Stem cells containing unrearranged T cell receptor (TCR) loci and methods of use thereof

Abstract

Methods are provided for generating stem cells that cannot undergo T cell receptor (TCR) or B cell receptor (BCR) gene rearrangement. Specifically, methods, compositions and kits are provided for use in generating cells of T cell lineage or B cell lineage that contain unrearranged TCR or BCR loci, respectively. In one embodiment, the cells are further engineered to express a TCR, bCR or CAR that confers specificity to an antigen of interest. Cells, compositions, kits and uses thereof are also provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 178,990, filed April 23, 2021, the contents of which are incorporated herein by reference in their entirety.

[0002] This application relates to stem cells that are incapable of undergoing T cell receptor (TCR) or B cell receptor (BCR) gene rearrangement. Specifically, this application relates to methods, compositions, and kits for use in generating cells of the T or B cell lineage that contain unrearranged TCR or BCR loci, respectively. [Background technology]

[0003] The ability of a T cell to specifically recognize an antigen is achieved by expression of a specific T cell receptor encoded by a uniquely rearranged genomic locus of the TCR α and TCR β chains. T cell development is based on successful rearrangement of the T cell receptor (TCR) locus that encodes the antigen-specific receptor.

[0004] V(D)J recombination activating genes (RAG) 1 and 2 are two essential DNA processing enzymes required for the rearrangement of B cell receptor and T cell receptor loci (Schatz at al., 1989; Oettinger et al., 1990). RAG1 / 2 first initiate V(D)J recombination by forming a complex that recognizes and binds recombination signal sequences (RSSs) found adjacent to each V, D, and J gene segment. Upon formation of synapse with another RSS, the RAG complex induces double-stranded DNA breaks, which are repaired by a non-homologous end joining process (Jones and Gellert, 2004; Smith et al., 2019). This ultimately results in the incomplete joining of different V, D, and J gene segments to potentially generate millions of different antigen receptors from hundreds of V(D)J segments. Summary of the Invention

[0005] We used CRISPR / Cas9-directed deletion of the RAG2 gene (RAG2-KO) to differentiate human pluripotent stem cells and showed that human RAG2-deficient developing T cells progress to the CD4+CD8+ double-positive stage. We also showed that expression of rearranged TCR β chains promotes cell survival and / or proliferation of developing human T cells at the double-positive stage.

[0006] Accordingly, the present disclosure provides a method for generating stem or progenitor cells that are incapable of undergoing T cell receptor (TCR) gene rearrangement, comprising: (a) culturing a sample containing stem or progenitor cells, Methods are provided, wherein expression of at least one gene or protein required for V(D)J recombination in stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0007] In one embodiment, the method further comprises (b) isolating cells of a T cell lineage.

[0008] In another embodiment, the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

[0009] In another embodiment, the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), a paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0010] In another embodiment, the stem cell is a pluripotent stem cell. Optionally, the pluripotent stem cell is an embryonic stem cell or an induced pluripotent stem cell (iPSC).

[0011] In another embodiment, the stem or progenitor cells are human cells.

[0012] In another embodiment, the cell of the T cell lineage is a progenitor T (proT) cell, optionally a CD45+CD34+CD7+ progenitor T (proT) cell.

[0013] In another embodiment, the cells of the T cell lineage are CD4+CD8+ double positive cells or CD4+CD8+CD3+ double positive cells.

[0014] In another embodiment, the cells of the T cell lineage are CD8+CD3+ single positive cells or CD4+CD3+ single positive cells.

[0015] In another embodiment, the method further comprises engineering the stem or progenitor cells, or cells of a T cell lineage, to contain at least one of nucleic acids encoding a T cell receptor (TCR), a TCR β chain, and a chimeric antigen receptor (CAR).

[0016] In another embodiment, the stem or progenitor cells, or cells of a T cell lineage, express at least one of a T cell receptor (TCR), a TCR beta chain, and a chimeric antigen receptor (CAR).

[0017] In another embodiment, the method further comprises engineering the stem or progenitor cell, or cell of a T cell lineage, to comprise a nucleic acid encoding a TCR beta chain. In a further embodiment, the stem or progenitor cell, or cell of a T cell lineage, that comprises a nucleic acid encoding a TCR beta chain does not comprise a nucleic acid encoding a TCR beta chain or a chimeric antigen receptor (CAR).

[0018] In another embodiment, the stem or progenitor cells, or cells of a T cell lineage, express a TCR β chain.

[0019] In another embodiment, the stem or progenitor cell, or cell of a T cell lineage, comprises a nucleic acid encoding a TCR β chain and a nucleic acid encoding a CAR.

[0020] In another embodiment, the TCR or CAR confers specificity to an antigen, optionally a tumor-associated antigen, a viral antigen or an autoantigen.

[0021] The present disclosure also provides cells of a T cell lineage, the cells being generated by the methods described herein.

[0022] In one embodiment, the cells of the T cell lineage are CD4+CD8+ double positive cells or CD4+CD8+CD3+ double positive cells.

[0023] In another embodiment, the cells are CD45+CD34+CD7+ precursor T cells, CD8+CD3+ single positive cells, or CD4+CD3+ single positive cells.

[0024] The disclosure also provides a stem or progenitor cell, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cell is reduced or eliminated compared to a wild-type stem or progenitor cell.

[0025] In one embodiment, the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

[0026] In another embodiment, the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), a paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0027] In another embodiment, the stem or progenitor cells further comprise at least one of a nucleic acid encoding a T cell receptor (TCR), a TCR beta chain, and a chimeric antigen receptor (CAR).

[0028] In another embodiment, the stem or progenitor cells further comprise a nucleic acid encoding a TCR beta chain. In a further embodiment, the stem or progenitor cells comprising a nucleic acid encoding a TCR beta chain do not comprise a nucleic acid encoding a TCR beta chain or a chimeric antigen receptor (CAR).

[0029] In another embodiment, the stem cells are pluripotent stem cells, optionally embryonic stem cells or induced pluripotent stem cells (iPSCs).

[0030] In another embodiment, the stem or progenitor cells are human cells.

[0031] The present disclosure also provides the use of stem or progenitor cells described herein to generate cells of a T cell lineage.

[0032] The present disclosure also provides a kit comprising: (i) a stem or progenitor cell described herein; and (ii) instructions for using the stem or progenitor cell described herein to generate cells of a T cell lineage.

[0033] The present disclosure provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering to a subject in need of treatment an effective amount of cells or progenitor cells; Further provided are methods in which the stem or progenitor cells are engineered to contain at least one of nucleic acids encoding a T cell receptor (TCR) and a chimeric antigen receptor (CAR) that confer specificity to an antigen.

[0034] The present disclosure also provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells and isolating cells of a T cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of a cell of the T cell lineage to a subject in need thereof; Methods are provided in which stem or progenitor cells, or cells of a T cell lineage, are engineered to contain at least one of nucleic acids encoding a T cell receptor (TCR) and a chimeric antigen receptor (CAR) that confer specificity to an antigen.

[0035] In one embodiment, the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

[0036] In another embodiment, the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), a paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0037] In another embodiment, the disease is cancer and the antigen is a tumor-associated antigen.

[0038] The present disclosure also provides a method for generating stem or progenitor cells that are incapable of undergoing T cell receptor (BCR) gene rearrangement, comprising: (a) culturing a sample containing stem or progenitor cells, Methods are provided, wherein expression of at least one gene or protein required for V(D)J recombination in stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0039] In one embodiment, the method further comprises (b) isolating cells of the B cell lineage.

[0040] In another embodiment, the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

[0041] In another embodiment, the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), a paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0042] In another embodiment, the stem cells are pluripotent stem cells, optionally embryonic stem cells or induced pluripotent stem cells (iPSCs).

[0043] In another embodiment, the stem or progenitor cells are human cells.

[0044] In another embodiment, the cells of the B cell lineage are CD20+ or ​​CD19+ cells.

[0045] In another embodiment, the cell of the B cell lineage is a tumor infiltrating B cell (TIB).

[0046] In another embodiment, the method further comprises engineering the stem or progenitor cells, or cells of the B cell lineage, to contain at least one of nucleic acids encoding a B cell receptor (BCR), a BCR beta chain, and a chimeric antigen receptor (CAR).

[0047] In another embodiment, the stem or progenitor cells, or cells of the B cell lineage, express a B cell receptor (BCR), a BCR beta chain, or a chimeric antigen receptor (CAR).

[0048] In another embodiment, the BCR or CAR confers specificity to an antigen, optionally a tumor-associated antigen, a viral antigen or an autoantigen.

[0049] The present disclosure also provides cells of the B cell lineage, the cells being produced by the methods described herein.

[0050] In one embodiment, the cells of the B cell lineage are CD20+ or ​​CD19+ cells.

[0051] In another embodiment, the cell of the B cell lineage is a tumor infiltrating B cell (TIB).

[0052] The present disclosure also provides the use of the stem or progenitor cells described herein to generate cells of the B cell lineage.

[0053] The present disclosure also provides a kit comprising (i) a stem or progenitor cell described herein; and (ii) instructions for using the stem or progenitor cell described herein to generate cells of a B cell lineage.

[0054] The present disclosure also provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of stem or progenitor cells to a subject in need thereof; Methods are provided in which stem or progenitor cells are engineered to contain nucleic acid encoding a B cell receptor (BCR) that confers specificity for an antigen.

[0055] The present disclosure also provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells and isolating cells of a B cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of cells of the B cell lineage to a subject in need thereof; Methods are provided in which stem or progenitor cells, or cells of the B cell lineage, are engineered to contain nucleic acid encoding a B cell receptor (BCR) that confers specificity for an antigen.

[0056] In one embodiment, the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

[0057] In another embodiment, the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), a paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0058] In another embodiment, the disease is cancer and the antigen is a tumor-associated antigen.

[0059] Other features and advantages of the present application will become apparent from the following detailed description of the invention. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the present application, are given by way of illustration only, since various changes and modifications within the spirit and scope of the present application will become apparent to those skilled in the art from the detailed description of the invention.

