Methods for assessing the potency of viral vector particles

Abstract

Cells, methods, kits and articles of manufacture, including those related to evaluating the efficacy of viral vectors, are provided herein.The present disclosure relates to a method for screening the efficacy of viral vectors, including vectors encoding recombinant receptors that contain extracellular antigen binding domains and intracellular signaling domains, such as chimeric antigen receptors (CARs).The method includes evaluating the efficacy of viral vectors based on detectable or measurable expression or activity of reporter molecule(s) that are responsive to the signal via the intracellular signaling region of T cell receptors, such as recombinant receptors.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 164,532, filed March 22, 2021, which is incorporated by reference in its entirety for all purposes.

[0002] Incorporation by reference to sequence listing This application is submitted with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 73504_2023240_SEQLIST.TXT, created on March 21, 2022, and is 57,897 bytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety.

[0003] The present disclosure relates to methods for screening the efficacy of one or more viral vectors, including vectors encoding recombinant receptors containing an extracellular target-binding domain and an intracellular signaling domain, such as a chimeric antigen receptor (CAR). The methods include evaluating or determining the efficacy of the viral vectors based on the detectable or measurable expression or activity of a reporter molecule, such as a reporter enzyme, that responds to a signal via a T cell receptor, e.g., the intracellular signaling domain of the recombinant receptor. In some embodiments, the methods can be used to screen multiple viral vectors, each containing a nucleic acid molecule encoding a candidate recombinant receptor, e.g., a CAR, and evaluate such a vector or vectors for efficacy. The methods can be high-throughput. Also provided are reporter cells, such as reporter T cells, cell compositions, and kits for use in the methods. [Background technology]

[0004] Current methods are cost-prohibitive, inaccurate, and not easily reproducible, and improved strategies for determining vector efficacy are needed. Shortcomings in current protocols for measuring vector efficacy result in large and unwanted lot-to-lot variations in transduced cells, including those associated with adoptive immunotherapy for use in the treatment of cancer, infectious diseases, and autoimmune diseases. Methods and cells for use in the methods that meet these needs are provided. Summary of the Invention

[0005] Provided herein is a method for determining the efficacy of a viral vector, the method comprising: a) introducing a tailored amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each having been introduced with a different amount of the tailored test viral vector, and each of the reporter T cell populations comprising reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, the recombinant receptor comprising an extracellular binding domain specific for a target, a transmembrane domain, and comprising, or complexed with, an intracellular signaling region comprising an ITAM-containing domain; b) incubating each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulating agent, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling through the intracellular signaling region of the recombinant receptor to produce a detectable signal from the reporter molecule; c) measuring each of the multiple populations of reporter T cells for a detectable signal from the reporter molecule; and d) determining, based on the measured detectable signal, an tailored amount of the test viral vector that results in a particular (e.g., half-maximal) detectable signal. In some embodiments, the target is an antigen of the recombinant receptor.

[0006] In some embodiments, provided herein are methods for determining the efficacy of a viral vector, the method comprising: a) introducing an adjusted amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, wherein each population of reporter T cells is identical and each has been introduced with a different amount of the adjusted test viral vector, and each of the reporter T cell populations comprises reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, wherein the recombinant receptor comprises an extracellular binding domain specific for an antigen, a transmembrane domain, and comprises or is complexed with an intracellular signaling region comprising an ITAM-containing domain; b) incubating each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulating agent, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling through the intracellular signaling region of the recombinant receptor to produce a detectable signal from the reporter molecule; c) measuring each of the multiple populations of reporter T cells for a detectable signal from the reporter molecule; and d) determining, based on the measured detectable signal, an adjusted amount of the test viral vector that results in a particular (e.g., half-maximal) detectable signal.

[0007] In some of any of the provided embodiments, the potency is relative potency, and the method further includes comparing a specific (e.g., half-maximal) detectable signal of the test viral vector to a specific (e.g., half-maximal) detectable signal of a reference viral vector standard in the same assay.

[0008] Also disclosed is a method for determining the efficacy of a viral vector, comprising: a) introducing a controlled amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each having been introduced with a different amount of the controlled test viral vector, each reporter T cell population comprising reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, the recombinant receptor comprising an extracellular binding domain specific for a target, a transmembrane domain, and an intracellular signaling region comprising an ITAM-containing domain; b) introducing each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulant. Provided herein are methods comprising: c) incubating a plurality of populations of reporter T cells in a culture medium containing a recombinant receptor stimulating agent, wherein binding of the recombinant receptor to the recombinant receptor induces signal transduction via the intracellular signaling domain of the recombinant receptor to generate a detectable signal from the reporter molecule; c) measuring each of the plurality of populations of reporter T cells for a detectable signal from the reporter molecule; and d) determining the relative efficacy of the test viral vector based on the measured detectable signal by comparing a specific (e.g., half-maximal) detectable signal of the test viral vector with a specific (e.g., half-maximal) detectable signal of a reference viral vector standard in the same assay. In some embodiments, the target is an antigen of the recombinant receptor.

[0009] Also disclosed is a method for determining the efficacy of a viral vector, comprising: a) introducing a controlled amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each having been introduced with a different amount of the controlled test viral vector, each reporter T cell population comprising reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, the recombinant receptor comprising an extracellular binding domain specific for an antigen, a transmembrane domain, and an intracellular signaling region comprising an ITAM-containing domain; and b) introducing each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulant. Provided herein are methods comprising: c) incubating a plurality of populations of reporter T cells, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling through the intracellular signaling domain of the recombinant receptor to generate a detectable signal from the reporter molecule; c) measuring each of the plurality of populations of reporter T cells for a detectable signal from the reporter molecule; and d) determining the relative potency of the test viral vector based on the measured detectable signal by comparing a specific (e.g., half-maximal) detectable signal of the test viral vector with a specific (e.g., half-maximal) detectable signal of a reference viral vector standard in the same assay.

[0010] In some of the provided embodiments, the relative potency is the percentage of the detectable signal of the test viral vector relative to the reference viral vector standard. In some of the provided embodiments, the relative potency is the ratio of the detectable signal of the test viral vector to the reference viral vector standard. In some of the provided embodiments, the adjusted amount of the test viral vector is a serial dilution of the viral vector. In some of the provided embodiments, the serial dilution of the viral vector is a serial dilution based on vector volume. In some of the provided embodiments, the serial dilution is a serial dilution based on vector titer. In some of the provided embodiments, the viral vector titer is a functional titer, and the functional titer may be quantified by an in vitro plaque assay. In some of the provided embodiments, the viral vector titer is a physical titer, and the physical titer may be quantified via DNA or RNA quantification by PCR. In some of the provided embodiments, the viral vector titer is quantified as infectious units (IU) per unit of viral vector volume. In some of the provided embodiments, the serial dilutions are based on the multiplicity of infection (MOI) of the viral vector. In some of the provided embodiments, the MOI is quantified via the viral vector titer, optionally functional titer, per permissible number of cells in culture conditions suitable for infection.

[0011] In some of the provided embodiments, the amount of the test viral vector is the ratio of the viral vector concentration to the number of cells in the population of reporter T cells. In some of the provided embodiments, the adjusted amount of the test viral vector is the ratio of a constant viral vector concentration to the number of cells in the population of reporter T cells. In some of the provided embodiments, the amount of the test viral vector is the volume of the test viral vector. In some of the provided embodiments, the amount of the test viral vector is the titer of the test viral vector. In some of the provided embodiments, the amount of the test viral vector is the MOI of the test viral vector. In some of the provided embodiments, the MOI is between about 0.001 and 10 particles / cell, optionally 0.01 or about 0.01, 0.1 or about 0.1, 1.0 or about 1.0, or 10 or about 10 particles / cell, or any value between any of the foregoing.

[0012] In some of the provided embodiments, the reporter T cells are immortalized cell lines. In some of the provided embodiments, the reporter T cells are Jurkat cell lines or derivatives thereof. In some of the provided embodiments, the Jurkat cell lines or derivatives thereof are Jurkat cell clone E6-1.

[0013] In some of the provided embodiments, the regulatory element comprises a response element or elements recognized by a transcription factor activated upon signaling through the ITAM-containing domain of the recombinant receptor induced by a recombinant receptor stimulating agent. In some of the provided embodiments, the T cell transcription factor is selected from the group consisting of Nur77, NF-κB, NFAT, or AP1. In some of the provided embodiments, the T cell transcription factor is Nur77.

[0014] In some of the provided embodiments, the transcriptional regulatory element comprises a Nur77 promoter or a portion thereof containing a response element(s) recognized by a transcription factor. In some of the provided embodiments, the transcriptional regulatory element is a transcriptional regulatory element within the endogenous Nur77 locus in the T cell. In some of the provided embodiments, a nucleic acid sequence encoding a reporter molecule is integrated into the genome of the reporter T cell at or near the endogenous locus encoding Nur77, wherein the reporter molecule is operably linked to a transcriptional regulatory element at the endogenous Nur77 locus. In some of the provided embodiments, the nucleic acid sequence encoding the reporter molecule is integrated by a) introducing a genetic disruption at one or more target sites at or near the endogenous locus encoding Nur77, and b) introducing a template polynucleotide comprising a nucleic acid encoding the reporter molecule for knock-in of the reporter molecule at the endogenous locus by homology-directed repair (HDR).

[0015] In some of the provided embodiments, the genetic disruption is induced by a CRISPR-Cas9 combination that specifically binds to, recognizes, or hybridizes with a target site. In some of the provided embodiments, the RNA-guided nuclease comprises a guide RNA (gRNA) having a targeting domain that is complementary to the target site. In some of the provided embodiments, the nucleic acid encoding the reporter is present in the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77. In some of the provided embodiments, the one or more target sites comprise the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 3) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 4), and / or the nucleic acid is present in the genome at a site that comprises the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 3) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 4).

[0016] In some of any of the provided embodiments, the reporter molecule is or includes luciferase, β-galactosidase, chloramphenicol acetyltransferase (CAT), β-glucuronidase (GUS), or modified forms thereof. In some of any of the provided embodiments, the reporter molecule is luciferase, optionally firefly luciferase. In some of any of the provided embodiments, the nucleic acid sequence encoding the reporter molecule further encodes one or more markers that are or include a transduction marker and / or a selection marker. In some of any of the provided embodiments, the transduction marker includes a fluorescent protein, optionally eGFP.

[0017] In some of the provided embodiments, the reference viral vector standard is a validated viral vector lot that represents the same manufacturing process as the test viral vector. In some of the provided embodiments, the reference viral vector standard is a viral vector lot produced under Good Manufacturing Practice (GMP). In some of the provided embodiments, the evaluation of the reference viral vector standard is performed in parallel with the test viral vector in an assay.

[0018] In some of the provided embodiments, the intracellular signaling domain is or comprises the intracellular signaling domain of a CD3 chain or a signaling portion thereof. In some of the provided embodiments, the intracellular signaling domain is or comprises the CD3-zeta (CD3ζ) chain or a signaling portion thereof. In some of the provided embodiments, the intracellular signaling region further comprises a costimulatory signaling region. In some of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of the provided embodiments, the costimulatory signaling region comprises the intracellular signaling domain of CD28, 4-1BB, or ICOS or a signaling portion thereof. In some of the provided embodiments, the recombinant receptor is an engineered T cell receptor (eTCR). In some of the provided embodiments, the recombinant receptor is a chimeric antigen receptor (CAR).

[0019] In some of any of the provided embodiments, the recombinant receptor stimulating agent is or is a binding molecule that is or comprises the target antigen or extracellular domain-binding portion thereof of the recombinant receptor, appropriately the recombinant antigen. In some of the provided embodiments, the binding molecule is or comprises the extracellular domain-binding portion of the antigen, the extracellular domain-binding portion comprising an epitope recognized by the recombinant receptor. In some of the provided embodiments, the recombinant receptor stimulating agent is or comprises a binding molecule that is specific for the extracellular target-binding domain of the recombinant receptor. In some of the provided embodiments, the recombinant receptor stimulating agent is or comprises an antibody that is specific for the extracellular target-binding domain of the recombinant receptor. In some of the provided embodiments, the recombinant receptor stimulating agent is or comprises a binding molecule that is an anti-idiotypic antibody specific for the extracellular antigen-binding domain of the recombinant receptor. In some of the provided embodiments, the recombinant receptor stimulating agent is or comprises a binding molecule that is an anti-idiotypic antibody specific for the extracellular antigen-binding domain of the recombinant receptor.

[0020] In some of the provided embodiments, the recombinant receptor stimulator is immobilized or attached to a solid support. In some of the provided embodiments, the solid support is a vessel in which multiple incubations are performed, optionally the surface of a well of a microwell plate. In some of the provided embodiments, the solid support is a bead.

[0021] In some of the provided embodiments, the beads are obtained from a composition having a binding molecule concentration of between 0.5 μg / mL and 500 μg / mL, or between about 0.5 μg / mL and about 500 μg / mL (inclusive), optionally 5 or about 5 μg / mL, 10 or about 10 μg / mL, 25 or about 25 μg / mL, 50 or about 50 μg / mL, 100 or about 100 μg / mL, or 200 or about 200 μg / mL, or any value therebetween. In some of the provided embodiments, the beads are added at a ratio of reporter T cells to beads of 5:1 to 1:5, or about 5:1 to about 1:5, inclusive. In some of the provided embodiments, the beads are added at a ratio of reporter cells to beads of 3:1 to 1:3, or 2:1 to 1:2, or about 3:1 to about 1:3, or about 2:1 to about 1:2. In some of any of the provided embodiments, the beads are added at a ratio of reporter cells to beads that is 1:1 or about 1:1.

[0022] In some of the provided embodiments, the recombinant receptor stimulator is a target-expressing cell, and the cell may be a clone derived from a cell line or a primary cell obtained from a subject. In some of the provided embodiments, the target-expressing cell is a cell line. In some embodiments, the target is an antigen of the recombinant receptor, and thus, in some cases, the target-expressing cell is an antigen-expressing cell. In some of the provided embodiments, the target-expressing cell is a cell that may have been transduced to express the target of the recombinant receptor. In some of the provided embodiments, the target-expressing cell is added at a ratio of 1.1 to 10:1, or about 1:1 to about 10:1, of antigen-expressing cells to reporter T cells. In some of the provided embodiments, the target-expressing cell is added at a ratio of 1:1 to 6:1, or about 1:1 to about 6:1, of target-expressing cells to reporter T cells.

[0023] In some of the provided embodiments, the recombinant receptor stimulator is an antigen-expressing cell, and the cell may be a clone derived from a cell line or a primary cell taken from a subject. In some of the provided embodiments, the antigen-expressing cell is a cell line. In some of the provided embodiments, the cell line is a tumor cell line.

[0024] In some of any of the provided embodiments, the antigen-expressing cells are cells that may have been transduced to express the antigen of the recombinant receptor. In some of the provided embodiments, the antigen-expressing cells are added at a ratio of antigen-expressing cells to reporter T cells of 1.1 to 10:1 or about 1:1 to about 10:1. In some of the provided embodiments, the antigen-expressing cells are added at a ratio of antigen-expressing cells to reporter T cells of 1:1 to 6:1 or about 1:1 to about 6:1.

[0025] In some of the provided embodiments, the multiple incubations are performed in flasks, tubes, or multi-well plates. In some of the provided embodiments, the multiple incubations are each performed individually in wells of a multi-well plate. In some of the provided embodiments, the multi-well plate is a 96-well plate, a 48-well plate, a 12-well plate, or a 6-well plate.

[0026] In some of the provided embodiments, the detectable signal is measured using a plate reader. In some of the provided embodiments, the detectable signal is luciferase luminescence and the plate reader is a luminometer plate reader.

[0027] In some of the provided embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a retroviral vector. In some of the provided embodiments, the viral vector is a retroviral vector. In some of the provided embodiments, the viral vector is a lentiviral vector. In some of the provided embodiments, the lentiviral vector is derived from HIV-1.

[0028] In some of any of the provided embodiments, the detectable signal is luciferase luminescence. [Brief explanation of the drawings]

[0029] [Figure 1A] Figure 1A shows an exemplary vector potency assay in which transduced reporter cells are incubated with antigen-expressing target cells for a period of time, followed by the addition of luciferase substrate. Figure 1B shows the results of testing the expression of enhanced green fluorescent protein (EGFP) and luciferase enzyme activity in the presence of activating agonists and substrates in several exemplary Jurkat reporter cells containing the Nur77-luciferase-EGFP knock-in reporter. Figure 1C shows the dose-dependent curve of luciferase activity in exemplary Jurkat reporter cells in the presence of decreasing PMA / ionomycin concentrations. [Figure 1B] Figure 1A shows an exemplary vector potency assay in which transduced reporter cells are incubated with antigen-expressing target cells for a period of time, followed by the addition of luciferase substrate. Figure 1B shows the results of testing the expression of enhanced green fluorescent protein (EGFP) and luciferase enzyme activity in the presence of activating agonists and substrates in several exemplary Jurkat reporter cells containing the Nur77-luciferase-EGFP knock-in reporter. Figure 1C shows the dose-dependent curve of luciferase activity in exemplary Jurkat reporter cells in the presence of decreasing PMA / ionomycin concentrations. [Figure 1C]Figure 1A shows an exemplary vector potency assay in which transduced reporter cells are incubated with antigen-expressing target cells for a period of time, followed by the addition of luciferase substrate. Figure 1B shows the results of testing the expression of enhanced green fluorescent protein (EGFP) and luciferase enzyme activity in the presence of activating agonists and substrates in several exemplary Jurkat reporter cells containing the Nur77-luciferase-EGFP knock-in reporter. Figure 1C shows the dose-dependent curve of luciferase activity in exemplary Jurkat reporter cells in the presence of decreasing PMA / ionomycin concentrations. [Figure 2A] Figure 2A shows an exemplary three-plate assay format for a vector potency assay. Figure 2B shows an exemplary dose-response curve for an exemplary test sample, with vector volume (in microliters) plotted on the x-axis and relative light units (RLU) plotted on the y-axis, which is directly proportional to the vector function. Figure 2C shows the dose-response curves for the test and reference samples, as well as the 50% effective concentration (EC50) of the test sample compared to the EC50 of the reference standard. Figure 2D further shows an exemplary dose-response curve for cells transduced with a CD19-targeted CAR. [Figure 2B] Figure 2A shows an exemplary three-plate assay format for a vector potency assay. Figure 2B shows an exemplary dose-response curve for an exemplary test sample, with vector volume (in microliters) plotted on the x-axis and relative light units (RLU) plotted on the y-axis, which is directly proportional to the vector function. Figure 2C shows the dose-response curves for the test and reference samples, as well as the 50% effective concentration (EC50) of the test sample compared to the EC50 of the reference standard. Figure 2D further shows an exemplary dose-response curve for cells transduced with a CD19-targeted CAR. [Figure 2C]Figure 2A shows an exemplary three-plate assay format for a vector potency assay. Figure 2B shows an exemplary dose-response curve for an exemplary test sample, with vector volume (in microliters) plotted on the x-axis and relative light units (RLU) plotted on the y-axis, which is directly proportional to the vector function. Figure 2C shows the dose-response curves for the test and reference samples, as well as the 50% effective concentration (EC50) of the test sample compared to the EC50 of the reference standard. Figure 2D further shows an exemplary dose-response curve for cells transduced with a CD19-targeted CAR. [Figure 2D] Figure 2A shows an exemplary three-plate assay format for a vector potency assay. Figure 2B shows an exemplary dose-response curve for an exemplary test sample, with vector volume (in microliters) plotted on the x-axis and relative light units (RLU) plotted on the y-axis, which is directly proportional to the vector function. Figure 2C shows the dose-response curves for the test and reference samples, as well as the 50% effective concentration (EC50) of the test sample compared to the EC50 of the reference standard. Figure 2D further shows an exemplary dose-response curve for cells transduced with a CD19-targeted CAR. [Figure 3] Figure 3 depicts an exemplary dose-response curve for cells transduced with a BCMA-targeting CAR, with vector MOI (IU / cell) plotted on the x-axis and relative luminescence units plotted on the y-axis. [Figure 4A] FIG. 4A depicts the calculated best-fit line of the potency assay as described, and the corresponding residual distribution is shown in FIG. 4B. [Figure 4B] FIG. 4A depicts the calculated best-fit line of the potency assay as described, and the corresponding residual distribution is shown in FIG. 4B. [Figure 5] FIG. 5 depicts the specificity of the provided potency assay as determined by detectable signal from the reference standard but not from the non-specific vector, as determined by measuring relative light units (RLU). [Figure 6]Figure 6 shows the stability-indicating specificity of the provided potency assay as determined by assessing vector potency of viral vectors after at least one imposed stress condition. The results demonstrate a decrease in vector potency, indicating the specificity of the assay as an indicator of stability. [Figure 7] FIG. 7 depicts exemplary readouts across four independent assays performed by separate operators. DETAILED DESCRIPTION OF THE INVENTION

[0030] Provided herein are methods for assessing or determining the relative efficacy of viral vectors, such as those used to transduce reporter cells (e.g., reporter cell compositions). Provided embodiments relate to methods that use engineered reporter cells, such as those that express recombinant proteins, such as those that express recombinant receptors. Receptors can include chimeric receptors, e.g., chimeric antigen receptors (CARs), and other transgenic antigen receptors, including transgenic T cell receptors (TCRs).

[0031] In some contexts, the provided embodiments, including cells, methods, kits, and articles of manufacture, can be adapted to assess the efficacy of different types of viral vectors, hi some embodiments, the methods can be used to assess the efficacy of multiple viral vector compositions, e.g., multiple viral vector compositions with different properties or efficacies.

[0032] In some embodiments, methods employ transduced reporter cells, e.g., reporter T cells, containing a reporter, such as a reporter enzyme, that is responsive to a signal via an intracellular signaling region of a recombinant receptor, e.g., a primary activation signal in T cells, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain containing an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the reporter cells, e.g., reporter T cells, have a reporter that is responsive to a signal via an intracellular signaling region of a receptor, in some embodiments, a recombinant receptor. In some embodiments, methods involve the use of such cells. In some embodiments, the reporter T cells comprise a nucleic acid sequence encoding the reporter molecule operably linked to a transcriptional regulatory element of an endogenous locus encoding the reporter molecule or Nur77. In some embodiments, the reporter T cells contain reporter molecule(s) that have been knocked into the endogenous Nur77 locus, such that expression of the reporter(s) is controlled by the endogenous transcriptional regulatory element of the Nur77 gene.

[0033] Cell-based therapies, including adoptive T cell therapies (e.g., those involving the administration of cells expressing chimeric receptors, e.g., chimeric antigen receptors (CARs) and / or other recombinant antigen receptors, specific for a disease or disorder of interest, as well as other adoptive immune cell and adoptive T cell therapies), can be effective in treating cancer and other diseases and disorders. For cell and gene therapies, one aspect of manufacturing is the vector used to introduce a gene of interest into cells for administration to a patient or used directly as a therapeutic composition in a patient. Inherent in the generation of viral vectors and their use in downstream therapies is the complexity of viral vectors, which require in-process characterization to limit lot-to-lot variability. In certain contexts, available approaches for assessing the efficacy of such vectors may be unsatisfactory in one or more of cost, reproducibility, precision, or practicality within the framework of Good Manufacturing Practices (GMP).

[0034] Current techniques for measuring vector potency are inconsistent, cost prohibitive, and poorly reproducible. Unlike traditional biologics, viral vectors contain both protein and nucleic acid components. As a result, there are numerous detection methods available that target either the viral genome or viral proteins. Methods for characterizing viral vectors include DNA hybridization, real-time PCR (qPCR, ddPCR), optical density (A 260 / 280 These include determining physical viral titers by means known in the art, such as PCR, NanoSight, and HPLC. In some embodiments, quantitative PCR (qPCR) can be used to measure vector potency as a measure of transgene expression. qPCR relies on a plasmid DNA standard curve to calculate viral titers, which can result in batch-to-batch variation. Digital droplet PCR (ddPCR) does not quantify from a standard curve, but the choice of PCR target sequence, as well as primer design, can have a significant impact on the robustness of any PCR-based strategy. Enzyme-linked immunosorbent assay (ELISA) can be used to measure viral proteins present in a sample but is dependent on the availability of antibodies of the appropriate serotype. Because molecular assays are affected by numerous experimental factors that can directly affect the accuracy of titer and / or potency calculations, physical titers are often subject to significant variability. These standards and controls are crucial, as variability is often observed in lot-to-lot viral vector production.

[0035] In some embodiments, viral vectors can also be assessed by measuring the infectious or functional titer of the viral composition. Infectious titer can be measured using plaque assays, fluorescent focus assays, end-point dilution assays (TCID 50Functional titers can be measured by several cell-based assays known to those skilled in the art, including ELISA or other cell-based assays. Generally, these cell-based assays are highly product-specific, as indicator or reporter cells are transfected with the viral vector and transgene expression is measured (e.g., by RT-PCR, ELISA, or FACS). In some embodiments, functional titers are expressed as transducing units per mL (TU / mL) of lentiviral or retroviral vector. Similarly, vector titers may also commonly be expressed as plaque-forming units per mL (PFU / mL) or infectious units per mL (IFU / mL). The latter term is used for viral vectors that do not lyse cell membranes and therefore are not compatible with standard plate-based plaque assays. However, functional titers usually require a significant amount of time to determine and are often considered impractical during the intermediate or initial stages of viral vector production.

[0036] In some aspects, the efficacy of viral vectors is established using various cell-based assays, although the assay outputs may vary. For example, in some cases, viral vector efficacy is assessed by determining the degree or percentage of CAR expression or evaluating cytokine production. In some embodiments, such assays may be long in duration and / or subject to high variability (e.g., 20-30% predictability). Furthermore, many existing assays are not performed in a relative format, thereby not accounting for day-to-day variability. This means that the risk with many existing viral vector efficacy assays is that results may be variable from assay to assay, even when derived from the same test viral vector.

[0037] Another important consideration in viral vector analytics is the relatively small lot size, which limits the availability of sufficient material for method development, assay qualification / validation, and stability testing. The amount of material generated during viral vector manufacturing is significantly less than that generated during the manufacture of traditional biologics such as monoclonal antibodies (King et al. "Viral Vector Characterization: A Look at Analytical Tools" CellCultureDish.Com, October 2018). Therefore, there is a need to provide more effective methods for assessing viral vector potency. In some embodiments, the provided methods allow potency to be determined more easily, quickly, and reliably.

[0038] Therefore, in some contexts, the ability to efficiently and reliably evaluate the efficacy of viral vectors can be a useful tool for the creation of cell- and gene-based therapies.Improved strategies are also needed to evaluate the efficacy of viral vectors produced from different processes, including different production lots and relatively fast and reliable methods.The provided method can be used to evaluate the release of genetic material for use in the engineering of cell therapies, including T cell therapies.

[0039] The provided embodiments for assessing viral vector efficacy are particularly useful in conjunction with viral vectors used to deliver certain transgenes into T cells encoding recombinant receptors, such as CARs, that contain the intracellular signaling domain of a T cell receptor (TCR) component and / or a signaling domain comprising an immunoreceptor tyrosine-based activation motif (ITAM). The provided reporter cells contain a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor that is responsive to the transcription factor induced by signaling upon stimulation of such a signaling domain. In some embodiments, expression of the reporter(s), among other parameters, can be assessed after incubation of the reporter T cells in the presence or absence of a recombinant receptor stimulating agent that binds to the binding domain of the T cell receptor and / or an agent that induces or is inducible to signal through the intracellular signaling region of the receptor.

[0040] The provided embodiments are based on the observation that, in some contexts, expression of the endogenous Nur77 gene is substantially unaffected or unaffected by other signaling pathways that may act cell-intrinsically and / or cell-extrinsically and may not depend on signaling through a recombinant receptor, e.g., cytokine signaling or toll-like receptor (TLR) signaling (see, e.g., Ashouri et al., (2017) J. Immunol. 198:657-668). In some contexts, Nur77 expression is sensitive to signals from primary activation signals in T cells, signaling domains of T cell receptor (TCR) components, and / or immunoreceptor tyrosine-based activation motif (ITAM)-containing signaling domains. In some contexts, the response of the Nur77 reporter is dose-responsive to signals through the signaling domain. Furthermore, in some embodiments, the provided reporter T cells contain a nucleic acid sequence encoding a reporter molecule(s) knocked into the endogenous Nur77 locus, providing a stable reporter cell line that can produce consistent results independent of, for example, the location or copy number of random genomic integration and / or loss of the reporter. Such reporter cells can be used to screen the efficacy of multiple viral vectors simultaneously with a consistent readout.

[0041] In certain embodiments, the assay is performed using reporter cells, where the reporter molecule is an enzyme such as luciferase. An advantage of enzyme-based assays, such as luminescence-based assays, is that they can output signals in the several-log range, whereas fluorescence-based reporters are often not bright enough to provide such a quantitative range. Furthermore, luminescence-based detection methods can also provide high sensitivity and low background intensity. Furthermore, luciferase or other enzymes are more compatible with plate-based assays, can be measured in solution, and offer the potential for rapid readout. Furthermore, due to the dose-responsiveness of signals induced by T cell transcription factors, particularly those provided by the Nur77 reporter system, the high sensitivity and wide detection range of luminescence-based reporters, along with the wide linear range, including the true linear range of viral vector potency, are possible with the provided methods. These features of the provided assays offer advantages not possible using existing methods for measuring viral vector potency.

[0042] The methods provided herein are designed to more comprehensively evaluate the relative efficacy of viral vectors. The methods provided herein are designed to provide a more biologically relevant measure of viral vector efficacy. In some embodiments, the efficacy of viral vector compositions determined according to the methods described herein may provide an improved measure of manufacturing control and / or variability, which in turn may allow for improved evaluation of vector release for use in genetic engineering, including in conjunction with evaluating vector stability.

[0043] In some embodiments, the methods provided herein reduce or eliminate sources of variability.For example, the methods provided herein are robust to the variability that may be caused by plate position bias, operator bias and / or daily sampling or testing.In some cases, eliminating variability such as plate position bias, operator bias and / or sampling or testing variability allows comparison of viral vector lot compositions.

[0044] The methods provided herein include assay formats that involve a series of incubations in which different modulating ratios of viral vectors are introduced into cells of a reporter cell composition for evaluation of reporter signal induced by a recombinant receptor stimulating agent (e.g., a binding molecule). In some embodiments, measuring potency involves measuring the detectable signal of a reporter molecule stimulated by binding of a recombinant receptor stimulating agent (e.g., a binding molecule) to a recombinant receptor across multiple modulating ratios of viral vector. The ability of the method to evaluate reporter activity at different modulating ratios of viral vector allows for the determination, estimation, and / or extrapolation of the potency of a viral vector lot in response to recombinant receptor (i.e., antigen)-specific stimulation. In some embodiments, a range of measurements can be used to extract, estimate, and / or determine the potency of a viral vector, as measured by how engineered cells of a particular reporter cell composition respond to different levels of recombinant receptor stimulation (i.e., modulated vector).

