invention represents a significant advance in the field.

[0027] Step (i) of the method of the invention involves providing a sample from a genetic editing procedure. "Genetic editing procedures" include any such procedures in which a target polynucleotide sequence is "edited" by the addition and / or deletion and / or mutation of one or more nucleotide bases in the molecule. The term "genetic editing" also encompasses "genome editing" and "gene editing". Several genome editing tools have been developed, including ZFN, TALEN, and the currently popular CRISPR / Cas9 system, and each of these editing tools is included in what is referred to herein as a "genetic editing procedure".

[0028] A genetic editing procedure allows genetic material in a polynucleotide sequence to be added, removed, or altered at specific locations. Thus, a "sample from a genetic editing procedure" includes a sample containing the product of the resulting genome editing procedure. As will be understood, such a sample may contain one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences. Additionally, a sample may also contain one or more incorrectly edited polynucleotide sequences.

[0029] For the avoidance of doubt, it is contemplated that it is within the scope of the present invention that the present methods may be used to determine whether a sample contains 100% correctly edited polynucleotides, or whether it contains 100% unedited (i.e., 0% edited) polynucleotides, or whether it contains 100% incorrectly edited polynucleotides, or a combination thereof.

[0030] A "polynucleotide sequence" includes any biopolymer composed of nucleotide monomers in a chain, e.g., DNA and / or cDNA and / or RNA. Each polynucleotide sequence may be present in the sample in an amount of about 0.1 ng to about 5000 ng, e.g., about 0.1 ng to about 2000 ng, e.g., about 1 ng to about 1000 ng. In other words, in step (ii), each polynucleotide sequence may be present in an amount of about 0.01 ng / μL to 500 ng / μL, e.g., about 0.05 ng / μL to about 250 ng / μL.

[0031] Step (ii) of the method of the invention entails performing rolling circle amplification to generate an RCA product from one or more polynucleotide sequences in the sample.

[0032] In one embodiment, the method includes a step of preparing the sample prior to RCA, the preparation step including DNA extraction from the sample, denaturation of the DNA, followed by probe hybridization and ligation.

[0033] It will be appreciated that any single molecule detection method may be used in relation to step (iii), which may include fluorescence microscopy, for example epifluorescence microscopy.

[0034] Preferably, in the methods of the invention, the RCA product is labeled with a detectable moiety.

[0035] In certain embodiments, the detectable moiety can be selected from the list consisting of a fluorophore, a chromophore and a nanoparticle, preferably a fluorophore.

[0036] In certain embodiments, the detectable moiety may be a spectrally resolved fluorophore selected from the list consisting of cyanine 3, cyanine 5, Alexa Fluor family dyes (such as 488 and 750), fluorescein (FITC), Atto family dyes (such as ATTO 550 and ATTO 488), quantum dots, and synthetic fluorophores.

[0037] In a preferred embodiment, different detectable moieties are used to label the RCA products generated from the correctly edited and unedited polynucleotide sequences. Thus, in that embodiment of the invention, the RCA products are differentially labeled, making it possible to distinguish the RCA products from the correctly edited and / or unedited polynucleotide sequences from each other.

[0038] Furthermore, an additional detectable moiety may be used to label the incorrectly edited polynucleotide sequences in the sample, which detectable moiety is distinct from the moieties used to label the correctly edited and unedited polynucleotide sequences.

[0039] Preferably, in the method of the invention, step (iii) comprises quantifying the RCA product generated in step (ii) and determining the amount of correctly edited and / or unedited polynucleotide sequences in the sample. The correctly edited and unedited polynucleotide sequences may be quantified relative to each other and / or relative to the total number of polynucleotide sequences in the sample by also quantifying the total number of incorrectly edited polynucleotide sequences.

[0040] In this embodiment, where the method of the present invention allows for accurate quantification and characterization of targeted gene editing efficiency by using RCA, the method may also use gene editing site-specific circularization oligonucleotide sequences.

[0041] In one embodiment, the RCA products may be differentially labeled by hybridizing labeled oligonucleotides complementary to a control, unedited gene sequence and the edited sequence, and the level of hybridization allows for quantification of the sequences, which in turn allows for the ratio of editing efficiencies to be determined.

[0042] Oligonucleotides can be labeled with a variety of reporter molecules, including, but not limited to, fluorophores, chemiluminescent labels, colorimetric labels, phosphorescent labels, and particles such as quantum dots, gold particles, or silver particles.

[0043] In an embodiment, each circularizable probe or circularized gene target is designed or selected to include edited and unedited gene sites. The above-mentioned probes or targets can be ligated into a circle that is a substrate for RCA reaction. The amplicons obtained from each reacted probe can be digitally differentially labeled and quantified. By measuring the ratio of amplicons derived from control / reference, edited and unedited target site probes, it is possible to calculate the efficiency of gene editing technology and identify the editing itself with high accuracy.

[0044] "Quantifying the RCA product" includes digitally quantifying.

[0045] In certain embodiments, the resulting RCA products can be detected and quantified by immobilization on a solid support such as a microarray or concentration on a filtration membrane, or by single molecule detection schemes that allow for differential detection, including, but not limited to, amplified single molecule detection.

[0046] Quantification is achieved by imaging the fixed RCPs using a fluorescent microscope. The resulting images are processed with image processing software that performs top-hat filtering, spot registration, spot size filtering, and spot quantification algorithms, where each spot corresponds to an RCP obtained from a target molecule. This counting of individual spots or positive entities is what we call digital quantification.

[0047] In certain embodiments, the number of RCPs in a sample is greater than 1 copy, for example, greater than 10, 100, 200, 400 or 500 copies.

[0048] In a preferred embodiment, the method further comprises quantifying the total number of polynucleotide sequences in the sample.

[0049] "Total number of polynucleotide sequences in a sample" includes the total number of correctly edited polynucleotide sequences, unedited polynucleotide sequences, and incorrectly edited sequences combined in a sample.

[0050] In some embodiments, the total number of correctly edited polynucleotide sequences may be quantified, followed by quantification of the total number of unedited polynucleotide sequences, quantification of the total number of correctly edited polynucleotide sequences, and quantification of the total number of incorrectly edited polynucleotide sequences, and the amounts may be summed up. The quantification of each sequence type may be performed in any order. Alternatively, the total number of correctly edited polynucleotide sequences, unedited polynucleotide sequences, and incorrectly edited polynucleotide sequences may be quantified and summed up simultaneously.

[0051] Preferably, step (ii) of the method comprises generating circular single-stranded polynucleotide substrates from the polynucleotide sequences in the sample, wherein the circular single-stranded polynucleotide substrates are specific for the correctly edited polynucleotide sequence and for the unedited polynucleotide sequence.

