Compositions and methods for treating NGYL1 deficiency

Abstract

Disclosed herein are compositions and methods useful for expressing functional NGLY1 protein in a subject by administering an rAAV containing a transgene encoding NGLY1. Also disclosed herein are methods for treating NGLY1 gene deficiency in a subject in need thereof.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 180,065, filed April 26, 2021. The contents of this earlier filed application are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing, which is being submitted contemporaneously with the filing of this application via EFS-Web, contains the filename "38132_0001P1_SL.txt", is 28,672 bytes in size, was created on April 11, 2022, and is hereby incorporated by reference in its entirety. [Background technology]

[0003] NGLY1 deficiency is an extremely rare autosomal recessive disorder caused by loss of NGLY1 function. The current known prevalence is 27 out of approximately 331 million people living in the United States. It is an extremely severe childhood disease that manifests at birth and during early development and has a significant impact on daily functioning. Because NGLY1 protein is not a secreted protein, its assay requires tissue biopsy and no diagnostic assay for its activity exists. Currently, whole-exome or whole-genome sequencing is the only way to confirm the diagnosis.

[0004] Individuals with NGLY1 deficiency are extremely severely ill. Daily care by caregivers is required for patients to survive. Phenotypically, disease presentation includes (1) global developmental delay and / or intellectual disability, (2) (hypo)lacrimation, (3) elevated liver transaminases, and (4) hyperkinetic dyskinesia. Ninety percent of patients never walk and must use a walker or wheelchair from an early age. Most patients (94.6%; 35 / 37) surveyed as part of the NGLY1 registry are non-verbal, and those able to express words rely on augmentative and alternative communication (AAC) devices for communication and treatment. Adequate nutrition requires manual feeding or the use of a gastrostomy tube (G-tube) administered by a caregiver. Caregivers must manage all aspects of the daily bathing and toileting regimen. Pneumonia and urinary tract infections require frequent hospitalizations. Approximately half of patients (51.4%; 18 / 37) experience seizures that may require hospitalization. Surgery is common for several problems, including spinal fusion, inguinal hernias, tracheotomy, and kidney problems.

[0005] Additional multisystem clinical findings include apparent progressive brain atrophy and acquired microcephaly; ophthalmologic manifestations including exophthalmos, optic atrophy, and retinal changes; constipation; hepatomegaly and other liver abnormalities; hypocholesterolemia; length-dependent sensorimotor axonal loss; muscle atrophy; and joint contractures that limit mobility.

[0006] There are 51 variants in the 65 patients identified by the Grace Science Foundation. These include nonsense, missense, frameshift, and splicing mutations scattered throughout the NGLY1 gene, as well as three partial or complete gene deletions. The variants are found in the catalytic domain, the AAA ATPase-binding PUB domain (IPR018997), and the PAW domain that binds the mannose moiety of N-linked oligosaccharide chains (IPR006588) (Figure 3) (Zhou X, Zhao G, Truglio JJ, Wang L, Li G, Lennarz WJ, et al. Structural and biochemical studies of the C-terminal domain of mouse peptide-N-glycanase identify it as a mannose-binding module. Proc Natl Acad Sci USA. 2006;103(46):17214-17219). The most commonly reported nonsense variant, c.1201A>T (p.Arg401Ter), corresponds to a nearly absent transcript and may portend more severe pathology (Lam C, Wolfe L, Need A, Shashi V, Enns G. NGLY1-related congenital disorder of deglycosylation. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A, editors. GeneReviews(R) [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2019. 2018 Feb 8). [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Zhou X, Zhao G, Truglio JJ, Wang L, Li G, Lennarz WJ, et al. Structural and biochemical studies of the C-terminal domain of mouse peptide-N-glycanase identify it as a mannose-binding module. Proc Natl Acad Sci USA. 2006;103(46):17214-17219 [Non-Patent Document 2] Lam C, Wolfe L, Need A, Shashi V, Enns G. NGLY1 -related congenital disorder of deglycosylation. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A, editors. GeneReviews(R) [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2019. 2018 Feb 8 Summary of the Invention [Problem to be solved by the invention]

[0008] There is currently no known treatment for NGLY1 deficiency and there is a great need in the art for such a treatment. [Means for solving the problem]

[0009] The invention disclosed herein is a method of promoting expression of functional NGLY1 protein in a subject, comprising administering to a subject in need of treatment an effective amount of a recombinant adeno-associated virus (rAAV) comprising a capsid comprising a nucleic acid engineered to express human NGLY1 in at least the central nervous system ("CNS") of the subject (which may be expressed in tissues outside the CNS), wherein the subject has NGLY1 deficiency. In embodiments, the subject comprises two endogenous NGLY1 alleles with loss-of-function mutations associated with NGLY1 deficiency. In certain embodiments, the subject is an NGLY1 deficiency carrier and has one loss-of-function allele. In embodiments, the rAAV comprising a transgene engineered to express NGLY1 is administered by intracerebroventricular (ICV) administration, or alternatively by administration into the cisterna magna. In embodiments, the rAAV has an AAV9 serotype. The coding sequence for the NGLY1 protein may, in embodiments, be codon-optimized, including reduced in the presence of CpG dinucleotides, and have the nucleotide sequence of SEQ ID NO: 1. The administration methods described herein result in improvement of symptoms and / or biomarkers of NGLY1 deficiency within an appropriate period of time following administration, such as a reduction in accumulation of GlcNAc-Asparagine (GNA) in the CNS or other biological sample of the subject, behavioral indices that are quantifiable or indicative of one or more signs or symptoms of NGLY1 deficiency, frequency of seizures, developmental delay, neurocognitive function, dystonia, polyneuropathy, abnormal sweat response, gait abnormalities, and motor function.

[0010] Also disclosed herein is a method of treating a subject having NGLY1 deficiency, the method comprising administering to the subject an effective amount of rAAV comprising a capsid containing a nucleic acid engineered to express at least NGLY1 in the CNS of the subject, in an embodiment where administration is ICV administration (alternatively, the rAAV may be administered via the cisterna magna).

[0011] According to one embodiment of the present invention, disclosed herein is a method for reducing accumulation of GlcNAc-Asn (GNA) in at least the CNS of a subject, the method comprising administering to the subject a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising a transgene encoding NGLY1 operably linked to a regulatory element for expression in the CNS of the subject, the subject having NGLY1 deficiency, in certain embodiments, the subject has (or is homozygous for) two loss-of-function NGLY1 alleles, or alternatively, the subject comprises at least one endogenous NGLY1 allele with a loss-of-function mutation associated with NGLY1 deficiency, e.g., a carrier of NGLY1 deficiency, in embodiments, the rAAV is administered by ICV administration, or alternatively via the cisterna magna. In embodiments, the subject comprises two endogenous NGLY1 alleles with a loss-of-function mutation associated with NGLY1 deficiency.

[0012] According to one embodiment of the present invention, disclosed herein is a method of monitoring GlcNAc-Asn (GNA) levels in cerebrospinal fluid (CSF) and / or plasma of a subject, the method comprising measuring GNA levels in a first sample including CSF and / or plasma before administering to the subject a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising a transgene encoding NGLY1 operably linked to a regulatory element for expression in the CNS of the subject, and comparing GNA levels in a subsequent sample from the subject after rAAV administration to determine efficacy of the rAAV, wherein the subject comprises at least one endogenous NGLY1 allele having a loss-of-function mutation associated with NGLY1 deficiency, and in an embodiment, the rAAV is administered by ICV administration or alternatively via the cisterna magna. In an embodiment, the subject comprises two endogenous NGLY1 alleles having loss-of-function mutations associated with NGLY1 deficiency.

[0013] Another embodiment of the invention disclosed herein is a rAAV comprising a nucleic acid engineered to express NGLY1 in at least the central nervous system ("CNS"). In another embodiment, the nucleic acid encoding NGLY1 further comprises a promoter of SEQ ID NO: 4 and an intron having SEQ ID NO: 5. Gene expression cassette constructs are provided having the nucleotide sequence of SEQ ID NO: 8 (comprising the nucleotide sequence of SEQ ID NO: 1 operably linked to a CAG promoter and polyA signal sequence) or SEQ ID NO: 9 (the entire construct with flanking ITR sequences).

[0014] In yet another embodiment of the invention disclosed herein, there is a nucleic acid molecule expressing NGLY1 that is incorporated into the rAAV of the invention.

[0015] In another embodiment of the invention, there is a host cell comprising the rAAV of the invention. [Brief description of the drawings]

[0016] [Figure 1] FIG. 8 shows the biodistribution of GS-100 (e.g., an rAAV9 vector containing a codon-optimized full-length version of hNGLY1 (SEQ ID NO: 1) under the control of a CAG promoter and a polyA signal with flanking ITR sequences (see FIG. 8)) vector DNA. [Diagram 2] FIG. 1 shows that ICV GS-100 administration results in CNS hNGLY1 (human NGLY1) protein expression in an animal model of NGLY1 deficiency. [Diagram 3] FIG. 1 shows that GNA can be detected in NGLY1-deficient organisms. [Figure 4] FIG. 1 shows that GS-100 administration reduced GNA biomarker levels. [Diagram 5] FIG. 1 shows that GNA biomarker reduction correlates in tissues and body fluids. [Figure 6A] ~ [Figure 6B]6 shows that GS-100 improves behavioral defects in Ngly1-deficient rats. Figure 6A shows that GS-100 treatment improves the latency of rats to fall onto the rotarod. Figure 6B shows that ICV administration of GS-100 treatment increases rearing. [Figure 7] Figure 7 shows that GS-100 vector genome and hNGLY1 mRNA expression correlates with GNA tissue concentrations in the hippocampus. Figure 7 also shows that improvement in rearing behavior is associated with reduced CSF and tissue GNA levels after GS-100 treatment. [Figure 8] Schematic diagram of the AAV9NGLY1 expression vector GS-100, containing the inverted terminal repeats (ITR), CMV enhancer / Chicken B-actin promoter combination (CAG), codon-optimized human NGLY1 cDNA (hNGLY1 cDNA), a mutated Woodchuck Hepatitis Virus posttranscriptional regulatory element (WPRE-mut6); and a rabbit beta-globin polyadenylation signal (polyA). [Figure 9] FIG. 1 shows the trend toward decreased GNA accumulation following intravenous administration of GSL-14 (e.g., AAV-NGLY1; hNGLY1 cDNA codons optimized for reduced CpG content, and a V5 tag contained with a CAG promoter). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The present invention may be understood more readily by reference to the following detailed description of the invention, the drawings, and examples contained herein.

[0018] The terminology used herein is for the purpose of describing particular embodiments of the invention only and is not intended to be limiting.

[0019] All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided herein may be different from the actual publication dates, which may require independent confirmation.

[0020] definition As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0021] As used herein, the word "or" means any one member of a particular list and also includes any combination of members of that list.

[0022] The phrase "and / or" as used in the specification and claims should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctive in some cases and disjunctive in other cases. Other elements may be present other than the elements specifically identified by the "and / or" clause, whether or not associated with those elements specifically identified, unless expressly indicated otherwise. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising," can refer in one embodiment to A without B (which may include elements other than B); in another embodiment to B without A (which may include elements other than A); in yet another embodiment to both A and B (which may include other elements), etc.

[0023] As used herein, the term "transgene" refers to a gene or genetic material that has been transferred into the genome by genetic engineering techniques or artificially introduced from one organism into another, i.e., a host organism.

[0024] As used herein, the term "transgene expression" relates to the control of the amount and timing of appearance of a functional product of a transgene in a host organism.

[0025] As used herein, the term "endogenous" refers to substances and processes that originate from within an organism, tissue or cell.

[0026] "Inhibit", "inhibiting" and "inhibition" refer to reducing or decreasing gene expression, activity, response, condition, disease, or other biological parameter (e.g., GNA). This can include, but is not limited to, complete ablation of the activity, response, condition, or disease. This can also include, for example, a 10% inhibition or reduction in gene expression, activity, response, condition, or disease compared to wild-type or control levels. Thus, in some embodiments, the inhibition or reduction can be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any reduction therebetween, when compared to native or control levels. In some embodiments, the inhibition or reduction is 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100% when compared to wild-type or control levels. In some aspects, inhibition or reduction is between 0-25, 25-50, 50-75, or 75-100% when compared to wild-type or control levels.

[0027] "Promote", "promotion", and "promoting" refer to an increase in an activity, response, condition, disease, or other biological parameter. This can include, but is not limited to, the onset of an activity, response, condition, or disease. This can also include, for example, a 10% increase in an activity, response, condition, or disease when compared to wild-type or control levels. Thus, in some embodiments, the increase or promotion can be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100% or more, or any amount of promotion in between, when compared to native or control levels. In some embodiments, the increase or promotion is 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100% when compared to wild-type or control levels. In some embodiments, the increase or promotion is 0-25, 25-50, 50-75, or 75-100% or more, e.g., 200, 300, 500, or 1000% or more, when compared to wild-type or control levels. In some embodiments, the increase or promotion can be greater than 100% when compared to wild-type or control levels, e.g., 100, 150, 200, 250, 300, 350, 400, 450, 500% or more, when compared to wild-type or control levels.

[0028] The term "operably linked" refers to the functional relationship of a nucleic acid to another nucleic acid sequence. Promoters, enhancers, transcription and translation termination sites, and other signal sequences are examples of nucleic acid sequences that are linked to other sequences to confer functional activity of the construct as a whole. For example, operably linking DNA to a transcriptional control element refers to the physical and functional relationship between the DNA and the promoter, such that transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to, and transcribes the DNA.

[0029] As used herein, the terms "promoter," "promoter element," or "promoter sequence" are equivalents and, as used herein, refer to a DNA sequence that, when operably linked to a desired nucleotide sequence, is capable of controlling the transcription of the desired nucleotide sequence into mRNA. A promoter is located 5' (i.e., upstream) of the desired nucleotide sequence (e.g., proximal to the transcription start site of a structural gene), but not necessarily immediately upstream, since intervening sequences are optionally included between the promoter and the sequence to be transcribed, which control its transcription into mRNA and provide specific binding sites by RNA polymerase and other transcription factors for initiation of transcription.

[0030] As used herein, the term "subject" refers to the target of administration, e.g., a human. Thus, the subject of the disclosed method may be, for example, a vertebrate, such as a mammal, fish, bird, reptile, or amphibian. The term "subject" also includes domestic animals (e.g., cats, dogs, etc.), livestock animals (e.g., cows, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mice, rabbits, rats, guinea pigs, fruit flies, etc.). In some aspects, the subject may be a mammal. In some aspects, the subject may be a human. The term does not denote a particular age or sex. Thus, adult, pediatric, adolescent, and neonatal subjects, as well as fetuses, whether male or female, are within the scope of the present invention.

[0031] As used herein, the term "patient" refers to a subject suffering from a disease or disorder. The term "patient" includes human and veterinary subjects. In some aspects of the methods of the present invention, the "patient" has been diagnosed as needing treatment for NGLY1 deficiency, for example, prior to the next administration of the gene therapy NGLY1 composition of the present invention. In some aspects of the methods of the present invention, the patient in need of treatment for NGLY1 deficiency can be heterozygous for a loss of function mutation in the NGLY1 gene, or can be homozygous for a loss of function mutation in the NGLY1 gene.