[0045] In some embodiments, the potency of a viral vector is expressed as a value or measure of the modulation ratio and / or amount or concentration (e.g., titer) or volume of the viral vector determined based on the detectable signal (e.g., luminescence) of the reporter molecule. In some embodiments, the potency of a viral vector composition is a value or measure of the modulation ratio and / or amount or concentration or volume of the viral vector at which a particular value of detectable signal (e.g., luminescence signal) occurs (e.g., half-maximal value (e.g., 50% of maximum activity)). In some embodiments, the potency of a viral vector composition is the modulation ratio at which a particular value of detectable signal (e.g., half-maximal value (e.g., 50% of maximum activity) occurs. In some embodiments, the potency of a viral vector composition is the concentration of viral vector at which a particular (e.g., half-maximal) value of detectable signal (e.g., luminescence signal) occurs. In some embodiments, the method is volume-based modulation, and the potency of the viral vector composition is the volume of a particular viral vector lot at which a particular (e.g., half-maximal) value of recombinant receptor-dependent activity occurs. In some embodiments, a particular (e.g., half-maximal) value of detectable signal (e.g., luminescence) corresponds to a particular effective stimulation (e.g., 50% of effective stimulation (ES)) of reporter T cells according to the measured detectable signal from the reporter molecule present in the reporter cells. 50 )) reflects the adjusted ratio, concentration (e.g., titer) and / or volume of viral vector at which the

[0046] In some embodiments, the potency of a viral vector is expressed as a value or measure of the adjusted ratio and / or amount or concentration (e.g., titer) or volume of the viral vector determined based on the detectable signal (e.g., luminescence) of the reporter molecule. In some embodiments, the potency of a viral vector composition is a value or measure of the adjusted ratio and / or amount or concentration or volume of the viral vector at which a specific (e.g., half-maximal value (e.g., 50% of maximum activity)) of a detectable signal (e.g., luminescence signal) occurs. In some embodiments, the potency of a viral vector composition is the adjusted ratio at which a specific (e.g., half-maximal value (e.g., 50% of maximum activity)) of a detectable signal occurs. In some embodiments, the potency of a viral vector composition is the concentration of the viral vector at which a specific (e.g., half-maximal) value of a detectable signal (e.g., luminescence signal) occurs. In some embodiments, the method is based on multiplicity of infection (MOI), and the potency of the viral vector composition is the IU / cell ratio of a specific viral vector lot at which a specific (e.g., half-maximal) value of recombinant receptor-dependent activity occurs. In some embodiments, a particular (e.g., half-maximal) value of detectable signal (e.g., luminescence) corresponds to a particular effective stimulation (e.g., 50% effective stimulation (ES)) of reporter T cells according to the measured detectable signal from the reporter molecule present in the reporter cells. 50 )) reflects the adjusted ratio, concentration (e.g., MOI) and / or IU / cell ratio of viral vectors at which the viral vectors are expressed.

[0047] In some embodiments, the efficacy of a viral vector composition is relative efficacy. For example, the modulation ratio at which the half-maximal detectable signal for a viral vector is measured can be compared to the modulation ratio at which the half-maximal detectable signal for a reference standard or a control viral vector is measured. Of course, where appropriate, the concentration, amount, volume, or MOI of the viral vector can be used instead of the modulation ratio. In some embodiments, the reference standard or control is a viral vector with a known and / or validated modulation ratio that produces a specific (e.g., half-maximal) detectable signal in the assay. In some embodiments, the reference standard or control is a commercially available viral vector with a modulation ratio at which a specific (e.g., half-maximal) detectable signal has been determined, for example, using a method as described herein. In some embodiments, the reference standard or control is a different viral vector with a modulation ratio at which a specific (e.g., half-maximal) detectable signal has been determined, for example, using a method as described herein. In some embodiments, the different viral vector compositions contain nucleic acids encoding the same recombinant receptor that binds to the same target as the test viral vector. In some embodiments, the reference viral vector standard is produced from a process determined to be representative of the manufacturing process for the test viral vector. In some embodiments, the reference viral vector standard is GMP (Good Manufacturing Practice) grade. In some embodiments, the relative potency is a ratio determined by dividing the adjusted ratio that produces a particular (e.g., half-maximal) value of the test viral vector by the adjusted ratio that produces a particular (e.g., half-maximal) value of the reference standard or control. In some embodiments, the relative potency is a percentage determined by dividing the adjusted ratio that produces a particular (e.g., half-maximal) value of the test viral vector composition by the adjusted ratio that produces a particular (e.g., half-maximal) value of the reference standard, and multiplying by 100.

[0048] The methods provided herein, including assays for evaluating the efficacy of viral vector compositions, allow for the comparison of different viral vector compositions, including reference standards. The ability to compare viral vector compositions not only identifies viral vector compositions with improved, optimal, and / or consistent efficacy, but also provides a method for identifying candidate viral vector compositions for further development and / or analysis, identifying manufacturing processes and procedures that result in viral vector compositions with improved or optimal efficacy, identifying manufacturing procedures or processes that result in viral vector compositions with consistent efficacy, and / or estimating the inherent variability of manufacturing procedures. In certain embodiments, the method can be used in a release assay to confirm that viral vector genetic material is suitable for use in connection with methods for manipulating cell therapy using recombinant receptors (e.g., CAR).

[0049] All publications, including patent documents, scientific articles, and databases, referenced in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication was individually incorporated by reference. To the extent that a definition set forth herein contradicts or otherwise conflicts with a definition set forth in a patent, application, published application, or other publication incorporated herein by reference, the definition set forth herein takes precedence over the definition incorporated herein by reference.

[0050] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0051] I. Methods for assessing viral vector efficacy Provided herein is a method for evaluating the efficacy of a test viral vector, for example, a viral vector encoding a recombinant receptor (e.g., a CAR). Provided herein is a reporter T cell composition containing T cells (e.g., CD3+, CD4+, CD8+ T cells) transfected with a test viral vector to express a recombinant receptor (e.g., a CAR), and the efficacy of the test viral vector is measured using an assay comprising multiple incubations, each of which comprises culturing cells of the reporter cell composition containing a recombinant receptor stimulating agent, such as an antigen, an antigen-expressing cell, or a cell engineered to express a recombinant receptor with other binding domains capable of binding to the recombinant receptor, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor stimulates a detectable signal in the reporter cell. In some embodiments, the detectable signal is the expression of an enzyme that converts an available substrate into a detectable product, i.e., an enzymatic signal such as a luciferase reaction.

[0052] The methods provided herein for determining potency can be performed using replicates. For example, assays can be performed two, three, four, five, or more times. In some embodiments, replicates are used to confirm the accuracy and / or precision of the assay, including the consistency of the measured and / or determined potency and / or relative potency of the detectable signal of the test viral vector. In some embodiments, a single assay is performed by running the assay in duplicate or triplicate with a particular test viral vector. In some embodiments, the assay is performed in duplicate. In some embodiments, the assay is performed in triplicate. In some cases where an assay is performed in duplicate or triplicate, for example, the measured detectable signal from each of the replicates is used to provide a statistical measure of the measured detectable signal. For example, in some cases, the mean, median, standard deviation, and / or variance of each measure of the detectable signal is determined. In some embodiments, the mean of each measure of the detectable signal is determined. In some embodiments, the standard deviation of each measure of the detectable signal is determined. In some embodiments, the average measure of the detectable signal is fitted using a mathematical model to generate a curve of the detectable signal. In some embodiments, the curve is normalized to the mean maximum. In some embodiments, the mean modulation ratio that results in a half-maximal detectable signal in the assay is the potency of the test viral vector. In some embodiments, the potency of the test viral vector is the relative potency determined by taking the mean modulation ratio that results in a half-maximal detectable signal in the assay and comparing the mean modulation ratio to the single or mean modulation ratio that results in a half-maximal detectable signal for a reference viral vector. In some embodiments, the relative potency is the mean potency of the test viral vector divided by the single or mean potency of the reference viral vector. In some embodiments, the relative potency is expressed as a ratio. In some embodiments, the relative potency is expressed as a percentage.

[0053] A. Transducing the Modified Viral Vector into Reporter Cells In some embodiments, multiple populations of reporter T cells are generated, and a certain number of cells of the reporter composition are introduced, e.g., transduced, with different or adjusted amounts of the test viral vector to generate a plurality of different modulation ratios. In some embodiments, each of the multiple populations of reporter T cells contains a different adjusted amount of the viral vector, e.g., a different ratio, concentration, volume, or MOI of the test viral vector. In some embodiments, each of the multiple populations of reporter T cells is generated by introducing a certain number of cells of the reporter cells with different amounts, concentrations, MOIs, or volumes of the test viral vector to generate a plurality of different modulation ratios.

[0054] In some embodiments, the adjusted amount of test viral vector is a serial dilution of the viral vector. For example, a range of serially diluted amounts (e.g., volume, titer or MOI) of the viral vector is evaluated among each of multiple populations of reporter cells. In some embodiments, the serial dilution of the viral vector is based on the vector volume, and in some embodiments, the serial dilution is based on the viral vector titer.

[0055] In some embodiments, the adjusted amount is the ratio of a fixed amount of the test viral vector to the number of cells in each of multiple populations of reporter cells.

[0056] Methods for characterizing viral vectors include any of a variety of known methods, such as DNA hybridization or PCR methods such as real-time PCR (qPCR, ddPCR), optical density (A 260 / 280), NanoSight, and HPLC, among others. In some embodiments, physical titer can be performed by quantifying viral RNA or DNA using PCR. In some aspects, quantitative PCR (qPCR) can be used to measure vector potency as a measure of transgene expression. qPCR relies on a plasmid DNA standard curve to calculate viral titer, which can result in batch-to-batch variation. Digital droplet PCR (ddPCR) does not quantify from a standard curve, but the selection of PCR target sequence, as well as primer design, can have a significant impact on the robustness of any PCR-based strategy. Enzyme-linked immunosorbent assay (ELISA) can be used to measure viral proteins present in a sample but is dependent on the availability of antibodies of the appropriate serotype. Because molecular assays are affected by numerous experimental factors that can directly affect the accuracy of titer and / or potency calculations, physical titers are often subject to significant variability. These standards and controls are crucial because variability is often observed in lot-to-lot viral vector manufacturing. In some embodiments, the viral vector titer is a physical titer.

[0057] In some embodiments, viral vectors can also be assessed by measuring the infectious or functional titer of the viral composition. Infectious titer can be measured using plaque assays, fluorescent focus assays, end-point dilution assays (TCID 50The functional titer can be measured by several cell-based assays known to those skilled in the art, including ELISA or other cell-based assays. Generally, these cell-based assays are highly product-specific, as indicator or reporter cells are transfected with the viral vector and transgene expression is measured (e.g., by RT-PCR, ELISA, or FACS). In some aspects, functional titer is expressed as transducing units per mL (TU / mL) of lentiviral or retroviral vector. Similarly, vector titer may also commonly be expressed as plaque-forming units per mL (PFU / mL) or infectious units per mL (IFU / mL). The latter term is used for viral vectors that do not lyse cell membranes and therefore are not compatible with standard plate-based plaque assays. However, functional titers usually require a significant amount of time to determine and are often considered impractical during the intermediate or initial stages of viral vector production. In some embodiments, the viral vector titer is a functional titer. In some embodiments, the viral vector titer is quantified in IU / mL.

[0058] In some embodiments, the serial dilution of the viral vector is based on the multiplicity of infection (MOI) of the viral vector. In some embodiments, the serial dilution is based on the viral vector titer. In some aspects, the MOI of the viral vector can be determined as the ratio of viral vector particles to cells present in a population (e.g., the ratio of test viral vector particles to cells in a population of permissive cells). Quantification of viral vector particles can be quantified via titer in some aspects. In some embodiments, the MOI is quantified using functional titer. In some aspects, the functional titer can be determined using the methods described above, including plaque assays or other in vitro infection assays known in the art.

[0059] In some embodiments, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more incubations, or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more incubations are performed, each containing a different ratio of test viral vector to reporter cells, i.e., a adjusted amount, either volume or IU / cell ratio. In some embodiments, 3 or at least 3 series of adjustments are performed, each containing a different serial dilution of the test viral vector introduced into reporter cells. In some embodiments, 6 or at least 6 series of adjustments are performed, each containing a different serial dilution of the test viral vector introduced into reporter cells. In some embodiments, 10 or at least 10 series of serial dilutions are performed, each containing a different serial dilution of the test viral vector introduced into reporter cells.

[0060] In some embodiments, a method for determining the efficacy of a viral vector comprises: a) introducing (e.g., transducing) a controlled amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each being introduced (e.g., transduced) with a different amount of the controlled test viral vector, wherein each of the reporter T cell populations comprises reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, the recombinant receptor comprising an extracellular binding domain specific for an antigen, a transmembrane domain, and comprising or complexed with an intracellular signaling region comprising an ITAM-containing domain. In provided embodiments, the method further comprises incubating each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulating agent, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling via the intracellular signaling region of the recombinant producer to generate a detectable signal from the reporter molecule. In the provided methods, the methods include measuring each of a plurality of populations of reporter T cells for a detectable signal from the reporter molecule, and then determining an adjusted amount of the test viral vector that results in a half-maximal detectable signal based on the measured detectable signal.

[0061] In some embodiments, the adjusted amount that produces half-maximal detectable signal is compared to the adjusted ratio that produces half-maximal detectable signal in a reference standard, such as a reference viral vector.For example, the adjusted ratio that produces half-maximal detectable signal in a test viral vector, determined according to the method described herein, is divided by the adjusted ratio that produces half-maximal detectable signal in the reference viral vector to obtain relative potency.In some embodiments, the relative potency is expressed as a ratio.In some embodiments, the relative potency is expressed as a percentage.

[0062] In some embodiments, provided herein is a method for determining the efficacy of a viral vector, comprising introducing (e.g., transducing) a controlled amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each being introduced (e.g., transduced) with a different amount of the controlled test viral vector, each reporter T cell population comprising reporter T cells comprising a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor, and the recombinant receptor comprising an extracellular binding domain specific for an antigen, a transmembrane domain, and an intracellular signaling region comprising an ITAM-containing domain. In the provided method, the method further comprises incubating each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulating agent, wherein binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling via the intracellular signaling region of the recombinant producer to generate a detectable signal from the reporter molecule. In provided methods, the method further includes determining the relative potency of the viral test viral vector based on the measured detectable signal by measuring each of the multiple populations of reporter T cells for a detectable signal from the reporter molecule and comparing the half-maximal detectable signal to the half-maximal detectable signal of a reference viral vector standard in the same assay.

[0063] The assays provided herein can be performed in any vessel or vessels suitable for multiple incubations. In some embodiments, the assays are performed in multi-well plates.

[0064] The conditions under which introduction (e.g., transduction) using the reporter cell composition and viral vector is carried out may include one or more of a specific medium, temperature, oxygen content, carbon dioxide content, time, and / or agents, such as nutrients, amino acids, antibiotics, and ions. The duration of introduction of the viral vector, such as transduction, is intended to be commensurate with at least the minimum amount of time for introduction of the viral vector into the reporter cells (e.g., transduction as described in Section 1.A.3). In some embodiments, introduction (e.g., transduction) is carried out for 24, 36, 48, 60, or 72 hours, about 24, 36, 48, 60, or 72 hours, or at least 24, 36, 48, 60, or 72 hours. In some embodiments, introduction (e.g., transduction) is carried out for 24 or 48 hours, about 24 or about 48 hours, or at least 24 or at least 48 hours. In some embodiments, the introduction (e.g., transduction) is carried out for 24 hours to 72 hours, or for about 24 hours to about 72 hours. In some embodiments, the introduction (e.g., transduction) is carried out for 24 hours to 48 hours, or for about 24 hours to about 48 hours.

[0065] In some embodiments, the introduction (e.g., transduction) is carried out at a temperature of about 25 to about 38°C, e.g., about 30 to about 37°C, e.g., 37°C ± 2°C or about 37°C ± 2°C. In some embodiments, the introduction (e.g., transduction) is carried out at a CO2 level of about 2.5% to about 7.5%, e.g., about 4% to about 6%, e.g., 5% ± 0.5% or about 5% ± 0.5%. In some embodiments, the introduction (e.g., transduction) is carried out at a temperature of 37°C or about 37°C and / or a CO2 level of 5% or about 5%.

[0066] 1. Reporter Cells Provided herein are cells, methods, vectors, polynucleotides, cells, polynucleotides, kits and articles of manufacture, including those related to assessing the efficacy of viral vectors, e.g., methods for assessing the activity of recombinant receptors, e.g., chimeric antigen receptors (CARs).

[0067] In some embodiments, cells such as reporter T cells are provided for evaluating the efficacy of viral vectors. In some embodiments, the reporter T cells comprise a reporter molecule(s), and expression of the reporter molecule(s) is responsive to a signal via the intracellular signaling region of a T cell receptor. In some embodiments, the provided cells comprise reporter T cells. In some embodiments, the reporter T cells contain a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of Nur77 or a variant thereof, where the transcriptional regulatory element may be a transcriptional regulatory element in the endogenous Nur77 locus in the T cell. In some aspects, the provided cells, such as the provided reporter T cells, contain a nucleic acid sequence encoding a reporter molecule(s) operably linked to a transcriptional regulatory element, e.g., a transcriptional regulatory element in an endogenous locus encoding Nur77. In some embodiments, the provided cells can be used to evaluate the activity of one or more viral vectors, for example, to screen multiple libraries of candidate receptors encoded by the vectors.

[0068] Provided embodiments also include methods for evaluating the transduction efficiency of a viral vector, e.g., using any of the provided cells or constructs. In some embodiments, the vector contains a nucleic acid encoding a recombinant receptor. In some embodiments, the recombinant receptor is a CAR. In some embodiments, the method includes incubating one or more reporter T cells, e.g., T cells each comprising: i) a recombinant receptor, e.g., a recombinant receptor that is a CAR comprising an intracellular signaling region, and ii) reporter molecule(s), wherein expression of the reporter molecule(s) is responsive to a signal via the intracellular signaling region of the recombinant receptor, and the incubation is performed in the presence and / or absence of an agent that binds to the binding domain of the recombinant receptor and / or an agent that induces or is capable of inducing a signal via the intracellular signaling region of the recombinant receptor, and evaluating the one or more reporter T cells for expression or activity of the reporter molecule(s). In some embodiments, the method can employ cells, e.g., any of the reporter T cells described herein.

[0069] In some embodiments, a plurality (and / or library) of reporter T cells comprising one or more of any of the reporter T cells generated by the methods described herein is also provided.

[0070] Also provided in some embodiments are reporter T cells, recombinant receptors, binding domains, or polynucleotides encoding recombinant receptors identified by any of the methods provided herein, or present in cells identified.

[0071] Provided herein are cells, e.g., T cell lines, containing reporter molecule(s) capable of being expressed upon a signal via the intracellular signaling region of a T cell receptor, including a recombinant receptor. Also provided are methods of using such cells, e.g., methods of using such cells to evaluate the efficacy of a viral vector. In some embodiments, the methods provided herein include evaluating the efficacy, e.g., transduction efficiency, of a vector encoding a recombinant receptor, e.g., a CAR, in a T cell. In some embodiments of the methods provided herein, the efficacy is evaluated in T cells, such as a T cell line. In some embodiments, the T cell comprises reporter molecule(s), e.g., a reporter molecule(s), capable of being expressed upon a signal via the intracellular signaling region of the T cell receptor and / or binding and / or recognition of the recombinant receptor to an antigen or epitope. In some embodiments, a reporter T cell, such as a reporter T cell line, is provided that comprises a nucleic acid sequence encoding a reporter molecule(s) operably linked to a transcriptional regulatory element of an endogenous locus encoding Nur77.

[0072] In some embodiments, T cells are provided, e.g., T cells comprising reporter molecule(s) or reporter T cells. In some embodiments of the methods provided herein, T cells, e.g., reporter T cells, are employed to evaluate the efficacy of a viral vector, e.g., transduction efficiency. In some embodiments, the T cells are a T cell line, e.g., a Jurkat-derived cell line. In some embodiments, reporter T cells derived from a T cell line are provided. In some embodiments, reporter T cells are provided that stably express a fluorophore, such as any fluorescent protein. Examples of fluorescent proteins include green fluorescent protein (GFP), yellow fluorescent protein (YFP), cerulean / cyan fluorescent protein (CYP), or enhanced GFP (eGFP). In some embodiments, the T cells are a T cell line that expresses a fluorescent protein and contains a reporter molecule, e.g., a reporter molecule capable of generating a detectable signal or catalyzing a measurable activity upon signaling via the intracellular signaling region of a recombinant receptor. Also provided are compositions containing cells, e.g., any of the reporter T cells described herein.

[0073] In some aspects, T cells or T cell compositions into which a viral vector is introduced may be referred to as "host cells" or "host cell lines." In some embodiments, the host cells are T cells. The terms "host cells," "host cell lines," and "host cell cultures" are used interchangeably and refer to cells into which an exogenous nucleic acid molecule has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and its progeny regardless of the number of passages. The progeny may not be completely identical to the parent cell in nucleic acid content and may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are also included herein.

[0074] In some embodiments, the cell or cell line is an immortalized cell line and / or a clonal cell line. In some embodiments, the cell or cell line is a transformed cell line. In some embodiments, the cell or cell line is a T cell line. In some embodiments, the cell or cell line is a cell line capable of delivering, transmitting, and / or mediating signaling via CD3. For example, the cell or cell line contains or expresses a component of a T cell receptor (TCR) signaling pathway containing CD3 or can be transduced with a CD3-containing TCR complex. In some embodiments, the cell contains or expresses a component of a signaling pathway for delivery of a signal from a primary signaling domain, a signaling domain capable of inducing a primary activation signal in T cells, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain containing an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the cell or cell line is an H9 human T lymphocyte (ATCC, HTB-176) or a Jurkat human T cell leukemia cell line (ATCC, TIB-152).

[0075] In some embodiments, the cells are cell lines, such as cell lines available from informal and commercial sources, such as the American Type Culture Collection (ATCC), the National Institute of General Medical Sciences (NIGMS), the ASHI repository, the European Collection of Cell Cultures (ECACC), or the International Histocompatibility Working (IHW) Group Cell and DNA bank. In some cases, the cell lines are commercially available. In some embodiments, the cells are cell lines or are derived from cell lines, e.g., T cell lines. In some embodiments, the cell line is a T lymphocyte or T lymphoblast cell line.For example, cells or cell lines may include Jurkat, clone E6-1 (ATCC, PTS-TIB-152(TM), TIB-152(TM)); 31E9 (ATCC, HB-11052(TM)); CCRF-CEM (ATCC, CCL-119(TM), CRM-CCL-119D(TM), CRM- CCL-119(TM), PTS-CCL-119(TM)); CCRF-HSB-2(ATCC, CCL-120.1(TM)); CEM / C1(ATCC, CRL-2265(TM)); CEM / C2(ATCC, CRL-2264(TM)); CEM-CM3(ATCC, TIB-195(TM)) ));FeT-1C(ATCC, CRL-11968(trademark));FeT-J(ATCC, CRL-11967(trademark));J.CaM1.6(ATCC, CRL-2063(trademark));J.RT3-T3.5(ATCC, TIB-153(trademark)) (trademark));Loucy (ATCC, CRL-2629(trademark));MOLT-3(ATCC, CRL-1552(trademark));MYA-1(ATCC, CRL-2417(trademark));SUP-T1(ATCC, CRL-1942(trademark));TALL-104(ATCC, CRL-11386(trademark));I 9.2;I 2.1;D1.1;J.gamma1 subline or J-Lat. In some embodiments, the cell or cell line is Jurkat, clone E6-1 (ATCC, PTS-TIB-152™, TIB-152™).

[0076] a. Manipulating reporter cells In some embodiments, the T cells contain one or more nucleic acid molecules introduced via genetic engineering, thereby expressing recombinant or engineered products of such nucleic acid molecules. In some embodiments, the nucleic acid molecules are heterologous, i.e., not normally present in the cell or sample obtained from the cell, e.g., obtained from another organism or cell that is not normally found in the cell being engineered and / or the organism from which such cell is derived. In some embodiments, the nucleic acid molecules are non-naturally occurring nucleic acids not found in nature, including those that contain chimeric combinations of nucleic acid molecules encoding various domains from multiple different cell types. In some embodiments, the T cells into which one of multiple recombinant receptors is introduced, transfected, and / or transduced are T hybridoma cells.

[0077] Also provided are a plurality of T cells or compositions of T cells. In some embodiments, the provided plurality of T cells or compositions of T cells comprise any of the T cells described herein, e.g., reporter T cells. In some embodiments, the provided plurality of T cells or compositions of T cells (e.g., reporter T cells) are engineered to stably express a fluorescent protein, e.g., eGFP.

[0078] Various methods for the introduction of genetically engineered components are well known and can be used with the provided methods and compositions. Exemplary methods include methods for the transfer of nucleic acids and stable expression of corresponding proteins, including via viral, e.g., retroviral or lentiviral, transduction, transposons, and electroporation.

[0079] In some embodiments, the methods provided herein are used in conjunction with manipulating one or more compositions of reporter T cells. In certain embodiments, the manipulation is or includes the introduction of a polynucleotide, for example, a recombinant polynucleotide encoding a recombinant protein. The introduction of a nucleic acid molecule encoding a recombinant protein, such as a recombinant receptor, into cells can be carried out using any of several known vectors. Such vectors include viral and non-viral systems, including lentiviral and gammaretroviral systems, as well as transposon-based systems such as PiggyBac or Sleeping Beauty-based gene transfer systems. Exemplary methods include methods for transferring receptor-encoding nucleic acids, including those via viral (e.g., retroviral or lentiviral), transduction, transposon, and electroporation. In some embodiments, the manipulation results in one or more manipulated compositions of reporter T cells.

[0080] b. reporter molecule In some embodiments, the cell line, e.g., a T cell line, contains reporter molecule(s) whose expression is responsive to a signal via the intracellular signaling region of a T cell receptor, i.e., hereinafter referred to as a "reporter cell," e.g., a "reporter T cell." In some embodiments, the provided cells, such as reporter T cells, contain reporter molecule(s) whose expression is responsive to a signal via the intracellular signaling region of a T cell receptor or recombinant receptor. In some embodiments, expression of the reporter molecule(s) is responsive to a signal via a primary signaling domain, a signaling domain capable of inducing a primary activation signal in a T cell, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain containing an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, expression of the reporter molecule(s) is responsive to a signal via a costimulatory signaling region, such as the intracellular signaling domain or signaling portion thereof, of a CD3 chain, optionally the CD3-zeta (CD3ζ) chain, and / or the intracellular signaling domain or signaling portion thereof, of a T cell costimulatory molecule.

[0081] In some embodiments, the provided T cells, e.g., either the reporter T cells and / or the T cells used to assess vector efficacy, contain nucleic acid sequences encoding one or more reporter molecules capable of producing a detectable signal or catalyzing a measurable activity upon signaling through the intracellular signaling region of the recombinant receptor.

[0082] In some embodiments, the detectable signal or measurable activity comprises an indicator that is altered compared to an indicator produced by the reporter molecule(s) in the reporter cell in the absence of vector transduction in the cell and / or in the presence or absence of an agent that binds to the receptor's binding domain and / or induces or is inducible to a signal via the receptor's intracellular signaling region. In some embodiments, the detectable indicator is induced or expressed, increased, decreased, changes color, or changes location in the cell compared to a signal produced by the reporter(s) in the absence of vector transduction in the cell and / or in the presence or absence of an agent that binds to the receptor's binding domain and / or induces or is inducible to a signal via the receptor's intracellular signaling region. In some embodiments, expression of the reporter molecule(s) is responsive to the quality and / or strength of a signal via the intracellular signaling region and / or binding and / or recognition of the recombinant receptor to the target antigen or epitope. Thus, in some embodiments, a reporter(s) capable of producing an indication upon signaling through the intracellular signaling region of the recombinant receptor can be used in low, medium, or high throughput screening methods to determine the efficacy, e.g., transduction efficiency, of a vector introduced into a T cell or multiple T cells.

[0083] In some embodiments, the reporter(s) can be expressed or induced to catalytically active in cells that are detected upon signal transduction via the intracellular signaling region and / or binding and / or recognition of the recombinant receptor to a target antigen or epitope, and / or upon cellular signaling transduced via an intracellular signaling region containing CD3 or a portion thereof. Generally, a signal, such as a T cell receptor activation signal, is induced or initiated upon binding of an agent, e.g., a specific antigen or epitope, that results in crosslinking and activation of a signaling complex containing CD3. The signal can then, in some cases, initiate further downstream signaling and expression of various intracellular compounds associated with antigen or epitope binding and / or activation signaling, e.g., T cell activation signaling. In some embodiments, T cell activation via the CD3 complex can lead to the induction of signaling pathways in the T cell, resulting in the production of cellular signaling and expression of products (e.g., interleukin-2) by the T cell.

[0084] In some embodiments, a "reporter molecule" or "reporter" is any molecule that is or can generate a detectable signal that is altered compared to the signal from or generated by the reporter in the presence or absence of an agent that binds to the binding domain of the receptor and / or an agent that induces or is inducible of a signal via the intracellular signaling region of the recombinant receptor, and / or in the absence of T cell activation, e.g., T cell activation via the intracellular signaling region of the receptor. In some embodiments, the detectable signal is induced or expressed, increased, decreased, suppressed, altered in color, or altered in location in the cell compared to the signal generated by the reporter in the absence of T cell activation and / or the absence of the recombinant receptor in the cell. In some embodiments, the reporter is or can generate a detectable signal in the cell, which may include light emission (e.g., fluorescence), FRET, biochemical second messengers, i.e., the concentration of a molecule (e.g., calcium), protein or gene expression, or protein secretion from the cell (e.g., IL-2). In some embodiments, the reporter is an enzyme or can catalyze a reaction within the cell that produces a measurable product or products. A variety of reporter systems for T cell function, including T cell activation, are known (see, e.g., Hoekstra et al. (2015) Trends in Immunol, 36:392-400).