[0060] Embodiments of the present disclosure will now be described in connection with the following drawings. [Brief description of the drawings]

[0061] [Figure 1] Generation and characterization of RAG2-KO hESC lines. A shows Sanger sequencing of genomic DNA of CRISPR / Cas9-targeted RAG2 of clones 1 and 4. The altered allele is shown in the chromatograph and sequence above, while the alignment of the altered and WT alleles is shown below. B shows immunoblots for RAG2 protein expression of in vitro derived T-lineage cells from RAG2-KO clones (1 and 4) and control WT hESCs, or control PBMCs obtained from T-ALL patients. GAPDH serves as a loading control. C shows immunofluorescence of RAG2-KO hESC clones for pluripotency markers. Scale bar corresponds to 100 μm. D shows immunohistochemistry of RAG2-KO hESC clones for ectodermal (neural tissue), mesodermal (cartilage) and endodermal (glandular tissue) lineages in a teratoma formation assay. E shows the yield and enrichment of CD34+ hemogenic endothelial cells after 8 days of embryoid body differentiation from control WT, RAG2-KO-1 and RAG2-KO-4 hESCs (n=3 out of 3 independent experiments). [Diagram 2] Figure 1 shows the development of T cells from control WT and RAG2-KO hESC lines. A shows representative flow cytometry analysis of control WT and RAG2-KO (clones 1 and 4) hPSC-derived T lineage cells from d8 EB+10-34d OP9-DL4-7FS co-cultures as indicated. Cells were pre-gated for DAPI-CD45+. (n=5 out of 5 independent experiments). B shows cell numbers of control WT and RAG2-KO (clones 1 and 4) hPSC-derived T lineage cells per 10,000 inputs of CD34+ cells after the indicated days of culture in OP9-DL4-7FS. (n=3 out of 3 independent experiments). [Diagram 3](A-B) Forced expression of rearranged TCR β chain in RAG2-KO CD4+CD8+ DP cells leads to cell expansion. A shows a schematic of the experimental approach. B shows cell counts of RAG2-KO DPs (clones 1 and 4) retrovirally transduced with empty vector (dTomato), TCR alpha chain (TRA 1383i) or TCR beta chain (TRB 1383i) per 10,000 inputs of CD34+ cells. Transduced T lineage cells (dTomato+) were first sorted for CD7+CD5+CD4+CD8+ double positive cells and then recultured on OP9-DL4-7FS for 10 days. (n=3 out of 3 independent experiments). [Figure 4] (A-B) TCR gene expression and CD4+CD8+ signature gene expression. A shows heatmap analysis of specific TCR genes expressed in control WT DPs but absent in RAG2-KO1 / 4 DPs and TCRβ-transduced RAG2-KO1 / 4 DPs. B shows expression of CD4+CD8+ signature genes (as determined by thymic DP signature genes shown in Table 3) in RAG2-KO, TCRβ-transduced RAG2-KOs and umbilical cord blood (UCB)-derived DPs. (n=2 for control WT, RAG2-KO-1, RAG2-KO-4 and UCB, n=1 for TCRβ-transduced RAG2-KO-1 and TCRβ-transduced RAG2-KO-4 from one independent experiment). [Diagram 5] Transcriptome analysis of control WT, RAG2-KO and RAG2-KO TCRβ transduced CD4+CD8+ DP cells. RNA-seq analysis of control WT, RAG2-KO1 / 4 and TCRβ+ RAG2-KO1 / 4 CD4+CD8+ DP. Differentially highly expressed genes in control WT DP compared to RAG2-KO1 / 4 DP (A) and differentially highly expressed genes in RAG2-KO1 / 4 DP compared to control WT DP (B) are shown. (n=2 for control WT, RAG2-KO-1 and RAG2-KO-4, n=1 for TCRβ transduced RAG2-KO-1 and TCRβ transduced RAG2-KO-4 from one independent experiment). [Figure 6] Analysis of proliferation and differentiation genes and biological pathways is shown. A is a heatmap analysis of differentially expressed genes in DPs from RAG2-KO1 / 4 (KO) and TCRβ transduced RAG2-KO1 / 4 (KOTCRb) cells. B shows gene ontology biological pathway names with genes that are differentially upregulated in control WT DPs compared to RAG2-KO DPs. Biological pathways related to cell survival and / or proliferation are highlighted. Within groups of biological pathways involved in specific aspects of leukocyte regulation, the specific genes involved are also shown. [Figure 7] Figure 7 shows forced expression of TCRαβ and TCRγδ chains in RAG2-KO CD4+CD8+ DP. A shows that TCRαβ and TCRγδ transduced DPs showed higher cell numbers after 4 and 10 days of culture compared to dTomato transduced DPs. From left to right: dTomato, TCRαβ- and TCRγδ. Figure 7B is a flow cytometry analysis of TCR-transduced RAG2-KO DP cells showing the expression of the corresponding αβ and γδ TCRs, respectively, on the cell surface of T lineage cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0062] As described above, we have used CRISPR / Cas9-directed deletion of the RAG2 gene (RAG2-KO) to differentiate human pluripotent stem cells and shown that human RAG2-deficient developmental T cells progress to the CD4+CD8+ stage. We have also shown that RAG2-KO CD4+CD8+ double positive cells can be engineered to express TCRαβ and TCRγδ chains, and that expression of rearranged TCRβ chains promotes cell survival and / or proliferation of developmental human T cells at the double positive stage.

[0063] I. Methods for generating cells Accordingly, the present disclosure provides a method for generating stem or progenitor cells that are incapable of undergoing T cell receptor (TCR) gene rearrangement, comprising: (a) culturing a sample containing stem or progenitor cells, The method further comprises (b) isolating a cell of a T cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cell is reduced or eliminated compared to a wild-type stem or progenitor cell.

[0064] The disclosure also provides a method of generating a cell of a T cell lineage that comprises an unrearranged T cell receptor (TCR) locus, the method comprising: (a) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0065] The term "cell of the T cell lineage" refers to a cell that exhibits at least one phenotypic characteristic of a T cell or its precursor or progenitor cells that distinguishes the cell from other lymphoid cells, as well as cells of the erythroid or myeloid lineages. Such phenotypic characteristics can include the expression of one or more proteins specific for T lineage commitment on the cell or its precursor or progenitor cells, or physiological, morphological, functional, or immunological characteristics specific for T cells.

[0066] In one embodiment, the cell of the T cell lineage is a human cell.

[0067] As used herein, the term "a cell" or "the cell" includes a plurality of cells.

[0068] As used herein, the term "isolated" means that cells have been separated or purified from cells or biological materials that are found with the cells in their natural environment, thus distinguishing the cells from their natural state.

[0069] The present disclosure also provides a method for generating stem or progenitor cells that are incapable of undergoing B cell receptor (BCR) gene rearrangement, comprising: (a) culturing a sample containing stem or progenitor cells, The present invention provides a method, wherein expression of at least one gene or protein required for V(D)J recombination in a stem or progenitor cell is reduced or eliminated compared to a wild-type stem or progenitor cell, in one embodiment, the method further comprises (b) isolating a cell of a B cell lineage.

[0070] The disclosure further provides a method of generating a cell of a B cell lineage that comprises an unrearranged B cell receptor (BCR) locus comprising: (a) culturing a sample comprising stem or progenitor cells; and (b) isolating a cell of the B cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0071] The term "cell of B-cell lineage" refers to a cell that exhibits at least one phenotypic characteristic of a B-cell or its precursor or progenitor cells that distinguishes the cell from other lymphoid cells, as well as a cell of erythroid or myeloid lineage. Such phenotypic characteristics can include expression of one or more proteins specific to the B-lineage on the cell or its precursor or progenitor cells, or physiological, morphological, functional, or immunological characteristics specific to B-cells. In another embodiment, the cell of B-cell lineage is a CD20+ or ​​CD19+ cell. In another embodiment, the cell of B-cell lineage is a tumor-infiltrating B cell (TIB).

[0072] In one embodiment, the cell of the B cell lineage is a human cell.

[0073] Cells of the T cell lineage can be classified as: (a) precursor or progenitor cells committed to the T cell lineage ("progenitor T cells" or "proT cells" as described herein); (b) CD7+ immature T cells; (c) cells that have undergone CD4 or CD8 lineage commitment (e.g., CD4+CD8 lo TCR int (d) cells characterized by TCR gene rearrangements; (e) precursor thymocytes that are CD4+CD8+ double positive (DP); (f) CD4-CD8+ or CD4+CD8- and optionally TCR hi (g) CD3+CD90+, (h) CD4-CD8+ or CD4+CD8- and TCR hi (i) single positive (SP) cells that are TCR-αβ + and / or TCR-γδ + (j) cells characterized by expression of any of multiple Vβ chains (e.g., Vβ-3, -6 and 17a); or (k) TCR / CD3 hi , mature and functional or activated T cells which may be characterized as CD4-CD8+ or CD4+CD8-.

[0074] In one embodiment, a cell of the T cell lineage is a "precursor T cell" or "proT cell." As used herein, the term "precursor T cell" or "proT cell" refers to a T cell that can mature into a mature T cell or lymphocyte. In one embodiment, a proT cell is a CD45+CD34+CD7+ proT cell.

[0075] In another embodiment, the progenitor T cells are human progenitor T cells. The phenotype of the human progenitor T cells includes CD34+CD7+ and CD7+CD5+CD1a-.

[0076] The inventors have shown that human RAG2-deficient developmental T cells progress to a CD4+CD8+ double positive stage. Thus, in another embodiment, cells of the T cell lineage are CD4 and CD8 double positive (DP) cells, characterized by a CD4+CD8+ or CD4+CD8+CD3+ phenotype.

[0077] In another embodiment, cells of the T cell lineage are CD4 or CD8 single positive (SP) cells characterized by a CD4-CD8+, CD4+CD8- or CD4-CD8+CD3+, CD4+CD8-CD3+ phenotype.

[0078] As used herein, an "unrearranged T cell receptor (TCR) locus" refers to a TCR locus that has not undergone rearrangement and remains in germline configuration. Similarly, an "unrearranged B cell receptor (BCR) locus" refers to a BCR locus that has not undergone rearrangement and remains in germline configuration.

[0079] The TCR locus can include an alpha (α) chain and a beta (β) chain (e.g., encoded by genes TRA and TRB, respectively), or a gamma and delta (γ / δ) chain (e.g., encoded by genes TRG and TRD, respectively). As will be appreciated by those of skill in the art, during T cell development, rearrangements of segments of genes encoding the TCR locus occur to encode an antigen-specific receptor.

