Compounds and methods for reducing expression of IFNAR1

Abstract

Provided are oligomeric agents, compounds, methods, and pharmaceutical compositions for reducing the amount or activity of IFNAR1 RNA in a cell or animal, and in some cases, reducing the amount of IFNAR1 protein in a cell or animal, which are useful for treating diseases and conditions associated with neuroinflammation, including Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia.

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided in a file entitled BIOL0416WOSEQ_ST25.txt, created on June 8, 2022, and having a size of 589 KB. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of IFNAR1 RNA in a cell or animal, and in some cases, reducing the amount of IFNAR1 protein in a cell or animal, which are useful for treating neurological diseases or conditions associated with neuroinflammation, including Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. [Background technology]

[0003] Aicardi-Goutières syndrome (AGS) is a progressive inflammatory encephalopathy associated with several neuropathological manifestations including seizures, feeding difficulties, dystonia, spasticity, motor, language, and social developmental delays. Imaging of AGS patients shows white matter abnormalities, T-cell infiltration, B-cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and cerebellar myelopathy, and patients also have high levels of interferon alpha (IFNa) and lymphocytosis in the cerebrospinal fluid. AGS is associated with mutations in one of ten genes, namely TREX1 (DNA exonuclease), RNASEH2A, B or C (subunits of RNASEH2), SAMHD1 (dNTP hydrolase), ADAR1 (RNA editing enzyme), MDA5 (dsRNA sensor), USP18 (negative regulator of type I IFN signaling), LSM11 and RNU7-1 (component of the replication-dependent histone pre-mRNA processing complex). Mutations in any one of these genes result in aberrant activation of the antiviral response and high levels of IFNa (Adang, et al., 2020, J. Child Neurol., 35, 7016; Rodero, et al., 2016, J. Esp. Med., 213, 2527-2538).

[0004] Interferon alpha and beta receptor subunit 1 (IFNAR1) is one of two components of the interferon alpha receptor involved in type I interferon signaling, which is elevated in patients with AGS and is thought to be an important mediator of neuropathology. Increased levels of type I interferon signaling have also been associated with diseases or conditions such as stroke, brain injury, Alzheimer's disease, neuropsychiatric lesions due to systemic lupus erythematosus, neuromyelitis optica, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, and neuroinflammation associated with ataxia telangiectasia (Wlodarczyk,et al.,2021,Glia 69,943-953; Santer,et al.,2009,J.Immunol.182,1192-1201; Zeng,et al.,2019,Arthritis Res.Ther.21,205.017; Karageorgas,et al.,2011,J Biomed Biotechnol 2011,273907; Roy,et al.,2020,J Clin Invest.130,1912-1930, Witcher,2021,J.Neurosci.JN-RM-2469-2420, Blank,et al.,2016,Immunity 44,901-912,Hartlova,et al.,2015,Immunity 44,901-912,McDonough,et al.,2017,J Neurosci.37,8292-8308). In transgenic mice, overexpression of IFNa increases the levels of type I interferon signaling, leading to neurodegenerative changes, T cell infiltration, B cell infiltration, microglial cell activation, reactive astrocytosis, endothelial cell activation, and calcification in the thalamus and cerebellum (Hofer, et al., 2013, Cytokine & Growth Factor Reviews 24, 257-267; Klok, et al., 2015, Ann. Clin. Transl. Neurol., 2, 774-779).Type I interferon signaling induces the expression of hundreds of genes, including Interferon Induced Protein with Tetratricopeptide Repeats 1 (Ifit1), Interferon Induced Protein with Tetratricopeptide Repeats 3 (Ifit3), and Interferon Regulatory Factor 7 (Irf7) (Li, et al., 2018, J. Biol. Chem. 292, P5845-P5859). Crossing Alzheimer's disease mouse models with IFNAR1 knockout mice suppressed type I interferon signaling, leading to an anti-inflammatory response in glial cells and reduced neuroinflammation (Minter, MR, et al., 2016, Acta Neuropathologica Commun. 4:72). Summary of the Invention

[0005] Certain embodiments of the oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions described herein are useful for reducing or inhibiting the expression of IFNAR1 in cells or animals. In certain embodiments, the level of IFNAR1 RNA or protein can be reduced in cells or animals. In certain embodiments, the subject has Aicardi-Goutières syndrome. In certain embodiments, the subject has a disease or disorder associated with a mutation in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, or RNU7-1.

[0006] Also provided are methods for treating a disease or disorder associated with elevated type I interferon signaling, in certain embodiments, the disease or disorder is AGS, stroke, epilepsy, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, or ataxia telangiectasia. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" and other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.

[0008] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference in their entirety with respect to the portions of the documents discussed herein.

[0009] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0010] Unless otherwise stated, the following terms have the following meanings.

[0011] As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside can include a modified nucleobase or an RNA nucleobase (uracil).

[0012] As used herein, "2'-MOE" refers to a 2'-O(CH) in place of the 2'-OH group of a furanosyl sugar moiety. 2 ) 2 OCH 3 A "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" refers to a 2'-O(CH) group in place of the 2'-OH group of a furanosyl sugar moiety. 2 ) 2 OCH 3 "MOE" refers to a sugar moiety having a 2'-MOE group. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0013] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0014] As used herein, "2'-OMe" refers to a 2'-OCH in place of the 2'-OH group of a furanosyl sugar moiety. 3 A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. 3 Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0015] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0016] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D ribosyl stereochemical configuration.

[0017] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F sugar moiety.

[0018] As used herein, "2'-NMA" refers to a 2'-OCH in place of the 2'-OH of a furanosyl sugar moiety. 2 C(=O)-N(H)CH 3 A "2-NMA sugar moiety" or a "2'-O-[2-(methylamino)-2-oxoethyl] sugar moiety" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. 2 C(=O)-N(H)CH 3 "saccharide moiety" means a sugar moiety having a group.

[0019] "2'-NMA sugar moiety" means the sugar moiety of a 2'-NMA nucleoside.

[0020] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0021] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0022] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0023] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0024] As used herein, "abasic sugar moiety" refers to the sugar portion of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0025] As used herein, "improve" in relation to treatment refers to an improvement in at least one symptom or characteristic compared to the same symptom or characteristic without treatment.In certain embodiments, improvement is a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or progression of the severity or frequency of a symptom or characteristic.In certain embodiments, the symptom or characteristic is one or more of epilepsy, feeding difficulties, dystonia, spasticity, motor development delay, language development delay, social skills development delay, white matter abnormality, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and cerebellar myelopathy.In certain embodiments, the characteristic is the level of IFNa or lymphocytosis in the cerebrospinal fluid of the subject.