[0032] As used herein, the term "normal" refers to an individual, sample, or subject that does not have NGLY1 deficiency or does not have an increased susceptibility to developing NGLY1 deficiency.

[0033] As used herein, the term "treat" or "treatment" refers to the medical management of a patient with the goal of curing, relieving, or stabilizing (e.g., NGLY1 deficiency). The term includes active treatment, i.e., treatment specifically directed to ameliorating a disease, pathological condition, or disorder, and also includes causal treatment, i.e., treatment directed to eliminating the cause of the associated disease, pathological condition, or disorder. In addition, the term includes palliative treatment, i.e., treatment designed to alleviate symptoms other than the cure of a disease, pathological condition, or disorder; preventive treatment, i.e., treatment directed to minimizing or partially or completely inhibiting the onset of the associated disease, pathological condition, or disorder; and supportive treatment, i.e., treatment employed to complement another specific therapy directed to ameliorating the associated disease, pathological condition, or disorder; and supportive treatment, i.e., treatment employed to complement another specific therapy directed to ameliorating the associated disease, pathological condition, or disorder. In various aspects, the term encompasses any treatment of a subject, including a mammal (e.g., a human), including (i) inhibiting the disease, i.e., arresting its development; or (ii) alleviating the disease (e.g., NGLY1 deficiency), i.e., causing regression of the disease.

[0034] As used herein, the term "prevent" or "preventing" means to eliminate, avoid, remove, halt, stop, or hinder something from happening, especially by preemptive measures. Unless otherwise indicated, it is understood that when reduce, inhibit, or prevent is used herein, the use of the other two terms is also expressly disclosed. For example, "prevent" means to minimize the chance that a subject with an increased susceptibility to developing NGLY1 deficiency will develop NGLY1 deficiency. In the context used herein, prevention does not necessarily completely eliminate all sequelae associated with NGLY1 deficiency, but encompasses any reduction in the appearance of one or more symptoms associated with NGLY1 deficiency.

[0035] Disclosed herein is a therapeutic modality, preferably AAV9-mediated NGLY1 gene therapy (e.g., GS-100), for treating a subject with NGLY1 deficiency to reduce one or more symptoms associated with NGLY1 deficiency or prevent the onset of one or more symptoms associated with NGLY1 deficiency. The development of GS-100 involved 1) the identification of reliable biomarkers for NGLY1 deficiency consistent with a deficiency in NGLY1 enzyme activity, and 2) the use of an animal disease model that exhibits both systemic and CNS / PNS disease features.

[0036] The NGLY1 gene encodes N-glycanase, a conserved cytoplasmic deglycosylase involved in the endoplasmic reticulum-associated protein degradation (ERAD) pathway. It cleaves N-glycans from asparagine residues of misfolded proteins at a GlcNAc-Asn bond. In the absence of NGLY1, this GlcNAc-Asn bond remains intact, which can lead to cytoplasmic accumulation of Asn-glycan metabolites such as GlcNAc-Asn (aspartylglucosamine or GNA). Loss of NGLY1 activity in cells leads to impaired proteotoxic stress response and defective energy metabolism. Engineered loss of NGLY1 in rats leads to reduced early survival, severe neurodegenerative phenotypes, and pathological abnormalities in the peripheral and central nervous systems, similar to those observed in patients. GNA can also be used as a biomarker for diseases directly related to the activity of NGLY1, and was found to be elevated in both patient and Ngly1-deficient rat samples, as disclosed herein.

[0037] composition Nucleic Acids. Disclosed herein are nucleic acids comprising at least one transgene operably linked to a promoter, wherein the transgene encodes NGLY1 (N-glycanase 1; GENE ID:55768). The NGLY1 gene encodes N-glycanase (EC 3.5.1.52), a highly conserved enzyme that catalyzes the deglycosylation of misfolded N-linked glycoproteins by cleaving glycan chains before the proteins are degraded by the proteasome. NGLY1 is a cytoplasmic component of the endoplasmic reticulum-associated degradation (ERAD) pathway, which identifies and degrades misfolded glycoproteins.

[0038] The NGLY1 gene can encode an mRNA having the nucleotide sequence of NM001145293.1, NM001145294.1, NM001145295.1, or NM018297.4. The NGLY1 gene can encode a protein having the amino acid sequence of NP001138765.1, NP001138766.1, NP001138767.1, or NP060767.2. In some embodiments of the present invention, the NGLY1 gene is codon-optimized for expression in a mammal, such as a human. Sequences corresponding to all GenBank accession numbers described in this disclosure are incorporated herein by reference in their entirety. Additionally, the DNA sequences provided herein can include reverse complements to form double-stranded DNA sequences, or can be reverse complements of sequences disclosed herein.

[0039] In some embodiments, the isolated nucleic acid encoding NGLY1 comprises the following sequence:

[0040] In some embodiments, the nucleic acid sequence encoding NGLY1 comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1. In some aspects, the nucleic acid sequence encoding the NGLY1 gene comprises up to 20 nucleotides different from the NGLY1 gene depicted in SEQ ID NO: 1. In some aspects, the NGLY1 gene comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides different from the NGLY1 gene depicted in SEQ ID NO: 1. In some aspects, the nucleic acid sequence encoding the NGLY1 gene comprises more than 20 nucleotides different from the NGLY1 gene depicted in SEQ ID NO: 1.

[0041] In some aspects, the nucleic acid sequence encoding NGLY1 comprises an insertion relative to SEQ ID NO: 1. In some aspects, the nucleic acid sequence encoding NGLY1 comprises an insertion relative to SEQ ID NO: 1 that does not introduce a frameshift mutation. In some aspects, the insertion into the nucleic acid sequence relative to SEQ ID NO: 1 comprises an insertion of a multiple of three nucleotides (e.g., 3, 6, 9, 12, 15, 18, etc.). In some aspects, the insertion into the nucleic acid sequence relative to SEQ ID NO: 1 results in an increase in the total number of amino acid residues in the resulting NGLY1 protein (e.g., an increase of 1-3, 15, 3-10, 5-10, 5-15, or 10-20 amino acid residues).

[0042] In some aspects, the nucleic acid sequence encoding NGLY1 comprises a deletion relative to SEQ ID NO: 1. In some aspects, the nucleic acid sequence encoding NGLY1 comprises a deletion relative to SEQ ID NO: 1 that does not introduce a frameshift mutation. In some aspects, the deletion of the nucleic acid sequence relative to SEQ ID NO: 1 comprises a deletion of a multiple of three nucleotides (e.g., 3, 6, 9, 12, 15, 18, etc.). In some aspects, the deletion of the nucleic acid sequence relative to SEQ ID NO: 1 results in a reduction in the total number of amino acid residues in the resulting NGLY1 protein (e.g., a reduction of 1-3, 1-5, 3-10, 5-10, 5-15, or 10-20 amino acid residues).

[0043] In some aspects, the nucleic acid sequence encoding NGLY1 is a codon-optimized sequence (e.g., codon optimized for expression in a mammalian cell). In some aspects, the codon-optimized sequence encoding NGLY1 comprises reduced GC content compared to a wild-type sequence that is not codon-optimized. In some aspects, the codon-optimized sequence encoding NGLY1 comprises a 1-5%, 3-5%, 3-10%, 5-10%, 5-15%, 10-20%, 15-30%, 20-40%, 25-50%, or 30-60% reduction in GC content compared to a wild-type sequence that is not codon-optimized. In some aspects, the codon-optimized sequence encoding NGLY1 comprises fewer guanine and / or cytosine nucleobases compared to a wild-type sequence that is not codon-optimized. In some aspects, the codon-optimized sequence encoding NGLY1 comprises 1-5, 3-5, 3-10, 5-10, 5-15, 10-20, 15-30, 20-40, 25-50, or 30-60 fewer guanine and / or cytosine nucleobases than the non-codon-optimized wild-type sequence. In some aspects, the codon-optimized sequence encoding NGLY1 comprises fewer CpG dinucleotide islands than the non-codon-optimized wild-type sequence. In some embodiments, the codon-optimized sequence encoding NGLY1 comprises 1-3, 3-5, 3-10, 5-10, 5-15, 10-20, 15-30, 20-40, 25-50, or 30-60 fewer CpG dinucleotide islands than the non-codon-optimized wild-type sequence. In a specific embodiment, the nucleotide sequence encoding NGLY1 is SEQ ID NO:1.

[0044] Promoter. In the constructs disclosed herein, the nucleic acid encoding the NGLY1 protein, comprising the nucleotide sequence of SEQ ID NO:1, is operably linked to a promoter for direct expression of the sequence encoding NGLY1, particularly in CNS cells. In some embodiments, the promoter is a constitutive promoter, such as a chicken beta-actin (CBA) promoter, a retroviral Rous sarcoma virus (RSV) LTR promoter (with or without an RSV enhancer), a cytomegalovirus (CMV) promoter (with or without a CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], a CMV-enhanced chicken β-actin promoter (CB), a CAG promoter, an SV40 promoter, a dihydrofolate reductase promoter, a (3 actin promoter, a phosphoglycerol kinase (PGK) ... In some aspects, the promoter can be an enhanced chicken β-actin promoter, an EF1a promoter, or an EF1a promoter [Invitrogen]. In some aspects, the promoter can be an enhanced chicken β-actin promoter. In some aspects, the promoter can be a U6 promoter. In some aspects, the promoter can be a CB6 promoter. In some aspects, the promoter can be a JeT promoter. In some aspects, the promoter can be a CB promoter.

[0045] In some embodiments, the CB promoter comprises the following sequence: CACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGCGCGCGCGCGCGCGCGAGGGCGGGCGGGCGGGCGGAGGAGGTGCGGCGCAGCCAATCAGAGCGGCGCGCTCGAAAGTTCCTTTATGGCGGAGGCGGCGGCGGCGGCCCTATAAAAAAGCGAGCGGCGCGGCGGG(sequence number 2)

[0046] In some aspects, the promoter can be an inducible promoter. Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or specific physiological conditions, such as acute phase, the presence of a specific differentiation state of cells, or only replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but not limited to, Invitrogen, Clontech, and Ariad. Many other systems have been described and can be easily selected by one of skill in the art. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)); the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)); the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995)); and also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998); the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)); and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters that may be useful include those that are regulated by specific physiological conditions, such as temperature, acute phase, a particular differentiation state of a cell, or only replicating cells.

[0047] In some aspects, the native promoter for the transgene (e.g., NGLY1) can be used. In some aspects, the native promoter can be used when it is desired that the expression of the transgene should mimic the expression of the native wild-type NGLY1 gene (e.g., the non-mutated NGLY1 gene). The native promoter can be used when the expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus. In some aspects, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, can also be used to mimic the native expression.

[0048] In some aspects, the promoter drives transgene expression in neural tissue. In some aspects, the disclosure provides a nucleic acid operably comprising a tissue-specific promoter operably linked to a transgene. As used herein, a "tissue-specific promoter" refers to a promoter that preferentially regulates (e.g., drives or upregulates) gene expression in a particular cell type relative to other cell types. A cell type-specific promoter can be specific to any cell type, such as a central nervous system (CNS) cell, a liver cell (e.g., a hepatocyte), a cardiac cell, a muscle cell, etc. Examples of tissue-specific promoters include, but are not limited to, a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a creatine kinase (MCK) promoter, an a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include the beta-actin promoter, the Hepatitis B virus core promoter (Sandig et al., Gene Ther., 3:1002-9 (1996)); the alpha-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)); the bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998)), and the immunoglobulin heavy chain promoter.

[0049] As used herein, the term "hybrid promoter" refers to a regulatory construct capable of driving transcription of an RNA transcript (e.g., a transcript encoded by a transgene) where the construct comprises two or more artificially placed regulatory elements. Typically, a hybrid promoter comprises at least one element that is a minimal promoter and at least one element that has an enhancer sequence or an intronic, exonic, or UTR sequence that comprises one or more transcriptional regulatory elements. In some aspects where the hybrid promoter comprises an exonic, intronic, or UTR sequence, such sequence(s) can encode an upstream portion of an RNA transcript while also containing a regulatory element that regulates (e.g., enhances) the transcription of the transcript. In some aspects, the two or more elements of the hybrid promoter can be from a heterologous source relative to each other. In some aspects, the hybrid promoter comprises a first sequence from a chicken beta-actin promoter and a second sequence from a CMV enhancer. In some aspects, the hybrid promoter comprises a first sequence from a CMV enhancer and a second sequence from a chicken beta-actin promoter. In some aspects, the hybrid promoter comprises a first sequence from a chicken beta-actin promoter and a second sequence from an intron of a chicken beta-actin gene. In some aspects, the hybrid promoter comprises a first sequence from a chicken beta-actin promoter fused to a CMV enhancer sequence and a sequence from an intron of a chicken beta-actin gene. In some aspects, the hybrid promoter comprises a CB6 promoter. In some aspects, the hybrid promoter comprises a JeT promoter. In some aspects, the promoter can be a CAG promoter. In some aspects, the CAG promoter comprises a CMV enhancer sequence and a CB promoter sequence. In some aspects, the CMV enhancer sequence comprises the following sequence: CTAGTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC (SEQ ID NO: 3)

[0050] In some embodiments, the CAG promoter comprises the following sequence (including the double-stranded DNA sequence with the reverse complement): (SEQ ID NO:4)

[0051] In the NGLY1 expression constructs disclosed herein, a sequence encoding NGLY1, e.g., SEQ ID NO:1, is operably linked to a CAG "promoter" or regulatory sequence, SEQ ID NO:4.

[0052] In some aspects, the vector may further comprise conventional control elements operably linked to the transgene elements in a manner that allows its transcription, translation and / or expression in cells transfected with the vector or infected with the virus produced by the present disclosure. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA, polyadenylation) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (e.g., Kozak consensus sequences); sequences that enhance protein stability; and, optionally, sequences that enhance secretion of the encoded product. Numerous expression control sequences, including promoters that are natural, constitutive, inducible and / or tissue-specific, are known in the art and can be utilized.