[0080] As used herein, the term "genes or proteins required for V(D)J recombination" refers to genes for proteins required for correct rearrangement of the B- or T-cell receptor (BCR or TCR) locus. In one embodiment, the genes or proteins required for V(D)J recombination are lymphocyte-specific genes such as RAG1 or RAG2 or TdT.

[0081] In another embodiment, the gene or protein required for V(D)J recombination is a member of the non-homologous end joining (NHEJ) pathway for DNA repair.

[0082] In another embodiment, the gene or protein required for V(D)J recombination is Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1, also known as Cernunnos or XRCC4-like factor (XLF)), paralogues of XRCC4 and XLF (PAXX), or DNA polymerases lambda and μ.

[0083] As mentioned above, in one embodiment, the gene or protein required for V(D)J recombination is RAG1 or RAG2. V(D)J recombination activating genes (RAG) 1 and 2 encode two essential DNA processing enzymes required for rearrangement of B cell receptor and T cell receptor (BCR or TCR) loci (Schatz at al., 1989; Oettinger et al, 1990). As mentioned above, the inventors have differentiated human pluripotent stem cells using CRISPR / Cas9-directed deletion of the RAG2 gene (RAG2-KO) and shown that human RAG2-deficient developmental T cells progress to the CD4+CD8+ stage.

[0084] Thus, in the methods disclosed herein, cells of the T cell lineage or B cell lineage can be generated by culturing a sample comprising stem or progenitor cells, wherein expression and / or function of RAG1 and / or RAG2 in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0085] As used herein, RAG1 refers to V(D)J recombination activator protein (RAG)1 encoded by the RAG1 gene. The term "RAG1" includes RAG1 from any species or source. The term also includes sequences modified from any of the known published sequences of RAG1 proteins and genes. RAG1 or RAG1 genes may have any of the known published sequences of RAG1 that can be obtained from public sources such as GenBank. In one embodiment, RAG1 is human RAG1. An example of a human amino acid sequence of RAG1 includes GenBank Accession No. AAQ13571.1. An example of a human nucleic acid sequence of RAG1 includes GenBank No. NM_001377277.1 (Gene ID: 5896). The foregoing sequences are incorporated herein by reference.

[0086] RAG2 refers to the V(D)J recombination activator protein (RAG)2 encoded by the RAG2 gene. The term "RAG2" includes RAG2 from any species or source. The term also includes sequences modified from any of the known published sequences of the RAG2 protein and RAG2 gene. RAG2 or the RAG2 gene may have any of the known published sequences of RAG2 that can be obtained from public sources such as GenBank. In one embodiment, RAG2 is human RAG2. An example of a human amino acid sequence of RAG2 includes GenBank Accession No. AAH22397.1. An example of a human nucleic acid sequence of RAG2 includes GenBank Accession No. NM_000536.4 (Gene ID: 5897). The foregoing sequences are incorporated herein by reference.

[0087] As used herein, the term "RAG1 expression" includes both RAG1 protein expression and RAG1 gene expression. Similarly, the term "RAG2 expression" includes both RAG2 protein expression and RAG2 gene expression.

[0088] As used herein, the terms "RAG1 function" and "RAG2 function" refer to the biological activities of RAG1 and RAG2, respectively. For example, cells lacking the biological activity of the RAG1 and / or RAG2 enzymes are unable to undergo rearrangement of the B cell receptor and T cell receptor (BCR or TCR) loci.

[0089] Endogenous expression and / or function of genes or proteins required for V(D)J recombination (e.g., endogenous expression and / or function of RAG1 and / or RAG2) can be reduced or eliminated using any of several methods known in the art.

[0090] The reduction or elimination of expression and / or function of genes or proteins required for V(D)J recombination can be achieved by mutation or deletion of the corresponding gene sequence. The reduction or elimination of expression and / or function of RAG1 or RAG2 can be achieved, for example, by mutation or deletion of the RAG1 or RAG2 gene sequence. For example, the RAG1 or RAG2 gene sequence can be mutated or deleted from the genome of pluripotent stem cells, for example, using gene editing methods. Thus, for example, approaches using RNA / DNA-guided endonucleases (e.g., clustered regularly interspaced short repeats (CRISPR) / Cas9, Cpf1, and Argonaute), transcription activator-like effector (TALE)-nucleases, zinc finger nucleases (ZFN), or meganucleases can be adapted for use in embodiments of the present disclosure. In various examples, the insertion or deletion is performed by gene editing, causing a frameshift mutation and resulting in gene knockout (i.e., lack of expression of a functional gene product).

[0091] A specific example of a protocol used in the present invention in the context of RAG2 includes transfection of an expression vector containing a cassette of GFP, Cas9 endonuclease, CRISPR chimeric cDNA and gRNA portion targeting RAG2.

[0092] In another embodiment, RAG1 and / or RAG2 inhibitors are used to reduce the expression and / or function of endogenous RAG1 and / or RAG2. The term "inhibitor" refers to an agent that reduces, decreases, or otherwise blocks the expression or activity of its target, and includes any substance that can inhibit the expression or activity of a target, including, but not limited to, small molecules, antisense oligonucleotide molecules (antisense nucleic acid molecules), siRNA or shRNA, aptamers, proteins, antibodies (and fragments thereof), gene editing agents, and other substances directed against target expression or activity.

[0093] Endogenous RAG1 and / or RAG2 expression and / or function can be reduced temporarily or permanently (eg, by introducing a genetic mutation or deletion into the germline).

[0094] As used herein, the term "wild type" refers to a cell that has normal (unmodified) endogenous expression levels of genes or proteins required for V(D)J recombination. In one embodiment, the term "wild type" refers to a cell that has normal (unmodified) endogenous expression levels of RAG1 and / or RAG2 genes or proteins. A wild type cell is optionally a stem or progenitor cell.

[0095] In one embodiment of the present disclosure, endogenous RAG1 expression and / or function is reduced by at least 5%, 10%, 25%, 50%, 75% or 100% compared to wild-type cells. In another embodiment, the cells have no detectable endogenous RAG1 expression and / or function.

[0096] In another embodiment, endogenous RAG2 expression and / or function is reduced by at least 5%, 10%, 25%, 50%, 75% or 100% compared to wild-type cells, hi another embodiment, the cells have no detectable endogenous RAG2 expression and / or function.

[0097] In one embodiment, the stem or progenitor cells are pluripotent stem cells. As used herein, the term "pluripotent stem cells" refers to any stem cell that has the potential to differentiate into all cell types of the human or animal body, including non-embryonic tissues. These stem cells include both embryonic stem cells (ESCs) and induced pluripotent cells (iPSCs). Thus, cells suitable for the method of the present invention include stem cells selected from iPSCs and ESCs. In one embodiment, the pluripotent stem cells are human pluripotent stem cells (hPSCs), which include human iPSCs (hiPSCs) and human ESCs (hESCs).

[0098] As used herein, the term "embryonic stem cell" or "ESC" refers to undifferentiated embryonic stem cells that have the capacity to integrate and become part of the germline of a developing embryo.

[0099] As used herein, the term "induced pluripotent stem cells" or "iPSCs" refers to cells derived from somatic cells, such as skin or blood cells, that have been reprogrammed back to an embryonic-like pluripotent state. In one embodiment, the iPSCs are derived from T cells with known or unknown TCR specificity (e.g., T cells with a TCR with specificity for cancer).

[0100] In one embodiment, the stem or progenitor cells are hematopoietic stem or progenitor cells (HSPCs). In another embodiment, the stem or progenitor cells are CD34 + Hematopoietic progenitor cells, optionally differentiated from ESCs or iPSCs, CD34 + CD34 hemogenic endothelial progenitor cells or differentiated from ESCs or pluripotent stem cells (PSCs) + Pre-hematopoietic cells. CD34 + Various differentiation protocols for obtaining cells are known in the art. For therapeutic applications, stem or progenitor cells used to generate cells of the T cell lineage can be obtained from the patient to be treated.

[0101] Stem or progenitor cells may be obtained from any suitable source, including, but not limited to, umbilical cord blood, embryos, embryonic tissue, fetal tissue, bone marrow and blood.

[0102] Typically, a sample containing stem or progenitor cells is first depleted of non-stem or mature cells. Negative and positive selection methods known in the art can be used to enrich for stem or progenitor cells. For example, cells can be sorted based on cell surface antigens using a fluorescence activated cell sorter or magnetic beads that bind cells with certain cell surface antigens. Negative selection columns can be used to remove cells that express lineage-specific surface antigens.

[0103] In an embodiment, the sample containing stem or progenitor cells is lineage negative (Lin - ) and sequence position (Lin + ) fractions. - The fraction was CD34 + The cells can be selected.

[0104] The progenitor or stem cells may be cultured under suitable conditions to generate cells of the T or B cell lineage. Methods for culturing progenitor or stem cells to generate cells of the T or B cell lineage are known in the art.

[0105] For example, as described herein, human pluripotent stem cells can be induced to differentiate as embryoid bodies, and then CD34+ cells can be isolated by magnetic assisted cell sorting and co-cultured with OP9-DL4 cells to induce differentiation into T cells. Such protocols are described in Kennedy et al. 2012.

[0106] In one embodiment, the cells are cultured in the presence of one or more Notch ligands conjugated to a suspension support for a time sufficient to form cells of the T cell lineage.

[0107] The progenitor or stem cells can be cultured in suspension on plates or in a bioreactor, optionally a closed bioreactor or a closed automated bioreactor. A variety of bioreactors are known in the art and can include batch, fed-batch, or continuous bioreactors. An example of a continuous bioreactor is the continuous stirred tank reactor model.

[0108] Various concentrations of progenitor or stem cells in the culture are contemplated. For example, the concentration of progenitor or stem cells in the culture can be between one and several million cells per ml of medium.