[0052] "Circular single-stranded polynucleotide substrate" includes substrates produced using the probes described herein, followed by probe hybridization and ligation.

[0053] More preferably, a circular single-stranded polynucleotide substrate is generated using a first oligonucleotide probe that specifically targets the correctly edited polynucleotide sequence and a second oligonucleotide probe that specifically targets the unedited polynucleotide sequence. This is generally accomplished by using probes that target the edited and unedited sites, which become circular only when they find their respective targets.

[0054] It is preferred that the first and / or second oligonucleotide probe is selected from the group comprising a padlock probe, a molecular inversion probe, a gap-fill probe, a split-like probe, a lotus probe, a trilock probe, or a combination thereof.

[0055] In one embodiment, the first and / or second oligonucleotide probe is a combination of a padlock probe, which favors the detection of unedited sequences, and an oligonucleotide gap-fill probe, which favors the detection of edited sequences.

[0056] As used herein, the term "padlock probe" refers to a single-stranded DNA molecule having two segments complementary to a target connected by a linker polynucleotide sequence. When the complementary segments hybridize to the DNA target, the padlock probe circularizes.

[0057] In one embodiment, circular oligonucleotides are generated by specific hybridization and ligation of padlock probes on their respective targets. Here, the above-mentioned probes are designed to contain differential sequences that allow them to distinguish between control, edited and unedited gene sequences. After subsequent RCA reactions, multiple complementary copies of the original probes are generated. The resulting single molecule amplicons are differentially labeled by hybridizing labeled oligonucleotide tags that correspond to those originally encoded in each probe, generating a population of differentially labeled amplicons that originate from control, edited and unedited gene sequence sites, respectively.

[0058] By the term "molecular inversion probe," we refer to a padlock probe that has been modified such that when the probe is hybridized to a polynucleotide fragment, a circular structure is formed with the intended target captured in the gap between the complementary segments.

[0059] As used herein, the term "gap-fill probe" refers to a probe having probe arms designed to flank the gene editing site after hybridization, thus leaving a gap above the editing site.

[0060] In one embodiment, circular substrates for RCA are generated by specific hybridization and ligation of oligonucleotide gap-fill probes on their respective targets. The gaps on the editing sites are filled by hybridization and ligation of oligonucleotides complementary to the sequences contained within the gaps, thus forming circular oligonucleotide molecules. After the subsequent RCA reaction, multiple complementary copies of the filled probes are generated. The resulting single molecule amplicons are differentially labeled by hybridizing a labeled oligonucleotide complementary to the gap originally filled and to the joint arm of the gap-fill probe, where the gap-filled labeled events correspond to the unedited gene sequence and the unfilled events correspond to the edited sequence.

[0061] The term "split-like probe" refers to a probe that consists of at least two separate probes designed to be partially complementary to a polynucleotide target and a connector sequence. Upon hybridization to a polynucleotide fragment, the probes are brought into close proximity and their backbones are linked by the connector sequence. Nicks in the backbone can be closed by ligase, while nicks or gaps in the polynucleotide target site can be closed by ligase alone or in combination with polymerase, respectively.

[0062] The term "lotus probe" refers to a probe that is already partially circular, but requires specific hybridization of a polynucleotide target sequence to form a functional circular oligonucleotide molecule. The hybridized target fragment is bound to two nicks, Alternatively, gaps can be created that can be closed later by ligase, or in the case of gaps combined with polymerase. These probes are dumbbell shaped and consist of either a single probe or multiple separate probes.

[0063] The term "trilock probe" refers to a probe that consists of four separate probes: a common backbone probe, two probes that are partially complementary to the polynucleotide target, and a "trilock linker" that holds them all together by being partially complementary to the other probes. The two probe arms that are complementary to the polynucleotide target can either match perfectly to create a nick site that can be sealed with ligase, or create a gap that is filled by polymerase before being sealed by ligase.

[0064] The term "sequencing probe" refers to a probe that consists of a barcode in a backbone and allows sequencing of the evolving RCP by being compatible with NGS chemistry.

[0065] In certain embodiments, the first and second oligonucleotide probes circularize upon recognition of their specific target polynucleotide sequences.

[0066] Circularization occurs when the ends of a polynucleotide sequence (which can be a probe or a target) hybridize next to each other, forming a circle. DNA ligase then joins the ends, completely closing the circular molecule. In the case of gap-fill probes (also known as molecular inversion probes), circularization occurs after polymerase fills the gap between the ends of the probe, and then ligase joins the two ends.

[0067] In a preferred embodiment, circularization of the first and / or second oligonucleotide probe is mediated and / or improved by one or more joining probes, optionally wherein one or more of the joining probes is a selector probe.

[0068] Circular substrates may be generated by circularizing gene editing site regions, and the polynucleotide sequence from the genetic editing procedure is, for example, fragmented by restriction endonuclease and then denatured. The gene editing region may be circularized using a so-called selector probe that is complementary to the joint end of the fragmented region. After exonucleolytic digestion of any non-circular target, RCA is performed, thus generating multiple copies of the gene-edited polynucleotide sequence.

[0069] "Joining probes" include probes that hybridize adjacent to ends in a tail-to-end manner to form a single strand of DNA sequence after ligation.

[0070] In a preferred embodiment, a circular single-stranded polynucleotide substrate is formed by ligation of a first oligonucleotide probe and its specific target polynucleotide sequence and by ligation of a second oligonucleotide probe and its specific target polynucleotide sequence, optionally where the ligation is performed by a ligase with specific intramolecular ligation activity.

[0071] In a preferred embodiment, rolling circle amplification of a circular single-stranded polynucleotide substrate is primed by a target sequence or by an amplification primer that is complementary to the circular single-stranded polynucleotide substrate.

[0072] In one embodiment, the polymerase that performs RCA requires a 3'OH end to initiate RCA. This 3' end base can be complementary to the circle, so the circle is used as a template. When detecting sequences in genomic DNA, this 3' end is not complementary to the circle, and there is a long stretch of single-stranded DNA that is bound to the circle. This provides two ways to initiate RCA.

[0073] When RCA is target initiated, the polymerase itself digests the long DNA stretch until it reaches a circle, at which point it finds a 3' end that is complementary to the circle and can then initiate RCA. When RCA is primer initiated, a primer hybridizes to the circle, which generates a 3' end that can then initiate RCA.

[0074] An "amplification primer" comprises a polynucleotide sequence that is perfectly complementary to a circular template.