[0053] In certain embodiments, a construct comprising a nucleotide sequence encoding NGLY1 comprises an intron sequence operably linked to and 5' to the coding sequence. In particular, the intron sequence can be a chimeric intron. In some aspects, the chimeric intron comprises a nucleic acid sequence from a chicken beta-actin gene, e.g., a non-coding intron sequence from intron 1 of the chicken beta-actin gene. In some aspects, the intron sequence of the chicken beta-actin gene ranges from about 50 to about 150 nucleotides in length (e.g., any length between 50 and 150 nucleotides, inclusive). In some aspects, the intron sequence of the chicken beta-actin gene ranges from about 100 to 120 (e.g., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120) nucleotides in length. In some aspects, the chimeric intron can be flanked by one or more untranslated sequences (e.g., untranslated sequences located between the promoter sequence and the chimeric intron sequence, and / or untranslated sequences located between the chimeric intron and the first codon of the transgene sequence). In some aspects, each of the one or more untranslated sequences can be non-coding sequences from a rabbit beta-globulin gene (e.g., untranslated sequences from rabbit beta-globulin exon 1, exon 2, etc.). In certain embodiments, the intron sequence is as follows (this is one strand of the DNA sequence and can include the reverse complement as well as form a double stranded sequence): TATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGC TTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGCAGTGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACTCACTATAG (SEQ ID NO: 5)

[0054] In some aspects, the rAAV comprises a posttranscriptional response element. As used herein, the term "posttranscriptional response element" refers to a nucleic acid sequence that assumes a tertiary structure that, when transcribed, enhances expression of a gene. Examples of posttranscriptional regulatory elements include, but are not limited to, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), mouse RNA transport element (RTE), constitutive transport element (CTE) of simian retrovirus type 1 (SRV-1), CTE from Mason-Pfizer monkey virus (MPMV), and the 5' untranslated region of human heat shock protein 70 (Hsp70 5'UTR). In some embodiments, the rAAV vector comprises a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). In some aspects, the WPRE can be a mutant WRPE. In some aspects, the WPRE comprises the following sequence: (SEQ ID NO:6)

[0055] In some aspects, a polyadenylation sequence can be inserted after the transgene sequence and optionally before the 3'AAV ITR sequence. The rAAV constructs useful in this disclosure also desirably include an intron located between the promoter / enhancer sequence and the transgene. In certain embodiments, the polyA signal sequence is a rabbit beta globin polyA sequence having the following nucleotide sequence: GATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCG (SEQ ID NO: 7)

[0056] In certain embodiments provided herein, the gene expression cassette construct comprises or consists of elements arranged as follows: CAG promoter-chimeric intron sequence-codon optimized NGLY1 coding sequence (SEQ ID NO: 1)-WPRE-Mut6 sequence-rabbit beta globin poly A signal sequence. This construct is shown in Figure 8. The nucleotide sequence of the gene expression cassette from the CAG promoter to the poly A signal sequence is as follows:

[0057] Recombinant AAV. In some aspects, the isolated nucleic acid disclosed herein can be a recombinant adeno-associated virus (rAAV) vector. In some aspects, the rAAV vector described herein can be minimally composed of a transgene and its regulatory sequence, and 5' and 3' AAV inverted terminal repeats (ITRs). It is this recombinant AAV vector that can be packaged into a capsid protein and delivered to a selected target cell. In some aspects, the transgene can be a nucleic acid sequence heterologous to the vector sequence that encodes a desired polypeptide, protein, functional RNA molecule, or other gene product. In some aspects, the nucleic acid coding sequence can be operably linked to a regulatory component in a manner that allows for transcription, translation, and / or expression of the transgene in cells of the target tissue.

[0058] In some aspects, the isolated nucleic acid described herein comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof, and a second region comprising a transgene encoding NGLY1. The isolated nucleic acid (e.g., a recombinant AAV vector) can be packaged into a capsid protein and administered to a subject and / or delivered to a selected target cell. The transgene can also comprise a region encoding, for example, a protein and / or an expression control sequence (e.g., a polyA tail).

[0059] Also disclosed herein are vectors that contain a single cis-acting wild-type ITR. In some embodiments, the ITR can be a 5'ITR. In some embodiments, the ITR can be a 3'ITR. The ITR sequence is about 145 bp in length. In some embodiments, the entire sequence encoding the ITR(s) can be used in the molecule, although some minor modification of these sequences is tolerated. In some embodiments, the ITR can be mutated at its terminal resolution site (TR), inhibiting replication at the vector end where the TR is mutated, resulting in the formation of a self-complementary AAV. In some embodiments, a transgene-containing "cis-acting" plasmid can be used, in which the selected transgene sequence and associated regulatory elements can be flanked by 5'AAV ITR sequences and 3'hairpin-forming RNA sequences. The AAV ITR sequences can be obtained from any known AAV, including currently identified mammalian AAV types. In some aspects, the ITR sequences can be AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, and / or AAVrh10 ITR sequences. In some aspects, the AAV ITR sequences are AAV2.

[0060] In certain aspects, the recombinant AAV genome containing the transgene contains the following elements: AAV2ITR-CAG promoter-NGLY1 coding sequence-polyA signal sequence-AAV2ITR sequence. In certain aspects, the construct further comprises an intron and / or a WPRE sequence. In further specific embodiments, the construct contains AAV2 ITR sequence-CAG promoter-intron sequence-NGLY1 codon optimized coding sequence-WPRE Mut6 sequence-rabbit beta globin polyA signal sequence-AAV2 ITR sequence. In certain embodiments, the nucleotide sequence of the construct is as follows:

[0061] In some aspects, the rAAV vector can be a self-complementary vector that includes a nucleic acid sequence encoding an NGLY1 protein or a portion thereof.

[0062] In certain aspects, the rAAV is of the AAV9 serotype. Other serotypes with tropism for CNS cells can also be used. In certain embodiments, the rAAV has an amino acid sequence of the AAV9 capsid or has a capsid that is 99%, 98%, 95%, 90% or 85% identical to the AAV9 capsid. The AAV9 capsid has an amino acid sequence as follows: MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY KYLGPGNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE SVPDPQPIGE PPAAPSGVGS LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI TTSTRTWALP TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY QLPYVLGSAH EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF PSQMLRTGNN FQFSYEFENV PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT INGSGQNQQT LKFSVAGPSN MAVQGRNYIP GPSYRQQRVS TTVTQNNNSE FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS LIFGKQGTGR DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK NTPVPADPPT AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ YTSNYYKSNN VEFAVNTEGV YSEPRPIGTR YLTRNL (SEQ ID NO: 10)

[0063] In some aspects, the isolated nucleic acids and / or rAAVs described herein can be modified and / or selected to enhance targeting of the isolated nucleic acids and / or rAAVs to target tissues (e.g., CNS). Non-limiting methods of modification and / or selection include AAV capsid serotypes (e.g., AAV9), tissue-specific promoters, and / or targeting peptides. In some aspects, the isolated nucleic acids and rAAVs disclosed herein can include AAV capsid serotypes (e.g., AAV9) that have enhanced targeting to CNS tissues. In some aspects, the isolated nucleic acids and rAAVs described herein can include tissue-specific promoters. In some aspects, the isolated nucleic acids and rAAVs described herein can include AAV capsid serotypes that have enhanced targeting to CNS tissues and tissue-specific promoters. Although AAV9 targets CNS tissues, rAAV9 vectors can also transduce other non-CNS tissues, and thus transgenes under the control of a promoter, such as the CAG promoter, can be expressed in both the CNS and other tissues outside the CNS. In some aspects, CNS delivery of the constructs disclosed herein can target CNS tissues resulting in CNS expression of NGLY1, but can also result in NGLY1 expression in peripheral tissues, including but not limited to the liver and heart.

[0064] In some aspects, the disclosure provides isolated AAV. As used herein with respect to AAV, the term "isolated" refers to AAV that is artificially obtained or produced. Isolated AAV can be produced using recombinant methods. Such AAV is referred to herein as "recombinant AAV". Recombinant AAV (rAAV) preferably has tissue-specific targeting capabilities, such that the transgene of the rAAV can be specifically delivered to one or more predetermined tissue(s). AAV capsids can be an important factor in determining these tissue-specific targeting capabilities. Thus, rAAVs with capsids suitable for the tissues to be targeted can be selected. In some aspects, the rAAV comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, or AAV.PHPB capsid proteins, or proteins having substantial homology thereto. In some embodiments, the rAAV comprises an AAV9 capsid protein. In some embodiments, the rAAV comprises an AAVPHP.B capsid protein.

[0065] In some aspects, the rAAV described herein can be a pseudotyped rAAV. Pseudotyping is the process of producing a virus or viral vector in combination with a foreign viral envelope protein. The result is a pseudotyped viral particle. This method allows the foreign viral envelope protein to be used to alter the host tropism or increased / decreased stability of the viral particle. In some aspects, the pseudotyped rAAV comprises nucleic acid from two or more different AAVs, where the nucleic acid from one AAV encodes a capsid protein and the nucleic acid of at least one other AAV encodes other viral proteins and / or viral genomes. In some aspects, pseudotyped rAAV refers to an AAV that comprises the inverted terminal repeats (ITRs) of one AAV serotype and the capsid protein of a different AAV serotype. For example, a pseudotyped AAV vector containing the ITRs of serotype X encapsidated with proteins of Y can be referred to as AAVX / Y (e.g., AAV2 / 1 has the ITRs of AAV2 and the capsid of AAV1). In some aspects, pseudotyped rAAVs can be useful to combine the tissue-specific targeting capabilities of capsid proteins from one AAV serotype with viral DNA from another AAV serotype, thereby allowing targeted delivery of a transgene to a target tissue.

[0066] Methods for obtaining recombinant AAV with desired capsid proteins are well known in the art. (See, for example, US Patent Application Publication No. 2003 / 0138772, the entire contents of which are incorporated herein by reference). Typically, the method involves culturing a host cell that contains a nucleic acid sequence encoding an AAV capsid protein or a fragment thereof; a functional rep gene; a recombinant AAV vector comprised of AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to allow packaging of the recombinant AAV vector into an AAV capsid protein. Typically, the capsid protein is a structural protein encoded by the cap gene of AAV. In some aspects, AAV contains three capsid proteins, virion proteins 1 to 3 (referred to as VP1, VP2, and VP3), which are transcribed from a single cap gene via alternative splicing. In some aspects, the molecular weights of VP1, VP2, and VP3 are about 87 kDa, about 72 kDa, and about 62 kDa, respectively. In some aspects, upon translation, the capsid protein forms a spherical 60-mer protein shell around the viral genome. In some aspects, the capsid protein protects the viral genome, delivers the genome, and / or interacts with the host cell. In some aspects, the capsid protein delivers the viral genome to the host in a tissue-specific manner.

[0067] In some aspects, the AAV capsid protein may be an AAV serotype selected from the group consisting of AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10 and AAVrh10. In some aspects, the AAV capsid protein may be an AAVrh8, AAVrh10 or AAV.PHPB serotype. In some aspects, the AAV capsid protein may be an AAVrh8 serotype. In some aspects, the AAV capsid protein may be an AAV9 serotype. In some aspects, the AAV capsid protein may be an AAV.PHPB serotype.

[0068] In some aspects, the components that are cultured in a host cell to package a rAAV vector in an AAV capsid can be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequences, cap sequences, and / or helper functions) can be provided by a stable host cell that has been engineered to contain one or more of the required components using methods known to those of skill in the art.

[0069] In some aspects, such stable host cells can contain the required component(s) under the control of an inducible promoter. However, the required component(s) can be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the discussion of regulatory elements suitable for use with the transgene. In some aspects, the selected stable host cell can contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, stable host cells can be generated that are derived from 293 cells (containing E1 helper functions under the control of a constitutive promoter) but contain rep and / or cap proteins under the control of an inducible promoter. Still other stable host cells can be generated by one of skill in the art.

[0070] The recombinant AAV vectors, rep sequences, cap sequences, and helper functions useful for producing the rAAV described herein can be delivered to the packaging host cell using any suitable genetic elements (vectors). The selected genetic elements can be delivered by any suitable method, including those described herein. The methods used to construct any of the compositions disclosed herein are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of an appropriate method is not a limitation of this disclosure. See, for example, K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745.

[0071] In some aspects, recombinant AAV can be produced using a triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, recombinant AAV can be produced by transfecting a host cell with a recombinant AAV vector (including a transgene) packaged in an AAV particle, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (i.e., rep and cap) and functions in trans for productive AAV replication and encapsidation. In some aspects, the AAV helper function vector can support efficient AAV vector production without producing any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in the present disclosure include pHLP19, described in U.S. Pat. No. 6,001,650, both of which are incorporated herein by reference in their entirety, and the pRep6cap6 vector, described in U.S. Pat. No. 6,156,303. Accessory function vectors encode nucleotide sequences for non-AAV derived viral and / or cellular functions (i.e., "accessory functions") on which AAV depends for replication. Accessory functions include functions necessary for AAV replication, including, but not limited to, moieties involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression product, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.

[0072] Cells. Transfected host cells are disclosed herein. The term "transfection" is used to refer to the uptake of foreign DNA by a cell, and a cell is "transfected" when exogenous DNA is introduced through the cell membrane. Numerous transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Using such techniques, one or more exogenous nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, can be introduced into a suitable host cell.

[0073] As used herein, the term "host cell" refers to any cell that carries or can carry a desired substance. Often, the host cell can be a mammalian cell (e.g., a non-human primate, rodent, or human cell). In some aspects, the host cell can be a mammalian cell, a yeast cell, a bacterial cell, an insect cell, a plant cell, or a fungal cell. The host cell can be used as a recipient of AAV helper constructs, AAV minigene plasmids, accessory function vectors, or other transfer DNA related to the production of recombinant AAV. The term includes the progeny of the original cell that has been transfected. Thus, as used herein, "host cell" can refer to a cell that has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parent cell may not necessarily be completely identical in morphology or in genome or total DNA complement to the original parent due to natural, accidental, or deliberate mutations.

[0074] Provided herein is a host cell for the production of rAAV, particularly rAAV9 particles, containing a genome including a transgene (comprising the nucleotide sequence of SEQ ID NO: 1) encoding NGLY1 operably linked to regulatory elements that facilitate expression of the NGLY1 transgene in vivo. For example, operably linked to a CAG promoter and a polyA signal sequence. The gene expression cassette may have the nucleotide sequence of SEQ ID NO: 8 and may include flanking ITR sequences, for example, the entire construct with flanking ITR sequences may have the nucleotide sequence of SEQ ID NO: 9.

[0075] As used herein, the term "cell line" refers to a cell population capable of continuous or sustained growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in the karyotype during storage or transfer of such clonal populations. Thus, cells derived from the cell line referred to may not be exactly the same as the ancestral cell or culture, and the cell line referred to includes such variants.

[0076] As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA segment has been introduced, such as a DNA segment that directs the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid, such as RNA.

[0077] Treatment method Methods are provided for treating a subject suffering from NGLY1 deficiency by administering a rAAV containing a transgene encoding NGLY1 and engineered to express NGLY1 protein in the CNS and other tissue(s), particularly a rAAV9 vector containing a construct disclosed herein, such as containing the nucleotide sequence of SEQ ID NO:1. The rAAV encoding NGLY1 protein can be administered by any method known in the art. In some aspects, the rAAV is delivered by intracerebroventricular or intracisternal (ICM) administration. In some aspects, the method of delivering a transgene to a CNS tissue of a subject can include co-administration of an effective amount of rAAV by two different routes of administration, e.g., intracerebroventricular and intravenous administration. The co-administration of rAAV can be done at about the same time or at different times. In some aspects, the rAAV is administered in an appropriate dosage, e.g., 6×10 6 ~6×10 16 The genome copies / kg (or alternatively, dosage assessed according to brain volume or CSF volume for brain administration) are delivered. The combination of rAAV serotypes, including AAV9, regulatory elements, and modes of administration, results in therapeutically effective delivery of NGLY1 protein to CNS tissues, as well as other peripheral tissues that promote the therapeutic benefit of administration.