[0026] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where a second ring is formed via a bridge that connects two of the atoms of the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety. Examples of bicyclic sugar moieties include LNA (locked nucleic acid) sugar moieties and cEt sugar moieties, as defined herein. A "bicyclic nucleoside" is a nucleoside that includes a bicyclic sugar moiety.

[0027] As used herein, "chiral enrichment" in relation to a population refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom as defined herein. A chiral enrichment population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is an oligomeric compound that includes a modified oligonucleotide. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesyl phosphoramidate internucleoside linkage.

[0028] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0029] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0030] As used herein, "complementary" in relation to an oligonucleotide means that when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of the oligonucleotide and the nucleobases of the other nucleic acid or one or more regions thereof can hydrogen bond with each other. "Complementary region" in relation to a region of an oligonucleotide means that when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of the region and the nucleobases of the other nucleic acid or one or more regions thereof can hydrogen bond with each other. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art and are not considered as complementary nucleobases as defined herein unless otherwise indicated.For example, inosine can pair with adenosine, cytosine, or uracil, but is not considered to be complementary thereto.Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside.Rather, some mismatches are allowed.As used herein, "fully complementary" or "100% complementary" in relation to oligonucleotides means that an oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleobase of said oligonucleotide.

[0031] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that joins the conjugate moiety to the oligonucleotide.

[0032] As used herein, "conjugate linker" means a single bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0033] As used herein, "conjugate moiety" means a covalently attached grouping of atoms that modifies one or more molecular properties, including but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance, compared to the same molecule lacking the conjugate moiety.

[0034] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH 3 )-O-2', and the methyl group of the bridge has the S configuration.

[0035] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0036] As used herein, "deoxy region" refers to a region of 5 to 12 contiguous nucleotides in which at least 70% of the nucleosides contain a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region is the gap of a gapmer.

[0037] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is suitable for reducing the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent.

[0038] As used herein, an "internucleoside linkage" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, a "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage.

[0039] As used herein, "linked nucleosides" are nucleosides that are joined in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0040] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0041] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned.

[0042] As used herein, "motif" refers to a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0043] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety.

[0044] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0045] As used herein, "nucleobase" refers to unmodified or modified nucleobase. Nucleobase is a heterocyclic moiety. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0046] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0047] As used herein, "nucleoside" means a compound or fragment of a compound that includes a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0048] As used herein, "oligomeric agent" refers to an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single stranded oligomeric compound or an oligomeric duplex formed by two complementary oligomeric compounds.

[0049] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0050] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.

[0051] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0052] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to an animal. Certain such carriers allow the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharma- ceutical acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0053] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0054] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0055] As used herein, "prodrug" refers to a first form of a therapeutic agent that is converted to a second form in an animal or in a cell thereof outside the body. Typically, the conversion of the prodrug in the animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0056] As used herein, "stabilizing phosphate group" refers to a 5'-chemical moiety that provides stabilization of the 5'-phosphate portion of the 5'-terminal nucleoside of an oligonucleotide under biological conditions, compared to the stability of the unmodified 5'-phosphate of the unmodified nucleoside. Such stabilization of the 5'-phosphate group includes, but is not limited to, resistance to removal by phosphatases. Stabilizing phosphate groups include, but are not limited to, 5'-vinyl phosphonate and 5'-cyclopropyl phosphonate.

[0057] As used herein, "standard cell assay" refers to the assays described in Examples 1 and 2, as well as reasonable variations thereof.

[0058] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis with respect to a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules that includes a stereorandom chiral center, the number of molecules that have a stereorandom chiral center in the (S) configuration may be the same as the number of molecules that have a stereorandom chiral center in the (R) configuration, but is not necessarily the same ("racemic"). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates as a result of synthesis, for example, by the action of a non-chiral reagent adjacent to the adjacent sugar moiety of enriched stereochemistry. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0059] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0060] As used herein, "sugar surrogate" refers to a modified sugar moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide, but is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides, including sugar surrogates, can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluorohexitol nucleic acid), morpholino, and other structures described herein and known in the art.

[0061] As used herein, "symptoms or characteristics" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptoms are evident to the subject or a medical professional examining or testing such a subject. In certain embodiments, the characteristics are evident by invasive diagnostic testing, including but not limited to postmortem examination. In certain embodiments, the characteristics are evident by MRI scans of the brain.

[0062] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid to which an oligomeric compound is designed to act. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0063] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0064] As used herein, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0065] As used herein, "antisense activity" refers to any detectable and / or measurable change that can be attributed to the hybridization of an antisense compound to its target nucleic acid.In certain embodiments, antisense activity is the reduction in the amount or expression of target nucleic acid or the protein encoded by such target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of antisense compound.In certain embodiments, antisense activity is the regulation of splicing of target pre-mRNA.

[0066] As used herein, "antisense agent" means an antisense compound and optionally one or more additional features, such as a sense compound.

[0067] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0068] As used herein, "sense compound" means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0069] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises the oligonucleotide portion of an antisense compound that can hybridize to a target nucleic acid and has at least one antisense activity.Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0070] As used herein, "sense oligonucleotide" means an oligonucleotide that includes an oligonucleotide portion of a sense compound that is capable of hybridizing to an antisense oligonucleotide.

[0071] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region disposed between an external region having one or more nucleosides, the nucleosides comprising the internal region being chemically distinct from the nucleoside(s) comprising the external region, and the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing". In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides of the internal region, counted from the 5' end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, the internal region is a deoxy region. In certain embodiments, each nucleoside of the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides of the gap being 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0072] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a specific cell type(s).

[0073] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0074] As used herein, "RNAi agent" refers to an antisense agent that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNase H.

[0075] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single stranded. In certain embodiments, the RNase H agent is double stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily through RISC / Ago2.

[0076] As used herein, "treating" refers to improving a disease or condition of a subject by administering an oligomeric agent or oligomeric compound described herein.In certain embodiments, treating a subject improves symptoms compared to the same symptoms without treatment.In certain embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, delays the progression of symptoms, or reduces the severity or frequency of symptoms.

