Compositions and methods for inhibiting ketohexokinase (KHK)

Abstract

Compositions and methods for inhibiting ketohexokinase (KHK) are provided. Provided herein are oligonucleotides that inhibit KHK expression. Also provided are compositions containing same, and uses thereof, particularly in relation to the treatment of diseases, disorders and / or conditions associated with KHK expression.

Description

[Background technology]

[0001] Ketohexokinase (KHK) is a key enzyme in fructose metabolism. KHK catalyzes the conversion of D-fructose to fructose-1-phosphate. Under conditions of elevated fructose intake, a major portion of fructose-1-phosphate contributes to the synthesis of fatty acids and triglycerides, among others. In the liver, uncontrolled regulation of this process can lead to diseases such as nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH). Similarly, fructose metabolism converts fructose to glucose in the liver. Increased levels of glucose can lead to glucose intolerance (i.e., prediabetes, type 2 diabetes, and impaired fasting glucose). Excess glucose is converted to fatty acids and triglycerides, increasing the risk of developing cardiovascular diseases (e.g., hypertension). Reducing the amount of KHK in the liver may reduce the occurrence of these diseases or their symptoms. Strategies to target the KHK gene to prevent such diseases are needed. RNAi agents targeting KHK genes are disclosed, for example, in WO2015 / 123264 and WO2020 / 060986. Summary of the Invention

[0002] Disclosure Summary The present disclosure is based in part on the discovery that oligonucleotides (e.g., RNAi oligonucleotides) reduce KHK expression in liver. Specifically, target sequences within KHK mRNA were identified, and oligonucleotides were created that bind to these target sequences and inhibit KHK mRNA expression. As demonstrated herein, the oligonucleotides inhibited mouse KHK expression and / or monkey and human KHK expression in liver. Without being bound by theory, the oligonucleotides described herein are useful for treating diseases, disorders, or conditions associated with KHK expression (e.g., nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH)). In some embodiments, the oligonucleotides described herein are useful for treating diseases, disorders, or conditions associated with mutations in KHK gene.

[0003] Thus, in some embodiments, the present disclosure provides a double-stranded RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising an antisense strand and a sense strand, the antisense strand and the sense strand forming a duplex region, the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being at least 15 consecutive nucleotides in length, or a pharma- ceutically acceptable salt thereof. In some embodiments, the present disclosure provides a double-stranded RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising an antisense strand and a sense strand, the antisense strand and the sense strand forming a duplex region, the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being at least 15 consecutive nucleotides in length, and KHK expression is reduced by at least 50%. In any of the aforementioned or related aspects, the sense strand comprises a sequence set forth in any one of SEQ ID NOs: 4-387. In any of the aforementioned or related embodiments, the antisense strand comprises a sequence set forth in any one of SEQ ID NOs: 388-771.

[0004] In another aspect, the present disclosure provides a double-stranded RNAi oligonucleotide for inhibiting expression of KHK, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a duplex region, the sense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from any one of the nucleotide sequences of SEQ ID NOs: 4 to 387, and the antisense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from the nucleotide sequence of SEQ ID NOs: 388 to 771, or a pharma- ceutically acceptable salt thereof. In another aspect, the present disclosure provides a double-stranded RNAi oligonucleotide for inhibiting expression of KHK, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a duplex region, the sense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from any one of the nucleotide sequences of SEQ ID NOs: 4 to 387, and the antisense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from the nucleotide sequence of SEQ ID NOs: 388 to 771, and KHK expression is reduced by at least 50%., or a pharma- ceutically acceptable salt thereof.

[0005] In any of the foregoing or related embodiments, the sense strand is 15-50 nucleotides in length. In some embodiments, the sense strand is 18-36 nucleotides in length. In other embodiments, the sense strand is 15-30 nucleotides in length. In some embodiments, the antisense strand is 15-30 nucleotides in length. In some embodiments, the antisense strand is 22 nucleotides in length.

[0006] In any of the foregoing or related embodiments, the antisense strand and the sense strand form a duplex region at least 19 nucleotides in length. In any of the foregoing or related embodiments, the antisense strand and the sense strand form a duplex region at least 20 nucleotides in length. In any of the foregoing or related embodiments, the antisense strand and the sense strand form a duplex region at least 20 nucleotides in length. In some embodiments, the antisense strand is 22 nucleotides in length and the antisense strand and the sense strand form a duplex region at least 19 nucleotides in length. In some embodiments, the antisense strand is 22 nucleotides in length and the antisense strand and the sense strand form a duplex region at least 20 nucleotides in length. In some embodiments, the antisense strand is 22 nucleotides in length and the antisense strand and the sense strand form a duplex region at least 20 nucleotides in length. In any of the above or related embodiments, the antisense strand comprises a region of complementarity that is at least 19 contiguous nucleotides in length, optionally at least 20 nucleotides in length. In any of the above or related embodiments, the sense strand comprises at its 3' end a stem-loop shown as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length.

[0007] In some aspects, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, wherein the oligonucleotide comprises a sense strand and an antisense strand having a length of 15 to 50 nucleotides, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, and the region of complementarity is at least 15 contiguous nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0008] In still another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, wherein the oligonucleotide comprises a sense strand having a length of 15 to 50 nucleotides and an antisense strand having a length of 15 to 30 nucleotides, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a complementary region to any one of KHK mRNA target sequences of SEQ ID NOs: 4 to 387, and the complementary region is at least 15 contiguous nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0009] In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, wherein the oligonucleotide comprises a sense strand and an antisense strand having a length of 15 to 50 nucleotides, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof. In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, wherein the oligonucleotide comprises a sense strand and an antisense strand having a length of 18 to 36 nucleotides, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0010] In still another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, wherein the oligonucleotide comprises a sense strand having a length of 18 to 36 nucleotides and an antisense strand having a length of 22 nucleotides, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof. In some aspects, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising a sense strand 18-36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region, the 3' end of the sense strand comprising a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2 and L forms a loop between S1 and S2 of 3-5 nucleotides in length), the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0011] In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region, the 3' end of the sense strand comprising a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2, and L forms a loop between S1 and S2 of 3-5 nucleotides in length), the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0012] In yet another aspect, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region at least 19 nucleotides in length, optionally 20 nucleotides in length, the 3' end of the sense strand comprising a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2, and L forms a loop between S1 and S2 that is 3-5 nucleotides in length), the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, the region of complementarity being 19 contiguous nucleotides in length, optionally 20 nucleotides in length, or a pharma- ceutically acceptable salt thereof.

[0013] In some aspects, the present disclosure provides an RNAi oligonucleotide for reducing KHK expression, the oligonucleotide comprising: (i) an antisense strand having a length of 19 to 30 nucleotides, the antisense strand comprising a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, the region of complementarity being selected from SEQ ID NOs: 948 to 953; and (ii) a sense strand having a length of 19 to 50 nucleotides that contains a region of complementarity to the antisense strand; Including, Provided is an RNAi oligonucleotide, where the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand. In some embodiments, the RNAi oligonucleotide comprises a stem loop at the 3' end, where the stem loop is depicted as S1-L-S2, where S1 is complementary to S2, and L forms a loop between S1 and S2 that is 3-5 nucleotides in length.

[0014] In any of the aforementioned or related embodiments, the disclosure provides RNAi oligonucleotides comprising a stem loop depicted as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length. In some embodiments, L is a triloop or tetraloop. In any of the aforementioned or related embodiments, L is a tetraloop. In some embodiments, the tetraloop comprises the sequence 5'-GAAA-3'. In any of the aforementioned or related embodiments, S1 and S2 are 1-10 nucleotides in length and have the same length. In some embodiments, S1 and S2 are 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length. In some embodiments, S1 and S2 are 6 nucleotides in length. In any of the aforementioned or related embodiments, the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO:871). In any of the above or related aspects, the present disclosure provides an RNAi oligonucleotide comprising a nicked tetraloop structure. In some embodiments, the RNAi oligonucleotide comprises a nicking between the 3' end of the sense strand and the 5' end of the antisense strand. In some embodiments, the antisense strand and the sense strand are not covalently linked.

[0015] In any of the foregoing or related aspects, the present disclosure provides an RNAi oligonucleotide, wherein the antisense strand comprises a 3' overhang of one or more nucleotides in length. In some embodiments, the 3' overhang comprises a purine nucleotide. In some embodiments, the 3' overhang is 2 nucleotides in length. In some embodiments, the 3' overhang is selected from AA, GG, AG and GA. In some embodiments, the 3' overhang is GG or AA. In some embodiments, the 3' overhang is GG. In any of the above or related aspects, the present disclosure provides an RNAi oligonucleotide comprising at least one modified nucleotide. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2'-modification is a modification selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. In some embodiments, the 2'-modification is 2'-fluoro. In some embodiments, the 2'-modification is 2'-O-methyl. In some embodiments, the 2'-modification is 2'-fluoro and 2'-O-methyl.

[0016] In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide comprising at least one modified nucleotide, wherein about 10-15%, 10%, 11%, 12%, 13%, 14% or 15% of the nucleotides of the sense strand comprise a 2'-fluoro modification. In some aspects, about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% of the nucleotides of the antisense strand comprise a 2'-fluoro modification. In some aspects, about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% of the nucleotides of the oligonucleotide comprise a 2'-fluoro modification. In some embodiments, the sense strand comprises 36 nucleotides from 5' to 3' at positions 1-36, with positions 8-11 comprising 2'-fluoro modifications. In some embodiments, the antisense strand comprises 22 nucleotides from 5' to 3' at positions 1-22, with positions 2, 3, 4, 5, 7, 10 and 14 comprising 2'-fluoro modifications. In some embodiments, the remaining nucleotides of the sense strand and / or antisense strand comprise 2'-O-methyl modifications.

[0017] In any of the foregoing or related aspects, the present disclosure provides an RNAi oligonucleotide in which all of the nucleotides are modified. In some embodiments, positions 8, 9, 10, and 11 (5' to 3') of the sense strand are modified. In some embodiments, positions 3, 8, 9, 10, 12, 13, and 17 (5' to 3') of the sense strand are modified. In some embodiments, positions 2, 3, 4, 5, 7, 10, and 14 (5' to 3') of the antisense strand are modified. In some embodiments, positions 2-5, 7, 8, 10, 14, 16, and 19 (5' to 3') of the antisense strand are modified. In some embodiments, positions 8, 9, 10, and 11 (5' to 3') of the sense strand and positions 2, 3, 4, 5, 7, 10, and 14 (5' to 3') of the antisense strand are modified. In some embodiments, positions 3, 8, 9, 10, 12, 13, and 17 (5' to 3') of the sense strand and positions 2-5, 7, 8, 10, 14, 16, and 19 (5' to 3') of the antisense strand are modified. In some embodiments, the modification is a 2'-fluoro modification.

[0018] In any of the foregoing or related embodiments, the oligonucleotide comprises at least one modified internucleotide linkage. In some embodiments, at least one modified internucleotide linkage is a phosphorothioate linkage. In some embodiments, the antisense strand comprises phosphorothioate linkages (i) between positions 1 and 2 and between positions 2 and 3; or (ii) between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, the positions being numbered 1 to 4 from 5' to 3'. In some embodiments, the antisense strand is 22 nucleotides in length and comprises phosphorothioate linkages between positions 20 and 21 and between positions 21 and 22, the positions being numbered 1 to 22 from 5' to 3'.

[0019] In any of the above or related aspects, the present disclosure provides an RNAi oligonucleotide, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some aspects, the phosphate analog is an oxymethylphosphonate, vinylphosphonate or malonylphosphonate, and optionally the phosphate analog is a 4'-phosphate analog comprising 5'-methoxyphosphonate-4'-oxy. In any of the foregoing or related aspects, the present disclosure provides an RNAi oligonucleotide comprising an antisense strand comprising a phosphorylated nucleotide at the 5' end, wherein the phosphorylated nucleotide is selected from uridine and adenosine. In some aspects, the phosphorylated nucleotide is uridine.

[0020] In any of the foregoing or related embodiments, the oligonucleotide reduces or inhibits KHK expression in vivo. In any of the foregoing or related embodiments, the oligonucleotide is a Dicer substrate. In some embodiments, the oligonucleotide is a Dicer substrate that upon endogenous Dicer processing produces a double-stranded nucleic acid of 19-23 nucleotides in length that is capable of reducing KHK expression in mammalian cells. In any of the above or related aspects, the present disclosure provides an RNAi oligonucleotide, in which at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands. In some embodiments, each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid. In some embodiments, the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop. In some embodiments, the one or more targeting ligands are conjugated to one or more nucleotides of the loop. In some embodiments, the loop comprises 4 nucleotides numbered 1-4 from 5' to 3', and the nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, and the targeting ligands are the same or different. In any of the above or related aspects, the present disclosure provides an RNAi oligonucleotide, wherein each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety. In some aspects, the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety. In some aspects, up to 4 nucleotides of L of the stem loop are each conjugated to a monovalent GalNAc moiety.

[0021] In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide comprising an antisense strand comprising a complementary region, the complementary region being fully complementary to a KHK mRNA target sequence at nucleotide positions 2-8 of the antisense strand, the nucleotide positions being numbered from 5' to 3'. In some aspects, the complementary region being fully complementary to a KHK mRNA target sequence at nucleotide positions 2-11 of the antisense strand, the nucleotide positions being numbered from 5' to 3'. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 872-878 and 886-911. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 879-884 and 912-938.

[0022] In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the antisense strand comprises a nucleotide sequence selected from SEQ ID NOs: 913, 917, 918, 920, 923, and 936. In some aspects, the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 942-947. In some aspects, the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 887, 891, 892, 894, 897, and 909.

[0023] In any of the foregoing or related aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 888 and 914, respectively; (e) SEQ ID NOs: 889 and 915, respectively; (f) SEQ ID NOs: 890 and 916, respectively; (g) SEQ ID NOs: 891 and 917, respectively; (h) SEQ ID NOs: 877 and 884, respectively; (i) SEQ ID NOs: 878 and 930, respectively; (j) SEQ ID NOs: 876 and 883, respectively; (k) SEQ ID NOs: 875 and 882, respectively; (l) SEQ ID NOs: 892 and 918, respectively; (m) SEQ ID NOs: 893 and 919, respectively; (n) SEQ ID NOs: 894 and 920, respectively; (o) SEQ ID NOs: 904 and 931, respectively; (p) SEQ ID NOs: 895 and 921, respectively; (q) SEQ ID NOs: 905 and 932, respectively; (r) SEQ ID NOs: 896 and 922, respectively; (s) SEQ ID NOs: 911 and 938, respectively; (t) SEQ ID NOs: 906 and 933, respectively; (u) SEQ ID NOs: 897 and 923, respectively; (v) SEQ ID NOs: 907 and 934, respectively; (w) SEQ ID NOs: 908 and 935, respectively; (x) SEQ ID NOs: 903 and 929, respectively; (y) SEQ ID NOs: 901 and 927, respectively; (z) SEQ ID NOs: 874 and 881, respectively; (aa) SEQ ID NOs: 902 and 928, respectively; (bb) SEQ ID NOs: 873 and 880, respectively; (cc) SEQ ID NOs: 872 and 879, respectively; (dd) SEQ ID NOs: 898 and 924, respectively; (ee) SEQ ID NOs: 899 and 925, respectively; (gg) SEQ ID NOs: 900 and 926, respectively; and (hh) SEQ ID NOs: 909 and 936, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0024] In some aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 887 and 913, respectively; (b) SEQ ID NOs: 891 and 917, respectively; (c) SEQ ID NOs: 892 and 918, respectively; (d) SEQ ID NOs: 894 and 920, respectively; (e) SEQ ID NOs: 897 and 923, respectively; and (f) SEQ ID NOs: 909 and 936, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0025] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 909 and 936, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 894 and 920, respectively. In yet other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 897 and 923, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 892 and 918, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 891 and 917, respectively. In yet further embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 887 and 913, respectively.

[0026] In any of the foregoing or related aspects, the present disclosure provides RNAi oligonucleotides, wherein the oligonucleotides described herein achieve at least 50% knockdown of KHK mRNA. In some embodiments, the oligonucleotides described herein achieve at least 50% knockdown of KHK mRNA in vitro. In some embodiments, the oligonucleotides described herein achieve at least 50% knockdown of KHK mRNA in vivo. In some embodiments, the oligonucleotides described herein achieve at least 50% knockdown of KHK mRNA in vitro and in vivo. In some embodiments, the oligonucleotides described herein that achieve at least 50% knockdown of KHK mRNA comprise a sense strand and an antisense strand, wherein the sense strand and the antisense strand are (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 890 and 916, respectively; (e) SEQ ID NOs: 891 and 917, respectively; (f) SEQ ID NOs: 892 and 918, respectively; (g) SEQ ID NOs: 893 and 919, respectively; (h) SEQ ID NOs: 894 and 920, respectively; (i) SEQ ID NOs: 911 and 938, respectively; (j) SEQ ID NOs: 899 and 925, respectively; (k) SEQ ID NOs: 900 and 926, respectively; (l) SEQ ID NOs: 909 and 936, respectively; and (m) SEQ ID NOs: 897 and 923, respectively. The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of:

[0027] In any of the foregoing or related aspects, the disclosure provides RNAi oligonucleotides, wherein the sense and antisense strands are modified such that the antisense and sense strands comprise one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate linkage, and the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 774-804. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs:819-849.

[0028] In any of the foregoing or related aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 774 and 819, respectively; (b) SEQ ID NOs: 775 and 820, respectively; (c) SEQ ID NOs: 776 and 821, respectively; (d) SEQ ID NOs: 777 and 822, respectively; (e) SEQ ID NOs: 778 and 823, respectively; (f) SEQ ID NOs: 779 and 824, respectively; (g) SEQ ID NOs: 780 and 825, respectively; (h) SEQ ID NOs: 781 and 826, respectively; (i) SEQ ID NOs: 782 and 827, respectively; (j) SEQ ID NOs: 783 and 828, respectively; (k) SEQ ID NOs: 784 and 829, respectively; (l) SEQ ID NOs: 785 and 830, respectively; (m) SEQ ID NOs: 786 and 831, respectively; (n) SEQ ID NOs: 787 and 832, respectively; (o) SEQ ID NOs: 788 and 833, respectively; (p) SEQ ID NOs: 789 and 834, respectively; (q) SEQ ID NOs: 790 and 835, respectively; (r) SEQ ID NOs: 791 and 836, respectively; (s) SEQ ID NOs: 792 and 837, respectively; (t) SEQ ID NOs: 793 and 838, respectively; (u) SEQ ID NOs: 794 and 839, respectively; (v) SEQ ID NOs:795 and 840, respectively; (w) SEQ ID NOs: 796 and 841, respectively; (x) SEQ ID NOs: 797 and 842, respectively; (y) SEQ ID NOs: 798 and 843, respectively; (z) SEQ ID NOs: 799 and 844, respectively; (aa) SEQ ID NOs: 800 and 845, respectively; (bb) SEQ ID NOs: 801 and 846, respectively; (cc) SEQ ID NOs: 802 and 847, respectively; (dd) SEQ ID NOs: 803 and 848, respectively; and (ee) SEQ ID NOs: 804 and 849, respectively The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0029] In some aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 775 and 820, respectively; (b) SEQ ID NOs: 779 and 824, respectively; (c) SEQ ID NOs: 780 and 825, respectively; (d) SEQ ID NOs: 782 and 827, respectively; (e) SEQ ID NOs: 785 and 830, respectively; and (f) SEQ ID NOs: 804 and 849, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0030] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 804 and 894, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 782 and 827, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 775 and 820, respectively. In still other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 779 and 824, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 780 and 825, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 785 and 830, respectively. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs:805-818. In any of the foregoing or related aspects, the disclosure provides an RNAi oligonucleotide, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs:850-863.

[0031] In any of the foregoing or related aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 805 and 850, respectively; (b) SEQ ID NOs: 806 and 851, respectively; (c) SEQ ID NOs: 807 and 852, respectively; (d) SEQ ID NOs: 808 and 853, respectively; (e) SEQ ID NOs: 809 and 854, respectively; (f) SEQ ID NOs: 810 and 855, respectively; (g) SEQ ID NOs: 811 and 856, respectively; (h) SEQ ID NOs: 812 and 857, respectively; (i) SEQ ID NOs: 813 and 858, respectively; (j) SEQ ID NOs: 814 and 859, respectively; (k) SEQ ID NOs: 815 and 860, respectively; (l) SEQ ID NOs: 816 and 861, respectively; (m) SEQ ID NOs: 817 and 862, respectively; and (n) SEQ ID NOs: 818 and 863, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0032] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 805 and 850, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 809 and 854, respectively. In yet other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 810 and 855, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 812 and 857, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 815 and 860, respectively. In yet other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 818 and 863, respectively.

[0033] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, the dsRNAi comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, the sense strand comprising the sequence of 5'-mG-S-mA-mA-mG-mA-mG-mA-fA-fG-fC-fA-mG-mA-mU-mC-mC-mU-mG-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 775) and all of its modifications, and the antisense strand comprising the sequence of 5'-[Meho mA-GalNAc=sulfonate-4O-mU]-S-fA-S-fC-fA-fG-mG-fA-mU-mC-fU-mG-mC-mU-fU-mC-mU-mC-mU-mC-S-mG-S-mG-3' (SEQ ID NO:820), and all of its modifications, wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and ademA-GalNAc=sulfonate-4O-mU

[0034] [ka] or a pharma- ceutically acceptable salt thereof.

[0035] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, wherein the sense strand comprises the sequence of 5'-mC-S-mA-mG-mA-mU-mG-mU-fG-fU-fC-fU-mG-mC-mU-mA-mC-mA-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 779) and all of its modifications, and wherein the antisense strand comprises the sequence of 5'-[Me phosphatase and all of the modifications thereof, including the sequence of ademA-GalNAc=ademA-GalNAc-4O-mU]-S-fU-S-fC-S-fU-fG-mU-fA-mG-mC-fA-mG-mA-mC-fA-mC-mA-mU-mC-mU-mG-S-mG-S-mG-3' (SEQ ID NO: 824), where mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and

[0036] [ka] or a pharma- ceutically acceptable salt thereof.

[0037] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, wherein the sense strand comprises the sequence of 5'-mG-S-mA-mC-mU-mU-mU-mG-fA-fG-fA-fA-mG-mG-mU-mU-mG-mA-mU-mC-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 780) and all of its modifications, and wherein the antisense strand comprises the sequence of 5'-[Me phosphatase and all of the modifications thereof, including the sequence of ademA-GalNAc=ademA-GalNAc-4O-mU-fC-mA-fA-mC-mC-fU-mU-mC-mU-fC-mA-mA-mA-mG-mU-mC-S-mG-S-mG-3' (SEQ ID NO: 825), where mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and

[0038] [ka] or a pharma- ceutically acceptable salt thereof.

[0039] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, wherein the sense strand comprises the sequence of 5'-mU-S-mG-mU-mU-mU-mG-mU-fC-fA-fG-fC-mA-mA-mA-mG-mA-mU-mG-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 785) and all of its modifications, and wherein the antisense strand comprises the sequence of 5'-[Meho mA-GalNAc=sulfonate-4O-mU]-S-fA-S-fC-fA-fU-mC-fU-mU-mU-fG-mC-mU-mG-fA-mC-mA-mA-mA-mC-mA-S-mG-S-mG-3' (SEQ ID NO:830), and all of its modifications, wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and ademA-GalNAc=sulfonate-4O-mU

[0040] [ka] or a pharma- ceutically acceptable salt thereof.