[0085] In some embodiments, the reporter is a detectable moiety, such as a light-emitting or bioluminescent protein, that can be detected by using a spectrophotometer, luminometer, fluorometer, or other related method, or monitored visually. In some embodiments, the reporter is a detectable moiety, such as an enzyme that produces bioluminescence, e.g., an enzyme that can convert a substrate to emit light, e.g., luciferase or a variant thereof. Non-limiting examples of light-emitting proteins or enzymes that produce bioluminescence include, for example, luciferase, fluorescent proteins such as red, blue, and green fluorescent proteins (see, e.g., U.S. Patent No. 6,232,107, which provides GFPs from Renilla species and other species), the lacZ gene from Escherichia coli (E. coli), alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), and chloramphenicol acetyltransferase (CAT). Exemplary light-emitting reporter genes include luciferase (luc), β-galactosidase, chloramphenicol acetyltransferase (CAT), β-glucuronidase (GUS), and fluorescent proteins and variants thereof, for example, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP) such as superfold GFP (sfGFP), red fluorescent protein (RFP) such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed or DsRed2, cyan fluorescent protein (CFP), blue-green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), and yellow fluorescent protein (YFP), and variants thereof, including species variants, monomeric variants, and codon-optimized and / or enhanced variants of fluorescent proteins.Luciferases and variants thereof can include those from firefly (Photinus pyralis), sea pansy (Renilla reniformis), Photobacterium species (Vibrio fischeri, Vibrio haweyi, and Vibrio harveyi), dinoflagellates, marine copepods (Metridia longa), deep-sea shrimp (Oplophorus), and jack-o'-lantern mushrooms (Omphalotus olearius), as well as variants thereof, including codon-optimized and / or enhanced variants. In some embodiments, the reporter molecule is firefly luciferase, optionally firefly luciferase 2 (amino acid sequence set forth in SEQ ID NO:9, encoded by the nucleic acid sequence set forth in SEQ ID NO:8). In some embodiments, the reporter molecule is green fluorescent protein (GFP), optionally enhanced GFP (amino acid sequence set forth in SEQ ID NO: 11, encoded by nucleic acid sequence set forth in SEQ ID NO: 10).

[0086] In some embodiments, the reporter molecule may be other well-known genes that can be induced or expressed in T cells upon antigen or epitope binding and / or activity of a hormone or cytokine or receptor, e.g., signal transduction or activation. Expression of these reporter genes can also be monitored by measuring the level of mRNA transcribed from these genes.

[0087] In some embodiments, the reporter, such as a detectable moiety, may be directly associated with a particular recombinant receptor, e.g., a CAR, or may be a downstream signal induced by activation of the recombinant receptor, e.g., a CAR, after antigen or epitope binding, thereby providing a direct readout of the reporter's activity, e.g., signal transduction or cell activation. In some embodiments, the detectable signal in a cell induced upon antigen or epitope binding and / or signal or activity via the intracellular signaling region of the recombinant receptor is a change in the location of the detectable moiety in the cell compared to its location in the cell in the absence of binding of the antigen receptor to the recognized antigen or epitope and / or signal or activity via the intracellular signaling region of the recombinant receptor. In some aspects, a particular recombinant receptor, e.g., a CAR, may be engineered, such as operably fused to a detectable moiety whose activity is turned on and / or otherwise visualized upon association or binding to an antigen, such as an epitope. In some cases, the association of the recombinant receptor, e.g., a CAR, may result in internalization of the receptor, which can be monitored. In some embodiments, a transcription factor or other signaling molecule whose expression is induced in response to a signal or activity via the intracellular signaling region of the recombinant receptor may be engineered, such as by being operably fused to a detectable moiety whose activity is turned on and / or otherwise visualized upon association or binding to an antigen or epitope. In some cases, a signal or activity via the intracellular signaling region of the recombinant receptor, such as T cell activation and / or signaling, can result in translocation of the signal-specific transcription factor from the cytosol to the nucleus, which can be monitored. In some embodiments, the detectable moiety can be any of those described, such as a fluorescent, enzymatic, or luminescent protein.

[0088] In some embodiments, fluorescence resonance energy transfer (FRET)-based systems can be used to monitor the changes in the interaction between two molecules in cells. FRET systems that can monitor TCR association and / or T cell activation are known (see, for example, Zal and Gascoigne (2004) Curr. Opin. Immunol., 16:674-83; Yudushkin and Vale (2010) PNAS, 107:22128-22133; Ibraheem et al. (2010) Curr. Opin. Chem. Biol., 14:30-36).

[0089] In some embodiments of the methods and cells provided herein, the reporter molecule(s) are associated with, under operative control of, and / or regulated by a T cell activator. In some embodiments, the reporter molecule is encoded by a T cell activator, e.g., a nucleic acid sequence under operative control of a regulatory element, that is responsive to a signal via an intracellular signaling domain and / or the quality and / or strength of binding and / or recognition of a recombinant receptor to a target antigen or epitope. In some embodiments, a "T cell activator" is a molecule or factor, or portion thereof, that is responsive to a signal transduction via a receptor present or expressed on a T cell, e.g., a T cell receptor (TCR), antigen or epitope binding, or a recombinant receptor that includes an intracellular signaling domain that includes a component of the TCR complex of the T cell or a component of a TCR complex or a portion thereof. In some embodiments, the T cell activator can be a canonical factor, or portion thereof, that is part of a normal downstream signaling pathway of the T cell. In some embodiments, the readout of T cell activation is a reporter encoded by a construct containing a T cell activator operably linked to a reporter molecule capable of detectable expression. In some embodiments, antigen or epitope binding and / or a signal or activity via the intracellular signaling region of a recombinant receptor, e.g., a CAR, induces signal transduction that induces a T cell activator to express a reporter. Detectable expression of the reporter molecule can then be monitored as an indicator of T cell activation.

[0090] In some embodiments, a T cell activator is or contains one or more regulatory elements, e.g., one or more transcriptional control elements, of a target gene whose expression depends on or is associated with the activation of a component of the TCR complex, whereby the regulatory domain or element is recognized by a transcription factor to drive expression of such gene. In some cases, a T cell activator, such as a regulatory domain or element, can be or contain all or a portion of an endogenous regulatory region of a particular locus, e.g., the T cell activator is derived from the target locus. In some embodiments, a T cell activator is or contains a promoter, enhancer, or other response element, or portion thereof, that is recognized by a transcription factor to drive expression of a gene whose activity is normally turned on by T cell activation. In some embodiments, a T cell activator can be a regulatory domain or region (e.g., a promoter, enhancer, or other response element) of a transcription factor whose activity is turned on by T cell activation. In some embodiments, the T cell activator is responsive to one or more of a signal via the intracellular signaling region and / or the quality and / or strength of binding and / or recognition of the recombinant receptor to a target antigen or epitope. In some embodiments, the regulatory element is responsive to one or more of the state of recombinant receptor binding to an antigen or epitope, T cell activation, the signal strength of the recombinant receptor, and / or the quality of signaling via the intracellular signaling region of the recombinant receptor, e.g., a CAR. In some embodiments, the T cell activator is or comprises a transcriptional regulatory element of a gene whose expression is induced and / or upregulated upon binding of the recombinant receptor to an antigen or epitope, T cell activation, the signal strength of the recombinant receptor, and / or the quality of signaling via the intracellular signaling region of the recombinant receptor, e.g., a CAR.

[0091] Usually, T cell activator is operably associated with a detectable readout of T cell activation, for example, a reporter that can be expressed and detected by cell.Therefore, for example, reporter expression can be induced during T cell activation instead of or in addition to endogenous gene.T cell activator alone or together with detectable readout can be endogenous, exogenous or heterologous to cell.

[0092] In some embodiments, the T cell activating factor can be a regulatory element, e.g., a transcriptional regulatory element, e.g., a promoter, enhancer, or response element(s), that contains a binding site for a T cell transcription factor and thereby links downstream activity of the T cell transcription factor. In some embodiments, the transcription factor is nuclear factor of activated T cells (NFAT), C / EBP, AP1, STAT1, STAT2, Nur77, or NFκB. In some embodiments, the T cell activating factor contains response element(s) recognized by nuclear factor of activated T cells (NFAT), C / EBP, AP1, STAT1, STAT2, Nur77, and NFκB. In some embodiments, the T cell activating factor can contain regulatory element(s) recognized by or responsive to one or two, and in some cases, three or more unique transcription factors.

[0093] In some cases, the T cell activator contains a binding site, such as a response element, recognized only by a single transcription factor that is selectively activated by signaling through a component of the TCR complex induced through receptor engagement after antigen or epitope binding to a receptor, e.g., a recombinant receptor, e.g., a CAR. In some embodiments, the T cell activator contains a response element(s) recognized by a transcription factor activated upon stimulation of T cells through the endogenous TCR complex. For example, the regulatory region of a gene generally contains multiple regulatory elements that may be responsive to more than one signaling pathway in a cell. In contrast, an artificial regulatory region or artificial promoter containing a regulatory element(s) recognized by a transcription factor that is selectively activated only by signaling through a component of the TCR complex can increase the specificity of the reporter system so that it is only responsive to T cell activation. In some embodiments, the T cell activator contains a regulatory element(s) recognized by NFAT. In some embodiments, the T cell activator contains a regulatory element(s) recognized by NFκB.

[0094] In some embodiments, the reporter molecule is encoded by a nucleic acid sequence under operable control of a T cell activator, such as a regulatory element, that is responsive to the quality and / or strength of a signal through an antigen receptor, such as a TCR complex. In some aspects, the T cell activator is responsive to the quality and / or strength of a signal through an intracellular signaling region and / or in response to binding and / or recognition of a recombinant receptor (e.g., a receptor being screened or evaluated, such as a recombinant receptor expressed by a cell) to a target antigen or epitope. In some embodiments, the T cell activating factor is selected from the group consisting of orphan nuclear hormone receptor Nur77 (Nr4a1), nerve growth factor IB (NGFIB), GFRP1; Gfrp; HMR; Hbr-1; Hbr1; Hmr; N10; NAK-1; NGFI-B; NGFIB; NP10; Ngfi-b; orphan nuclear receptor HMR; ST-59; TIS1; TR3; TR3 orphan receptor; early response protein NAK1; growth factor-inducible nuclear protein N10; hormone receptor; immediate early gene transcription factor NGFI-B; nerve growth factor IB nuclear receptor variant 1; nerve growth factor-inducible protein IB; nerve growth factor-inducible protein IB; neuronal orphan nuclear receptor NUR77; nhr-6; nr4a1; nuclear hormone receptor NUR / 77; nuclear protein N10; nuclear receptor subfamily 4 group A member 1; orphan nuclear receptor NGFI-B; orphan nuclear receptor NR4A1; orphan nuclear receptor TR3; steroid receptor TR3; testis receptor 3; zgc:92434; is or contains a transcriptional regulatory element(s) associated with the expression of an exemplary human Nur77 DNA sequence set forth in SEQ ID NO: 1 encoding the polypeptide set forth in SEQ ID NO: 2.

[0095] Nur77 is generally encoded by an immediate early response gene induced in response to signaling through or activating signals from the endogenous T cell receptor (TCR) complex, endogenous TCR engagement, and / or engagement via the CD3-zeta signaling domain, or a molecule containing an immunoreceptor tyrosine-based activation motif (ITAM), which is involved in signaling through or activating signals from the endogenous T cell receptor (TCR) complex. The Nur77 gene product itself can generally bind to regulatory elements associated with the promoters of several genes, inducing downstream expression of the genes. The level or degree of Nur77 expression can serve as an indicator of the strength of T cell signals, for example, TCR signals (Moran et al. (2011) JEM, 208:1279-1289). Thus, in some embodiments, the expression of a reporter molecule operably linked to a transcriptional regulatory element(s) of the Nur77 locus, or a portion thereof, can provide an indicator of the strength of T cell signaling. Furthermore, Nur77 expression is generally unaffected or unaffected by other signaling pathways, e.g., cytokine signaling or toll-like receptor (TLR) signaling, which may act extrinsically and may not depend on signaling through a recombinant receptor (see, e.g., Ashouri et al., (2017) J. Immunol. 198:657-668). In some embodiments, the T cell activator is a Nur77 promoter or enhancer or portion thereof, or a molecule or gene containing a Nur77 response element(s).

[0096] In some of any of the embodiments, the reporter T cell contains a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of Nur77 or a variant thereof. In some of any of such embodiments, the variant of the transcriptional regulatory element is a variant nucleic acid sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the transcriptional regulatory element within the endogenous Nur77 locus in the T cell. In some of any of these embodiments, the variant of the transcriptional regulatory element is a functional variant having a nucleic acid sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a transcriptional regulatory element within the endogenous Nur77 locus in a T cell, and that is responsive to signaling through or from the endogenous T cell receptor (TCR) complex, to engagement of the endogenous TCR and / or to engagement via the CD3-zeta signaling region of a molecule containing an immunoreceptor tyrosine-based activation motif (ITAM), which is involved in signaling through or from the TCR complex, e.g., the CD3-zeta signaling region, and / or to signaling via the intracellular signaling region of the recombinant receptor, wherein incubation is performed in the presence or absence of an agent that binds to the binding domain of the recombinant receptor and / or that induces or is capable of inducing signaling via the intracellular signaling region of the recombinant receptor.

[0097] In some embodiments, a construct or vector is generated containing a nucleic acid sequence encoding a reporter molecule under the operable control of a T cell activator, e.g., the Nur77 promoter, which can be activated or induced upon antigen or epitope binding and / or a signal or activity via the intracellular signaling region of a receptor, e.g., a recombinant receptor, e.g., a CAR, to the recognized antigen or its epitope. In some embodiments, a "reporter construct" comprises a nucleic acid encoding a reporter molecule(s) operably linked to a sequence of a T cell activator or factor(s) capable of inducing expression thereof.

[0098] Reporter constructs can be known or produced by recombinant DNA technology. In some embodiments, the nucleic acid sequence encoding reporter molecule(s) is cloned into an expression plasmid, for example, a mammalian expression vector, for example, pcDNA or other mammalian expression vector. In some embodiments, the nucleic acid sequence encoding reporter molecule(s) is cloned into a retroviral vector, for example, a lentiviral vector.

[0099] In some embodiments, the nucleic acid sequence encoding the reporter molecule(s) is integrated into a genomic location in the cell, for example, an endogenous genomic location. In some embodiments, the nucleic acid sequence encoding the reporter molecule may be integrated into a genomic location where its expression is associated with, under the operable control of, and / or should be regulated by, regulatory elements present in the endogenous genomic location of a particular gene whose expression may be responsive to a signal via an intracellular signaling region and / or receptor binding and / or recognition to a target antigen or epitope, and / or the quality and / or intensity of T cell signaling or T cell activation. In some embodiments, the nucleic acid sequence encoding the reporter molecule(s) may be integrated into an endogenous genomic location located under the operable control of the transcriptional regulatory elements of a gene whose expression is induced and / or upregulated upon a signal via the intracellular signaling region of the recombinant receptor and / or binding and / or recognition of the recombinant receptor to a target antigen or epitope. In some embodiments, a nucleic acid sequence encoding a reporter molecule(s) can be integrated into an endogenous genomic location for co-expression with an endogenous gene encoded at a location under the operable control of a promoter, enhancer, or response element, or a portion thereof, that can be activated or induced upon antigen or epitope binding to a recognized antigen or epitope thereof and / or signal or activity via the intracellular signaling region of a recombinant receptor, e.g., a CAR, and / or T cell signaling or activation. In some embodiments, the endogenous gene is Nur77. In some embodiments, the T cell activator is a Nur77 promoter, enhancer, or response element, or a portion thereof. In some embodiments, the nucleic acid sequence encoding the reporter molecule is targeted for in-frame integration with the coding sequence, coding region, and / or open reading frame (ORF) of an endogenous gene, e.g., an endogenous Nur77 gene, separated by a self-cleaving element, e.g., a sequence encoding T2A.

[0100] In some embodiments, a T cell or plurality of T cells provided herein or a T cell or plurality of T cells used in the methods provided herein can contain two or more reporters, hi some embodiments, a T cell or plurality of T cells can contain two different reporters.

[0101] c. Exemplary Reporter T Cells In some embodiments, the provided reporter T cells or reporter T cells used in the methods provided herein contain a nucleic acid sequence encoding a reporter molecule present in the genome of the cell or targeted for integration into an endogenous genomic location, such that expression of the reporter can be associated with, under the operable control of, and / or regulated by regulatory elements present in the endogenous genomic location of a particular gene that can be responsive to a signal via an intracellular signaling region and / or the quality and / or strength of binding and / or recognition of the recombinant receptor to a target antigen or epitope, and / or T cell signaling or T cell activation. In some embodiments, the reporter T cells are generated by including a genetic disruption at one or more target sites at or near the endogenous locus of interest and introducing a homology-directed repair (HDR) template polynucleotide. In some embodiments, the reporter T cells contain a targeted knock-in of a nucleic acid sequence encoding a reporter molecule into an endogenous locus linked to a signal via the endogenous T cell receptor (TCR) and / or a T cell activator, e.g., a regulatory element, that is responsive to the quality and / or strength of TCR binding and / or recognition to a target antigen or epitope.

[0102] In some embodiments, reporter T cells are generated by using gene editing techniques to target knock-in a nucleic acid sequence encoding a reporter molecule at an endogenous locus linked to a T cell activator, e.g., a Nur77 promoter, enhancer, or response element, or a portion thereof, followed by inducing a targeted genetic disruption, e.g., a DNA break, using HDR. In some embodiments, the nucleic acid sequence encoding the reporter molecule is present in the genome of the cell or is targeted for in-frame integration with the coding sequence, coding region, and / or open reading frame (ORF) of an endogenous gene, e.g., an endogenous Nur77 gene. Thus, in some exemplary embodiments, reporter T cells are generated by inducing a genetic disruption at one or more target sites at or near the endogenous locus encoding Nur77 and introducing a template polynucleotide for HDR.

[0103] In some embodiments, genetic disruption is induced by a fusion protein comprising a DNA-binding protein or DNA-binding nucleic acid that specifically binds to or hybridizes with a target site, optionally a DNA-targeting protein and a nuclease or an RNA-guided nuclease. In some embodiments, the fusion protein comprising a DNA-targeting protein and a nuclease or an RNA-guided nuclease is or comprises a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas9 combination that specifically binds to, recognizes, or hybridizes with a target site. In some embodiments, the RNA-guided nuclease comprises a guide RNA (gRNA) having a targeting domain that is complementary to the target site.

[0104] In some embodiments, introducing a genetic disruption or break involves the use of one or more agents capable of introducing a genetic disruption, break, double-strand break (DSB), and / or nick at a target site in genomic DNA, thereby activating and / or recruiting various cellular DNA repair mechanisms, which utilize a template polynucleotide containing homology arm sequences, a DNA repair template, to efficiently copy and integrate a nucleic acid sequence encoding a reporter molecule at or near the site of the targeted genetic disruption by HDR, based on homology between the endogenous gene sequence surrounding the target site and the 5' and / or 3' homology arms contained in the template polynucleotide.

[0105] In some embodiments, the one or more agents capable of inducing genetic disruption or cleavage comprise a DNA-binding protein or a DNA-binding nucleic acid that specifically binds to or hybridizes with a target site in the genome, for example, at or near the Nur77 gene. In some aspects, targeted cleavage, e.g., DNA cleavage, at or near the endogenous gene encoding Nur77 is achieved using a protein or nucleic acid coupled to or complexed with a gene-editing nuclease, such as in a chimeric or fusion protein. In some embodiments, the one or more agents capable of introducing genetic disruption or cleavage comprise a fusion protein comprising a DNA-targeting protein and a nuclease or an RNA-guided nuclease.

[0106] In some embodiments, introducing the genetic disruption or cleavage is carried out by gene editing methods such as using zinc finger nucleases (ZFNs), TALENs or CRISPR / Cas systems with engineered guide RNAs that cleave target site(s), e.g., at or near the Nur77 gene.

[0107] In some embodiments, the agent capable of inducing targeted cleavage comprises various components, such as a fusion protein comprising a DNA targeting protein and a nuclease or an RNA-guided nuclease. In some embodiments, targeted cleavage is carried out using a DNA targeting molecule comprising a DNA binding protein, such as one or more zinc finger proteins (ZFPs) or transcription activator-like effectors (TALEs), fused to a nuclease, such as an endonuclease. In some embodiments, targeted cleavage is carried out using an RNA-guided nuclease, such as a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) system (including Cas and / or Cfp1). In some embodiments, targeted cleavage is carried out using an agent capable of introducing a genetic disruption or cleavage, e.g., sequence-specific or targeted nucleases, including DNA-binding targeted nucleases and gene-editing nucleases, e.g., zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) and RNA-guided nucleases, e.g., CRISPR-associated nuclease (Cas) systems, that are specifically engineered and / or designed to target at least one target site(s), the sequence of a gene, or a portion thereof.

[0108] In some embodiments, the one or more agents specifically target at least one target site(s), for example, at or near the Nur77 gene. In some embodiments, the agent comprises a ZFN, TALEN, or CRISPR / Cas9 combination that specifically binds to, recognizes, or hybridizes to the target site(s). In some embodiments, the CRISPR / Cas9 system comprises a crRNA / tracr RNA ("single guide RNA") engineered to guide specific cleavage. In some embodiments, the agent comprises a nuclease based on the Argonaute system (e.g., from T. thermophilus, also known as "TtAgo" (Swarts et al., (2014) Nature 507(7491): 258-261)).

[0109] Zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs) and CRISPR system binding domains can be "engineered" to bind to a predetermined nucleotide sequence, for example, by manipulating the recognition helix region of naturally occurring ZFPs or TALE proteins (by changing one or more amino acids). Engineered DNA binding proteins (ZFPs or TALEs) are proteins that do not exist in nature. Rational design criteria include applying substitution rules and computer processing algorithms to process information in databases that store information on existing ZFP and / or TALE design and binding data. For example, see U.S. Patent Nos. 6,140,081, 6,453,242 and 6,534,261, and also see WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536 and WO03 / 016496 and U.S. Patent Publication No. 20110301073. Exemplary ZFNs, TALEs and TALENs are described, for example, in Lloyd et al., Frontiers in Immunology, 4(221): 1-7 (2013).

[0110] A zinc finger protein (ZFP), or zinc finger domain thereof, is a protein or domain within a larger protein that binds to DNA in a sequence-specific manner via one or more zinc fingers, regions of amino acid sequence within the binding domain whose structure is stabilized by the coordination of zinc ions. Among ZFPs are artificial ZFP domains, typically 9–18 nucleotides in length, generated by the assembly of individual fingers to target specific DNA sequences. ZFPs include those with two, three, four, five, or six fingers, each of which contains an alpha helix with two invariant histidine residues coordinated by zinc along with two cysteines in a single beta turn, approximately 30 amino acids in length. Generally, the sequence specificity of a ZFP can be altered by making amino acid substitutions in the four helix configurations (-1, 2, 3, and 6) of the zinc finger recognition helix. Thus, for example, ZFPs or ZFP-containing molecules can be engineered to bind to non-naturally occurring target sites of choice.

[0111] In some cases, the DNA targeting molecule is or comprises a zinc finger DNA binding domain fused to a DNA cleavage domain to form a zinc finger nuclease (ZFN).For example, the fusion protein comprises a cleavage domain (or cleavage half-domain) derived from at least one type IIS restriction enzyme and one or more zinc finger binding domains, which may be engineered or unengineered.In some cases, the cleavage domain is derived from the type IIS restriction endonuclease FokI, which generally catalyzes double-stranded cleavage of DNA at 9 nucleotides from the recognition site on one strand and 13 nucleotides from the recognition site on the other strand. See, e.g., U.S. Patent Nos. 5,356,802, 5,436,150, and 5,487,994; Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31, 978-31, 982.

[0112] Many gene-specific engineered zinc fingers are commercially available. For example, Sangamo Biosciences (Richmond, CA, USA) has collaborated with Sigma-Aldrich (St. Louis, MO, USA) to develop a platform (CompoZr) for zinc finger construction, allowing researchers to completely avoid zinc finger construction and validation, and provide zinc fingers that are specifically targeted to thousands of targets. For example, see Gaj et al., Trends in Biotechnology, 2013, 31(7), 397-405. In some cases, commercially available zinc fingers are used or custom-made.

[0113] In some embodiments, the Nur77 gene can be targeted for cleavage using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins. See Sander and Joung, Nature Biotechnology, 32(4): 347-355. In some embodiments, a "CRISPR system" collectively refers to the transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr mate sequences (including "direct repeats" and tracrRNA-processed partial direct repeats in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), and / or other sequences and transcripts from the CRISPR locus.

[0114] In some aspects, the CRISPR / Cas nuclease or CRISPR / Cas nuclease system comprises a non-coding guide RNA (gRNA) that binds to DNA in a sequence-specific manner and a Cas protein (e.g., Cas9) with nuclease functionality. In some embodiments, the CRISPR / Cas nuclease system comprises at least one of the following: a guide RNA (gRNA) having a targeting domain that is complementary to a target site in the Nur77 gene; or at least one nucleic acid encoding the gRNA.

[0115] Generally, a guide sequence, e.g., a guide RNA, is any polynucleotide sequence that includes at least one sequence portion, e.g., a targeting domain, that is sufficiently complementary to a target site sequence, e.g., a target site in the Nur77 gene in humans, to hybridize with the target sequence at the target site and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, in the context of CRISPR complex formation, a "target site" (also known as a "target configuration," "target DNA sequence," or "target location") generally refers to a sequence to which a guide sequence is designed to have complementarity, and hybridization between the target sequence and a domain of the guide RNA, e.g., the targeting domain, promotes CRISPR complex formation. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote CRISPR complex formation. Generally, a guide sequence is selected to reduce the degree of secondary structure within the guide sequence. Secondary structure can be determined by any suitable polynucleotide folding algorithm.

[0116] In some embodiments, a CRISPR enzyme (e.g., Cas9 nuclease) combined with (may be complexed with) a guide sequence is delivered to a cell. For example, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. For example, one or more elements of the CRISPR system are derived from a specific organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes, Staphylococcus aureus, or Neisseria meningitides.

[0117] In some embodiments, a guide RNA (gRNA) specific to a target site (e.g., Nur77 gene) is used to guide an RNA-guided nuclease, e.g., Cas, to introduce DNA cleavage at the target site or target location. Methods for designing gRNAs and exemplary targeting domains can include those described, for example, in International PCT Publication No. WO2015 / 161276. The targeting domain can be incorporated into the gRNA, which is used to target the Cas9 nuclease to the target site or target location. Methods for selecting and validating target sequences and off-target analysis are described, for example, in Mali et al., 2013 Science 339(6121): 823-826; Hsu et al. Nat Biotechnol, 31(9): 827-32; Fu et al., 2014 Nat Biotechnol; Heigwer et al., 2014 Nat Methods 11(2):122-3; Bae et al., 2014 Bioinformatics; Xiao A et al., 2014 Bioinformatics. Genome-wide gRNA databases for CRISPR genome editing are publicly available, containing exemplary single guide RNA (sgRNA) sequences that target the constitutive exons of genes in the human or mouse genome (see, e.g., genescript.com / gRNA-database.html; see also Sanjana et al. (2014) Nat. Methods, 11:783-4). In some embodiments, the gRNA sequence is or includes a sequence with minimal off-target binding to non-target sites or locations.

[0118] In some exemplary embodiments, the target site is in or near the final exon of the endogenous locus encoding Nur77. In some exemplary embodiments, the target site is in or near the final exon of the endogenous locus encoding Nur77, but before the stop codon of the endogenous locus encoding Nur77. In some embodiments, the one or more target sites comprise the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 14) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 15). In some embodiments, the gRNA comprises a targeting domain sequence selected from CAUGAAGAUCUUGUCAAUGA (SEQ ID NO: 3) or UGCACACGUGUUCCCAGGC (SEQ ID NO: 4).

[0119] In some embodiments, the induction of genetic disruption or cleavage is carried out by delivering or introducing one or more agents capable of introducing genetic disruption or cleavage, such as Cas9 and / or gRNA components, into cells using any of several known delivery methods or vehicles for introduction or transfer into cells, for example, using lentiviral delivery vectors or any of the known methods or vehicles for delivering Cas9 molecules and gRNA.Exemplary methods are described, for example, in Wang et al. (2012) J. Immunother. 35(9): 689-701; Cooper et al. (2003) Blood. 101:1637-1644; Verhoeyen et al. (2009) Methods Mol Biol. 506: 97-114; and Cavalieri et al. (2003) Blood. 102(2): 497-505. In some embodiments, a nucleic acid sequence encoding one or more components of one or more agents capable of inducing genetic disruption or cleavage, for example, DNA cleavage, is introduced into the cell, for example, by any method described herein or known for introducing nucleic acids into cells. In some embodiments, one or more components of agents capable of inducing genetic disruption or cleavage, for example, a vector encoding a CRISPR guide RNA and / or a Cas9 enzyme, can be delivered into the cell.

[0120] In some embodiments, one or more agents capable of introducing genetic disruption or cleavage, such as the Cas9 / gRNA system, are introduced into cells as a ribonucleoprotein (RNP) complex. The RNA complex comprises a ribonucleotide sequence, such as an RNA or gRNA molecule, and a protein, such as the Cas9 protein or a variant thereof. For example, the Cas9 protein is delivered as an RNP complex comprising the Cas9 protein and a gRNA molecule targeting the target sequence, for example, using electroporation or other physical delivery methods. In some embodiments, the RNP is delivered into cells via electroporation or other physical means, such as particle gun, calcium phosphate transfection, cell compaction, or squeezing. In some embodiments, the RNP can cross the cell membrane of the cell without the need for the addition of additional delivery agents (e.g., small molecule agents, lipids, etc.).

[0121] In some embodiments, a template polynucleotide comprising a nucleic acid sequence encoding a reporter molecule is introduced into cells. In some embodiments, the template polynucleotide is introduced into engineered cells before, simultaneously with, or after the introduction of a drug(s) capable of introducing targeted genetic disruption. In the presence of targeted genetic disruption, for example, DNA breakage, the template polynucleotide can be used as a DNA repair template to efficiently copy and integrate a transgene, for example, a nucleic acid sequence encoding a reporter molecule, into or near the site of targeted genetic disruption by HDR based on the homology between the endogenous gene sequence surrounding the target site and the 5' and / or 3' homology arm contained in the template polynucleotide. In some embodiments, the gene editing and HDR steps are performed simultaneously and / or in one experimental reaction. In some embodiments, the gene editing and HDR steps are performed continuously or sequentially in one or consecutive experimental reactions. In some embodiments, the gene editing and HDR steps are performed simultaneously or at different times in separate experimental reactions.

[0122] In some embodiments, HDR can be used to target integration of one or more transgenes at one or more target sites in a genome, for example, the Nur77 gene. In some embodiments, nuclease-induced HDR can be used to integrate a transgene, for example, a nucleic acid sequence encoding a reporter molecule, that changes the target sequence at a specific target position.