[0075] In certain embodiments, the primers may be modified with a moiety that protects the primer from exonuclease activity. Such a moiety may be selected from the group consisting of ortho-methyl RNA bases and alpha-thiol phosphate linkages.

[0076] Preferably, the detectable moiety is selected from the group comprising a fluorophore, a chromophore, or a combination thereof.

[0077] As mentioned above, after the RCA step the RCA product is present in the liquid sample. In a particularly preferred embodiment of the invention, step (iii) comprises immobilizing the RCA product on a surface.

[0078] For example, the RCA product can be immobilized on a surface by electrostatic, covalent, or steric interactions with the surface as described above.

[0079] Alternatively, the RCA product may be bound to magnetic beads to provide a bead-bound RCA product, and a magnetic source may be provided to attract the bead-bound RCA product onto the above-mentioned surface to immobilize the RCA product on the surface.

[0080] The magnetic beads may have an average size of about 10 nm to about 5 μm, such as about 10 nm to about 2 μm, for example, about 500 nm to about 2 μm. In this regard, the magnetic beads may have an average diameter of about 10 nm to about 5 μm, such as about 10 nm to about 2 μm, for example, about 500 nm to about 2 μm, or about 50 nm to about 200 nm.

[0081] In another embodiment, the surface is a glass surface or a porous membrane.

[0082] In certain embodiments, the porous membrane is a filtration membrane, for example a porous hydrophilic membrane.

[0083] In certain embodiments, the RCA product is immobilized by filtering the liquid sample through a porous membrane. The liquid sample can be drawn through the porous membrane by gravity filtration, by application of a vacuum pump, or by capillary forces.

[0084] In certain embodiments, the liquid sample is drawn through the porous membrane by capillary forces by applying the liquid sample to one side of the porous membrane and applying an absorbent layer to the other side of the porous membrane, placing the absorbent layer and porous membrane in liquid connection and in liquid from the liquid sample.

[0085] For the avoidance of doubt, the porous membrane is permeable to the liquid in the liquid sample but substantially impermeable to the RCA product.

[0086] As used herein, the term "capillary force" refers to the drawing or wicking of liquid through a porous membrane to immobilize the RCA product on the surface of the membrane.

[0087] In some embodiments, an area of ​​the porous membrane corresponds to a single field of view of an optical detection device.

[0088] In an embodiment, the porous membrane has a thickness of about 0.01 μm to about 100 μm, such as about 0.05 μm to 0.5 μm, such as about 0.07 μm to about 0.2 μm, or the filtration membrane has a thickness of about 0.1 μm.

[0089] In another embodiment, the porous membrane is about 2 to about 20 mm 2 For example, about 5 to about 15 mm 2 For example, about 5 to about 10 mm 2 has a surface area of

[0090] In a further embodiment, the porous membrane is substantially annular in shape, e.g., annular in shape, the porous membrane having a diameter in the range of about 0.1 to about 10 mm, e.g., about 0.5 mm to about 10 mm, e.g., about 1 mm to about 5 mm, or about 1 mm to about 3 mm, or the filtration membrane is annular with a diameter of about 2 mm.

[0091] In certain embodiments, when the RCA product is immobilized on a glass surface, the glass surface is modified to interact with the RCA product.

[0092] In certain embodiments, the glass surface can be modified with a positively charged homopolymer, such as poly-L-lysine, poly-D-lysine, or aminosilane.

[0093] The RCA product may also contain an affinity molecule such as biotin by introducing a biotin-modified dNTP into the RCA reaction mixture. The biotinylated RCA product may be immobilized on a glass surface modified with streptavidin.

[0094] In another embodiment, the RCA product in the liquid sample is flowed through a microfluidic channel to concentrate the sample into a single field of view of the microscope. The liquid flow may be achieved by using a pump system, or the flow may be achieved passively. This concentration step may be referred to as microfluidic concentration.

[0095] Concentration / immobilization of the RCA product allows for lower amounts / concentrations of polynucleotide to be used compared to currently known procedures. Specific amounts / concentrations of polynucleotide that can be used are outlined above.

[0096] In a preferred embodiment of the invention, step (iii) comprises detecting the RCA product by microscopy, optionally wherein the microscopy is selected from the group comprising bright field microscopy, fluorescence microscopy, or a combination thereof.

[0097] In a preferred embodiment of the invention, step (iii) comprises detecting the RCA product by DNA sequencing.

[0098] As used herein, the term "DNA sequencing" refers to sequencing techniques such as sequencing by ligation, sequencing by synthesis, or sequencing by hybridization, as well as Sanger or next generation sequencing. Such methods are well known to those skilled in the art of molecular biology.

[0099] Preferably, the efficiency of the genetic editing procedure is determined based on the relative amounts of correctly edited and unedited polynucleotide sequences in the sample.

[0100] For example, the number of correctly edited polynucleotide sequences can be determined relative to a control relative to the remaining unedited sequences. If the total number of edited and unedited sequences combined does not equal 100%, the difference may be due to incorrect or unexpected edits.

[0101] In an embodiment, the efficiency of a genetic editing procedure can be determined by adding a detectable moiety that targets the same polynucleotide that is edited, but at a different location than the location that is edited.

[0102] This allows accurate quantification of the efficiency of the method, depending on which gene can be edited, but not edited by the correct sequence.Therefore, the detectable moiety theoretically binds to different positions on the polynucleotide to be edited, and therefore binds to all polynucleotide sequences in the sample, thus allowing the total number of sequences to be determined.The moiety that targets edited sequences and unedited sequences quantifies the total number of correctly edited sequences and unedited sequences, while the difference between the total number of polynucleotide sequences and the combination of correctly edited sequences and unedited sequences allows the quantification of incorrectly edited sequences.

[0103] The inclusion of this control probe allows for a very accurate analysis of efficiency without relying on other more expensive and complicated methods such as ddPCR and qPCR.

[0104] In a further aspect, the invention provides a method for identifying a product of a genetic editing procedure, the method comprising: (i) providing a sample from a genetic editing procedure, the sample comprising one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences; (ii) performing rolling circle amplification to generate an RCA product from one or more polynucleotide sequences in the sample; and (iii) determining a product of the genetic editing procedure based on the presence of the RCA product generated in step (ii).

[0105] In a further aspect, the invention provides for the use of rolling circle amplification to identify the product of a genetic editing procedure and / or to determine the efficiency of a genetic editing procedure.