[0077] As used herein, a "therapeutically effective amount" refers to an amount of an agent or composition that confers a therapeutic effect on an animal, e.g., a therapeutically effective amount ameliorates a symptom of a disease.

[0078] Specific Embodiments Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of an IFNAR1 nucleic acid, and said modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0079] Embodiment 2. The oligomeric compound of embodiment 1, wherein said IFNAR1 nucleic acid has the nucleobase sequence of either SEQ ID NO:1 or SEQ ID NO:2.

[0080] Embodiment 3. The nucleic acid base sequence of the modified oligonucleotide is any one of nucleic acid bases 5085 to 5133, 19997 to 20061, 20076 to 20133, 20528 to 20616, 22294 to 22329, 22453 to 22476, 22595 to 22626, 25530 to 25565, 25606 to 25652, 25710 to 25720, and 25730 to 25740 of SEQ ID NO: 1. 31072-31096, 31792-31837, 32353-32386, or 35016-35042.

[0081] Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an isometric portion within nucleobases 20003-20022, 20104-20123, 20591-20610, 22455-22474, 22456-22475, or 29981-30000 of SEQ ID NO:1.

[0082] Embodiment 5. The oligomeric compound of any of embodiments 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the IFNAR1 nucleic acid.

[0083] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12 to 2687, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0084] Embodiment 7. The oligomeric compound of embodiment 6, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 12-2687.

[0085] Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 12 to 2687.

[0086] Embodiment 9. The oligomeric compound of any of embodiments 6-8, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-89.

[0087] Embodiment 10. The oligomeric compound of any of embodiments 6-8, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 90-2687.

[0088] Embodiment 11. The oligomeric compound of any of embodiments 6-8, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0089] Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide consists of 20 to 80 linked nucleosides and the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0090] Embodiment 13. The oligomeric compound of embodiment 12, wherein said modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0091] Embodiment 14. The oligomeric compound of any of embodiments 6 to 12, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an IFNAR1 nucleic acid, and the IFNAR1 nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0092] Embodiment 15. The modified oligonucleotide is 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 17-50, 17-40, 17-50, 17-60, 17-70, 17-80, 17-90, 17-100, 17-110, 17-120, 17-130, 17-140, 17-150, 17-20, 17-25, 17-30, 17-50, 17-20, 17-31, 17-32, 17-33, 17-34, 17-35, 17-45, 17-46, 17-47, 17-48, 17-50, 17-51, 17-52, 17-53, 17-64, 17-65, 17-70, 17-80, 17-90, 17-160, 17-170, 17-180, 17-190, 17-210, 17-220, 17-23 15. The oligomeric compound according to any one of the preceding embodiments, comprising from 1 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0093] Embodiment 16. The oligomeric compound according to any one of embodiments 1 to 14, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0094] Embodiment 17. The oligomeric compound of any one of embodiments 1 to 16, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0095] Embodiment 18 The oligomeric compound of embodiment 17, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0096] Embodiment 19. The bicyclic sugar moiety is -O-CH 2 - and -O-CH(CH 3 20. The oligomeric compound of embodiment 18, comprising a 2'-4' bridge selected from:

[0097] Embodiment 20 The oligomeric compound of embodiment 17, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0098] Embodiment 21 The oligomeric compound of embodiment 20, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0099] Embodiment 22. The oligomeric compound of any one of embodiments 1 to 21, wherein at least one nucleoside of said modified oligonucleotide compound comprises a sugar surrogate.

[0100] Embodiment 23. The oligomeric compound according to any one of embodiments 1 to 22, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0101] Embodiment 24. The oligomeric compound according to embodiment 23, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0102] Embodiment 25 The oligomeric compound of embodiment 22 or embodiment 23, wherein each internucleoside linkage is a modified internucleoside linkage.

[0103] Embodiment 26 The oligomeric compound according to embodiment 25, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0104] Embodiment 27. The oligomeric compound according to any of embodiments 22 to 25, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

[0105] Embodiment 28. The oligomeric compound of any of embodiments 1-23, wherein each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0106] Embodiment 29. The oligomeric compound of any of embodiments 1-26 or 28, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

[0107] Embodiment 30. The modified oligonucleotide is: ssssssssssssssss, sooooossssssssssssooss, soooosssssssssssss, sooossssssssssss, sooossssssssssss, soosssssssssssss, soossossssssssss, soossossssssss ssooss, sossssssssssssssooss, ssoossssssssssooss, sssoosssssssssssooss, ssssosss sssssssooss, sooooosssssssssssoss, soooossssssssssssoss, soooossssssssssssoss, sooo 24. The oligomeric compound of embodiment 23, comprising an internucleoside linkage motif (5' to 3') selected from sssssssssssssss, soosoosssssssssssss, soossossssssssssss, soossssssssssssss, sossooossssssssssss, sosssosssssssssss, ssoooosssssssssss, sssooosssssssssss, and ssssoosssssssssssss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0108] Embodiment 31 The oligomeric compound according to any one of embodiments 1 to 30, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0109] Embodiment 32 The oligomeric compound of embodiment 31, wherein the modified nucleobase is 5-methylcytosine.

[0110] Embodiment 33 The oligomeric compound of embodiment 32, wherein each cytosine is a 5-methylcytosine.

[0111] Embodiment 34 The oligomeric compound of any one of embodiments 1 to 33, wherein the modified oligonucleotide comprises a deoxy region.

[0112] Embodiment 35 The oligomeric compound of embodiment 34, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.

[0113] Embodiment 36. The oligomeric compound of embodiment 34 or embodiment 35, wherein the deoxy region consists of 6, 7, 8, 9, 10, or between 6 and 10 linked nucleosides.

[0114] Embodiment 37. The oligomeric compound of any of embodiments 34-36, wherein each nucleoside immediately adjacent to the deoxy region contains a modified sugar moiety.

[0115] 38. The deoxy region is arranged on the 5' side with a 5' exoregion consisting of 1 to 6 linked 5' exoregion nucleosides and on the 3' side with a 3' exoregion consisting of 1 to 6 linked 3' exoregion nucleosides; the 3'-most nucleoside of the 5' exoregion comprises a modified sugar moiety; and 38. The oligomeric compound of any of embodiments 34-37, wherein the 5'-most nucleoside of said 3' exoregion comprises a modified sugar moiety.

[0116] Embodiment 39 The oligomeric compound of embodiment 38, wherein each nucleoside of the 3' exogenous region comprises a modified sugar moiety.