[0109] One or more positive cytokines that promote the commitment and differentiation of cells of the T-cell or B-cell lineage may also be added to the culture. The cytokines may be of human origin or may be derived from other species. The concentration of the cytokines in the culture is typically about 1-10 ng / ml. The following are representative examples of cytokines that may be used in the present application to promote the commitment and differentiation of cells of the T-cell lineage: all members of the Flt-3-ligand, as well as interleukin-7 (IL-7) and stem cell factor. In one embodiment, the cytokines used herein are Flt-3-ligand and IL-7, as well as stem cell factor. The cytokines may be combined with an equimolar or greater amount of glycosaminoglycan, such as heparin sulfate. The cytokines may be commercially available or produced by recombinant DNA techniques and purified to various degrees. Some of the cytokines may be purified from the culture medium of the cell line by standard biochemical techniques.

[0110] One or more additional molecules, optionally conjugated to the suspension support, may also be added to the culture. In one embodiment, the additional molecule is a molecule that promotes T cell development (e.g., promotes the commitment and differentiation of cells of the T cell lineage), also referred to herein as a "T cell costimulatory molecule." In one example, the inventors have shown that microbeads conjugated DL4 and VCAM1 cultured with HSPCs accelerate differentiation into the T cell lineage. Thus, in one embodiment, the T cell costimulatory molecule is VCAM1. As used herein, the term "VCAM1" refers to vascular cell adhesion protein 1, also known as vascular cell adhesion molecule 1 (VCAM1) or cluster of differentiation 106 (CD106), which in humans is a protein encoded by the VCAM1 gene. The term "VCAM1" also includes mutants or variants of VCAM1. In another embodiment, the T cell costimulatory molecule is a cytokine or chemokine (stem cell factor, IL-7, CCL25 or CXCR4), major histocompatibility complex (MHC) class I or class II, or costimulatory (CD80, CD86) molecule. Optionally, the T cell costimulatory molecule comprises at least one protein tag. A variety of protein tags are known in the art and can be used for several purposes. In one embodiment, the T cell costimulatory molecule comprises an Fc tag (also known as an Fc fusion protein).

[0111] Progenitor cells and stem cells can be cultured in culture medium, including conditioned medium, non-conditioned medium, or embryonic stem cell medium. Examples of suitable conditioned medium include IMDM, DMEM, or αMEM, or equivalent medium, conditioned with embryonic fibroblasts (e.g., human embryonic fibroblasts or mouse embryonic fibroblasts). Examples of suitable non-conditioned medium include Iscove's modified Dulbecco's medium (IMDM), DMEM, or αMEM, or equivalent medium. Culture medium can contain serum (e.g., bovine serum, fetal bovine serum, calf serum, horse serum, human serum, or artificial serum substitute), or can be serum-free.

[0112] In one embodiment, the culture conditions involve culturing the progenitor or stem cells for a sufficient period of time so that the cells in the preparation form proT cells. In another embodiment, the culture conditions involve culturing the progenitor or stem cells for a sufficient period of time so that the cells in the preparation form mature T cells, e.g., mature SP T cells. It should be understood that the cells can be maintained for a suitable time required to achieve a desired cell composition. Optionally, the progenitor or stem cells are cultured for at least 6, 8, 10, 12, 14, 21, 28, 35, or 42 days.

[0113] In one embodiment, the method further comprises engineering the cell to contain a nucleic acid encoding a T cell receptor (TCR) or a chimeric antigen receptor (CAR). In another embodiment, the method further comprises engineering the cell to contain a nucleic acid encoding a T cell receptor beta chain (TCRβ).

[0114] Cells can be engineered at any point during the differentiation process to contain a nucleic acid encoding a TCR, a CAR, and / or a TCRβ. For example, in one embodiment, a stem cell or progenitor cell contains a nucleic acid encoding a TCR, a CAR, and / or a TCRβ. In another embodiment, a cell of a T cell lineage contains a nucleic acid encoding a TCR, a CAR, and / or a TCRβ. In a further embodiment, the stem cell or progenitor cell and / or the cell of a T cell lineage expresses a TCR, a CAR, and / or a TCRβ.

[0115] In one embodiment, the stem or progenitor cells, or cells of the T cell lineage, contain nucleic acid encoding only TCRβ. In other words, the stem or progenitor cells, or cells of the T cell lineage, contain nucleic acid encoding TCRβ and no nucleic acid encoding a TCR or a CAR.

[0116] In another embodiment, the stem or progenitor cells, or cells of a T cell lineage, comprise a nucleic acid encoding a TCRβ and a nucleic acid encoding a CAR, In such an embodiment, the TCRβ can direct differentiation while the CAR can provide therapeutic benefit.

[0117] In another embodiment, the method further comprises engineering a cell of the B cell lineage to express a B cell receptor (BCR), a B cell receptor beta chain (BCRβ) and / or a CAR. The cells may be engineered to contain a nucleic acid encoding a BCR, a BCRβ and / or a CAR at any point during the differentiation process. For example, in one embodiment, the stem cell or progenitor cell contains a nucleic acid encoding a BCR, a BCRβ and / or a CAR. In another embodiment, the cell of the B cell lineage contains a nucleic acid encoding a BCR, a BCRβ and / or a CAR. In a further embodiment, the stem cell or progenitor cell and / or the cell of the B cell lineage expresses a BCR, a BCRβ and / or a CAR.

[0118] Cells can be engineered by any method known in the art to contain nucleic acid encoding TCR, TCRβ, CAR, BCR or BCRβ. For example, cells can be transformed with viral or non-viral vectors carrying TCR, TCRβ, CAR, BCR or BCRβ. Examples of viral vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses and adeno-associated viruses. Examples of non-viral vectors include, but are not limited to, nude DNA, minicircle DNA vectors, liposomes, polymers and molecular conjugates.

[0119] The TCR, BCR or CAR optionally confers specificity for an antigen, such as a tumor-associated antigen, a viral antigen or a self-antigen.

[0120] "Tumor-associated antigen" refers to an antigen produced by tumor cells. Examples of tumor-associated antigens include, but are not limited to, alphafetoprotein (AFP), arsinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), WT1, and NYESO1.

[0121] A "viral antigen" is an antigen that is encoded by the viral genome. Examples of viral antigens include, but are not limited to, EBV, CMV, HIV, and SARS viral antigens.

[0122] " Self-antigen " is an antigen produced by a subject. Self-antigen can be a tumor-associated antigen. The T cell expressing TCR or CAR that confers specificity to self-antigen can be used, for example, to generate regulatory T cell that blocks self-reactive T cell.

[0123] II. Pluripotent stem cells As described herein, the inventors generated a RAG2-deficient (RAG2-KO) human pluripotent stem cell (hPSC) line.

[0124] Thus, the disclosure also provides an isolated stem or progenitor cell, in which expression of at least one gene or protein required for V(D)J recombination, optionally RAG1 and / or RAG2, in the stem or progenitor cell is reduced or eliminated compared to a wild-type stem or progenitor cell. Optionally, the stem or progenitor cell is a human cell.

[0125] In one embodiment, the stem cells are pluripotent stem cells.

[0126] In another embodiment, the pluripotent stem cells are embryonic stem cells or induced pluripotent stem cells (iPSCs).

[0127] Reducing or eliminating the expression and / or function of RAG1 or RAG2 can be accomplished by any one of several methods known in the art.

[0128] In one embodiment, the stem or progenitor cells comprise mutated or deleted RAG1 and / or RAG2 gene sequences. For example, an insertion or deletion in the RAG1 and / or RAG2 gene sequence can cause a frameshift mutation, resulting in a gene knockout (i.e., lack of expression of a functional gene product).

[0129] In one embodiment of the present disclosure, endogenous RAG1 expression and / or function is reduced by at least 5%, 10%, 25%, 50%, 75% or 100% in stem or progenitor cells compared to wild-type cells. In another embodiment, the cells have no detectable endogenous RAG1 expression and / or function.

[0130] In another embodiment, endogenous RAG2 expression and / or function is reduced by at least 5%, 10%, 25%, 50%, 75% or 100% in stem or progenitor cells compared to wild-type cells, hi another embodiment, the cells have no detectable endogenous RAG2 expression and / or function.

[0131] In addition, in one embodiment, the stem or progenitor cells further comprise a nucleic acid encoding a TCR, a CAR, a TCRβ, a BCR, or a BCRβ. In another embodiment, the stem or progenitor cells express a TCR, a CAR, a TCRβ, a BCR, or a BCRβ.

[0132] In a further embodiment, the stem or progenitor cells comprise nucleic acid encoding TCRβ and do not comprise nucleic acid encoding a TCR or a CAR.

[0133] IV. Cells of the T-cell or B-cell lineage The disclosure further provides cells of the T cell or B cell lineage, or mitotic or differentiated cells progeny thereof, produced by the methods, systems and kits described herein.

[0134] In one embodiment, the disclosure provides "progenitor T cells" or "pro T cells" generated by the methods described herein. In another embodiment, the progenitor T cells are human progenitor T cells, e.g., human progenitor T cells characterized as CD34+CD7+, CD7+CD5+CD1a-, or CD45+CD34+CD7+.

[0135] The disclosure also provides double positive (DP) T cells characterized as CD4+CD8+ or CD4+CD8+CD3+. The disclosure further provides cells of the T cell lineage that are single positive (SP) cells characterized as CD4-CD8+, CD4+CD8- or CD8+CD3+, CD4+CD3+.

[0136] In one embodiment, the cell of the T cell lineage further comprises a nucleic acid encoding a TCR, a CAR or a TCRβ. In another embodiment, the cell of the T cell lineage expresses a TCR, a CAR or a TCRβ.

[0137] In a further embodiment, the cells of the T cell lineage comprise nucleic acid encoding TCRβ and do not comprise nucleic acid encoding a TCR or a CAR.

[0138] In another embodiment, cells of the T cell lineage (e.g., precursor T cells or mature T cells) generated by the methods described herein are engineered with a T cell receptor (TCR) or chimeric antigen receptor (CAR) that confers specificity for an antigen.

[0139] The antigen is optionally a tumor-associated antigen (TAA), a viral antigen, or an autoantigen. T cells engineered to express a TCR or CAR to confer specificity to a TAA may be useful for treating conditions such as cancer.

[0140] Similarly, in another embodiment, the cell of the B cell lineage further comprises a nucleic acid encoding a CAR, a TCRβ, a BCR, or a BCRβ. In another embodiment, the cell of the B cell lineage expresses a CAR, a BCR, or a BCRβ.

[0141] In another embodiment, cells of the B cell lineage generated by the methods described herein are engineered with a B cell receptor (BCR) or chimeric antigen receptor (CAR) that confers specificity for an antigen.