[0106] When used herein in connection with a particular value (e.g., amount), the term "about" (or similar terms such as "approximately") is understood to indicate that such value may vary by up to 10% (particularly up to 5%, e.g., up to 1%) of the defined value. In each case, it is contemplated that such terms may be replaced with a notation such as "±10%" (or by indicating a variation of the particular amount calculated based on the relevant value). It is also contemplated that in each case, such terms may be omitted. [Brief description of the drawings]

[0107] [Figure 1] Comparison of workflows of different methods available for pre-screening gene editing efficiency and specificity. [Diagram 2] FIG. 1 is a schematic of a method for quantifying editing efficiency and identifying editing by quantifying rolling circle amplicons. [Diagram 3] FIG. 13 is a schematic diagram of the design and principle of generating circular templates for RCA using padlock probes targeted to gene editing sites. [Figure 4] FIG. 13 is a schematic diagram of the design and principle of generating circular templates for RCA using gap-fill probes targeted to gene editing sites. [Diagram 5] FIG. 1 is a schematic diagram of the design and principle of generating circular templates for RCA using a selector probe targeted to the gene editing fragment sequence. [Figure 6] FIG. 1 is a schematic diagram of the design and principle of generating circular templates for RCA using splint probes, padlock probes, invader probes or splint probes for single nucleotide polymorphism sites. [Figure 7] FIG. 1 is a schematic diagram of the design and principle of generating circular templates for RCA using a lotus or lotus-like probe targeting the gene editing fragment sequence. [Figure 8]FIG. 13 is a schematic diagram of the design and principle of generating circular templates for RCA using a triple split probe targeting the gene edited fragment sequence. [Figure 9] FIG. 1 is a schematic diagram of a method for quantifying editing efficiency and identifying edits by next generation sequencing of rolling circle amplified amplicons. [Figure 10] RCPs generated in the presence and absence of the gene of interest. Only in the presence of the gene of interest are RCPs generated and visible as bright fluorescent entities under a fluorescent microscope. Scale bar = 10 μm. [Figure 11] Microfluidic enrichment of RCPs. RCPs can be observed under a fluorescent microscope only in samples where the gene of interest is present. White arrows point to individual RCPs. Scale bar = 10 μm. [Figure 12A] FIG. 13 is an exemplary image of a region of interest showing multiplexed quantification of three genes. The merged image shows all three colors, and the second row shows decomposed images of each channel with arrows indicating exemplary locations of RCPs. [Figure 12B] 1 is a graph illustrating the concept of digitally quantifying three different genes with the same gene copy number using the described method. The average of two individual measurements and the corresponding standard deviation are shown. [Figure 13A] Graph showing quantification of RCP from samples with various human DNA inputs and constant mouse DNA as a control. [Figure 13B] Figure 1 is a graph showing the data from A as a percentage of expected / theoretical for the observed RCP ratio. Pure human DNA input was taken as the reference (100% theoretical and 100% observed) and various inputs were taken relative to their RCP counts. The average of two individual measurements and the corresponding standard deviation are shown. [Figure 13C] Exemplary images of regions of interest showing reduced amounts of RCP to reduce human DNA input. Scale bar corresponds to 20 μm. [Figure 14A]Graph showing the specificity of the method using padlock probes and RCA to discriminate a single nucleotide. The average of two individual measurements and the corresponding standard deviation are shown. [Figure 14B] Exemplary regions of interest showing the presence of an RCP from the reference gene in both cases (perfect match and one nucleotide mismatch) and the absence of an RCP in the case of a one nucleotide mismatch. Scale bar corresponds to 20 μm. [Figure 15] Graph showing the ability of the method to quantify polynucleotide sequences from different organisms, also showing padlock probe configuration, where the reference shows the same level of events as the unedited sequence (compare the bar graphs of reference and unedited). In the case of editing events, the ratio of reference to unedited or control to unedited allows conclusions to be drawn about the editing level. The average of two individual measurements is shown.

[0108] In the figures, the following reference numbers are used: [Explanation of symbols]

[0109] 1. Control sequence 2. Unedited sequence site 3. Edited sequence site 4. Padlock Probe for Control Sequence 5. Padlock Probe for Unedited Sequences 6. Padlock Probe for Edited Sequences 7. Gap-fill Probes for Control Sequences 8. Gap-fill Probes for Unedited Sequences 9. Gap-fill Probes for Edited Sequences 10. Selector probe for control sequence 11. Selector probes for unedited sequences 12. Selector probes for edited sequences 13. Gap-fill Probe Hybridization Sites 14. Target strand containing single nucleotide polymorphism site (N) 15. Ligation site 16. Padlock probes with DNA bases at the 3' end for detecting single nucleotide polymorphism sites 17. Alternative INVADER Probes for Single Nucleotide Polymorphism Site Detection 18. Invader Flap 19. Replaced Invader Flap 20. Conventional INVADER probes for detecting single nucleotide polymorphism sites 21. Splint probes with RNA bases at the 3' end for detecting single nucleotide polymorphism sites 22. Splint ligation site 23. Nicks for direct ligation or gaps for ligation followed by filling 24. Lotus Probe 25. Polynucleotide target sequence 26. Trilock Probe 27. Trilock Linker 28. Sequencing probes with probe-specific barcodes compatible with NGS chemistry 29. Polynucleotide sequences having single nucleotide polymorphisms DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0110] In certain embodiments, the methods of the invention allow for quantification of the efficiency of targeted gene editing methods, as well as the identification of those gene edits, particularly using circular oligonucleotide substrates generated by probe or target circularization and subsequent rolling circle amplification (RCA).

[0111] Referring to the schematic diagrams shown in Figures 2, 3, 4, 5, 6, 7, 8, and 9, the method herein involves generating and quantifying populations of differentially labeled and amplified single molecules from a control gene sequence (1), an unedited target site sequence (2), and an edited target site sequence (3). By quantifying and calculating the ratio of labeled amplicons from each population, the efficiency of the gene editing technology can be measured with high accuracy. In particular, the amplicons are generated by a rolling circle amplification reaction of circular oligonucleotide substrates generated by a highly specific multiplex target sequence recognition reaction.

[0112] In the particular method shown in Figure 3, circular oligonucleotides are generated by specific hybridization and ligation of so-called padlock probes on their respective targets. Here, the aforementioned probes are designed to contain differential sequences that allow to distinguish between control, edited and unedited gene sequences. After the subsequent RCA reaction, multiple complementary copies of the original probe are generated. The resulting single molecule amplicons are differentially labeled by hybridizing labeled oligonucleotide tags that correspond to those originally encoded in each probe. This generates a population of differentially labeled amplicons that originate from the control, edited and unedited gene sequence sites, respectively.