[0117] Embodiment 40 The oligomeric compound of embodiment 38 or embodiment 39, wherein each nucleoside of the 5' external region comprises a modified sugar moiety.

[0118] Embodiment 41. The modified oligonucleotide comprises: a 5' exoregion consisting of five linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and having a 3' exoregion consisting of 5 linked nucleosides; The oligomeric compound of embodiment 40, wherein each of said 5' exoregion nucleosides and each of said 3' exoregion nucleosides is a 2'-MOE nucleoside.

[0119] Embodiment 42. The modified oligonucleotide comprises: a 5' exoregion consisting of six linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and having a 3' exon region consisting of four linked nucleosides; The oligomeric compound of embodiment 40, wherein each of said 5' exoregion nucleosides and each of said 3' exoregion nucleosides is a 2'-MOE nucleoside.

[0120] Embodiment 43. The modified oligonucleotide comprises: a 5' exoregion consisting of three linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and having a 3' exoregion consisting of three linked nucleosides; The oligomeric compound of embodiment 40, wherein each of said 5' exoregion nucleosides and each of said 3' exoregion nucleosides is a cEt nucleoside.

[0121] Embodiment 44. The modified oligonucleotide comprises: a 5' exon region consisting of 1 to 6 linked nucleosides; a deoxy region consisting of 6 to 10 linked nucleosides, and having a 3' exon region consisting of 1 to 6 linked nucleosides; The oligomeric compound of embodiment 40, wherein each of said 5' exoregion nucleosides and each of said 3' exoregion nucleosides is a cEt nucleoside or a 2'-MOE nucleoside and each of said deoxy region nucleosides is a 2'-β-D-deoxynucleoside.

[0122] Embodiment 45. The modified oligonucleotide comprises: a 5' exon region consisting of 3 to 6 linked nucleosides; a deoxy region consisting of 7-8 linked nucleosides, and A 3' exon region consisting of 3-6 linked nucleosides and having a glycomotif comprising Each of the 3' exoregion nucleosides is selected from a 2'-MOE nucleoside and a cEt nucleoside, and the 5' exoregion has the following formula: (Nk)n(Nd)(Nx) wherein each Nk is a bicyclic nucleoside, Nx is a 2'-OMe nucleoside, Nd is a 2'-β-D-deoxynucleoside, and n is 1 to 4.

[0123] Embodiment 46. The oligomeric compound of any of embodiments 1-38, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety.

[0124] Embodiment 47. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: m C es T eo T eo Teo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (SEQ ID NO: 2668), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0125] Embodiment 48. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m C e (SEQ ID NO: 2040), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0126] Embodiment 49. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (SEQ ID NO: 2670), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0127] Embodiment 50. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 2679), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0128] Embodiment 51. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m Cds T ds T eo m C es m C es T e (SEQ ID NO: 2625), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0129] Embodiment 52. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO: 1317), where A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0130] Embodiment 53. An oligomeric compound according to any one of embodiments 1 to 52, comprising the modified oligonucleotide.

[0131] Embodiment 54. An oligomeric compound according to any one of embodiments 1 to 52, comprising a conjugate group.

[0132] Embodiment 55. The oligomeric compound of embodiment 54, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0133] Embodiment 56 The oligomeric compound according to embodiment 54 or embodiment 55, wherein the conjugate linker consists of a single bond.

[0134] Embodiment 57. The oligomeric compound according to any of embodiments 55 or 56, wherein said conjugate linker is cleavable.

[0135] Embodiment 58. The oligomeric compound according to any of embodiments 55 to 57, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0136] Embodiment 59. The oligomeric compound of any of embodiments 55-57, wherein said conjugate linker does not comprise any linker nucleosides.

[0137] Embodiment 60. The oligomeric compound of any of embodiments 54-59, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0138] Embodiment 61. The oligomeric compound of any of embodiments 54-59, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0139] Embodiment 62. The oligomeric compound of any one of embodiments 1 to 61, comprising a terminal group.

[0140] Embodiment 63 The oligomeric compound of embodiment 62, wherein the terminal group is an abasic sugar moiety.

[0141] Embodiment 64. An oligomeric compound according to any one of embodiments 1 to 62, which is a single-stranded oligomeric compound.

[0142] Embodiment 65. A compound having the following chemical structure:

[0143] [ka]

[0144] A modified oligonucleotide according to (SEQ ID NO: 2668), or a salt thereof.

[0145] Embodiment 66 The modified oligonucleotide of embodiment 65, which is a sodium or potassium salt.

[0146] Embodiment 67. A compound having the following chemical structure:

[0147] [ka]

[0148] A modified oligonucleotide according to (SEQ ID NO: 2668).

[0149] Embodiment 68. The following chemical structure:

[0150] [ka]

[0151] A modified oligonucleotide according to (SEQ ID NO: 2040), or a salt thereof.

[0152] Embodiment 69. The modified oligonucleotide of embodiment 68, which is a sodium or potassium salt.

[0153] Embodiment 70. The following chemical structure:

[0154] [ka]

[0155] A modified oligonucleotide according to (SEQ ID NO: 2040).

[0156] Embodiment 71. The following chemical structure:

[0157] [ka]

[0158] A modified oligonucleotide according to (SEQ ID NO: 2670), or a salt thereof.

[0159] Embodiment 72. The modified oligonucleotide of embodiment 71, which is a sodium or potassium salt.

[0160] Embodiment 73. The following chemical structure:

[0161] [ka]

[0162] A modified oligonucleotide according to (SEQ ID NO: 2670).

[0163] Embodiment 74. The following chemical structure:

[0164] [ka]

[0165] A modified oligonucleotide according to (SEQ ID NO: 2679), or a salt thereof.

[0166] Embodiment 75. The modified oligonucleotide of embodiment 74, which is a sodium or potassium salt.

[0167] Embodiment 76. A compound having the following chemical structure:

[0168] [ka]

[0169] A modified oligonucleotide according to (SEQ ID NO: 2679).

[0170] Embodiment 77. The following chemical structure:

[0171] [ka]

[0172] A modified oligonucleotide according to (SEQ ID NO: 2625), or a salt thereof.

[0173] Embodiment 78. The modified oligonucleotide of embodiment 77, which is a sodium or potassium salt.

[0174] Embodiment 79. The following chemical structure:

[0175] [ka]

[0176] A modified oligonucleotide according to (SEQ ID NO: 2625).