[0041] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, wherein the sense strand comprises the sequence of 5'-mG-S-mC-mA-mG-mG-mA-mA-fG-fC-fA-fC-mU-mG-mA-mG-mA-mU-mU-mC-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 804) and all of its modifications, and wherein the antisense strand comprises the sequence of 5'-[Me phosphatase and all of the sequences and modifications thereof, including mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and ademA-GalNAc = ... [ka] or a pharma- ceutically acceptable salt thereof.

[0042] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, wherein the sense strand comprises the sequence of 5'-mU-S-mU-mU-mG-mA-mG-mA-fA-fG-fG-fU-mU-mG-mA-mU-mC-mU-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 782) and all of its modifications, and wherein the antisense strand comprises a 5'[Me phosphatase and all of the modifications thereof, including the sequence of ademA-GalNAc=ademA-GalNAc-4O-mU]-S-fU-S-fC-S-fA-fG-mA-fU-mC-mA-fA-mC-mC-mU-fU-mC-mU-mC-mA-mA-mA-S-mG-S-mG-3' (SEQ ID NO: 827), where mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'F ribonucleoside; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and

[0043] [ka] or a pharma- ceutically acceptable salt thereof.

[0044] In yet another aspect, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 775 and an antisense strand comprising SEQ ID NO: 820, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA

[0045] [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000008.tif245156.

[0046] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 779 and an antisense strand comprising SEQ ID NO: 824, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000010.tif245133.

[0047] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 780 and an antisense strand comprising SEQ ID NO: 825, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000012.tif245140.

[0048] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 782 and an antisense strand comprising SEQ ID NO: 827, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000014.tif243159.

[0049] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 785 and an antisense strand comprising SEQ ID NO: 830, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000016.tif245157.

[0050] In some aspects, the disclosure provides a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, wherein the dsRNA comprises a sense strand comprising SEQ ID NO: 804 and an antisense strand comprising SEQ ID NO: 849, wherein the antisense strand comprises a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA, and wherein the dsRNA [ka] A double-stranded RNAi oligonucleotide (dsRNAi) is provided in the form of a conjugate having the structure of TIFF2024516356000018.tif245149. In some aspects, the disclosure provides a method for treating a subject having a disease, disorder, or condition associated with KHK expression, comprising administering to the subject a therapeutically effective amount of any of the RNAi oligonucleotides or pharmaceutical compositions described herein, thereby treating the subject.

[0051] In some embodiments, the present disclosure provides a pharmaceutical composition comprising any of the RNAi oligonucleotides described herein and a pharma- ceutically acceptable carrier, salt, delivery agent or excipient. In some embodiments, the present disclosure provides a pharmaceutical composition comprising any of the RNAi oligonucleotides described herein and a pharma-ceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. Similarly, the oligonucleotides herein may be provided in their free acid form. In some aspects, the present disclosure provides a method for modulating KHK expression in a target cell expressing KHK, comprising administering to the target cell an effective amount of an RNAi oligonucleotide or pharmaceutical composition described herein. In some aspects, the disclosure provides a method of delivering an oligonucleotide to a subject, the method comprising administering a pharmaceutical composition described herein.

[0052] In some aspects, the disclosure provides a method for reducing KHK expression in a cell, a population of cells, or a subject, comprising: i. contacting a cell or population of cells with any of the RNAi oligonucleotides or pharmaceutical compositions described herein; or ii. administering to a subject any of the RNAi oligonucleotides or pharmaceutical compositions described herein. The present invention provides a method comprising: In any of the foregoing or related aspects, the method of reducing KHK expression includes reducing the amount or level of KHK mRNA, the amount or level of KHK protein, or both. In any of the foregoing or related embodiments, the subject has a disease, disorder or condition associated with KHK expression. In some embodiments, the disease, disorder or condition associated with KHK expression is non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In any of the foregoing or related embodiments, the RNAi oligonucleotide or pharmaceutical composition is administered in combination with a second composition or therapeutic agent.

[0053] In some aspects, the disclosure provides a method for treating a subject having a disease, disorder, or condition associated with KHK expression, comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, or a pharma- ceutically acceptable salt thereof, wherein the sense strand and the antisense strand are (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 888 and 914, respectively; (e) SEQ ID NOs: 889 and 915, respectively; (f) SEQ ID NOs: 890 and 916, respectively; (g) SEQ ID NOs: 891 and 917, respectively; (h) SEQ ID NOs: 877 and 884, respectively; (i) SEQ ID NOs: 878 and 930, respectively; (j) SEQ ID NOs: 876 and 883, respectively; (k) SEQ ID NOs: 875 and 882, respectively; (l) SEQ ID NOs: 892 and 918, respectively; (m) SEQ ID NOs: 893 and 919, respectively; (n) SEQ ID NOs: 894 and 920, respectively; (o) SEQ ID NOs: 904 and 931, respectively; (p) SEQ ID NOs: 895 and 921, respectively; (q) SEQ ID NOs: 905 and 932, respectively; (r) SEQ ID NOs: 896 and 922, respectively; (s) SEQ ID NOs: 911 and 938, respectively; (t) SEQ ID NOs: 906 and 933, respectively; (u) SEQ ID NOs: 897 and 923, respectively; (v) SEQ ID NOs: 907 and 934, respectively; (w) SEQ ID NOs: 908 and 935, respectively; (x) SEQ ID NOs: 903 and 929, respectively; (y) SEQ ID NOs: 901 and 927, respectively; (z) SEQ ID NOs: 874 and 881, respectively; (aa) SEQ ID NOs: 902 and 928, respectively; (bb) SEQ ID NOs: 873 and 880, respectively; (cc) SEQ ID NOs: 872 and 879, respectively; (dd) SEQ ID NOs: 898 and 924, respectively; (ee) SEQ ID NOs: 899 and 925, respectively; (ff) SEQ ID NOs: 900 and 926, respectively; and (gg) SEQ ID NOs: 909 and 936, respectively The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of:

[0054] In some aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 887 and 913, respectively; (b) SEQ ID NOs: 891 and 917, respectively; (c) SEQ ID NOs: 892 and 918, respectively; (d) SEQ ID NOs: 894 and 920, respectively; (e) SEQ ID NOs: 897 and 923, respectively; and (f) SEQ ID NOs: 909 and 936, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0055] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 887 and 913, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 891 and 917, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 892 and 918, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 894 and 920, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 897 and 923, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 909 and 936, respectively.

[0056] In some aspects, the disclosure provides a method for treating a subject having a disease, disorder, or condition associated with KHK expression, comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, or a pharma- ceutically acceptable salt thereof, wherein the sense strand and the antisense strand are (a) SEQ ID NOs: 774 and 819, respectively; (b) SEQ ID NOs: 775 and 820, respectively; (c) SEQ ID NOs: 776 and 821, respectively; (d) SEQ ID NOs: 777 and 822, respectively; (e) SEQ ID NOs: 778 and 823, respectively; (f) SEQ ID NOs: 779 and 824, respectively; (g) SEQ ID NOs: 780 and 825, respectively; (h) SEQ ID NOs: 781 and 826, respectively; (i) SEQ ID NOs: 782 and 827, respectively; (j) SEQ ID NOs: 783 and 828, respectively; (k) SEQ ID NOs: 784 and 829, respectively; (l) SEQ ID NOs: 785 and 830, respectively; (m) SEQ ID NOs: 786 and 831, respectively; (n) SEQ ID NOs: 787 and 832, respectively; (o) SEQ ID NOs: 788 and 833, respectively; (p) SEQ ID NOs: 789 and 834, respectively; (q) SEQ ID NOs: 790 and 835, respectively; (r) SEQ ID NOs: 791 and 836, respectively; (s) SEQ ID NOs: 792 and 837, respectively; (t) SEQ ID NOs: 793 and 838, respectively; (u) SEQ ID NOs: 794 and 839, respectively; (v) SEQ ID NOs:795 and 840, respectively; (w) SEQ ID NOs: 796 and 841, respectively; (x) SEQ ID NOs: 797 and 842, respectively; (y) SEQ ID NOs: 798 and 843, respectively; (z) SEQ ID NOs: 799 and 844, respectively; (aa) SEQ ID NOs: 800 and 845, respectively; (bb) SEQ ID NOs: 801 and 846, respectively; (cc) SEQ ID NOs: 802 and 847, respectively; (dd) SEQ ID NOs: 803 and 848, respectively; and (ee) SEQ ID NOs: 804 and 849, respectively is selected from the group consisting of:

[0057] In any of the foregoing or related aspects, the present disclosure provides a method for the preparation of a nucleic acid sequence comprising the steps of: (a) SEQ ID NOs: 775 and 820, respectively; (b) SEQ ID NOs: 779 and 824, respectively; (c) SEQ ID NOs: 780 and 825, respectively; (d) SEQ ID NOs: 782 and 827, respectively; (e) SEQ ID NOs: 785 and 830, respectively; and (f) SEQ ID NOs: 804 and 849, respectively. The present invention provides an RNAi oligonucleotide comprising a nucleotide sequence selected from the group consisting of:

[0058] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 775 and 820, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 779 and 824, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 780 and 825, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 782 and 827, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 785 and 830, respectively. In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 804 and 849, respectively.

[0059] In some aspects, the disclosure provides a method for treating a subject having a disease, disorder, or condition associated with KHK expression, comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, or a pharma- ceutically acceptable salt thereof, wherein the sense strand and the antisense strand are: (a) SEQ ID NOs: 805 and 850, respectively; (b) SEQ ID NOs: 806 and 851, respectively; (c) SEQ ID NOs: 807 and 852, respectively; (d) SEQ ID NOs: 808 and 853, respectively; (e) SEQ ID NOs: 809 and 854, respectively; (f) SEQ ID NOs: 810 and 855, respectively; (g) SEQ ID NOs: 811 and 856, respectively; (h) SEQ ID NOs: 812 and 857, respectively; (i) SEQ ID NOs: 813 and 858, respectively; (j) SEQ ID NOs: 814 and 859, respectively; (k) SEQ ID NOs: 815 and 860, respectively; (l) SEQ ID NOs: 816 and 861, respectively; (m) SEQ ID NOs: 817 and 862, respectively; and (n) SEQ ID NOs: 818 and 863, respectively. is selected from the group consisting of:

[0060] In some embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 805 and 850, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 809 and 854, respectively. In yet other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 810 and 855, respectively. In further embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 812 and 857, respectively. In other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 815 and 860, respectively. In still other embodiments, the present disclosure provides an RNAi oligonucleotide, wherein the sense strand and the antisense strand comprise the nucleotide sequences set forth in SEQ ID NOs: 818 and 863, respectively. In any of the foregoing or related aspects, the disease, disorder or condition associated with KHK expression is non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In any of the foregoing or related aspects, the RNAi oligonucleotides described herein are administered at a concentration of between 0.01 mg / kg and 5 mg / kg.

[0061] In some aspects, the present disclosure provides the use of any of the RNAi oligonucleotides or pharmaceutical compositions described herein in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with KHK expression, optionally in the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0062] In some aspects, the present disclosure provides any of the RNAi oligonucleotides or pharmaceutical compositions described herein for use or adapted for use in the treatment of a disease, disorder or condition associated with KHK expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In some aspects, the disclosure provides a kit comprising any of the RNAi oligonucleotides described herein, any pharma- ceutically acceptable carrier, and a package insert containing instructions for administration to a subject having a disease, disorder, or condition associated with KHK expression. In some aspects, the disease, disorder or condition associated with KHK expression is non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0063] In some embodiments, the present disclosure provides an oligonucleotide for reducing KHK expression, the oligonucleotide comprising a nucleotide sequence of 15-50 nucleotides in length, the nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, the region of complementarity being at least 15 contiguous nucleotides in length, or a pharma- ceutically acceptable salt thereof. In some embodiments, the oligonucleotide is single-stranded. In some embodiments, the oligonucleotide is an antisense oligonucleotide. In some embodiments, the nucleotide sequence is 15-30 nucleotides in length. In some embodiments, the nucleotide sequence is 20-25 nucleotides in length. In some embodiments, the nucleotide sequence is 22 nucleotides in length. In some embodiments, the region of complementarity is 19 contiguous nucleotides in length. In some embodiments, the region of complementarity is 20 contiguous nucleotides in length. In some embodiments, the nucleotide sequence comprises at least one modification. In some embodiments, the nucleotide sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 879-885 and 912-938. In some embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO: 920. In other embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:923. In still other embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:918. In further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:917. In still further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:913. In still further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:936. In some embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:894. In other embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:897. In still other embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:892. In further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:891.In still further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO: 887. In still further embodiments, the nucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO:909. In some aspects, the disclosure provides a cell comprising the oligonucleotide described herein. In some aspects, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide disclosed herein, or a pharma- ceutically acceptable salt thereof, and at least one pharma- ceutically acceptable carrier, delivery agent, or excipient. In some aspects, the disclosure provides a method for treating a subject having a disease, disorder or condition associated with KHK expression, comprising administering to the subject a therapeutically effective amount of an oligonucleotide or pharmaceutical composition described herein. In some aspects, the disclosure provides a method of delivering an oligonucleotide to a subject, the method comprising administering to a subject a pharmaceutical composition described herein.

[0064] In some aspects, the disclosure provides a method for reducing KHK expression in a cell, a population of cells, or a subject, comprising: i. contacting a cell or population of cells with an oligonucleotide or pharmaceutical composition described herein; or ii. administering to a subject an oligonucleotide or pharmaceutical composition described herein. In some embodiments, reducing KHK expression comprises reducing the amount or level of KHK mRNA, the amount or level of KHK protein, or both. In any of the foregoing or related embodiments, the subject has a disease, disorder or condition associated with KHK expression. In some embodiments, the disease, disorder or condition associated with KHK expression is non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In any of the above or related aspects, the oligonucleotide or pharmaceutical composition is administered in combination with a second composition or therapeutic agent.

[0065] In some aspects, the present disclosure provides the use of the oligonucleotide or pharmaceutical composition described herein in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with KHK expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In other aspects, the present disclosure provides the oligonucleotide or pharmaceutical composition described herein for use or adapted for use in the treatment of a disease, disorder or condition associated with KHK expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH). In some aspects, the disclosure provides a kit comprising an oligonucleotide described herein, an optional pharma- ceutically acceptable carrier, and a package insert containing instructions for administration to a subject having a disease, disorder, or condition associated with KHK expression. In any of the foregoing or related aspects, the disease, disorder or condition associated with KHK expression is non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0066] In some aspects, the disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of KHK, the dsRNA agent comprising a sense strand and an antisense strand that form a duplex region, the sense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a nucleotide sequence selected from SEQ ID NOs: 4-387, and the antisense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a nucleotide sequence selected from SEQ ID NOs: 388-771.

[0067] In some aspects, the disclosure provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of KHK, the dsRNA agent comprising a sense strand and an antisense strand forming a duplex region, the sense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a nucleotide sequence selected from SEQ ID NOs: 872-878 and 886-911, and the antisense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a nucleotide sequence selected from SEQ ID NOs: 879-885 and 912-938. [Brief description of the drawings]

[0068] [Figure 1] Figure 1 provides a graph depicting the percent (%) remaining mRNA in Hep3B cells (expressing endogenous human KHK) 24 hours after treatment with 1 nM DsiRNAs targeting various regions of the KHK gene. 384 DsiRNAs were designed and screened. Three primer pairs were used that recognize the KHK-A isoform (KHK-F763, NM_000221.2), KHK-C (KHK-825, NM_006488.3) and KHK-All (both isoforms) (KHK-F495, KHK-F1026, NM_006488.3). Expression was normalized between samples using HPRT and SFRS9 housekeeping genes. [Figure 2A-2B] Figures 2A and 2B provide schematics of the low-2'-fluoro modification patterns (low-2'-fluoro (3PS) and low-2'-fluoro (2PS), respectively) that are applied to the KHK mRNA target sequence to create the GalNAc-KHK construct. The sense strand contains a tetraloop structure at nucleotides 26-31 of the 36 nucleotide strand. The antisense strand is complementary and contains a 2 nucleotide overhang. [Diagram 3]FIG. 3 provides a graph depicting the percent (%) remaining KHK mRNA in KHK-A and KHK-C HDI (hydrodynamic injection) mice treated with human / non-human primate (NHP)-conserved GalNAc-KHK constructs. Three days after subcutaneous dosing of GalNAc-KHK constructs formulated in PBS at 2 mg / kg, mice were injected via HDI with plasmids encoding either KHK-A or KHK-C, and the percent (%) of KHK mRNA was measured in liver samples one day later compared to mice treated with PBS. mRNA was measured from liver using primers that recognize KHK-All (equilateral triangle), KHK-C (inverted triangle), and KHK-A (hexagon). The "Hs, 1 mm Mf" annotation represents the human-specific sequence, which is one base mismatch different from the monkey sequence. [Figure 4A] Figure 4A provides a schematic of the mid-2'-fluoro modification pattern applied to the KHK target sequence to create the GalNAc-KHK construct. The sense strand contains a tetraloop structure at nucleotides 26 to 31 of a 36 nucleotide chain. The antisense strand is complementary and contains a 2 nucleotide overhang. [Figure 4B-4C]4B-4C provide graphs depicting the percent KHK mRNA remaining after treatment of mice with GalNAc-KHK constructs with a medium-2'-fluoro modification pattern. Three days after subcutaneous dosing of GalNAc-KHK constructs formulated in PBS at 2 mg / kg, mice were injected with a plasmid encoding KHK-C via HDI, and the percent KHK mRNA was measured in liver samples one day later compared to mice treated with PBS. mRNA was measured using primers that specify both the KHK-A and KHK-C isoforms (i.e., KHK-All) (FIG. 4B), as well as primers that specify only the KHK-C isoform (FIG. 4C). Multiple GalNAc-KHK constructs were combined in a "mixed" group at 2 mg / kg for a total of 10 mg / kg treatment (KHK-0861, -0865, -0882, -0883, -0885) as a positive knockdown control. Annotations such as "Hs, 1mm Mf" represent human-specific sequences that differ from the monkey sequence by one base mismatch. [Figure 4D] FIG. 4D provides a graph depicting the percent KHK mRNA remaining after mice were treated with different GalNAc-KHK constructs with medium-2'-fluoro modification patterns. Three days after subcutaneous dosing of GalNAc-KHK constructs formulated in PBS at 2 mg / kg, mice were injected with a plasmid encoding KHK-C via HDI, and the percent KHK mRNA was measured in liver samples one day later compared to mice treated with PBS. mRNA was measured using primers that specify only mouse KHK (MmKHK-ALL-5-6, forward: GCTCTTCCAGTTGTTTAGCTATGGT (SEQ ID NO: 939), reverse: CAGGTGCTTGGCCACATCTT (SEQ ID NO: 940), probe: AGGTGGTGTTTGTCAGC (SEQ ID NO: 941)). Remaining mRNA was normalized to the PBS control. Multiple GalNAc-KHK constructs were combined in a "mixed" group as a positive knockdown control. [Figure 4E]FIG. 4E provides a graph depicting the difference in percent (%) KHK mRNA remaining after treatment with GalNAc-KHK constructs with different modification patterns (low-2′F (FIGS. 2A and 2B) and mid-2′F (FIG. 4A)). Remaining mRNA was normalized to the PBS control. Multiple GalNAc-KHK constructs were combined in a “mixed” group as a positive knockdown control. [Diagram 5] Figure 5 provides a graph showing the difference in percent KHK mRNA remaining after treating mice with GalNAc-KHK constructs. Three days after subcutaneous dosing of GalNAc-KHK constructs formulated in PBS at 2 mg / kg, mice were injected with a plasmid encoding KHK-C (NM_006488) (pCMV6-KHK-C, Catalog Number: RC223488, OriGene) via HDI, and percent KHK mRNA remaining was measured in liver samples one day later compared to mice treated with PBS. Results include mRNA measured from primers for KHK-All (equivalent triangles) and KHK-C (inverted triangles). The gray arrow indicates that 30 mg / kg treatment of KHK-885 has a knockdown of over 98%. [Figure 6A-6B] 6A-6B provide graphs depicting the percent (%) KHK mRNA remaining after treatment of KHK-C plasmid HDI mice (as described in FIG. 5) with different GalNAc-KHK constructs. mRNA was measured using primers that specify both the KHK-A and KHK-C isoforms (KHK-All; FIG. 6A), as well as primers that specify only the KHK-C isoform (FIG. 6B). [Figure 6C] Figure 6C provides a graph depicting the percent (%) remaining KHK mRNA in liver after treatment of KHK-C plasmid HDI mice (as described in Figure 5) with different GalNAc-KHK constructs. mRNA was measured using primers specific for mouse KHK only. [Figure 7A-7C]7A-7C provide graphs depicting percent (%) remaining KHK mRNA in liver biopsies from non-human primates (NHPs) 28 days (FIG. 7A), 56 days (FIG. 7B), and 84 days (FIG. 7C) after a single dose of a particular GalNAc construct. NHPs were injected subcutaneously with 6 mg / kg GalNAc-KHK on study day 0. Percentages shown are the average reduction in KHK-mRNA compared to PBS controls. [Figure 7D] FIG. 7D provides a line graph demonstrating changes in KHK mRNA in liver biopsies taken at various time points from NHPs (as treated in FIGS. 7A-7C) following a single dose of the GalNAc-KHK construct. [Figure 8A-8C] 8A-8C provide graphs depicting the percent (%) KHK protein remaining in liver biopsies from non-human primates (NHPs) after 28 days (FIG. 8A), 56 days (FIG. 8B), and 84 days (FIG. 8C) of treatment. NHPs were treated as in FIGS. 7A-7C. Percentages shown are the average reduction in KHK-protein compared to PBS controls. [Figure 8D] FIG. 8D provides a line graph demonstrating changes in KHK protein in liver biopsies taken at various time points from NHPs (as treated in FIGS. 7A-7C) following a single dose of the GalNAc-KHK construct. [Figure 9A-9C] Figures 9A-9C provide correlation graphs demonstrating the relationship between residual KHK mRNA expression and residual KHK protein expression in liver biopsies from NHPs treated with a single dose of GalNAc-KHK constructs. Correlations between all constructs are compared at 28 days (Figure 9A), 56 days (Figure 9B), and 84 days (Figure 9C) post-dosing. Individual dots represent individual biopsies. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0069] Detailed Description According to some aspects, the present disclosure provides the oligonucleotide that reduces KHK expression in liver.In some embodiments, the oligonucleotide provided herein is useful for treating the disease associated with KHK expression in liver.In some aspects, the present disclosure provides the method of treating the disease associated with KHK expression by reducing KHK gene expression in cell (e.g., liver cell).

[0070] Oligonucleotide inhibitors of KHK expression Ketohexokinase (KHK) target sequence In some embodiments, the present disclosure provides an oligonucleotide that targets a target sequence that includes ketohexokinase (KHK) mRNA. In some embodiments, the oligonucleotide, or a portion, fragment, or strand thereof (e.g., the antisense strand or guide strand of dsRNA) binds or anneals to a sequence that includes KHK mRNA, thereby inhibiting KHK expression. In some embodiments, the oligonucleotide targets a target sequence that includes KHK-A isoform mRNA. In some embodiments, the oligonucleotide targets a target sequence that includes KHK-C isoform mRNA. In some embodiments, the oligonucleotide targets a KHK target sequence in vivo for the purpose of inhibiting KHK expression. In some embodiments, the amount or degree of inhibition of KHK expression by an oligonucleotide that targets a KHK target sequence correlates with the efficacy of the oligonucleotide. In some embodiments, the amount or degree of inhibition of KHK expression by an oligonucleotide that targets a KHK target sequence correlates with the amount or degree of therapeutic benefit in a subject or patient with a disease, disorder, or condition associated with the expression of KHK treated with the oligonucleotide.