[0113] In another particular method according to the invention shown in Figure 4, circular substrates for RCA are generated by specific hybridization and ligation of so-called oligonucleotide gap-fill probes on their respective targets. Here, the above-mentioned probe arm (i) is designed to flank the gene editing site after hybridization, thus leaving a gap on the editing site. The above-mentioned gap is filled by hybridization and ligation of an oligonucleotide complementary to the sequence contained within the gap, thus forming a circular oligonucleotide molecule. After a subsequent RCA reaction, multiple complementary copies of the filled probe are generated. The resulting single molecule amplicons are differentially labeled by hybridizing a labeled oligonucleotide complementary to the one originally filling the gap and to the joint arm of the gap-fill probe. Here, the gap-filled labeled events correspond to the unedited gene sequence, and the unfilled events correspond to the edited sequence.

[0114] In another embodiment of the method according to the present invention shown in Fig. 4, circular substrates for RCA are generated by specific hybridization, ligation and polymerization of so-called gap-fill probes on their respective targets. Here, the above-mentioned probe arm (i) is designed to flank the gene editing site after hybridization, thus leaving a gap on the editing site. The above-mentioned gap is filled by polymerization and ligation by the concerted action of polymerase and ligase, thus forming a circular oligonucleotide molecule. After the subsequent RCA reaction, multiple complementary copies of the filled probe are generated. The resulting single molecule amplicons are differentially labeled by hybridizing a labeled oligonucleotide complementary to the expected gap sequence and to the joint arm of the gap-fill probe. Here, the gap-filled labeled events correspond to the unedited gene sequence and the unfilled events correspond to the edited sequence.

[0115] In another embodiment of the method of the present invention shown in Figure 5, a circular substrate is generated by circularizing the gene editing site region, and genomic DNA from the edited cell is fragmented, for example by a restriction endonuclease, and then denatured. A so-called selector probe, which is complementary to the joint end of the fragmented gene region, is used to circularize the gene edited region. After exonucleolytic digestion of the non-circular target, RCA is performed, thus generating multiple copies of the gene edited region. The resulting single molecule amplicons are differentially labeled by hybridizing labeled oligonucleotides complementary to the control, unedited gene sequence and the edited sequence, thus being quantified to determine the ratio of editing efficiency.

[0116] In another embodiment of the method according to the invention shown in Figure 6, polynucleotide target sequences with single nucleotide polymorphisms can be targeted by padlock probes (16), alternative invader probes (17), traditional invader probes (20) or splint probes (21) with specific bases at the 3' end. This design provides high specificity since these probes can only be ligated in case of perfect matching sequences, allowing differentiation of very close polynucleotide sequences.

[0117] In another embodiment of the method according to the invention shown in FIG. 7, the polynucleotide target sequence is fragmented into specific fragments which can then be hybridized to the respective Lotus probes and then circularized after sealing the nicks with ligase or using a gap-fill mechanism to serve as a template for the RCA reaction.

[0118] In another embodiment of the method of the present invention, a trilock probe is used to generate a circular substrate by specifically binding to a polynucleotide sequence, as shown in Figure 8. The two probe arms complementary to the polynucleotide target either match perfectly to create a nick site that can be sealed with ligase, or create a gap that can be filled by polymerase before being sealed by ligase, and then serve as a template for the RCA reaction.

[0119] In another embodiment according to the present invention shown in Figure 9, the probes presented in Figures 2, 3, 4, 5, 6, 7, and 8 are designed to include barcodes compatible with NGS chemistry, allowing the generated RCPs to be identified and quantified not only by direct measurement but also by DNA sequencing.

[0120] In a particular embodiment, the method may comprise the following steps. DNA extraction from samples used in gene editing experiments DNA denaturation Probe hybridization and ligation (this is a mixture containing probes for control, edited and unedited) RCA ·RCP sign Fixation of RCP in membrane Fluorescence microscopy Image processing and quantification of resulting spots

[0121] array SEQ ID NO:1 Padlock probe RPP 30 PO 4- TTGTTGAGTGTTGGCGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCG TCGCGTGCATAACCAGGCCA SEQ ID NO:2 Detection Oligonucleotides TCCTCAGTAATAGTGTCTTACTTTT-Cy3 SEQ ID NO:3 Padlock probe GAPDH PO4- AAGGGTGCAGCTGAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGAGCGTTTTCTCCCTA SEQ ID NO:4 Padlock Probe NRXN1 Unedited PO4-CGGCGGCCGCCTGCAGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATGCTGATTCTGACGCG SEQ ID NO:5 Padlock Probe NRXN1 Reference PO4-AATAAGGGTCCCGAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACAGAGAGTAGTACTTCCGACTACACCGTGACGAAGA SEQ ID NO:6 Capture Oligonucleotides Biotin-TTTTTCCTCAGTAATAGTGTCTTAC SEQ ID NO:7 Detection oligonucleotide CY3 ATTTAGCATACATCGTCGCG-CY3 SEQ ID NO:8 Detection oligonucleotide FITC GGGCCTTATTCCGGTGCTATTTTTT-FITC SEQ ID NO:9 Padlock probe ACTB reference PO4-TTGTAGAAGGTGTGGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATGCCACACGCAGCTCA SEQ ID NO:10 Padlock probe ACTB edited PO4-CCTTCACCGTTCCAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGAACCGACTGCTGTCA SEQ ID NO:11 Padlock Probe NRXN1 SNP PO4-CGGCGGCCGCCTGCAGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATGCTGATTCTGACGCT SEQ ID NO:12 Padlock probe Me28S: see A2486 PO4-TCAACACCGCTGGCAGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACGGGCCTTATTCCGGTGCTATCGGAGACAGAGAGCT SEQ ID NO:13 Padlock probe ACTB reference 2 PO4-TTGTAGAAGGTGTGGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACAGAGAGTAGTACTTCCGACTGCCACACGCAGCTCA SEQ ID NO:14 Padlock probe ACTB Reference mut PO4-TTGTAGAAGGTGTGGGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGGCCACACGCAGCTCG SEQ ID NO:15 Detection oligonucleotide Atto647 AGAGAGTAGTACTTCCGACT-Atto647 SEQ ID NO:16 External primer TACTGAGGAGCTGCATAC * A * C " before the base * " indicates phosphorothioate modification EXAMPLES

[0122] Example 1 Generation of RCPs from human DNA The RCPs shown in Figures 2 and 3 were generated from human DNA using a padlock probe ligation reaction. For this, 1 μg of human DNA (Sigma Aldrich) was fragmented with 10 U of MscI (NEB) in 1× CutSmart buffer (NEB) for 30 min at 37° C. in a total of 10 μL.