[0177] Embodiment 80. The following chemical structure:

[0178] [ka]

[0179] A modified oligonucleotide according to (SEQ ID NO: 1317), or a salt thereof.

[0180] Embodiment 81. The modified oligonucleotide of embodiment 80, which is a sodium or potassium salt.

[0181] Embodiment 82. The following chemical structure:

[0182] [ka]

[0183] A modified oligonucleotide according to (SEQ ID NO: 1317).

[0184] Embodiment 83. A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 64 or a chirally enriched population of modified oligonucleotides according to any one of embodiments 65 to 82, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0185] Embodiment 84. The chirally enriched population of embodiment 83, which is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

[0186] Embodiment 85. The chirally enriched population of embodiment 83, which is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0187] Embodiment 86. The chirally enriched population of embodiment 83, which is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0188] Embodiment 87. The chirally enriched population of embodiment 83, which is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp configuration, the Sp configuration, and the Rp configuration.

[0189] Embodiment 88. A population of oligomeric compounds according to any one of embodiments 1 to 64, or a population of modified oligonucleotides according to any one of embodiments 65 to 82, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0190] Embodiment 89. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide, and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound described in any one of embodiments 1-64.

[0191] Embodiment 90. The oligomeric duplex of embodiment 89, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0192] Embodiment 91 The oligomeric duplex of embodiment 89 or embodiment 90, wherein the first modified oligonucleotide comprises a 5'-stabilizing phosphate group.

[0193] Embodiment 92 The oligomeric duplex of embodiment 91, wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0194] Embodiment 93 The oligomeric duplex of any of embodiments 89-92, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.

[0195] Embodiment 94 The oligomeric duplex of any of embodiments 89-92, wherein the first modified oligonucleotide comprises a 2'-NMA sugar moiety.

[0196] Embodiment 95 The oligomeric duplex of any of embodiments 89-94, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0197] Embodiment 96 The oligomeric duplex of embodiment 95, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0198] Embodiment 97. The bicyclic sugar moiety of the second modified oligonucleotide is -O-CH 2 - and -O-CH(CH 3 97. The oligomeric duplex of embodiment 96, comprising a 2'-4' bridge selected from:

[0199] Embodiment 98 The oligomeric duplex of embodiment 95, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0200] Embodiment 99. The oligomeric duplex of embodiment 98, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0201] Embodiment 100. The oligomeric duplex of any of embodiments 89-99, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

[0202] Embodiment 101. The oligomeric duplex of any of embodiments 89-100, wherein at least one internucleoside linkage of said second modified oligonucleotide is a modified internucleoside linkage.

[0203] Embodiment 102. The oligomeric duplex of embodiment 101, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0204] Embodiment 103. The oligomeric duplex of any of embodiments 89-102, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

[0205] Embodiment 104. The oligomeric duplex of any of embodiments 89-101 or 103, wherein each internucleoside linkage of the second modified oligonucleotide is independently a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0206] Embodiment 105. The oligomeric duplex of any of embodiments 89 to 104, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0207] Embodiment 106 The oligomeric duplex of embodiment 105, wherein the modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

[0208] Embodiment 107. The oligomeric duplex of any of embodiments 89-106, wherein the second modified oligonucleotide comprises a conjugate group.

[0209] Embodiment 108. The oligomeric duplex of embodiment 107, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0210] Embodiment 109. The oligomeric duplex of embodiment 107 or embodiment 108, wherein the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide.

[0211] Embodiment 110. The oligomeric duplex of embodiment 107 or embodiment 108, wherein the conjugate group is attached to the second modified oligonucleotide at the 3' end of the second modified oligonucleotide.

[0212] Embodiment 111 The oligomeric duplex of any one of embodiments 107-110, wherein the conjugate group comprises a lipid.

[0213] Embodiment 112. The oligomeric duplex of any of embodiments 107-111, wherein the second modified oligonucleotide comprises a terminal group.

[0214] Embodiment 113 The oligomeric duplex of embodiment 112, wherein the terminal group is an abasic sugar moiety.

[0215] Embodiment 114. The second modified oligonucleotide is selected from the group consisting of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 1 114. The oligomeric duplex of any of embodiments 89-113, consisting of 7-30, 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0216] Embodiment 115. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound as described in any one of embodiments 1 to 64 or a modified oligonucleotide as described in any one of embodiments 65 to 82.

[0217] Embodiment 116. The antisense agent of embodiment 115, which is an oligomeric duplex of any of embodiments 89 to 114.

[0218] Embodiment 117. An antisense agent according to embodiment 115 or embodiment 116, i. an RNase H agent capable of reducing the amount of IFNAR1 nucleic acid by activating RNase H, or ii. RNAi agents capable of reducing the amount of IFNAR1 nucleic acid by activating RISC / Ago2 The antisense agent,

[0219] Embodiment 118. An antisense agent according to any one of embodiments 115 to 117, comprising a conjugate group, wherein the conjugate group comprises a cell targeting moiety.

[0220] Embodiment 119. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 64, a modified oligonucleotide according to any one of embodiments 65 to 82, a population according to any one of embodiments 83 to 88, an oligomeric duplex according to any one of embodiments 89 to 114, or an antisense agent according to any one of embodiments 115 to 118, and a pharma- ceutically acceptable diluent or carrier.

[0221] Embodiment 120. The pharmaceutical composition of embodiment 119, wherein the pharma- ceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0222] Embodiment 121. The pharmaceutical composition of embodiment 120, consisting essentially of said oligomeric compound, said modified oligonucleotide, said population, said oligomeric duplex, or said antisense agent, and said phosphate buffered saline or said artificial cerebrospinal fluid.

[0223] Embodiment 122. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 64, a modified oligonucleotide according to any one of embodiments 65 to 82, a population according to any one of embodiments 83 to 88, an oligomeric duplex according to any one of embodiments 89 to 114, an antisense agent according to any one of embodiments 115 to 118, or a pharmaceutical composition according to any one of embodiments 119 to 121.

[0224] Embodiment 123. A method for treating a disease associated with type I interferon signaling, comprising administering a therapeutically effective amount of an oligomeric compound according to any of embodiments 1-64, a modified oligonucleotide according to any of embodiments 65-82, a population according to any of embodiments 83-88, an oligomeric duplex according to any of embodiments 89-114, an antisense agent according to any of embodiments 115-118, or a pharmaceutical composition according to any of embodiments 119-121 to a subject having a disease associated with type I interferon signaling, thereby treating the disease associated with type I interferon signaling.