[0123] HDR using an exogenously provided template polynucleotide (also referred to as a donor polynucleotide or template sequence) can result in alteration of nucleic acid sequence at the target site. For example, the template polynucleotide provides the alteration of the target sequence, for example, the insertion of a transgene contained in the template polynucleotide. In some embodiments, a plasmid or vector can be used as a template for homologous recombination. In some embodiments, a linear DNA fragment can be used as a template for homologous recombination. In some embodiments, a single-stranded template polynucleotide can be used as a template for altering the target sequence by an alternative method of homology-directed repair (e.g., single-stranded annealing) between the target sequence and the template polynucleotide. The alteration of the target sequence caused by the template polynucleotide depends on cleavage by a nuclease, for example, a targeted nuclease, such as CRISPR / Cas9. The cleavage or genetic disruption by the nuclease can include double-stranded breaks or two single-stranded breaks.

[0124] In some embodiments, "recombination" refers to the process of exchange of genetic information between two polynucleotides. In some embodiments, "homologous recombination (HR)" refers to a specialized form of such exchange that occurs, for example, during repair of double-strand breaks in cells by homology-directed repair mechanisms. Because this process results in the transfer of genetic information from a template polynucleotide to a target, it requires nucleotide sequence homology and uses the template polynucleotide to template the repair of target DNA (i.e., DNA that has experienced a double-strand break, e.g., a target site within an endogenous gene), and is variously known as "non-crossover gene conversion" or "short tract gene conversion." In some embodiments, such transfer can involve mismatch correction of heteroduplex DNA that forms between the disrupted target and template polynucleotide, and / or "synthesis-dependent strand annealing," in which the template polynucleotide is used to resynthesize the genetic information that becomes part of the target, and / or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the template polynucleotide is incorporated into the target polynucleotide.

[0125] In some embodiments, a template polynucleotide, such as a polynucleotide containing a transgene, is integrated into the genome of a cell by a homology-independent mechanism. The method includes creating a double-strand break (DSB) in the genome of a cell and cleaving the template polynucleotide molecule using a nuclease so that the template polynucleotide is integrated at the site of the DSB. In some embodiments, the template polynucleotide is integrated by a non-homology-dependent method (e.g., NHEJ). Upon in vivo cleavage, the template polynucleotide can be integrated into the DSB position of the genome of the cell in a targeted manner. The template polynucleotide can contain one or more of the same target sites for one or more of the nucleases used to create the DSB. Thus, the template polynucleotide can be cleaved by one or more of the same nucleases used to cleave the endogenous gene into which integration is desired. In some embodiments, the template polynucleotide contains different nuclease target sites from the nucleases used to induce the DSB. As described above, genetic disruption of a target site or location can be created by any mechanism, such as ZFN, TALEN, CRISPR / Cas9 system or TtAgo nuclease.

[0126] In canonical HDR, a double-stranded template polynucleotide containing a homologous sequence is introduced into the target site, where it is either directly integrated into the target site or used as a template for inserting a transgene near the target site. After excision at a genetic disruption or break, repair can proceed via various pathways, such as the double Holliday junction model (also known as double-strand break repair, or DSBR) or the synthesis-dependent strand annealing (SDSA) pathway. In some embodiments, other DNA repair pathways, such as single-strand annealing (SSA), single-strand break repair (SSBR), mismatch repair (MMR), base excision repair (BER), nucleotide excision repair (NER), intrastrand cross-linking (ICL), translesion synthesis (TLS), and error-free postreplication repair (PRR), can be used by cells to repair double-strand or single-strand breaks created by nucleases.

[0127] Targeted integration results in the transgene being integrated into a specific gene or locus in genome.Transgene can be integrated into at least one target site or one of the sites in genome or anywhere near it.In some embodiments, transgene is present in or is integrated into the genome of cell at least one target site or near it, for example, 300, 250, 200, 150, 100, 50, 10, 5, 4, 3, 2, 1 or less base pairs upstream or downstream of the cleavage site, for example, within 100, 50, 10, 5, 4, 3, 2, 1 base pairs on either side of target site, for example, within 50, 10, 5, 4, 3, 2, 1 base pairs on either side of target site.

[0128] The genetic disruption or cleavage at the target site should be located close enough to the site for targeted integration so that the desired region is generated, for example, the insertion of a transgene occurs.In some embodiments, the distance is 10, 25, 50, 100, 200, 300, 350, 400 or 500 nucleotides or less.In some embodiments, it is considered that the genetic disruption or cleavage should be located close enough to the targeted integration site so that the genetic disruption or cleavage is located within the region that is subject to exonuclease-mediated removal during end resection. In some embodiments, the targeting domain is designed so that the cleavage event occurs within a region desired to be altered, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 300, 350, 400, or 500 nucleotides of the site for targeted insertion, e.g., between about 0 and about 200 bp (e.g., 0-17 bp) from the targeted integration site. The genetic disruption or truncation may be located at a distance of 5, 0-150, 0-125, 0-100, 0-75, 0-50, 0-25, 25-200, 25-175, 25-150, 25-125, 25-100, 25-75, 25-50, 50-200, 50-175, 50-150, 50-125, 50-100, 50-75, 75-200, 75-175, 75-150, 75-125, or 75-100 bp apart. The genetic disruption or truncation may be located upstream or downstream of the region desired to be altered, e.g., the site for targeted insertion. In some embodiments, the truncation is located within the region desired to be altered, e.g., within a region defined by at least two mutant nucleotides. In some embodiments, the truncation is placed immediately adjacent to the region desired to be altered, for example, immediately upstream or downstream of a site for targeted integration.

[0129] A template polynucleotide having homology to a sequence at or near one or more target sites in endogenous DNA can be used to alter the structure of target DNA, e.g., a transgene, e.g., a nucleic acid sequence encoding a reporter molecule. In some embodiments, the template polypeptide contains homologous sequences (e.g., homology arms) flanking both ends of the transgene, e.g., a nucleic acid sequence encoding a reporter molecule for targeted insertion, e.g., any of the reporter molecules described herein. In some embodiments, the homologous sequences target the transgene to or near the Nur77 locus. In some embodiments, the template polynucleotide includes additional sequences (coding or non-coding sequences) between the homology arms, e.g., regulatory sequences, e.g., promoters and / or enhancers, splice donor and / or acceptor sites, internal ribosome entry sites (IRES), ribosomal skip elements (e.g., 2A peptides), markers and / or SA sites, and / or sequences encoding one or more additional transgenes. The sequence of interest in the template polynucleotide can include one or more sequences that encode a functional polypeptide (eg, a cDNA), with or without a promoter.

[0130] In some embodiments, nuclease-induced HDR results in the insertion of a transgene (also referred to as an "exogenous sequence" or "transgene sequence") for the expression of the transgene for targeted insertion. The template polynucleotide sequence is typically not identical to the genomic sequence into which it is inserted. The template polynucleotide sequence may contain a non-homologous sequence flanked by two regions of homology to enable efficient HDR at the desired location. In addition, the template polynucleotide sequence may comprise a vector molecule containing a sequence that is not homologous to the region of interest in cellular chromatin. The template polynucleotide sequence may contain several non-contiguous regions of homology to cellular chromatin. For example, for targeted insertion of a sequence that is not normally present in the region of interest, the sequence may be present in a transgene and flanked by regions of homology to the sequence of the region of interest.

[0131] The polynucleotide for insertion can also be referred to as a "transgene" or "exogenous sequence" or "donor" polynucleotide or molecule. The template polynucleotide can be single-stranded and / or double-stranded DNA and can be introduced into cells in either linear or circular form. The template polynucleotide can be single-stranded and / or double-stranded DNA and can be introduced into cells in either linear or circular form. See U.S. Patent Publication Nos. 20100047805 and 20110207221. The template polynucleotide can also be introduced in the form of DNA that can be introduced into cells in either circular or linear form. When introduced in linear form, the ends of the template polynucleotide can be protected (e.g., from exonuclease degradation) by known methods. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides can be ligated to one or both ends. For example, see Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting heterologous polynucleotides from degradation include, but are not limited to, adding terminal amino groups and using modified internucleotide linkages, such as phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues.When introduced in double-stranded form, template polynucleotide can contain one or more nuclease target sites, for example, nuclease target sites flanking both sides of the transgene to be integrated into the genome of cells.For example, see US Patent Publication No. 20130326645.

[0132] In some embodiments, the template polynucleotide is double-stranded. In some embodiments, the template polynucleotide is single-stranded. In some embodiments, the template polynucleotide comprises a single-stranded portion and a double-stranded portion.

[0133] In some embodiments, the template polynucleotide contains a nucleic acid sequence encoding a transgene, such as a reporter molecule, flanked at both ends by homologous sequences (also referred to as "homology arms") at the 5' and 3' ends to allow DNA repair mechanisms, such as homologous recombination mechanisms, to use the template polynucleotide as a template for repair and effectively insert the transgene into the target site of integration in the genome. The homology arms should extend at least to the region where end resection may occur, for example, to allow the excised single-stranded overhang to find a complementary region within the template polynucleotide. The total length may be limited by parameters such as plasmid size or viral packaging limitations. In some embodiments, the homology arms do not extend into repetitive elements, such as ALU repeats or LINE repeats.

[0134] Exemplary homology arm lengths include at least 50, 100, 200, 250, 300, 400, 500, 600, 700, 750, 800, 900, 1000, 2000, 3000, 4000, or 5000 or at least about 50, 100, 200, 250, 300, 400, 500, 600, 700, 750, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the homology arm length is 50 to 100, 100 to 250, 250 to 500, 500 to 750, 750 to 1000, 1000 to 2000, 2000 to 3000, 3000 to 4000, or 4000 to 5000 nucleotides.

[0135] A target site (also known as a "target location," "target DNA sequence," or "target position"), in some embodiments, refers to a target DNA (e.g., a chromosome) that is modified by one or more agents capable of inducing genetic disruption, e.g., a Cas9 molecule. For example, a target site can be a modified Cas9 molecule cleavage of DNA at the target site and modification directed by a template polynucleotide, e.g., targeted insertion of a transgene at the target site. In some embodiments, a target site can be a site between two nucleotides, e.g., adjacent nucleotides, on DNA to which one or more nucleotides are added. The target site may comprise one or more nucleotides that are modified by the template polynucleotide. In some embodiments, the target site is within the target sequence (e.g., the sequence to which the gRNA binds). In some embodiments, the target site is upstream or downstream of the target sequence (e.g., the sequence to which the gRNA binds).

[0136] In some embodiments, the template polynucleotide comprises about 500-1000, e.g., 600-900 or 700-800 base pairs of homology on either side of the target site in the endogenous gene. In some embodiments, the template polynucleotide comprises about 500, 600, 700, 800, 900, or 1000 base pairs of homology 5' of the target site, 3' of the target site, or both 5' and 3' of the target site.

[0137] In some embodiments, the template polynucleotide is a nucleic acid sequence that can be used with a nuclease, e.g., a Cas9 molecule and / or a gRN molecule, to alter the structure of a target site. In some embodiments, the target site is typically modified to have some or all of the sequence of the template polynucleotide at or near the cleavage site(s). In some embodiments, the template polynucleotide is single-stranded. In some embodiments, the template polynucleotide is double-stranded. In some embodiments, the template polynucleotide is DNA, e.g., double-stranded DNA. In some embodiments, the template polynucleotide is single-stranded DNA. In some embodiments, the template polynucleotide is encoded on the same vector backbone as the Cas9 and gRNA, e.g., an AAV genome, a plasmid DNA. In some embodiments, the template polynucleotide is excised from the vector backbone in vivo, e.g., flanked by gRNA recognition sequences. In some embodiments, the template polynucleotide is on a polynucleotide molecule separate from the Cas9 and gRNA. In some embodiments, the Cas9 and gRNA are introduced in the form of a ribonucleoprotein (RNP) complex, and the template polynucleotide is introduced as a polynucleotide molecule, for example, in a vector.

[0138] In some embodiments, the template polynucleotide alters the structure of the target site, e.g., inserting a transgene by participating in a homology-directed repair event. In some embodiments, the template polynucleotide alters the sequence of the target site.

[0139] In some embodiments, the template polynucleotide comprises sequences corresponding to sites on the target sequence that are cleaved by a Cas9-mediated cleavage event, hi some embodiments, the template polynucleotide comprises sequences corresponding to both a first site on the target sequence that is cleaved in a first Cas9-mediated event and a second site on the target sequence that is cleaved in a second Cas9-mediated event.

[0140] A template polynucleotide typically comprises the following components: [5' homology arm]-[transgene]-[3' homology arm]. The homology arms provide for recombination into the chromosome at or near the cleavage site, e.g., the target site(s), and thus insertion of the transgene into the DNA. In some embodiments, the homology arms flank the most distal cleavage site.

[0141] In some embodiments, the template polynucleotide comprises the structure [5' homology arm]-[nucleic acid sequence encoding the reporter molecule]-[3' homology arm]. In some embodiments, the 5' homology arm and / or the 3' homology arm comprise a nucleic acid sequence homologous to a nucleic acid sequence present at and / or surrounding one or more target sites.

[0142] In some embodiments, the 5' homology arm comprises a nucleic acid sequence that is homologous to a nucleic acid sequence 5' of one or more target sites. In some embodiments, the 3' homology arm comprises a nucleic acid sequence that is homologous to a nucleic acid sequence 3' of one or more target sites. In some embodiments, the 5' homology arm and the 3' homology arm are independently between about 50 to 100, 100 to 250, 250 to 500, 500 to 750, 750 to 1000, or 1000 to 2000 base pairs in length.

[0143] In some embodiments, the 3' end of the 5' homology arm is adjacent to the 5' end of the transgene. In some embodiments, the 5' homology arm can extend 5' from the 5' end of the transgene by at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the 5' end of the 3' homology arm is adjacent to the 3' end of the transgene. In some embodiments, the 3' homology arm can extend 3' from the 3' end of the transgene by at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides.

[0144] Similarly, in some embodiments, the template polynucleotide has a 5' homology arm, a transgene, and a 3' homology arm so that the template polynucleotide extends substantially the same distance on either side of the target site. For example, the homology arms may have different lengths, but the transgene can be selected to compensate for this. For example, the transgene may extend further 5' from the target site than it extends 3' from the target site, but the homology arm 5' of the target site is shorter than the homology arm 3' of the target site to compensate. The reverse is also possible, for example, the transgene may extend further 3' from the target site than it extends 5' from the target site, but the homology arm 3' of the target site is shorter than the homology arm 5' of the target site to compensate. In some embodiments, for targeted insertion, the homology arms, e.g., the 5' and 3' homology arms, may each comprise approximately 1000 base pairs (bp) of sequence flanking both ends of the distal-most gRNA (e.g., 1000 bp of sequence at either the site of genetic disruption or the target site).

[0145] In some embodiments, the template polynucleotide contains homology arms for targeting the endogenous Nur77 locus (an exemplary nucleotide sequence of endogenous human Nur77 set forth in SEQ ID NO: 1; NCBI reference sequence: NM_001202233.1, encoding the amino acid sequence set forth in SEQ ID NO: 2). In some embodiments, the genetic disruption of the Nur77 locus is introduced at or near the 3' end of the region, e.g., at or near the last exon of the coding region of the gene, including sequences immediately prior to the stop codon, e.g., within the last exon of the coding sequence, or within 500 bp (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp) of the stop codon. In some embodiments, the genetic disruption of the Nur77 locus is introduced into an early coding region in the gene, including sequences immediately following the transcription start site, within the first exon of the coding sequence, or within 500 bp (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp) of the transcription start site, or within 500 bp (e.g., 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp) of the start codon.

[0146] In some embodiments, the template polynucleotide contains about 500-1000, e.g., 600-900 or 700-800 base pairs of homology on either side of the genetic disruption introduced by the targeted nuclease and / or gRNA. In some embodiments, the template polynucleotide comprises a 5' homology arm sequence of about 500, 600, 700, 800, 900, or 1000 base pairs that is homologous to 500, 600, 700, 800, 900, or 1000 base pairs of sequence 5' of the genetic disruption (e.g., at the Nur77 locus) and a 3' homology arm sequence of about 500, 600, 700, 800, 900, or 1000 base pairs that is homologous to 500, 600, 700, 800, 900, or 1000 base pairs of sequence 3' of the genetic disruption (e.g., at the Nur77 locus).

[0147] In some embodiments, the location of the genetic disruption (e.g., target site) and the design of the template polynucleotide are selected so that upon introduction of the genetic disruption and targeted integration of the transgene, e.g., a nucleic acid sequence encoding a reporter molecule, is in-frame with the endogenous gene, e.g., the endogenous Nur77 gene. In some embodiments, the transgene, e.g., a nucleic acid sequence encoding a reporter molecule, is integrated or targeted for integration in-frame near the end of an exon at the end of the endogenous Nur77 gene, such that expression of the transgene is under operable control of endogenous Nur77 transcriptional regulatory elements and allows expression of the endogenous Nur77 polypeptide (in some cases, except for the last few amino acids at the C-terminus). In some embodiments, a ribosomal skipping element / self-cleaving element, e.g., a 2A element, is positioned upstream of the transgene coding sequence such that the ribosomal skipping element / self-cleaving element is positioned in-frame with the endogenous gene. In some embodiments, a transgene, e.g., a nucleic acid sequence encoding a reporter molecule, is integrated or targeted for integration such that endogenous Nur77 transcriptional regulatory elements control expression of the endogenous Nur77 polypeptide-T2A-reporter molecule.

[0148] In some exemplary embodiments, the encoded reporter molecule is or includes a fluorescent protein, luciferase, β-galactosidase, chloramphenicol acetyltransferase (CAT), β-glucuronidase (GUS), or modified forms thereof. In some embodiments, the fluorescent protein is or includes green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), superfold GFP, red fluorescent protein (RFP), cyan fluorescent protein (CFP), blue-green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), and yellow fluorescent protein (YFP), or variants thereof, including species variants, monomeric variants, and codon-optimized and / or enhanced variants of fluorescent proteins. In some embodiments, the encoded reporter molecule is a red fluorescent protein (RFP), such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed, or DsRed2. In some embodiments, the encoded reporter molecule is EGFP. For example, in some embodiments, the nucleic acid sequence encoding the reporter molecule comprises the sequence of nucleic acid set forth in SEQ ID NO: 10 or a sequence of nucleic acid exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOs: 10. In some embodiments, the encoded reporter molecule comprises the sequence of amino acids set forth in SEQ ID NO: 11 or a sequence of amino acids exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOs: 11.

[0149] In some cases, a ribosome skipping element / self-cleaving element, e.g., T2A, can cause the ribosome to skip synthesis of the peptide bond at the C-terminus of the 2A element (ribosome skipping), leading to separation between the end of the 2A sequence and the next downstream peptide (see, e.g., de Felipe, Genetic Vaccines and Ther. 2:13 (2004) and de Felipe et al. Traffic 5:616-626 (2004)). This allows the inserted transgene to be transcriptionally controlled by an endogenous promoter, e.g., the Nur77 promoter, at the integration site. Exemplary ribosome skipping elements / self-cleaving elements include the 2A sequences from foot-and-mouth disease virus, equine rhinitis A virus, Thosea asigna virus (T2A, e.g., SEQ ID NO: 6), and porcine teschovirus-1, as described in U.S. Patent Publication No. 20070116690. In some embodiments, exemplary ribosomal skipping / self-cleaving elements comprise a sequence of amino acids exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NO: 6. In some embodiments, a template polynucleotide comprises a T2A ribosomal skipping element (the sequence set forth in SEQ ID NO: 6 or 7) upstream of a nucleic acid sequence encoding a transgene, e.g., a reporter molecule.

[0150] In some embodiments, the template polynucleotide comprises one or more mutations, for example, silent mutations, that prevent RNA-guided nuclease or DNA-binding nuclease fusion protein from recognizing and cleaving the template polynucleotide.The template polynucleotide may, for example, comprise at least 1, 2, 3, 4, 5, 10, 20, or 30 silent mutations relative to the corresponding sequence in the genome of the cell to be modified.In some embodiments, the template polynucleotide comprises at most 2, 3, 4, 5, 10, 20, 30, or 50 silent mutations relative to the corresponding sequence in the genome of the cell to be modified.In some embodiments, the transgene contains one or more mutations, for example, silent mutations, that prevent Cas9 from recognizing and cleaving the template polynucleotide.The template polynucleotide may, for example, comprise at least 1, 2, 3, 4, 5, 10, 20, or 30 silent mutations relative to the corresponding sequence in the genome of the cell to be modified. In some embodiments, the template polynucleotide contains at most 2, 3, 4, 5, 10, 20, 30, or 50 silent mutations relative to the corresponding sequence in the genome of the cell to be altered. In some embodiments, the homology arms contained in the template polynucleotide contain silent mutations that prevent an RNA-guided nuclease or DNA-binding nuclease fusion protein from recognizing and cleaving the template polynucleotide.

[0151] In some embodiments, an exemplary template polynucleotide contains a polynucleotide encoding a T2A ribosomal skip element (the sequence set forth in SEQ ID NO:6, encoding the polypeptide sequence set forth in SEQ ID NO:7), a luciferase enzyme (FFLuc2, as set forth in SEQ ID NO:8, encoding the polypeptide sequence set forth in SEQ ID NO:9), and an eGFP fluorescent protein (the sequence set forth in SEQ ID NO:10, encoding the polypeptide sequence set forth in SEQ ID NO:11), flanked on either side of the T2A, FFLuc2, and eGFP coding sequences by a 5' homology arm (as set forth in SEQ ID NO:12, containing two silent mutations compared to the corresponding Nur77 genomic sequence set forth in SEQ ID NO:1) and a 3' homology arm (as set forth in SEQ ID NO:13) homologous to sequences surrounding the stop codon of the endogenous Nur77 gene. In some embodiments, a transgene, e.g., a sequence encoding T2A-EGFP-FFLuc2, can be targeted to be inserted in frame with the endogenous Nur77 gene before the stop codon. In some embodiments, an exemplary template polynucleotide for HDR comprises the nucleic acid sequence set forth in SEQ ID NO:5. In some embodiments, exemplary target site sequences for introduction of a genetic disruption or truncation include the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 14) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 15).

[0152] 2. Viral Vectors In some embodiments, the method includes contacting a cell composition, such as the reporter T cell composition described in Section IA1, with a prepared test or reference viral vector (also referred to as a "viral vector composition").

[0153] In some embodiments, a viral vector (e.g., a retroviral vector, e.g., a lentiviral vector) contains a nucleic acid encoding a recombinant receptor, such as a chimeric antigen receptor (CAR) or other antigen receptor, in the genome of the viral vector. The genome of a viral vector usually contains a sequence in addition to the nucleic acid encoding the recombinant receptor. Such a sequence may include a sequence that allows the genome to be packaged into a viral particle and / or a sequence that promotes expression of the nucleic acid encoding the recombinant receptor, such as a CAR.

[0154] Viral vectors, including retroviral vectors, have become the predominant method for introducing genes into mammalian, for example, human cells.Other sources of viral vectors include DNA viruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses.Methods for generating vectors, such as vectors containing nucleic acids encoding recombinant receptors, are well known in the art.See, for example, Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.In some of any such embodiments, the vector is an adenovirus, an adeno-associated virus, or a retrovirus, for example, a lentivirus.

[0155] The provided viral vector particles contain a genome derived from a retroviral genome-based vector, e.g., a gammaretroviral or lentiviral genome-based vector. Any of a number of such suitable vector genomes are known (see, e.g., Koste et al. (2014) Gene Therapy 2014 Apr 3. doi: 10.1038 / gt.2014.25; Carlens et al. (2000) Exp Hematol 28(10): 1137-46; Alonso-Camino et al. (2013) Mol Ther Nucl Acids 2, e93; Park et al., Trends Biotechnol. 2011 November 29(11): 550-557; Pfeifer and Verma (2001) Annu. Rev. Genomics Hum. Genet., 2:177-211). In some embodiments of the provided viral vectors, a heterologous nucleic acid encoding a recombinant receptor, e.g., an antigen receptor, e.g., a CAR, is contained and / or located between the 5' LTR and 3' LTR sequences of the vector genome.

[0156] a. retroviral vector In some embodiments, the viral vector particle contains a genome derived from a retroviral genome-based vector, e.g., a lentiviral genome-based vector. In some embodiments, the viral vector particle is a lentiviral vector particle. In some aspects of the provided viral vectors, a heterologous nucleic acid (e.g., a polynucleotide) encoding a recombinant protein, e.g., an antigen receptor, e.g., a chimeric antigen receptor (CAR) or a transgenic T cell receptor (TCR), is contained and / or located between the 5'LTR and 3'LTR sequences of the vector genome. In some embodiments, the recombinant protein is an antigen receptor. In some embodiments, the recombinant protein is a T cell receptor (TCR). In some embodiments, the recombinant protein is a chimeric antigen receptor (CAR).

[0157] In some embodiments, the viral vector genome is a lentiviral genome, such as an HIV-1 genome or an SIV genome. For example, lentiviral vectors have been generated by variously attenuating pathogenic genes, for example, deleting genes env, vif, vpu, and nef for therapeutic purposes, making the vector safer. Lentiviral vectors are well known. See Naldini et al. (1996 and 1998); Zufferey et al., (1997); Dull et al., 1998, U.S. Patent No. 6,013,516; and U.S. Patent No. 5,994,136). In some embodiments, these viral vectors are plasmid-based or virus-based, and are configured to retain the essential sequences for integrating foreign nucleic acid, for selection, and for transferring nucleic acid into host cells. Known lentiviruses can be readily obtained from repositories or collections, such as the American Type Culture Collection ("ATCC"; 10801 University Blvd., Manassas, Va. 20110-2209), or can be isolated from known sources using commercially available techniques.

[0158] Non-limiting examples of lentiviral vectors include those derived from lentiviruses, such as human immunodeficiency virus 1 (HIV-1), HIV-2, simian immunodeficiency virus (SIV), human T-lymphotropic virus 1 (HTLV-1), HTLV-2, or equine infectious anemia virus (E1AV). For example, lentiviral vectors have been generated by variously attenuating HIV pathogenic genes, such as deleting the env, vif, vpr, vpu, and nef genes for therapeutic purposes, making the vector safer. Lentiviral vectors are known in the art; see Naldini et al., (1996 and 1998); Zufferey et al., (1997); Dull et al., 1998, U.S. Patent Nos. 6,013,516 and 5,994,136). In some embodiments, these viral vectors are plasmid-based or virus-based and are configured to carry the necessary sequences for integrating foreign nucleic acids, for selection, and for transferring nucleic acids into host cells. Known lentiviruses can be readily obtained from repositories or collections, such as the American Type Culture Collection ("ATCC"; 10801 University Blvd., Manassas, Va. 20110-2209), or can be isolated from known sources using commercially available techniques.

[0159] In some embodiments, the viral genome vector can contain the 5' and 3' LTR sequences of retrovirus, for example, lentivirus.In some aspects, the viral genome construct can contain the sequences derived from the 5' and 3' LTR of lentivirus, particularly the R and U5 sequences derived from the 5' LTR of lentivirus and the inactivated 3' LTR or self-inactivating 3' LTR derived from lentivirus.The LTR sequence can be the LTR sequence derived from any lentivirus derived from any species.For example, it can be the LTR sequence derived from HIV, SIV, FIV or BIV.Usually, the LTR sequence is the HIV LTR sequence.

[0160] In some embodiments, the nucleic acid of a viral vector, such as an HIV viral vector, lacks an additional transcription unit. The vector genome may contain an inactivated 3'LTR or a self-inactivating 3'LTR (Zufferey et al. J Virol 72:9873, 1998; Miyoshi et al., J Virol 72:8150, 1998). For example, a self-inactivating (SIN) vector can be generated using a deletion in the U3 region of the 3'LTR of the nucleic acid used to generate the viral vector RNA. This deletion can then be transferred to the 5'LTR of the proviral DNA during reverse transcription. Self-inactivating vectors generally have enhancer and promoter sequences deleted from the 3' long terminal repeat (LTR), which are copied into the 5'LTR during vector integration. In some embodiments, sufficient sequences, including the TATA box, can be removed to eliminate the transcriptional activity of the LTR. This can prevent the generation of full-length vector RNA in transduced cells. In some embodiments, the U3 element of the 3'LTR contains deletions of its enhancer sequence, TATA box, Sp1, and NF-kappa B site. As a result of the self-inactivating 3'LTR, the provirus generated after entry and reverse transcription contains an inactivated 5'LTR. This can improve safety by reducing the risk of vector genome mobilization and the influence of the LTR on adjacent cellular promoters. The self-inactivating 3'LTR can be constructed by any method known in the art. In some embodiments, this does not affect the vector titer or in vitro or in vivo properties of the vector.

[0161] Optionally, in the viral construct, for example, a heterologous promoter sequence, the U3 sequence from lentivirus 5'LTR can be replaced with a promoter sequence.This can increase the titer of the virus recovered from packaging cell line.Enhancer sequence can also be included.Any enhancer / promoter combination that increases the expression of viral RNA genome in packaging cell line can be used.In one example, the CMV enhancer / promoter sequence is used (US Patent No. 5,385,839 and US Patent No. 5,168,062).

[0162] In certain embodiments, the risk of insertional mutagenesis can be minimized by constructing a retroviral vector genome, e.g., a lentiviral vector genome, that is defective for integration. Various approaches can be pursued to generate non-integrating vector genomes. In some embodiments, mutation(s) can be engineered into the integrase enzyme component of the pol gene to encode a protein with an inactive integrase. In some embodiments, the vector genome itself can be modified to prevent integration, for example, by mutating or deleting one or both attachment sites, or by rendering the 3' LTR-proximal polypurine tract (PPT) nonfunctional by deletion or modification. In some embodiments, non-genetic approaches are available, including pharmacological agents that inhibit one or more functions of integrase. The approaches are not mutually exclusive; i.e., more than two of them can be used at once. For example, both the integrase and attachment sites can be non-functional, or the integrase and PPT sites can be non-functional, or the attachment site and PPT site can be non-functional, or all of them can be non-functional. Such methods and viral vector genomes are known and available (see Philpott and Thrasher, Human Gene Therapy 18:483, 2007; Engelman et al. J Virol 69:2729, 1995; Brown et al J Virol 73:9011 (1999); WO2009 / 076524; McWilliams et al., J Virol 77:11150, 2003; Powell and Levin J Virol 70:5288, 1996).