[0142] The antigen is optionally a tumor-associated antigen (TAA), a viral antigen, or an autoantigen. T cells engineered to express a BCR or CAR to confer specificity to a TAA may be useful for treating conditions such as cancer.

[0143] In another aspect, the disclosure provides a pharmaceutical composition comprising an isolated stem or progenitor cell, or a cell of T or B cell lineage produced by the methods described herein, and a pharma- ceutically acceptable diluent or carrier.

[0144] Suitable diluents and carriers are described, for example, in Remington's Pharmaceutical Sciences. Based thereon, compositions include, but are not limited to, a solution of proT cells associated with one or more pharma- ceutically acceptable vehicles or diluents, contained in a buffer solution having a suitable pH and isotonic with physiological fluids.

[0145] Pharmaceutical compositions include, but are not limited to, lyophilized powders, or aqueous or non-aqueous sterile injection solutions or suspensions, which may further contain antioxidants, buffers, bacteriostats, and solutes that render the composition substantially compatible with the tissues or blood of the intended recipient. Other components that may be present in such compositions include, for example, water, surfactants (such as Tween™), alcohols, polyols, glycerin, and vegetable oils. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. Compositions may be supplied, for example, but not limited to, as lyophilized powders that are reconstituted with sterile water or saline prior to administration to a patient.

[0146] The pharmaceutical composition also includes a cryopreservation solution. In one embodiment, the cells of the T cell lineage generated by the methods described herein are cryopreserved in an appropriate medium, e.g., a pharma- ceutically acceptable medium or a GMP-grade medium, and optionally formulated for administration to a subject in need thereof.

[0147] Suitable pharmaceutically acceptable carriers include essentially chemically inert and non-toxic compositions that do not interfere with the effectiveness of the biological activity of pharmaceutical compositions. Examples of suitable pharmaceutical carriers include, but are not limited to, water, saline, glycerol solution, ethanol, N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), dioleylphosphotidyl-ethanolamine (DOPE), and liposomes. Such compositions should contain a therapeutically effective amount of compound together with a suitable amount of carrier to provide a form for direct administration to a patient.

[0148] The composition can be administered, for example, parenterally, intravenously, subcutaneously, intramuscularly, intracranially, intraorbitally, intraocularly, intraventricularly, intracapsularly, intraspinally, intracisternally, intraperitoneally, intranasally, by aerosol or oral administration. For parenteral administration, a solution of the pro-T cells described herein can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO and mixtures thereof, with or without alcohol, and in oils. These preparations contain preservatives to prevent the growth of microorganisms under normal storage and use conditions. Those skilled in the art will know how to prepare suitable formulations.

[0149] Preferably, the cells of the T cell lineage or B cell lineage are present in an amount effective to treat a condition in a subject in need thereof. In one embodiment, the cells of the T cell lineage are present in an amount effective to enhance hematopoietic progenitor cell engraftment in a subject in need thereof. Optionally, the composition further comprises cells of the T cell lineage or a tissue for transplantation. In one embodiment, the tissue comprises the thymus. In another embodiment, the tissue comprises an organ.

[0150] III. Kit The stem or progenitor cells described herein may be prepared and packaged into kits for use in generating cells of the T cell lineage or cells of the B cell lineage.

[0151] Accordingly, also provided herein are kits for producing cells of a T cell lineage or cells of a B cell lineage, comprising stem or progenitor cells, wherein expression of RAG1 and / or RAG2 in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells.

[0152] In one embodiment, the kit further comprises a culture medium for culturing the sample containing stem or progenitor cells to produce cells of T cell lineage or cells of B cell lineage. Examples of culture medium include conditioned medium, non-conditioned medium or embryonic stem cell medium. The culture medium may contain serum (e.g., bovine serum, fetal bovine serum, calf serum, horse serum, human serum or artificial serum substitute) or may be serum-free.

[0153] In another embodiment, the kit further comprises one or more additional molecules. In one embodiment, the additional molecule is a molecule that promotes T cell development (e.g., promotes commitment and differentiation of cells of the T cell lineage), also referred to herein as a "T cell costimulatory molecule." In another embodiment, the T cell costimulatory molecule is VCAM1.

[0154] The medium optionally contains one or more cytokines that promote the commitment and differentiation of cells of the T cell lineage or cells of the B cell lineage. The cytokines may be of human origin or may be derived from other species. The concentration of the cytokines in the culture is typically about 1-10 ng / ml. The following are representative examples of cytokines that may be used in the present application: all members of the Flt-3-ligand, as well as interleukin-7 (IL-7) and stem cell factor. In one embodiment, the cytokines used herein are Flt-3 ligand and IL-7, as well as stem cell factor. The cytokines may be combined with an equimolar or greater amount of glycosaminoglycan, such as heparin sulfate. The cytokines may be commercially available or produced by recombinant DNA techniques and purified to various degrees. Some of the cytokines may be purified from the culture medium of the cell line by standard biochemical techniques.

[0155] In one embodiment, the kit comprises one or more containers for the reagents described herein.

[0156] In various embodiments, printed instructions providing guidance in the use of the reagent(s) may also be included in the kit. The term "instructions" or "instructions for use" typically includes tangible representations describing the cells, culture periods, temperatures, media conditions, etc. For example, in one embodiment, the instructions describe a method including culturing a sample containing stem or progenitor cells.

[0157] V. Therapeutic uses T cells and B cells engineered to recognize specific antigens have broad therapeutic applications.

[0158] Accordingly, the present disclosure provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of the cells or progenitor cells to a subject in need thereof;

[0159] Methods are provided in which stem or progenitor cells are engineered to contain at least one of nucleic acids encoding a T cell receptor (TCR), a chimeric antigen receptor (CAR), or a B cell receptor (BCR) that confers specificity for an antigen.

[0160] The present disclosure also provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of RAG1 and / or RAG2 in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of a cell of the T cell lineage to a subject in need thereof; Methods are provided in which cells of the T cell lineage are engineered with a T cell receptor (TCR) or a chimeric antigen receptor (CAR) to confer specificity for an antigen.

[0161] The present disclosure also provides for the use of a cell of the T cell lineage generated by the methods described herein for treating a disease or condition in a subject, where the cell of the T cell lineage is engineered with a T cell receptor (TCR) or a chimeric antigen receptor (CAR) that confers specificity to an antigen. The present disclosure further provides for the use of a cell of the T cell lineage generated by the methods described herein for the preparation of a medicament for treating a disease or condition in a subject, where the cell of the T cell lineage is engineered with a T cell receptor (TCR) or a chimeric antigen receptor (CAR) that confers specificity to an antigen.

[0162] The disclosure also provides a cell of a T cell lineage produced by the methods described herein, for use in treating a disease or condition in a subject, wherein the cell of the T cell lineage is engineered with a T cell receptor (TCR) or a chimeric antigen receptor (CAR) that confers specificity for an antigen.

[0163] The present disclosure also provides a method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells and isolating cells of a B cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in the stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of cells of the B cell lineage to a subject in need thereof;

[0164] Methods are provided in which cells of the B cell lineage are engineered with at least one B cell receptor (TCR) to confer specificity for an antigen.

[0165] The present disclosure also provides for the use of a cell of the B cell lineage generated by the methods described herein for treating a disease or condition in a subject, wherein the cell of the B cell lineage is engineered with a B cell receptor (BCR) or CAR that confers specificity to an antigen. The present disclosure further provides for the use of a cell of the B cell lineage generated by the methods described herein for the preparation of a medicament for treating a disease or condition in a subject, wherein the cell of the B cell lineage is engineered with a B cell receptor (BCR) or CAR that confers specificity to an antigen.

[0166] The present disclosure also provides a cell of a B cell lineage produced by the methods described herein, for use in treating a disease or condition in a subject, wherein the cell of the B cell lineage is engineered with a B cell receptor (BCR) or CAR that confers specificity for an antigen.

[0167] The antigen is optionally a tumor-associated antigen (TAA), a viral antigen, or an autoantigen. In one embodiment, the antigen is a TAA and the disease is cancer.

[0168] As used herein, the phrase "effective amount" or "therapeutically effective amount" refers to an amount effective at the dosage and duration necessary to achieve the desired result. The effective amount may vary depending on factors such as the subject's condition, age, sex, weight, etc. The amount of a given cell preparation that corresponds to such an amount varies depending on a variety of factors, such as the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated, etc., but can nevertheless be routinely determined by one of skill in the art. Preferably, the "effective amount" is an amount effective for cells of the T cell lineage to engraft in the subject being treated.

[0169] As used herein, and as is well understood in the art, the term "treat" or "treatment" refers to an approach to obtain beneficial or desired results, including clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, whether detectable or undetectable, reduction in the extent of disease, stable (i.e., not worsening) state of disease, prevention of disease spread, delay or slowing of disease progression, improvement or palliation of symptoms, reduction in recurrence of disease, and remission (either partial or complete). "Treat" and "treatment" also mean prolonging survival compared to expected survival in the absence of treatment. As used herein, "treating" and "treatment" also include prophylactic treatment.

[0170] As used herein, the term "subject" means any member of the animal kingdom, preferably a human.

[0171] The following non-limiting examples are illustrative of the present application. EXAMPLES

[0172] Example 1 Materials and Methods: Maintenance of hESCs. Human ESCs (H1; WiCell Research Institute, Madison, WI) were maintained and expanded on Matrigel (Corning, NY, USA)-coated plates in TeSR-E8 medium (STEMCELL Technologies, Vancouver, Canada). Cells were passaged by non-enzymatic dissociation using 0.5 mM EDTA.

[0173] Generation of RAG2-KO hESCs. The pD1321-GFP expression vector, which contains a cassette of GFP, Cas9 endonuclease, CRISPR chimeric cDNA, and a gRNA portion designed to target RAG2 [GGTTATGCTTTACATCCAGA (SEQ ID NO: 1)], was custom synthesized (DNA2.0). After transfection with Lipofectamine 3000 (Life Technologies, Carlsbad, CA), GFP was detected using flow cytometry. + hESCs were sorted. Individual clones were picked, expanded, and aliquots were collected for purification of genomic DNA using a genomic DNA kit (Invitrogen). Mutations (indels) were verified by sequencing the products of PCR amplification of the regions flanking the target site. RAG2 KO clone 1 showed a 1 bp deletion in one allele and a 16 bp deletion in the other allele, while clone 4 showed an 11 bp deletion in one allele and a 23 bp deletion in the other allele.