[0071] Through examination of the nucleotide sequences of mRNAs encoding KHK, including mRNAs from several different species (e.g., human, cynomolgus monkey, monkey, and rat; see, e.g., Example 2), as well as the results of in vitro and in vivo testing (see, e.g., Examples 2-6), it has been discovered that certain nucleotide sequences of KHK mRNA are more suitable than others for oligonucleotide-based inhibition and are therefore useful as target sequences for the oligonucleotides herein. In some embodiments, the sense strand of an oligonucleotide (e.g., dsRNA) described herein comprises a KHK target sequence. In some embodiments, a portion or region of the sense strand of a dsRNA described herein comprises a KHK target sequence. In some embodiments, the KHK target sequence comprises or consists of the sequence of any one of SEQ ID NOs: 4-387. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1-19 of any one of SEQ ID NOs: 4-387. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 39. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 39. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 102. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 102. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 104. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 104. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 107. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 107. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 191.In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 191. In some embodiments, the KHK target sequence comprises or consists of the sequence set forth in SEQ ID NO: 269. In some embodiments, the KHK target sequence comprises or consists of nucleotides 1 to 19 of the sequence set forth in SEQ ID NO: 269.

[0072] KHK targeting sequence In some embodiments, the oligonucleotide herein has a complementary region to KHK mRNA (e.g., within the target sequence of KHK mRNA) for the purpose of targeting mRNA and inhibiting its expression in cells.In some embodiments, the oligonucleotide herein comprises a KHK targeting sequence (e.g., the antisense strand or guide strand of dsRNA) with a complementary region that binds or anneals to the KHK target sequence by complementary (Watson-Crick) base pairing.The targeting sequence or complementary region is generally of suitable length and base content that allows the oligonucleotide (or its strand) to bind or anneal to KHK mRNA for the purpose of inhibiting its expression. In some embodiments, the targeting sequence or complementary region is at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 nucleotides in length. In some embodiments, the targeting sequence or complementary region is about 12 to about 30 (e.g., 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 to 27, or 15 to 30) nucleotides in length. In some embodiments, the targeting sequence or complementary region is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 18 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 19 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 20 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 21 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 22 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 23 nucleotides in length.In some embodiments, the targeting sequence or complementary region is 24 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the targeting sequence or complementary region is 18 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the targeting sequence or complementary region is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the targeting sequence or complementary region is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the targeting sequence or complementary region is 21 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the targeting sequence or complementary region is 22 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the target sequence or complementary region is 23 nucleotides in length. In some embodiments, the oligonucleotide comprises a target sequence or complementary region complementary to any one of SEQ ID NOs: 4-387, and the target sequence or complementary region is 24 nucleotides in length.

[0073] In some embodiments, the oligonucleotides herein comprise a targeting sequence or complementary region that is fully complementary to the KHK target sequence (e.g., the antisense strand or guide strand of a double-stranded oligonucleotide). In some embodiments, the targeting sequence or complementary region is partially complementary to the KHK target sequence. In some embodiments, the targeting sequence or complementary region has a mismatch of up to 3 nucleotides to the KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence of KHK. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence of KHK. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to any one of the sequences of SEQ ID NOs: 4-387. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence of KHK. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of any one of the sequences of SEQ ID NOs: 4-387. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 39. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 39. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 102. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 102. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 104. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 104.In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 107. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 107. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 191. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 191. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 269. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 269. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to any one of the sequences set forth in SEQ ID NOs: 4-387. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to nucleotides 1-19 of any one of SEQ ID NOs: 4-387. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence set forth in SEQ ID NO:39.

[0074] In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO:39. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence set forth in SEQ ID NO:102. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO:102. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence set forth in SEQ ID NO:104. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO:104. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence set forth in SEQ ID NO:107. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO:107. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence set forth in SEQ ID NO: 191. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 191. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence set forth in SEQ ID NO: 269. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to nucleotides 1-19 of the sequence set forth in SEQ ID NO: 269. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to any one of SEQ ID NOs: 872-878 and 886-911. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to any one of SEQ ID NOs: 872-878 and 886-911.In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909.

[0075] In some embodiments, the oligonucleotides herein comprise a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides comprising KHK mRNA, wherein the contiguous sequence of nucleotides is about 12 to about 30 nucleotides in length (e.g., 12 to 30, 12 to 28, 12 to 26, 12 to 24, 12 to 20, 12 to 18, 12 to 16, 14 to 22, 16 to 20, 18 to 20, or 18 to 19 nucleotides in length). In some embodiments, the oligonucleotides comprise a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides comprising KHK mRNA, wherein the contiguous sequence of nucleotides is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the oligonucleotides comprise a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides comprising KHK mRNA, wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides comprising KHK mRNA, wherein the contiguous sequence of nucleotides is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, wherein, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, wherein the contiguous sequence of nucleotides is 20 nucleotides in length.In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 872-878 and 886-911, where, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 872-878 and 886-911, where, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 872-878 and 886-911, where, optionally, the contiguous sequence of nucleotides is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, where, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, where, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, where, the contiguous sequence of nucleotides is 20 nucleotides in length.

[0076] In some embodiments, a targeting sequence or complementary region of an oligonucleotide is provided that is complementary to consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 4-387 and spans the entire length of the antisense strand. In some embodiments, a targeting sequence or complementary region of an oligonucleotide is provided that is complementary to consecutive nucleotides of nucleotides 1-19 of a sequence shown in any one of SEQ ID NOs: 4-387 and spans the entire length of the antisense strand. In some embodiments, a complementary region of an oligonucleotide is provided that is complementary to consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 4-387 and spans a portion of the entire length of the antisense strand. In some embodiments, a complementary region of an oligonucleotide is provided that is complementary to consecutive nucleotides of nucleotides 1-19 of a sequence shown in any one of SEQ ID NOs: 4-387 and spans a portion of the entire length of the antisense strand. In some embodiments, the oligonucleotides herein comprise a complementary region (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., completely) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-19 of the sequence set forth in any one of SEQ ID NOs: 4-387. In some embodiments, the oligonucleotides herein comprise a complementary region (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., completely) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-20 of the sequence set forth in any one of SEQ ID NOs: 4-387. In some embodiments, a targeting sequence or complementary region of the oligonucleotide is provided that is complementary to contiguous nucleotides of the sequence set forth in any one of SEQ ID NOs: 872-878 and 886-911 and spans the entire length of the antisense strand. In some embodiments, a complementary region of the oligonucleotide is provided that is complementary to contiguous nucleotides of the sequence set forth in any one of SEQ ID NOs: 872-878 and 886-911 and spans a portion of the entire length of the antisense strand.In some embodiments, the oligonucleotides herein comprise a region of complementarity (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-19 of the sequence set forth in any one of SEQ ID NOs: 872-878 and 886-911. In some embodiments, the oligonucleotides herein comprise a region of complementarity (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-20 of the sequence set forth in any one of SEQ ID NOs: 872-878 and 886-911. In some embodiments, oligonucleotide targeting sequences or complementary regions are provided that are complementary to contiguous nucleotides of the sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, spanning the entire length of the antisense strand. In some embodiments, there is provided a region of complementarity of an oligonucleotide that is complementary to contiguous nucleotides of a sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, and that spans a portion of the entire length of the antisense strand. In some embodiments, an oligonucleotide herein comprises a region of complementarity (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-19 of a sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909. In some embodiments, an oligonucleotide herein comprises a region of complementarity (e.g., in the antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-20 of a sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909.

[0077] In some embodiments, the oligonucleotide herein comprises a targeting sequence or complementary region with one or more base pair (bp) mismatches with the corresponding KHK target sequence. In some embodiments, the targeting sequence or complementary region may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding KHK target sequence, provided that the ability of the targeting sequence or complementary region to bind or anneal to KHK mRNA under appropriate hybridization and / or the ability of the oligonucleotide to inhibit KHK expression is maintained. Alternatively, the targeting sequence or complementary region may have 1 or less, 2 or less, 3 or less, 4 or less, or 5 or less mismatches with the corresponding KHK target sequence, provided that the ability of the targeting sequence or complementary region to bind or anneal to KHK mRNA under appropriate hybridization and / or the ability of the oligonucleotide to inhibit KHK expression is maintained. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region with one mismatch with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region with two mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region with three mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region with four mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region with five mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region with more than one mismatch with the corresponding target sequence (e.g., 2, 3, 4, 5, or more mismatches), where at least two (e.g., all) of the mismatches are located consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row) or the mismatches are scattered throughout the targeting sequence or complementary region.In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region having more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) with the corresponding target sequence, where at least two (e.g., all) of the mismatches are located contiguously (e.g., 2, 3, 4, 5, or more mismatches in a row), or where at least one or more non-mismatched base pairs are located between the mismatches, or a combination thereof. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, where the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, where the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, where the targeting sequence or complementary region may have at most 1, at most 2, at most 3, at most 4, or at most 5 mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, where the targeting sequence or complementary region may have at most 1, at most 2, at most 3, at most 4, or at most 5 mismatches with the corresponding KHK target sequence.In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of any one of SEQ ID NOs: 872-878 and 886-911, where the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of any one of SEQ ID NOs: 872-878 and 886-911, where the targeting sequence or complementary region may have at most 1, at most 2, at most 3, at most 4, or at most 5 mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909 nucleotides, where the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with the corresponding KHK target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909 nucleotides, where the targeting sequence or complementary region may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding KHK target sequence.

[0078] Types of oligonucleotides A variety of oligonucleotide types and / or structures are useful for targeting KHK in the methods herein, including, but not limited to, RNAi oligonucleotides, antisense oligonucleotides, miRNAs, etc. Any of the oligonucleotide types described herein or elsewhere are contemplated for use as a framework to be incorporated into the KHK targeting sequences herein for purposes of inhibiting KHK expression.

[0079] In some embodiments, the oligonucleotides herein inhibit KHK expression by participating in the RNA interference (RNAi) pathway upstream or downstream of Dicer participation. For example, RNAi oligonucleotides have been developed with each strand having a size of about 19-25 nucleotides with at least one 3' overhang of 1-5 nucleotides (see, for example, U.S. Patent No. 8,372,968). Longer oligonucleotides have also been developed that are processed by Dicer to produce active RNAi products (see, for example, U.S. Patent No. 8,883,996). Further research has produced extended dsRNAs in which at least one end of at least one strand extends beyond the double-stranded targeting region, including structures in which one of the strands includes a thermodynamically stabilized tetraloop structure (see, for example, U.S. Patent Nos. 8,513,207 and 8,927,705, and International Publication No. WO2010 / 033225). Such structures can include single-stranded (ss) extensions (on one or both sides of the molecule), as well as double-stranded (ds) extensions.

[0080] In some embodiments, the oligonucleotides herein participate in the RNAi pathway downstream of Dicer engagement (e.g., Dicer cleavage). In some embodiments, the oligonucleotides described herein are Dicer substrates. In some embodiments, upon endogenous Dicer processing, a double-stranded nucleic acid of 19-23 nucleotides in length is generated that can reduce KHK expression. In some embodiments, the oligonucleotide has an overhang (e.g., 1, 2, or 3 nucleotides in length) at the 3' end of the sense strand. In some embodiments, the oligonucleotide has an overhang (e.g., 1, 2, or 3 nucleotides in length) at the 3' end of the antisense strand. In some embodiments, the oligonucleotide (e.g., siRNA) comprises a 21-nucleotide guide strand that is antisense to a target RNA and a complementary passenger strand, where both strands anneal to form a 19 bp duplex and a 2-nucleotide overhang at either or both 3' ends. Longer oligonucleotide designs are also possible, including oligonucleotides with a 23-nucleotide guide strand and a 21-nucleotide passenger strand, where there is a blunt end on the right side of the molecule (the 3' end of the passenger strand / the 5' end of the guide strand) and a 2-nucleotide 3' guide strand overhang on the left side of the molecule (the 5' end of the passenger strand / the 3' end of the guide strand).In such molecules, there is a 21bp double-stranded region.See, for example, U.S. Patent Nos. 9,012,138; 9,012,621 and 9,193,753.

[0081] In some embodiments, the oligonucleotides herein comprise a sense strand and an antisense strand, both ranging in length from about 17-36 (e.g., 17-36, 20-25, or 21-23) nucleotides. In some embodiments, the oligonucleotides herein comprise an antisense strand 19-30 nucleotides in length and a sense strand 19-50 nucleotides in length, where the antisense strand and the sense strand are separate strands forming an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand. In some embodiments, the oligonucleotides herein comprise a sense strand and an antisense strand, both ranging in length from about 19-22 nucleotides. In some embodiments, the sense strand and the antisense strand are of equal length. In some embodiments, the oligonucleotides comprise a sense strand and an antisense strand, such that there is a 3' overhang on either the sense strand or the antisense strand, or on both the sense strand and the antisense strand. In some embodiments, for oligonucleotides having a sense strand and an antisense strand that are both in the range of about 21-23 nucleotides in length, the 3' overhang on the sense strand, the antisense strand, or both the sense strand and the antisense strand is 1 or 2 nucleotides in length. In some embodiments, the oligonucleotide has a guide strand of 22 nucleotides and a passenger strand of 20 nucleotides, where there is a blunt end on the right side of the molecule (3' end of the passenger strand / 5' end of the guide strand) and a 2 nucleotide 3' guide strand overhang on the left side of the molecule (5' end of the passenger strand / 3' end of the guide strand). In such molecules, there is a 20 bp double-stranded region.

[0082] Other oligonucleotide designs for use with the compositions and methods herein include 16-mer siRNAs (see, e.g., NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY. Blackburn (ed.), Royal Society of Chemistry, 2006), shRNAs (e.g., with short stems of 19 bp or less; see, e.g., Moore et al. (2010) METHODS MOL. BIOL. 629:139-156), blunt-ended siRNAs (e.g., 19 bp in length; see, e.g., Kraynack & Baker (2006) RNA 12:163-176), asymmetric siRNAs (aiRNAs; see, e.g., Sun et al. (2008) NAT. BIOTECHNOL. 26:1379-1382), asymmetric shorter duplex siRNAs (see, e.g., Chang et al. (2009) MOL. THER. 17:725-32), fork siRNA (see, e.g., Hohjoh (2004) FEBS LETT. 557:193-198), ss siRNA (Elsner (2012) NAT. BIOTECHNOL. 30:1063), dumbbell-shaped circular siRNA (see, e.g., Abe et al. (2007) J. AM. CHEM. SOC. 129:15108-09), and small internal segmented interfering RNA (siRNA; see, e.g., Bramsen et al. (2007) NUCLEIC ACIDS RES. 35:5886-97). Further non-limiting examples of oligonucleotide structures that may be used in some embodiments to reduce or inhibit expression of KHK are microRNAs (miRNAs), small hairpin RNAs (shRNAs), and short siRNAs (see, e.g., Hamilton et al. (2002) EMBO J. 21:4671-79; see also U.S. Patent Application Publication No. 2009 / 0099115).

[0083] Furthermore, in some embodiments, the oligonucleotide for reducing or inhibiting KHK expression herein is single-stranded (ss). Such structures may include, but are not limited to, single-stranded RNAi molecules. Recent attempts have demonstrated the activity of ss RNAi molecules (see, for example, Matsui et al. (2016) MOL. THER. 24:946-955). However, in some embodiments, the oligonucleotide herein is an antisense oligonucleotide (ASO). An antisense oligonucleotide is a single-stranded oligonucleotide having a nucleobase sequence that, when written in the 5' to 3' direction, contains the reverse complement of a targeted segment of a particular nucleic acid and is suitably modified to induce RNaseH-mediated cleavage of the target RNA in a cell (e.g., as a mixmer) or inhibit translation of a target mRNA in a cell (e.g., as a gapmer). ASOs for use herein can be modified in any suitable manner known in the art, including, for example, those set forth in U.S. Patent No. 9,567,587 (including, for example, length, sugar moieties of nucleobases (pyrimidines, purines), and substitutions of heterocyclic moieties of nucleobases). Additionally, ASOs have been used for decades to reduce expression of specific target genes (see, for example, Bennett et al. (2017) ANNU. REV. PHARMACOL. 57:81-105).

[0084] In some embodiments, the antisense oligonucleotide shares a region of complementarity with KHK mRNA. In some embodiments, the antisense oligonucleotide targets SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide targets SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide targets SEQ ID NO: 3. In some embodiments, the antisense oligonucleotide is 15-50 nucleotides in length. In some embodiments, the antisense oligonucleotide is 15-25 nucleotides in length. In some embodiments, the antisense oligonucleotide is 22 nucleotides in length. In some embodiments, the antisense oligonucleotide is complementary to any one of SEQ ID NOs: 4-387. In some embodiments, the antisense oligonucleotide is complementary to nucleotides 1-19 of any one of SEQ ID NOs: 4-387. In some embodiments, the antisense oligonucleotide is at least 15 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 19 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 20 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide differs from the target sequence by 1, 2, or 3 nucleotides.

[0085] Double-stranded oligonucleotides In some aspects, the present disclosure provides a double-stranded (ds) RNAi oligonucleotide for targeting KHK mRNA and inhibiting KHK expression (e.g., via the RNAi pathway), comprising a sense strand (also referred to herein as passenger strand) and an antisense strand (also referred to herein as guide strand). In some embodiments, the sense strand and the antisense strand are separate strands and are not covalently linked. In some embodiments, the sense strand and the antisense strand are covalently linked. In some embodiments, the sense strand and the antisense strand form a duplex region, in which the sense strand and the antisense strand, or a portion thereof, are bound to each other in a complementary manner (e.g., by Watson-Crick base pairing).

[0086] In some embodiments, the sense strand comprises a first region (R1) and a second region (R2), where R2 comprises a first subregion (S1), a tetraloop (L) or a triloop (triL), and a second subregion (S2), where L or triL is located between S1 and S2, and S1 and S2 form a second duplex (D2). D2 can have a variety of lengths. In some embodiments, D2 is about 1-6 bp in length. In some embodiments, D2 is 2-6, 3-6, 4-6, 5-6, 1-5, 2-5, 3-5, or 4-5 bp in length. In some embodiments, D2 is 1, 2, 3, 4, 5, or 6 bp in length. In some embodiments, D2 is 6 bp in length.

[0087] In some embodiments, R1 of the sense strand and the antisense strand form a first duplex (D1). In some embodiments, D1 is at least about 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, D1 is in the range of about 12-30 nucleotides in length (e.g., 12-30, 12-27, 15-22, 18-22, 18-25, 18-27, 18-30, or 21-30 nucleotides in length). In some embodiments, D1 is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 20, at least 25, or at least 30 nucleotides in length). In some embodiments, D1 is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, D1 is 20 nucleotides in length. In some embodiments, D1 comprising the sense strand and the antisense strand does not span the entire length of the sense strand and / or the antisense strand. In some embodiments, D1 comprising the sense strand and the antisense strand spans the entire length of either the sense strand or the antisense strand, or both. In certain embodiments, D1 comprising the sense strand and the antisense strand spans the entire length of both the sense strand and the antisense strand. In some embodiments, the dsRNAi provided herein comprises a sense strand having any one of SEQ ID NOs: 4-387, and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 388-771 as set forth in Table 2.

[0088] In some embodiments, the dsRNAi oligonucleotide comprises: (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 888 and 914, respectively; (e) SEQ ID NOs: 889 and 915, respectively; (f) SEQ ID NOs: 890 and 916, respectively; (g) SEQ ID NOs: 891 and 917, respectively; (h) SEQ ID NOs: 877 and 884, respectively; (i) SEQ ID NOs: 878 and 930, respectively; (j) SEQ ID NOs: 876 and 883, respectively; (k) SEQ ID NOs: 875 and 882, respectively; (l) SEQ ID NOs: 892 and 918, respectively; (m) SEQ ID NOs: 893 and 919, respectively; (n) SEQ ID NOs: 894 and 920, respectively; (o) SEQ ID NOs: 904 and 931, respectively; (p) SEQ ID NOs: 895 and 921, respectively; (q) SEQ ID NOs: 905 and 932, respectively; (r) SEQ ID NOs: 896 and 922, respectively; (s) SEQ ID NOs: 911 and 938, respectively; (t) SEQ ID NOs: 906 and 933, respectively; (u) SEQ ID NOs: 897 and 923, respectively; (v) SEQ ID NOs: 907 and 934, respectively; (w) SEQ ID NOs: 908 and 935, respectively; (x) SEQ ID NOs: 903 and 929, respectively; (y) SEQ ID NOs: 901 and 927, respectively; (z) SEQ ID NOs: 874 and 881, respectively; (aa) SEQ ID NOs: 902 and 928, respectively; (bb) SEQ ID NOs: 873 and 880, respectively; (cc) SEQ ID NOs: 872 and 879, respectively; (dd) SEQ ID NOs: 898 and 924, respectively; (ee) SEQ ID NOs: 899 and 925, respectively; (ff) SEQ ID NOs: 900 and 926, respectively; and (gg) SEQ ID NOs: 909 and 936, respectively The present invention also includes a sense strand and an antisense strand comprising a nucleotide sequence selected from the group consisting of:

[0089] In some embodiments, the dsRNAi oligonucleotide comprises: (a) SEQ ID NOs: 887 and 913, respectively; (b) SEQ ID NOs: 891 and 917, respectively; (c) SEQ ID NOs: 892 and 918, respectively; (d) SEQ ID NOs: 894 and 920, respectively; (e) SEQ ID NOs: 897 and 923, respectively; and (f) SEQ ID NOs: 909 and 936, respectively. The present invention also includes a sense strand and an antisense strand comprising a nucleotide sequence selected from the group consisting of:

[0090] In some embodiments, the sense strand comprises the sequence of SEQ ID NO:887 and the antisense strand comprises the sequence of SEQ ID NO:913. In some embodiments, the sense strand comprises the sequence of SEQ ID NO:891 and the antisense strand comprises the sequence of SEQ ID NO:917. In some embodiments, the sense strand comprises the sequence of SEQ ID NO:892 and the antisense strand comprises the sequence of SEQ ID NO:918. In some embodiments, the sense strand comprises the sequence of SEQ ID NO:894 and the antisense strand comprises the sequence of SEQ ID NO:920. In some embodiments, the sense strand comprises the sequence of SEQ ID NO:897 and the antisense strand comprises the sequence of SEQ ID NO:923. In some embodiments, the sense strand comprises the sequence of SEQ ID NO:909 and the antisense strand comprises the sequence of SEQ ID NO:936.

[0091] It should be recognized that in some embodiments, the sequences presented in the sequence listing may be referenced in describing the structure of an oligonucleotide (e.g., dsRNAi oligonucleotide) or other nucleic acid. In such embodiments, the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., RNA counterparts of DNA nucleotides or DNA counterparts of RNA nucleotides), and / or one or more modified nucleotides, and / or one or more modified internucleotide linkages, and / or one or more other modifications when compared to a specific sequence, while maintaining essentially the same or similar complementary properties as the specific sequence.