[0163] In some embodiments, the vector contains a sequence for propagation in a host cell, for example, a prokaryotic host cell. In some embodiments, the nucleic acid of a viral vector contains one or more origins of replication for propagation in a prokaryotic cell, for example, a bacterial cell. In some embodiments, the vector that contains a prokaryotic replication origin may also contain a gene whose expression confers a detectable or selectable marker, such as drug resistance.

[0164] b. Preparation of retroviral vectors Viral vector genomes are usually constructed in the form of a plasmid that can be transfected into packaging or producer cell lines. Any of a variety of known methods can be used to generate retroviral particles whose genome contains an RNA copy of the viral vector genome. In some embodiments, the creation of a viral-based gene delivery system involves at least two components: first, a packaging plasmid containing structural proteins and the enzymes necessary to generate viral vector particles; and second, the viral vector itself, i.e., the genetic material to be transferred. Biosafety protection can be incorporated into the design of one or both of these components.

[0165] In some embodiments, the packaging plasmid may contain all retroviral, e.g., HIV-1, proteins other than the envelope proteins (Naldini et al., 1998). In other embodiments, the viral vector may lack additional viral genes, e.g., those associated with pathogenicity, e.g., vpr, vif, vpu, and nef, and / or Tat, the primary transactivator of HIV. In some embodiments, lentiviral vectors, e.g., HIV-based lentiviral vectors, contain only three genes of the parent virus: gag, pol, and rev, which reduces or eliminates the possibility of wild-type virus reconstitution via recombination.

[0166] In some embodiments, the viral vector genome is introduced into a packaging cell line that contains all the components necessary for packaging the viral genome RNA transcribed from the viral vector genome into viral particles. Alternatively, the viral vector genome can contain one or more sequences, for example, one or more genes encoding viral components in addition to the recombinant nucleic acid of interest. In some aspects, however, to prevent genome replication in target cells, the endogenous viral genes required for replication are separately removed and provided in the packaging cell line.

[0167] In some embodiments, packaging cell lines are transfected with one or more plasmid vectors containing the components necessary to produce particles. In some embodiments, packaging cell lines are transfected with a plasmid containing a viral vector genome, including a nucleic acid encoding an LTR, a cis-acting packaging sequence, and a sequence of interest, i.e., an antigen receptor, such as CAR, and one or more helper plasmids encoding viral enzymatic and / or structural components, such as Gag, pol, and / or rev. In some embodiments, multiple vectors are used to separate the various genetic components that produce retroviral vector particles. In some such embodiments, providing separate vectors to packaging cells reduces the chance of recombination events that could otherwise produce replication-competent viruses. In some embodiments, a single plasmid vector carrying all of the retroviral components can be used.

[0168] In some embodiments, retroviral vector particles, e.g., lentiviral vector particles, are pseudotyped to increase the efficiency of transduction of host cells. For example, in some embodiments, retroviral vector particles, e.g., lentiviral vector particles, are pseudotyped with the VSV-G glycoprotein, which provides a broader cellular host range, expanding the range of cell types that can be transduced. In some embodiments, packaging cell lines are transfected with a plasmid or polynucleotide encoding a non-native envelope glycoprotein, such as a xenotropic, polytropic, or amphotropic envelope, e.g., Sindbis virus envelope, GALV, or VSV-G.

[0169] In some embodiments, the packaging cell line provides components, including viral regulatory and structural proteins, required in trans for packaging viral genomic RNA into lentiviral vector particles. In some embodiments, the packaging cell line can be any cell line capable of expressing lentiviral proteins and producing functional lentiviral vector particles. In some aspects, suitable packaging cell lines include 293 (ATCC CCL X), 293T, HeLA (ATCC CCL 2), D17 (ATCC CCL 183), MDCK (ATCC CCL 34), BHK (ATCC CCL-10), and Cf2Th (ATCC CRL 1430) cells.

[0170] In some embodiments, the packaging cell line stably expresses viral protein(s). For example, in some aspects, packaging cell lines can be constructed that contain gag, pol, rev, and / or other structural genes, but lack the LTRs and packaging components. In some embodiments, packaging cell lines can be transiently transfected with nucleic acid molecules encoding one or more viral proteins, along with a viral vector genome containing a nucleic acid molecule encoding a heterologous protein and / or a nucleic acid encoding an envelope glycoprotein.

[0171] In some embodiments, the viral vector and packaging and / or helper plasmid are introduced into a packaging cell line via transfection or infection. The packaging cell line produces viral vector particles containing the viral vector genome. Transfection or infection methods are well known. Non-limiting examples include calcium phosphate, DEAE-dextran, lipofection, electroporation, and microinjection.

[0172] When the recombinant plasmid and retroviral LTR and packaging sequence are introduced into a particular cell line (e.g., by calcium phosphate precipitation), the packaging sequence can allow the RNA transcript of the recombinant plasmid to be packaged into viral particles, which can then be secreted into the culture medium. In some embodiments, the medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. For example, in some aspects, after co-transfection of the packaging plasmid and transfer vector into a packaging cell line, viral vector particles are recovered from the culture medium and titered using standard methods used by those skilled in the art.

[0173] In some embodiments, retroviral vectors, e.g., lentiviral vectors, can be produced in a packaging cell line, e.g., an exemplary HEK 293T cell line, by introducing a plasmid that allows for the production of lentiviral particles. In some embodiments, the packaging cells are transfected and / or contain polynucleotides encoding gag and pol and a recombinant receptor, e.g., a polynucleotide encoding an antigen receptor, e.g., a CAR. In some embodiments, the packaging cell line is optionally and / or further transfected and / or contains a polynucleotide encoding a rev protein. In some embodiments, the packaging cell line is optionally and / or further transfected and / or contains a polynucleotide encoding a non-native envelope glycoprotein, e.g., VSV-G. In some such embodiments, approximately two days after transfection of cells, e.g., HEK 293T cells, the cell supernatant contains the recombinant lentiviral vector, which can be harvested and titered.

[0174] The retroviral vector particles that are recovered and / or produced can be used to transduce target cells using the method described above.Once viral RNA is reverse transcribed in target cells, it is transferred into the nucleus and stably integrated into host genome.One or two days after viral RNA is integrated, the expression of recombinant protein, such as antigen receptor, for example, CAR, can be detected.

[0175] c. a nucleic acid encoding a heterologous protein In some embodiments, viral vectors contain the nucleic acid (e.g., polynucleotide) encoding heterologous recombinant protein.In some embodiments, heterologous recombinant protein or molecule is or comprises recombinant receptor, such as antigen receptor, for example, SB-transposon for gene silencing, capsid-encapsulated transposon, for example, homologous double-stranded nucleic acid for genome recombination or reporter gene (e.g., fluorescent protein, e.g., GFP) or luciferase).

[0176] In some embodiments, the viral vector contains a nucleic acid (e.g., polynucleotide) encoding a recombinant receptor and / or chimeric receptor, for example, a heterologous receptor protein. Recombinant receptors, for example, heterologous receptors, can include antigen receptors, for example, chimeric antigen receptors (CARs), and other antigen-binding receptors, for example, functional non-TCR antigen receptors, including transgenic T cell receptors (TCRs). Receptors can also include other receptors, for example, other chimeric receptors, for example, receptors that bind to specific ligands and have transmembrane and / or intracellular signaling domains similar to those present in CARs.

[0177] In any of these instances, the nucleic acid (e.g., polynucleotide) is inserted into or located in a region of the viral vector, e.g., generally in a non-essential region of the viral genome. In some embodiments, the nucleic acid (e.g., polynucleotide) is inserted into the viral genome at a specific viral sequence to generate a virus that is replication-deficient.

[0178] In some embodiments, the encoded recombinant antigen receptor, e.g., CAR, is one that is capable of specifically binding to one or more ligands on the cells or disease to be targeted, e.g., cancer, infectious disease, inflammatory or autoimmune disease, or other disease or condition, including those described herein for targeting using the provided methods and compositions.

[0179] In certain embodiments, exemplary antigens are αvβ6 integrin (avb6 integrin), B-cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (also known as CA9, CAIX, or G250), cancer testis antigen, cancer / testis antigen 1B (CTAG, also known as NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), cyclin, cyclin A2, CC motif chemokine ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), truncated epidermal growth factor protein (tEGFR), type III epidermal growth factor receptor mutant (EGFR), and EGFR-specific EGFR. vIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrin B2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor-like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), folate binding protein (FBP), folate receptor alpha, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside GD3, glycoprotein 100 (gp100), G protein-coupled receptor 5D (GPCR5D), Her2 / neu (receptor tyrosine kinase erb-B2), Her3 (erb-B3), Her4 (erb-B4), erbB dimer, human high molecular weight melanoma-associated antigen (HMW-MAA), Hepatitis B surface antigen, human leukocyte antigen A1 (HLA-A1), human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Ra), IL-13 receptor alpha 2 (IL-13Ra2), kinase insert domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1-CAM), CE7 epitope of L1-CAM, leucine-rich repeat-containing 8 family member A (LRRC8A), Lewis Y, melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, mesothelin, c-Met, murine cytomegalovirus (CMV), mucin 1 (MUC1), MUC16, natural killer group 2 member D (NKG2D) ligand, melan-A (MART-1), neural cell adhesion molecule (NCAM),The receptor may be or include carcinoembryonic antigen, preferentially expressed antigen in melanoma (PRAME), progesterone receptor, prostate-specific antigen, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), survivin, trophoblast glycoprotein (TPBG, also known as 5T4), tumor-associated glycoprotein 72 (TAG72), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms' tumor 1 (WT-1), a pathogen-specific antigen or an antigen associated with a universal tag and / or biotinylated molecule and / or a molecule expressed by HIV, HCV, HBV, or other pathogens. In some embodiments, the antigen targeted by the receptor includes an antigen associated with a B-cell malignancy, such as any of a number of known B-cell markers. In some embodiments, the antigen is or comprises CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Ig kappa, Ig lambda, CD79a, CD79b, or CD30.

[0180] In some embodiments, exemplary antigens include orphan tyrosine kinase receptor RORl, tEGFR, Her2, LI-CAM, CD19, CD20, CD22, mesothelin, CEA and hepatitis B surface antigen, antifolate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, EGP-2, EGP-4, EPHa2, ErbB2, 3 or 4, FBP, fetal acetylcholine receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL- 13R-alpha2, kdr, kappa light chain, Lewis Y, L1 cell adhesion molecule, MAGE-A1, mesothelin, MUC1, MUC16, PSCA, NKG2D ligand, NY-ESO-1, MART-1, gp100, carcinoembryonic antigen, ROR1, TAG72, VEGF-R2, carcinoembryonic antigen (CEA), prostate specific antigen, PSMA, Her2 / neu, estrogen receptor, progesterone receptor, ephrin B2, CD123, CS-1, c-Met, GD-2 and MAGE A3, CE7, Wilms' tumor 1 (WT-1), cyclins, e.g., cyclin A1 (CCNA1) and / or biotinylated molecules and / or molecules expressed by and / or characteristic of or specific for HIV, HCV, HBV, HPV and / or other pathogens and / or oncogenic versions thereof.

[0181] In some embodiments, the antigen is or includes a pathogen-specific or pathogen-expressed antigen, hi some embodiments, the antigen is a viral antigen (e.g., a viral antigen from HIV, HCV, HBV, etc.), a bacterial antigen, and / or a parasitic antigen.

[0182] Antigen receptors, including CARs and recombinant TCRs, and their generation and introduction, in some embodiments, can be described in, for example, International Patent Application Publication Nos. WO200014257, WO2013126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, WO2015 / 168613, WO2016 / 030414, U.S. Patent Application Publication Nos. US2002131960, US2013287748, US201301 49337, US20190389925, U.S. Patent Nos. 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353 and 8,479,118 and European Patent Application No. EP2537416 and / or Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75.

[0183] 1) Chimeric antigen receptor In some embodiments, the nucleic acid (e.g., polynucleotide) contained in the genome of the viral vector encodes a chimeric antigen receptor (CAR). CARs are generally engineered receptors with an extracellular portion containing an extracellular ligand-binding domain, e.g., an antibody or fragment thereof, linked to one or more intracellular signaling components. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain and / or an intracellular domain linking the extracellular domain and the intracellular signaling domain. Such molecules typically mimic or resemble signals mediated by natural antigen receptors and / or signals mediated by such receptors in combination with costimulatory receptors.

[0184] In some embodiments, CARs are constructed with specificity for a specific marker, for example, a marker expressed in a specific cell type to be targeted by adoptive therapy, such as a cancer marker and / or any of the antigens described. Thus, CARs typically comprise one or more antigen-binding fragments, domains, or portions of an antibody, or one or more antibody variable domains and / or antibody molecules. In some embodiments, CARs comprise antigen-binding portions (single or multiple) of an antibody molecule, such as a heavy chain variable chain (VH) or its antigen-binding portion, or a single-chain antibody fragment (scFv) derived from the heavy chain variable (VH) and light chain variable (VL) chains of a monoclonal antibody (mAb).

[0185] In some embodiments, engineered cells, e.g., T cells, are provided that express a CAR with specificity for a particular antigen (or marker or ligand), e.g., an antigen expressed on the surface of a particular cell type. In some embodiments, the antigen is a polypeptide. In some embodiments, the antigen is a carbohydrate or other molecule. In some embodiments, the antigen is selectively expressed or overexpressed in cells having a disease or condition, e.g., tumor or pathogenic cells, compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed in normal cells and / or expressed in engineered cells.

[0186] In certain embodiments, the recombinant receptor, e.g., a chimeric receptor, contains a cytoplasmic signaling domain or region (interchangeably referred to as an intracellular signaling domain or region), e.g., a cytoplasmic (intracellular) region capable of inducing a primary activation signal in a T cell, e.g., an intracellular signaling region comprising a cytoplasmic signaling domain or region of a T cell receptor (TCR) component (e.g., the cytoplasmic signaling domain or region of the zeta chain of the CD3-zeta (CD3ζ) chain or a functional variant or signaling portion thereof), and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the CAR comprises an extracellular antigen recognition domain that specifically binds to a target antigen and an intracellular signaling domain comprising an ITAM. In some embodiments, the intracellular signaling domain comprises the intracellular domain of the CD3-zeta (CD3ζ) chain.

[0187] In some embodiments, the chimeric receptor further contains an extracellular ligand-binding domain that specifically binds to a ligand (e.g., antigen) antigen. In some embodiments, the chimeric receptor is a CAR that contains an extracellular antigen-recognition domain that specifically binds to an antigen. In some embodiments, the ligand, e.g., antigen, is a protein expressed on the surface of a cell. In some embodiments, the CAR is a TCR-like CAR, and the antigen is a processed peptide antigen, such as a peptide antigen of an intracellular protein, which, like a TCR, is recognized on the cell surface in the context of a major histocompatibility complex (MHC) molecule.

[0188] Exemplary antigen receptors, including CARs, and methods for engineering and introducing such receptors into cells include, for example, International Patent Application Publication Nos. WO200014257, WO2013126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, U.S. Patent Application Publication Nos. US2002131960, US2013287748, US20130149337, Those described in U.S. Patent Nos. 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353 and 8,479,118 and European Patent Application No. EP 2537416 and / or Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75. In some embodiments, antigen receptors include CARs such as those described in U.S. Patent No. 7,446,190 and those described in International Patent Application Publication No. WO / 2014055668 A1.Examples of CARs include CARs as disclosed in any of the above publications, e.g., WO2014031687, US8,339,645, US7,446,179, US2013 / 0149337, U.S. Pat. No. 7,446,190, U.S. Pat. No. 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US8,339,645, US7,446,179, US2013 / 0149337, U.S. Pat. No. 7,446,190 and U.S. Pat. No. 8,389,282.

[0189] In some embodiments, CARs are constructed with specificity for a particular antigen (or marker or ligand), for example, an antigen expressed in a particular cell type to be targeted by adoptive therapy, such as a cancer marker and / or an antigen intended to induce a dampening response, for example, an antigen expressed in a normal or non-disease cell type. Thus, CARs typically contain one or more antigen-binding molecules, such as one or more antigen-binding fragments, domains, or portions, or one or more antibody variable domains and / or antibody molecules, in their extracellular portion. In some embodiments, CARs contain the antigen-binding portion(s) of an antibody molecule, for example, a single-chain antibody fragment (scFv) derived from the heavy chain variable (VH) and light chain variable (VL) chains of a monoclonal antibody (mAb).

[0190] In some embodiments, the antibody or its antigen-binding portion is expressed on a cell as part of a recombinant receptor, e.g., an antigen receptor. Among antigen receptors are functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs). In general, CARs containing antibodies or antigen-binding fragments thereof exhibiting TCR-like specificity directed against peptide-MHC complexes are also sometimes referred to as TCR-like CARs. In some embodiments, the extracellular antigen-binding domain specific for the MHC-peptide complex of the TCR-like CAR is linked to one or more intracellular signaling components via a linker and / or transmembrane domain(s), in some aspects. In some embodiments, such molecules typically mimic or resemble the signaling through a natural antigen receptor, e.g., a TCR, optionally in combination with a costimulatory receptor.

[0191] In some embodiments, the recombinant receptor, e.g., a chimeric receptor (e.g., a CAR), comprises a ligand-binding domain that binds to, e.g., specifically binds to, an antigen (or ligand). Among the antigens targeted by the chimeric receptor are those that are expressed in the context of the disease, condition, or cell type to be targeted by adoptive cell therapy. Among the diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, including blood cancers, immune cancers, e.g., lymphomas, leukemias, and / or myelomas, e.g., B, T, and myeloid leukemias, lymphomas, and multiple myelomas.

[0192] In some embodiments, the antigen (or ligand) is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen (or ligand) is selectively expressed or overexpressed in cells of a disease or condition, e.g., tumor or pathogenic cells, compared to normal or non-target cells or tissues. In other embodiments, the antigen is expressed in normal cells and / or expressed in engineered cells. In some embodiments, the antigen is associated with a disease or condition, e.g., cancer, an autoimmune disease or disorder, or an infectious disease. In some embodiments, an antigen receptor, e.g., a CAR, specifically binds to the universal tag.

[0193] In some embodiments, the CAR contains an antigen expressed on the surface of a cell, for example, an antibody or antigen-binding fragment (e.g., scFv) that specifically recognizes an intact antigen. In some embodiments, the target is an antigen of the recombinant receptor, and therefore, in some cases, the target-expressing cell is an antigen-expressing cell.

[0194] In some embodiments, the antigen (or ligand) is a tumor antigen or a cancer marker. In some embodiments, the antigen (or ligand) antigen is αvβ6 integrin (avb6 integrin), B-cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (also known as CA9, CAIX, or G250), a cancer testis antigen, or a cancer / testis antigen. 1B(also known as CTAG, NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), cyclin, cyclin A2, CC motif chemokine ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD138, CD171, epidermal growth factor protein (EGFR), truncated epidermal growth factor protein (tEGFR), type III epidermal growth factor receptor mutation (EGFR vIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrin B2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor-like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), folate binding protein (FBP), folate receptor alpha, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside Glycoside GD3, glycoprotein 100 (gp100), G protein-coupled receptor 5D (GPCR5D), Her2 / neu (receptor tyrosine kinase erb-B2), Her3 (erb-B3), Her4 (erb-B4), erbB dimer, human high molecular weight melanoma-associated antigen (HMW-MAA), hepatitis B surface antigen, human leukocyte antigen A1 (HLA-A1), human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha ( ... IL-22Ra), IL-13 receptor alpha 2 (IL-13Ra2), kinase insert domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1-CAM), CE7 epitope of L1-CAM, leucine-rich repeat-containing 8 family member A (LRRC8A), Lewis Y, melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, mesothelin, c-Met, murine cytomegalovirus (CMV), mucin 1 (MUC1), MUC16, natural killer group 2 member D (NKG2D) ligand, melan-A (MART-1), neural cell adhesion molecule (NCAM), carcinoembryonic antigen, preferentially expressed antigen in melanoma (PRAME), progesterone receptor, prostate-specific antigen, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), survivin,The antigen targeted by the receptor may be or include trophoblast glycoprotein (TPBG, also known as 5T4), tumor-associated glycoprotein 72 (TAG72), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms' tumor 1 (WT-1), a pathogen-specific antigen, or a universal tag and / or a biotinylated molecule and / or an antigen associated with a molecule expressed by HIV, HCV, HBV, or other pathogens. The antigen targeted by the receptor may, in some embodiments, include an antigen associated with a B-cell malignancy, e.g., any of several known B-cell markers. In some embodiments, the antigen is or includes BCMA, CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Ig kappa, Ig lambda, CD79a, CD79b, or CD30. In some embodiments, the antigen is or includes CD19. In some embodiments, the antigen is or includes BCMA.

[0195] In some embodiments, the antigen or antigen-binding domain is CD19. In some embodiments, the scFv comprises VH and VL derived from an antibody or antibody fragment specific to CD19. In some embodiments, the antibody or antibody fragment that binds to CD19 is a mouse-derived antibody, such as FMC63 and SJ25C1. In some embodiments, the antibody or antibody fragment is a human antibody, such as the human antibody described in U.S. Patent Publication No. US2016 / 0152723.

[0196] In some embodiments, the scFv is derived from FMC63. FMC63 generally refers to a murine monoclonal IgG1 antibody raised against Nalm-1 and -16 cells expressing CD19 of human origin (Ling, NR, et al. (1987). Leucocyte typing III. 302). In some embodiments, the FMC63 antibody comprises a CDRH1 set forth in SEQ ID NO: 19, a CDRH2 set forth in SEQ ID NO: 20, and a CDRH3 set forth in SEQ ID NO: 21 or SEQ ID NO: 35, and a CDRL1 set forth in SEQ ID NO: 16, a CDRL2 set forth in SEQ ID NO: 17 or 36, and a CDR L3 set forth in SEQ ID NO: 18 or 37. In some embodiments, the FMC63 antibody comprises a heavy chain variable region (V) comprising the amino acid sequence of SEQ ID NO: 22. H ), and a light chain variable region (V) comprising the amino acid sequence of SEQ ID NO: 23 L ) is included.

[0197] In some embodiments, the scFv comprises a variable light chain containing the CDRL1 sequence of SEQ ID NO: 16, the CDRL2 sequence of SEQ ID NO: 17, and the CDRL3 sequence of SEQ ID NO: 18, and / or a variable heavy chain containing the CDRH1 sequence of SEQ ID NO: 19, the CDRH2 sequence of SEQ ID NO: 20, and the CDRH3 sequence of SEQ ID NO: 21. In some embodiments, the scFv comprises a light chain variable chain containing the CDRL1 sequence of SEQ ID NO: 16, the CDRL2 sequence of SEQ ID NO: 36, and the CDRL3 sequence of SEQ ID NO: 37, and a heavy chain variable chain containing the CDRH1 sequence of SEQ ID NO: 19, the CDRH2 sequence of SEQ ID NO: 20, and the CDRH3 sequence of SEQ ID NO: 35.

[0198] In some embodiments, the scFv comprises a heavy chain variable chain region set forth in SEQ ID NO: 22 and a light chain variable chain region set forth in SEQ ID NO: 23. In some embodiments, the variable heavy chain and variable light chain are connected by a linker. In some embodiments, the linker is set forth in SEQ ID NO: 39. In some embodiments, the scFv comprises, in order, V H , linker, and V L In some embodiments, the scFv comprises, in order, V L , linker, and VH In some embodiments, the scFv is encoded by the sequence of nucleotides set forth in SEQ ID NO: 24 or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 24. In some embodiments, the scFv comprises the sequence of amino acids set forth in SEQ ID NO: 24 or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 24.

[0199] In some embodiments, the scFv is derived from SJ25C1. SJ25C1 is a murine monoclonal IgG1 antibody raised against Nalm-1 and -16 cells expressing CD19 of human origin (Ling, NR, et al. (1987). Leucocyte typing III. 302). In some embodiments, the SJ25C1 antibody comprises CDRH1, H2, and H3 sequences set forth in SEQ ID NOS: 28-30, respectively, and CDRL1, L2, and L3 sequences set forth in SEQ ID NOS: 25-27, respectively. In some embodiments, the SJ25C1 antibody comprises a heavy chain variable region (V) comprising the amino acid sequence of SEQ ID NO: 31. H ), and a light chain variable region (V) comprising the amino acid sequence of SEQ ID NO: 32 L ) is included.

[0200] In some embodiments, the scFv comprises a variable light chain containing the CDRL1 sequence of SEQ ID NO:25, the CDRL2 sequence of SEQ ID NO:26, and the CDRL3 sequence of SEQ ID NO:27, and a variable heavy chain containing the CDRH1 sequence of SEQ ID NO:28, the CDRH2 sequence of SEQ ID NO:29, and the CDRH3 sequence of SEQ ID NO:30. In some embodiments, the scFv comprises a variable heavy chain region set forth in SEQ ID NO:31 and a variable light chain region set forth in SEQ ID NO:32. In some embodiments, the variable heavy chain and variable light chain are connected by a linker. In some embodiments, the linker is set forth in SEQ ID NO:33. In some embodiments, the scFv comprises, in order, V H、Linker, and V L In some embodiments, the scFv comprises, in order, V L , linker, and V H In some embodiments, the scFv comprises the sequence of amino acids set forth in SEQ ID NO: 34, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34.

[0201] In some embodiments, an antibody or antigen-binding fragment (e.g., scFv or V H domain) specifically recognizes an antigen, e.g., BCMA. In some embodiments, the antibody or antigen-binding fragment is derived from, or is a variant of, an antibody or antigen-binding fragment that specifically binds BCMA.

[0202] In some embodiments, the CAR is an anti-BCMA CAR specific for BCMA, e.g., human BCMA. Chimeric antigen receptors containing anti-BCMA antibodies, including mouse anti-human BCMA antibodies and human anti-human antibodies, and cells expressing such chimeric receptors have been described. See Carpenter et al., Clin Cancer Res., 2013, 19(8):2048-2060, WO2016 / 090320, WO2016090327, WO2010104949A2, and WO2017173256. In some embodiments, the antigen or antigen-binding domain is BCMA. In some embodiments, the scFv is a V derived from an antibody or antibody fragment specific for BCMA. H and V L In some embodiments, the antibody or antibody fragment that binds BCMA comprises a V from an antibody or antibody fragment described in International Patent Application Publication Nos. WO2016 / 090327 and WO2016 / 090320. H and V L is or contains

[0203] In some embodiments, the antigen or antigen-binding domain is GPRC5D. In some embodiments, the scFv is a V derived from an antibody or antibody fragment specific for GPRC5D. H and V L In some embodiments, the antibody or antibody fragment that binds to GPRC5D comprises a V from the antibodies or antibody fragments described in International Patent Application Publication Nos. WO2016 / 090329 and WO2016 / 090312. H and V L is or contains

[0204] In some embodiments, the CAR contains a ligand- (e.g., antigen-) binding domain that binds to or recognizes, e.g., specifically binds, a universal tag or universal epitope. In some embodiments, the binding domain can bind to a molecule, tag, polypeptide, and / or epitope that can be linked to a different binding molecule (e.g., antibody or antigen-binding fragment) that recognizes an antigen associated with a disease or disorder. Exemplary tags or epitopes include dyes (e.g., fluorescein isothiocyanate) or biotin. In some embodiments, the binding molecule (e.g., antibody or antigen-binding fragment) linked to the tag recognizes an antigen associated with a disease or disorder, e.g., a tumor antigen, and engineered cells expressing a tag-specific CAR exert the cytotoxicity or other effector function of the engineered cell. In some embodiments, the specificity of the CAR for an antigen associated with a disease or disorder is provided by a binding molecule (e.g., antibody) bearing a tag, and binding molecules bearing different tags may be used to target different antigens. Exemplary CARs specific for universal tags or universal epitopes include those described, for example, in US9,233,125, WO2016 / 030414, Urbanska et al., (2012) Cancer Res 72: 1844-1852, and Tamada et al., (2012) Clin Cancer Res 18:6436-6445.

[0205] In some embodiments, the antigen is or includes a pathogen-specific or pathogen-expressed antigen. In some embodiments, the antigen is a viral antigen (e.g., a viral antigen from HIV, HCV, HBV, etc.), a bacterial antigen, and / or a parasitic antigen. In some embodiments, the CAR contains a TCR-like antibody, e.g., an antibody or antigen-binding fragment (e.g., scFv) that specifically recognizes an intracellular antigen, e.g., a tumor-associated antigen, presented on the cell surface as an MHC-peptide complex. In some embodiments, an antibody or antigen-binding portion thereof that recognizes an MHC-peptide complex can be expressed on a cell as part of a recombinant receptor, e.g., an antigen receptor. Among antigen receptors are functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs). In general, a CAR containing an antibody or antigen-binding fragment exhibiting TCR-like specificity directed against a peptide-MHC complex may be referred to as a TCR-like CAR.

[0206] Reference to a "major histocompatibility complex" (MHC) refers, in some cases, to a protein, generally a glycoprotein, containing a polymorphic binding site or groove capable of complexing with a peptide antigen of a polypeptide, including peptide antigens processed by the cellular machinery. In some cases, the MHC molecule may be displayed or expressed on the cell surface, e.g., as a complex with a peptide, i.e., an MHC-peptide complex, for antigen presentation in a conformation recognizable by an antigen receptor on a T cell, e.g., a TCR or a TCR-like antibody. Generally, MHC class I molecules are heterodimers having a transmembrane α chain, in some cases a transmembrane α chain with three α domains, and noncovalently associated β2-microglobulin. Generally, MHC class II molecules are composed of two transmembrane glycoproteins, α and β, both of which are typically transmembrane. An MHC molecule may comprise an effective portion of an MHC containing an antigen-binding site or site for peptide binding and sequences necessary for recognition by an appropriate antigen receptor. In some embodiments, MHC class I molecules deliver peptides from the cytosol to the cell surface, where the MHC-peptide complex is delivered to a T cell, e.g., typically a CD8 + Recognized by T cells, but in some cases by CD4 + In some embodiments, MHC class II molecules deliver peptides from the vesicle system to the cell surface, where they are typically recognized by CD4 T cells. + They are recognized by T cells. Generally, MHC molecules are encoded by a group of linked gene loci, which are collectively called H-2 in mice and human leukocyte antigens (HLA) in humans. Therefore, typically, human MHC is also sometimes called human leukocyte antigens (HLA).

[0207] The term "MHC-peptide complex" or "peptide-MHC complex" or derivatives thereof refers to a complex or association of a peptide antigen and an MHC molecule, e.g., typically through non-covalent interactions of the peptide in the binding groove or cleft of the MHC molecule. In some embodiments, the MHC-peptide complex is present or presented on the surface of a cell. In some embodiments, the MHC-peptide complex can be specifically recognized by an antigen receptor, e.g., a TCR, a TCR-like CAR, or an antigen-binding site thereof.