[0174] Western blot analysis. Briefly, cell lysates were prepared by incubating cells in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40, 2 mM EDTA) containing protease inhibitor cocktail (Roche) for 20 min at 4 °C, followed by centrifugation at 14000 × g for 15 min at 4 °C. Proteins were separated by SDS-PAGE, transferred onto PVDF membranes (Millipore, Louis, MO) and probed with anti-RAG2 antibody (Abcam-Ab95955; 1:1000 dilution) overnight at 4 °C, followed by incubation with secondary antibody. The anti-RAG2 antibody used was a rabbit polyclonal raised against a recombinant fragment corresponding to amino acids 271-519 of human RAG2 (Abcam), which is well beyond the gRNA target site. Immunoreactive bands were visualized using Western Blotting Luminol Reagent (Thermo). PBMC from T-ALL patients were used as a positive control (Bories et al, 1991).

[0175] Immunostaining. Cells were fixed with 4% paraformaldehyde, permeabilized and blocked with 5% NGS (Abcam, Cambridge, USA) and 1% Triton X-100 (Sigma-Aldrich, Louis, MO) in PBS for 30 min. Cells were stained and analyzed as previously described (Li et al., 2017).

[0176] Teratoma formation. All animal studies were approved by the Ethics Committee of Experimental Research of Peking University and followed the International Animal Care and Use Committee Guidelines. Six to eight week old non-obese diabetic (NOD) / SCID mice were treated with 1 × 10 7 hESCs were injected subcutaneously and allowed to form teratomas for 8 weeks. Histological analysis was performed as previously described (Li et al., 2017).

[0177] hPSC Differentiation and CD34 + Isolation. hPSCs, H1 embryonic stem cells (ESCs) were differentiated as previously described (Kennedy et al., 2012). After 8 days of differentiation, embryoid bodies were harvested, dissociated into single cells using collagenase type IV and trypsin-EDTA as previously described (Kennedy et al., 2012), and positively selected using an anti-CD34 PE-conjugated antibody (BD Biosciences) and a MACS column (Miltenyi Biotec) containing anti-PE microbeads. Cell yield and purity of positive selection were assessed pre- and post-MAC by flow cytometry.

[0178] OP9-DL4-7FS co-culture and differentiation. OP9-DL4 cells expressing hIL-7, hFLT3-L and hSCF (7FS) were generated and grown at 37°C, 5% CO2 in α-MEM containing 10-20% FBS (Gibco), 1% Pen-Strep (Life Technologies) and phospho-ascorbic acid (Sigma-Aldrich). For co-culture, OP9-DL4-7FS cells were plated in 6-well plates the day before. MACS-purified CD34 + Count the cells and culture 5–20 x 10 cells per 6-well plate. 4 Cells were seeded at a density of 1000 x 1000 and differentiated by co-culturing with OP9-DL4-7FS cells in OP9 medium at 37°C and 5% CO2, and cells were passaged and co-cultured with fresh OP9-DL4-7FS cells approximately every 5 days.

[0179] Retroviral transduction. PG13 cell lines stably expressing empty vector dTomato, TCRα-dTomato or TCRβ-dTomato were grown to 70% confluence, at which point the medium was switched to α-MEM with 15% FBS and 1% Pen-Strep and the supernatants were conditioned for 48 h before transducing OP9-DL4-7FS / T cell cultures. On D8+24 of OP9-DL4-7FS / T cell cultures, the corresponding PG13 supernatants were transduced once a day with 1 μl / ml polybrene and centrifuged at 2000xg for 90 min at room temperature for 4 days (2–3 × 10 per 2 ml of supernatant). 6 The cells were left undisturbed for 3 days and then incubated with dTomato. + CD7 + CD5 + CD4 + CD8 + Sorted cells were placed into OP9-DL4-7FS co-cultures for up to 10 days.

[0180] Flow cytometry. Cells were stained with the following mouse anti-human antibodies for 30 min on ice: CD3-BrilliantViolet421, CD4-AlexaFluor700, CD8β-PE, CD31-FITC, CD34-PE, CD45RA-PE / CF594, TCRgd-FITC (BD Biosciences), CD5-PE / Cy7, CD7-AlexaFluor700, CD45-APC / eFluor780, TCRab-APC (eBiosciences), CD8α-PE / Dazzle, CD38-BrilliantViolet421 (BioLegend). Cells were resuspended in flow cytometry buffer containing DAPI and data were collected using an LSR Fortessa flow cytometer (BD Biosciences) and analyzed using FlowJo version 9.7.6. For intracellular staining, cells were fixed and permeabilized using a fixation / permeabilization kit with GolgiPlug™ (BD Biosciences) according to the manufacturer's instructions.

[0181] Control and RAG2-KO in vitro derived CD4 + CD8 + RNA-Seq analysis of cells. Cells were collected on days 24–28 of coculture and stained with fluorochrome-conjugated antibodies against CD45, CD7 (eBioscience), CD5, CD4, CD8 (BD Biosciences), and DAPI using a FACSVantage Diva or FACSAria cell sorter (BD Biosciences). + CD8 + Sorted cell populations were sorted into populations. Total RNA was extracted from the sorted cell populations using TRIzol. Purified RNA was subjected to RNA sequencing using an Illumina Novaseq 6000. Library preparation was performed using the Illumina TruSeq Strandard Total RNA Sample Preparation kit. Sequencing was performed using a 100-cycle paired read protocol and multiplexing, yielding approximately 40 million reads / sample. Samples were aligned to GRCh38 using HISAT2. Read counts were calculated using HTSeq. Differential gene expression analysis was performed using the edgeR package in the R platform.

[0182] Statistical analysis. Data and error bars are presented as the mean ± standard error of the mean. To determine statistical significance, one-way ANOVA (comparing three means) was performed using Prism version 6. Statistical significance was determined as *P<0.05 and **P<0.01.

[0183] Data availability. Raw and processed RNA-Seq data are available from the Gene Expression Omnibus, accession number GSE164276 (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE164276).

[0184] Results and Discussion Generation and characterization of RAG2-KO hPSC lines. To assess the role of RAG2 in human T cell development, CRISPR-Cas9 gene editing was used to target exon 3 of the RAG2 gene (Figure 1A). hPSCs were transfected with a plasmid encoding RAG2-targeting guide RNA, Cas9 enzyme, and green fluorescent protein (GFP). Transfected GFP + hPSCs were single-cell sorted and cultured. After expansion of individual clones, two clones containing unique insertion-deletion containing biallelic mutations (KO-1 and KO-4) were identified (Figure 1A). To assess the effect of RAG2 mutations on protein expression, Western blot analysis was performed and confirmed the absence of detectable RAG2 protein in both KO-1 and -4 derived T lineage cells (Figure 1B).

[0185] To assess whether RAG2-KO hPSCs maintained pluripotency, expression of key markers and formation of teratomas were assessed. Immunofluorescence staining showed that RAG2-KO hPSCs expressed OCT4, NANOG, SOX2 and SSEA-4 (Figure 1C). To functionally test pluripotency, RAG2-KO hPSCs were injected into immunodeficient mice and histological analysis revealed the formation of RAG2-KO teratomas with all three germ layers (Figure 1D), indicating that RAG2-KO hPSCs retained key features of pluripotency. To determine the ability of RAG2-KO hESCs to generate hematopoietic progenitors, CD34 expression was analyzed after 8 days of embryoid body differentiation culture (Kennedy et al, 2012). Control WT, RAG2-KO-1 and -4 hPSCs expressed similar frequencies of blood endothelial CD34 + This results in cells that can be further enriched by magnetic assisted cell sorting (MACS) (Figure IE).

[0186] T cell development from RAG2-KO hPSCs. CD34 +Hemogenic endothelial cells were MACS-enriched and cultured with OP9-DL4 cells, expressing human IL-7, FLT3 ligand and stem cell factor (7FS) to induce T cell differentiation. After 10 days of culture, control WT, RAG2-KO-1 and -4 cells progressed along the T cell lineage as indicated by expression of both CD7 and CD5 (Figure 2A). All three groups had progressed to CD4 by day 15. + They reached the intermediate single positive (ISP) stage and showed intracellular CD3 expression by day 20 (Figure 2A). After 24 days of culture, the majority of cells from the control WT, RAG2-KO-1 and -4 groups were CD7 + CD5 + Notably, after 29–34 days of culture, control WT, RAG2-KO-1, and -4 cells all expressed CD4 + CD8 + As expected, however, only the control WT cells showed intracellular TCRβ expression and cell surface CD3 / TCRβ expression (Fig. 2A). These results suggest that RAG2-deficient human T cell progenitors express CD4 + CD8 + It is shown that they can differentiate up to the DP stage.

[0187] To determine cell survival and expansion, total cellularity was quantified from control WT, RAG2-KO-1 and -4 developed T cells. After 20 days of culture, all three samples showed similar cell numbers (Figure 2B). However, after 40 days of culture, control WT lineage cells further increased their survival and expansion, by this time having approximately 10-fold more cellularity, in contrast to RAG2-KO-1 and -4 T lineage cells (Figure 2B).

[0188] RAG2-KO CD4 + CD8 + Forced expression of TCRβ chain in DP. RAG2-KO hPSC-derived CD34 +Cells were cultured on OP9-DL4-7FS cells for 24 days, and DP cells were retrovirally transduced with empty vector (dTomato), rearranged TCR α chain (TRA 1383i), or rearranged TCR β chain (TRB 1383i) (Figure 3A). Transduced RAG-KO cells were cultured on OP9-DL4-7FS cells for 24 days, and DP cells were retrovirally transduced with empty vector (dTomato), rearranged TCR α chain (TRA 1383i), or rearranged TCR β chain (TRB 1383i) (Figure 3A). + CD5 + CD4 + CD8 + DP cells were sorted and transferred back onto OP9-DL4-7FS cells for an additional 10 days and assessed for cell survival and expansion (Figure 3A). Both dTomato- and TCRα-transduced DPs showed similar cell numbers after 10 days of culture (Figure 3B). However, TCRβ-transduced DPs showed significantly higher cell numbers after 10 days of culture compared to dTomato- and TCRα-transduced DPs (Figure 3B). Without being bound by theory, this suggests that expression of rearranged TCRβ chains, as opposed to TCRα chains, promotes cell survival and / or expansion of developing human T cells at the DP stage.