[0092] In some embodiments, the dsRNAi oligonucleotide herein comprises a sense strand of 25 nucleotides and an antisense strand of 27 nucleotides, which when acted by dicer enzyme, results in the antisense strand being incorporated into mature RISC.In some embodiments, the sense strand of dsRNA is longer than 27 nucleotides (for example, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides).In some embodiments, the sense strand of dsRNA is longer than 25 nucleotides (for example, 26, 27, 28, 29 or 30 nucleotides). In some embodiments, the sense strand of the dsRNA comprises a nucleotide sequence selected from SEQ ID NOs: 4-387, wherein the nucleotide sequence is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand of the dsRNA comprises a nucleotide sequence selected from SEQ ID NOs: 4-387, wherein the nucleotide sequence is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).

[0093] In some embodiments, the oligonucleotides herein have one 5' end that is less thermodynamically stable when compared to the other 5' end. In some embodiments, asymmetric oligonucleotides are provided that include a blunt end at the 3' end of the sense strand and a 3' overhang at the 3' end of the antisense strand. In some embodiments, the 3' overhang on the antisense strand is about 1-8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7 or 8 nucleotides in length). Typically, dsRNAi oligonucleotides have a 2 nucleotide overhang at the 3' end of the antisense (guide) strand. However, other overhangs are possible. In some embodiments, the overhang is a 3' overhang that includes 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5 or 6 nucleotides in length. However, in some embodiments, the overhang is a 5' overhang comprising 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 4-387, and a 5' overhang comprising 1-6 nucleotides in length. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4-387, wherein the oligonucleotide comprises a 5' overhang comprising 1-6 nucleotides in length. In some embodiments, the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 388-771, wherein the oligonucleotide comprises a 5' overhang comprising 1-6 nucleotides in length.In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4-387, and an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 388-771, wherein the oligonucleotide comprises a 5' overhang comprising 1-6 nucleotides in length.

[0094] In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are modified. In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are complementary to the target mRNA (e.g., KHK mRNA). In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are not complementary to the target mRNA. In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein are unpaired. In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein comprise unpaired GG. In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein are not complementary to the target mRNA. In some embodiments, the two terminal nucleotides at the 3' end of each of the dsRNAi oligonucleotides are GG. Typically, one or both of the two terminal GG nucleotides at the 3' end of each of the double-stranded oligonucleotides are not complementary to the target mRNA. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, wherein the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein comprise unpaired GG. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, wherein the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein comprise unpaired GG. In some embodiments, the oligonucleotide comprises an antisense strand that comprises a nucleotide sequence selected from SEQ ID NOs: 388-771, wherein the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein comprise unpaired GG.In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4-387, and an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 388-771, wherein the two terminal nucleotides at the 3' end of the antisense strand of the dsRNAi oligonucleotide herein comprise unpaired GG.

[0095] In some embodiments, there are one or more (e.g., 1, 2, 3, 4, or 5) mismatches between the sense strand and the antisense strand. If there is more than one mismatch between the sense strand and the antisense strand, they may be located consecutively (e.g., 2, 3, or more in a row) or may be scattered throughout the complementary region. In some embodiments, the 3' end of the sense strand contains one or more mismatches. In some embodiments, two mismatches are incorporated into the 3' end of the sense strand. In some embodiments, base mismatches or destabilization of the segment at the 3' end of the sense strand of the dsRNAi oligonucleotide improve or increase the potency of the dsRNAi oligonucleotide. In some embodiments, the sense and antisense strands of the oligonucleotide are: (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. wherein there are one or more (e.g., 1, 2, 3, 4, or 5) mismatches between the sense and antisense strands.

[0096] Antisense strand In some embodiments, the antisense strand of dsRNAi oligonucleotide is referred to as "guide strand".For example, the antisense strand, which participates in RNA-induced silencing complex (RISC), binds to Argonaute protein such as Ago2, or participates in or binds to one or more similar factors, as the antisense strand, and directs the silencing of target gene, is referred to as guide strand.In some embodiments, the sense strand that is complementary to guide strand can be referred to as "passenger strand".

[0097] In some embodiments, the dsRNAi oligonucleotides herein comprise an antisense strand that is at most about 50 nucleotides in length (e.g., at most 50, at most 40, at most 35, at most 30, at most 27, at most 25, at most 21, at most 19, at most 17, or at most 12 nucleotides in length). In some embodiments, the dsRNAi oligonucleotides comprise an antisense strand that is at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 22, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length). In some embodiments, the dsRNAi oligonucleotide comprises an antisense strand ranging in length from about 12 to about 40 (e.g., 12-40, 12-36, 12-32, 12-28, 15-40, 15-36, 15-32, 15-28, 17-22, 17-25, 19-27, 19-30, 20-40, 22-40, 25-40, or 32-40) nucleotides. In some embodiments, the dsRNAi oligonucleotide comprises an antisense strand ranging in length from 15 to 30 nucleotides. In some embodiments, the antisense strand of any one of the dsRNAi oligonucleotides disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length. In some embodiments, the dsRNAi oligonucleotide comprises an antisense strand that is 22 nucleotides in length.

[0098] In some embodiments, the dsRNAi oligonucleotides disclosed herein for targeting KHK comprise an antisense strand that comprises or consists of a sequence set forth in any one of SEQ ID NOs: 388-771. In some embodiments, the dsRNAi oligonucleotides herein comprise an antisense strand that comprises at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 388-771. In some embodiments, the dsRNAi oligonucleotides disclosed herein for targeting KHK comprise an antisense strand that comprises or consists of a sequence set forth in any one of SEQ ID NOs: 879-885 and 912-938. In some embodiments, the dsRNAi oligonucleotides herein comprise an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 879-885 and 912-938. In some embodiments, the dsRNAi oligonucleotides disclosed herein for targeting KHK comprise an antisense strand comprising or consisting of a sequence set forth in any one of SEQ ID NOs: 913, 917, 918, 920, 923, and 936. In some embodiments, the dsRNAi oligonucleotides herein comprise an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 913, 917, 918, 920, 923, and 936. In some embodiments, the dsRNAi oligonucleotides herein comprise an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs:948-953.

[0099] Sense strand In some embodiments, the dsRNAi oligonucleotides disclosed herein for targeting KHK mRNA and inhibiting KHK expression comprise a sense strand sequence as set forth in any one of SEQ ID NOs: 4-387. In some embodiments, the dsRNAi oligonucleotides have a sense strand comprising at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 4-387. In some embodiments, the dsRNAi oligonucleotides disclosed herein for targeting KHK mRNA and inhibiting KHK expression comprise a sense strand sequence as set forth in any one of SEQ ID NOs: 872-878 and 886-911. In some embodiments, the dsRNAi oligonucleotide has a sense strand that comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 872-878 and 886-911. In some embodiments, the dsRNAi oligonucleotide disclosed herein for targeting KHK mRNA and inhibiting KHK expression comprises a sense strand sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909. In some embodiments, the dsRNAi oligonucleotide has a sense strand that includes at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909.

[0100] In some embodiments, the dsRNAi oligonucleotides herein comprise a sense strand (or passenger strand) of up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 36, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, the dsRNAi oligonucleotides may have a sense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 36, or at least 38 nucleotides in length). In some embodiments, the oligonucleotide may have a sense strand ranging in length from about 12 to about 50 (e.g., 12-50, 12-40, 12-36, 12-32, 12-28, 15-40, 15-36, 15-32, 15-28, 17-21, 17-25, 19-27, 19-30, 20-40, 22-40, 25-40, or 32-40) nucleotides. In some embodiments, the dsRNAi oligonucleotide comprises a sense strand 15-50 nucleotides in length. In some embodiments, the dsRNAi oligonucleotide comprises a sense strand 18-36 nucleotides in length. In some embodiments, the oligonucleotides may have a sense strand that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the dsRNAi oligonucleotides comprise a sense strand that is 36 nucleotides in length.

[0101] In some embodiments, the sense strand comprises a stem-loop structure at its 3' end. In some embodiments, the stem-loop is formed by intrastrand base pairing. In some embodiments, the sense strand comprises a stem-loop structure at its 5' end. In some embodiments, the stem is a duplex of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 nucleotides in length. In some embodiments, the stem-loop provides protection of the dsRNAi oligonucleotide against degradation (e.g., enzymatic degradation), facilitates or improves targeting and / or delivery to a target cell, tissue or organ (e.g., liver), or both. For example, in some embodiments, the loop of the stem-loop provides a nucleotide comprising one or more modifications that facilitate, improve, or increase targeting to a target mRNA (e.g., KHK mRNA), inhibiting target gene expression (e.g., KHK expression), and / or delivery to a target cell, tissue or organ (e.g., liver), or a combination thereof. In some embodiments, the stem loop itself or modifications to the stem loop do not substantially affect the inherent gene expression inhibitory activity of the dsRNAi oligonucleotide, but facilitate, improve or increase the stability (e.g., provide protection against degradation) and / or delivery of the oligonucleotide to a target cell, tissue or organ (e.g., liver). In certain embodiments, the dsRNAi oligonucleotide comprises a sense strand that comprises (e.g., at its 3' end) a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2, and L forms a single-stranded loop between S1 and S2 that is at most about 10 nucleotides long (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides long). In some embodiments, the loop (L) is 3 nucleotides long. In some embodiments, the loop (L) is 4 nucleotides long.In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, and the oligonucleotide comprises a sense strand (e.g., at its 3' end) that includes a stem-loop shown as S1-L-S2, where S1 is complementary to S2 and L forms a single-stranded loop between S1 and S2 that is up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length). In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, and the oligonucleotide comprises a sense strand (e.g., at its 3' end) that includes a stem loop depicted as S1-L-S2, where S1 is complementary to S2 and L forms a single-stranded loop between S1 and S2 that is up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length). In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 872-878 and 886-911, and the oligonucleotide comprises a sense strand (e.g., at its 3' end) that includes a stem loop depicted as S1-L-S2, where S1 is complementary to S2 and L forms a single-stranded loop between S1 and S2 up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length). In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909 nucleotides, and the oligonucleotide comprises a sense strand (e.g., at its 3' end) that includes a stem loop depicted as S1-L-S2, where S1 is complementary to S2 and L forms a single-stranded loop between S1 and S2 up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length).

[0102] In some embodiments, the loop (L) of the stem loop having the structure S1-L-S2 described above is a triloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, and a triloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, and a triloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 of any one of SEQ ID NOs: 872-878 and 886-911, and a triloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 887, 891, 892, 894, 897, and 909, and a triloop. In some embodiments, the triloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, delivery ligands, and combinations thereof.

[0103] In some embodiments, the loop (L) of the stem loop having the structure S1-L-S2 described above is a tetraloop (e.g., in a nicked tetraloop structure) and comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 4-387, and a tetraloop. In some embodiments, the loop (L) of the stem loop having the structure S1-L-S2 described above is a tetraloop (e.g., in a nicked tetraloop structure) and comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides 1-19 in any one of SEQ ID NOs: 4-387, and a tetraloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 872-878 and 886-911, and a tetraloop. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous sequence of nucleotides in any one of SEQ ID NOs: 887, 891, 892, 894, 897, and 909, and a tetraloop. In some embodiments, the tetraloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, delivery ligands, and combinations thereof. In some embodiments, the dsRNAi oligonucleotides herein comprise a sense strand comprising a nucleotide sequence selected from SEQ ID NOs:942-947.

[0104] Length of duplex In some embodiments, the duplex formed between the sense strand and the antisense strand is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, the duplex formed between the sense strand and the antisense strand is within the range of 12-30 nucleotides in length (e.g., 12-30, 12-27, 12-22, 15-25, 18-30, 18-22, 18-25, 18-27, 18-30, 19-30, or 21-30 nucleotides in length). In some embodiments, the duplex formed between the sense strand and the antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the duplex formed between the sense strand and the antisense strand does not span the entire length of the sense strand and / or the antisense strand. In some embodiments, the duplex between the sense strand and the antisense strand spans the entire length of either the sense strand or the antisense strand. In some embodiments, the duplex between the sense strand and the antisense strand spans the entire length of both the sense strand and the antisense strand. In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the duplex formed between the sense strand and the antisense strand is within the range of 12 to 30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length).

[0105] Oligonucleotide End In some embodiments, the dsRNAi oligonucleotides herein comprise a sense strand and an antisense strand, such that there is a 3' overhang on either the sense strand or the antisense strand, or on both the sense strand and the antisense strand. In some embodiments, the dsRNAi oligonucleotides herein comprise a sense strand and an antisense strand, which are separate strands forming an asymmetric duplex region with an overhang on the 3' end of the antisense strand. In some embodiments, the dsRNAi oligonucleotides provided herein have one 5' end that is less thermodynamically stable than the other 5' end. In some embodiments, asymmetric dsRNAi oligonucleotides are provided that comprise a blunt end on the 3' end of the sense strand and an overhang on the 3' end of the antisense strand. In some embodiments, the 3' overhang on the antisense strand is 1-8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length). In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the antisense strand comprises a 3' overhang 1 to 8 nucleotides in length (eg, 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length).

[0106] Typically, oligonucleotides for RNAi have a 2-nucleotide overhang at the 3' end of the antisense (guide) strand. However, other overhangs are possible. In some embodiments, the overhang is a 3' overhang comprising 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, the overhang is a 5' overhang comprising 1-6 nucleotides, optionally 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-5, 5-6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the antisense strand comprises a 5' overhang of 1 to 6 nucleotides in length.

[0107] In some embodiments, one or more (e.g., 2, 3, 4) terminal nucleotides at the 3'-end or 5'-end of the sense strand and / or antisense strand are modified. For example, in some embodiments, one or two terminal nucleotides at the 3'-end of the antisense strand are modified. In some embodiments, the last nucleotide at the 3'-end of the antisense strand is modified, for example, includes a 2' modification, for example, 2'-O-methoxyethyl. In some embodiments, the last one or two terminal nucleotides at the 3'-end of the antisense strand are complementary to the target. In some embodiments, the last one or two nucleotides at the 3'-end of the antisense strand are not complementary to the target.

[0108] In some embodiments, the dsRNAi oligonucleotide herein comprises a stem-loop structure at the 3' end of the sense strand and comprises two terminal overhang nucleotides at the 3' end of the antisense strand.In some embodiments, the dsRNAi oligonucleotide herein comprises a nicked tetraloop structure, where the 3' end of the sense strand comprises a stem-loop structure and comprises two terminal overhang nucleotides at the 3' end of the antisense strand.In some embodiments, the two terminal overhang nucleotides are GG.Typically, one or both of the two terminal GG nucleotides of the antisense strand are not complementary to the target. In some embodiments, the 5' and / or 3' end of the sense or antisense strand comprises an inverted cap nucleotide.

[0109] In some embodiments, one or more (e.g., 2, 3, 4, 5, 6) modified internucleotide linkages are provided between the terminal nucleotides at the 3' or 5' ends of the sense and / or antisense strands. In some embodiments, modified internucleotide linkages are provided between overhanging nucleotides at the 3' or 5' ends of the sense and / or antisense strands.

[0110] Oligonucleotide Modification In some embodiments, the dsRNAi oligonucleotides described herein comprise modifications.Oligonucleotides (e.g., dsRNAi oligonucleotides) can be modified in a variety of ways to improve or control specificity, stability, delivery, bioavailability, resistance to nuclease degradation, immunogenicity, base pairing properties, RNA distribution and cellular uptake, and other characteristics related to therapeutic or research use.

[0111] In some embodiments, the modification is a modified sugar. In some embodiments, the modification is a 5'-terminal phosphate group. In some embodiments, the modification is a modified internucleotide linkage. In some embodiments, the modification is a modified base. In some embodiments, the oligonucleotides described herein may include any one of the modifications described herein or any combination thereof. For example, in some embodiments, the oligonucleotides described herein include at least one modified sugar, a 5'-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base. In some embodiments, the sense and antisense strands of the oligonucleotides include (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the oligonucleotide comprises at least one modified sugar, a 5'-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base.

[0112] The number of modifications in an oligonucleotide (e.g., dsRNAi oligonucleotide) and the position of the nucleotide modifications can affect the properties of the oligonucleotide. For example, oligonucleotides can be delivered in vivo by conjugating them to or incorporating them into lipid nanoparticles (LNPs) or similar carriers. However, when an oligonucleotide is not protected by an LNP or similar carrier, it can be advantageous to modify at least a portion of the nucleotides. Thus, in some embodiments, all or substantially all of the nucleotides of an oligonucleotide are modified. In some embodiments, more than half of the nucleotides are modified. In some embodiments, less than half of the nucleotides are modified. In some embodiments, the sugar moieties of all nucleotides that make up the oligonucleotide are modified at the 2' position. Modifications can be reversible or irreversible. In some embodiments, the oligonucleotides disclosed herein have sufficient number and type of modified nucleotides to cause the desired characteristics (e.g., protection from enzymatic degradation, ability to target desired cells after in vivo administration, and / or thermodynamic stability).

[0113] sugar modification In some embodiments, the dsRNAi oligonucleotides described herein comprise modified sugars. In some embodiments, modified sugars (also referred to herein as sugar analogs) comprise modified deoxyribose or ribose moieties, for example, where one or more modifications occur at the 2', 3', 4' and / or 5' carbon position of the sugar. In some embodiments, modified sugars can also comprise unnatural alternative carbon structures, such as those found in locked nucleic acids ("LNA"; see, for example, Koshkin et al. (1998) TETRAHEDON 54:3607-30), non-locked nucleic acids ("UNA"; see, for example, Snead et al. (2013) MOL. THER-NUCL. ACIDS 2:e103), and bridged nucleic acids ("BNA"; see, for example, Imanishi & Obika (2002) CHEM COMMUN. (CAMB) 21:1653-59).

[0114] In some embodiments, the nucleotide modification at the sugar comprises a 2'-modification. In some embodiments, the 2'-modification may be 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-fluoro (2'-F), 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA) or 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the modification is 2'-F, 2'-OMe or 2'-MOE. In some embodiments, the modification at the sugar comprises a modification of the sugar ring, which may comprise a modification of one or more carbons of the sugar ring. For example, modifications of the sugar of a nucleotide can include the 2'-oxygen of the sugar linked to the 1'-carbon or 4'-carbon of the sugar, or the 2'-oxygen linked to the 1'-carbon or 4'-carbon through an ethylene or methylene bridge. In some embodiments, modified nucleotides have acyclic sugars that lack a 2'-carbon to 3'-carbon bond. In some embodiments, modified nucleotides have a thiol group, for example at the 4' position of the sugar.

[0115] In some embodiments, the dsRNAi oligonucleotides described herein comprise at least about one modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, or more). In some embodiments, the sense strand of the dsRNAi oligonucleotide comprises at least about one modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or more). In some embodiments, the antisense strand of the dsRNAi oligonucleotide comprises at least about one modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, or more). In some embodiments, all nucleotides of the sense strand of the dsRNAi oligonucleotide are modified. In some embodiments, all nucleotides of the antisense strand of the dsRNAi oligonucleotide are modified. In some embodiments, all nucleotides of the dsRNAi oligonucleotide (i.e., both the sense strand and the antisense strand) are modified. In some embodiments, the modified nucleotides include 2'-modifications (e.g., 2'-F or 2'-OMe, 2'-MOE, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid).

[0116] In some embodiments, the present disclosure provides dsRNAi oligonucleotides with different modification patterns.Exemplary modification patterns are shown in US Provisional Application No. 62 / 909,278 and WO2021 / 067744, both of which are incorporated herein by reference.In some embodiments, the modified dsRNAi oligonucleotides include the sense strand sequence with the modification pattern shown in the examples and sequence listing, and the antisense strand with the modification pattern shown in the examples and sequence listing.

[0117] In some embodiments, the dsRNAi oligonucleotide disclosed herein comprises an antisense strand that comprises 2'-F modified nucleotides. In some embodiments, the dsRNAi oligonucleotide disclosed herein comprises an antisense strand that comprises 2'-F and 2'-OMe modified nucleotides. In some embodiments, the dsRNAi oligonucleotide disclosed herein comprises a sense strand that comprises 2'-F modified nucleotides. In some embodiments, the dsRNAi oligonucleotide disclosed herein comprises a sense strand that comprises 2'-F and 2'-OMe modified nucleotides.

[0118] In some embodiments, the dsRNAi oligonucleotides described herein comprise a sense strand in which about 10-15%, 10%, 11%, 12%, 13%, 14% or 15% of the nucleotides of the sense strand comprise a 2'-fluoro modification. In some embodiments, about 11% of the nucleotides of the sense strand comprise a 2-fluoro modification. In some embodiments, the dsRNAi oligonucleotides described herein comprise an antisense strand in which about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% of the nucleotides of the antisense strand comprise a 2'-fluoro modification. In some embodiments, about 32% of the nucleotides of the antisense strand comprise a 2'-fluoro modification. In some embodiments, the dsRNAi oligonucleotide has about 15-25%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25% of its nucleotides that contain 2'-fluoro modifications. In some embodiments, about 19% of the nucleotides in the dsRNAi oligonucleotide contain 2'-fluoro modifications.

[0119] In some embodiments, one or more of positions 8, 9, 10, or 11 of the sense strand are modified with a 2'-F group. In some embodiments, one or more of positions 3, 8, 9, 10, 12, 13, and 17 of the sense strand are modified with a 2'-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are modified with a 2'-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 of the antisense strand are modified with a 2'-F group. In some embodiments, the sugar moieties of each of the nucleotides at positions 1-7 and 12-20 of the sense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of each of the nucleotides at positions 1-7, 12-27, and 31-36 of the sense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of the nucleotides at positions 1-2, 4-7, 11, 14-16, and 18-20 of the sense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of the nucleotides at positions 1-2, 4-7, 11, 14-16, 18-27, and 31-36 of the sense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of the nucleotides at positions 1, 6, 8-9, 11-13, and 15-22 of the antisense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of the nucleotides at positions 6, 9, 11-13, 15, 17, 18, and 20-22 of the antisense strand are modified with 2'-OMe. In some embodiments, the sugar moieties of the nucleotides at positions 1, 6, 9, 11-13, 15, 17, 18, and 20-22 of the antisense strand are modified with 2'-OMe.

[0120] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more of positions 8, 9, 10 or 11 of the sense strand is modified with a 2'-F group.

[0121] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more of positions 3, 8, 9, 10, 12, 13 and 17 of the sense strand are modified with a 2'-F group.

[0122] In some embodiments, the antisense strand has three nucleotides in which the 2' position of the sugar moiety is modified with 2'-F. In some embodiments, the sugar moieties at positions 2, 5, and 14, and optionally up to three of the nucleotides at positions 1, 3, 7, and 10 of the antisense strand, are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 2, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 1, 2, 5, and 14 of the antisense strand are modified with 2'-F. In yet other embodiments, the sugar moieties at each of positions 1, 2, 3, 5, 7, and 14 of the antisense strand are modified with 2'-F. In yet another embodiment, the sugar moieties at each of positions 1, 2, 3, 5, 10, and 14 of the antisense strand are modified with 2'-F. In another embodiment, the sugar moieties at each of positions 2, 3, 5, 7, 10, and 14 of the antisense strand are modified with 2'-F.

[0123] In some embodiments, the antisense strand has three nucleotides in which the 2' position of the sugar moiety is modified with 2'-F. In some embodiments, the sugar moieties at positions 2, 5, and 14, and optionally up to three of the nucleotides at positions 3, 4, 7, and 10 of the antisense strand, are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 2, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 2, 4, 5, and 14 of the antisense strand are modified with 2'-F. In yet other embodiments, the sugar moieties at each of positions 2, 3, 4, 5, 7, and 14 of the antisense strand are modified with 2'-F. In yet another embodiment, the sugar moieties at each of positions 2, 3, 4, 5, 10, and 14 of the antisense strand are modified with 2'-F. In another embodiment, the sugar moieties at each of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are modified with 2'-F. In some embodiments, the sugar moieties at each of positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 are modified with a 2'-F.