[0078] In some embodiments, the targeted CNS tissue may be the cortex, hippocampus, thalamus, hypothalamus, cerebellum, brainstem, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, or a combination thereof. In some embodiments, the targeted tissue is the PNS. The route of administration to target the CNS tissue may depend on the AAV serotype. In some embodiments, when the AAV serotype is AAVPHP.B, AAV1, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and CSp3, the route of administration may be intravascular injection. In some embodiments, when the AAV serotype is AAVPHP.B, AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and CSp3, the route of administration may be intrathecal and / or intracerebral injection. In some aspects, the route of administration can be intraventricular or ICM administration when the AAV serotype is AAVPHP.B, AAV1, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and CSp3. In some aspects, the route of administration can be intraventricular or ICM administration when the AAV serotype is AAVPHP.B, AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh.10, rh.39, rh.43, and CSp3.

[0079] In some aspects, a composition (e.g., a pharmaceutical composition) may include a rAAV that includes a nucleic acid encoding NGLY1. In some aspects, a composition that includes a recombinant AAV that includes at least one modified gene regulatory sequence or element may further include a pharma- ceutically acceptable carrier. A suitable carrier may be selected for the indication for which the rAAV is intended. For example, one suitable carrier includes saline, which may be formulated with various buffer solutions (e.g., phosphate buffered saline). Examples of other suitable carriers include, but are not limited to, sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. Optionally, the compositions disclosed herein may include other pharmaceutical ingredients, such as preservatives, or chemical stabilizers, in addition to the rAAV and carrier(s). Examples of suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0080] In some embodiments, the rAAV is administered in a pharmaceutical composition comprising phosphate buffered saline (PBS) at pH 7.3 and 0.001% of a pharma- ceutically acceptable non-ionic surfactant, such as pluronic F-68 (PF68), or other suitable pharma- ceutically acceptable buffer or excipient. The formulation can be frozen until ready for use, then thawed and administered.

[0081] In some aspects, compositions disclosed herein can include a rAAV alone or in combination with one or more other viruses (e.g., a second rAAV coding for one or more different transgenes). In some aspects, a composition can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs, each with one or more different transgenes.

[0082] rAAV can be administered in sufficient amounts to transfect cells of desired tissues and provide sufficient levels of gene transfer and expression without undue adverse effects. In some aspects, acceptable routes of administration include, but are not limited to, direct delivery to selected organs (e.g., liver, skeletal muscle injection), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parenteral routes of administration. In some aspects, the route of administration can be by intraventricular injection. Routes of administration can be combined as needed.

[0083] The dose of rAAV virion required to achieve a particular "therapeutic effect", e.g., units of dose in genome copies per kilogram of body weight (GC / kg), units of dose in genome copies per brain volume, and units of dose in genome copies per CSF volume, will vary based on several factors, including, but not limited to, the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the particular disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine the rAAV virion dose range for treating a patient with a particular disease or disorder based on the factors described above, as well as other factors well known in the art.

[0084] An effective amount of rAAV is an amount sufficient to target infection in an animal and target the desired tissue. The effective amount depends mainly on factors such as the subject's species, age, weight, health, and the tissue to be targeted, and therefore may vary between animals and tissues. For example, an effective amount of rAAV is about 10 6 ~10 16 genome copy number (e.g., 1 × 10 6 ~1×10 16 In the methods disclosed herein, a therapeutically effective dose can range from about 1 ml to about 100 ml of solution containing 6×10 13 gc / kg~6×10 14 gc / kg, 7×10 13 gc / kg, 8×10 13gc / kg, 9×10 13 gc / kg, 1×10 14 gc / kg, 2×10 14 gc / kg, 3×10 14 gc / kg, 4×10 14 gc / kg, or 5 x 10 14 gc / kg (or alternatively, genome copies per brain volume, CSF volume, or other measure suitable for ICV or ICM delivery). In some embodiments, 11 ~10 12 Dosages of about 10 / kg or appropriate measured rAAV genome copy number may be appropriate. 11 ~10 13 Dosages of about 10 / kg or appropriate measured rAAV genome copy number may be appropriate. 11 ~10 14 Dosages of about 10 / kg or appropriate measured rAAV genome copy number may be appropriate. 11 ~10 15 Dosages of about 1×10 / kg or an appropriate measured rAAV genome copy number may be appropriate. 14 Dosages of vector genome (vg) copies / kg or appropriate measures may be appropriate. In some embodiments, dosages can be altered or reduced when specifically targeting one or more brain region(s). In some embodiments, dosages of about 10 7 ~10 8 A dosage of rAAV genome copies / kg, or a suitable measure, may be appropriate. In some embodiments, a dosage of about 10 8 ~10 9 A dosage of rAAV genome copies / kg, or a suitable measure, may be appropriate. In some embodiments, a dosage of about 10 9 ~10 10 A dosage of rAAV genome copies / kg, or a suitable measure, may be appropriate. In some embodiments, a dosage of about 10 10 ~10 11 Dosage of rAAV genome copies / kg, or other suitable measure, may be appropriate.

[0085] In some aspects, a potential side effect of administering an AAV to a subject may be an immune response in the subject to the AAV, including inflammation, which may depend on the route of administration, particularly if the administration of the AAV is systemic. In some aspects, a subject can be immunosuppressed prior to administration of one or more rAAVs, as described herein.

[0086] As used herein, "immunosuppressed" or "immunosuppression" refers to a reduction in the activation or efficacy of an immune response in a subject. Immunosuppression can be induced in a subject using one or more (e.g., multiple, e.g., 2, 3, 4, 5 or more) agents, including, but not limited to, rituximab, methylprednisolone, prednisolone, sirolimus, immune globulin injections, prednisone, methotrexate, and any combination thereof.

[0087] In some aspects, the methods disclosed herein can further include inducing immunosuppression in the subject (e.g., administering one or more immunosuppressants) prior to administering the rAAV (e.g., an rAAV or pharmaceutical composition disclosed herein) to the subject. In some aspects, the subject can be immunosuppressed (e.g., immunosuppression is induced in the subject) for about 30 days to about 0 days (e.g., any time up to 30 days prior to administration of the rAAV, inclusive) prior to administration of the rAAV to the subject. In some aspects, the subject can be pretreated with an immunosuppressant (e.g., rituximab, sirolimus, and / or prednisone) for at least 7 days.

[0088] In some aspects, the subject's immunosuppression is maintained during and / or after administration of the rAAV or pharmaceutical composition. In some aspects, the subject can be immunosuppressed (e.g., administered one or more immunosuppressive agents) for between one day and one year after administration of the rAAV or pharmaceutical composition.

[0089] In some embodiments, the rAAV composition is modified to reduce aggregation of AAV particles in the composition, particularly when high rAAV concentrations are present (e.g., −10 13rAAV can be formulated to 500 ng / ml or higher. Methods for reducing aggregation of rAAV are well known in the art and include, for example, adding detergents, adjusting pH, adjusting salt concentration, etc. (See, for example, Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)

[0090] The formulation of pharma- ceutically acceptable excipient and carrier solutions is well known to those of skill in the art, as is the development of appropriate dosing and treatment regimens for use with the particular compositions described herein in various treatment regimens.

[0091] In some embodiments, the percentage of active ingredient(s) can, of course, vary and can conveniently be from about 1 or 2% to about 70% or 80% or more by weight or volume of the total formulation, although these formulations can contain at least about 0.1% or more of the active compound. Of course, the amount of active compound in each therapeutically useful composition can be prepared so as to obtain an appropriate dosage in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product expiration date, and other pharmacological considerations can be taken into account by those skilled in the art of preparing such pharmaceutical formulations, and as such, various dosages and treatment regimens may be desirable.

[0092] In some aspects, it may be desirable to deliver the rAAV-based therapeutic construct in a suitably formulated pharmaceutical composition as disclosed herein, either subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, intracerebroventricularly, or by inhalation. In some aspects, the administration modalities described in U.S. Patent Nos. 5,543,158; 5,641,515; and 5,399,363 (each of which is specifically incorporated herein by reference in its entirety) can be used to deliver the rAAV. In some embodiments, the preferred mode of administration may be by intracerebroventricular injection.

[0093] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases, this form can be sterile and fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars or sodium chloride, can be included. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0094] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent is first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions may be suitable for intravenous, intramuscular, subcutaneous, intracerebroventricular, and intraperitoneal administration. In this regard, sterile aqueous media that may be employed are known to those skilled in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection fluid or injected at the proposed injection site (see, for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). In certain embodiments, the rAAV is formulated in phosphate buffered saline (PBS) at pH 7.3, containing 0.001% of a pharma- ceutically acceptable non-ionic surfactant, such as PF68. Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

[0095] Sterile injectable solutions can be prepared by incorporating the required amount of active rAAV into a suitable solvent with various other ingredients as listed herein, as necessary, followed by filtration sterilization.In general, dispersions can be prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and other ingredients as required from those listed above.In the case of sterile powders for preparing sterile injectable solutions, the preparation method can be vacuum drying and freeze-drying techniques, which produce a powder of active ingredients and any additional desired ingredients from the solution previously sterile-filtered.

[0096] The rAAV compositions disclosed herein can also be formulated in neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of the protein) and can be formed with inorganic acids such as hydrochloric or phosphoric acids, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. Salts formed with free carboxyl groups can also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, and the like. Upon formulation, solutions are administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulations can be easily administered in a variety of dosage forms, such as injectable solutions, drug release capsules, and the like.

[0097] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutical acceptable" refers to molecular entities and compositions that do not produce allergic or similar untoward reactions when administered to a host.

[0098] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present disclosure into suitable host cells. In particular, rAAV vector-delivered transgenes can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc.

[0099] Such formulations can be used to introduce pharma- ceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulatory half-life have been developed (U.S. Pat. No. 5,741,516). In addition, various methods of liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868 and 5,795,587).

[0100] Liposomes have been used successfully with many cell types that are typically resistant to transfection by other techniques. Furthermore, liposomes are not limited by the length of DNA that is typical of virus-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials have been completed to examine the efficacy of liposome-mediated drug delivery.

[0101] Liposomes can be formed from phospholipids that are dispersible in aqueous media and can spontaneously form multilamellar concentric bilayer vesicles (also called multilamellar vesicles (MLVs)). MLVs generally have diameters of 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200-500 angstroms, which contain aqueous solution in their core.

[0102] Alternatively, nanocapsule formulations of rAAV can be used. Nanocapsules are generally stable and can incorporate materials in a reproducible manner. To avoid side effects due to intracellular polymer overloading, such ultrafine particles (approximately 0.1 pm in size) should be designed with polymers that can be degraded in vivo. The use of biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements is contemplated.

[0103] In addition to the above delivery methods, the following techniques can also be used as alternative methods to deliver rAAV compositions to a host. Sonophoresis (e.g., ultrasound) has been used and is described in U.S. Pat. No. 5,656,016 as a device for increasing the permeation rate and efficacy of drugs into and through the circulatory system. Other possible drug delivery alternatives are intraosseous injections (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Pat. No. 5,697,899).

[0104] In some aspects, the methods can include administering one or more additional therapeutic agents to a subject administered the rAAV or pharmaceutical composition described herein.

[0105] Disclosed herein is a method for treating NGLYI deficiency by administration of the rAAV vector described herein, which contains a transgene encoding NGLY1 engineered to be expressed in the CNS and can be of AAV9 serotype. NGLY1 deficiency, caused by loss-of-function mutations in the NGLY1 gene, is an extremely rare genetic disorder, and patients suffer from developmental delay, seizures, tear deficiency, elevated liver transaminases in childhood, and movement disorders. In some aspects, gene replacement therapy described herein can be useful for restoring NGLY1 function, primarily in the central nervous system (CNS), but also in other tissues, including the liver and heart, and can alleviate disease symptoms.

[0106] Disclosed herein are isolated nucleic acids, rAAVs, compositions, and methods useful for treating NGLY1 deficiency. In some aspects, a method for treating NGLY1 deficiency in a subject can include administering a rAAV comprising a transgene encoding NGLY1 having a coding sequence of SEQ ID NO: 1, for example, in a gene expression cassette engineered to express NGLY1 in the CNS (e.g., a construct having a nucleotide sequence of SEQ ID NO: 8 (comprising a nucleotide sequence of SEQ ID NO: 1 operably linked to a CAG promoter and a polyA signal sequence) or SEQ ID NO: 9 (the entire construct with flanking ITR sequences), under the control of a CAG promoter, wherein the rAAV is of the AAV9 serotype. In certain embodiments, the rAAV is administered ICV, or alternatively, into the cisterna magna. In some aspects, delivery into the cisterna magna can be by direct injection (e.g., intracisternal (ICM)) or lumbar puncture. Some patients with NGLY1 deficiency suffer from scoliosis, making it difficult to administer therapeutic agents by lumbar puncture. Thus, in patients with scoliosis, rAAV is administered by ICV or by ICM directly into the cisterna magna. In some embodiments, rAAV is administered by ICM to subjects with scoliosis. In some embodiments, rAAV is administered by ICV and IV, or by ICM and IV.

[0107] Also disclosed herein is a method of promoting expression of functional NGLY1 protein in a subject (e.g., the central nervous system (CNS) and other tissues of a subject), comprising administering, including ICV administration (or alternatively, administration into the cisterna magna) an rAAV as described herein to a subject having or suspected of having a disease of a disorder associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency). As used herein, a disease or disorder associated with low levels of NGLY1 expression is a disease or disorder in which a subject has at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% lower levels of NGLY1 expression compared to a control subject (e.g., a healthy subject or an untreated subject).

[0108] In some embodiments, administering a rAAV described herein to a subject promotes expression of NGLY1 2-fold to 100-fold (e.g., 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, etc.) compared to a control subject. In some embodiments, administering a rAAV described herein to a subject promotes expression of NGLY1 2-fold to 100-fold (e.g., 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 75-fold, 100-fold, etc.) in the CNS of the subject compared to a control subject. As used herein, a "control" subject can refer to a subject that has not been administered an isolated nucleic acid, rAAV, or composition described herein, or a healthy subject. In some embodiments, a control subject can be the same subject that is administered (e.g., prior to administration) an isolated nucleic acid, rAAV, or composition described herein. In some embodiments, administering a described isolated nucleic acid, rAAV, or composition to a subject promotes expression of NGLY1 2-fold compared to a control. In some embodiments, administration of the rAAV described herein to a subject promotes expression of NGLY1 100-fold compared to a control. In some embodiments, administration of the rAAV described herein to a subject promotes expression of NGLY1 5-fold compared to a control. In some embodiments, administration of the rAAV described herein to a subject promotes expression of NGLY1 10-fold compared to a control. In some embodiments, administration of the rAAV described herein to a subject promotes expression of NGLY1 5-fold to 100-fold compared to a control (e.g., 5-fold to 10-fold, 10-fold to 15-fold, 10-fold to 20-fold, 15-fold to 25-fold, 20-fold to 30-fold, 25-fold to 35-fold, 30-fold to 40-fold, 35-fold to 45-fold, 40-fold to 60-fold, 50-fold to 75-fold, 60-fold to 80-fold, 75-fold to 100-fold compared to a control).

[0109] In some aspects, administration of a rAAV described herein to a subject promotes expression of NGLY1 in the subject (e.g., promotes expression of NGLY1 in the CNS of the subject) by an increase of 5% to 200% (e.g., 5% to 50%, 25% to 75%, 50% to 100%, 75% to 125%, 100% to 200%, or 100% to 150%, etc.) compared to a control subject.