[0123] The reactions were then inactivated and the DNA denatured by heating the reactions to 95° C. for 10 minutes and then quickly chilled on ice. A ligation mix was then prepared consisting of 100 pM (of each) padlock probe (PO4-TTGTTGAGTGTTGGCGTGTATGCAGCTCCTCAGTAATAGTGTCTTACATTTAGCATACATCGTCGCGTGCATAACCAGGCCA, SEQ ID NO: 1) (IDT), Tth ligase buffer (20 mM Tris-HCl (pH 8.3) (Thermo Fisher Scientific), 25 mM KCl (Thermo Fisher Scientific), 10 mM MgCl2 (Thermo Fisher Scientific), 0.5 mM NAD (Thermo Fisher Scientific), 0.01% Triton® X-100 (Sigma Aldrich)), 0.2 μg / μL BSA (Thermo Fisher Scientific), 0.68 mM ATP (Thermo Fisher Scientific), and 5 U of Tth DNA ligase (Blirt SA) in a final volume of 20 μL. The mixture was incubated at 95°C for 1 min, followed by 50°C for 40 min. The circles resulting from this reaction were mixed in phi29 DNA polymerase buffer (50 mM Tris-HCl (pH 8.3), 10 mM MgCl2, 10 mM (NH4)2SO4) containing 0.2 μg / μL BSA, 125 μM dNTPs (Thermo Fisher Scientific) and 8 U of phi29 DNA polymerase (Monserate) in a total volume of 30 μL. The amplification mixture was incubated at 37°C for 3 h, followed by incubation at 65°C for 2 min.RCPs were fluorescently labeled by adding 30 μL of hybridization buffer (1.4 M NaCl (KI Substrat), 0.01% TWEEN 20 (Sigma Aldrich), 20 mM Tris-HCl (pH 8) and 20 mM EDTA (KI Innovation)) containing 5 nM detection oligonucleotide (TCCTCAGTAATAGTGTCTTACTTTT-Cy3, SEQ ID NO: 2) (IDT) for 2 min at 75°C and 15 min at 55°C.

[0124] RCP detection on slides To visualize RCPs, 10 μL of the hybridization reaction was placed on a Superfrost slide (ThermoFisher) and spread on the surface using a 24 × 24 mm Menzel Glaser coverslip (VWR). The slide was incubated at room temperature for 5 minutes to allow the RCPs to adhere to the slide. After incubation, five fields within the 24 × 24 mm coverslip were imaged with a Zeiss Axio Imager Z2 epifluorescence microscope equipped with a 20x objective with a field of view of 0.75 × 0.75 μm. The resulting RCPs were quantified using a custom-built pipeline using CellProfiler software. Exemplary images are shown in Figure 10.

[0125] RCP detection in concentrated sample analysis devices The sample analysis device used for the concentration in FIG. 3 was manufactured by Aline, Inc. (US). The filtration membrane was a Protran™ NC Nitrocellulose membrane (GE Healthcare Lifesciences) with a pore size of 0.1 μm, the absorbent layer was a cellulose fiber sample pad sheet (Meck-Millipore), the spacing layer was a form of pressure-sensitive adhesive (Aline), and the liquid impermeable layer was polyethylene terephthalate (Aline). The sample-containing wells were 1.5 mm in diameter. The sample analysis device was manufactured to have the dimensions of a standard microscope slide, 25×75 mm, with 10 sample-containing wells aligned on the sample analysis device. A labeled dilution of RCP was applied to the sample-containing wells embedded in the sample analysis device with a diameter of 1.5 mm. 10 μL of labeled RCP was applied to the sample-containing wells. The applied liquid sample formed a large droplet on the top of the sample-containing well. After approximately 4 minutes, all the liquid sample was blotted through the filter membrane. Sample-containing wells were imaged with a Zeiss Axio Imager Z2 epifluorescence microscope equipped with a 20x objective with a field of view of 0.75 x 0.75 μm. The resulting RCPs were quantified using a custom-built pipeline using CellProfiler software. Exemplary images are shown in Figure 11.

[0126] Example 2 Principles and analytical capabilities of the present invention This example demonstrates the principle and analytical capabilities of using the present invention to digitally determine the number of sequences present in a sample and is illustrated in FIG.

[0127] Generate RCP The RCPs generated for FIG. 12 were prepared from human and mouse DNA with a constant amount of mouse DNA (1 μg) across conditions and decreasing amounts of human DNA (1 μg, 500 ng, 100 ng, and 1 ng, respectively). For this, human (Sigma Aldrich) and mouse (Sigma Aldrich) DNA were fragmented in a total of 20 μL using 15 U of AluI (NEB) in 1× Tth buffer (Blirt) for 5 min at 37° C. Next, a ligation mixture was prepared consisting of 1 nM (of each) padlock probe (SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5) (IDT), Tth ligase buffer (Blirt), and 7.5 U of Tth DNA ligase (Blirt) in a final volume of 30 μL. The mixture was incubated at 98° C. for 10 min, followed by 55° C. for 45 min. The circles resulting from this reaction were mixed in Tth buffer (Blirt) containing 24 U of Exonuclease I (NEB), 0.8 mM dNTPs, 5 nM of the external primer (SEQ ID NO: 16) (IDT), 6 μg of BSA (Thermo Fisher Scientific) and 12 U of phi29 DNA polymerase (Blirt) in a total volume of 40 μL. The amplification mixture was incubated at 37° C. for 3 hours, followed by incubation at 65° C. for 2 minutes.

[0128] RCP sign RCPs were fluorescently labeled by adding 10 μL of hybridization buffer (0.7 M NaCl (KI Substrat), 0.005% TWEEN 20 (Sigma Aldrich), 10 mM Tris-HCl (pH 8) and 10 mM EDTA (KI Substrat)) containing 5 nM (of each) detection oligonucleotide (SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:15) (IDT) for 2 min at 75° C. and 20 min at 55° C.

[0129] Capture of RCPs on beads The resulting labeled RCP was captured on Dynabeads™ MyOne™ Streptavidin T1 (Thermo Fisher Scientific). Dynabeads™ MyOne™ Streptavidin T1 beads are superparamagnetic beads with a diameter of 1 μm. For this, the beads were prepared according to the manufacturer's instructions and then added to the RCP solution at a concentration of 0.125 μg / μL. The capture reaction was incubated for 20 min at 37° C., after which the beads were washed once in washing buffer and resuspended in the same buffer.