[0225] Embodiment 124. The method of embodiment 123, wherein the disease associated with type I interferon signaling is Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, or ataxia telangiectasia.

[0226] Embodiment 125. The method of embodiment 123 or embodiment 124, wherein the disease is associated with elevated levels of interferon alpha.

[0227] Embodiment 126. The method of any one of embodiments 122 to 125, wherein the subject has a mutation in a gene selected from TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, and RNU7-1.

[0228] Embodiment 127. The method of any one of embodiments 123 to 126, wherein administration of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition reduces seizures, dystonia, spasticity, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, or cerebellar myelopathy, or improves intake, motor development, language development, or social skills development in the subject.

[0229] Embodiment 128. The method of any of embodiments 123-127, wherein administration of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition reduces interferon alpha and / or lymphocytosis in cerebrospinal fluid of the subject.

[0230] Embodiment 129. The method of any one of embodiments 122 to 128, wherein the subject is a human.

[0231] Embodiment 130. A method for reducing expression of IFNAR1 in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 64, a modified oligonucleotide according to any one of embodiments 65 to 82, a population according to any one of embodiments 83 to 88, an oligomeric duplex according to any one of embodiments 89 to 114, an antisense agent according to any one of embodiments 115 to 118, or a pharmaceutical composition according to any one of embodiments 119 to 121.

[0232] Embodiment 131 The method of embodiment 130, wherein the cell is a neuron or a glial cell, and optionally, the cell is an astrocyte or a microglial cell.

[0233] Embodiment 132 The method of embodiment 130 or embodiment 131, wherein the cell is a human cell.

[0234] Embodiment 133. Use of an oligomeric compound according to any one of embodiments 1 to 64, a modified oligonucleotide according to any one of embodiments 65 to 82, a population according to any one of embodiments 83 to 88, an oligomeric duplex according to any one of embodiments 89 to 114, an antisense agent according to any one of embodiments 115 to 118, or a pharmaceutical composition according to any one of embodiments 119 to 121 for treating a disease associated with type I interferon signaling.

[0235] Embodiment 134. Use of an oligomeric compound according to any one of embodiments 1 to 64, a modified oligonucleotide according to any one of embodiments 65 to 82, a population according to any one of embodiments 83 to 88, an oligomeric duplex according to any one of embodiments 89 to 114, an antisense agent according to any one of embodiments 115 to 118, or a pharmaceutical composition according to any one of embodiments 119 to 121 in the manufacture of a medicament for treating a disease associated with type I interferon signaling.

[0236] Embodiment 135. The use according to embodiment 133 or embodiment 134, wherein the disease is associated with elevated levels of interferon alpha.

[0237] Embodiment 136. The use according to any of embodiments 133 to 135, wherein the disease associated with type I interferon signaling is Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, or ataxia telangiectasia.

[0238] Certain Oligomeric Agents and Compounds In certain embodiments, oligomeric agents are provided that target IFNAR1 nucleic acid.In certain embodiments, the IFNAR1 nucleic acid has the sequence shown in GENBANK Accession No. NC_000021.9, truncated from 33321001 to 33363000 (SEQ ID NO: 1) or GENBANK Accession No. NM_000629.2 (SEQ ID NO: 2), each of which is incorporated by reference in its entirety.In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound.In certain embodiments, the oligomeric agent is an oligomeric duplex.

[0239] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, the nucleobase sequence of the modified oligonucleotide being at least 80% complementary to an equal length portion of an IFNAR1 nucleic acid, the modified oligonucleotide having at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the IFNAR1 nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the IFNAR1 nucleic acid.