[0124] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more sugar moieties at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand are modified with 2'-F.

[0125] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more of the sugar moieties at positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 of the antisense strand are modified with a 2'-F group.

[0126] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2 and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 5, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 1, 2, 5, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 1, 2, 3, 5, 7, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 1, 2, 3, 5, 10, and 14 modified with 2'-F.

[0127] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2 and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 5, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 4, 5, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 3, 4, 5, 7, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 3, 4, 5, 10, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 3, 4, 5, 7, 10, and 14 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having sugar moieties at positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 modified with 2'-F.

[0128] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more of positions 8, 9, 10 or 11 of the sense strand and one or more of positions 2, 3, 4, 5, 7, 10 and 14 of the antisense strand are modified with a 2'-F group.

[0129] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein one or more of positions 3, 8, 9, 10, 12, 13 and 17 of the sense strand and one or more of positions 2, 3, 4, 5, 7, 8, 10, 14, 16 and 19 of the antisense strand are modified with 2'-F.

[0130] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 5, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 1, 2, 5, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0131] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 4, 5, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0132] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 1, 2, 3, 5, 7, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 3, 4, 5, 7, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0133] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 1, 2, 3, 5, 10, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0134] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 3, 4, 5, 10, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0135] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 3, 5, 7, 10, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0136] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having each sugar moiety of the nucleotides at positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 of the antisense strand modified with 2'-F, and each sugar moiety of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0137] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having a sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise an antisense strand having a sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 that is 2'-OMe modified.

[0138] In some embodiments, the oligonucleotides provided herein comprise an antisense strand having a sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0139] In some embodiments, the oligonucleotides provided herein comprise a sense strand having sugar moieties at positions 8-11 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise a sense strand having sugar moieties at positions 3, 8, 9, 10, 12, 13, and 17 modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise a sense strand having sugar moieties at positions 1-7 and 12-17 or 12-20 modified with 2'OMe. In some embodiments, the oligonucleotides provided herein comprise a sense strand having sugar moieties at each of nucleotides 1-7 and 12-17 or 12-20 of the sense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the oligonucleotides provided herein comprise a sense strand having sugar moieties at positions 1-2, 4-7, 11, 14-16, and 18-20 modified with 2'OMe. In some embodiments, the oligonucleotides provided herein comprise a sense strand having a sugar moiety at each of the nucleotides at positions 1-2, 4-7, 11, 14-16, and 18-20 of the sense strand modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA).

[0140] In some embodiments, the oligonucleotides provided herein comprise a sense strand having a sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 that is modified with 2'-F. In some embodiments, the oligonucleotides provided herein comprise a sense strand having a sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 that is 2'-OMe modified.

[0141] In some embodiments, the oligonucleotides provided herein include 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), and 2'-deoxy-2'-fluoro-β-d-arabinyl. and a sense strand having sugar moieties at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 modified with a modification selected from the group consisting of: bino nucleic acid (2'-FANA).

[0142] 5'-Terminal Phosphate In some embodiments, the oligonucleotides described herein include a 5'-terminal phosphate. In some embodiments, the 5'-terminal phosphate group of the RNAi oligonucleotide enhances the interaction with Ago2. However, oligonucleotides containing a 5'-phosphate group may be susceptible to degradation via phosphatases or other enzymes, which may limit their bioavailability in vivo. In some embodiments, the oligonucleotides (e.g., double-stranded oligonucleotides) herein include a 5' phosphate analog that is resistant to such degradation. In some embodiments, the phosphate analog is an oxymethylphosphonate, vinylphosphonate, or malonylphosphonate, or a combination thereof. In certain embodiments, the 5' end of the oligonucleotide strand is attached to a chemical moiety that mimics the electrostatic and steric properties of a natural 5'-phosphate group (a "phosphate mimic"). In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the oligonucleotide comprises a 5'-terminal phosphate.

[0143] In some embodiments, the oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar (referred to as a "4'-phosphate analog"). See, for example, International Patent Application Publication No. WO2018 / 045317. In some embodiments, the oligonucleotide herein comprises a 4'-phosphate analog at the 5'-terminal nucleotide. In some embodiments, the phosphate analog is an oxymethylphosphonate, where the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., its 4'-carbon) or an analog thereof. In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or an aminomethylphosphonate, where the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is attached to the 4'-carbon of the sugar moiety or an analog thereof. In certain embodiments, the 4'-phosphate analog is an oxymethylphosphonate. In some embodiments, the oxymethylphosphonate is represented by the formula -O-CH2-PO(OH)2, -O-CH2-PO(OR)2, or -O-CH2-POOH(R), where R is independently selected from H, CH3, an alkyl group, CH2CH2CN, CH2OCOC(CH3)3, CHOCH2CH2Si(CH3)3, or a protecting group. In certain embodiments, the alkyl group is CH2CH3. More typically, R is independently selected from H, CH3, or CH2CH3. In some embodiments, R is CH3. In some embodiments, the 4'-phosphate analog is 5'-methoxyphosphonate-4'-oxy.

[0144] In some embodiments, the dsRNAi oligonucleotides provided herein comprise an antisense strand that comprises a 4'-phosphate analog at the 5' terminal nucleotide, where the 5' terminal nucleotide comprises the following structure: [ka] 5'-Methoxyphosphonate-4'-oxy-2'-O-methyluridine phosphorothioate [Mephosphonate-4O-mUs]

[0145] Modified internucleotide linkages In some embodiments, the oligonucleotides herein (e.g., dsRNAi oligonucleotides) comprise modified internucleotide linkages. In some embodiments, the phosphate modifications or substitutions result in an oligonucleotide comprising at least about one (e.g., at least one, at least two, at least three, or at least five) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein comprises from about one to about ten (e.g., from one to ten, two to eight, four to six, three to ten, five to ten, one to five, one to three, or one to two) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.

[0146] The modified internucleotide linkage may be a phosphorodithioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thioalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage, or a boranophosphate linkage. In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides disclosed herein is a phosphorothioate linkage.

[0147] In some embodiments, the oligonucleotides provided herein (e.g., dsRNAi oligonucleotides) have phosphorothioate linkages between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotides described herein have phosphorothioate linkages between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand, respectively. In some embodiments, the sense and antisense strands of the oligonucleotides are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein the oligonucleotide comprises a modified internucleotide linkage. In some embodiments, the sense and antisense strands of the oligonucleotide comprise: (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein the oligonucleotide comprises phosphorothioate linkages between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the sense and antisense strands of the oligonucleotide comprise: (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein the oligonucleotide comprises phosphorothioate linkages between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand, respectively.

[0148] Base Modification In some embodiments, the oligonucleotides herein (e.g., dsRNAi oligonucleotides) have one or more modified nucleobases. In some embodiments, the modified nucleobase (also referred to herein as a base analog) is linked to the 1' position of a nucleotide sugar moiety. In certain embodiments, the modified nucleobase is a nitrogenous base. In certain embodiments, the modified nucleobase does not contain a nitrogen atom. See, e.g., U.S. Patent Application Publication No. 2008 / 0274462. In some embodiments, the modified nucleotide comprises a universal base. In some embodiments, the modified nucleotide does not contain a nucleobase (abasic). In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: wherein the oligonucleotide comprises one or more modified nucleobases.

[0149] In some embodiments, a universal base is a heterocyclic moiety located at the 1' position of a nucleotide sugar moiety of a modified nucleotide, or at an equivalent position of a nucleotide sugar moiety substitution, which, when present in a duplex, may be located opposite more than one type of base without substantially altering the structure of the duplex. In some embodiments, compared to a reference single-stranded nucleic acid (e.g., an oligonucleotide) that is perfectly complementary to a target nucleic acid, a single-stranded nucleic acid containing a universal base has a lower T than a duplex formed with a complementary nucleic acid. m In some embodiments, a single stranded nucleic acid containing a universal base has a higher T than a duplex formed with a nucleic acid containing a mismatched base, when compared to a reference single stranded nucleic acid in which the universal base is replaced with a base resulting in a single mismatch. m The nucleic acid forms a duplex with a target nucleic acid having the formula:

[0150] Non-limiting examples of universal binding nucleotides include, but are not limited to, inosine, 1-β-D-ribofuranosyl-5-nitroindole, and / or 1-β-D-ribofuranosyl-3-nitropyrrole (see U.S. Patent Application Publication No. 2007 / 0254362; Van Aerschot et al. (1995) NUCLEIC ACIDS RES. 23:4363-4370; Loakes et al. (1995) NUCLEIC ACIDS RES. 23:2361-66; and Loakes & Brown (1994) NUCLEIC ACIDS RES. 22:4039-43).

[0151] Targeting Ligands In some embodiments, it is desirable to target the oligonucleotides (e.g., dsRNAi oligonucleotides) of the present disclosure to one or more cells or one or more organs. Such a strategy may help to avoid undesirable effects in other organs or to avoid excessive loss of oligonucleotides to cells, tissues or organs that would not benefit from the oligonucleotide. Thus, in some embodiments, the oligonucleotides (e.g., dsRNAi oligonucleotides) disclosed herein are modified to facilitate targeting and / or delivery to a particular tissue, cell or organ (e.g., to facilitate delivery of the oligonucleotide to the liver). In some embodiments, the oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligands. In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the oligonucleotide comprises a targeting ligand conjugated to at least one nucleotide.

[0152] In some embodiments, the targeting ligand comprises carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein or protein part (e.g., antibody or antibody fragment), or lipid. In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand may be RGD peptide used to target tumor vasculature or glioma cells, CREKA peptide to target tumor vasculature or stoma, transferrin, lactoferrin or aptamer to target transferrin receptor expressed in CNS vasculature, or anti-EGFR antibody to target EGFR in glioma cells. In certain embodiments, the targeting ligand is one or more GalNAc moieties.

[0153] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, 2-4 nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, the targeting ligand is conjugated to 2-4 nucleotides at either the end of the sense strand or the antisense strand (e.g., the targeting ligand is conjugated to a 2-4 nucleotide overhang or extension at the 5' or 3' end of the sense strand or the antisense strand), such that the targeting ligand resembles a toothbrush bristles and the oligonucleotide resembles a toothbrush. For example, the oligonucleotide may include a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, or 4 nucleotides of the stem loop may be individually conjugated to a targeting ligand. In some embodiments, oligonucleotides (e.g., dsRNAi oligonucleotides) provided by the present disclosure comprise a stem-loop at the 3' end of the sense strand, wherein the loop of the stem-loop comprises a tri-loop or a tetra-loop, and wherein the 3 or 4 nucleotides comprised in the tri-loop or tetra-loop, respectively, are individually conjugated to a targeting ligand.

[0154] GalNAc is a high affinity ligand for ASGPR, which is mainly expressed on the sinusoidal surface of hepatocytes and plays a major role in binding, internalization and subsequent removal of circulating glycoproteins (asialoglycoproteins) that contain terminal galactose or GalNAc residues.Conjugation (either indirectly or directly) of GalNAc moieties to the oligonucleotides of the present disclosure can be used to target these oligonucleotides to ASGPR expressed on cells.In some embodiments, the oligonucleotides of the present disclosure are conjugated to at least one or more GalNAc moieties, where the GalNAc moieties target the oligonucleotide to ASGPR expressed on human liver cells (e.g., human hepatocytes).In some embodiments, the GalNAc moieties target the oligonucleotide to the liver.

[0155] In some embodiments, the oligonucleotide of the present disclosure is directly or indirectly conjugated to monovalent GalNAc.In some embodiments, the oligonucleotide is directly or indirectly conjugated to more than one monovalent GalNAc (i.e., conjugated to 2, 3 or 4 monovalent GalNAc moieties, typically conjugated to 3 or 4 monovalent GalNAc moieties).In some embodiments, the oligonucleotide is conjugated to one or more divalent GalNAc, trivalent GalNAc or tetravalent GalNAc moieties.

[0156] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a GalNAc moiety. In some embodiments, 2-4 nucleotides of the tetraloop are each conjugated to a separate GalNAc. In some embodiments, 1-3 nucleotides of the triloop are each conjugated to a separate GalNAc. In some embodiments, the targeting ligand is conjugated to 2-4 nucleotides at either end of the sense or antisense strand (e.g., the ligand is conjugated to an overhang or extension of 2-4 nucleotides at the 5' or 3' end of the sense or antisense strand), such that the GalNAc moieties resemble toothbrush bristles and the oligonucleotide resembles a toothbrush. In some embodiments, the GalNAc moieties are conjugated to nucleotides of the sense strand. For example, 3 or 4 GalNAc moieties can be conjugated to nucleotides in a tetraloop of the sense strand with each GalNAc moiety conjugated to one nucleotide. In some embodiments, the tetraloop is any combination of adenine and guanine nucleotides.

[0157] In some embodiments, the tetraloop (L) is: [ka] (X=heteroatom) has a monovalent GalNAc moiety attached to any one or more guanine nucleotides of the tetraloop via any linker described herein.

[0158] In some embodiments, the tetraloop (L) is: [ka] (X=heteroatom) has a monovalent GalNAc attached to any one or more of the adenine nucleotides of the tetraloop via any linker described herein.

[0159] In some embodiments, the oligonucleotides herein have the structure: [ka] As depicted in Figure 1, the nucleotide sequence contains a monovalent GalNAc attached to a guanine nucleotide, designated [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanine-GalNAc.

[0160] In some embodiments, the oligonucleotides herein have the structure: [ka] As shown in Figure 1, the nucleotide sequence of the present invention comprises a monovalent GalNAc attached to an adenine nucleotide, designated [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc.

[0161] An example of such a conjugate is shown below for a loop comprising the nucleotide sequence GAAA from 5' to 3' (L=linker, X=heteroatom). Such a loop may be present, for example, at positions 27-30 of the sense strand provided herein, as shown in Figures 2 and 4A. In the formula: [ka] is used to describe the point of attachment to the oligonucleotide chain.

[0162] [ka]

[0163] The targeting ligand can be linked to the nucleotide using a suitable method or chemistry (e.g., click chemistry). In some embodiments, the targeting ligand is conjugated to the nucleotide using a click linker. In some embodiments, the targeting ligand is conjugated to any one of the nucleotides of the oligonucleotides described herein using an acetal-based linker. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016 / 100401. In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is stable. An example is shown below for a loop containing the nucleotide GAAA 5' to 3', where a GalNAc moiety is attached to the nucleotide of the loop using an acetal linker. Such a loop may be present, for example, at positions 27-30 of the sense strand, as shown in Figures 2 and 4A. In the chemical formula:

[0164] [ka] is the point of attachment to the oligonucleotide chain.

[0165] [ka] or TIFF2024516356000028.tif190134

[0166] As mentioned, the targeting ligand can be linked to the nucleotide using various suitable methods or chemical synthesis techniques (e.g., click chemistry). In some embodiments, the targeting ligand is conjugated to the nucleotide using a click linker. In some embodiments, the targeting ligand is conjugated to any one of the nucleotides of the oligonucleotides described herein using an acetal-based linker. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016 / 100401. In some embodiments, the linker is an unstable linker. However, in other embodiments, the linker is a stable linker.

[0167] In some embodiments, a duplex extension (e.g., up to 3, 4, 5, or 6 bp in length) is provided between the targeting ligand (e.g., the GalNAc moiety) and the dsRNA. In some embodiments, the oligonucleotide herein (e.g., the dsRNAi oligonucleotide) does not have a GalNAc conjugated thereto.

[0168] In some embodiments, the sense and antisense strands of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the oligonucleotide comprises at least one GalNAc moiety conjugated to a nucleotide.

[0169] Exemplary KHK-targeted dsRNAi oligonucleotides In some embodiments, the present disclosure provides dsRNAi oligonucleotides that target KHK mRNA and reduce KHK expression (herein referred to as KHK-targeting dsRNAi oligonucleotides), where the oligonucleotide comprises a sense strand and an antisense strand that form a duplex region, where the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, and the region of complementarity is at least 15 contiguous nucleotides in length. In some embodiments, the present disclosure provides dsRNAi oligonucleotides that target KHK mRNA and reduce KHK expression (herein referred to as KHK-targeting dsRNAi oligonucleotides), where the oligonucleotide comprises a sense strand and an antisense strand that form a duplex region, where the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, and the region of complementarity is at least 15 contiguous nucleotides in length. In some embodiments, the region of complementarity is 15-20 nucleotides in length. In some embodiments, the region of complementarity is 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the region of complementarity is at least 19 contiguous nucleotides in length. In some embodiments, the region of complementarity is at least 20 nucleotides in length. In some embodiments, the region of complementarity is 19 nucleotides in length. In some embodiments, the region of complementarity is 20 nucleotides in length.

[0170] In some embodiments, the sense strand is 15-50 nucleotides in length. In some embodiments, the sense strand is 18-36 nucleotides in length. In some embodiments, the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 909, 894, 897, 892, 891, and 887, and is 15-50 nucleotides in length. In some embodiments, the sense strand is 36 nucleotides in length. In some embodiments, the antisense strand is 15-30 nucleotides in length. In some embodiments, the antisense strand comprises a nucleotide sequence selected from SEQ ID NOs: 936, 920, 923, 917, 918, and 913, and is 15-50 nucleotides in length. In some embodiments, the antisense strand is 22 nucleotides in length. In some embodiments, the sense strand is 36 nucleotides in length and the antisense strand is 22 nucleotides in length, and the sense strand and the antisense strand form a duplex region at least 19 nucleotides in length. In some embodiments, the duplex region is 20 nucleotides in length.

[0171] In some embodiments, the KHK-targeting dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a stem loop shown as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length. In some embodiments, S1 and S2 are 1-10 nucleotides in length and are the same length. In some embodiments, S1 and S2 are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, S1 and S2 are 6 nucleotides in length. In some embodiments, the loop is 3 nucleotides in length. In some embodiments, the loop is 4 nucleotides in length. In some embodiments, the loop is 5 nucleotides in length. In some embodiments, L is a triloop or tetraloop. In some embodiments, L is a triloop. In some embodiments, L is a tetraloop. In some embodiments, the tetraloop comprises the sequence 5'-GAAA-3'. In some embodiments, the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 871). In some embodiments, up to 4 nucleotides comprising L are each conjugated to a targeting ligand. In some embodiments, 1, 2, 3, or 4 nucleotides comprising L are each conjugated to a targeting ligand. In some embodiments, 3 nucleotides comprising L are each conjugated to a targeting ligand. In some embodiments, L is a tetraloop comprising the sequence 5'-GAAA-3', where each adenosine (A) nucleoside comprising the tetraloop is conjugated to a targeting ligand comprising a monovalent N-acetylgalactosamine (GalNAc) moiety.

[0172] In some embodiments, the antisense strand comprises a 3' overhang one or more nucleotides in length. In some embodiments, the 3' overhang is 2 nucleotides in length. In some embodiments, the sequence of the 3' overhang is 5'-GG-3'.

[0173] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region at least 19 nucleotides in length, optionally 20 nucleotides in length, wherein the 3' end of the sense strand comprises a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2, and L forms a loop between S1 and S2 that is 3-5 nucleotides in length), and the antisense strand comprises a region of complementarity to any one of the KHK mRNA target sequences of SEQ ID NOs: 4-387, wherein the region of complementarity is 19 contiguous nucleotides in length, optionally 20 nucleotides in length. In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region at least 19 nucleotides in length, optionally 20 nucleotides in length, and the 3' end of the sense strand comprises a stem loop shown as S1-L-S2 (wherein S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length), and the antisense strand comprises a region of complementarity to a KHK mRNA target sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, wherein the region of complementarity is 19 contiguous nucleotides in length, optionally 20 nucleotides in length.

[0174] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises at least one modified nucleotide. In some embodiments, the modified nucleotide comprises a 5-carbon sugar (e.g., ribose) having a 2'-modification. In some embodiments, the 2'-modification is a modification selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. In some embodiments, the 2'-modification is 2'-fluoro or 2'-O-methyl. In some embodiments, all nucleotides constituting the KHK-targeting dsRNAi oligonucleotide are modified. In some embodiments, all nucleotides constituting the KHK-targeting dsRNAi oligonucleotide are modified with a 2'-modification selected from 2'-fluoro and 2'-O-methyl. In some embodiments, all nucleotides constituting the KHK-targeting dsRNAi oligonucleotide are modified with a combination of 2'-fluoro and 2'-O-methyl. In some embodiments, the sense strand and the antisense strand of the oligonucleotide are (a) SEQ ID NOs: 909 and 936, respectively; (b) SEQ ID NOs: 894 and 920, respectively; (c) SEQ ID NOs: 897 and 923, respectively; (d) SEQ ID NOs: 892 and 918, respectively; (e) SEQ ID NOs: 891 and 917, respectively; and (f) SEQ ID NOs: 887 and 913, respectively. comprising a nucleotide sequence selected from the group consisting of: Here, the oligonucleotide is modified with a combination of 2'-fluoro and 2'-O-methyl. In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises at least one modified internucleotide linkage. In some embodiments, at least one modified internucleotide linkage is a phosphorothioate linkage.

[0175] In some embodiments, the KHK targeting dsRNAi oligonucleotide comprises an antisense strand, wherein the 4'-carbon of the sugar of the 5'-terminal nucleotide of the antisense strand comprises a phosphate analog.In some embodiments, the phosphate analog is an oxymethylphosphonate, vinylphosphonate or malonylphosphonate.In some embodiments, the phosphate analog is a 4'-phosphate analog comprising 5'-methoxyphosphonate-4'-oxy.

[0176] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand and an antisense strand, all nucleotides constituting the sense strand and the antisense strand are modified, the antisense strand comprises a region of complementarity to the KHK mRNA target sequence of any one of SEQ ID NOs: 4-387, and the complementary region is at least 15 consecutive nucleotides in length. In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand and an antisense strand, all nucleotides constituting the sense strand and the antisense strand are modified, the antisense strand comprises a region of complementarity to the KHK mRNA target sequence of nucleotides 1-19 of any one of SEQ ID NOs: 4-387, and the complementary region is at least 15 consecutive nucleotides in length. In some embodiments, the 5'-terminal nucleotide of the antisense strand comprises 5'-methoxyphosphonate-4'-oxy-2'-O-methyluridine [Mephosphonate-4O-mU] as described herein. In some embodiments, the 5'-terminal nucleotide of the antisense strand comprises a phosphorothioate linkage. In some embodiments, the antisense strand and the sense strand comprise one or more 2'-fluoro (2'-F) and 2'-O-methyl (2'-OMe) modified nucleotides and at least one phosphorothioate linkage. In some embodiments, the antisense strand comprises four phosphorothioate linkages and the sense strand comprises one phosphorothioate linkage. In some embodiments, the antisense strand comprises five phosphorothioate linkages and the sense strand comprises one phosphorothioate linkage.