[0130] Imaging of RCP To visualize the resulting bead-bound RCP, 10 μL of the capture reaction was placed on a Superfrost glass slide (Thermo Fisher Scientific). A 2 mm circular magnet (Supermagnete) was attached to a cell counter slide (Bio-Rad) to locally concentrate the bead-bound RCP onto a small surface area. The slide was incubated at room temperature for 5 min to concentrate the beads. After incubation, the slide was viewed under a 20x objective and a 0.65×0.65 μm microscope. 2 Images were taken with an Olympus IX73 inverted fluorescent microscope with a field of view of 100 x 100 mm.

[0131] RCP quantification The acquired images were analyzed using a custom-made pipeline in CellProfiler software (version 4.1.3, https: / / cellprofiler.org, by the Broad Institute and originally published by Lamprecht et al. CellProfiler: free, versatile software for automated biological image analysis, Biotechniques (2007); 42(1): 71-75). The pipeline consisted of image enhancement and object identification with manual thresholding.

[0132] In conclusion, the results confirm the ability of the present method to correctly quantify the presence and amount of genes of interest using padlock probes and RCA. In this example, all three genes have one allele in the genome and therefore should show a similar number of RCPs / events. This is exactly what the graph in Figure 12 shows.

[0133] Example 3 Analytical Capabilities of the Invention This example demonstrates the analytical ability to use the present invention to determine the proportion of a sequence of interest present in a complex sample and is illustrated in FIG.

[0134] Generate RCP The RCPs generated for FIG. 13 were prepared from human and mouse DNA with a constant amount of mouse DNA (1 μg) across conditions and decreasing amounts of human DNA (1 μg, 500 ng, 100 ng, and 1 ng, respectively). For this, human (Sigma Aldrich) and mouse (Sigma Aldrich) DNA were fragmented in a total of 20 μL using 15 U of AluI (NEB) in 1× Tth buffer (Blirt) for 5 min at 37° C. Next, a ligation mixture was prepared consisting of 1 nM (of each) padlock probe (SEQ ID NO: 9, SEQ ID NO: 10) (IDT), Tth ligase buffer (Blirt), and 7.5 U of Tth DNA ligase (Blirt) in a final volume of 30 μL. The mixture was incubated at 98° C. for 10 min, followed by 55° C. for 45 min. The circles resulting from this reaction were mixed in Tth buffer (Blirt) containing 24 U of Exonuclease I (NEB), 0.8 mM dNTPs, 5 nM of the external primer (SEQ ID NO: 16) (IDT), 6 μg of BSA (Thermo Fisher Scientific) and 12 U of phi29 DNA polymerase (Blirt) in a total volume of 40 μL. The amplification mixture was incubated at 37° C. for 3 hours, followed by incubation at 65° C. for 2 minutes.

[0135] RCP sign RCPs were fluorescently labeled by adding 10 μL of hybridization buffer (0.7 M NaCl (KI Substrat), 0.005% TWEEN 20 (Sigma Aldrich), 10 mM Tris-HCl (pH 8) and 10 mM EDTA (KI Substrat)) containing 5 nM (of each) detection oligonucleotide (SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8) (IDT) for 2 min at 75° C. and 20 min at 55° C.

[0136] Capture, imaging, and quantification were performed as described in Example 2.

[0137] In conclusion, there is a strong correlation and agreement between the observed number of RCPs, as a ratio between the human reference and the different dilutions, and the theoretically expected ratio (in percentages). The result is a simplified method for digitally quantifying the presence or absence of DNA sequences when compared to competing methods such as digital PCR.

[0138] Example 4 Analytical capabilities of the present invention in terms of specificity This example demonstrates the analytical ability in terms of specificity to distinguish single nucleotide differences using the present invention and is shown in FIG.

[0139] Generate RCP The RCP generated for FIG. 14 was prepared from 1 μg human DNA (Sigma Aldrich). For this, human DNA was fragmented in a total of 20 μL using 15 U AluI (NEB) in 1×Tth buffer (Blirt) for 5 min at 37° C. Then, a ligation mixture was prepared consisting of 1 nM padlock probe (SEQ ID NO: 3) and either 1 nM padlock probe (SEQ ID NO: 4) as a perfect match or 1 nM padlock probe (SEQ ID NO: 11) (IDT) as a one nucleotide mismatch at the 3′ end, Tth ligase buffer (Blirt) and 5 U Tth DNA ligase (Blirt) in a final volume of 20 μL. The mixture was incubated at 55° C. for 20 min. The circles resulting from this reaction were mixed in phi29 DNA polymerase buffer (Blirt) containing 6 μg BSA, 0.8 mM dNTPs (Thermo Fisher Scientific), 5 nM of the outer primer (SEQ ID NO: 16) (IDT) and 12 U of phi29 DNA polymerase (Blirt) in a total volume of 30 μL. The amplification mixture was incubated at 37° C. for 2 hours, followed by incubation at 65° C. for 2 minutes.

[0140] RCP sign RCPs were fluorescently labeled by adding 30 μL of hybridization buffer (0.7 M NaCl (KI Substrat), 0.005% TWEEN 20 (Sigma Aldrich), 10 mM Tris-HCl (pH 8) and 10 mM EDTA (KI Substrat)) containing 5 nM detection oligonucleotides (SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8) (IDT) for 2 min at 75° C. and 20 min at 55° C.

[0141] Capture, imaging, and quantification were performed as described in Example 2.

[0142] In conclusion, the results confirm the high specificity of the padlock probe-based approach by being able to distinguish between single nucleotide differences in the target sequence. In the case of a single nucleotide difference, the padlock probe cannot be ligated and become a circular template for the subsequent RCA reaction. This makes the method particularly useful for gene editing where targeted evolution or genetic diseases are being studied. The high specificity makes this method particularly superior to PCR-based approaches where differentiation between single nucleotides often requires primer optimization.

[0143] Example 5 Quantification of different DNA sources This example demonstrates the ability to quantify DNA independent of the organism or gene of interest, where DNA from Drosophila melanogaster, HEK cells, and human buffy coats were used as examples, and is shown in Figure 15.

[0144] Generate RCP The RCPs generated in Figure 15 were prepared from different sources, namely Drosophila melanogaster, HEK cells, and human buffy coat DNA (Sigma Aldrich). Each reaction was performed in a separate experiment to demonstrate the ability of the presented technique to generate and quantify RCA products from different sources and organisms. For this, DNA was fragmented in a total of 20 μL using 15 U of AluI (NEB) in 1×Tth buffer (Blirt) for 15 min at 37°C. The ligation mixture was then prepared. The mixture consisted of 1 nM (of each) padlock probe (SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 1) (IDT) for HEK cells and buffy coat DNA, respectively, and 1 nM padlock probe (SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14) for DNA from Drosophila, in Tth ligase buffer (Blirt) and 7.5 U of Tth DNA ligase (Blirt) in a final volume of 30 μL. The mixture was incubated at 98° C. for 10 min, followed by 45 min at 55° C. The resulting circles from this reaction were mixed in Tth buffer (Blirt) with 24 U of Exonuclease I (NEB), 0.8 mM dNTPs, 5 nM of external primer (SEQ ID NO: 16) (IDT), 6 μg of BSA (Thermo Fisher Scientific) and 12 U of phi29 DNA polymerase (Blirt) in a total volume of 40 μL. The amplification mixture was incubated at 37°C for 3 hours, followed by incubation at 65°C for 2 minutes.