[0240] In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises nucleobases 3964-3983, 4050-4069, 4573-4592, 4574-4593, 4600-4619, 4601-4620, 4603-4622, 4606-4625, 4619-4638, 4620-4639, 4681-4700, 4716-4735, 4717-4736, 4724-4743, 4725-4744, 4731-4750, 4732-4751, 4733-4752, 4740-4759, 4744-4763, 4771-4772, 4773-4774, 4775-4776, 4777-4778, 4779-4781, 4782-4782, 4783-4783, 4784-4784, 4785-4785, 4786-4786, 4787-4787, 4788-4789, 4790-4791, 4792-4793, 4794-4795, 4796-4796, 4798-4797, 4799-4800, 4801-4802, 4803-4804, 4805-4806, 4806-4808, 4809-4810, 4811-4811, 481 4790, 4772~4791, 4773~4792, 4786~4805, 4788~4807, 4797~4816, 4798~4817, 4801~4820, 4808~4827, 4812~4831, 4814~4833, 4815~4834, 4823~4838 , 4825~4844, 4827~4846, 4841~4860, 4846~4865, 4847~4866, 4862~4881, 4875~4894, 4888~4907, 4889~4908, 4905~4924, 4906~4925, 4942~4961, 495 2~4971, 4957~4976, 4958~4977, 5035~5054, 5036~5055, 5061~5080, 5082~5101, 5083~5102, 5084~5103, 5085~5104, 5086~5101, 5086~5105, 5087~51 02, 5087~5106, 5089~5104, 5089~5108, 5090~5105, 5096~5115, 5113~5132, 5114~5133, 5137~5156, 5142~5161, 5147~5162, 5166~5185, 5179~5198, 5 181~5200, 5182~5201, 5183~5202, 5519~5538, 5532~5551, 5533~5552, 5537~5556, 5546~5565, 5598~5617, 5599~5618, 5600~5619, 5637~5656, 5653~ 5672, 5657~5676, 5669~5688, 5673~5692, 5701~5720, 5702~5721, 5703~5722, 5709~5728, 5755~5774, 5757~5776, 5761~5780, 5850~5869, 5878~5897,5901~5920、5902~5921、5904~5923、5907~5926、5910~5929、5915~5934、5916~5935、5917~5936、5920~5939、5921~5940、5922~5941、5923~5942、5924~5943、5931~5950、5934~5953、5935~5954、5955~5974、5984~6003、5985~6004、6028~6047、6033~6052、6035~6054、6051~6070、6052~6071、6090~6109、6111~6130、6112~6131、6113~6132、6145~6164、6170~6189、6171~6190、6195~6214、6203~6222、6204~6223、6206~6225、6207~6226、6237~6256、6264~6283、6279~6298、6306~6325、6357~6376、6361~6380、6407~6426、6408~6427、6409~6428、6412~6431、6420~6439、6425~6444、6481~6500、6482~6501、6512~6527、6672~6691、6674~6689、6710~6729、6734~6753、6749~6768、6759~6778、6760~6779、6831~6850、6835~6854、6838~6857、6916~6935、6919~6938、6921~6940、6926~6945、6935~6954、6936~6955、6941~6960、6945~6964、7211~7230、7230~7249、7234~7253、7237~7256、7307~7326、7310~7329、7311~7330、7312~7331、7315~7334、7331~7350、7437~7456、7438~7457、7443~7462、7458~7477、7526~7545、7528~7547、7543~7562、7545~7564、7569~7588、7570~7589、7585~7604、7588~7607、7589~7608、7590~7609、7591~7610、7592~7607、7592~7611、7593~7608、7593~7612、7595~7610、7595~7614、7596~7611、7602~7621、7614~7633、7617~7636、7618~7637、7619~7638、7639~7658、7640~7659、7644~7663、7649~7664、7661~7680、7662~7681、7663~7682、7665~7684、7667~7686、7668~7687、7681~7700、7683~7702、7684~7703、7685~7704、7747~7766、7771~7790、7772~7791、7773~7792、7774~7793、7775~7794、7777~7796、7778~7797、7781~7800、7782~7801、7784~7803、7785~7804、7787~7806、7788~7807、7790~7809、7803~7822、7805~7824、7806~7825、7831~7850、7867~7882、7931~7950、7957~7976、7978~7997、7979~7998、7980~7999、8144~8163、8196~8215、8210~8229、8211~8230、8226~8245、8227~8246、8231~8250、8232~8251、8261~8280、8271~8286、8300~8319、8301~8320、8310~8329、8324~8343、8325~8344、8339~8358、8343~8362、8347~8366、8351~8370、8356~8375、8357~8376、8359~8378、8360~8379、8361~8380、8362~8381、8364~8383、8366~8385、8368~8387、8369~8388、8383~8402、8387~8406、8388~8407、8391~8410、8392~8411、8393~8412、8394~8413、8398~8417、8408~8427、8409~8428、8421~8440、8425~8444、8428~8447、8429~8448、8433~8452、8443~8462、8444~8463、8524~8543、8549~8568、8550~8569、8551~8570、8584~8603、8624~8643、8626~8645、8627~8646、8629~8648、8630~8649、8631~8650、8632~8651、8636~8655、8637~8656、8652~8671、8653~8672、8656~8675、8657~8676、8659~8678、8660~8679、8661~8680、8682~8701、8698~8717、8716~8735、8717~8736、8721~8740、8722~8741、8724~8743、8731~8750、8733~8752、8748~8767、8761~8780、8762~8781、8763~8782、8764~8783、8765~8784、8770~8789、8776~8795、8777~8796、8778~8797、8782~8801、8791~8806、8791~8810、8792~8811、8793~8808、8793~8812、8794~8809、8794~8813、8795~8810、8795~8814、8807~8826、8808~8827、8809~8828、8822~8841、8831~8850、8834~8853、8835~8854、8836~8855、8857~8876、8938~8957、8939~8958、8957~8972、8980~8999、9021~9040、9022~9041、9025~9044、9026~9041、9026~9045、9038~9057、9156~9175、9164~9183、9204~9223、9205~9224、9252~9271、9253~9272、9254~9273、9255~9274、9257~9276、9319~9338、9329~9348、9374~9393、9375~9394、9376~9395、9377~9396、9379~9398、9388~9407、9393~9412、9394~9413、9414~9433、9416~9435、9419~9438、9421~9440、9422~9441、9423~9442、9425~9444、9446~9465、9467~9486、9469~9488、9499~9518、9557~9576、9560~9579、9561~9580、9563~9582、9564~9583、9566~9585、9567~9586、9568~9587、9569~9588、9570~9589、9571~9590、9578~9597、9579~9598、9667~9686、9668~9687、9676~9695、9677~9696、9685~9704、9707~9726、9713~9732、9714~9733、9715~9734、9740~9759、9741~9760、9742~9761、9743~9762、9744~9763、9748~9767、9805~9824、9806~9825、9817~9836、9896~9915、10107~10126、10137~10156、10150~10169、10270~10289、10274~10293、10420~10439、10421~10440、10628~10647、10635~10654、10691~10710、10700~10719、10702~10721、10704~10723、10705~10724、10779~10798、10780~10799、11007~11026、11008~11027、11009~11028、11016~11035、11067~11086、11127~11146、11168~11187、11170~11189、11173~11192、11174~11193、11175~11194、11288~11307、11378~11397、11379~11398、11394~11413、11411~11430、11412~11431、11413~11432、11415~11434、11417~11436、11421~11440、11422~11441、11423~11442、11424~11443、11426~11445、11429~11448、11495~11514、11496~11515、11520~11539、11521~11540、11522~11541、11548~11567、11549~11568、11552~11571、11572~11591、11574~11593、11610~11629、11614~11633、11666~11685、11667~11686、11669~11688、11698~11717、11706~11725、11752~11771、11799~11818、11812~11831、11816~11835、11817~11836、11818~11837、11847~11866、11853~11872、11855~11870、11882~11897、11883~11902、11895~11914、11896~11915、11897~11916、11899~11918、11900~11919、11901~、 