[0177] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: a sense strand comprising 2'-F modified nucleotides at positions 8-11, 2'-OMe modified nucleotides at positions 1-7, 12-27, and 31-36, GalNAc conjugated nucleotides at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2; 2'-F modified nucleotides at positions 2, 3, 4, 5, 7, 10 and 14, 2'-OMe at positions 1, 6, 8, 9, 11-13 and 15-22, phosphorothioate linkages between positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, and a 5'-terminal nucleotide at position 1 comprising a 4'-phosphate analog, optionally the 5'-terminal nucleotide being 5'-methoxyphosphonate-4'-oxy-2' an antisense strand that comprises -O-methyluridine [Mephosphonate-4O-mU]; positions 1-20 of the antisense strand form a duplex region with positions 1-20 of the sense strand, positions 21-36 of the sense strand form a stem-loop, and positions 27-30 form a loop of the stem-loop, optionally positions 27-30 comprise a tetraloop, and positions 21 and 22 of the antisense strand comprise an overhang, and the sense and antisense strands (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 888 and 914, respectively; (e) SEQ ID NOs: 889 and 915, respectively; (f) SEQ ID NOs: 890 and 916, respectively; (g) SEQ ID NOs: 891 and 917, respectively; (h) SEQ ID NOs: 877 and 884, respectively; (i) SEQ ID NOs: 878 and 930, respectively; (j) SEQ ID NOs: 876 and 883, respectively; (k) SEQ ID NOs: 875 and 882, respectively; (l) SEQ ID NOs: 892 and 918, respectively; (m) SEQ ID NOs: 893 and 919, respectively; (n) SEQ ID NOs: 894 and 920, respectively; (o) SEQ ID NOs: 904 and 931, respectively; (p) SEQ ID NOs: 895 and 921, respectively; (q) SEQ ID NOs: 905 and 932, respectively; (r) SEQ ID NOs: 896 and 922, respectively; (s) SEQ ID NOs: 911 and 938, respectively; (t) SEQ ID NOs: 906 and 933, respectively; (u) SEQ ID NOs: 897 and 923, respectively; (v) SEQ ID NOs: 907 and 934, respectively; (w) SEQ ID NOs: 908 and 935, respectively; (x) SEQ ID NOs: 903 and 929, respectively; (y) SEQ ID NOs: 901 and 927, respectively; (z) SEQ ID NOs: 874 and 881, respectively; (aa) SEQ ID NOs: 902 and 928, respectively; (bb) SEQ ID NOs: 873 and 880, respectively; (cc) SEQ ID NOs: 872 and 879, respectively; (dd) SEQ ID NOs: 898 and 924, respectively; (ee) SEQ ID NOs: 899 and 925, respectively; (ff) SEQ ID NOs: 900 and 926, respectively; and (gg) SEQ ID NOs: 909 and 936, respectively The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of:

[0178] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: a sense strand comprising 2'-F modified nucleotides at positions 8-11, 2'-OMe modified nucleotides at positions 1-7, 12-27, and 31-36, GalNAc conjugated nucleotides at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2; and 2'-F modified nucleotides at positions 2, 3, 4, 5, 7, 10, and 14, 2'-OMe at positions 1, 6, 8, 9, 11-13, and 15-22, phosphorothioate linkages between positions 1 and 2, 2 and 3, 20 and 21, and 21 and 22, and a 5'-terminal nucleotide at position 1 comprising a 4'-phosphate analog, optionally the 5'-terminal nucleotide being 5'-methoxyphosphonate-4'-oxy-2'-O- an antisense strand that comprises methyluridine [Mephosphonate-4O-mU]; positions 1-20 of the antisense strand form a duplex region with positions 1-20 of the sense strand, positions 21-36 of the sense strand form a stem-loop, positions 27-30 form a loop of the stem-loop, and optionally positions 27-30 comprise a tetraloop, and positions 21 and 22 of the antisense strand comprise an overhang, and the sense and antisense strands (a) SEQ ID NOs: 886 and 912, respectively; (b) SEQ ID NOs: 887 and 913, respectively; (c) SEQ ID NOs: 910 and 937, respectively; (d) SEQ ID NOs: 888 and 914, respectively; (e) SEQ ID NOs: 889 and 915, respectively; (f) SEQ ID NOs: 890 and 916, respectively; (g) SEQ ID NOs: 891 and 917, respectively; (h) SEQ ID NOs: 877 and 884, respectively; (i) SEQ ID NOs: 878 and 930, respectively; (j) SEQ ID NOs: 876 and 883, respectively; (k) SEQ ID NOs: 875 and 882, respectively; (l) SEQ ID NOs: 892 and 918, respectively; (m) SEQ ID NOs: 893 and 919, respectively; (n) SEQ ID NOs: 894 and 920, respectively; (o) SEQ ID NOs: 904 and 931, respectively; (p) SEQ ID NOs: 895 and 921, respectively; (q) SEQ ID NOs: 905 and 932, respectively; (r) SEQ ID NOs: 896 and 922, respectively; (s) SEQ ID NOs: 911 and 938, respectively; (t) SEQ ID NOs: 906 and 933, respectively; (u) SEQ ID NOs: 897 and 923, respectively; (v) SEQ ID NOs: 907 and 934, respectively; (w) SEQ ID NOs: 908 and 935, respectively; (x) SEQ ID NOs: 903 and 929, respectively; (y) SEQ ID NOs: 901 and 927, respectively; (z) SEQ ID NOs: 874 and 881, respectively; (aa) SEQ ID NOs: 902 and 928, respectively; (bb) SEQ ID NOs: 873 and 880, respectively; (cc) SEQ ID NOs: 872 and 879, respectively; (dd) SEQ ID NOs: 898 and 924, respectively; (ee) SEQ ID NOs: 899 and 925, respectively; (ff) SEQ ID NOs: 900 and 926, respectively; and (gg) SEQ ID NOs: 909 and 936, respectively The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of:

[0179] In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 887, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 913. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 891, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 917. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 892, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 918. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 894, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 920. In some embodiments, the KHK-targeting dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 897, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 923. In some embodiments, the KHK-targeting dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 909, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 936.

[0180] In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 948; and (ii) a sense strand 19-50 nucleotides in length that includes a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0181] In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 949; and (ii) a sense strand 19-50 nucleotides in length that includes a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0182] In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 950; and (ii) a sense strand 19-50 nucleotides in length that includes a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0183] In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that comprises a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 951; and (ii) a sense strand 19-50 nucleotides in length that comprises a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand. In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that comprises a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 952; and (ii) a sense strand 19-50 nucleotides in length that comprises a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0184] In some embodiments, a KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that comprises a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 953; and (ii) a sense strand 19-50 nucleotides in length that comprises a region of complementarity to the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0185] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 948; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0186] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 949; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0187] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 950; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand. In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 951; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0188] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 952; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0189] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 953; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the stem-loop is set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0190] In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 948; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 942, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0191] In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 949; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 943, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand. In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 950; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 944, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0192] In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 951; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 945, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0193] In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 952; and (ii) a sense strand 19-50 nucleotides in length that includes a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 946, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand. In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 953; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, the region of complementarity to the antisense strand being set forth in SEQ ID NO: 947, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

[0194] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 948; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 942, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0195] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 949; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 943, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0196] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 950; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 944, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0197] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 951; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 945, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0198] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 952; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 946, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0199] In some embodiments, a KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises: (i) an antisense strand 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a KHK mRNA target sequence, the region of complementarity being set forth in SEQ ID NO: 953; and (ii) a sense strand 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at its 3' end, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 947, the stem-loop being set forth as S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 that is 3-5 nucleotides in length, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

[0200] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises the following modification pattern: Sense strand: 5'-mX-S-mX-mX-mX-mX-mX-mX-fX-fX-fX-fX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX -mX-mX-mX-mX-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mX-mX-mX-mX-mX-mX-3'. Hybridizes with: Antisense strand: 5'-[Mephosphonate-4O-mX]-S-fX-S-fX- S-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-mX-mX-mX-mX-mX-S-mX-S-mX-3'; where mX = 2'-O-methyl modified nucleotide, fX = 2'-fluoro modified nucleotide, -S- = phosphorothioate linkage, - = phosphodiester linkage, [Mephosphonate-4O-mX] = 5'-methoxyphosphonate-4'-oxy modified nucleotide, and ademA-GalNAc = GalNAc attached to an adenine nucleotide.

[0201] In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression comprises the following modification pattern: Sense strand: 5'-mX-S-mX-fX-mX-mX-mX-mX-fX-fX-fX-mX-fX-fX-mX-mX-mX-fX-mX-mX-mX-mX-mX-mX -mX-mX-mX-mX-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mX-mX-mX-mX-mX-mX-3'. Hybridizes with: Antisense strand: 5'-[Mephosphonate-4O-mX]-S-fX-S-fX-S-fX-fX-mX-fX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-S-mX-S-mX-3'; where mX = 2'-O-methyl modified nucleotide, fX = 2'-fluoro modified nucleotide, -S- = phosphorothioate linkage, - = phosphodiester linkage, [Mephosphonate-4O-mX] = 5'-methoxyphosphonate-4'-oxy modified nucleotide, and ademA-GalNAc = GalNAc attached to an adenine nucleotide.

[0202] In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand selected from SEQ ID NOs: 774-804, and an antisense strand selected from SEQ ID NOs: 819-849. In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 775, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 820. In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 779, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 824. In some embodiments, the KHK-targeted dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 780, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 825. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 782, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 827. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 785, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 830. In some embodiments, the KHK-targeted dsRNAi oligonucleotides for reducing KHK expression provided by the present disclosure comprise a sense strand comprising the nucleotide sequence set forth in SEQ ID NO: 804, and an antisense strand comprising the nucleotide sequence set forth in SEQ ID NO: 849.

[0203] In some embodiments, the sense and antisense strands of the KHK-targeting dsRNAi oligonucleotide are (a) SEQ ID NOs: 774 and 819, respectively; (b) SEQ ID NOs: 775 and 820, respectively; (c) SEQ ID NOs: 776 and 821, respectively; (d) SEQ ID NOs: 777 and 822, respectively; (e) SEQ ID NOs: 778 and 823, respectively; (f) SEQ ID NOs: 779 and 824, respectively; (g) SEQ ID NOs: 780 and 825, respectively; (h) SEQ ID NOs: 781 and 826, respectively; (i) SEQ ID NOs: 782 and 827, respectively; (j) SEQ ID NOs: 783 and 828, respectively; (k) SEQ ID NOs: 784 and 829, respectively; (l) SEQ ID NOs: 785 and 830, respectively; (m) SEQ ID NOs: 786 and 831, respectively; (n) SEQ ID NOs: 787 and 832, respectively; (o) SEQ ID NOs: 788 and 833, respectively; (p) SEQ ID NOs: 789 and 834, respectively; (q) SEQ ID NOs: 790 and 835, respectively; (r) SEQ ID NOs: 791 and 836, respectively; (s) SEQ ID NOs: 792 and 837, respectively; (t) SEQ ID NOs: 793 and 838, respectively; (u) SEQ ID NOs: 794 and 839, respectively; (v) SEQ ID NOs:795 and 840, respectively; (w) SEQ ID NOs: 796 and 841, respectively; (x) SEQ ID NOs: 797 and 842, respectively; (y) SEQ ID NOs: 798 and 843, respectively; (z) SEQ ID NOs: 799 and 844, respectively; (aa) SEQ ID NOs: 800 and 845, respectively; (bb) SEQ ID NOs: 801 and 846, respectively; (cc) SEQ ID NOs: 802 and 847, respectively; (dd) SEQ ID NOs: 803 and 848, respectively; and (ee) SEQ ID NOs: 804 and 849, respectively The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of: In some embodiments, the KHK-targeting dsRNAi oligonucleotide for reducing KHK expression provided by the present disclosure comprises a sense strand selected from SEQ ID NOs: 805-818 and an antisense strand selected from SEQ ID NOs: 850-863.

[0204] In some embodiments, the sense and antisense strands of the KHK-targeting dsRNAi oligonucleotide are (a) SEQ ID NOs: 805 and 850, respectively; (b) SEQ ID NOs: 806 and 851, respectively; (c) SEQ ID NOs: 807 and 852, respectively; (d) SEQ ID NOs: 808 and 853, respectively; (e) SEQ ID NOs: 809 and 854, respectively; (f) SEQ ID NOs: 810 and 855, respectively; (g) SEQ ID NOs: 811 and 856, respectively; (h) SEQ ID NOs: 812 and 857, respectively; (i) SEQ ID NOs: 813 and 858, respectively; (j) SEQ ID NOs: 814 and 859, respectively; (k) SEQ ID NOs: 815 and 860, respectively; (l) SEQ ID NOs: 816 and 861, respectively; (m) SEQ ID NOs: 817 and 862, respectively; and (n) SEQ ID NOs: 818 and 863, respectively. The nucleic acid sequence comprises a nucleotide sequence selected from the group consisting of:

[0205] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO: 775 and an antisense strand comprising SEQ ID NO: 820, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000030.tif245156.

[0206] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO:779 and an antisense strand comprising SEQ ID NO:824, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000032.tif245133.

[0207] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO: 780 and an antisense strand comprising SEQ ID NO: 825, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000034.tif245141.

[0208] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO:782 and an antisense strand comprising SEQ ID NO:827, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000036.tif243159.

[0209] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO: 785 and an antisense strand comprising SEQ ID NO: 830, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000038.tif245157.

[0210] In some embodiments, the KHK-targeting dsRNAi oligonucleotide comprises a sense strand comprising SEQ ID NO:804 and an antisense strand comprising SEQ ID NO:849, wherein the dsRNA comprises [ka] It is in the form of a conjugate having the structure TIFF2024516356000040.tif245148.

[0211] formulation A variety of formulations have been developed to facilitate the use of oligonucleotides. For example, oligonucleotides (e.g., dsRNAi oligonucleotides) can be delivered to a subject or cellular environment using formulations that minimize degradation, facilitate delivery and / or uptake, or provide another beneficial property of the oligonucleotide in the formulation. In some embodiments, compositions are provided herein that include oligonucleotides (e.g., dsRNAi oligonucleotides) that reduce the expression of KHK. Such compositions can be suitably formulated so that when administered to a subject, either in the environment surrounding the target cell or systemically, a sufficient portion of the oligonucleotide enters the cell to reduce KHK expression. Any of a variety of suitable oligonucleotide formulations can be used to deliver the oligonucleotides disclosed herein for reduction of KHK. In some embodiments, the oligonucleotides are formulated into buffer solutions, such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids. Any of the oligonucleotides described herein can be provided in the form of pharma-ceutically acceptable salts, as well as nucleic acids.

[0212] Formulation of oligonucleotides with cationic lipids can be used to facilitate the transfection of oligonucleotides into cells.For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used.Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche), all of which can be used according to the manufacturer's instructions. Thus, in some embodiments, the formulation comprises a lipid nanoparticle. In some embodiments, the excipient comprises a liposome, lipid, lipid complex, microsphere, microparticle, nanosphere, or nanoparticle, or may otherwise be formulated for administration to a cell, tissue, organ, or body of a subject in need thereof (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013).

[0213] In some embodiments, the formulation herein includes an excipient. In some embodiments, the excipient confers improved stability, improved absorption, improved solubility, and / or therapeutic enhancement of the active ingredient to the composition. In some embodiments, the excipient is a buffer (e.g., sodium citrate, sodium phosphate, Tris base, or sodium hydroxide) or a vehicle (e.g., a buffer solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is lyophilized to extend its shelf life, and then put into solution before use (e.g., administration to a subject). Thus, the excipient in a composition comprising any one of the oligonucleotides described herein may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone) or a collapse temperature regulator (e.g., dextran, Ficoll™, or gelatin). In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration, which includes parenteral (e.g., intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous), oral (e.g., inhalation), transdermal (e.g., topical), transmucosal, and rectal administration.

[0214] Pharmaceutical compositions suitable for injection use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for extemporaneous preparation of sterile injection solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Carriers can be, for example, solvents or dispersion media containing water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. In many cases, it is preferable to include isotonic agents, for example, sugars, polyhydric alcohols, for example, mannitol, sorbitol, sodium chloride in the composition. Sterile injection solutions can be prepared by incorporating the required amount of oligonucleotide into the selected solvent with one or a combination of the above-listed components, followed by sterilization filtration as necessary.

[0215] In some embodiments, the composition may contain at least about 0.1% or more of a therapeutic agent (e.g., a dsRNAi oligonucleotide for reducing KHK expression), although the percentage of active ingredient may be about 1% to 80% or more by mass or volume of the total composition. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, and other pharmacological considerations will be contemplated by those skilled in the art of preparing such pharmaceutical formulations, and as such, various dosages and treatment regimens may be desirable.

[0216] How to use Reduction of KHK expression In some embodiments, the present disclosure provides a method for contacting or delivering an effective amount of the oligonucleotide (e.g., dsRNAi oligonucleotide) herein to a cell or a population of cells to reduce KHK expression.In some embodiments, the reduction of KHK expression is determined by measuring the amount or level of KHK mRNA, KEK protein, or KHK activity in the cell.Methods include those described herein and known to those skilled in the art. The methods provided herein are useful in any suitable cell type. In some embodiments, the cell is any cell that expresses KHK mRNA (e.g., hepatocyte). In some embodiments, the cell is a primary cell obtained from a subject. In some embodiments, the primary cell has undergone a limited number of passages so that the cell substantially maintains its native phenotypic characteristics. In some embodiments, the cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., it can be delivered to a cell in culture or an organ in which the cell resides).

[0217] In some embodiments, the oligonucleotide herein is delivered to a cell or a group of cells using a nucleic acid delivery method known in the art, including but not limited to injection of a solution containing the oligonucleotide, irradiation with particles coated with the oligonucleotide, exposing a cell or a group of cells to a solution containing the oligonucleotide, or electroporation of cell membrane in the presence of the oligonucleotide.Other methods known in the art for delivering oligonucleotide to cells may also be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate.

[0218] In some embodiments, the reduction of KHK expression is determined by an assay or technique that evaluates one or more molecules, properties or characteristics of a cell or a population of cells associated with KHK expression, or by an assay or technique that evaluates a molecule that directly indicates KHK expression in a cell or a population of cells (e.g., KHK mRNA or KHK protein). In some embodiments, the extent to which the oligonucleotides provided herein reduce KHK expression is assessed by comparing KHK expression in a cell or a population of cells contacted with the oligonucleotide to a suitable control (e.g., a suitable cell or population of cells that has not been contacted with the oligonucleotide or that has been contacted with a control oligonucleotide). In some embodiments, the control amount or level of KHK expression in a control cell or population of cells is predetermined so that the control amount or level does not need to be measured in every instance that the assay or technique is performed. The predetermined level or value can take various forms. In some embodiments, the predetermined level or value can be a single cutoff value, such as a median or mean.

[0219] In some embodiments, contacting or delivering the oligonucleotide (e.g., dsRNAi oligonucleotide) described herein to a cell or a population of cells results in a reduction in KHK expression in a cell or a population of cells that is not contacted with the oligonucleotide or that is contacted with a control oligonucleotide. In some embodiments, the reduction in KHK expression is about 1% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 70% or less, about 80% or less, or about 90% or less compared to the control amount or level of KHK expression. In some embodiments, the control amount or level of KHK expression is the amount or level of KHK mRNA and / or KHK protein in a cell or a population of cells that is not contacted with the oligonucleotide described herein. In some embodiments, the effect of delivery of oligonucleotide to a cell or a population of cells by the methods herein is evaluated after any finite period or amount of time (e.g., minutes, hours, days, weeks, months).For example, in some embodiments, KHK expression is determined in a cell or a population of cells at least about 4 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours after contacting or delivering oligonucleotide to a cell or a population of cells; or at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, about 56 days, about 63 days, about 70 days, about 77 days, or about 84 days, or more, after contacting or delivering oligonucleotide to a cell or a population of cells. In some embodiments, KHK expression is determined in a cell or population of cells at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, or about 6 months or more after contacting or delivering an oligonucleotide to the cell or population of cells.

[0220] In some embodiments, the oligonucleotide is delivered in the form of a transgene that has been engineered to express the oligonucleotide or a strand that contains the oligonucleotide (e.g., its sense and antisense strands) in a cell. In some embodiments, the oligonucleotide is delivered using a transgene engineered to express any of the oligonucleotides disclosed herein. The transgene can be delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or a non-viral vector (e.g., a plasmid or synthetic mRNA). In some embodiments, the transgene can be directly injected into the subject.

[0221] Treatment The present disclosure provides oligonucleotides for use as medicaments, particularly for use in methods for treating diseases, disorders, and conditions associated with the expression of KHK. The present disclosure also provides oligonucleotides for use or adapted for use to treat subjects (e.g., humans with diseases, disorders, or conditions associated with KHK expression) that would benefit from reducing KHK expression. In some contexts, the present disclosure provides oligonucleotides for use or adapted for use to treat subjects with diseases, disorders, or conditions associated with KHK expression. The present disclosure also provides oligonucleotides for use or adapted for use in the manufacture of medicaments or pharmaceutical compositions for treating diseases, disorders, or conditions associated with KHK expression. In some embodiments, the oligonucleotides for use or adapted for use target KHK mRNA and reduce KHK expression (e.g., via the RNAi pathway). In some embodiments, the oligonucleotides for use or adapted for use target KHK mRNA and reduce the amount or level of KHK mRNA, KHK protein, and / or KHK activity.

[0222] In addition, in some embodiments of the methods herein, subjects with or susceptible to a disease, disorder or condition associated with KHK expression are selected for treatment with the oligonucleotides (e.g., double-stranded oligonucleotides) herein. In some embodiments, the methods include selecting individuals with or susceptible to a marker (e.g., biomarker) for a disease, disorder or condition associated with KHK expression, such as, but not limited to, KHK mRNA, KHK protein, or a combination thereof. Similarly, as described in detail below, some embodiments of the methods provided by the present disclosure include steps such as measuring or obtaining a baseline value for a marker of KHK expression (e.g., KHK), and then comparing the value thus obtained with one or more other baseline values ​​or values ​​obtained after administering the oligonucleotide to the subject to evaluate the effectiveness of treatment.

[0223] The present disclosure also provides a method of treating a subject having, suspected of having, or at risk of developing a disease, disorder, or condition associated with KHK expression with the oligonucleotides provided herein. In some aspects, the present disclosure provides a method of treating, or attenuating the onset or progression of, a disease, disorder, or condition associated with KHK expression using the oligonucleotides provided herein. In other aspects, the present disclosure provides a method of using the oligonucleotides provided herein to achieve one or more therapeutic benefits in a subject having a disease, disorder, or condition associated with KHK expression. In some embodiments of the methods herein, the subject is treated by administering a therapeutically effective amount of any one or more of the oligonucleotides provided herein. In some embodiments, the treatment includes reducing KHK expression. In some embodiments, the subject is treated therapeutically. In some embodiments, the subject is treated prophylactically.

[0224] In some embodiments of the methods herein, one or more oligonucleotides (e.g., dsRNAi oligonucleotides) herein or pharmaceutical compositions comprising one or more oligonucleotides are administered to a subject having a disease, disorder, or condition associated with KHK expression, such that KHK expression is reduced in the subject, thereby treating the subject. In some embodiments, the amount or level of KHK mRNA is reduced in the subject. In some embodiments, the amount or level of KHK protein is reduced in the subject. In some embodiments, the amount or level of KHK activity is reduced in the subject. In some embodiments, the amount or level of triglycerides (TG) (e.g., one or more TGs, or total TG) is reduced in the subject. In some embodiments, the amount or level of plasma glucose is reduced in the subject. In some embodiments, the amount or level of blood pressure (e.g., systolic pressure, diastolic pressure, or both) is reduced in the subject. In some embodiments, the amount or level of abdominal fat is reduced in the subject. In some embodiments, the amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and / or HDL cholesterol) is reduced in the subject. In some embodiments, the amount or level of fatty liver is reduced in a subject.In some embodiments, the amount or level of liver fibrosis is reduced in a subject.In some embodiments, the ratio of total cholesterol to HDL cholesterol is changed in a subject.In some embodiments, any combination of the following is reduced or changed in a subject: KHK expression, the amount or level of KHK mRNA, the amount or level of KHK protein, the amount or level of KHK activity, the amount or level of blood glucose, the amount or level of abdominal fat, the amount or level of blood pressure, the amount or level of TG, the amount or level of cholesterol and / or the ratio of total cholesterol to HDL cholesterol, the amount or level of fatty liver, and the amount or level of liver fibrosis.