[0145] RCP sign RCPs were fluorescently labeled by adding 10 μL of hybridization buffer (0.7 M NaCl (KI Substrat), 0.005% TWEEN 20 (Sigma Aldrich), 10 mM Tris-HCl (pH 8) and 10 mM EDTA (KI Substrat)) containing 5 nM (of each) detection oligonucleotide (SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:15) (IDT) for 2 min at 75° C. and 20 min at 55° C.

[0146] Capture, imaging, and quantification were performed as described in Example 2.

[0147] In conclusion, the results confirm the ability of the method to easily detect genes of interest from different DNA sources.Furthermore, this example confirms the design of padlock probes that show the same level of events as the reference unedited sequence.In the case of editing events, the ratio of reference to unedited or control to unedited allows conclusions to be drawn on the editing level.This makes the method easy to use for different research questions and applications within the field of gene editing.

Claims

1. 1. A method for determining the efficiency of a genetic editing procedure, said method comprising: (i) providing a sample from a genetic editing procedure, said sample comprising one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences; (ii) performing rolling circle amplification to generate an RCA product from the one or more polynucleotide sequences in the sample; and (iii) determining the efficiency of the genetic editing procedure based on the presence of the RCA product produced in step (ii); A method comprising:

2. 2. The method of claim 1, wherein prior to performing the rolling circle amplification step (ii), the method comprises generating circular single-stranded polynucleotide substrates from the polynucleotide sequences in the sample, wherein the circular single-stranded polynucleotide substrates are specific for the correctly edited polynucleotide sequences and the unedited polynucleotide sequences.

3. 3. The method of claim 1 or 2, wherein the RCA product is labeled with a detectable moiety, preferably differentially labeled, such that the RCA product can be distinguished from the correctly edited polynucleotide sequence and / or the unedited polynucleotide sequence.

4. 4. The method of any one of claims 1 to 3, wherein step (iii) comprises quantifying the RCA product generated in step (ii) and determining the amount of the correctly edited and / or unedited polynucleotide sequence in the sample.

5. The method of any one of claims 1 to 4, wherein the method further comprises the step of quantifying the total number of polynucleotide sequences in the sample.

6. 6. The method of any one of claims 1 to 5, wherein the circular single-stranded polynucleotide substrate is generated using a first oligonucleotide probe that specifically targets the correctly edited polynucleotide sequence and a second oligonucleotide probe that specifically targets the unedited polynucleotide sequence.

7. 7. The method of claim 6, wherein the first and second oligonucleotide probes are selected from the group comprising a padlock probe, a molecular inversion probe, a gap-fill probe, a split-like probe, a lotus probe, or a combination thereof.

8. 8. The method of claim 6 or 7, wherein the first and second oligonucleotide probes circularize upon recognition of their specific target polynucleotide sequences.

9. 9. The method of claim 8, wherein circularization of the first and / or second oligonucleotide probes is mediated and / or improved by one or more joining probes, optionally wherein the one or more joining probes are selector probes.

10. 10. The method of any one of claims 6 to 9, wherein the circular single-stranded polynucleotide substrate is formed by ligation of the first oligonucleotide probe and its specific target polynucleotide sequence and by ligation of the second oligonucleotide probe and its specific target polynucleotide sequence, optionally wherein ligation is performed by a ligase with specific intramolecular ligation activity.

11. 11. The method of any one of claims 6 to 10, wherein rolling circle amplification of the circular single-stranded polynucleotide substrate is primed by a target sequence or by an amplification primer that is complementary to the circular single-stranded polynucleotide substrate.

12. The method of any one of claims 6 to 11, wherein the detectable moiety is selected from the group comprising a fluorophore, a chromophore, or a combination thereof.

13. The method of any one of claims 1 to 12, wherein step (iii) comprises immobilizing the RCA product on a surface.

14. The method of claim 13, wherein the RCA product is immobilized on the surface by electrostatic, covalent, or steric interactions with the surface.

15. 15. The method of claim 13 or 14, wherein the surface is a glass surface or a porous membrane.

16. 16. The method of claim 15, wherein the porous membrane is a filtration membrane, e.g. a porous hydrophilic membrane.

17. 17. The method of claim 15 or 16, wherein the RCA product is immobilized by filtering through the porous membrane.

18. The method of claim 15, wherein the glass surface is modified to interact with RCA products.

19. The method of any one of claims 1 to 12, wherein the RCA product is flowed through a microfluidic channel to concentrate the sample into a single field of view of a microscope.

20. 20. The method of any one of claims 1 to 19, wherein step (iii) comprises detecting the RCA product by microscopy, optionally wherein the microscopy is selected from the group comprising bright field microscopy, fluorescence microscopy, or a combination thereof.

21. 21. The method of any one of claims 1 to 20, wherein step (iii) comprises detecting the RCA product by DNA sequencing.

22. 22. The method of any one of claims 1-21, wherein the efficiency of the genetic editing procedure is determined based on the relative amounts of the correctly edited and the unedited polynucleotide sequences in the sample.

23. 14. The method of claim 13, wherein the method comprises attaching the RCA product to magnetic beads to provide a bead-bound RCA product.

24. 24. The method of claim 23, wherein the RCA product is immobilized by providing a magnetic source to attract the bead-bound RCA product to a location on the surface.

25. 1. A method for identifying a product of a genetic editing procedure, the method comprising: (i) providing a sample from a genetic editing procedure, said sample comprising one or more correctly edited polynucleotide sequences and / or one or more unedited polynucleotide sequences; (ii) performing rolling circle amplification to generate an RCA product from the one or more polynucleotide sequences in the sample; (iii) determining a product of the genetic editing procedure based on the presence of the RCA product produced in step (ii); A method comprising:

26. The use of rolling circle amplification to identify the product of a genetic editing procedure and / or to determine the efficiency of a genetic editing procedure.

27. 1. A kit of parts comprising: a first container comprising a gene editing reagent; a second container containing an RCA reagent; Instructions for use of the kit in the method according to any one of claims 1 to 25. Includes a kit of parts.

Images