[0110] Further disclosed herein is a method of treating a subject having a disease or disorder associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency). In some aspects, the method can include administering to the subject an effective amount of a rAAV comprising a capsid containing a nucleic acid engineered to express NGLY1 in the CNS of the subject, particularly by ICV administration (or alternatively into the cisterna magna). As used herein, the term "treat" refers to the application or administration of a composition (e.g., an isolated nucleic acid or rAAV described herein) to a subject having a disease or disorder associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency) for the purpose of curing, relieving, alleviating, modifying, curing, ameliorating, improving, or affecting the disorder, symptoms of the disease, or predisposition to the disease.

[0111] Alleviating a disease associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency) includes delaying the onset or progression of the disease or reducing the severity of the disease. Alleviating a disease does not necessarily require a curative outcome. As used herein, "delaying" the onset of a disease means delaying, hindering, slowing, impeding, stabilizing, and / or postponing the progression of the disease. This delay can be for a variety of lengths of time, depending on the history of the disease and / or the individual being treated. A method of "delaying" or alleviating the onset of a disease or delaying the onset of a disease is a method that reduces the probability of developing one or more symptoms of the disease within a given time frame and / or reduces the extent of symptoms within a given time frame, compared to not using the method. Such comparisons are typically based on clinical studies, using a sufficient number of subjects to obtain statistically significant results.

[0112] In particular, administration of the rAAV described herein to a human subject suffering from NGLY1 deficiency results in a reduction in one or more biomarkers or characteristics of the disease within 10 weeks, 15 weeks, 20 weeks, 25 weeks, 30 weeks, 40 weeks, 50 weeks, or 1 year after administration. In particular, a reduction in hypo / analgia, a reduction in the occurrence of seizures, developmental delay, a reduction or slowing of progression of peripheral neuropathy, or a reduction in liver transaminase levels. The inventors have identified the levels and accumulation of GlcNAc-Asn (GNA) in body fluids as a marker of NGLY1 deficiency, and thus a reduction in GNA levels after administration of the rAAV therapeutic, e.g., as measured in body fluid samples and by LC-MS / MS, indicates a therapeutic effect (see below).

[0113] "Onset" or "progression" of a disease refers to the initial appearance and / or subsequent progression of the disease. Onset of a disease may be detectable and assessable using standard clinical techniques well known in the art. However, onset also refers to progression that may be undetectable. As used herein, the term onset or progression refers to the biological course of a symptom. Onset includes appearance, recurrence, and onset. As used herein, "onset" or "onset" of a disease may be associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency).

[0114] In some aspects, the subject may be a human, mouse, rat, pig, dog, cat, or non-human primate. In some aspects, the subject has or is suspected of having a disease or disorder associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency). In some aspects, the subject with a disease or disorder associated with low levels of NGLY1 expression (e.g., NGLY1 deficiency) comprises at least one NGLY1 allele with a loss-of-function mutation (e.g., associated with NGLY1 deficiency). In some aspects, the NGLY1 allele with a loss-of-function mutation (e.g., associated with NGLY1 deficiency) comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation, or a nonsense mutation. The subject may have two NGLY1 alleles with the same loss-of-function mutation (homozygous) or two NGLY1 alleles with different loss-of-function mutations (compound heterozygous). In certain aspects, the subject is a carrier of NGLY1 deficiency, and in certain aspects is heterozygous for the loss-of-function alleles described herein.

[0115] In some aspects, an NGLY1 allele with a loss-of-function mutation may include a frameshift mutation in exon 12. In some aspects, an NGLY1 allele with a loss-of-function mutation may include a nonsense mutation in exon 8 resulting in a substitution of Arg401 to Ter (e.g., a stop codon) (R401X). In some aspects, an NGLY1 allele with a loss-of-function mutation includes a frameshift mutation resulting from a 1-bp deletion (c.1891delC). In some aspects, an NGLY1 allele with a loss-of-function mutation includes a c.1201A-T transversion in exon 8 resulting in a substitution of Arg401 to Ter (e.g., a stop codon) (R401X). In some aspects, an NGLY1 allele with a loss-of-function mutation may include a 1-bp duplication (c.1370dupG) in exon 9 resulting in a frameshift and premature termination (Arg458 to Ter). In some embodiments, the NGLY1 allele with a loss-of-function mutation comprises a 3-bp deletion (c.1205 1207delTTC) resulting in a deletion of one residue (402del). In some embodiments, the NGLY1 allele with a loss-of-function mutation may comprise a c.1570C-T transition resulting in a substitution of Arg542 to Ter (R542X).

[0116] In some aspects, the rAAV disclosed herein can be administered in sufficient amounts to transfect cells of desired tissues and provide sufficient levels of gene transfer and expression without undue adverse effects. Pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to selected organs (e.g., the central nervous system), ICV or cisternal administration, oral, inhalation (including intranasal and intratracheal delivery), intraocular, intraventricular, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes of administration. If necessary, routes of administration can be combined.

[0117] In some aspects, the dose of rAAV virion required to achieve a particular "therapeutic effect", e.g., dose units per genome copies / kg body weight (GC / kg) (or alternatively, based on brain size or CSF volume), can vary based on several factors, including, but not limited to, the route of rAAV virion administration, the level of gene or RNA expression required to achieve the therapeutic effect, the particular disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can easily determine the rAAV virion dose range to treat a patient with a particular disease or disorder based on the factors described above, as well as other factors well known in the art. An effective amount of rAAV is an amount sufficient to target infection of a subject or desired tissue. In some aspects, an effective amount of rAAV is an amount sufficient to generate a stable somatic transgenic animal model. The effective amount depends primarily on factors such as the subject's species, age, weight, health, and the tissue being targeted, and therefore can vary between animals and tissues. For example, an effective amount of rAAV is about 10 9 ~10 16 The amount of solution may range from about 1 ml to about 100 ml containing 10 genome copies. In some embodiments, the rAAV transduces hepatocytes. In some embodiments, an effective amount of rAAV is 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the effective amount of rAAV may be 10 genome copies / kg per subject. 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 In some cases, the number of genome copies may be about 6×10 09 ~6×10 14 A dosage of 1000 rAAV genome copies may be appropriate.

[0118] In some embodiments, the rAAV composition is modified to reduce aggregation of AAV particles in the composition, particularly when high rAAV concentrations are present (e.g., −10 13rAAV can be formulated to a concentration of 100 GC / ml or higher. Methods for reducing aggregation of rAAV are well known in the art and include, for example, adding detergents, adjusting pH, adjusting salt concentration, etc. (See, for example, Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)

[0119] Assessment of therapeutic efficacy. The efficacy of the rAAV compositions described herein can be assessed by in vitro and in vivo assays, such as NGLY1-deficient animal models. Assessment of the efficacy of administration is described in Examples 1 and 2 herein.

[0120] GNA as a biomarker. NGLY1 deficiency is a slowly progressing rare disease of ultra-low prevalence caused by a single enzymatic deficiency of NGLY1. NGLY1 is required to cleave the bond linking the reducing end GlcNAc (from N-linked glycans) to asparagine in misfolded proteins. The disease is associated with significant accumulation of the NGLY1 substrate, GlcNAc-asparagine (GNA), in plasma, CSF, and tissues. GNA accumulation has been observed in all preclinical models and patient samples examined so far. These observations, combined with the biochemical understanding that the bond linking GlcNAc to asparagine (ASN) in GNA is the same bond normally cleaved by NGLY1, indicate that GNA accumulation is the primary biochemical event in the disease. Restoration of NGLY1 function prevents GNA accumulation.

[0121] Accumulation of GNA in critical CNS regions is a direct consequence of the absence of NGLY enzyme activity and has been shown to correlate with disease severity in NGLY1-deficient rats. Introduction of wild-type NGLY1 gene into tissues of these animals results in a significant reduction in GNA levels that correlates with improved pathology and animal behavior. Data from NGLY1 natural history studies suggest that NGLY1 deficiency exhibits high phenotypic variability and slow progression in most aspects of the disease, so that long-term clinical observation may be required to measure progression. Based on biochemical understanding of NGLY1 function, therapeutic approaches aimed at replacing wild-type NGLY1, and non-clinical data, GNA levels are reasonably likely to reflect NGLY1 correction and predict clinical benefit.

[0122] In NGLY1-deficient cells, degradation of N-linked glycoproteins is disrupted, leading to the generation of GNA. NGLY1 normally works with cytoplasmic mannosidase (Man2c1), ENGase, proteosomes, and the lysosomal system to degrade N-linked glycoproteins into monosaccharides and amino acids. In NGLY1-deficient cells, cytoplasmic mannosidase (Man2c1), ENGase, protease, and the lysosomal system still function normally, but in the absence of NGLY1 cells are unable to metabolize the bond linking the terminal GlcNAc to asparagine. This metabolic block leads to the accumulation of GNA in tissues and fluids throughout the body.

[0123] In the absence of NGLY1, GNA cannot be catabolized in the cytoplasm and therefore becomes the "limit digestion product" of all N-linked glycoproteins accumulated in the cytoplasm. Since GNA is the "sum" of the substrates of all NGLY1 target glycoproteins, it is considered to be the optimal substrate measure of NGLY1 enzyme activity.

[0124] Mouse model of NGLY1 deficiency. Ngly1-deficient mice are embryonic lethal on a C57BL / 6 background (Fujihira H, Masahara-Negishi Y, Tamura M, Huang C, Harada Y, Wakana S, et al. Lethality of mice bearing a knockout of the Ngly1-gene is partially rescued by the additional deletion of the Engase gene. PLoS Genet. 2017;13(4):e1006696). Although the absence of Ngly1 is lethal in mice, other studies in mice have shown that 4- to 5-fold overexpression of hNGLY1 is not toxic, suggesting that relatively small amounts of active NGLY1 protein are required to rescue embryonic lethality in mice.

[0125] Rat model of NGLY1 deficiency. A rat model of NGLY1 deficiency was generated using CRISPR-Cas9 in Sprague Dawley rats (Asahina M, Fujinawa R, Nakamura S, Yokoyama K, Tozawa R, Suzuki T. Ngly1- / - rats develop neurodegenerative phenotypes and pathological abnormalities in their peripheral and central nervous systems. Hum Mol Genet. 2020;29(10):1635-1647). This model is homozygous for a deletion of exons 11 and 12 as well as the 3' polyA region of the Ngly1 gene. Exons 11 and 12 encode the PAW (mannose-binding) domain of NGLY1. Ngly1 - / -Rats display potential disease-related phenotypes as measured using rotarod, locomotion / hind leg standing, and passive avoidance behavior assessments. The therapeutic efficacy of NGLY1 therapeutics can be evaluated in this model. NGLY1-deficient human HEK293, HepG2, and ReNcell VM cell lines, which represent both the systemic (kidney cells, hepatocytes) and CNS / PNS (neuronal progenitor cell) components of NGLY1 deficiency, are also useful for evaluation of therapeutic efficacy.

[0126] In addition to characterizing the behavioral phenotype in the rat model, the substrate biomarker GNA was also evaluated in Ngly1-deficient rats and in NGLY1-deficient HEK293, HepG2, and ReNcell VM cell lines. All three NGLY1-deficient cell lines showed increased GNA levels compared to their wild-type controls. In particular, Ngly1 - / - Animals showed significant elevations of substrate biomarkers in urine, blood, CSF and all tissues examined compared to wild-type animals. Accumulation of GNA substrate biomarkers was highest in the brain compared to PNS and systemic tissues, highlighting the need for efficient delivery to CNS tissues. - / - A decrease in GNA substrate levels in the animal is indicative of therapeutic efficacy, for example, within days or weeks of administration.

[0127] Pathologically, Ngly1 - / - Rats showed progressive CNS and PNS pathology. Early-onset axonal / myelin degeneration in both the DRG and spinal cord increased in severity, whereas infiltrating immune cells appeared later in life. The same was true for thalamic neuronal loss, calcification, and gliosis, which were not detected at postnatal day 33.

[0128] kit Disclosed herein are kits that include any of the agents described herein. In some aspects, any of the agents disclosed herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. The kits can include one or more containers that house the components of the disclosure and instructions for use. Specifically, such kits can include one or more agents described herein, along with instructions that describe the intended use and proper use of these agents. In some aspects, the agents in the kits can be in pharmaceutical formulations and dosages appropriate for a particular use and method of administration of the agents. Kits for research purposes can contain appropriate concentrations or amounts of components to perform various experiments.

[0129] Also disclosed herein is a kit for producing rAAV.In some embodiments, the kit can include a container that contains an isolated nucleic acid that encodes NGLY1 protein or a part thereof.In some embodiments, the kit can further include instructions for producing rAAV.In some embodiments, the kit further includes at least one container that contains a recombinant AAV vector, where the recombinant AAV vector contains a transgene.

[0130] In some embodiments, the kit can include a container that contains the recombinant AAV described above.In some embodiments, the kit can further include a container that contains a pharma- ceutically acceptable carrier.For example, the kit can include one container that contains rAAV and a second container that contains a buffer solution suitable for injecting rAAV into a subject.In some embodiments, the container can be a syringe.

[0131] In some aspects, the kits can be designed to facilitate the use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit can be provided in liquid form (e.g., solution), or solid form (e.g., dry powder), as applicable. In some aspects, some of the compositions can be configured or otherwise processable (e.g., into an active form), for example, by the addition of appropriate solvents or other species (e.g., water or cell culture medium), which may or may not be provided with the kit. As used herein, "instructions" can define an instructional and / or facilitative component, typically involving written instructions on or associated with the disclosed packaging. Instructions can also include any verbal or electronic instructions provided in any manner, such as audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communication, etc., such that the user clearly recognizes that instructions can be associated with the kit. The written instructions may be in a format prescribed by a government agency regulating the manufacture, use, or sale of drugs or biological products, and the instructions may also reflect approval by the agency of the manufacture, use, or sale for administration to animals.

[0132] The kits disclosed herein can also contain any one or more of the components described herein in one or more containers. In some embodiments, the kits can include instructions for mixing one or more components of the kit and / or for isolating and mixing a sample and applying to a subject. The kits can include a container-containing agent described herein. The agent can be in liquid, gel, or solid (powder) form. The agent can be aseptically prepared, packaged in a syringe, and shipped refrigerated. Alternatively, it can be contained in a vial or other container for storage. A second container can have another agent that is aseptically prepared. Alternatively, the kit can include an active agent that is premixed and shipped in a syringe, vial, tube, or other container. The kits can have one or more or all of the components necessary to administer the agent to an animal, such as a syringe, topical application device, or iv needle tube and bag, especially in the case of kits for making certain somatic cell animal models.