[0189] Control WT, RAG2-KO and RAG2-KO TCRβ-transduced CD4 + CD8 +Transcriptome analysis of DP cells. Control WT, RAG2-KO control transduced and RAG2-KO TCRβ transduced DP cells were selected for RNA sequencing (RNA-Seq) analysis. With the obvious exception of several TCR genes, including the 1383i TCRβ used for transduction and several TCRα genes, control WT DP cells expressed a large set of TCRα, TCRβ, TCRγ and TCRδ genes that were absent in RAG2-KO control transduced and RAG-KO TCRβ transduced DP cells, likely the result of germline transcripts induced by β selection signals, as seen in mice (Villey et al., 1997) (Table 1 and Figure 4A). Furthermore, expression of genes from RAG2-KO control and TCRβ transduced DP cells was compared to that of umbilical cord blood (UCB) hematopoietic stem cell-derived DP cells for a set of DP-associated signature genes (Casero et al., 2015) (Table 1). This analysis revealed that TCRβ-transduced RAG2-KO DP cells acquired expression of a set of genes that were present in UCB-derived DP cells, including RORC, that are induced after β-selection in mice (He 2000) (Fig. 4B).

[0190] Differential expression gene analysis was performed to determine the genes upregulated in control WT compared to RAG2-KO (KO-1 and KO-4) DP cells and vice versa. Genes significantly upregulated in control WT compared to both RAG2-KO-1 and RAG2-KO-4 included CCDC152, GPR183, IL32, and MAL (Table 1 and Figure 5A). Genes significantly upregulated (p<0.05) in control WT compared to RAG2-KO-1 or -4 included ADAMTS17, IL1RL1, PLXNA2, and TEAD1, or CTSW, IKBKG, IL21R, and IL4R, respectively (Table 1 and Figure 5A). Notably, many of these genes (such as TEAD1, IKBKG, and IL32) were also highly expressed in TCRβ-transduced RAG2-KO DP cells similar to control WT DP cells (Figure 5A). Interestingly, the expression of a subset of genes (e.g., MAL) was not rescued by forced expression of TCRβ chain (Figure 5A). Genes that were significantly upregulated in both RAG2-KO-1 and RAG2-KO-4 compared to control WT include HBG1, HBG2, LOC100240735, and LOC339975 (Table 1 and Figure 5B). Genes that were significantly upregulated in RAG2-KO-1 or -4 compared to control WT include CCDC8, CPA4, EPHA4, and ID1, or ANKRD1, CMTM8, MET, and RHOU, respectively (Table 1 and Figure 5B). Notably, many of these genes (e.g., ID1, RHOU, and HBG1) showed low expression in TCRβ-transduced RAG2-KO DP cells similar to control WT DP cells (Figure 5B). Interestingly, expression of a subset of genes (e.g., LOC100240735) was not reduced by forced expression of the TCRβ chain (Figure 5B). Phylogenetic tree analysis again showed that TCRβ-transduced RAG2-KO DP cells were more similar to control WT DP cells than to control-transduced RAG2-KO DP cells (Figure 5).

[0191] Analysis of cell cycle regulators, survival and differentiation genes known to be involved in mouse β selection (Lefebvre et al., 2005; Klein et al., 2019; Sicinska et al., 2003) revealed a set of genes, such as RORC, CD27, ERG and CCDN3, that were also regulated after TCRβ expression in RAG2-KO DPs (Figure 6A). Gene ontology analysis to determine biological pathways involving genes upregulated in control WT compared to RAG2-KO DP cells revealed a gene program involved in “negative regulation of the intrinsic apoptosis signaling pathway” (Figure 6B). Furthermore, gene set pathways related to leukocyte regulation included genes involved in “positive regulation of lymphocyte activation” and “regulation of lymphocyte proliferation” (Figure 6B). Thus, these data provide further evidence that RAG2-dependent TCRβ expression in developing human T cells supports their survival and / or proliferation. [Summary of the Invention]

[0192] We generated RAG2-KO hPSCs to assess the role of TCRβ during human T cell development. In contrast to the effects seen in Rag1- or Rag2-deficient mice, which show a complete lack of DP thymocytes, developing human T cells express CD4 + CD8 + The absence of RAG1 / 2 in mice indicates that RAG1 / 2-mediated TCRβ rearrangement is essential for the transfer of DN3 to CD44 - CD25 - CD44 has been well documented to regulate the transition to the DN4 and DP stages. - CD25 + resulting in a definitive block at the DN3 stage (von Boehmer et al., 1999; Michie and Zuniga-Pflucker, 2002). However, the precise developmental block in the absence of RAG1 / 2 expression or TCRβ rearrangement during human T cell development has remained largely unresolved (Rothenberg and Taghon, 2005; Carrasco et al., 2002).

[0193] The requirement for TCRβ-induced survival / proliferation, or β-selection, is mediated by CD4+, in which 5% of cells express the cell surface TCRβ protein. + It has previously been suggested that this occurs at the ISP stage (Blom et al., 1999). Another study instead showed that 25% of cells express the intracellular TCRβ protein, which is CD4 + CD8α + CD8β - It has been suggested that β-selection occurs later at the early double-positive (EDP) stage (Carrasco et al., 1999). Therefore, based on these two studies, it is possible that β-selection occurs in CD4 + It was proposed that the development of TCRβ begins at the ISP stage and continues until the EDP stage. Here, robust development past the ISP and EDP to the DP stage was detected, as expression of CD4, CD8α and CD8β was observed in RAG2-KO developmental T cells. Although the requirement for the TCRβ chain in phenotypic differentiation to the DP stage differs between mouse and human, the TCRβ chain promotes cell expansion (survival / proliferation) similarly in both mouse and human developmental T cells, as enforced TCRβ expression rescued cell expansion. Without being bound by theory, the requirement for TCRβ, and therefore preTCR, during, but not before, the DP stage during human T cell development may reflect differential expression of cell cycle and survival genes. In mice, expression of preTCR in DN3 cells leads to expression of Bmi-1, which suppresses expression of the cell cycle inhibitor Cdkn2a. Suppression of Cdkn2a is required for preTCR-induced cell proliferation and DN3-DP transition (Miyazaki et al, 2008). In summary, this study reveals unexpected timing required for TCRβ-mediated β selection in developing human T cells.

[0194] Example 2 RAG2-KO CD4 + CD8 + Forced expression of TCRαβ and TCRγδ chains in DP RAG2-KO hPSC-derived CD34 +Cells were cultured on OP9-DL4-7FS cells for 21 days, and DP cells were retrovirally transduced with empty vector (dTomato), rearranged TCR αβ chain (1383i-TCR) (Roszkowski et al., 2003) or rearranged TCR γδ chain (3C2-TCR) (Benveniste et al., 2018) (Figure 7). Transduced RAG-KO cells were cultured on OP9-DL4-7FS cells for 21 days, and DP cells were retrovirally transduced with empty vector (dTomato), rearranged TCR αβ chain (1383i-TCR) (Roszkowski et al., 2003) or rearranged TCR γδ chain (3C2-TCR) (Benveniste et al., 2018) (Figure 7). + CD5 + CD4 + CD8 + DP cells were sorted and transferred back onto OP9-DL4-7FS cells for an additional 4 and 10 days to assess cell survival and expansion (Figure 7A). TCRαβ- and TCRγδ-transduced DPs showed higher cell numbers after 4 and 10 days compared to dTomato-transduced DPs (Figure 7A), with TCRαβ-transduced cells showing a much higher fold expansion than TCRγδ-transduced cells, similar to that seen with TCRβ-transduced DP cells (Figure 3). Without being bound by theory, this suggests that expression of rearranged TCRαβ or TCRγδ chains, similar to TCRβ chains alone (preTCR, pTα / TCRβ), promotes cell survival and / or proliferation of developing human T cells at the DP stage. In addition, flow cytometry analysis of TCR-transduced RAG2-KO DP cells shows expression of the corresponding αβ and γδ TCRs, respectively, on the cell surface of T lineage cells (Figure 7B). These results indicate that developmental T cells derived from in vitro differentiated RAG2-deficient PSCs can be transduced to efficiently express either γδ or αβ TCRs.

[0195] Example 3 CRISPR-Cas9 gene editing is used to target each of the following genes: Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1, also known as Cernunnos or XRCC4-like factor (XLF)), paralogues of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

[0196] hPSCs are transfected with plasmids encoding gene-targeting guide RNA, Cas9 enzyme, and green fluorescent protein (GFP). + hPSCs are single-cell sorted and cultured.

[0197] To assess whether the various KO hPSCs maintained pluripotency, expression of key markers and teratoma formation were assessed. Immunofluorescence staining shows that KO hPSCs express OCT4, NANOG, SOX2, and SSEA-4.

[0198] To functionally test pluripotency, KO hPSCs were injected into immunodeficient mice and histological analysis revealed the formation of KO teratomas with all three germ layers, indicating that KO hPSCs retained key features of pluripotency. To determine the ability of KO hESCs to generate hematopoietic progenitors, CD34 expression is analyzed after 8 days of embryoid body differentiation culture (Kennedy et al., 2012). Control WT and KO hPSCs expressed similar frequencies of blood endothelial CD34 + The cells are produced.

[0199] T cell development from CD34 KO hPSCs. + Hemogenic endothelial cells were MACS enriched and cultured with OP9-DL4 cells, expressing human IL-7, FLT3 ligand and stem cell factor (7FS) to induce T cell differentiation. After 10 days of culture, control WT and KO cells progress along the T cell lineage as indicated by expression of both CD7 and CD5. All three groups express CD4 by day 15. + They reach the intermediate single positive (ISP) stage and show intracellular CD3 expression by day 20. After 24 days of culture, the majority of cells from the control WT and KO groups express CD7 + CD5 + After 29–34 days of culture, all control WT and KO cells were CD4 + CD8 + Reach the DP stage.

[0200] Total cellularity is quantified from control WT and KO developed T cells to determine cell survival and expansion. After 20 days of culture, all three samples show similar cell numbers.