[0225] In some embodiments of the methods herein, an oligonucleotide (e.g., a dsRNAi oligonucleotide) herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with KHK, such that KHK expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99%, when compared to KHK expression prior to administration of the one or more oligonucleotides or pharmaceutical compositions. In some embodiments, KHK expression is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to KHK expression in a subject that has not received the one or more oligonucleotides or pharmaceutical compositions or that has received a control one or more oligonucleotides, pharmaceutical compositions or treatment (e.g., a reference or control subject).

[0226] In some embodiments of the methods herein, one or more oligonucleotides herein, or a pharmaceutical composition comprising one or more oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with KHK expression, such that the amount or level of KHK mRNA is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK mRNA in the subject before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of KHK mRNA is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK mRNA in a subject that has not received one or more oligonucleotides or pharmaceutical compositions or that has received a control one or more oligonucleotides, pharmaceutical compositions or treatment (e.g., a reference or control subject).

[0227] In some embodiments of the methods herein, one or more oligonucleotides herein, or a pharmaceutical composition comprising one or more oligonucleotides, are administered to a subject having a disease, disorder or condition associated with KHK expression, such that the amount or level of KHK protein is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK protein in the subject before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of KHK protein is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK protein in a subject that has not received one or more oligonucleotides or pharmaceutical compositions or that has received a control one or more oligonucleotides, pharmaceutical compositions or treatment (e.g., a reference or control subject).

[0228] In some embodiments of the methods herein, one or more oligonucleotides (e.g., dsRNAi oligonucleotides) herein, or a pharmaceutical composition comprising one or more oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with KHK, such that the amount or level of KHK activity / expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK activity in the subject prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of KHK activity is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of KHK activity in a subject that has not received the oligonucleotide or pharmaceutical composition or that has received a control oligonucleotide, pharmaceutical composition or treatment (e.g., a reference or control subject).

[0229] In some embodiments of the methods herein, an oligonucleotide or a pharmaceutical composition comprising the oligonucleotide herein is administered to a subject having a disease, disorder, or condition associated with KHK expression, such that the amount or level of TG (e.g., one or more TGs, or total TG) is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of TG in the subject prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of TG is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of TG in a subject not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment (e.g., a reference or control subject).

[0230] In general, the normal or desirable TG range for a human patient is <150 mg / dL of blood, with <100 being considered ideal. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a TG amount or level of ≧150 mg / dL. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a TG amount or level in the range of 150-199 mg / dL, which is considered borderline high TG levels. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a TG amount or level in the range of 200-499 mg / dL, which is considered high TG levels. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a TG amount or level in the range of 500 mg / dL or more (i.e., ≧500 mg / dL), which is considered very high TG levels. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have an amount or level of TG that is ≧150 mg / dL, ≧200 mg / dL, or ≧500 mg / dL. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have an amount or level of TG that is 200-499 mg / dL or 500 mg / dL or more. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have an amount or level of TG that is ≧200 mg / dL.In some embodiments of the methods herein, an oligonucleotide (e.g., a dsRNAi oligonucleotide) herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with KHK expression, such that the amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and / or HDL cholesterol) is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, when compared to the amount or level of cholesterol in the subject prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of cholesterol is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of cholesterol in a subject that has not received the oligonucleotide or pharmaceutical composition or that has received a control oligonucleotide, pharmaceutical composition or treatment (e.g., a reference or control subject).

[0231] Generally, the normal or desirable cholesterol range (total cholesterol) for an adult human patient is <200 mg / dL of blood. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a cholesterol amount or level of ≧200 mg / dL. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a cholesterol amount or level in the range of 200-239 mg / dL, which is considered to be borderline high cholesterol levels. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a cholesterol amount or level in the range of 240 mg / dL or higher (i.e., ≧240 mg / dL), which is considered to be a high cholesterol level. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a cholesterol amount or level of 200-239 mg / dL or ≧240 mg / dL. In some embodiments, the patient selected for treatment or the patient to be treated is identified or determined to have a cholesterol amount or level that is ≧200 mg / dL or ≧240 mg / dL or higher.

[0232] In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with KHK expression, such that the amount or level of liver fibrosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of liver fibrosis in the subject prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of liver fibrosis is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of liver fibrosis in a subject not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment (e.g., a reference or control subject).

[0233] In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with KHK expression, such that the amount or level of hepatic steatosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of hepatic steatosis prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of fatty liver is reduced in a subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of fatty liver in a subject not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment (e.g., a reference or control subject). Suitable methods for determining KHK expression, KHK mRNA, KHK protein, KHK activity, TG, plasma glucose or cholesterol amount or level, amount or activity in a subject or in a sample from a subject are known in the art. Furthermore, the examples presented herein describe methods for determining KHK expression.

[0234] In some embodiments, the amount or level of KHK expression, KHK mRNA, KHK protein, KHK activity, TG, plasma glucose or cholesterol is reduced in a cell (e.g., a hepatocyte), a population or group of cells (e.g., an organoid), an organ (e.g., a liver), blood or a fraction thereof (e.g., plasma), a tissue (e.g., liver tissue), a sample (e.g., a liver biopsy sample), or any other suitable biological material obtained or isolated from a subject. In some embodiments, KHK expression, KHK mRNA, KHK protein, KHK activity, TG, plasma glucose or cholesterol amount or level, or any combination thereof, is reduced in more than one type of cell (e.g., hepatocytes and one or more other types of cells), more than one group of cells, more than one organ (e.g., liver and one or more other organs), more than one fraction of blood (e.g., plasma and one or more other blood fractions), more than one type of tissue (e.g., liver tissue and one or more other types of tissue), or more than one sample type (e.g., liver biopsy sample and one or more other types of biopsy sample).

[0235] Generally, a normal or desirable blood glucose level for a human patient is <140 mg / dL. A blood glucose level of 140-199 mg / dL 2 hours after a meal indicates prediabetes, and >200 mg / dL indicates diabetes. In some embodiments, the patient selected for treatment or the patient to be treated has been identified or determined to have a blood glucose level of about 140 mg / dL to about 199 mg / dL, which is considered prediabetic. In some embodiments, the patient selected for treatment or the patient to be treated has been identified or determined to have a blood glucose level of ≧200 mg / dL, which is considered diabetic. In some embodiments of the methods herein, an oligonucleotide (e.g., dsRNAi oligonucleotide) herein, or a pharmaceutical composition comprising an oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with KHK expression, such that the amount or level of blood glucose is reduced to the normal or prediabetic range.

[0236] Examples of diseases, disorders, or conditions associated with KHK expression include, but are not limited to, glucose intolerance, prediabetes, type 1 diabetes, type 2 diabetes, metabolic liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), drug-induced liver disease, alcohol-induced liver disease, infectious pathogen-induced liver disease, inflammatory liver disease, immune system dysfunction-mediated liver disease, dyslipidemia, cardiovascular disease, restenosis, syndrome X, metabolic syndrome, diabetes, obesity, hypertension, chronic cholangiopathy, e.g., primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC), biliary atresia, progressive familial intrahepatic cholestasis type 3 (PFIC3), inflammatory bowel disease, Crohn's disease, ulcerative colitis, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, colorectal cancer, metabolic disease. fibrosis or cirrhosis, NAFLD-induced fibrosis or cirrhosis, NASH-induced fibrosis or cirrhosis, alcohol-induced liver fibrosis or cirrhosis, drug-induced liver fibrosis or cirrhosis, radiotherapy or chemotherapy-induced fibrosis or cirrhosis, bile duct fibrosis, liver fibrosis or cirrhosis due to any chronic cholestatic disease, intestinal fibrosis of any etiology, Crohn's disease-induced fibrosis, ulcerative colitis-induced fibrosis, intestinal (e.g., small intestine) fibrosis, colonic fibrosis, gastric fibrosis, disorders of elevated uric acid (e.g., hyperuricemia, gout), sugar craving, alcohol craving, aldolase B deficiency, hereditary fructose intolerance, chronic kidney disease, diabetic nephropathy, renal fibrosis, liver failure, loss of liver function, coagulation disorders, steatohepatitis, impaired glycemic control, and other KHK-related metabolic related disorders and diseases. Of particular interest herein are metabolic syndrome, hypertriglyceridemia, NAFLD, NASH, obesity, or a combination thereof.

[0237] Due to their high specificity, the oligonucleotides (e.g., dsRNAi oligonucleotides) herein specifically target the mRNA of the target gene in cells and tissues or organs (e.g., liver). In the prevention of disease, the target gene may be one that is necessary for the initiation or maintenance of the disease, or one that has been identified as being associated with a higher risk of suffering from the disease. In the treatment of disease, the oligonucleotide may be contacted with the cell, tissue, or organ (e.g., liver) that is responsible for exhibiting or mediating the disease. For example, an oligonucleotide that is substantially identical to all or part of a wild-type (i.e., native) or mutant gene associated with a disorder or condition associated with KHK expression may be contacted with or introduced into a cell or tissue type of interest, such as a hepatocyte or other liver cell. In some embodiments, the target gene may be a target gene from any mammal, such as a human target. Any gene may be silenced according to the methods described herein.

[0238] The method described herein typically comprises administering to a subject an effective amount of the oligonucleotide herein (e.g., dsRNAi oligonucleotide), i.e., an amount that can produce a desired therapeutic result.A therapeutically acceptable amount can be an amount that can treat a disease or disorder therapeutically.The appropriate dosage for any given subject depends on certain factors, including the subject's size, body surface area, age, the specific composition administered, the active ingredient in the composition, the number and route of administration, overall health, and other drugs administered together. In some embodiments, a subject is administered any one of the compositions herein either enterally (e.g., orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy, or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intraarterial injection or infusion, intraosseous injection, intramuscular injection, intracerebral injection, intraventricular injection, intrathecal injection), topically (e.g., on the skin, by inhalation, via eye drops, or through mucous membrane), or by direct injection into a target organ (e.g., the liver of a subject). Typically, the oligonucleotide herein is administered intravenously or subcutaneously.

[0239] As a non-limiting series of examples, oligonucleotides (e.g., dsRNAi oligonucleotides) herein will typically be administered four times a year (once every three months), every other month (once every two months), monthly, or weekly. For example, oligonucleotides can be administered every week, or at intervals of two or three weeks. Alternatively, oligonucleotides can be administered daily. In some embodiments, subjects are administered one or more loading doses of oligonucleotides, followed by one or more maintenance doses of oligonucleotides.

[0240] In some embodiments, the oligonucleotides herein are administered alone or in combination.In some embodiments, the oligonucleotides herein are administered in combination simultaneously, sequentially (in any order), or intermittently.For example, two oligonucleotides can be co-administered simultaneously.Alternatively, one oligonucleotide can be administered, followed by administration of a second oligonucleotide after any amount of time (e.g., 1 hour, 1 day, 1 week, or 1 month). In some embodiments, the subject to be treated is a human or non-human primate, or other mammalian subject. Other exemplary subjects include domestic animals, such as dogs and cats; livestock, such as horses, cows, pigs, goats, and chickens; and animals, such as mice, rats, guinea pigs, and hamsters.

[0241] In some embodiments, a single dose of one or more oligonucleotides (e.g., dsRNAi oligonucleotides) herein or pharmaceutical compositions comprising oligonucleotides are administered to a subject with a disease, disorder or condition associated with KHK expression, such that the amount or level of KHK mRNA and / or KHK protein, preferably KHK protein, is reduced in the subject. The reduction in the amount or level of KHK mRNA and / or KHK protein may be determined by comparison with the amount or level of KHK mRNA and / or KHK protein in a subject (e.g., a reference or control subject) that has not received the oligonucleotide or pharmaceutical composition or has received one or more control oligonucleotides or pharmaceutical compositions or treatments, or preferably by comparison with the amount or level of KHK mRNA and / or KHK protein before administration of the oligonucleotide or pharmaceutical composition. The amount or level of KHK mRNA and / or KHK protein may be determined from a liver biopsy sample from the subject. The single dose may be administered subcutaneously. The dose of oligonucleotide may be lower than 10 mg / kg of the subject's body weight, for example 6 mg / kg or less, in particular 0.01 mg / kg to 5 mg / kg. The reduction in the amount or level of KHK mRNA and / or KHK protein may be detectable for more than 10 days after administration of a single dose of oligonucleotide, for example it remains detectable on the 28th, 56th, and / or 84th day after administration. The reduction in the amount or level of KHK mRNA and / or KHK protein may be, for example, at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%. In a preferred embodiment, the reduction in the amount or level of KHK mRNA and / or KHK protein remains detectable at 28 days, optionally 56 days and / or 84 days following subcutaneous administration of a single dose of one or more oligonucleotides (e.g., dsRNAi oligonucleotides) herein, or a pharmaceutical composition comprising the oligonucleotides.

[0242] kit In some embodiments, the disclosure provides a kit comprising the oligonucleotide herein and instructions for use. In some embodiments, the kit comprises an oligonucleotide herein and a package insert containing instructions for use of the kit and / or any of its components. In some embodiments, the kit comprises the oligonucleotide herein, one or more controls, and various buffers, reagents, enzymes, and other standard components well known in the art in a suitable container. In some embodiments, the container comprises at least one vial, well, test tube, flask, bottle, syringe, or other container means into which the oligonucleotide is placed and, in some cases, suitably dispensed. In some embodiments, if additional components are provided, the kit contains additional containers into which the components are placed. The kit may also include means for containing the oligonucleotide and any other reagents that are strictly restricted for commercial sale. Such containers may include injection containers or blow-molded plastic containers into which the desired vials are held. The container and / or kit may include a label with instructions and / or warnings. In some embodiments, the kit comprises an oligonucleotide as described herein and a pharma- ceutically acceptable carrier, or a pharmaceutical composition comprising the oligonucleotide, and instructions for treating or delaying the progression of a disease, disorder, or condition associated with KHK expression in a subject in need thereof.

[0243] definition As used herein, the term "antisense oligonucleotide" encompasses a nucleic acid-based molecule that has a sequence complementary to all or a portion of a target mRNA, particularly a seed sequence, and is thereby capable of forming a duplex with the mRNA. Thus, the term "antisense oligonucleotide" as used herein may also be referred to as a "complementary nucleic acid-based inhibitor."

[0244] As used herein, "approximately" or "about" when applied to one or more values ​​of interest refers to a value similar to a stated reference value. In certain embodiments, "about" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less than) of the stated reference value, unless otherwise stated or otherwise clear from the context (except where such number would exceed 100% of possible values). As used herein, "administer," "administering," "administration," and the like refer to providing a substance (e.g., an oligonucleotide) to a subject in a pharmacologically useful manner (e.g., to treat a condition in the subject).

[0245] As used herein, "attenuate," "attenuating," "attenuating," and the like refer to reducing or effectively stopping. As a non-limiting example, one or more of the treatments herein may reduce or effectively stop the onset or progression of dyslipidemia / hypertriglyceridemia / hyperlipidemia, NAFLD, NASH, or glucose intolerance in a subject. This attenuation may be exemplified, for example, by a decrease in one or more aspects of dyslipidemia / hypertriglyceridemia / hyperlipidemia, NAFLD, NASH, or glucose intolerance (e.g., symptoms, tissue characteristics, and cellular, inflammatory, or immunological activity, etc.), no detectable progression (worsening) of one or more aspects of dyslipidemia / hypertriglyceridemia / hyperlipidemia, NAFLD, NASH, or glucose intolerance, or no detectable aspects of dyslipidemia / hypertriglyceridemia / hyperlipidemia, NAFLD, NASH, or glucose intolerance in a subject when they might otherwise be expected.

[0246] As used herein, "complementary" refers to a structural relationship between two nucleotides (e.g., in two inverted nucleic acids or in inverted regions of a single nucleic acid strand) that allows the two nucleotides to base pair with each other. For example, purine nucleotides of one nucleic acid that are complementary to pyrimidine nucleotides of an inverted nucleic acid can base pair together by forming hydrogen bonds with each other. In some embodiments, complementary nucleotides can base pair in a Watson-Crick manner, or in any other manner that allows the formation of a stable duplex. In some embodiments, two nucleic acids may have regions of multiple nucleotides that are complementary to each other to form a region of complementarity, as described herein.

[0247] As used herein, "deoxyribonucleotide" refers to a nucleotide that has a hydrogen instead of a hydroxyl at the 2' position of its pentose sugar when compared to a ribonucleotide. Modified deoxyribonucleotides are deoxyribonucleotides that have one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions in or to the sugar, phosphate group, or base.

[0248] As used herein, "double-stranded oligonucleotide" or "ds oligonucleotide" refers to an oligonucleotide that is substantially in a double-stranded form. In some embodiments, the complementary base pairing of the duplex region of the double-stranded oligonucleotide is formed between the antiparallel sequence of nucleotides of the covalently linked nucleic acid strands. In some embodiments, the complementary base pairing of the duplex region of the double-stranded oligonucleotide is formed between the antiparallel sequence of nucleotides of the covalently linked nucleic acid strands. In some embodiments, the complementary base pairing of the duplex region of the double-stranded oligonucleotide is formed from a single nucleic acid strand that is folded back (e.g., via a hairpin) to provide a complementary antiparallel sequence of nucleotides that base pair together. In some embodiments, the double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are fully double-stranded with each other. However, in some embodiments, the double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are partially double-stranded (e.g., with an overhang at one or both ends). In some embodiments, the double-stranded oligonucleotide comprises an antiparallel sequence of nucleotides that are partially complementary and thus may have one or more mismatches, which may include internal or terminal mismatches. As used herein, "duplex," in reference to a nucleic acid (eg, an oligonucleotide), refers to the structure formed by complementary base pairing of two antiparallel sequences of nucleotides. As used herein, "excipient" refers to a non-therapeutic agent that may be included in a composition to, for example, provide or contribute to a desired robustness or stabilizing effect. As used herein, the phrase "glucose intolerance" refers to a metabolic condition that results in higher than normal levels of blood glucose. Glucose intolerance can include type 1, type 1.5, and type 2 diabetes.

[0249] As used herein, "hepatocyte" or "hepatocytes" refers to cells of the liver parenchyma. These cells make up about 70%-85% of the liver's mass and produce serum albumin, FBN, and the prothrombin group of clotting factors (excluding factors 3 and 4). Markers for cells of the hepatocyte lineage include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers for mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb), and OC2-2F8. See, e.g., Huch et al. (2013) Nature 494:247-50.

[0250] As used herein, "hepatotoxic agent" refers to a chemical, virus, or other substance that is itself toxic to the liver or that can be processed to form a metabolic product that is toxic to the liver. Hepatotoxic agents can include, but are not limited to, carbon tetrachloride (CCl4), acetaminophen (paracetamol), vinyl chloride, arsenic, chloroform, nonsteroidal anti-inflammatory drugs (such as aspirin and phenylbutazone).

[0251] As used herein, the term "ketohexokinase" or "KHK" refers to an enzyme, specifically, hepatic fructokinase, which catalyzes the phosphorylation of fructose. The KHK gene encodes two protein isoforms (KHK-A and KHK-C). The two products arise from the same primary transcript by alternative splicing. The term "KHK" is intended to refer to both isoforms unless otherwise stated. "KHK" may also refer to the gene encoding the protein. As used herein, an "unstable linker" refers to a linker that can be cleaved (e.g., by acidic pH). A "fairly stable linker" refers to a linker that cannot be cleaved. As used herein, "liver inflammation" or "hepatitis" refers to a physical condition in which the liver becomes enlarged, impaired and / or painful, particularly as a result of injury or infection, such as may be caused by exposure to hepatotoxic agents. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, loss of appetite and weight loss. If left untreated, liver inflammation may progress to fibrosis, cirrhosis, liver failure or liver cancer.

[0252] As used herein, "liver fibrosis," "Liver Fibrosis," or "fibrosis of the liver" refers to the excessive accumulation of extracellular matrix proteins in the liver, which may include collagen (I, III, IV), FBN, andurin, elastin, laminin, hyaluronan, and proteoglycans, resulting from inflammation and liver cell death. If left untreated, liver fibrosis can progress to cirrhosis, liver failure, or liver cancer. As used herein, a "loop" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) that is adjacent to two antiparallel regions of the nucleic acid that are sufficiently complementary to one another such that under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell), the two antiparallel regions adjacent to the unpaired region hybridize to form a duplex (referred to as a "stem").

[0253] As used herein, "metabolic syndrome" or "metabolic liver disease" refers to a disorder characterized by a cluster of related medical conditions and associated pathologies, including, but not limited to, the following medical conditions: abdominal obesity, elevated blood pressure, elevated fasting plasma glucose, high serum triglycerides, liver fibrosis, and low levels of high density lipoprotein (HDL). As used herein, the term metabolic syndrome or metabolic liver disease can encompass a wide range of direct and indirect symptoms, diseases, and pathologies associated with metabolic syndrome and metabolic liver disease, an expanding list of conditions used throughout this document.

[0254] As used herein, "modified internucleotide linkage" refers to an internucleotide linkage that has one or more chemical modifications when compared to a reference internucleotide linkage that comprises a phosphodiester bond. In some embodiments, the modified nucleotide is a linkage that does not occur in nature. Typically, the modified internucleotide linkage imparts one or more desirable properties to the nucleic acid in which the modified internucleotide linkage is present. For example, the modified internucleotide linkage can improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

[0255] As used herein, "modified nucleotide" refers to a nucleotide that has one or more chemical modifications when compared to a corresponding reference nucleotide selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide and thymidine deoxyribonucleotide. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, the modified nucleotide has one or more chemical modifications in its sugar, nucleobase and / or phosphate group. In some embodiments, the modified nucleotide has one or more chemical moieties conjugated to the corresponding reference nucleotide. Typically, the modified nucleotide imparts one or more desirable properties to the nucleic acid in which the modified nucleotide is present. For example, the modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, etc. As used herein, "nicked tetraloop structure" refers to a structure of an RNAi oligonucleotide characterized by separate sense (passenger) and antisense (guide) strands, where the sense strand has a region of complementarity with the antisense strand, and where at least one of the strands, generally the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within at least one strand.

[0256] As used herein, "oligonucleotide" refers to a short nucleic acid (e.g., less than about 100 nucleotides in length). Oligonucleotides can be single-stranded (ss) or ds. Oligonucleotides may or may not have a double-stranded region. As a set of non-limiting examples, oligonucleotides can be, but are not limited to, small interfering RNA (siRNA), microRNA (miRNA), small hairpin RNA (shRNA), dicer substrate interfering RNA (DsiRNA), antisense oligonucleotides, short siRNA or ss siRNA. In some embodiments, double-stranded (dsRNA) is an RNAi oligonucleotide.

[0257] As used herein, "overhang" (or "overhang sequence") refers to terminal non-base-paired nucleotides resulting from one strand or region that extends beyond the end of the complementary strand with which it forms a duplex. In some embodiments, an overhang comprises one or more non-paired nucleotides that extend from the duplex region at the 5'-end or 3'-end of a dsRNA. In certain embodiments, an overhang is a 3' or 5' overhang on the antisense or sense strand of a dsRNA.