[0133] In some aspects, the methods disclosed herein can involve transfecting cells with total cellular DNA isolated from tissues that may harbor proviral AAV genomes at very low levels, and supplementing with helper virus functions (e.g., adenovirus) to induce and / or boost AAV rep and cap gene transcription in the transfected cells. In some aspects, RNA from the transfected cells can provide a template for RT-PCR amplification of cDNA and detection of novel AAV. When transfecting cells with total cellular DNA isolated from tissues that may harbor proviral AAV genomes, it is often desirable to supplement the cells with factors that promote AAV gene transcription. For example, the cells can also be infected with a helper virus, such as an adenovirus or a herpes virus. In some aspects, the helper functions can be provided by an adenovirus. The adenovirus can be a wild-type adenovirus and can be of human or non-human origin, e.g., non-human primate (NHP) origin. Similarly, adenoviruses known to infect non-human animals (e.g., chimpanzees, mice) can also be employed in the methods of the present disclosure (see, e.g., U.S. Pat. No. 6,083,716). In addition to wild-type adenoviruses, recombinant viruses or non-viral vectors (e.g., plasmids, episomes, etc.) with the necessary helper functions can be utilized. Such recombinant viruses are known in the art and can be prepared according to published techniques. See, e.g., U.S. Pat. Nos. 5,871,982 and 6,251,677, which describe hybrid Ad / AAV viruses. Various adenovirus strains are available from the American Type Culture Collection, Manassas, Va., or are available upon request from a variety of commercial and institutional sources. Additionally, the sequences of many of such strains are available from a variety of databases, including, e.g., PubMed and GenBank.

[0134] The cell can also be transfected with a vector (e.g., a helper vector) that provides helper functions for AAV. The vector that provides helper functions can provide adenoviral functions including, for example, Ela, Elb, E2a, E4ORF6. The sequences of the adenoviral genes that provide these functions can be obtained from any known adenovirus serotype, such as serotypes 2, 3, 4, 7, 12, and 40, and can further include any of the currently identified human types known in the art. Thus, in some aspects, the method involves transfecting a cell with a vector that expresses one or more genes required for AAV replication, AAV gene transcription, and / or AAV packaging.

[0135] In some aspects, the isolated capsid gene can be used to construct and package a recombinant AAV vector, and the functional characteristics associated with the novel capsid protein encoded by the gene can be determined using methods well known in the art.For example, the isolated capsid gene can be used to construct and package a recombinant AAV (rAAV) vector containing a reporter gene (e.g., B-galactosidase, GFP, luciferase, etc.).The rAAV vector can then be delivered to an animal (e.g., a mouse), and the tissue targeting properties of the isolated capsid gene can be determined by examining the expression of the reporter gene in various tissues of the animal (e.g., heart, liver, kidney).Other methods for characterizing the isolated capsid gene are disclosed herein, and still other methods are well known in the art.

[0136] The disclosed kits can have a variety of forms, such as blister pouches, shrink-wrapped pouches, vacuum sealable pouches, sealable thermoformed trays, or similar pouch or tray forms, with the accessories loosely packed within the pouches and including one or more tubes, containers, boxes, or bags. The kits can be sterilized after the accessories are added, thereby allowing the individual accessories within the containers to be opened otherwise. The kits can be sterilized using any suitable sterilization technique, such as radiation sterilization, heat sterilization, or other sterilization methods known in the art. The kits can also include other components, such as containers, cell culture media, salts, buffers, reagents, syringes, needles, cloths for applying or removing disinfectants, such as gauze, disposable gloves, supports for medications prior to administration, etc., depending on the particular application.

[0137] The instructions included in the kit can accompany methods for detecting latent AAV in cells. Additionally, kits of the present disclosure can include instructions, negative and / or positive controls, containers, diluents and buffers for samples, sample preparation tubes, and printed or electronic tables of reference AAV sequences for sequence comparison.

[0138] [Example] EXAMPLES

[0139] ICV delivery of AAV9-NGLY1 gene replacement therapy improves phenotypic and biomarker endpoints in Ngly1-deficient rats NGLY1 deficiency is a devastating, ultra-rare autosomal recessive disorder caused by loss of function mutations in NGLY1. Approximately 90 cases worldwide have been identified and published by the Grace Science Foundation. The NGLY1 gene encodes N-glycanase 1, a conserved enzyme that cleaves N-glycans from misfolded glycoproteins destined for proteasomal degradation as part of the endoplasmic reticulum-associated degradation (ERAD) pathway. Symptoms of NGLY1 deficiency include hyperkinesia, neuropathy, hypotonia, scoliosis, constipation, gait abnormalities, small hands and / or feet, liver dysfunction, developmental delay, hypo / anerythria, seizures, lack of speech development, and dysphagia.

[0140] Disclosed herein is AAV9 gene therapy (e.g., GS-100) that delivers a functional copy of the full-length human NGLY1 gene (hNGLY1) for the treatment of NGLY1 deficiency.

[0141] Vector Design. Described herein are rAAV9 vectors containing a codon-optimized full-length version of hNGLY1 (SEQ ID NO: 1) under the control of a CAG promoter (see FIG. 8; further comprising SEQ ID NO: 8 (comprising the nucleotide sequence of SEQ ID NO: 1 operably linked to a CAG promoter and a polyA signal sequence) or SEQ ID NO: 9 (the entire construct with flanking ITR sequences)).

[0142] The vector elements are AAV2 ITR, CAG promoter, chimeric CB-BG intron, codon-optimized human NGLY1 cDNA, WPRE-mut6 enhancer element, and Rb-BG polyA signal. The vector can be packaged into AAV9 capsids in human embryonic kidney (HEK) 293 cell culture production system. Elements within the GS-100 vector genome were selected to provide sustained broad expression across tissues.

[0143] Promoter. The CAG promoter (0.97 kb) combines the CMV early enhancer and the chicken B-actin promoter to provide broad expression across tissues.

[0144] Enhancer. The WPRE-mut6 sequence was included in the vector to increase protein expression.

[0145] Introns. Sequences from both the chicken beta-actin promoter (including the first exon and intron) and a rabbit beta-globin intron were included to increase nuclear export and translation.

[0146] Transgene. The transgene itself was modified from its known coding sequence (NM_018297.4) to allow for cloning and optimal protein translation. The rabbit B-globin polyadenylation site is a strong polyadenylation signal and was included to promote mRNA stability and maintain expression levels.

[0147] Methods: A rat model of NGLY1 deficiency was used. Rats were injected with GS-100 between postnatal days 39 and 45 and sacrificed at 9 weeks of age. GS-100 was administered intravenously (IV), intracerebroventricularly (ICV), or both (dual IV+ICV) in sequence. Rats were assessed using rotarod, position (open field with rearing), and biomarker determination.

[0148] Results. Figure 1 shows that ICV GS-100 administration results in extensive vector genome biodistribution. GS-100 vector genome (VG) DNA was quantified by qPCR and VG copies per diploid genome were calculated. Results show that ICV and ICV+IV administration results in higher biodistribution in CNS tissues than IV alone, and extensive distribution in peripheral tissues (heart and liver). Dual administration (ICV+IV) did not result in a consistent significant increase in biodistribution compared to ICV alone. IV administration resulted in much lower distribution in the CNS than ICV or ICV+IV administration.

[0149] Immunohistochemistry (IHC) analysis was performed on heart, dorsal root ganglion, spinal cord and brain tissues following GS-100 administration and compared to controls. IHC analysis of rat tissues detected hNGLY1 protein expression in GS-100 treated rats. Figure 2 shows that ICV GS-100 administration results in CNS hNGLY1 protein expression. ICV and ICV+IV administration result in substantial hNGLY1 protein expression in the CNS. ICH analysis of IV administration of GS-100 did not detect substantial CNS expression of hNGLY1 protein.

[0150] In turn, in the absence of NGLY1, the inability to completely cleave N-glycans from glycoproteins leads to the accumulation of GlcNAc-Asn (GNA). For example, GNA can be detected in NGLY1-deficient organisms (human cell line and rat data shown, Wilcoxon p<0.01; Figure 3). GNA biomarker levels were quantitatively measured after GS-100 administration using LC-MS / MS. Figure 4 shows that GS-100 administration reduced GNA biomarker levels. ICV or ICV+IV administration significantly reduced GNA accumulation in most tissues (Dunn's p<0.01), with dual administration providing no additional significant benefit. IV administration of GS-100 reduces GNA accumulation in two brain regions and some peripheral tissues.

[0151] The decrease in GNA biomarker levels correlates in tissues and body fluids. GNA concentrations measured by LC-MS / MS were compared between tissue and liquid matrices after GS-100 administration. Figure 5 shows that GNA concentrations in brain tissue correlate with those in CSF (linear model, p<0.001) and GNA concentrations correlate with those in plasma (linear model, p<0.05). These data provide evidence that GNA accumulation in liquid matrices can be used as a marker for the presence of functional NGLY1 in tissues.

[0152] GS-100 ameliorates behavioral deficits in Ngly1-deficient rats. Behavioral analysis of Ngly1-deficient rats shows deficits as assessed by reduced latency to fall off the rotarod and their ability to rear in an open field locomotor test compared to wild-type littermates. Following ICV administration of GS-100, these behavioral deficits improved significantly (p<0.01) compared to untreated controls (see FIG. 6). ICV+IV administration did not result in significant differences in behavioral improvement compared to ICV administration.

[0153] The reduction in GNA biomarkers also correlates with GS-100. GS-100 vector genome (VG) DNA and mRNA expression was determined by qPCR (hNGLY1 mRNA compared to Hprt mRNA expression). Figure 7 shows that GNA accumulation levels were quantified using LC-MS / MS. GS-100 delivery (VG DNA) or expression (mRNA) was inversely correlated with GNA concentrations (linear model, p<0.001). Improved behavioral outcomes following GS-100 administration correlate with reduced GNA concentrations. These data indicate that the GNA biomarkers act as pharmacodynamic markers of GS-100-mediated delivery of functional hNGLY1.

[0154] Discussion. GS-100 is an AAV9 gene therapy that delivers a functional copy of the full-length human NGLY1 gene for the treatment of NGLY1 deficiency. GS-100 administration via ICV and ICV+IV to Ngly1-deficient rats results in widespread biodistribution of AAV9 encoding human NGLY1 DNA and corresponding human NGLY1 protein expression. GS-100 administration delivered by ICV or dual-route ICV+IV significantly reduced levels of the biomarker GNA in the CNS, while IV administration did not provide substantial delivery to CNS tissues. Ngly1-deficient rats treated with ICV and ICV+IV GS-100 show improvements in functional behavioral tests. ICV+IV administration compared to ICV alone did not provide additional GS-100 transduction or expression levels in the CNS or additional improvement in behavioral phenotype. Biomarker reduction following ICV administration of GS-100 correlated with vector DNA biodistribution, hNGLY1 mRNA expression, and behavioral improvement. The correlation between tissue and fluid GNA, combined with the correlation between GNA levels and GS-100, indicates that GNA may serve as a pharmacodynamic marker for the delivery of functional human NGLY1.

[0155] In summary, these data provide evidence that ICV delivery of GS-100 may be useful as a treatment for NGLY1 deficiency. EXAMPLES

[0156] AAV9-mediated gene therapy for NGLY1 deficiency and evaluation of NGLY1 biomarker changes in a rat disease model Recently, elevated levels of GNA and NHGNA were reported in dried blood spots and urine samples from NGLY1 patients, respectively. Based on this data, we tested whether cytoplasmic GNA (and NHGNA) accumulation is a hallmark of NGLY1 deficiency and directly correlates with the loss of NGLY1 activity. Ngly1 knockout mice are perinatal lethal, whereas Ngly1 knockout (Ngly1 - / -) rat model was used. Approximately 25% of these homozygous animals survive after weaning. Characterization of these surviving knockouts reveals reduced initial body weight and abnormalities in the rotarod and grip strength tests. Longitudinal evaluation of these phenotypes, as well as GNA biomarker changes in blood, urine and CSF, was performed after treatment with AAV-NGLY1 (GSL-14; hNGLY1 cDNA was codon optimized for reduced CpG content and contained a V5 tag using a CAG promoter; SEQ ID NO: 11). Study animals (wild type and Ngly1 - / - Cohorts of rats were administered a single intravenous dose (3 × 10 13 The mice were treated with 100 μg / kg of human NGLY1 (AAV9 vector expressing human NGLY1). Serum / urine GNA levels were monitored weekly, and CSF was analyzed using untreated wild-type and Ngly1 - / - For comparison to controls, samples were taken 5 weeks after dosing at the end of the study. Results showed a reduction in the biomarker in the heart, but not in the brain or CSF (see FIG. 9). The GNA biomarker is tightly linked to the enzymatic activity of NGLY1, and in combination with a rat model of NGLY1 disease that shows early onset of motor neuron loss consistent with the patient phenotype, both are important for determining the in vivo efficacy of GS-100 gene therapy.

[0157] SEQ ID NO: 11 (CMV enhancer-CB promoter-chimeric intron-midGC transgene codon optimized-WPREmut6-rGB polyA):

[0158] Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, certain changes and modifications can be practiced within the scope of the appended claims.