[0201] KO CD4 + CD8 + Forced expression of TCRβ chain in DP. KO hPSC-derived CD34 + Cells are cultured on OP9-DL4-7FS cells for 24 days, and DP cells are retrovirally transduced with empty vector (dTomato), rearranged TCR α chain (TRA 1383i) or rearranged TCR β chain (TRB 1383i). Transduced KO cells are expressed as CD7 + CD5 + CD4 + CD8 + DP cells are sorted and transferred back onto OP9-DL4-7FS cells for an additional 10 days to assess cell survival and expansion. Both dTomato- and TCRα-transduced DPs show similar cell numbers after 10 days of culture. However, TCRβ-transduced DPs show significantly higher cell numbers after 10 days of culture compared to dTomato- and TCRα-transduced DPs.

[0202] Example 4 Generation of KO SP T cells Generation of KO SP T cells. KO hPSCs engineered with one or more of a rearranged TCR β chain (TRB 1383i), CAR or TCR are differentiated into CD34+ cells and then CD4+CD8+ DP cells as described above or without stromal cells (see, e.g., WO2019157597A1, the contents of which are incorporated by reference in their entirety). The generated CD4+CD8+ DP cells are further differentiated into CD4-CD8+ SP and / or CD8-CD4+ SP T cells. TCRβ engineered KO DP cells are more successful in progressing to SP T cells compared to KO only cells. [Table 1] TIFF2024515697000003.tif175159

Table 2

Table 3

Claims

1. 1. A method for generating stem or progenitor cells that are incapable of undergoing T cell receptor (TCR) gene rearrangement (TCR), comprising: (a) culturing a sample comprising stem or progenitor cells, The method, wherein expression of at least one gene or protein required for V(D)J recombination in the stem cell or progenitor cell is reduced or eliminated compared to wild-type stem cell or progenitor cell.

2. The method of claim 1, wherein the method further comprises (b) isolating cells of a T cell lineage.

3. 3. The method of claim 1 or 2, wherein the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

4. 3. The method of claim 1 or 2, wherein the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), paralogues of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

5. The method of claim 1 or 2, wherein the stem cells are pluripotent stem cells.

6. The method of claim 5, wherein the pluripotent stem cells are embryonic stem cells or induced pluripotent stem cells (iPSCs).

7. The method of claim 1 or 2, wherein the stem cells or progenitor cells are human cells.

8. The method of claim 1 or 2, wherein the cell of the T cell lineage is a precursor T (proT) cell.

9. 3. The method of claim 1 or 2, wherein the cells of the T cell lineage are CD4+CD8+ double positive cells or CD4+CD8+CD3+ double positive cells.

10. 3. The method of claim 1 or 2, wherein the cells of the T cell lineage are CD8+CD3+ single positive cells or CD4+CD3+ single positive cells.

11. 3. The method of claim 1 or 2, further comprising engineering the stem or progenitor cells, or the cells of the T cell lineage to contain at least one of nucleic acids encoding a T cell receptor (TCR), a TCR beta chain, and a chimeric antigen receptor (CAR).

12. 12. The method of claim 11, wherein the stem or progenitor cells, or the cells of the T cell lineage, express the at least one of the T cell receptor (TCR), the TCR β chain, and the chimeric antigen receptor (CAR).

13. 3. The method of claim 1 or 2, further comprising engineering the stem or progenitor cells, or the cells of the T cell lineage, to contain nucleic acid encoding a TCR β chain.

14. 14. The method of claim 13, wherein the stem or progenitor cells, or the cells of the T cell lineage further comprise a nucleic acid encoding a CAR.

15. 12. The method of claim 11, wherein the TCR or CAR confers specificity to an antigen, optionally a tumor-associated antigen, a viral antigen, or an autoantigen.

16. A cell of the T cell lineage produced by the method of claim 1 or 2.

17. The cell of claim 16, wherein the cell of the T cell lineage is a CD4+CD8+ double positive cell or a CD4+CD8+CD3+ double positive cell.

18. 17. The cell of claim 16, wherein the cell is a CD45+CD34+CD7+ progenitor T cell, a CD8+CD3+ single positive cell, or a CD4+CD3+ single positive cell.

19. A stem cell or progenitor cell, wherein expression of at least one gene or protein required for V(D)J recombination in said stem cell or progenitor cell is reduced or eliminated compared to a wild-type stem cell or progenitor cell.

20. The stem or progenitor cell of claim 19, wherein the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

21. 21. The stem or progenitor cell of claim 20, wherein the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), paralogue of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

22. 21. The stem or progenitor cell of claim 19 or 20, further comprising at least one of nucleic acids encoding a T cell receptor (TCR), a TCR beta chain, and a chimeric antigen receptor (CAR).

23. 21. The stem or progenitor cell of claim 19 or 20, further comprising a nucleic acid encoding a TCR beta chain.

24. The stem or progenitor cell of claim 19 or 20, wherein the stem cell is a pluripotent stem cell.

25. The stem or progenitor cell of claim 24, wherein the pluripotent stem cell is an embryonic stem cell or an induced pluripotent stem cell (iPSC).

26. 21. The stem or progenitor cell of claim 19 or 20, wherein the stem or progenitor cell is a human cell.

27. 21. Use of a stem or progenitor cell according to claim 19 or 20 for generating a cell of the T cell lineage.

28. 21. A kit comprising: (i) a stem or progenitor cell according to claim 19 or 20; and (ii) instructions for using the stem or progenitor cell to generate a cell of a T cell lineage.

29. 1. A method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in said stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of the cells or progenitor cells to a subject in need thereof; The method, wherein the stem or progenitor cells are engineered to contain at least one of nucleic acids encoding a T cell receptor (TCR) and a chimeric antigen receptor (CAR) that confer specificity to an antigen.

30. 1. A method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells and isolating cells of a T cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in said stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of said cells of said T cell lineage to a subject in need thereof; The method, wherein the stem or progenitor cells, or the cells of the T cell lineage, are engineered to contain at least one of nucleic acids encoding a T cell receptor (TCR) and a chimeric antigen receptor (CAR) that confers specificity for an antigen.

31. 31. The method of claim 29 or 30, wherein the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

32. 31. The method of claim 29 or 30, wherein the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), paralogues of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

33. 31. The method of claim 29 or 30, wherein the disease is cancer and the antigen is a tumor-associated antigen.

34. 1. A method for generating stem or progenitor cells that are incapable of undergoing T cell receptor (BCR) gene rearrangement, comprising: (a) culturing a sample comprising stem or progenitor cells, The method, wherein expression of at least one gene or protein required for V(D)J recombination in the stem cell or progenitor cell is reduced or eliminated compared to wild-type stem cell or progenitor cell.

35. 35. The method of claim 34, wherein the method further comprises (b) isolating cells of the B cell lineage.

36. 36. The method of claim 34 or 35, wherein the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

37. 36. The method of claim 34 or 35, wherein the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), paralogues of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

38. 36. The method of claim 34 or 35, wherein the stem cells are pluripotent stem cells.

39. 39. The method of claim 38, wherein the pluripotent stem cells are embryonic stem cells or induced pluripotent stem cells (iPSCs).

40. 36. The method of claim 34 or 35, wherein the stem or progenitor cells are human cells.

41. 36. The method of claim 34 or 35, wherein the cell of the B cell lineage is a CD20+ or ​​CD19+ cell.

42. 36. The method of claim 34 or 35, wherein the cell of the B cell lineage is a tumor-infiltrating B cell (TIB).

43. 36. The method of claim 34 or 35, further comprising engineering the stem or progenitor cells, or the cells of the B cell lineage to contain at least one of nucleic acids encoding a B cell receptor (BCR), a chimeric antigen receptor (CAR), or a BCR beta chain.

44. 44. The method of claim 43, wherein the stem or progenitor cells, or the cells of the B cell lineage express the B cell receptor (BCR), a chimeric antigen receptor (CAR), or a BCR beta chain.

45. 44. The method of claim 43, wherein the BCR or CAR confers specificity to an antigen, optionally a tumor-associated antigen, a viral antigen or an autoantigen.

46. ​​A cell of the B cell lineage produced by the method of claim 34 or 35.

47. The cell of claim 46, wherein the cell of the B cell lineage is a CD20+ or ​​CD19+ cell.

48. 47. The cell of claim 46, wherein the cell of the B cell lineage is a tumor-infiltrating B cell (TIB).

49. Use of a stem or progenitor cell according to claim 19 or 20 for generating a cell of the B cell lineage.

50. 21. A kit comprising: (i) a stem or progenitor cell according to claim 19 or 20; and (ii) instructions for using the stem or progenitor cell to generate a cell of a B-cell lineage.

51. 1. A method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells, wherein expression of at least one gene or protein required for V(D)J recombination in said stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of the stem cells or progenitor cells to a subject in need thereof; The method, wherein the stem or progenitor cells are engineered to contain at least one nucleic acid encoding a B cell receptor (BCR) or a chimeric antigen receptor (CAR) that confers specificity for an antigen.

52. 1. A method of treating a disease or condition in a subject, comprising: (i) culturing a sample comprising stem or progenitor cells and isolating cells of a B-cell lineage, wherein expression of at least one gene or protein required for V(D)J recombination in said stem or progenitor cells is reduced or eliminated compared to wild-type stem or progenitor cells; (ii) administering an effective amount of said cells of the B cell lineage to a subject in need thereof; The method, wherein the stem or progenitor cells, or the cells of the B cell lineage, are engineered to contain at least one nucleic acid encoding a B cell receptor (BCR) or a chimeric antigen receptor (CAR) that confers specificity for an antigen.

53. 53. The method of claim 51 or 52, wherein the at least one gene or protein required for V(D)J recombination is RAG1 and / or RAG2.

54. 53. The method of claim 51 or 52, wherein the at least one gene or protein required for V(D)J recombination is selected from the group consisting of Artemis, DNA-dependent protein kinase (DNA-PK), X-ray repair cross-complementing protein 4 (XRCC4), DNA ligase IV, non-homologous end joining factor 1 (NHEJ1), paralogues of XRCC4 and XLF (PAXX), DNA polymerase λ, and DNA polymerase μ.

55. 53. The method of claim 51 or 52, wherein the disease is cancer and the antigen is a tumor-associated antigen.

Images