[0258] As used herein, "phosphate analog" refers to a chemical moiety that mimics the electrostatic and steric properties of a phosphate group. In some embodiments, the phosphate analog is located at the 5'-terminal nucleotide of an oligonucleotide in place of the 5'-phosphate, which is often susceptible to enzymatic removal. In some embodiments, the 5' phosphate analog contains a phosphate-resistant linkage. Examples of phosphate analogs include, but are not limited to, 5' phosphonates, such as 5' methylene phosphonate (5'-MP) and 5'-(E)-vinyl phosphonate (5'-VP). In some embodiments, an oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar at the 5'-terminal nucleotide (referred to as a "4'-phosphate analog"). An example of a 4'-phosphate analog is an oxymethyl phosphonate, where the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., its 4'-carbon) or an analog thereof. See, e.g., U.S. Patent Publication No. 2019-0177729. Other modifications have been developed for the 5' end of oligonucleotides (see, e.g., International Patent Application No. WO2011 / 133871; U.S. Patent No. 8,927,513; and Prakash et al. (2015) NUCLEIC ACIDS RES. 43:2993-3011).

[0259] As used herein, "reduced expression" of a gene (e.g., KHK) refers to a reduction in the amount or level of RNA transcript (e.g., KHK mRNA) or protein encoded by the gene, and / or a reduction in the amount or level of the activity of the gene in a cell, a population of cells, a sample, or a subject, when compared to an appropriate reference (e.g., a reference cell, a population of cells, a sample, or a subject). For example, the act of contacting a cell with an oligonucleotide herein (e.g., an oligonucleotide comprising an antisense strand having a nucleotide sequence that is complementary to a nucleotide sequence comprising KHK mRNA) can result in a reduction in the amount or level of KHK mRNA, protein, and / or activity, when compared to a cell that is not treated with dsRNA (e.g., via degradation of KHK mRNA by the RNAi pathway). Similarly, as used herein, "reducing expression" refers to an act that results in reduced expression of a gene (e.g., KHK). As used herein, "reduced KHK expression" refers to a decrease in the amount or level of KHK mRNA, KHK protein and / or KHK activity in a cell, a population of cells, a sample or a subject when compared to an appropriate reference (e.g., a reference cell, population of cells, sample or subject).

[0260] As used herein, "complementary region" refers to a sequence of nucleotides of a nucleic acid (e.g., dsRNA) that is sufficiently complementary to an antiparallel sequence of nucleotides to allow hybridization between the two sequences of nucleotides under suitable hybridization conditions (e.g., in phosphate buffer, in a cell, etc.).In some embodiments, the oligonucleotide herein comprises a targeting sequence that has a complementary region to an mRNA target sequence.In some embodiments, the complementary region is completely complementary.In some embodiments, the complementary region is partially complementary (e.g., up to 3 nucleotide mismatches). As used herein, "ribonucleotide" refers to a nucleotide having ribose as its pentose sugar, which contains a hydroxyl group at its 2' position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of an atom other than the 2' position, including modifications or substitutions in or of the ribose, phosphate group, or base.

[0261] As used herein, "RNAi oligonucleotide" refers to either (a) a double-stranded oligonucleotide having a sense strand (passenger) and an antisense strand (guide), where the antisense strand or a portion of the antisense strand is used by Argonaute 2 (Ago2) endonuclease in cleaving a target mRNA (e.g., KHK mRNA), or (b) a single-stranded oligonucleotide having a single antisense strand, where the antisense strand (or a portion of the antisense strand) is used by Ago2 endonuclease in cleaving a target mRNA (e.g., KHK mRNA).

[0262] As used herein, a "strand" refers to a single contiguous sequence of nucleotides linked together through internucleotide linkages (e.g., phosphodiester or phosphorothioate linkages). In some embodiments, a strand has two free ends (e.g., a 5' end and a 3' end). As used herein, "subject" refers to any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or NHP. Also, "individual" or "patient" may be used interchangeably with "subject." As used herein, "synthetic" refers to a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid-state nucleic acid synthesizer)) or is not otherwise derived from a natural source (e.g., a cell or organism) that normally produces the molecule.

[0263] As used herein, a "targeting ligand" refers to a molecule (e.g., a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid) that selectively binds to a cognate molecule (e.g., a receptor) of a tissue or cell of interest and can be conjugated to another substance for the purpose of targeting other substances to the tissue or cell of interest. For example, in some embodiments, a targeting ligand may be conjugated to an oligonucleotide for the purpose of targeting the oligonucleotide to a specific tissue or cell of interest. In some embodiments, a targeting ligand selectively binds to a cell surface receptor. Thus, in some embodiments, a targeting ligand, when conjugated to an oligonucleotide, facilitates delivery of the oligonucleotide to a specific cell by selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of a complex comprising the oligonucleotide, the targeting ligand, and the receptor. In some embodiments, a targeting ligand is conjugated to an oligonucleotide via a linker that is cleaved after or during internalization by the cell, such that the oligonucleotide is released from the targeting ligand in the cell.

[0264] As used herein, "tetraloop" refers to a loop that increases the stability of a contiguous duplex formed by hybridization of flanking sequences of nucleotides. The increase in stability is measured by the increase in the melting temperature (T) of the contiguous stem duplex, on average, predicted from a series of loops of comparable length consisting of randomly selected sequences of nucleotides. m ) higher than the T of the adjacent stem duplex m For example, a tetraloop can be detected as an increase in T of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C. in 10 mM NaHPO for a hairpin containing a duplex at least 2 base pairs (bp) in length. mIn some embodiments, the tetraloop can provide a T of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C. in 10 mM NaH2PO4 for a hairpin comprising a duplex of at least 2 base pairs (bp) in length. mIn some embodiments, the tetraloop may stabilize the bp in the adjacent stem duplex by stacking interactions. In addition, interactions between nucleotides in the tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonds, and contact interactions (Cheong et al. (1990) NATURE 346:680-82; Heus & Pardi (1991) SCIENCE 253:191-94). In some embodiments, the tetraloop comprises or consists of 3-6 nucleotides, typically 4-5 nucleotides. In certain embodiments, the tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., conjugated to a targeting moiety or may not be conjugated). In one embodiment, the tetraloop consists of 4 nucleotides. Any nucleotide may be used in the tetraloop, and the standard IUPAC-IUB symbols for such nucleotides may be used, as described in Cornish-Bowden (1985) Nucleic Acids Res. 13:3021-3030. For example, the letter "N" may be used to mean that any base may be present at that position, the letter "R" may be used to indicate that A (adenine) or G (guanine) may be present at that position, and "B" may be used to indicate that C (cytosine), G (guanine), or T (thymine) may be present at that position. Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al. (1990) PROC. NATL. ACAD. SCI. USA 87:8467-8471; Antao et al. (1991) NUCLEIC ACIDS RES. 19:5901-5905).Examples of DNA tetraloops include tetraloops of the d(GNNA) family (e.g., d(GTTA), d(GNRA)) family, tetraloops of the d(GNAB) family, tetraloops of the d(CNNG) family, and tetraloops of the d(TNCG) family (e.g., d(TTCG)). See, e.g., Nakano et al. (2002) BIOCHEM. 41:14281-92; Okabe et al. (2000) NIPPON KAGAKKAI KOEN YOKOSHU 78:731. In some embodiments, the tetraloop is contained within a nicked tetraloop structure.

[0265] As used herein, "treat" or "treating" refers to the act of providing care to a subject in need thereof, for example, by administering a therapeutic agent (e.g., an oligonucleotide herein) to the subject for the purpose of improving the health and / or well-being of the subject with respect to an existing condition (e.g., disease, disorder) or preventing or reducing the likelihood of the occurrence of a condition. In some embodiments, treatment includes reducing the frequency or severity of at least one sign, symptom, or contributor to a condition (e.g., disease, disorder) experienced by the subject. EXAMPLES

[0266] Although the present disclosure has been described with reference to specific embodiments shown in the following examples, it should be understood by those skilled in the art that various modifications may be made and equivalents may be substituted without departing from the true spirit and scope of the present disclosure. Moreover, the following examples are provided for illustrative purposes and are not intended to limit the scope of the present disclosure in any manner. In addition, modifications may be made to adapt the circumstances, materials, compositions of matter, processes, one or more process steps to the purpose, spirit, and scope of the present disclosure. All such modifications are intended to be within the scope of the present disclosure. Standard techniques well known in the art or those specifically described below were utilized.

[0267] RNAi agents targeting KHK have been described and tested in vitro (e.g., WO2015123264 and WO2020060986). The following studies describe the identification of novel dsRNAi agents useful for reducing or inhibiting KHK expression based on in vitro and in vivo screening, including studies in non-human primates. The novel dsRNAi agents include a 36-mer sense strand and a 22-mer antisense strand, with a stem-loop having a nicked tetraloop conjugated to a GalNAc moiety at the 3' end of the sense strand to reduce KHK mRNA. The presence of the nick in the stem-loop provides a pre-cleaved antisense strand to form a pre-processed binding substrate for the Dicer enzyme, allowing Dicer to efficiently bind and hand off the double-stranded molecule to Ago2. The tetraloop provides a thermodynamically stabilizing element that prevents the loop from opening and being exposed at the 5' end of the antisense strand and the 3' end of the sense strand, thereby providing increased nuclease resistance.Therefore, this dsRNAi agent is particularly useful for inhibiting KHK expression in vitro and in vivo, as described in the following examples.

[0268] Compared with the dsRNAi agent described in the prior art, the dsRNAi agent presented herein may show improved in particular in vitro and / or in vivo reduction or inhibition of KHK expression, as determined for KHK mRNA and / or KHK protein level.Such improvement may relate to the size and / or duration of the inhibitory effect.Therefore, for example, lower doses and / or lower dose frequencies may be applicable for the medical use of the dsRNAi agent according to the present invention.The dsRNAi agent presented herein may also benefit from advantageous safety and tolerability features, such as high specificity, low off-target effect, or reduced immunogenicity.

[0269] Example 1 Preparation of double-stranded RNAi oligonucleotides Oligonucleotide synthesis and purification The double-stranded RNAi (dsRNA) oligonucleotides described in the preceding examples are chemically synthesized using methods described herein. Generally, dsRNAi oligonucleotides can be prepared using phosphoramidite synthesis as described in the literature (see, e.g., Hughes and Ellington (2017) COLD SPRING HARB PERSPECT BIOL. 9(1):a023812; Beaucage SL, Caruthers MH, Studies on Nucleotide Chemistry V: Deoxynucleoside Phosphoramidites-A New Class of Key Intermediates for Deoxypolynucleotide Synthesis, TETRAHEDRON LETT. 1981; 22:1859-62. doi: 10.1016 / S0040-4039(01)90461-7), as well as 19-23mer siRNAs (see, e.g., Scaringe et al. (1990) NUCLEIC ACIDS RES. 18:5433-5441 and Usman et al. (1987) J. AM. CHEM. SOC. 109:7845-7845; see also U.S. Patent Nos. 5,804,683; 5,831,071; 5,998,203; 6,008,400; 6,111,086; 6,117,657; 6,353,098; 6,362,323; 6,437,117 and 6,469,158). The dsRNAi oligonucleotide with a 19-mer core sequence is formatted into a construct with a 25-mer sense strand and a 27-mer antisense strand to allow processing by the RNAi machinery. The 19-mer core sequence is complementary to a region in KHK mRNA.

[0270] Individual RNA strands were synthesized and HPLC purified according to standard methods (Integrated DNA Technologies; Coralville, IA). For example, RNA oligonucleotides were synthesized using solid-phase phosphoramidite chemistry, deprotection, and desalting on a NAP-5 column (Amersham Pharmacia Biotech; Piscataway, NJ) using standard techniques (Damha & Olgivie (1993) METHODS MOL. BIOL. 20:81-114; Wincott et al. (1995) NUCLEIC ACIDS RES. 23:2677-84). Oligomers were purified using ion-exchange high performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm x 25 cm; Amersham Pharmacia Biotech) using a linear gradient of 15 min steps. The gradient varied from 90:10 buffer A:B to 52:48 buffer A:B, where buffer A was 100 mM Tris pH 8.5 and buffer B was 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260 nm and peaks corresponding to full-length oligonucleotide species were collected, pooled, desalted on a NAP-5 column and lyophilized.

[0271] The purity of each oligomer was determined by capillary electrophoresis (CE) in a Beckman PACE 5000 (Beckman Coulter, Inc.; Fullerton, CA). The CE capillary has an inner diameter of 100 μm and contains ssDNA 100R gel (Beckman-Coulter). Typically, about 0.6 nmole of oligonucleotide was injected into the capillary, run at an electric field of 444 V / cm, and detected by UV absorbance at 260 nm. Denaturing Tris-borate-7M-urea running buffer was purchased from Beckman-Coulter. Oligoribonucleotides of at least 90% purity as assessed by CE were obtained for use in the experiments described below. Compound identity was verified by matrix-assisted laser desorption / ionization (MALDI-TOF) mass spectrometry on a Voyager DE™ Biospectometry Work Station (Applied Biosystems; Foster City, Calif.) following the manufacturer's recommended protocol. Relative molecular masses of all oligomers were obtained within 0.2% of the predicted molecular mass in most cases.

[0272] Preparation of duplex Single-stranded RNA oligomers were re...

Claims

1. A double-stranded RNAi oligonucleotide for reducing ketohexokinase (KHK) expression, the oligonucleotide comprising an antisense strand and a sense strand, the antisense strand and the sense strand forming a duplex region, the antisense strand comprising a region of complementarity to a KHK mRNA target sequence of any one of SEQ ID NOs: 4 to 387, the region of complementarity being at least 15 contiguous nucleotides in length, or a pharma- ceutically acceptable salt thereof; Preferably, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 4 to 387; and / or The antisense strand comprises a sequence as set forth in any one of SEQ ID NOs: 388 to 771; Double-stranded RNAi oligonucleotides.

2. A double-stranded RNAi oligonucleotide for inhibiting expression of KHK, the double-stranded RNAi oligonucleotide comprising a sense strand and an antisense strand forming a duplex region, the sense strand comprising at least 15 consecutive nucleotides differing from any one of the nucleotide sequences of SEQ ID NOs: 4 to 387 by 3 nucleotides or less, and the antisense strand comprising at least 15 consecutive nucleotides differing from any one of the nucleotide sequences of SEQ ID NOs: 388 to 771 by 3 nucleotides or less, or a pharma- ceutically acceptable salt thereof; Preferably, the sense strand is 18-36 nucleotides in length and / or the antisense strand is 15-30 nucleotides in length. Double-stranded RNAi oligonucleotides.

3. 1. A double-stranded RNAi (dsRNAi) oligonucleotide for reducing or inhibiting ketohexokinase (KHK) expression, the oligonucleotide comprising: (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence that includes a region of complementarity to a KHK mRNA target sequence, wherein the region of complementarity is selected from SEQ ID NOs: 948-953; and (ii) a sense strand having a length of 19 to 50 nucleotides that contains a region of complementarity to the antisense strand; Including, the antisense strand and the sense strand are separate strands that form an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand; Double-stranded RNAi oligonucleotides.

4. The double-stranded RNAi oligonucleotide according to claim 1 or 3, wherein the complementary region contained in the antisense strand is at least 19 contiguous nucleotides in length, preferably 19 nucleotides.

5. The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3, wherein the duplex region is at least 20 nucleotides in length, preferably 20 nucleotides.

6. The sense strand has at its 3' end: S1-L-S2 where S1 is complementary to S2, L forms a loop between S1 and S2 that is 3-5 nucleotides long. and a stem loop represented as: Preferably, the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO:871), The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

7. At least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands; Preferably, each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety; More preferably, one or more targeting ligands are conjugated to one or more nucleotides of the loop according to claim 6. The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

8. the overhang is 2 nucleotides in length, Preferably, selected from AA, GG, AG, and GA; More preferably, the overhang is GG. The double-stranded RNAi oligonucleotide according to claim 3 .

9. all nucleotides of the oligonucleotide are modified; Preferably, 10-15%, 10%, 11%, 12%, 13%, 14% or 15% of the nucleotides of the sense strand comprise a 2'-fluoro modification; and / or about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand contain 2'-fluoro modifications; The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

10. The oligonucleotide comprises at least one phosphorothioate linkage, Preferably, it contains at least one phosphorothioate linkage between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4; Positions are numbered 1 to 4 from 5' to 3'; The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

11. The 4'-carbon of the sugar of the 5'-terminal nucleotide of the antisense strand is a phosphate analog, Preferably, the 4'-phosphate analog includes 5'-methoxyphosphonate-4'-oxy. The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

12. the antisense strand is 22 nucleotides in length, and / or The sense strand is 36 nucleotides in length; The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

13. The sense strand and the antisense strand are (a) SEQ ID NOs: 887 and 913, respectively; or (b) SEQ ID NOs: 891 and 917, respectively; or (c) SEQ ID NOs: 892 and 918, respectively; or (d) SEQ ID NOs: 894 and 920, respectively; or (e) SEQ ID NOs: 897 and 923, respectively; or (f) SEQ ID NOs: 909 and 936, respectively. comprising the nucleotide sequence shown in The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3.

14. A double-stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, the dsRNAi comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a KHK RNA transcript, e.g., KHK mRNA; (a) the sense strand comprises the sequence of 5'-mG-S-mA-mA-mG-mA-mG-mA-mG-mA-fA-fG-fC-fA-mG-mA-mU-mC-mC-mU-mG-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO:775), and all of its modifications; the antisense strand comprises the sequence 5'-[Mephosphonate 4O-mU]-S-fA-S-fC-fA-fG-mG-fA-mU-mC-fU-mG-mC-mU-fU-mC-mU-mC-mU-mC-S-mG-S-mG-3' (SEQ ID NO: 820) and all of its modifications; or (b) the sense strand comprises the sequence 5'-mC-S-mA-mG-mA-mU-mG-mU-fG-fU-fC-fU-mG-mC-mU-mA-mC-mA-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO:779), and all of its modifications; the antisense strand comprises the sequence 5'-[Mephosphonate 4O-mU]-S-fU-S-fC-S-fU-fG-mU-fA-mG-mC-fA-mG-mA-mC-fA-mC-mA-mU-mC-mU-mG-S-mG-S-mG-3' (SEQ ID NO:824) and all of its modifications; or (c) the sense strand comprises the sequence 5'-mG-S-mA-mC-mU-mU-mU-mG-fA-fG-fA-fA-mG-mG-mU-mU-mG-mA-mU-mC-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 780), and all of its modifications; the antisense strand comprises the sequence 5'-[Mephosphonate 4O-mU]-S-fG-S-fA-S-fU-fC-mA-fA-mC-mC-fU-mU-mC-mU-fC-mA-mA-mA-mG-mU-mC-S-mG-S-mG-3' (SEQ ID NO:825) and all of its modifications; or (d) the sense strand comprises the sequence 5'-mU-S-mU-mU-mG-mA-mG-mA-fA-fG-fG-fU-mU-mG-mA-mU-mC-mU-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO:782), and all of its modifications; the antisense strand comprises the sequence 5'[Mephosphonate 4O-mU]-S-fU-S-fC-S-fA-fG-mA-fU-mC-mA-fA-mC-mC-mU-fU-mC-mU-mC-mA-mA-mA-S-mG-S-mG-3' (SEQ ID NO:827) and all of its modifications; or (e) the sense strand comprises the sequence of 5'-mU-S-mG-mU-mU-mU-mG-mU-fC-fA-fG-fC-mA-mA-mA-mG-mA-mU-mG-mU-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO:785), and all of its modifications; the antisense strand comprises the sequence 5'-[Mephosphonate 4O-mU]-S-fA-S-fC-fA-fU-mC-fU-mU-mU-fG-mC-mU-mG-fA-mC-mA-mA-mA-mC-mA-S-mG-S-mG-3' (SEQ ID NO:830) and all of its modifications; or (f) the sense strand comprises the sequence 5'-mG-S-mC-mA-mG-mG-mA-mA-fG-fC-fA-fC-mU-mG-mA-mG-mA-mU-mU-mC-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3' (SEQ ID NO: 804), and all of its modifications; the antisense strand comprises the sequence of 5'-[Mephosphonate 4O-mU]-S-fG-S-fA-S-fA-fU-mC-fU-mC-mA-fG-mU-mG-mC-fU-mU-mC-mC-mU-mG-mC-S-mG-S-mG-3' (SEQ ID NO:849), and all of its modifications; where mC, mA, mG, mU = 2'-OMe ribonucleosides; fA, fC, fG, fU = 2'F ribonucleosides; "-" = phosphodiester linkage, "-S-" = phosphorothioate linkage, and ademA-GalNAc = 【Chemistry 1】 That is, A double-stranded RNAi oligonucleotide, or a pharma- ceutically acceptable salt thereof.

15. A double-stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of KHK, the dsRNAi comprising: (a) a sense strand comprising SEQ ID NO: 775 and an antisense strand comprising SEQ ID NO: 820, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 2】 【change】 or (b) a sense strand comprising SEQ ID NO: 779 and an antisense strand comprising SEQ ID NO: 824, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 3】 【change】 or (c) a sense strand comprising SEQ ID NO: 780 and an antisense strand comprising SEQ ID NO: 825, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 4】 【change】 or (d) a sense strand comprising SEQ ID NO: 782 and an antisense strand comprising SEQ ID NO: 827, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 5】 【change】 or (e) a sense strand comprising SEQ ID NO: 785 and an antisense strand comprising SEQ ID NO: 830, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 6】 【change】 or (f) a sense strand comprising SEQ ID NO: 804 and an antisense strand comprising SEQ ID NO: 849, wherein the antisense strand comprises a region complementary to a KHK RNA transcript, e.g., a KHK mRNA, and the dsRNAi is 【Chemistry 7】 【change】 the sense and antisense strands in the form of a conjugate having the structure: Including, A double-stranded RNAi oligonucleotide, or a pharma- ceutically acceptable salt thereof.

16. A pharmaceutical composition comprising the double-stranded RNAi oligonucleotide according to any one of claims 1 to 3 and 14 to 15, or a pharma- ceutically acceptable salt thereof, and at least one pharma- ceutically acceptable carrier, delivery agent, or excipient.

17. The double-stranded RNAi oligonucleotide according to any one of claims 1 to 3 and 14 to 15 for use as a medicament.

18. A double-stranded RNAi oligonucleotide according to any one of claims 1 to 3 and 14 to 15 for use in the treatment of a disease, disorder or condition associated with KHK expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

19. The double-stranded RNAi oligonucleotide of claim 18 , which is administered in combination with a second composition or therapeutic agent.

20. 1. A method for reducing KHK expression in a cell, a population of cells, or a subject, comprising: i. contacting a cell or a population of cells with the double-stranded RNAi oligonucleotide according to any one of claims 1 to 3 and 14 to 15, or a pharma- ceutically acceptable salt thereof; or ii. A step of administering the double-stranded RNAi oligonucleotide or a pharma- ceutical acceptable salt thereof according to any one of claims 1 to 3 and 14 to 15 to a subject. A method comprising:

21. The pharmaceutical composition of claim 16 for use as a medicine.

22. A pharmaceutical composition as described in claim 16 for use in the treatment of a disease, disorder or condition associated with KHK expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

23. The pharmaceutical composition of claim 22, administered in combination with a second composition or therapeutic agent.

24. A method for reducing KHK expression in a cell, a population of cells, or a subject, comprising: i. contacting a cell or a population of cells with the pharmaceutical composition of claim 16; or ii. Administering the pharmaceutical composition of claim 16 to a subject. A method comprising:

Images