[0159] References 1. Greene, JA and SH Podolsky, Reform, regulation, and pharmaceuticals--the Kefauver-Harris Amendments at 50. N Engl J Med, 2012. 367(16): p. 1481-3 2. Wraith, JE, et al., Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr, 2004. 144(5): p. 581-8 3. Kakkis, ED, et al., Long-term and high-dose trials of enzyme replacement therapy in the canine model of mucopolysaccharidosis I. Biochem Mol Med, 1996. 58(2): p. 156-67 4. Clarke, LA, et al., Long-term efficacy and safety of laronidase in the treatment of mucopolysaccharidosis I. Pediatrics, 2009. 123(1): p. 229-40 5. Harmatz, P., et al., Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-label extension study. J Pediatr, 2006. 148(4): p. 533-539 6. Muenzer, J., et al., A phase II / III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med, 2006. 8(8): p. 465-73 7. Chi, G.Y., Some issues with composite endpoints in clinical trials. Fundam Clin Pharmacol, 2005. 19(6): p. 609-19 8. Sankoh, A.J., H. Li, and R.B. D'Agostino, Sr., Use of composite endpoints in clinical trials. Stat Med, 2014. 33(27): p. 4709-14 9. Garcia-Garcia, H.M., et al., Standardized End Point Definitions for Coronary Intervention Trials: The Academic Research Consortium-2 Consensus Document. Circulation, 2018. 137(24): p. 26352650 10. Mazzone, E.S., et al., Reliability of the North Star Ambulatory Assessment in a multicentric setting. Neuromuscul Disord, 2009. 19(7): p. 458-61 11. Mayhew, J., et al., Development and preliminary evidence of the psychometric properties of the GNE myopathy functional activity scale. J Comp Eff Res, 2018. 7(4): p. 381-395 12. Vockley, J., et al., Results from a 78-week, single-arm, open-label phase 2 study to evaluate UX007 in pediatric and adult patients with severe long-chain fatty acid oxidation disorders (LC-FAOD). J Inherit Metab Dis, 2019. 42(1): p. 169-177 13. Balwani, M., et al., Phase 3 Trial of RNAi Therapeutic Givosiran for Acute Intermittent Porphyria. N Engl J Med, 2020. 382(24): p. 2289-2301 14. O'Brien, P.C., Procedures for comparing samples with multiple endpoints. Biometrics, 1984. 40(4): p. 1079-87 15. Pocock, S.J., N.L. Geller, and A.A. Tsiatis, The analysis of multiple endpoints in clinical trials. Biometrics, 1987. 43(3): p. 487-98 16. Tandon, P.K., Applications of global statistics in analysing quality of life data. Stat Med, 1990. 9(7): p. 819-27 17. Harmatz, P., et al., A novel Blind Start study design to investigate vestronidase alfa for mucopolysaccharidosis VII, an ultra-rare genetic disease. Mol Genet Metab, 2018. 123(4): p. 488494 18. Redelmeier, D.A., et al., Interpreting small differences in functional status: the Six Minute Walk test in chronic lung disease patients. Am J Respir Crit Care Med, 1997. 155(4): p. 1278-82 19. Puhan, M.A., et al., Interpretation of treatment changes in 6-minute walk distance in patients with COPD. Eur Respir J, 2008. 32(3): p. 637-43 20. du Bois, R.M., et al., Six-minute-walk test in idiopathic pulmonary fibrosis: test validation and minimal clinically important difference. Am J Respir Crit Care Med, 2011. 183(9): p. 1231-7 21. Abuduxikuer K, Zou L, Wang L, Chen L, Wang JS. Novel NGLY1 gene variants in Chinese children with global developmental delay, microcephaly, hypotonia, hypertransaminasemia, alacrimia, and feeding difficulty. J Hum Genet. 2020;65(4):387-396 22. Ahmed SS, Rubin H, Wang M, Faulkner D, Sengooba A, Dollive SN, et al. Sustained correction of a murine model of phenylketonuria following a single intravenous administration of AAVHSC15-PAH. Mol Ther Methods Clin Dev. 2020;17:568-580 23. Aiello-Laws L, Rutledge DN. Management of adult patients receiving intraventricular chemotherapy for the treatment of leptomeningeal metastasis. Clin J Oncol Nurs. 2008;12(3):429-35 24. Arvin M, Mononen I. Aspartylglycosaminuria: a review. Orphanet J Rare Dis. 2016;11(1):162 25. Asahina M, Fujinawa R, Nakamura S, Yokoyama K, Tozawa R, Suzuki T. Ngly1- / - rats develop neurodegenerative phenotypes and pathological abnormalities in their peripheral and central nervous systems. Hum Mol Genet. 2020;29(10):1635-1647 26. Atkinson AJ. Intracerebroventricular drug administration. Transl Clin Pharmacol. 2017;25(3):117-124 27. Bevan AK, Duque S, Foust KD, Morales PR, Braun L, Schmelzer L, et al. Systemic gene delivery in large species for targeting spinal cord, brain, and peripheral tissues for pediatric disorders. Mol Ther. 2011;19(11):1971-1980 28. Bailey RM, Armao D, Nagabhushan Kalburgi S , Gray SJ. Development of intrathecal AAV9 gene therapy for giant axonal neuropathy. Mol Ther Methods Clin. Dev. 2018;9:160-171 29. Bolon B, Garmin RH, Pardo ID, Jensen K, Sills RC, Roulois A, et al. STP position paper: recommended practices for sampling and processing the nervous system (brain, spinal cord, nerve, and eye) during nonclinical general toxicity studies. Toxicol Pathol. 2013;41(7):1028-1048 30. Bolon B, Krinke G, Butt MT, Rao DB, Pardo ID, Jortner BS, et al. STP position paper: recommended best practices for sampling, processing, and analysis of the peripheral nervous system (nerves and somatic and autonomic ganglia) during nonclinical toxicity studies. Toxicol Pathol. 2018 Jun;46(4):372-402 31. Buccafusco JJ. Methods of behavior analysis in neuroscience. In Fronteirs in Neuroscience. 2nd Ed. Boca Raton, FL: CRC Press / Taylor & Francis. 2009 32. Caglayan AO, Comu S, Baranoski JF, Parman Y, Kaymakcalan H, Akgumus GT, et al. NGLY1 mutation causes neuromotor impairment, intellectual disability, and neuropathy. Eur J Med Genet. 2015;58(1):39-43 33. Cahan EM, Frick SL. Orthopaedic phenotyping of NGLY1 deficiency using an international, family-led disease registry. Orphanet J Rare Dis. 2019;14(1):148 34. Chou AH. Polyglutamine-expanded ataxin-3 causes cerebellar dysfunction of SCA3 transgenic mice by inducing transcriptional dysregulation. Neurobiol Dis. 2008;31(1):89-101 35. Colella P, Ronzitti G, Mingozzi F. Emerging issues in AAV-mediated in vivo gene therapy. Mol Ther Methods Clin Dev. 2017;8:87-104 36. Crawley JN. Behavioral phenotyping of rodents. Comp Med. 2003;53:140-146 37. Crawley JN. Behavioral phenotyping strategies for mutant mice. Neuron. 2008;57(6):809-818 38. Davidoff AM, Ng CYC, Zhou J, Spence Y, Nathwani AC. Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway. Blood. 2003;102(2):480￢488 39. Duan D. Systemic AAV micro-dystrophin gene therapy for Duchenne muscular dystrophy. Mol Ther. 2018;26(10):2337-2356 40. Enns GM, Shashi V, Bainbridge M, Gambello MJ, Zahir FR, Gast T, et al. Mutations in NGLY1 cause an inherited disorder of the endoplasmic reticulum-associated degradation pathway. Genet Med. 2014;16(10):751-758 41. Foust KD, Wang X, McGovern VL, Braun L, Bevan AK, Haidet AM, et al. Rescue of the spinal muscular atrophy phenotype in a mouse model by early postnatal delivery of SMN. Nat Biotechnol. 2010;28(3):271-274 42. Fujihira H, Masahara-Negishi Y, Tamura M, Huang C, Harada Y, Wakana S, et al. Lethality of mice bearing a knockout of the Ngly1-gene is partially rescued by the additional deletion of the Engase gene. PLoS Genet. 2017;13(4):e1006696 43. Ge H, Wu Q, Lu H, Huang Y, Zhou T, Tan D, et al. Two novel compound heterozygous mutations in NGLY1 as a cause of congenital disorder of deglycosylation: a case presentation. BMC Med Genet. 2020;21:135 44. Greig JA, Nordin JML, Draper C, McMenamin D, Chroscinski EA, Bell P, et al. Determining the minimally effective dose of a clinical candidate AAV vector in a mouse model of Crigler-Najjar syndrome. Mol Ther Methods Clin Dev. 2018;10:237-244 45. Guyenet SJ, Furrer SA, Damian VM, Baughan TD, La Spada AR, Garden GA. A simple composite phenotype scoring system for evaluating mouse models of cerebellar ataxia. J Vis Exp. 2010;21:1787 46. Haijes HA, de Sain-van der Velden MGM, Prinsen HCMT, Willems AP, van der Ham M, Gerrits J, et al. Aspartylglycosamine is a biomarker for NGLY1-CDDG, a congenital disorder of deglycosylation. Mol Genet Metab. 2019;127(4):368-372 47. Hall PL, Lam C, Alexander JJ, Asif G, Berry GT, Ferreira C, et al. Urine oligosaccharide screening by MALDI-TOF for the identification of NGLY1 deficiency. Mol Genet Metab. 2018;124(1):82-86 48. Harmatz P, Whitley CB, Wang RY, Bauer M, Song W, Haller C, et al. A novel Blind Start study design to investigate vestronidase alfa for mucopolysaccharidosis VII, an ultra-rare genetic disease. Mol Genet Metab. 2018;123(4):488-494 49. Hendriksz CJ, Giugliani R, Harmatz P, Mengel E, Haller C. Multi-domain impact of elosulfase alfa in Morquio A syndrome in the pivotal Phase III trial. Mol Genet Metab. 2015;114(2):178-185 50. Hirai T, Enomoto M, Kaburagi H, Sotome S, Yoshida-Tanaka K, Ukegawa M, et al. Intrathecal AAV serotype 9-mediated delivery of shRNA against TRPV1 attenuates thermal hyperalgesia in a mouse model of peripheral nerve injury. Mol Ther. 2014;22(2):409-419 51. Hocquemiller M, Giersch L, Audrain M, Parker S, Cartier N. Adeno-associated virus-based gene therapy for CNS diseases. Hum Gene Ther. 2016;27(7):478-496 52. Hordeaux J, Buza EL, Dyer C, Goode T, Mitchell TW, Richman L, et al. Adeno-associated virus-induced dorsal root ganglion pathology. Hum Gene Ther. 2020;31(15-16):808-818 53. Huang C, Harada Y, Hosomi A, Masahara-Negishi Y, Seino J, Fujihira H, et al. Endo-β-N-acetylglucosaminidase forms N-GlcNAc protein aggregates during ER-associated degradation in Ngly1-defective cells. Proc Natl Acad Sci USA. 2015;112(5):1398-1403 54. Huang R, Cathey S, Pollard L, Wood T. UPLC-MS / MS analysis of urinary free oligosaccharides for lysosomal storage diseases: diagnosis and potential treatment monitoring. Clin Chem. 2018;64(12):1772-177 55. Jackson KL, Dayton RD, Klein RL. AAV9 supports wide-scale transduction of the CNS and TDP-43 disease modeling in adult rats. Mol Ther Methods Clin Dev. 2015;2:15036 56. Lalonde R, Strazielle C. Brain regions and genes affecting limb-clasping responses. Brain Res Rev. 2011;67(1-2):252-259 57. Lam C, Wolfe L, Need A, Shashi V, Enns G. NGLY1 -related congenital disorder of deglycosylation. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A, editors. GeneReviews(R) [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2019. 2018 Feb 8 58. Lam C, Ferreira C, Krasnewich D, Toro C, Latham L, Zein WM, et al. Prospective phenotyping of NGLY1-CDDG, the first congenital disorder of deglycosylation. Genet Med. 2017;19(2):160-168 59. Lanoix J, Acheson NH. A rabbit beta-globin polyadenylation signal directs efficient termination of transcription of polyomavirus DNA. EMBO J. 1988;7(8):2515-2522 60. Lehrbach NJ, Breen PC, Ruvkun G. Protein sequence editing of SKN-1A / Nrf1 by peptide:N-glycanase controls proteasome gene expression. Cell. 2019;177(3):737-750 61. Levitt N, Briggs D, Gil A, Proudfoot NJ. Definition of an efficient synthetic poly(A) site. Genes Dev. 1989;3(7):1019-1025 62. Lipari Pinto P, Machado C, Janeiro P, Dupont J, Quintas S, Soiusa AB, et al. NGLY1 deficiency-A rare congenital disorder of deglycosylation. JIMD Rep. 2020;53(1):2-9 63. Lipinski P, Cielecka-Kuszyk J, Socha P, Tylki-Szymanska A. Liver involvement in NGLY1 congenital disorder of deglycosylation. Pol J Pathol. 2020a;71(1):66-68 64. Lipinski P, Bogdanska A, Rozdzynska-Swiatkowska A, Wierzbicka-Rucinska A, Tylki-Szymanska A. NGLY1 deficiency: novel patient, review of the literature and diagnostic algorithm. JIMD Rep. 2020b51(1):82-88 65. Maguire CA, Crommentuijn MH, Mu D, Hudry E, Serrano-Pozo A, Hyman BT, et al. Mouse gender influences brain transduction by intravascularly administered AAV9. Mol Ther. 2013;21(8):1470-1471 66. Meadows AS, Pineda RJ, Goodchild L, Bobo TA, Fu H. Threshold for pre-existing antibody levels limiting transduction efficiency of systemic rAAV9 gene delivery: relevance for translation. Mol Ther Methods Clin Dev. 2019;13:453-462 67. Meadows AS, Duncan FJ, Camboni M, Waligura K, Montgomery C, Zaraspe K, et al. A GLP-compliant toxicology and biodistribution study: systemic delivery of an rAAV9 vector for the treatment of mucopolysaccharidosis IIIB. Hum Gene Ther Clin Dev. 2015;26(4):228-242 68. Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, et al. Single-dose gene-replacement therapy for spinal muscular atrophy. N Engl J Med. 2017;377(18):1713-1722 69. Miyazaki J, Takaki S, Araki K, Tashiro F, Tominaga A, Takatsu K, et al. Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene. 1989;79(2):269-277 70. Mononen T, Parviainen M, Penttila I, Mononen I. Liquid-chromatographic detection of aspartylglycosaminuria. Clin Chem. 1986;32(3):501-502 71. Mononen I, Mononen T, Ylikangas P, Kaartinen V, Savolainen K. Enzymatic diagnosis of aspartylglycosaminuria by fluorometric assay of glycosylasparaginase in serum, plasma, or lymphocytes. Clin Chem. 1994;40(3):38 5-388 72. Moser VC, McCormick JP, Creason JP, MacPhail RC. Comparison of chlordimeform and carbaryl using a functional observational battery. Fund Appl Toxicol. 1988;11(2):189-206 73. Moser VC, Ross JF. US EPA / AIHC Training video and reference manual for a functional observational battery. Washington, D.C.: US Environmental Protection Agency. 1996 [ PMC free article ] [ PubMed ] 74. Nakamura S, Muramatsu SI, Takino N, Ito M, Jimbo EF, Shimazaki K, et al. Gene therapy of the Glut1-deficient mouse using an adeno-associated viral vector with the human intrinsic GLUT1 promoter. J Gene Med. 2018;20(4):e3013 [ PMC free article ] [ PubMed ] 75. Need AC, Shashi V, Hitomi Y, Schoch K, Shianna KV, McDonald MT, et al. Clinical application of exome sequencing in undiagnosed genetic conditions. J Med Genet. 2012;49(6):353-561 [ PubMed ] 76. Neville DC, Field RA, Ferguson MA. Hydrophobic glycosides of N-acetylglucosamine can act as primers for polylactosamine synthesis and can affect glycolipid synthesis in vivo. Biochem J. 1995;307(Pt3)(Pt3):791-797 [ PubMed ] 77. Niemir N, Rouviere L, Besse A, Vanier MT, Dmytrus J, Marais T, et al. Intravenous administration of scAAV9-Hexb normalizes lifespan and prevents pathology in Sandhoff disease mice. Hum Mol Genet. 2018;27(6):954-968 78. Niwa H, Yamamura K, Miyaxaki J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991;108(2):193-199 79. Nott A, Le Hir, H, Moore MJ. Splicing enhances translation in mammalian cells: an additional function of the exon junction complex. Genes Dev. 2004;18(2):210-222 80. Panneman DM, Wortmann SB, Haaxma CA, van Hasselt PM, Wolf NI, Hendriks Y, et al. Variants in NGLY1 lead to intellectual disability, myoclonus epilepsy, sensorimotor axonal polyneuropathy and mitochondrial dysfunction. Clin Genet. 2020;97(4):556-566 81. Peyrl A, Chocholous M, Azizi AA, Czech T, Dorfer C, Mitteregger D, et al. Safety of Ommaya reservoirs in children with brain tumors: a 20-year experience with 5472 intraventricular drug administrations in 98 patients. J Neurooncol. 2014;120(1):139-145 82. Pinto PL, Machado C, Janeiro P, Dupont J, Quintas S, Sousa AB, et al. NGLY1 deficiency-A rare congenital disorder of deglycosylation. JIMD Rep. 2020;53(1):2-9 83. Powell SK, Rivera-Soto R, Gray SJ. Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy. Discov Med. 2015;19(102):49-57 84. Ren L, Gao G, Wang D. Optimizing in vivo NGLY1 gene delivery towards gene therapy for NGLY1 deficiency. American Society of Gene and Cell Therapy (ASGCT) 22nd Annual Meeting. 29 April to 02 May 2019 85. Robinson L, Platt B, Riedel G. Involvement of the cholinergic system in conditioning and perceptual memory. Behav Brain Res. 2011;221(2):443-465 86. Saade D, Bharucha-Goebel D, Jain M, Waite M, Norato G, Cheung K, et al. Review of safety and interim analysis of efficacy of a first-in-human intrathecal gene transfer study for giant axonal neuropathy. Presented at the 22 nd 87. Annual Meeting for the American Society of Gene and cell Therapy. Washington, DC. 29 April - 02 May 2019. Available at https: / / cslide-us.ctimeetingtech.com / asgct23 / attendee / eposter / file / 1348#1. Accessed September 2020 88. Samaranch L, Salegio EA, San Sebastian W, Kells AP, Bringas JR, Forsayeth J, et al. Strong cortical and spinal cord transduction after AAV7 and AAV9 delivery into the cerebrospinal fluid of nonhuman primates. Hum Gene Ther. 2013;24(5):526-532 89. Seibenhener ML, Wooten MC. Use of the open field maze to measure locomotor and anxiety-like behavior in mice. J Vis Exp. 2015;(96):e52434 90. Suzuki T, Huang C, Fujihira H. The cytoplasmic peptide:N-glycanase (NGLY1) - structure, expression and cellular functions. Gene. 2016;577(1):1-7 91. Suzuki T, Yano K, Sugimoto S, Kitajima K, Lennarz WJ, Inoue S, et al. Endo-beta-N-acetylglucosaminidase, an enzyme involved in processing of free oligosaccharides in the cytosol. Proc Natl Acad Sci U S A. 2002a;99(15):9691-9696 92. Suzuki T, Park H, Lennarz WJ. Cytoplasmic peptide:N-glycanase (PNGase) in eukaryotic cells: occurrence, primary structure, and potential functions. FASEB J. 2002b;16(7):635-641 93. Suzuki T, Park H, Hollingsworth NM, Sternglanz R, Lennarz WJ. PNG1, a yeast gene encoding a highly conserved peptide:N-glycanase. J Cell Biol. 2000;149(5):1039-1052 94. Talsness DM, Owings KG, Coelho E, Mercenne G, Pleinis JM, Zuberi AR, et al. A Drosophila natural variation screen identifies NKCC1 as a substrate of NGLY1 deglycosylation and a modifier of NGLY1 deficiency. bioRxiv 2020.04.13.039651; doi: https: / / doi.org / 10.1101 / 2020.04.13.039651 95. Tomlin FM, Gerling-Driessen UIM, Liu YC, Flynn RA, Vangala JR, Lentz CS, et al. Inhibition of NGLY1 inactivates the transcription factor Nrf1 and potentiates proteasome inhibitor cytotoxicity. ACS Cent Sci. 2017;3(11):1143-1155 96. Tornoe J, Kusk P, Johansen TE, Jensen PR. Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites. Gene. 2002;297(1-2):21-32 97. Valencia P, Dias AP, Reed R. Splicing promotes rapid and efficient mRNA export in mammalian cells. Proc Natl Acad Sci USA. 2008;105(9):3386-3391 98. van Keulen BJ, Rotteveel J, Finken MJJ. Unexplained death in patients with NGLY1 mutations may be explained by adrenal insufficiency. Physiol Rep. 2019;7(3):e13979 99. Wright JF. Codon modification and PAMPs in clinical AAV vectors: the tortoise or the hare? Mol Ther. 2020;28(3):701-703 100. Xia B, Asif G, Arthur L, Pervaiz MA, Li X, Liu R, et al. Oligosaccharide analysis in urine by maldi-tof mass spectrometry for the diagnosis of lysosomal storage diseases. Clin Chem. 2013;59(9):1357-1368 101. Zanta-Boussif MA, Charrier S, Brice-Ouset A, Martin S, Opolon P, Thrasher AJ, et al. Validation of a mutated PRE sequence allowing high and sustained transgene expression while abrogating WHV-X protein synthesis: application to the gene therapy of WAS. Gene Ther. 2009;16(5):605-619 102. Zhou X, Zhao G, Truglio JJ, Wang L, Li G, Lennarz WJ, et al. Structural and biochemical studies of the C-terminal domain of mouse peptide-N-glycanase identify it as a mannose-binding module. Proc Natl Acad Sci USA. 2006;103(46):17214-17219 103. Zhu J, Li Y, Wang Z, Jia W, Xu R. Toll-like receptor 4 deficiency impairs motor coordination. Front Neurosci. 2016;10:33 104. Zolgensma(R)(onasemnogene abeparvovec-xioi) USPI. Revised May 2019. AveXis, Inc. Bannockburn, IL, USA. Accessed June 2019 105. Mathai, S.C., et al., The minimal important difference in the 6-minute walk test for patients with pulmonary arterial hypertension. Am J Respir Crit Care Med, 2012. 186(5): p. 428-33 106. Okuyama, T., et al., Japan Elaprase Treatment (JET) study: idursulfase enzyme replacement therapy in adult patients with attenuated Hunter syndrome (Mucopolysaccharidosis II, MPS II). Mol Genet Metab, 2010. 99(1): p. 18-25 107. Photodynamic therapy of subfoveal choroidal neovascularization in age-related macular degeneration with verteporfin: one-year results of 2 randomized clinical trials--TAP report. Treatment of age-related macular degeneration with photodynamic therapy (TAP) Study Group. Arch Ophthalmol, 1999. 117(10): p. 1329-45 108. Ferris, F.L., 3rd, et al., New visual acuity charts for clinical research. Am J Ophthalmol, 1982. 94(1): p. 91-6 109. Reeves, B.C., J.M. Wood, and A.R. Hill, Reliability of high- and low-contrast letter charts. Ophthalmic Physiol Opt, 1993. 13(1): p. 17-26 110. Wuang, Y.P. and C.Y. Su, Reliability and responsiveness of the Bruininks-Oseretsky Test of Motor Proficiency-Second Edition in children with intellectual disability. Res Dev Disabil, 2009. 30(5): p. 847-55 111. Wang, R.Y., et al., The long-term safety and efficacy of vestronidase alfa, rhGUS enzyme replacement therapy, in subjects with mucopolysaccharidosis VII. Mol Genet Metab, 2020. 129(3): p. 219-227 112. Little, R.J.A. and Rubin, D.B. Statistical Analysis With Missing Data. 2nd ed. Princeton, NJ: Wiley: 2002