[0208] In some embodiments, peptides of polypeptides, e.g., peptide antigens or epitopes, can associate with MHC molecules, e.g., for recognition by antigen receptors. Generally, peptides are derived from or based on fragments of longer biomolecules, e.g., polypeptides or proteins. In some embodiments, peptides are typically about 8 to about 24 amino acids in length. In some embodiments, peptides have a length of 9 to 22 amino acids or about 9 to about 22 amino acids for recognition in an MHC class II complex. In some embodiments, peptides have a length of 8 to 13 amino acids or about 8 to about 13 amino acids for recognition in an MHC class I complex. In some embodiments, upon recognition of the peptide in the context of an MHC molecule, e.g., an MHC-peptide complex, the antigen receptor, e.g., a TCR or TCR-like CAR, produces or triggers an activation signal to the T cell that induces a T cell response, e.g., T cell proliferation, cytokine production, a cytotoxic T cell response, or other response.

[0209] In some embodiments, the TCR-like antibodies or antigen-binding sites are known or can be produced by known methods (see, e.g., U.S. Patent Application Publication Nos. US2002 / 0150914; US2003 / 0223994; US2004 / 0191260; US2006 / 0034850; US2007 / 00992530; US20090226474; US20090304679; and International PCT Publication No. WO03 / 068201).

[0210] In some embodiments, antibodies or antigen-binding portions thereof that specifically bind to MHC-peptide complexes can be produced by immunizing a host with an effective amount of an immunogen containing a specific MHC-peptide complex. In some cases, the peptide of the MHC-peptide complex is an epitope of an antigen capable of binding to an MHC, such as a tumor antigen, e.g., a universal tumor antigen, a myeloma antigen, or other antigens described below. In some embodiments, an effective amount of the immunogen is then administered to the host to elicit an immune response, where the immunogen retains its three-dimensional structure for a period of time sufficient to elicit an immune response to the three-dimensional presentation of the peptide in the binding groove of the MHC molecule. Serum collected from the host is then assayed to determine whether the desired antibodies that recognize the three-dimensional presentation of the peptide in the binding groove of the MHC molecule have been produced. In some embodiments, the produced antibodies can be evaluated to confirm that they can distinguish the MHC-peptide complex from the MHC molecule alone, the peptide of interest alone, and complexes of the MHC with an unrelated peptide. The desired antibodies can then be isolated.

[0211] In some embodiments, antibodies or antigen-binding portions thereof that specifically bind to MHC-peptide complexes can be produced by employing antibody library display methods, such as phage antibody libraries. In some embodiments, phage display libraries of mutant Fab, scFv, or other antibody forms can be generated, for example, phage display libraries in which library members are mutated at one or more residues in one or more CDRs. See, e.g., U.S. Patent Application Publication Nos. US20020150914, US2014 / 0294841; and Cohen CJ. et al. (2003) J. Mol. Recogn. 16:324-332.

[0212] The term "antibody" is used herein in the broadest sense and includes polyclonal and monoclonal antibodies, examples of which include intact antibodies and functional (antigen-binding) antibody fragments, such as antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, variable heavy chain (V) fragments, and fragments capable of specifically binding to an antigen. H ) regions, single-chain antibody fragments, e.g., single-chain variable fragments (scFv), and single-domain antibody (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, and tandem tri-scFv. The term "antibody" should be understood to encompass functional antibody fragments thereof, unless otherwise specified. The term also encompasses intact or full-length antibodies, including antibodies of any class or subclass, e.g., IgG and its subclasses, IgM, IgE, IgA, and IgD.

[0213] In some embodiments, antigen-binding proteins, antibodies, and antigen-binding fragments thereof, specifically recognize the antigen of the full-length antibody. In some embodiments, the heavy and light chains of the antibody may be full-length or may be antigen-binding portions (Fab, F(ab')2, Fv, or single-chain Fv fragment (scFv)). In other embodiments, the antibody heavy chain constant region is selected from, e.g., IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, particularly selected from, e.g., IgG1, IgG2, IgG3, and IgG4, and more particularly selected from IgG1 (e.g., human IgG1). In another embodiment, the antibody light chain constant region is selected from, e.g., kappa or lambda, particularly kappa.

[0214] Among the antibodies provided are antibody fragments. An "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of the intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; variable heavy chains (V); and fragments of variable heavy chains (V). H ) regions, single chain antibody molecules, such as scFv and single domain V H and multispecific antibodies formed from antibody fragments. In certain embodiments, the antibody is a single-chain antibody fragment comprising a variable heavy chain region and / or a variable light chain region, such as an scFv.

[0215] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy and light chains (V, respectively) of a native antibody H and V L ) generally have a similar structure, with each domain containing four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). A single V H or V L The V domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind to a particular antigen may be obtained by isolating the V domain from the antibody that binds the antigen. H or V L domains to identify the complementary V L or V H Domains can be isolated by screening libraries (see, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).

[0216] Single domain antibody is an antibody fragment that comprises all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody.In certain embodiments, single domain antibody is a human single domain antibody.In some embodiments, CAR comprises an antibody heavy chain domain that specifically binds to an antigen, for example, a cancer marker or a cell or disease to be targeted, for example, a cell surface antigen of tumor cell or cancer cell, for example, any of the target antigens described herein or known.

[0217] Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies as well as production by recombinant host cells. In some embodiments, the antibody is a recombinantly produced fragment, e.g., a fragment that contains a non-naturally occurring arrangement, such as two or more antibody regions or chains joined by a synthetic linker, e.g., a peptide linker, and / or that could not be produced by enzymatic digestion of a naturally occurring intact antibody. In some embodiments, the antibody fragment is an scFv.

[0218] A "humanized" antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs. A humanized antibody may contain at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody typically refers to a variant of a non-human antibody that has undergone humanization to reduce immunogenicity to humans while retaining the specificity and affinity of the parent non-human antibody. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve the specificity or affinity of the antibody.

[0219] Thus, in some embodiments, chimeric antigen receptors, including TCR-like CARs, comprise an extracellular portion containing an antibody or antibody fragment. In some embodiments, the antibody or fragment comprises an scFv. In some aspects, the chimeric antigen receptor comprises an extracellular portion containing an antibody or fragment and an intracellular signaling region. In some embodiments, the intracellular signaling region comprises an intracellular signaling domain. In some embodiments, the intracellular signaling domain is or comprises a primary signaling domain, a signaling domain capable of inducing a primary activation signal in T cells, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain containing an immunoreceptor tyrosine-based activation motif (ITAM).

[0220] In some embodiments, the extracellular portion of the CAR, e.g., an antibody portion thereof, further comprises a spacer, e.g., a spacer region, between the antigen-recognition component, e.g., an scFv, and the transmembrane domain. The spacer can be or include at least a portion of an immunoglobulin constant region or a mutant or modified version thereof, e.g., a hinge region, e.g., an IgG4 hinge region and / or CH1 / CL and / or Fc region. In some embodiments, the recombinant receptor further comprises a spacer and / or hinge region. In some embodiments, the constant region or region is that of human IgG, e.g., IgG4 or IgG1. In some aspects, a portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., an scFv, and the transmembrane domain. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 40 and is encoded by the sequence set forth in SEQ ID NO: 41. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 42. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 43.

[0221] In some embodiments, the constant region or portion is of IgD. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 44. In some embodiments, the spacer has a sequence of amino acids that exhibits at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to any of SEQ ID NOs: 40, 42, 43, and 44.

[0222] In some embodiments, the spacer comprises an immunoglobulin constant region or a mutant or modified version thereof, such as a hinge region, e.g., an IgG4 hinge region and / or a C H 1 / C Land / or at least a portion of the Fc region. In some embodiments, the recombinant receptor further comprises a spacer and / or hinge region. In some embodiments, the constant region or portion is that of human IgG, e.g., IgG4 or IgG1. In some aspects, the portion of the constant region serves as a spacer region between the antigen recognition component, e.g., scFv, and the transmembrane domain. The spacer may be of a length that provides increased cellular reactivity after antigen binding compared to the absence of the spacer. In some examples, the spacer is 12 or about 12 amino acids in length, or is 12 or less amino acids in length. Exemplary spacers include those having at least about 10-229 amino acids, about 10-200 amino acids, about 10-175 amino acids, about 10-150 amino acids, about 10-125 amino acids, about 10-100 amino acids, about 10-75 amino acids, about 10-50 amino acids, about 10-40 amino acids, about 10-30 amino acids, about 10-20 amino acids, or about 10-15 amino acids, including any integer between any of the endpoints of the recited ranges. In some embodiments, the spacer region has about 12 amino acids or fewer, about 119 amino acids or fewer, or about 229 amino acids or fewer. Exemplary spacers include an IgG4 hinge alone, an IgG4 hinge linked to CH2 and CH3 domains, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or International Patent Application Publication No. WO2014 / 031687. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 40 and is encoded by the sequence set forth in SEQ ID NO: 41. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 42. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 43.

[0223] In some embodiments, the constant region or portion is of IgD. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 44. In some embodiments, the spacer has a sequence of amino acids that exhibits at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to any of SEQ ID NOs: 40, 42, 43, and 44.

[0224] The extracellular ligand-binding, e.g., antigen recognition, domain is generally linked to one or more intracellular signaling components, e.g., signaling components that mimic activation via an antigen receptor complex, e.g., a TCR complex, in the case of a CAR, and / or another cell surface receptor. In some embodiments, a transmembrane domain links the extracellular ligand-binding domain and the intracellular signaling domain. In some embodiments, the antigen-binding component (e.g., an antibody) is linked to one or more transmembrane and intracellular signaling regions. In some embodiments, the CAR comprises a transmembrane domain fused to the extracellular domain. In one embodiment, a transmembrane domain naturally associated with one of the domains in the receptor, e.g., the CAR, is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and minimize interaction with other members of the receptor complex.

[0225] The transmembrane domain, in some embodiments, is derived from a natural source or from a synthetic source. If the source is natural, the domain, in some aspects, is derived from any membrane-bound or transmembrane protein. The transmembrane region includes those derived from (i.e., including at least the transmembrane region(s) thereof) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154. Alternatively, the transmembrane domain, in some embodiments, is synthetic. In some aspects, synthetic transmembrane domains comprise primarily hydrophobic residues, e.g., leucine and valine. In some aspects, triplets of phenylalanine, tryptophan, and valine are found at each end of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain(s).

[0226] In some embodiments, a short oligo- or polypeptide linker, e.g., a linker 2 to 10 amino acids in length, e.g., one containing glycine and serine, e.g., a glycine-serine doublet, is present and forms the link between the transmembrane domain and the cytoplasmic signaling domain of the CAR.

[0227] Recombinant receptors, e.g., CARs, generally comprise at least one intracellular signaling component(s). In some embodiments, the receptor comprises an intracellular component of the TCR complex, e.g., a TCR CD3 chain, e.g., CD3 zeta chain, which mediates T cell activation and cytotoxicity. Thus, in some aspects, the antigen-binding moiety is linked to one or more cell signaling modules. In some embodiments, the cell signaling module comprises a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., CAR, further comprises one or more additional molecules, e.g., a portion of Fc receptor gamma, CD8, CD4, CD25, or CD16. For example, in some aspects, the CAR or other chimeric receptor comprises a chimeric molecule between CD3-zeta (CD3-ζ) or Fc receptor gamma and CD8, CD4, CD25, or CD16.

[0228] In some embodiments, upon ligation of a CAR or other chimeric receptor, the cytoplasmic domain and / or region or the intracellular signaling domain and / or region of the receptor activates at least one of the normal effector functions or responses of an immune cell, e.g., a T cell, engineered to express the CAR. For example, in some contexts, the CAR induces T cell function, e.g., cytolytic activity or T helper activity, e.g., secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, e.g., if it transmits an effector function signal. In some embodiments, for example, the intracellular signaling region comprising the intracellular domain(s) includes the cytoplasmic sequence of a T cell receptor (TCR) and, in some aspects, also that of a co-receptor that, in its natural context, acts in concert with such receptors to initiate signal transduction after antigen receptor engagement and / or any derivative or variant of such molecule and / or any synthetic sequence having the same functional capability.

[0229] In the context of natural TCR, full activation generally requires not only TCR-mediated signal transduction but also costimulatory signal.Therefore, in some embodiments, the component for generating secondary or costimulatory signal is also included in CAR to promote full activation.In other embodiments, CAR does not include the component for generating costimulatory signal.In some aspects, another CAR is expressed in the same cell and provides the component for generating secondary or costimulatory signal.

[0230] T cell activation has been described in some embodiments as mediated by at least two classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequences) and those that act antigen-independently to provide secondary or costimulatory signals (secondary cytoplasmic signaling sequences). In some embodiments, a CAR comprises one or both of these signaling components.

[0231] In some aspects, the CAR comprises a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts in a stimulatory manner may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAM-containing primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD8, CD22, CD79a, CD79b, and CD66d. In certain embodiments, the ITAM-containing primary cytoplasmic signaling sequence comprises those derived from TCR or CD3 zeta, FcR gamma, or FcR beta. In some embodiments, the cytoplasmic signaling molecule(s) in the CAR contain a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta.

[0232] In some embodiments, the CAR comprises a signal transduction domain and / or a transmembrane portion of a costimulatory receptor, such as CD28, 4-1BB, OX40, CD27, DAP10, and / or ICOS. In some aspects, the same CAR comprises both an activation or signal transduction region and a costimulatory component. In some embodiments, the intracellular signal transduction domain comprises the intracellular signal transduction domain of a T cell costimulatory molecule. In some embodiments, the T cell costimulatory molecule is selected from the group consisting of CD28 and 41BB.

[0233] In some embodiments, the activation domain is contained within one CAR, but the costimulatory component is provided by another CAR that recognizes a different antigen. In some embodiments, the CAR comprises an activating or stimulatory CAR and a costimulatory CAR, both expressed in the same cell (see WO2014 / 055668). In some aspects, the CAR is a stimulatory or activating CAR; in other aspects, it is a costimulatory CAR. In some embodiments, the cell further comprises an inhibitory CAR (iCAR, Fedorov et al., Sci. Transl. Medicine, 5(215) (December 2013), e.g., a CAR that recognizes a different antigen, whereby the activation signal delivered via the CAR that recognizes the first antigen is reduced or inhibited by binding of the inhibitory CAR to its ligand, e.g., reducing off-target effects.

[0234] In certain embodiments, the intracellular signaling domain comprises a CD28 transmembrane and signaling domain linked to a CD3 intracellular domain, hi some embodiments, the intracellular signaling domain comprises a chimeric CD28 and CD137 costimulatory domain linked to a CD3 intracellular domain.

[0235] In some embodiments, CD8 + The intracellular signaling domain of cytotoxic T cells is CD4 + In some embodiments, the intracellular signaling domain of a CD8 helper T cell is identical to that of a CD8 +The intracellular signaling domain of cytotoxic T cells is CD4 + It is distinct from the intracellular signaling domain of helper T cells.

[0236] In some embodiments, the CAR comprises one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., a primary activation domain, in the cytoplasmic portion. Exemplary CARs include the intracellular components CD3-zeta, CD28, and 4-1BB.

[0237] In some embodiments, the recombinant receptor(s), e.g., CAR, encoded by the nucleic acid(s) (e.g., polynucleotide(s)) in the provided viral vector further comprises one or more markers, e.g., for purposes of confirming transduction or engineering and / or selecting cells to express the receptor and / or targeting cells expressing the molecule(s) encoded by the polynucleotide. In some aspects, such markers may be encoded by different nucleic acids or polynucleotides that may be introduced during the genetic engineering process, e.g., by the same vector or vector type, typically by transduction by the same method, e.g., any of the methods provided herein.

[0238] In some aspects, the marker, e.g., a transduction marker, is a protein and / or a cell surface molecule. Exemplary markers are naturally occurring, e.g., truncated mutants of endogenous markers, e.g., naturally occurring cell surface molecules. In some aspects, the mutants have reduced immunogenicity, reduced transport function, and / or reduced signaling function compared to the native or endogenous cell surface molecule. In some embodiments, the marker is a truncated version of a cell surface receptor, e.g., a truncated EGFR (tEGFR). In some aspects, the marker comprises all or a portion (e.g., a truncated form) of CD34, NGFR, or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a linker sequence, e.g., a cleavable linker sequence, e.g., a polynucleotide encoding T2A P2A, E2A, and / or F2A. See, e.g., WO2014 / 031687.

[0239] In some embodiments, the marker is a molecule that is not naturally found on or at the surface of a T cell, e.g., a cell surface protein or portion thereof.

[0240] In some embodiments, the molecule is a non-self molecule, eg, a non-self protein, ie, a molecule that is not recognized as "self" by the immune system of the host into which the cells are adoptively transferred.

[0241] In some embodiments, the marker does not provide a therapeutic function and / or produce any effect other than being used as a marker for genetic manipulation, e.g., to select successfully manipulated cells. In other embodiments, the marker may be a therapeutic molecule or a molecule that otherwise exerts some desired effect, such as a ligand for the cell encountered in vivo, e.g., a costimulatory molecule or immune checkpoint molecule that enhances and / or attenuates the response of the cell upon adoptive transfer and encounter with the ligand.

[0242] In some cases, CARs are referred to as first-, second-, and / or third-generation CARs. In some embodiments, first-generation CARs simply provide a signal induced by the CD3 chain upon antigen binding; in some embodiments, second-generation CARs provide such a signal and a costimulatory signal, for example, those that include an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137; in some embodiments, third-generation CARs include multiple costimulatory domains from different costimulatory receptors.

[0243] In some embodiments, the chimeric antigen receptor comprises an extracellular ligand-binding portion, e.g., an antigen-binding portion, e.g., an antibody or fragment thereof, in the intracellular domain. In some embodiments, the antibody or fragment comprises an scFv or single-domain VH antibody, and the intracellular domain contains an ITAM. In some aspects, the intracellular signaling domain comprises the signaling domain of the zeta chain of the CD3-zeta (CD3ζ) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting and / or positioned between the extracellular domain and the intracellular signaling region or domain.

[0244] In some embodiments, the transmembrane domain contains the transmembrane portion of CD28. The extracellular domain and the transmembrane can be directly or indirectly connected. In some embodiments, the extracellular domain and the transmembrane are connected by a spacer, such as any of those described herein. In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell costimulatory molecule between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 4-1BB.

[0245] In some embodiments, the CAR contains an antibody, e.g., an antibody fragment, a transmembrane domain that is or contains the transmembrane portion of D28 or a functional variant thereof, and an intracellular signaling domain that contains the signaling portion of CD28 or a variant thereof and the signaling portion of CD3 zeta or a variant thereof. In some embodiments, the CAR contains an antibody, e.g., an antibody fragment, a transmembrane domain that is or contains the transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain that contains the signaling portion of 4-1BB or a functional variant thereof and the signaling portion of CD3 zeta or a functional variant thereof. In some such embodiments, the receptor further comprises an Ig molecule, e.g., a human Ig molecule, e.g., a spacer that contains a portion of an Ig hinge, e.g., an IgG4 hinge, e.g., a hinge-only spacer.

[0246] In some embodiments, the transmembrane domain of the receptor, e.g., CAR, is the transmembrane domain of human CD28 or a variant thereof, e.g., the 27-amino acid transmembrane domain of human CD28 (Accession Number: P10747.1), or the sequence of amino acids set forth in SEQ ID NO: 45 or a sequence that is at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or similar to SEQ ID NO: 45. a transmembrane domain comprising a sequence of amino acids exhibiting 99% or greater sequence identity; in some embodiments, the transmembrane domain containing portion of the recombinant receptor comprises the sequence of amino acids set forth in SEQ ID NO: 46 or a sequence of amino acids exhibiting at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or greater sequence identity thereto.

[0247] In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell costimulatory molecule. In some aspects, the T cell costimulatory molecule is CD28 or 4-1BB.

[0248] In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of human CD28 or a functional variant thereof, e.g., a 41 amino acid domain thereof and / or such a domain having a LL to GG substitution at positions 186-187 of the native CD28 protein. In some embodiments, the intracellular signaling region and / or domain may comprise the sequence of amino acids set forth in SEQ ID NO: 47 or 48 or a sequence of amino acids exhibiting at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to SEQ ID NO: 47 or 48. In some embodiments, the intracellular region and / or domain comprises the intracellular costimulatory signaling domain of 4-1BB or a functional variant thereof, e.g., the 42-amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1) or a functional variant or portion thereof, e.g., the sequence of amino acids set forth in SEQ ID NO:49 or a sequence of amino acids exhibiting at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to SEQ ID NO:49.

[0249] In some embodiments, the intracellular signaling region and / or domain comprises a human CD3 chain, optionally a CD3 zeta stimulatory signaling domain, or a functional variant thereof, such as the 112 AA cytoplasmic domain of isoform 3 of human CD3ζ (Accession Number: P20963.2), or a CD3 zeta signaling domain as described in U.S. Patent No. 7,446,190 or U.S. Patent No. 8,911,993. In some embodiments, the intracellular signaling region comprises a sequence of amino acids set forth in SEQ ID NO:50, 51, or 52, or a sequence of amino acids exhibiting at least or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to SEQ ID NO:50, 51, or 52.

[0250] In some aspects, the spacer contains only the hinge region of an IgG, e.g., only the hinge of an IgG4 or IgG1, e.g., the hinge-only spacer set forth in SEQ ID NO: 40. In other embodiments, the spacer is an Ig hinge, e.g., and an IgG4 hinge, linked to the CH2 and / or CH3 domains. In some embodiments, the spacer is an Ig hinge, e.g., C H 2 and C H In some embodiments, the spacer is an IgG4 hinge linked to the C3 domain, such as that shown in SEQ ID NO: 42. In some embodiments, the spacer is an Ig hinge, such as that shown in SEQ ID NO: 42. H An IgG4 hinge linked to only three domains, such as that shown in SEQ ID NO: 43. In some embodiments, the spacer is or includes a glycine-serine rich sequence or other flexible linker, such as a known flexible linker.

[0251] For example, in some embodiments, the CAR comprises an extracellular ligand-binding portion, e.g., an antigen-binding portion, e.g., an antibody or fragment thereof comprising an sdAb and scFv that specifically binds to an antigen, e.g., an antigen described herein; a spacer, such as any of the spacers containing an Ig-hinge; a transmembrane domain that is a portion of CD28 or a variant thereof; an intracellular signaling domain that contains a signaling portion of CD28 or a functional variant thereof; and a signaling portion of a CD3-zeta signaling domain or a functional variant thereof. In some embodiments, the CAR comprises an extracellular ligand-binding portion, e.g., an antigen-binding portion, e.g., an antibody or fragment thereof comprising an sdAb and scFv that specifically binds to an antigen, e.g., an antigen described herein; a spacer, such as any of the spacers containing an Ig-hinge; a transmembrane domain that is a portion of CD28 or a variant thereof; an intracellular signaling domain that contains a signaling portion of 4-1BB or a functional variant thereof; and a signaling portion of a CD3-zeta signaling domain or a functional variant thereof.

[0252] In some embodiments, such CAR constructs further comprise a T2A ribosomal skip element and / or a tEGFR sequence, e.g., downstream of the CAR. In some embodiments, the nucleic acid molecule encoding such a CAR construct further comprises a sequence encoding a ribosomal skip element (e.g., T2A) followed by a tEGFR sequence, e.g., downstream of the sequence encoding the CAR. In some embodiments, T cells expressing an antigen receptor (e.g., a CAR) can be generated to express a truncated EGFR (EGFRt) as a non-immunogenic selection epitope (e.g., by introducing a construct encoding a CAR and EGFRt separated by a T2A ribosomal switch to express the two proteins from the same construct), which can then be used as a marker to detect such cells (see, e.g., U.S. Patent No. 8,802,374). In some cases, a peptide, such as T2A, can cause the ribosome to skip synthesis of the peptide bond at the C-terminus of the 2A element (ribosomal skipping), resulting in separation of the end of the 2A sequence from the next downstream peptide (see, e.g., de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and de Felipe et al. Traffic 5:616-626 (2004)). Numerous 2A elements are known. Examples of 2A sequences that can be used in the methods and nucleic acids disclosed herein include, but are not limited to, 2A sequences from foot-and-mouth disease virus (F2A), equine rhinitis A virus (E2A), Thosea asigna virus (T2A), and porcine teschovirus-1 (P2A), as described in U.S. Patent Publication No. 20070116690.

[0253] The recombinant receptor (e.g., CAR) expressed by the cells administered to the subject generally recognizes or specifically binds to a molecule that is expressed in, associated with, and / or specific to the disease or condition being treated or its cells.When the receptor specifically binds to a molecule (e.g., an antigen), it generally delivers an immunostimulatory signal (e.g., an ITAM-transduced signal) into the cell, thereby promoting an immune response targeted to the disease or condition.For example, in some embodiments, the cell expresses a CAR that specifically binds to an antigen of the disease or condition or expressed by cells or tissues associated with the disease or condition.

[0254] 3. Transduction In any of the provided embodiments, the provided methods include introducing a viral vector into a reporter cell by transduction. In some embodiments, transducing the cell includes contacting, e.g., incubating, the viral vector particle with a cell composition comprising a plurality of reporter cells.

[0255] In some embodiments, the cell composition (e.g., the transduction composition) is or has been incubated under stimulatory conditions prior to transducing the cells by incubation with viral vector particles. In some aspects, prior to incubation, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the T cells of the cell composition are activated cells, e.g., express surface markers selected from the group consisting of HLA-DR, CD25, CD69, CD71, CD40L, and 4-1BB, comprise intracellular expression of a cytokine selected from the group consisting of IL-2, IFN-gamma, and TNF-alpha, are in the G1 or later phase of the cell cycle, and / or are capable of proliferation. In some embodiments, prior to incubation, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% of the T cells of the cell composition are activated cells, e.g., express surface markers selected from the group consisting of HLA-DR, CD25, CD69, CD71, CD40L, and 4-1BB, comprise intracellular expression of a cytokine selected from the group consisting of IL-2, IFN-gamma, and TNF-alpha, are in the G1 or later phase of the cell cycle, and / or are capable of proliferation.

[0256] In some embodiments, during, or at least a portion of, the incubating and / or contacting, the cell composition may include one or more cytokines. In some embodiments, the cytokine is selected from IL-2, IL-7, or IL-15. In some embodiments, the cytokine is a recombinant cytokine. In some embodiments, the concentration of the cytokine in the cell composition is independently between 1 IU / mL and 1500 IU / mL or between about 1 IU / mL and about 1500 IU / mL, e.g., between 1 IU / mL and 100 IU / mL, 2 IU / mL and 50 IU / mL, 5 IU / mL and 10 IU / mL, 10 IU / mL and 500 IU / mL, 50 IU / mL and 250 IU / mL, 100 IU / mL and 200 IU / mL, 50 IU / mL and 1500 IU / mL, 100 IU / mL and 1000 IU / mL. / mL or 200 IU / mL to 600 IU / mL or about 1 IU / mL to about 100 IU / mL, about 2 IU / mL to about 50 IU / mL, about 5 IU / mL to about 10 IU / mL, about 10 IU / mL to about 500 IU / mL, about 50 IU / mL to about 250 IU / mL, about 100 IU / mL to about 200 IU / mL, about 50 IU / mL to about 1500 IU / mL, about 100 IU / mL to about 1000 IU / mL or about 200 IU / mL to about 600 IU / mL. In some embodiments, the concentration of cytokines in the cell composition is independently at least or at least about 1 IU / mL, 5 IU / mL, 10 IU / mL, 50 IU / mL, 100 IU / mL, 200 IU / mL, 500 IU / mL, 1000 IU / mL, or 1500 IU / mL. In certain aspects, an agent capable of activating the intracellular signaling domain of the TCR complex, e.g., an anti-CD3 and / or anti-CD28 antibody, can also be included during or at least a portion of the incubating or after the incubating.

[0257] In some embodiments, the cell composition may contain serum during, or at least a portion of, the incubation and / or contacting. In some embodiments, the serum is fetal bovine serum. In some embodiments, the serum is human serum. In some embodiments, the serum is present in the cell composition at a concentration of about 0.5% to 25% (v / v), 1.0% to 10% (v / v), or 2.5% to 5.0% (v / v), inclusive. In some embodiments, the serum is present in the cell composition at a concentration that is at least about 0.5% (v / v), 1.0% (v / v), 2.5% (v / v), 5% (v / v), or 10% (v / v).

[0258] In some embodiments, during, or at least a portion of, the incubation and / or contacting, the cell composition is serum-free and / or substantially serum-free. In some embodiments, during, or at least a portion of the incubation and / or contacting, the cell composition is incubated and / or contacted in the absence of serum. In certain embodiments, during, or at least a portion of the incubation and / or contacting, the cell composition is incubated and / or contacted in serum-free medium. In some embodiments, the serum-free medium is a defined and / or well-defined cell culture medium. In some embodiments, the serum-free medium is formulated to support the growth, proliferation, health, and homeostasis of cells of a particular cell type, e.g., immune cells, T cells, and / or CD4+ and CD8+ T cells.

[0259] In some embodiments, the cell composition comprises N-acetylcysteine ​​during, or at least a portion of, the incubation and / or contacting. In some embodiments, the concentration of N-acetylcysteine ​​in the cell composition is between 0.4 mg / mL and 4 mg / mL, between 0.8 mg / mL and 3.6 mg / mL, or between 1.6 mg / mL and 2.4 mg / mL, or between about 0.4 mg / mL and about 4 mg / mL, between about 0.8 mg / mL and about 3.6 mg / mL, or between about 1.6 mg / mL and about 2.4 mg / mL, inclusive. In some embodiments, the concentration of N-acetylcysteine ​​in the cell composition is at least about or about 0.4 mg / mL, 0.8 mg / mL, 1.2 mg / mL, 1.6 mg / mL, 2.0 mg / mL, 2.4 mg / mL, 2.8 mg / mL, 3.2 mg / mL, 3.6 mg / mL, or 4.0 mg / mL.

[0260] In some embodiments, multiple transductions are performed to generate multiple reporter T cells transduced with a viral vector encoding a recombinant receptor. In some embodiments, a tailored amount of the viral vector is added to each of the multiple reporter cell compositions. In some embodiments, each tailored amount is a serial dilution of a viral vector lot (e.g., a test viral vector lot). In some embodiments, the viral vector is diluted 2-fold to 10,000-fold or more, e.g., 2-fold to 5,000-fold, 2-fold to 2,000-fold. The specific range of dilutions can be empirically determined depending on the viral vector and encoded recombinant receptor employed. For example, the specific dilution range is one that results in a linear dose-response increase in detectable signal upon incubation with the recombinant receptor stimulator by a reference standard across multiple tailored amounts. In some embodiments, the specific range of serial dilutions is selected to include the lower asymptote of the detectable signal and the upper asymptote of the detectable signal, representing the minimum and maximum response, respectively.