Claims

**Claim 1** A pharmaceutical composition for treating NGLY1 deficiency in a subject in need thereof, comprising a therapeutically effective amount of recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising a nucleotide sequence encoding NGLY1 operably linked to a regulatory element for expression in the central nervous system (CNS) of the subject, and administered by intracerebroventricular (ICV) administration or via a cisterna magna, said pharmaceutical composition of the method. **Claim 2** The pharmaceutical composition according to claim 1, wherein the nucleotide sequence encoding NGLY1 is codon-optimized. **Claim 3** The pharmaceutical composition according to claim 2, wherein the nucleotide sequence encoding NGLY1 is the nucleotide sequence of SEQ ID NO:

1. **Claim 4** The pharmaceutical composition according to claim 1, wherein the regulatory element comprises a CAG promoter. **Claim 5** The pharmaceutical composition according to claim 4, wherein the nucleic acid construct further comprises a chimeric intron sequence, said chimeric intron sequence being operably linked and 5' to the nucleotide sequence encoding NGLY1. **Claim 6** The pharmaceutical composition according to claim 1, wherein the nucleic acid construct further comprises a WPRE-Mut6 sequence and a rabbit beta-globin polyA signal sequence. **Claim 7** The pharmaceutical composition according to claim 1, wherein the nucleic acid construct comprises the nucleotide sequence of SEQ ID NO:

8. **Claim 8** The pharmaceutical composition according to claim 1, wherein the nucleic acid construct is adjacent to AAV2 ITR. **Claim 9** The pharmaceutical composition according to claim 1, wherein the nucleic acid construct has the nucleotide sequence of SEQ ID NO:

9. **Claim 10** The pharmaceutical composition according to claim 1, wherein the rAAV is of serotype AAV9 or has a capsid that is at least 95% identical to SEQ ID NO: 10 (AAV9 sequence). **Claim 11** The pharmaceutical composition according to claim 1, wherein at least 5 weeks after administration, the GlcNAc-Asn (GNA) level in a sample from the subject is at least 10% decreased compared to the GNA level in said sample from the subject before said administration. **Claim 12** The pharmaceutical composition according to claim 1, wherein at least 5 weeks after administration, a decrease or alleviation of one or more symptoms of NGLY1 deficiency in the subject is seen compared to the symptoms in the subject before said administration. **Claim 13** The pharmaceutical composition according to claim 1, wherein the nucleic acid construct is a self-complementary AAV (scAAV) vector. Recombinant adeno-associated virus (rAAV) comprising an AAV9 capsid containing a nucleic acid construct comprising a codon-optimized nucleotide sequence encoding human NGLY1 of SEQ ID NO: 1 operably linked to a regulatory element such that NGLY1 is expressed in the central nervous system (CNS) of interest. The rAAV according to claim 14, wherein the regulatory element comprises a CAG promoter, a chimeric intron, a WPRE-MUT6 sequence, and a rabbit beta-globin polyA signal between AAV2-ITRs. The rAAV according to claim 15, wherein the nucleic acid construct has the nucleotide sequence of SEQ ID NO:

8. A pharmaceutical composition comprising the rAAV according to claim 14. The pharmaceutical composition according to claim 17, comprising phosphate-buffered saline at pH 7.3 and 0.001% PF68. An isolated nucleic acid comprising a nucleotide sequence encoding codon-optimized NGLY1 defined by SEQ ID NO: 1 operably linked to a regulatory element for the expression of NGLY1 in the central nervous system (CNS). The isolated nucleic acid according to claim 19, having the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9 (construct sequences with and without ITR sequences). A host cell comprising the isolated nucleic acid according to claim 19. The host cell according to claim 21, further comprising an isolated nucleic acid encoding an AAV capsid protein. The host cell according to claim 22, wherein the AAV capsid protein is AAV9. A method for producing the rAAV according to claim 14 by culturing a host cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding codon-optimized NGLY1 defined by SEQ ID NO: 1 operably linked to a regulatory element for the expression of NGLY1 in the central nervous system (CNS). **Claim 25** A pharmaceutical composition for reducing the accumulation of GlcNAc-Asn (GNA) in the central nervous system (CNS) of a subject, comprising a nucleic acid construct encoding human NGLY1 operably linked to a regulatory element for expression in the CNS of the subject, a therapeutically effective amount of recombinant adeno-associated virus (rAAV), and being administered by intracerebroventricular (ICV) administration or via a cisterna magna, said pharmaceutical composition. **Claim 26** The pharmaceutical composition according to claim 25, wherein the nucleotide sequence encoding human NGLY1 is codon-optimized. **Claim 27** The pharmaceutical composition according to claim 25, wherein the nucleotide sequence encoding human NGLY1 is the nucleotide sequence of SEQ ID NO:

1. **Claim 28** The pharmaceutical composition according to claim 25, wherein the regulatory element comprises a CAG promoter. **Claim 29** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct further comprises a chimeric intron sequence, said chimeric intron sequence being operably linked and being 5' relative to the nucleotide sequence encoding NGLY1. **Claim 30** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct further comprises a WPRE-Mut6 sequence and a rabbit beta-globin polyA signal sequence. **Claim 31** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct comprises the nucleotide sequence of SEQ ID NO:

8. **Claim 32** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct is adjacent to AAV2 ITR. **Claim 33** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct has the nucleotide sequence of SEQ ID NO:

9. **Claim 34** The pharmaceutical composition according to claim 25, wherein the rAAV is of AAV9 serotype or has a capsid that is at least 95% identical to SEQ ID NO: 10 (AAV9 sequence). **Claim 35** The pharmaceutical composition according to claim 25, wherein at least 5 weeks after administration, the GNA level in a sample from the subject is reduced by at least 10% compared to the GNA level in the sample of the subject before said administration. **Claim 36** The pharmaceutical composition according to claim 25, wherein at least 5 weeks after administration, a reduction or alleviation of one or more symptoms of NGLY1 deficiency disorder in the subject is observed compared to the symptoms in the subject before said administration. **Claim 37** The pharmaceutical composition according to claim 25, wherein the nucleic acid construct is a self-complementary AAV (scAAV) vector. **Claim 38** A pharmaceutical composition for treating NGLY1 deficiency in a subject in need thereof, comprising the rAAV according to claim 14. **Claim 39** The pharmaceutical composition according to claim 38, which is administered to a subject in a therapeutically effective amount selected from the group consisting of intravenous administration, ICV administration, intracisternal administration, or combinations thereof. **Claim 40** A pharmaceutical composition for treating NGLY1 deficiency in a subject in need thereof, comprising a therapeutically effective amount of recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising a transgene encoding NGLY1 operably linked to regulatory elements for expression in the central nervous system (CNS) of the subject, wherein the sequence encoding NGLY1 is SEQ ID NO: 1, and the pharmaceutical composition is administered by ICV administration or via intracisternal administration. **Claim 41** The pharmaceutical composition according to claim 40, wherein at least 5 weeks after administration, the GNA level in a sample from the subject is reduced by at least 10% compared to the GNA level in the sample of the subject before the administration. **Claim 42** The pharmaceutical composition according to claim 40, wherein at least 5 weeks after administration, a decrease or alleviation of one or more symptoms of NGLY1 deficiency in the subject is observed compared to the symptoms in the subject before the administration. **Claim 43** A pharmaceutical composition for reducing the accumulation of GlcNAc-Asn (GNA) in the central nervous system (CNS) of a subject, comprising a therapeutically effective amount of recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising a nucleotide sequence encoding human NGLY1 operably linked to regulatory elements for expression in the CNS of the subject, wherein the nucleotide sequence encoding human NGLY1 is the nucleotide sequence of SEQ ID NO: 1, and the pharmaceutical composition is administered by ICV administration or via intracisternal administration. **Claim 44** The pharmaceutical composition according to claim 43, wherein at least 5 weeks after administration, the GNA level in a sample from the subject is reduced by at least 10% compared to the GNA level in the sample of the subject before the administration. **Claim 45** The pharmaceutical composition according to claim 43, wherein at least 5 weeks after administration, a decrease or alleviation of one or more symptoms of NGLY1 deficiency in the subject is observed compared to the symptoms in the subject before the administration. A pharmaceutical composition for treating NGLY1 deficiency in a subject in need thereof, comprising a therapeutically effective amount of recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9, wherein the pharmaceutical composition is administered by intracerebroventricular (ICV) administration or via a cisterna. A pharmaceutical composition comprising a recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO:

9. A nucleic acid construct comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO:

9. A host cell comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO:

9. A pharmaceutical composition for reducing the accumulation of GlcNAc-Asn (GNA) in the central nervous system (CNS) of a subject, comprising a therapeutically effective amount of recombinant adeno-associated virus (rAAV) comprising a nucleic acid construct comprising the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9, wherein the pharmaceutical composition is administered by intracerebroventricular (ICV) administration or via a cisterna.

Images