[0261] In some embodiments, the concentration of cells in the cell composition is 1.0 x 10 5 cells / mL~1.0×108 cells / mL or approximately 1.0 x 10 5 cells / mL ~ approx. 1.0×10 8 cells / mL, e.g., at least or about at least or about 1.0 x 10 5 cells / mL, 5×10 5 cells / mL, 1×10 6 cells / mL, 5×10 6 cells / mL, 1×10 7 cells / mL, 5×10 7 cells / mL or 1 x 10 8 cells / mL.

[0262] In some embodiments, the cell composition (e.g., transduction composition) comprises at least or about at least or about 25×10 6 Individual cells, 50×10 6 Individual cells, 75×10 6 Individual cells 100×10 6 Individual cells, 125×10 6 Individual cells, 150×10 6 Individual cells, 175×10 6 Individual cells, 200×10 6 Individual cells, 225×10 6 Individual cells, 250×10 6 Individual cells, 275×10 6 cells or 300 x 10 6 For example, in some embodiments, the cell composition (e.g., transduction composition) comprises at least or about at least or about 50 x 10 cells. 6 Individual cells, 100×10 6 cells or 200 x 10 6 Contains individual cells.

[0263] In some embodiments, the cell composition (e.g., transduction composition) comprises at least or about at least or about 25×10 5 Individual cells, 50×10 5 Individual cells, 75×10 5 Individual cells 100×10 5 Individual cells, 125×10 5 Individual cells, 150×10 5 Individual cells, 175×10 5 Individual cells, 200×105 Individual cells, 225×10 5 Individual cells, 250×10 5 Individual cells, 275×10 5 cells or 300 x 10 5 For example, in some embodiments, the cell composition (e.g., transduction composition) comprises at least or about at least or about 50 x 10 cells. 5 Individual cells, 100×10 5 cells or 200 x 10 5 Contains individual cells.

[0264] In some embodiments, viral vector particles are provided at a certain ratio of viral vector particle copies per total number of cells, referred to as the multiplicity of infection (MOI). In some embodiments, MOI may refer to the ratio of agent (e.g., viral vector copies) to target (e.g., cell) for infection. In some embodiments, the MOI is between 0.01 and 10 particles / cell in the population of reporter T cells. In some embodiments, the MOI is 0.001 to 10 particles / cell in the population of reporter T cells. In some embodiments, the MOI is at least 0.001, 0.01, 0.10, 1.0, or 10 particles / cell in the population of reporter T cells. In some embodiments, the MOI is 0.001, 0.01, 0.10, 1.0, or 10 particles / cell in the population of reporter T cells.

[0265] In some embodiments, the viral vector particles are provided at a certain ratio of copies or infectious units (IU) of viral vector particles per total number of cells in the reporter T cell cell composition or per total number of cells to be transduced (e.g., a certain ratio that is an MOI as described above) (IU / cell). For example, in some embodiments, the viral vector particles are present during contacting at or about 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, or 60 IU of viral vector particles per cell, or at least about 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, or 60 IU of viral vector particles per cell.

[0266] In some embodiments, the titer of viral vector particles is about 1 x 10 6 IU / mL to 1×10 8 Between IU / mL, e.g., 5 x 10 6 IU / mL to 5 × 10 7 Between IU / mL or approximately 5 × 10 6 IU / mL to approximately 5 × 10 7 In some embodiments, the titer of viral vector particles is between 6 x 10 6 IU / mL, 7 × 10 6 IU / mL, 8 × 10 6 IU / mL, 9 × 10 6 IU / mL, 1 × 10 7 IU / mL, 2 × 10 7 IU / mL, 3 × 10 7 IU / mL, 4 × 10 7 IU / mL or 5 × 10 7 In some embodiments, the titer of viral vector particles is 6 x 10 6 IU / mL, 7 × 10 6 IU / mL, 8 × 10 6 IU / mL, 9 × 10 6 IU / mL, 1 × 10 7 IU / mL, 2 × 10 7IU / mL, 3 × 10 7 IU / mL, 4 × 10 7 IU / mL or 5 x 10 7 IU / mL or approximately 6 × 10 6 IU / mL, approximately 7×10 6 IU / mL, approximately 8×10 6 IU / mL, approximately 9×10 6 IU / mL, approximately 1×10 7 IU / mL, approximately 2×10 7 IU / mL, approximately 3×10 7 IU / mL, approximately 4×10 7 IU / mL or approximately 5 x 10 7 IU / mL, or any value between any of the aforementioned values.

[0267] In some embodiments, the method includes contacting or incubating, e.g., mixing, the cells with the viral vector particles. In some embodiments, the contacting or incubating is for 30 minutes to 72 hours, e.g., 30 minutes to 48 hours, 30 minutes to 24 hours, or 1 hour to 24 hours, e.g., at least or about at least 30 minutes, 1 hour, 2 hours, 6 hours, 12 hours, 24 hours, or 36 hours or more.

[0268] In some embodiments, the contacting or incubating is carried out in a solution of 0.5 mL to 500 mL or about 0.5 mL to about 500 mL, for example, 0.5 mL to 200 mL, 0.5 mL to 100 mL, 0.5 mL to 50 mL, 0.5 mL to 10 mL, 0.5 mL to 5 mL, 5 mL to 500 mL, 5 mL to 200 mL, 5 mL to 100 mL, 5 mL to 50 mL, 5 mL to 10 mL, 10 mL to 500 mL, 10 mL to 200 mL, 10 mL to 100 mL, 10 mL to 50 mL, 50 mL to 500 mL, 50 mL to 200 mL, 50 mL to 100 mL, 100 mL to 500 mL, 100 mL to 200 mL, or 200 mL to 500 mL mL or about 0.5 mL to about 200 mL, about 0.5 mL to about 100 mL, about 0.5 mL to about 50 mL, about 0.5 mL to about 10 mL, about 0.5 mL to about 5 mL, about 5 mL to about 500 mL, about 5 mL to about 200 mL, about 5 mL to about 100 mL, about 5 mL to about 50 mL, about 5 mL to about 10 mL, about 10 mL to about 500 mL, about 10 mL to about 200 mL, about 10 mL to about 100 mL, about 10 mL to about 50 mL, about 50 mL to about 500 mL, about 50 mL to about 200 mL, about 50 mL to about 100 mL, about 100 mL to about 500 mL, about 100 mL to about 200 mL, or about 200 mL to about 500 mL.

[0269] In some embodiments, contacting or incubating is carried out in a solution.In some embodiments, cells and virus particles are contacted in a volume of 1 μL to 1 mL or about 1 μL to about 1 mL, for example, 2 μL, 5 μL, 10 μL, 15 μL, 20 μL, 25 μL, 30 μL, 40 μL, 50 μL, 100 μL, 200 μL, 400 μL, 500 μL or 1 mL or about 2 μL, about 5 μL, about 10 μL, about 15 μL, about 20 μL, about 25 μL, about 30 μL, about 40 μL, about 50 μL, about 100 μL, about 200 μL, about 400 μL, about 500 μL or about 1 mL, or any value between any of the aforementioned values.

[0270] In certain embodiments, at least a portion of the manipulation, transduction and / or transfection is performed in a volume of about 5 mL to about 100 mL, e.g., about 10 mL to about 50 mL, about 15 mL to about 45 mL, about 20 mL to about 40 mL, about 25 mL to about 35 mL, or 30 mL or about 30 mL.

[0271] In some embodiments, incubation of the cells with the viral vector particles is carried out by contacting one or more cells of the composition with a nucleic acid molecule encoding a recombinant protein, e.g., a recombinant receptor. In some embodiments, contacting can be achieved using centrifugation. Such methods include any of those described in International Publication No. WO2016 / 073602. Exemplary centrifuge chambers include those produced and sold by Biosafe SA, such as those for use with the Sepax® and Sepax® 2 systems, e.g., the A-200 / F and A-200 centrifuge chambers and various kits for use with such systems. Exemplary chambers, systems, and processing equipment and cabinets are described, for example, in U.S. Patent No. 6,123,655, U.S. Patent No. 6,733,433, and published U.S. Patent Application Publication No. US2008 / 0171951 and published International Patent Application Publication No. WO00 / 38762, the disclosures of each of which are incorporated herein by reference in their entirety. Exemplary kits for use with such systems include, but are not limited to, single-use kits sold by BioSafe SA under the product names CS-430.1, CS-490.1, CS-600.1, or CS-900.2.

[0272] In some embodiments, incubating the cells with the viral vector particles further comprises contacting the composition (e.g., the primed composition) and / or the viral vector particles with a transduction adjuvant. In some embodiments, contacting the composition (e.g., the primed composition) and / or the viral vector particles with a transduction adjuvant occurs before, simultaneously with, or after spinoculation of the viral vector particles with the composition (e.g., the primed composition).

[0273] In some embodiments, at least a portion of the incubation of viral vector particles is carried out at or about 37°C ± 2°C. For example, in some embodiments, at least a portion of the incubation of viral particles is carried out at or about 35-39°C. In some embodiments, at least a portion of the incubation of viral vector particles carried out at or about 37°C ± 2°C is carried out for not more than 2 hours, 4 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 48 ​​hours, 60 hours, or 72 hours, or for not more than about 2 hours, 4 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 48 ​​hours, 60 hours, or 72 hours. In some embodiments, at least a portion of the incubation of viral vector particles carried out at or about 37°C ± 2°C is carried out for not more than 24 hours.

[0274] In some embodiments, at least a portion of the incubation of viral vector particles is carried out after inoculation. In some embodiments, at least a portion of the incubation of viral vector particles carried out after inoculation is carried out for 2 hours, 4 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 48 ​​hours, 60 hours or 72 hours or less, or for about 2 hours, about 4 hours, about 12 hours, about 18 hours, about 24 hours, about 30 hours, about 36 hours, about 48 hours, about 60 hours or about 72 hours or less. In some embodiments, at least a portion of the incubation of viral vector particles carried out after inoculation is carried out for 24 hours or for about 24 hours.

[0275] In some embodiments, the total duration of incubation of the viral vector particles is less than or equal to 12 hours, 24 hours, 36 hours, 48 ​​hours, or 72 hours.

[0276] In some embodiments, incubation of cells with viral vector particles results in or produces an output composition comprising cells transduced with the viral vector particles, also referred to herein as a population of transduced cells. Thus, in some embodiments, the population of transduced cells comprises T cells transduced with the heterologous polynucleotide. In some embodiments, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% of the T cells in the population of transduced cells are transduced with the heterologous polynucleotide. In some embodiments, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% of the T cells in the population of transduced cells are transduced with the heterologous polynucleotide. In some embodiments, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the T cells transduced with the heterologous polynucleotide are CCR7+.

[0277] In some embodiments, the population of transduced cells comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cells express the recombinant protein. In some embodiments, the population of transduced cells comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cells express the recombinant protein.

[0278] In some embodiments, the method further comprises one or more additional steps. In some embodiments, the method further comprises recovering or isolating the transduced cells produced by the method from the population of transduced cells. In some embodiments, the recovering or isolating comprises selecting for expression of the recombinant protein (e.g., CAR or TCR).

[0279] The percentage of T cells in a population of transduced cells transduced with a heterologous polynucleotide can be compared to the percentage of transduced T cells in other populations of transduced cells, e.g., the percentage of T cells in multiple populations of transduced cells transduced with a heterologous polynucleotide can be compared. In some embodiments, the maximum variability between the percentage of transduced T cells in multiple populations is less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% from the average percentage of transduction among the multiple populations. For example, multiple populations of transduced cells comprising transduced percentages of 70%, 80%, and 90% have a maximum variability of 12.5%. In some embodiments, the multiple populations of transduced cells include at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 populations of transduced cells.

[0280] B. Recombinant receptor-dependent stimulation of transduced reporter cells via binders The methods for assessing efficacy provided herein include stimulating the recombinant receptor (e.g., CAR, TCR) of a reporter T cell into which the recombinant receptor has been introduced. It is contemplated that any suitable means for stimulating the recombinant receptor that can also be quantified can be used. In some embodiments, stimulating the recombinant receptor is achieved by a recombinant receptor stimulating agent that can bind to and stimulate an intracellular signal by the recombinant receptor, generating a detectable signal from the receptor, such as those described in Section IC. Exemplary recombinant receptor stimulating agents include an antigen of the recombinant receptor (e.g., purified antigen or recombinant antigen), an antibody such as an anti-idiotypic antibody, and antigen-expressing cells.

[0281] 1. Drugs immobilized on surfaces In certain embodiments, the recombinant receptor stimulating agent is composed of a binding molecule capable of being bound by a recombinant receptor immobilized on a surface support. In provided embodiments, the binding molecule can be an antigen or portion of the antigen (e.g., the extracellular portion of the antigen) of the recombinant receptor, or an antibody (e.g., an anti-idiotypic antibody) specific for the recombinant receptor. For example, the binding molecule (e.g., an antigen or a binding portion thereof, or an antibody) can be immobilized or bound to a surface support, e.g., a non-cellular particle, and a regulated amount of cells (e.g., CAR-T cells) expressing the recombinant receptor of the therapeutic composition, e.g., cells, is contacted with the surface support. In some embodiments, the particles (e.g., bead particles) described herein provide a solid support or matrix to which the binding molecule (e.g., an antigen or a binding portion thereof, or an anti-idiotypic antibody) can be bound or attached in a manner that allows interaction between the binding molecule and the cell, particularly binding between the binding molecule and the recombinant receptor, e.g., CAR, expressed on the surface of the cell. In certain embodiments, the interaction between the conjugated or attached binding molecule and the cell mediates stimulation of the recombinant receptor, including one or more recombinant receptor-dependent activities, such as activation, expansion, cytokine production, cytotoxic activity, or other activities, e.g., as described in Section IC.

[0282] In certain embodiments, the surface support is a particle (e.g., a bead particle) to which a binding molecule (e.g., an antigen or binding portion thereof, or an anti-idiotypic antibody) is immobilized or attached. In some embodiments, the surface support is a solid support. In some examples, the solid support is a bead, and the antigen or moiety is immobilized on the bead. In some embodiments, the solid support is the surface of a well or plate, e.g., a cell culture plate. In some embodiments, the surface support is a soluble oligomeric particle, and the antigen is immobilized on the surface of the soluble oligomeric particle. Examples of surface supports for immobilizing or attaching agents (e.g., binding molecules) for recognition or binding to recombinant receptors can be found in published international application WO2019 / 027850, which is incorporated by reference for all purposes.

[0283] In certain embodiments, the surface support is a particle, which may include a colloid particle, a microsphere, a nanoparticle, a bead, e.g., a magnetic bead, etc. In some embodiments, the particle or bead is biocompatible, i.e., non-toxic. In certain embodiments, the particle or bead is non-toxic to cultured cells, e.g., cultured T cells. In certain embodiments, the particle is monodisperse. In certain embodiments, "monodisperse" encompasses particles (e.g., bead particles) having a size distribution with a standard deviation of less than 5%, e.g., a standard deviation in diameter of less than 5%.

[0284] In some embodiments, the particles or beads are made of biocompatible materials, i.e., materials suitable for biological use. In some embodiments, the particles, e.g., beads, are non-toxic to cultured cells, e.g., cultured T cells. In some embodiments, the particles, e.g., beads, can be any particle to which a binding molecule can be attached in a manner that allows interaction between the binding molecule and cells. In certain embodiments, the particles, e.g., beads, can be any particle that can be modified, e.g., surface-functionalized, to allow attachment of a binding molecule to the surface of the particle. In some embodiments, the particles, e.g., beads, are made of glass, silica, polyesters of hydroxycarboxylic acids, polyanhydrides of dicarboxylic acids, or copolymers of hydroxycarboxylic acids and dicarboxylic acids. In some embodiments, particles, e.g., beads, may be composed of, or at least partially composed of, polyesters of linear or branched, substituted or unsubstituted, saturated or unsaturated, linear or crosslinked alkanyl, haloalkyl, thioalkyl, aminoalkyl, aryl, aralkyl, alkenyl, aralkenyl, heteroaryl, or alkoxy hydroxy acids, or polyanhydrides of linear or branched, substituted or unsubstituted, saturated or unsaturated, linear or crosslinked alkanyl, haloalkyl, thioalkyl, aminoalkyl, aryl, aralkyl, alkenyl, aralkenyl, heteroaryl, or alkoxy dicarboxylic acids. Furthermore, particles, e.g., beads, may be quantum dots or may be composed of quantum dots, e.g., quantum dot polystyrene particles, e.g., beads. Particles, e.g., beads, containing a mixture of ester and anhydride bonds (e.g., copolymers of glycolic acid and sebacic acid) may also be employed. For example, particles, e.g., beads, can comprise materials including polyglycolic acid polymers (PGA), polylactic acid polymers (PLA), polysebacic acid polymers (PSA), poly(lactic-co-glycolic acid) copolymers (PLGA), [rho]poly(lactic-co-sebacic acid) copolymers (PLSA), poly(glycolic-co-sebacic acid) copolymers (PGSA), and the like.Other polymers from which particles, e.g., beads, can be constructed include polymers or copolymers of caprolactone, carbonate, amide, amino acid, orthoester, acetal, cyanoacrylate, and degradable urethane, and copolymers thereof with linear or branched, substituted or unsubstituted, alkanyl, haloalkyl, thioalkyl, aminoalkyl, alkenyl, or aromatic hydroxy- or dicarboxylic acids. Additionally, biologically important amino acids with reactive side groups, e.g., lysine, arginine, aspartic acid, glutamic acid, serine, threonine, tyrosine, and cysteine, or their enantiomers, may be included in copolymers with any of the above materials to provide reactive groups for conjugation to binding molecules, e.g., polypeptide antigens or antibodies.

[0285] In some embodiments, the particles are beads having a diameter greater than 0.001 μm, greater than 0.01 μm, greater than 0.05 μm, greater than 0.1 μm, greater than 0.2 μm, greater than 0.3 μm, greater than 0.4 μm, greater than 0.5 μm, greater than 0.6 μm, greater than 0.7 μm, greater than 0.8 μm, greater than 0.9 μm, greater than 1 μm, greater than 2 μm, greater than 3 μm, greater than 4 μm, greater than 5 μm, greater than 6 μm, greater than 7 μm, greater than 8 μm, greater than 9 μm, greater than 10 μm, greater than 20 μm, greater than 30 μm, greater than 40 μm, greater than 50 μm, greater than 100 μm, greater than 500 μm, and / or greater than 1,000 μm. In some embodiments, the particles or beads are between or about 0.001 μm to 1,000 μm, 0.01 μm to 100 μm, 0.1 μm to 10 μm, 0.1 μm to 100 μm, 0.1 μm to 10 μm, 0.001 μm to 0.01 μm, 0.01 μm to 0.1 μm, 0.1 μm to 1 μm, 1 μm to 10 μm, 1 μm to 2 μm, 2 μm to 3 μm, 3 μm to 4 μm, 4 μm to 5 μm, 1 μm to 5 μm and / or 5 μm to 10 μm, each inclusive. The diameter is 0.001 μm to about 1,000 μm, about 0.01 μm to about 100 μm, about 0.1 μm to about 10 μm, about 0.1 μm to about 100 μm, about 0.1 μm to about 10 μm, about 0.001 μm to about 0.01 μm, about 0.01 μm to about 0.1 μm, about 0.1 μm to about 1 μm, about 1 μm to about 10 μm, about 1 μm to about 2 μm, about 2 μm to about 3 μm, about 3 μm to about 4 μm, about 4 μm to about 5 μm, about 1 μm to about 5 μm, and / or about 5 μm to about 10 μm. In certain embodiments, the particles or beads have an average diameter of 1 μm and 10 μm, inclusive. In certain embodiments, the particles, e.g., beads, have a diameter of 1 μm or about 1 μm. In certain embodiments, the particles, e.g., beads, have an average diameter of at or about 2.8 μm. In some embodiments, the particles, e.g., beads, have a diameter of at or about 4.8 μm.

[0286] The particles (e.g., bead particles) used in the methods described herein can be commercially produced and obtained. Particles, e.g., beads, including methods for producing particles, e.g., beads, are well known in the art. See, e.g., U.S. Patent Nos. 6,074,884; 5,834,121; 5,395,688; 5,356,713; 5,318,797; 5,283,079; 5,232,782; 5,091,206; 4,774,265; 4,654,267; 4,554,088; 4,490,436; 4,452,773; U.S. Patent Application Publication No. 20100207051; and Sharpe, Pau T., Methods of Cell Separation, Elsevier, 1988. Commercially available particles, for example, beads (e.g., bead particles), include ProMag™ (PolySciences, Inc.); COMPELTM (PolySciences, Inc.); BioMag® (PolySciences, Inc.), including BioMag® Plus (PolySciences, Inc.) and BioMag® Maxi (Bang Laboratories, Inc.).M-PVA (Cehmagen Biopolymer Technologie AG); SiMAG (Chemicell GmbH); beadMAG (Chemicell GmbH); MagaPhase® (Cortex Biochem); Dynabeads® (Invitrogen), including Dynabeads® M-280 sheep anti-rabbit IgG (Invitrogen), Dynabeads® FlowComp™ (e.g., Dynabeads® FlowComp™ Human CD3, Invitrogen), Dynabeads® M-450 (e.g., Dynabeads® M-450 tosyl-activated, Invitrogen), Dynabeads® Untouched™ (e.g., Dynabeads® Untouched™ Human CD8 T Cell, Invitrogen) and Dynabeads® that bind, expand, and / or activate T cells (e.g., Dynabeads® Human T-Activator CD3 / CD28 for T Cell Expansion and Activation, Invitrogen); Estapor® M (Merk Chimie SAS); Estapor® EM (Merk Chimie SAS); MACSiBeads™ particles (e.g., anti-biotin MACSiBead particles, Miltenyi Biotec, catalog number 130-091-147); Streptamer® magnetic beads (IBA BioTAGnology); Strep-Tactin® magnetic beads (IBA BioTAGnology); Sicastar®-M (Micromod Partikeltechnologie GmbH); Micromer®-M (Micromod Partikeltechnologie); MagneSil™ (Promega GmbH); MGP (Roche Applied Science Inc.); Pierce™ Protein G Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Protein A Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Protein A / G Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ NHS-Activated Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Protein L Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Anti-HA Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Anti-c-Myc Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Glutathione Magnetic Beads (Thermo Fisher Scientific Inc.); Pierce™ Streptavidin Magnetic Beads (Thermo Fisher Scientific Inc.); MagnaBind™ Magnetic Beads (Thermo Fisher Scientific Inc.); Sera-Mag™ Magnetic Beads (Thermo Fisher Scientific Inc.); Anti-FLAG® M2 Magnetic Beads (Sigma-Aldrich); SPHEROTM Magnetic Particles (Spherotech Inc.); and HisPur™ Ni-NTA Magnetic Beads (Thermo Fisher Scientific Inc.)

[0287] In certain embodiments, the antigen or its extracellular domain portion is bound to the particle (e.g., bead) via a covalent chemical bond. In certain embodiments, the amino acid reactive group or moiety of the antigen or its extracellular domain portion is directly conjugated to the reactive group or moiety on the surface of the particle by direct chemical reaction. In certain embodiments, the amino acid carboxyl group (e.g., C-terminal carboxyl group), hydroxyl, thiol, or amine group (e.g., amino acid side chain group) of the antigen or its extracellular binding portion is directly conjugated to the hydroxyl or carboxyl group of the PLA or PGA polymer, the terminal amine or carboxyl group of the dendrimer, or the hydroxyl, carboxyl, or phosphate group of the phospholipid on the surface of the particle by direct chemical reaction. In some embodiments, the conjugated moiety is conjugated to both the binding molecule and the particle, for example, by a covalent bond, thereby linking them together.

[0288] In certain embodiments, the surface of the particle contains chemical moieties and / or functional groups that allow for the attachment (e.g., covalent or non-covalent) of a binding molecule (e.g., a polypeptide antigen or antibody). In certain embodiments, the particle surface contains exposed functional groups. Suitable surface-exposed functional groups include, but are not limited to, carboxyl, amino, hydroxyl, sulfate, tosyl, epoxy, and chloromethyl groups. In some embodiments, the binding molecule is a polypeptide and is conjugated to the surface-exposed functional group. In some embodiments, the surface-exposed functional group must be activated, i.e., undergo a chemical reaction to produce an intermediate product that allows for direct binding to the polypeptide. For example, the carboxyl group of a polypeptide molecule can be activated using the agents described above to generate an intermediate ester that can be directly bound to the amino group exposed on the surface of the particle. In another example, free amine groups on the surface of a support surface (e.g., beads) can be covalently bound to antigenic peptides and proteins or antigenic peptide or protein fusion proteins using sulfosuccinimidyl (4-iodoacetyl) aminobenzoate (sulfo-SIAB) chemistry. In yet other specific embodiments, the polypeptide binding molecules are covalently attached to the particles, e.g., bead particles, at surface-exposed functional groups that do not require drug activation prior to covalent attachment, examples of such functional groups include, but are not limited to, tosyl, epoxy, and chloromethyl groups.

[0289] In some embodiments, non-covalent binding between a ligand bound to an antigenic peptide or protein and an anti-ligand attached to a surface support (e.g., a bead) can conjugate the antigen to the support (e.g., a bead). In some embodiments, a biotin ligase recognition sequence tag can be attached to the C-terminus of the antigenic peptide or protein, and this tag can be biotinylated by biotin ligase. The biotin can then serve as a ligand and non-covalently conjugate the antigenic peptide or protein to avidin or streptavidin adsorbed or otherwise bound to the surface of the carrier as an anti-ligand. Alternatively, if a binding molecule (e.g., an antigen) is fused to an immunoglobulin domain having an Fc region as described herein, the Fc domain can act as a ligand, and protein A covalently or non-covalently bound to the surface of the surface support (e.g., a bead) can serve as an anti-ligand and non-covalently conjugate the antigenic peptide or protein to the carrier. Other means are well known in the art and may be employed to non-covalently conjugate binding molecules (e.g., antigens or anti-idiotypic antibodies) to surface supports (e.g., beads), including metal ion chelation techniques (e.g., using a poly-His tag at the C-terminus of the binding molecule, e.g., antigen, and a Ni-coated surface support); these methods may be substituted for those described herein.

[0290] In some embodiments, the binding molecule (eg, an antigen or an anti-idiotypic antibody) is conjugated to the particle by a linker. In certain embodiments, the linker may include, but is not limited to, various bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (e.g., dimethyl adipimidate HCl), active esters (e.g., disuccinimidyl suberate), aldehydes (e.g., glutareldehyde), bis-azido compounds (e.g., bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (e.g., bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (e.g., toluene 2,6-diisocyanate), and bis-active fluorine compounds (e.g., l,5-difluoro-2,4-dinitrobenzene). Specific coupling agents include N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP) and N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP), which provide disulfide bonds.

[0291] a. a target, e.g., an antigen In some embodiments, the recombinant receptor stimulator is or comprises a target, e.g., an antigen, a recombinant antigen or a fragment thereof. In some embodiments, the target is an antigen of the recombinant receptor. In some embodiments, the recombinant receptor stimulator is or comprises an antigen, e.g., a recombinant antigen or a fragment thereof.

[0292] For example, the recombinant receptor stimulating agent can be a target, e.g., an antigen, immobilized or bound to a surface support, e.g., a microwell plate, solid particles (e.g., beads), or oligomeric particles, e.g., as described above. In some embodiments, the target, e.g., an antigen, is a polypeptide or a variant or fragment of a polypeptide expressed on the surface of a cell associated with a disease, e.g., a cancer cell and / or a tumor cell. It is understood that a target is any molecule recognized or bound by the extracellular domain of the recombinant receptor. In some embodiments, the target is an antibody recognized or bound by the extracellular domain of the recombinant receptor. It is understood that in some embodiments, the target is an antigen, and that the antigen is recognized or bound by the extracellular domain of the recombinant receptor. One of skill in the art can determine targets, such as antigens, and the format of the target or antigen (e.g., cells expressed on or immobilized on a solid surface) sufficient to stimulate the recombinant receptor.

[0293] In some embodiments, the target is an antigen recognized by the extracellular domain of the recombinant receptor. In some embodiments, the antigen is αvβ6 integrin (avb6 integrin), B-cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), cancer testis antigen, cancer / testis antigen 1B (CTAG, also known as NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), cyclin, cyclin A2, CC motif chemokine ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD133, CD138, CD171, chondroitin sulfate proteoglycan 4 (CSPG4), epidermal growth factor protein (EGFR), epidermal growth factor receptor type III mutant (EGFR vIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrin B2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor-like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), folate binding protein (FBP), folate receptor alpha, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside GD3, glycoprotein 100 (gp100), glypican-3 (GPC3), G protein-coupled receptor 5D (GPRC5D), Her2 / neu (receptor tyrosine kinase erb-B2), Her3 (erb-B3), Her4 (erb -B4), erbB dimer, human high-molecular-weight melanoma-associated antigen (HMW-MAA), hepatitis B surface antigen, human leukocyte antigen A1 (HLA-A1), human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Rα), IL-13 receptor alpha 2 (IL-13Rα2), kinase insert domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1-CAM), CE7 epitope of L1-CAM, leucine-rich repeat-containing 8 family member A (LRRC8A), Lewis Y, melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, MAGE-A10, mesothelin (MSLN), c-Met, murine cytomegalovirus (CMV),Mucin 1 (MUC1), MUC16, natural killer group 2 member D (NKG2D) ligand, Melan-A (MART-1), neural cell adhesion molecule (NCAM), oncofetal antigen, preferentially expressed antigen in melanoma (PRAME), progesterone receptor, prostate-specific antigen, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), survivin, trophoblast glycoprotein (TPBG, also known as 5T4), tumor-associated glycoprotein 72 (TAG72), tyrosinase-related protein 1 (TRP1, In some embodiments, the antigen targeted by the receptor is or comprises an antigen associated with a B-cell malignancy, such as any of several known B-cell markers. In some embodiments, the antigen is or comprises CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Ig kappa, Ig lambda, CD79a, CD79b, or CD30.

[0294] In some embodiments, the antigen is or comprises a portion of a polypeptide antigen that is recognized or bound by a recombinant receptor, such as a CAR. In certain embodiments, the portion of the antigen is a region that contains the epitope that is recognized or bound by a recombinant receptor, such as a CAR. In certain embodiments, the portion of the polypeptide antigen is about 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500 In certain embodiments, the polypeptide portion contains at least 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, or 500 amino acids, or in some cases, contiguous amino acids. In certain embodiments, the polypeptide portion comprises the amino acid sequence of an epitope recognized by a recombinant receptor and / or CAR.

[0295] In certain embodiments, the antigen or portion contains about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% amino acid sequence identity to the polypeptide bound by and / or recognized by the recombinant receptor and / or CAR, or is a polypeptide variant containing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% amino acid sequence identity.

[0296] In certain embodiments, the extracellular domain of a recombinant receptor (e.g., a CAR) is specific for or binds to BCMA, and the antigen is BCMA or a portion of the extracellular domain of BCMA. In some embodiments, the BCMA polypeptide is a mammalian BCMA polypeptide. In certain embodiments, the BCMA polypeptide is a human BCMA polypeptide. In some embodiments, the BCMA antigen is or comprises the extracellular domain of BCMA, or a portion thereof, that includes an epitope recognized by an antigen receptor, e.g., a CAR. In certain embodiments, the BCMA antigen is or comprises a polypeptide having an amino acid sequence having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 53, or a fragment thereof containing at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, or at least 180 consecutive amino acids of SEQ ID NO: 53. In some embodiments, the BCMA antigen is or comprises the sequence set forth in SEQ ID NO: 53 or a portion thereof that is or contains an epitope recognized by an antigen receptor, e.g., a CAR.

[0297] In certain embodiments, the extracellular domain of a recombinant receptor (e.g., a CAR) is specific for or binds to ROR1, and the antigen is ROR1 or a portion of the extracellular domain of ROR1. In certain embodiments, the ROR1 polypeptide is mammalian. In certain embodiments, the ROR1 polypeptide is human. In some embodiments, the antigen is the extracellular domain of ROR1 or a portion thereof that contains an epitope recognized by an antigen receptor, e.g., a CAR. In some embodiments, the antigen is a polypeptide having an amino acid sequence having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 49, or a fragment thereof containing at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, or at least 180 consecutive amino acids of SEQ ID NO: 49. In some embodiments, the ROR1 antigen comprises the sequence set forth in SEQ ID NO: 49 or a portion thereof comprising an epitope recognized by an antigen receptor, e.g., a CAR.

[0298] In certain embodiments, the extracellular domain of the recombinant receptor (e.g., CAR) is specific for or binds to CD22, and the antigen is CD22 or a portion of the extracellular domain of CD22. In certain embodiments, the CD22 polypeptide is mammalian. In certain embodiments, the CD22 polypeptide is human. In some embodiments, the antigen is the extracellular domain of CD22 or a portion thereof that includes an epitope recognized by an antigen receptor, for example, a CAR. In some embodiments, the antigen is a polypeptide having an amino acid sequence having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 54, or a fragment thereof containing at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, or at least 180 consecutive amino acids of SEQ ID NO: 54. In some embodiments, the CD22 antigen comprises the sequence set forth in SEQ ID NO: 54 or a portion thereof comprising an epitope recognized by an antigen receptor, e.g., a CAR.

[0299] In certain embodiments, the extracellular domain of the recombinant receptor (e.g., CAR) is specific for or binds to CD19, and the antigen is CD19 or a portion of the extracellular domain of CD19. In certain embodiments, the CD19 polypeptide is mammalian. In certain embodiments, the CD19 polypeptide is human. In some embodiments, the antigen is the extracellular domain of CD19 or a portion thereof that contains an epitope recognized by an antigen receptor, for example, a CAR. In some embodiments, the antigen is a polypeptide having an amino acid sequence having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 45, or a fragment thereof containing at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, or at least 180 consecutive amino acids of SEQ ID NO: 45. In some embodiments, the CD19 antigen comprises the sequence set forth in SEQ ID NO: 45 or a portion thereof comprising an epitope recognized by an antigen receptor, e.g., a CAR.

[0300] In some embodiments, the antigen or portion thereof is formatted as a multimer, e.g., a dimer, comprising two or more polypeptide antigens or portions or variants thereof that are recognized and / or bound by a recombinant receptor, e.g., an antigen receptor (e.g., a CAR). In some embodiments, the polypeptide antigens or portions thereof are identical. In certain embodiments, the polypeptide antigens are directly or indirectly linked to regions or domains, e.g., multimerization domains, which promote or stabilize the interaction between two or more polypeptide antigens through complementary interactions between the domains or regions. In some embodiments, providing the polypeptide antigen as a multimer, e.g., a dimer, provides a multivalent interaction between the antigen or its extracellular domain portion and the antigen-binding domain of the antigen receptor, e.g., a CAR, which may, in some aspects, increase the avidity of the interaction. In some embodiments, the increased avidity of the antigen or its extracellular domain portion conjugated to the bead may be favorable for the stimulatory or agonistic activity of the antigen receptor, e.g., a CAR.

[0301] In some embodiments, the polypeptide is directly or indirectly linked to the multimerization domain. Exemplary multimerization domains include immunoglobulin sequences or portions thereof, leucine zippers, hydrophobic regions, hydrophilic regions, and compatible protein-protein interaction domains. The multimerization domain can be, for example, an immunoglobulin constant region or domain, such as an Fc domain or portions thereof derived from IgG, including IgG1, IgG2, IgG3, or IgG4 subtypes, IgA, IgE, IgD, and IgM, and modified forms thereof. In certain embodiments, the polypeptide antigen is directly or indirectly linked to the Fc domain. In some embodiments, the polypeptide is a fusion polypeptide comprising a polypeptide antigen or portions thereof and an Fc domain.

[0302] In certain embodiments, the antigen or its extracellular domain portion is a fusion polypeptide comprising an Fc domain. In some embodiments, the Fc domain is composed of the second and third constant domains (i.e., CH2 and CH3 domains) of the heavy chain of an IgA or IgD isotype, for example, CH2 or CH3 of an IgG, IgA, or IgD isotype. In some embodiments, the Fc domain is composed of three heavy chain constant domains (i.e., CH2, CH3, and CH4 domains) of an IgM or IgE isotype. In some embodiments, the Fc domain may further comprise a hinge sequence or a portion thereof. In certain aspects, the Fc domain contains part or all of the hinge domain and the CH2 and CH3 domains of an immunoglobulin molecule. In some cases, the Fc domain may form a dimer of two polypeptide chains joined by one or more disulfide bonds. In some embodiments, the Fc domain is derived from an immunoglobulin (e.g., IgG, IgA, IgM, or IgE) of a suitable mammal (e.g., human, mouse, rat, goat, sheep, or monkey). In some embodiments, the Fc domain is derived from the C of IgG. H 2 and C H In certain embodiments, the Fc domain is fused to the C-terminus of the polypeptide antigen. In certain embodiments, the Fc domain is fused to the N-terminus of the polypeptide antigen.

[0303] In some embodiments, the Fc domain is an IgG Fc domain or a portion or variant thereof. In some embodiments, the Fc domain is a human IgG Fc domain or a portion or variant thereof comprising the amino acid sequence set forth in SEQ ID NO: 46 or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 46. In certain embodiments, the Fc domain is a wild-type human IgG Fc domain or a portion or variant thereof. In certain embodiments, the Fc domain is a variant of a wild-type human IgG1 Fc domain.

[0304] In some embodiments, the fusion polypeptide comprises a variant Fc domain. In certain embodiments, the variant human IgG Fc domain contains a mutation, e.g., a substitution, deletion, or insertion, that reduces, decreases, and / or decreases pairing between the Fc domain and the light chain. In some embodiments, the variant human IgG Fc domain contains a mutation that reduces the binding affinity between the Fc domain and an Fc receptor. In certain embodiments, the variant human IgG Fc domain contains a mutation that reduces, decreases, and / or decreases the interaction, or the probability or likelihood of an interaction, between the Fc domain and an Fc receptor. In some embodiments, the variant human IgG Fc domain contains a mutation that reduces the binding affinity between the Fc domain and a protein of the complement system. In certain embodiments, the variant human IgG Fc domain contains a mutation that reduces, decreases, and / or decreases the interaction, or the probability or likelihood of an interaction, between the Fc domain and a protein of the complement system.

[0305] In some embodiments, the antigen or portion thereof is linked to a mutant human IgG1 Fc domain. In some embodiments, the mutant human IgG Fc domain contains a cysteine ​​to serine substitution in the hinge region of the Fc domain. In some embodiments, the mutant human IgG Fc domain contains a leucine to alanine substitution in the hinge region of the Fc domain. In certain embodiments, the mutant human IgG Fc domain contains a glycine to alanine substitution in the hinge region. In certain embodiments, the mutant human IgG Fc domain contains an alanine to serine substitution in the CH2 region of the Fc domain. In some embodiments, the mutant human IgG Fc domain comprises a proline to serine substitution in the CH2 region of the Fc domain. In some embodiments, the mutant human IgG Fc domain comprises the amino acid sequence set forth in SEQ ID NO: 47.

[0306] In some embodiments, the antigen or extracellular domain portion thereof is provided as a fusion polypeptide comprising an Fc domain, wherein the Fc domain is at the C-terminus of the fusion polypeptide.

[0307] In some embodiments, the antigen and the multimerization domain, e.g., the Fc domain, are connected by a linker, e.g., an amino acid linker. In certain embodiments, the antigen is fused to the N-terminus of the amino acid linker, and the multimerization domain, such as the Fc domain, is fused to the C-terminus of the linker. The amino acid linker can be of any length and contain any combination of amino acids, although the linker length can be relatively short (e.g., 10 or fewer amino acids) to reduce interactions between the linked domains. The amino acid composition of the linker can also be adjusted to reduce the number of amino acids with bulky side chains or amino acids likely to introduce secondary structure. Suitable amino acid linkers include, but are not limited to, those up to 3, 4, 5, 6, 7, 10, 15, 20, or 25 amino acids in length. An exemplary amino acid linker sequence includes GGGGS (SEQ ID NO: 52), and the linker contains 2, 3, 4, or 5 copies of GGGGS (SEQ ID NO: 22).

[0308] In some embodiments, the antigen is provided as the extracellular domain of BCMA, e.g., human BCMA, fused to an Fc domain (BCMA-Fc). In certain embodiments, the BCMA-Fc antigen contains all or a portion of the amino acid sequence set forth in SEQ ID NO: 48, or a sequence of amino acids that exhibits at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence similar to SEQ ID NO: 48, and that includes an epitope recognized by an antigen receptor, e.g., a CAR.

[0309] In some embodiments, the antigen is provided as the extracellular domain of ROR1, e.g., human ROR1, fused to an Fc domain (ROR1-Fc). In certain embodiments, the ROR-1-Fc antigen contains a sequence of amino acids that exhibits at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to all or a portion of the amino acid sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 50, and includes an epitope recognized by an antigen receptor, e.g., a CAR.

[0310] In certain embodiments, the antigen is provided as the extracellular domain of CD22, e.g., human CD22, fused to an Fc domain (e.g., CD22-Fc). In certain embodiments, the CD22-Fc antigen contains all or a portion of the amino acid sequence set forth in SEQ ID NO: 51, or a sequence of amino acids that exhibits at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 51, and that includes an epitope recognized by an antigen receptor, e.g., a CAR.

[0311] In some embodiments, the Fc fusion of the antigen or its extracellular binding domain is linked to or attached to a surface support as a dimer formed by two Fc fusion polypeptides containing the polypeptide antigen or its partial Fc domains. In some embodiments, the resulting polypeptide antigen-Fc fusion protein, e.g., BCMA-Fc, ROR1-Fc, CD22-Fc, or CD19-Fc, may be expressed, e.g., in a host cell transformed with an expression vector, whereby assembly between the Fc domains occurs via intramolecular disulfide bonds formed between the Fc moieties, resulting in a dimeric, e.g., bivalent, polypeptide antigen fusion protein. In some embodiments, the host cell is a mammalian cell line. Exemplary mammalian cells for recombinant expression of proteins include HEK293 cells or CHO cells or their derivatives. In some aspects, the nucleic acid encoding the Fc fusion protein further comprises a signal peptide for secretion from the cell. In an exemplary embodiment, the signal peptide is CD33 (e.g., as set forth in SEQ ID NO: 44).

[0312] In some embodiments, cells of the therapeutic cell composition express a CAR that binds to or recognizes a universal tag, which may be fused to an antibody or a fragment or variant thereof. In certain embodiments, cells expressing such a CAR can specifically recognize and kill target cells, e.g., tumor cells, bound by an antibody fused to the universal tag. An example includes, but is not limited to, T cells expressing an anti-FITC CAR that can bind to and / or recognize various human cancer cells when those cells are bound by a cancer-reactive FITC-labeled antibody. Thus, in some embodiments, the same CAR that binds to a universal tag is useful for treating various cancers, provided there is an available antibody that recognizes an antigen associated with the cancer that contains the universal tag. In certain embodiments, particles (e.g., bead particles) contain surface-exposed binding molecules that include a universal tag-binding molecule that can be bound or recognized by a recombinant receptor, e.g., a CAR. In certain embodiments, the binding molecule is a universal tag or a portion thereof that is bound or recognized by an antigen receptor, e.g., a CAR. Certain embodiments contemplate that any polypeptide domain that can be fused to an antibody, or antigen-binding fragment or variant thereof, that does not prevent the antibody from binding to its reactive target is suitable for use as a universal tag. In some embodiments, the particles are conjugated to a binding molecule comprising a universal tag, or a portion thereof, selected from the group consisting of FITC, streptavidin, biotin, histidine, dinitrophenol, peridinin chlorophyll protein complex, green fluorescent protein, PE, HRP, palmitoylation, nitrosylation, alkalanine phosphatase, glucose oxidase, and maltose binding protein.

[0313] b.Antibodies In some aspects, the binding molecule is a recombinant receptor as described in Section III, e.g., an antibody (e.g., an anti-idiotypic antibody) or antigen-binding fragment thereof ("anti-ID") that specifically recognizes a recombinant receptor, e.g., a CAR. In particular, an anti-idiotypic antibody targets the antigen-binding site of another antibody, e.g., the scFv of the extracellular antigen-binding domain of a CAR. In some embodiments, the anti-ID can bind to the recombinant receptor and stimulate recombinant receptor-dependent activity. Exemplary anti-idiotypic antibodies against antigen-specific CARs are known. These include, but are not limited to, anti-idiotypic antibodies directed against CD22-directed CARs (see, for example, PCT Publication No. WO2013188864); CD19-directed CARs (see, for example, PCT Publication No. WO2018 / 023100); GPRC5D-directed CARs (see, for example, PCT Application No. PCT / US2020 / 063497); and BCMA-directed CARs (see, for example, PCT Application No. PCT / US2020 / 063492). Anti-idiotypic antibodies can be immobilized or attached to a surface support (e.g., beads) as described above for use as a recombinant receptor stimulator for cells expressing the recombinant receptor (e.g., CAR) targeted by the anti-idiotypic antibody.

[0314] The term "antibody" is used herein in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, such as fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, single-chain antibody fragments, such as single-chain variable fragments (scFv), and single-domain antibody (e.g., sdAb, sdFv, nanobody) fragments. The term also encompasses engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, and tandem tri-scFv. The term "antibody," unless otherwise specified, should be understood to encompass functional antibody fragments thereof. The term also includes intact or full-length antibodies, including antibodies of any class or subclass, such as IgG and its subclasses, IgM, IgE, IgA, and IgD.

[0315] The term "anti-idiotypic antibody" refers to an antibody that specifically recognizes, is specifically targeted to, and / or specifically binds to the idiotope of an antibody, e.g., an antigen-binding fragment thereof. An antibody idiotope may include, but is not necessarily limited to, the complementarity-determining regions (CDRs) of an antibody, the variable regions of an antibody and / or residues within one or more of such variable regions and / or partial portions or portions of such CDRs and / or any combination of the foregoing. The CDRs may be one or more selected from the group consisting of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3. The antibody variable region may be a heavy chain variable region, a light chain variable region, or a combination of a heavy chain variable region and a light chain variable region. Partial fragments or portions of the heavy and / or light chain variable regions of an antibody can be fragments comprising two or more, five or more, or ten or more contiguous amino acids within the heavy or light chain variable region of the antibody, e.g., about 2 to about 100, about 5 to about 100, about 10 to about 100, about 2 to about 50, about 5 to about 50, or about 10 to about 50 contiguous amino acids; idiotopes can comprise multiple, non-contiguous stretches of amino acids. Partial fragments of the heavy and light chain variable regions of an antibody can be fragments comprising two or more, five or more, or ten or more contiguous amino acids within the variable region, e.g., about 2 to about 100, about 5 to about 100, about 10 to about 100, about 2 to about 50, about 5 to about 50, or about 10 to about 50 contiguous amino acids, and in some embodiments, contain one or more CDRs or CDR fragments. A CDR fragment can be two or more, five or more, contiguous or non-contiguous amino acids within a CDR. Thus, an antibody idiotope can be about 2 to about 100, about 5 to about 100, about 10 to about 100, about 2 to about 50, about 5 to about 50, or about 10 to about 50 contiguous amino acids comprising one or more CDRs or one or more CDR fragments within the heavy chain or light chain variable region of an antibody.In another embodiment, the idiotope can be a single amino acid located in the variable region of an antibody, for example, in a CDR site.

[0316] In some embodiments, an idiotope is any single antigenic determinant or epitope within the variable portion of an antibody. In some cases, it may overlap the actual antigen-binding site of an antibody, and in some cases, it may include variable region sequences outside the antigen-binding site of an antibody. The set of individual idiotopes of an antibody is, in some embodiments, referred to as the "idiotype" of such an antibody.

[0317] The terms "complementarity-determining region" and "CDR" are synonymous with "hypervariable region" or "HVR" and are known in the art. They refer to non-contiguous sequences of amino acids in an antibody variable region that confer antigen specificity and / or binding affinity. Generally, there are three CDRs (CDR-H1, CDR-H2, CDR-H3) in each heavy chain variable region and three CDRs (CDR-L1, CDR-L2, CDR-L3) in each light chain variable region. The terms "framework region" and "FR" are known in the art and refer to the non-CDR portions of the heavy and light chain variable regions. Generally, there are four FRs (FR-H1, FR-H2, FR-H3, and FR-H4) in each full-length heavy chain variable region and four FRs (FR-L1, FR-L2, FR-L3, and FR-L4) in each full-length light chain variable region.

[0318] The precise amino acid sequence boundaries of a given CDR or FR can be determined by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme); Al-Lazikani et al., (1997) JMB 273,927-948 ("Chothia" numbering scheme); MacCallum et al., J. Mol. Biol. 262: 732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding site topography," J. Mol. Biol. 262, 732-745. ("Contact" numbering scheme); Lefranc MP et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains," Dev Comp Immunol, 2003 Jan;27(1):55-77 (the "IMGT" numbering scheme) and Honegger A and Plueckthun A, "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool," J Mol Biol, 2001 Jun 8;309(3):657-70, (the "Aho" numbering scheme).

[0319] The boundaries of a given CDR or FR can vary according to the scheme used for identification.For example, Kabat scheme is based on structural alignment, while Chothia scheme is based on structural information.The numbering of both Kabat and Chothia schemes is based on the most common antibody region sequence length, and insertion corresponds to the insertion letter, for example, "30a", and deletion appears in some antibodies.The two schemes place certain insertions and deletions ("insertion deletions") in different positions, resulting in differential numbering.Contact scheme is based on the analysis of complex crystal structure, and is similar in many respects to the Chothia numbering scheme.

[0320] Table 1 below lists exemplary alignment boundaries for CDR-L1, CDR-L2, CDR-L3, and CDR-H1, CDR-H2, and CDR-H3, as identified by Kabat, Chothia, and contact schemes, respectively. For CDR-H1, residue numbers are listed using both the Kabat and Chothia numbering schemes. FRs are located between the CDRs, e.g., FR-L1 is located between CDR-L1 and CDR-L2. The Kabat numbering scheme shown places the insertion at H35A and H35B, so it is known that when the end of the Chothia CDR-H1 loop is numbered using the Kabat numbering scheme shown, the numbering scheme varies between H32 and H34 depending on the length of the loop.

[0321] [Table 1]

[0322] Thus, unless otherwise specified, the "CDR" or "complementarity determining region" of a given antibody or region thereof, e.g., its variable region, or each specific CDR (e.g., "CDR-H1, CDR-H2"), should be understood to encompass one (or specific) complementarity determining region as defined by any of the above schemes. For example, if a designated CDR (e.g., CDR-H3) is a CDR of a given V Hor V L When an amino acid sequence is described as containing the amino acid sequence of a corresponding CDR in the variable region, it is understood that such CDR has the sequence of the corresponding CDR (e.g., CDR-H3) in the variable region as defined by any of the above schemes. In some embodiments, the specified CDR sequence is specified.

[0323] Similarly, unless otherwise specified, a given antibody or region thereof, e.g., the FRs of its variable region or each specific FR(s) (e.g., FR-H1, FR-H2), should be understood to encompass one (or specific) framework region as defined by any known scheme. In some cases, a scheme for identifying a particular CDR, FR or FRs or CDRs is specified, such as CDRs as defined by Kabat, Chothia, or contact methods. In other examples, the specific amino acid sequence of a CDR or FR is provided.

[0324] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy and light chains of a naturally occurring antibody (V H and V L ) generally have a similar structure, with each domain containing four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). A single V H or V L The V domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind to a particular antigen may be identified by isolating the V domain from the antibody that binds the antigen. H or V L Using the domains, isolate and differentiate each complementary V L or V HMethods for screening libraries of domains are available (see, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).

[0325] Among the antibodies provided are antibody fragments. The term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of the intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. In certain embodiments, the antibody is a single-chain antibody fragment, e.g., scFv, that contains a heavy chain variable chain region and / or a light chain variable chain region.

[0326] Single domain antibodies are antibody fragments that contain all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In certain embodiments, single domain antibodies are human single domain antibodies.

[0327] Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies as well as production by recombinant host cells. In some embodiments, the antibody is a recombinantly produced fragment, e.g., a fragment that contains a non-naturally occurring arrangement, e.g., two or more antibody regions or chains joined by a synthetic linker, e.g., a peptide linker, and / or that could not be produced by enzymatic digestion of a naturally occurring intact antibody. In some aspects, the antibody fragment is an scFv.

[0328] A "humanized" antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all framework amino acid residues are derived from human FRs. In some embodiments, humanized forms of non-human antibodies, e.g., murine antibodies, are chimeric antibodies containing minimal sequence derived from non-human immunoglobulin. In certain embodiments, a humanized antibody is an antibody from a non-human species having one or more complementarity-determining regions (CDRs) from the non-human species and framework regions (FRs) from a human immunoglobulin molecule. In some embodiments, a humanized antibody may comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody generally refers to a variant of a non-human antibody that has undergo...

Claims

1. 1. A method for determining the efficacy of a viral vector, comprising: a) introducing a controlled amount of a test viral vector encoding a recombinant receptor into multiple populations of reporter T cells, each population of reporter T cells being identical and each being introduced with a different amount of the controlled test viral vector; Each of the reporter T cell populations comprises a reporter T cell that comprises a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of a T cell transcription factor; and introducing a recombinant receptor that contains an extracellular binding domain specific for a target, a transmembrane domain, and contains or is complexed with an intracellular signaling region that contains an ITAM-containing domain; b) incubating each of the multiple populations of reporter T cells in the presence of a recombinant receptor stimulating agent, where binding of the recombinant receptor stimulating agent to the recombinant receptor induces signaling through the intracellular signaling domain of the recombinant receptor to produce a detectable signal from the reporter molecule; c) measuring each of the multiple populations of reporter T cells for a detectable signal from the reporter molecule; and d) determining the adjusted amount of the test viral vector that results in a half-maximal detectable signal based on the measured detectable signal. A method comprising:

2. 2. The method of claim 1, wherein the potency is relative potency, and the method further comprises comparing the half-maximal detectable signal of the test viral vector to the half-maximal detectable signal of a reference viral vector standard in the same assay.

3. The relative efficacy is (a) the percentage of detectable signal of the test viral vector relative to a reference viral vector standard; or (b) The ratio of the detectable signal of the test viral vector to the reference viral vector standard. The method according to claim 2, wherein

4. The method of claim 1 , wherein the adjusted amount of the test viral vector is a serial dilution of the viral vector. (a) the serial dilution of the viral vector is a serial dilution based on the vector volume, or (b) the serial dilution of the viral vector is a serial dilution based on the viral vector titer; The method according to claim 4.

6. 5. The method of claim 4, wherein the viral vector titer is a functional titer or a physical titer and / or the viral vector titer is quantified as infectious units (IU) per unit of viral vector volume.

7. The method of any one of claims 1 to 3, wherein the adjusted amount of the test viral vector is a ratio of a constant amount of the viral vector to the number of cells in the population of reporter T cells.

8. 8. The method of claim 7, wherein the amount of the test viral vector is a volume of the test viral vector, a titer of the test viral vector, or an MOI of the test viral vector.

9. The method of any one of claims 1 to 8, wherein the reporter T cell is an immortalized cell line.

10. The method of claim 9, wherein the reporter T cell is a Jurkat cell line or a derivative thereof.

11. The method of claim 10, wherein the Jurkat cell line or a derivative thereof is Jurkat cell clone E6-1.

12. A method described in any of claims 1 to 11, wherein the transcriptional regulatory element includes a response element (singular or plural) recognized by a transcription factor that is activated upon signal transduction through the ITAM-containing domain of the recombinant receptor induced by a recombinant receptor stimulant.

13. The method of any of claims 1 to 12, wherein the T cell transcription factor is selected from the group consisting of Nur77, NF-κB, NFAT, and AP1.

14. the T cell transcription factor is Nur77; (a) the transcriptional regulatory element comprises the Nur77 promoter or a portion thereof that contains a response element or elements recognized by a transcription factor; (b) the transcriptional regulatory element is a transcriptional regulatory element within an endogenous Nur77 locus in a T cell; (c) a nucleic acid sequence encoding a reporter molecule is integrated into the genome of the reporter T cell at or near an endogenous locus encoding Nur77, wherein the reporter molecule is operably linked to a transcriptional regulatory element of the endogenous Nur77 locus; (d) a nucleic acid sequence encoding a reporter molecule is integrated by inducing a genetic disruption at one or more target sites at or near the endogenous locus encoding Nur77 and introducing a template polynucleotide comprising a nucleic acid encoding the reporter molecule for knock-in of the reporter molecule at the endogenous locus by homology directed repair (HDR); and / or (e) a nucleic acid encoding a reporter molecule is present in the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77; 14. The method according to any one of claims 1 to 13.

15. 15. The method of claim 14, wherein the genetic disruption is induced by a CRISPR-Cas9 combination that specifically binds to, recognizes, or hybridizes with one or more target sites.

16. 16. The method of claim 14 or claim 15, wherein the one or more target sites comprise the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 3) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 4), and / or the nucleic acid is present in the genome at a site comprising the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO: 3) and / or GCCTGGGAACACGTGTGCA (SEQ ID NO: 4). (a) the reporter molecule is luciferase; (b) the reporter molecule is firefly luciferase; (c) the nucleic acid sequence encoding the reporter molecule further encodes one or more markers that are or include a transduction marker and / or a selection marker; and / or (d) the nucleic acid sequence encoding the reporter molecule is or further encodes one or more markers including a transduction marker comprising a fluorescent protein; 19. The method of any one of claims 1 to 18.

18. 18. The method of any of claims 2 to 17, wherein evaluation of the reference viral vector standard is performed in parallel with the test viral vector in the assay.

19. The intracellular signaling domain is (a) the intracellular signaling domain of the CD3 chain or a signaling portion thereof, and / or (b) the CD3-zeta (CD3ζ) chain or a signal transduction portion thereof; 19. The method of any one of claims 1 to 18, which is or comprises:

20. 20. The method of any one of claims 1 to 19, wherein the intracellular signaling region further comprises a costimulatory signaling region.

21. A costimulatory signaling region, (a) the intracellular signaling domain of a T cell costimulatory molecule, or a signaling portion thereof, and / or (b) the intracellular signaling domain of CD28, 4-1BB or ICOS, or a signaling portion thereof 21. The method of claim 20, comprising:

22. 22. The method of any of claims 1 to 21, wherein the recombinant receptor is an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

23. The recombinant receptor stimulating agent is (a) a binding molecule which is or comprises a target antigen of a recombinant receptor or an extracellular domain binding portion thereof; (b) a binding molecule that is an antibody specific for the extracellular domain of the recombinant receptor or that comprises the same; (c) a binding molecule which is or comprises an extracellular domain-binding portion of an antigen, the extracellular domain-binding portion comprising an epitope recognised by a recombinant receptor; and / or (d) immobilized or attached to a solid support; 23. The method of any one of claims 1 to 22.

24. 24. The method of claim 23, wherein the solid support is a bead.

25. (a) the beads are obtained from a composition having a concentration of binding molecule of between or about 0.5 μg / mL and 500 μg / mL (inclusive), optionally 5 or about 5 μg / mL, 10 or about 10 μg / mL, 25 or about 25 μg / mL, 50 or about 50 μg / mL, 100 or about 100 μg / mL, or 200 or about 200 μg / m, or any value therebetween; (b) for incubation, beads are added at a ratio of reporter T cells to beads that is 5:1 to 1:5 or about 5:1 to about 1:5 (inclusive); (c) for incubation, beads are added at a ratio of reporter cells to beads of 3:1 to 1:3, or 2:1 to 1:2, or about 3:1 to about 1:3, or about 2:1 to about 1:2; and / or (d) for incubation, beads are added at a ratio of reporter cells to beads that is 1:1 or about 1:1; 25. The method of claim 24.

26. 26. The method of any one of claims 1 to 25, wherein the recombinant receptor stimulating agent is a target-expressing cell.

27. 27. The method of claim 26, wherein the target-expressing cells are clones derived from a cell line, are derived from a tumor cell line, or are primary cells taken from a subject.

28. 27. The method of claim 26, wherein the target-expressing cell is a cell that has been introduced to express the target of the recombinant receptor.

29. 29. The method of any of claims 26 to 28, wherein for incubating, the target-expressing cells are added at a ratio of target-expressing cells to reporter T cells of 1:1 to 10:1, or about 1:1 to about 10:1, or 1:1 to 6:1, or about 1:1 to about 6:

1.

30. Multiple incubations (a) carried out in flasks, tubes or multi-well plates; and / or (b) each performed individually in a well of a multi-well plate; 30. The method of any one of claims 1 to 29.

31. The method of any one of claims 1 to 30, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a lentiviral vector, or an HIV-1 derived lentiviral vector.

32. 32. The method of any one of claims 1 to 31, wherein the detectable signal is luciferase luminescence.

Images