11920、11903~11922、11904~11923、11906~11925、11910~11929、11911~11930、11915~11930、11960~11979、11964~11983、11965~11984、11999~12018、12025~12044、12046~12065、12085~12104、12086~12105、12100~12119、12148~12167、12180~12199、12181~12200、12185~12204、12187~12206、12189~12204、12189~12208、12191~12210、12212~12227、12245~12264、12247~12266、12248~12267、12250~12269、12309~12324、12310~12325、12311~12326、12313~12332、12314~12333、12315~12334、12347~12366、12350~12369、12355~12374、12377~12396、12381~12400、12385~12404、12386~12405、12387~12406、12426~12445、12427~12446、12432~12451、12433~12452、12471~12490、12472~12491、12479~12498、12482~12501、12487~12506、12498~12517、12499~12518、12500~12519、12502~12521、12503~12522、12504~12523、12573~12592、12575~12594、12576~12595、12577~12596、12968~12987、12969~12988、13011~13030、13034~13053、13177~13196、13178~13197、13213~13232、13215~13234、13217~13236、13220~13239、13337~13356、13338~13357、13339~13358、13367~13386、13413~13432、13414~13433、13427~13446、13428~13447、13429~13448、13430~13449、13431~13450、13461~13480、13490~13509、13491~13510、13492~13511、13493~13512、13496~13515、13497~13516、13498~13517、13499~13518、13500~13519、13505~13524、13510~13529、13511~13530、13532~13551、13557~13576、13567~13586、13568~13587、13569~13588、13570~13589、13580~13599、13581~13600、13582~13601、13586~13605、13587~13606、13589~13608、13590~13609、13591~13610、13608~13627、13644~13663、13645~13664、13663~13682、13718~13737、13725~13744、13727~13746、13728~13747、13729~13748、13736~13755、13737~13756、13738~13757、13740~13759、13743~13762、13754~13773、13755~13774、13776~13795、13818~13837、13819~13838、13820~13839、13830~13849、13832~13851、13845~13864、13864~13883、13865~13884、13878~13897、13911~13930、13913~13932、13921~13940、13924~13943、13954~13973、13974~13993、14016~14035、14017~14036、14018~14037、14019~14038、14020~14039、14021~14040、14023~14042、14024~14043、14025~14044、14026~14045、14052~14071、14114~14133、14141~14160、14160~14179、14161~14180、14163~14182、14177~14196、14296~14315、14300~14319、14338~14357、14341~14360、14343~14362、14454~14469、14521~14540、14549~14568、14582~14601、14583~14602、14598~14617、14599~14618、14607~14626、14613~14632、14640~14659、14642~14661、14644~14663、14721~14740、14804~14819、14830~14849、14834~14853、14845~14864、14848~14867、15610~15629、15611~15630、15626~15645、15979~15998、16046~16065、16055~16074、16056~16075、16059~16078、16060~16079、16061~16080、16062~16081、16063~16082、16064~16083、16252~16271、16253~16272、16254~16273、16269~16288、16292~16311、16293~16312、16295~16314、16296~16315、16297~16316、16323~16342、16324~16343、16327~16346、16334~16353、16350~16369、16352~16371、16353~16372、16354~16373、16356~16375、16357~16376、16360~16379、16361~16380、16363~16382、16365~16384、16408~16427、16450~16469、16463~16482、16464~16483、16465~16484、16466~16485、16472~16491、16479~16498、16539~16558、16543~16558、16559~16578、16577~16596、16580~16599、16591~16610、16650~16669、16702~16721、16703~16722、16705~16724、16727~16746、16728~16747、16730~16749、16873~16892、16875~16894、16907~16926、16915~16934、16946~16965、16947~16966、16951~16970、16968~16987、16980~16999、16983~17002、17081~17100、17084~17103、17109~17128、17134~17153、17135~17154、17136~17155、17137~17156、17195~17214、17236~17255、17392~17411、17556~17575、17557~17576、17558~17577、17617~17636、17618~17637、17627~17646、17631~17650、17632~17651、17634~17653、17649~17668、17659~17678、17660~17679、17708~17727、18056~18075、18057~18076、18058~18077、18059~18078、18061~18080、18088~18107、18091~18110、18092~18111、18093~18112、18138~18157、18139~18158、18149~18168、18151~18170、18158~18177、18159~18178、18160~18179、18161~18180、18165~18184、18166~18185、18167~18186、18171~18190、18174~18193、18212~18231、18231~18250、18232~18251、18241~18260、18242~18261、18244~18263、18248~18267、18279~18298、18281~18300、18282~18301、18312~18331、18313~18332、18316~18335、18318~18337、18324~18343、18327~18346、18329~18348、18330~18349、18344~18363、18345~18364、18351~18370、18352~18371、18367~18386、18368~18387、18405~18424、18420~18439、18425~18444、18473~18492、18487~18506、18488~18507、18530~18549、18533~18552、18534~18553、18545~18564、18564~18583、18565~18584、18584~18603、18590~18609、18606~18625、18607~18626、18608~18627、18611~18630、18628~18647、18714~18733、19081~19100、19165~19184、19173~19192、19176~19195、19182~19201、19210~19229、19212~19231、19216~19235、19237~19256、19238~19257、19239~19258、19283~19302、19285~19304、19310~19329、19311~19330、19407~19426、19555~19574、19587~19606、19588~19607、19589~19608、19593~19612、19594~19613、19640~19659、19656~19671、19659~19674、19685~19704、19687~19706、19688~19707、19725~19744、19741~19760、19762~19781、19763~19782、19778~19797、19785~19804、19786~19805、19793~19812、19797~19816、19799~19818、19800~19819、19801~19820、19806~19825、19813~19832、19814~19833、19815~19834、19820~19839、19829~19844、19838~19857、19841~19860、19863~19882、19900~19919、19922~19941、19997~20016、19998~20017、19999~20018、20000~20019、20001~20020、20002~20021、20003~20022、20004~20023、20008~20027、20012~20031、20013~20032、20014~20033、20015~20034、20024~20043、20032~20051、20033~20052、20037~20052、20038~20057、20044~20059、20046~20061、20075~20094、20076~20095、20086~20105、20087~20106、20088~20107、20090~20109、20091~20110、20102~20121、20104~20123、20105~20124、20106~20125、20107~20126、20108~20127、20109~20128、20110~20129、20111~20130、20112~20131、20113~20132、 20114~20133、20135~20154、20137~20156、20138~20157、20165~20184、20166~20185、20167~20186、20169~20188、20171~20190、20172~20191、20176~20195、20192~20211、20203~20222、20207~20226、20240~20259、20250~20269、20255~20270、20300~20319、20342~20361、20388~20407、20389~20408、20390~20409、20416~20435、20479~20498、20485~20504、20487~20506、20489~20508、20491~20510、20492~20511、20493~20512、20495~20514、20496~20515、20497~20516、20498~20517、20499~20518、20500~20519、20501~20520、20503~20522、20505~20524、20506~20525、20508~20527、20517~20536、20528~20547、20538~20557、20539~20558、20587~20606、20588~20607、20589~20608、20590~20609、20591~20610、20592~20611、20593~20612、20594~20613、20595~20614、20596~20615、20597~20616、20638~20657、20639~20658、20653~20672、20658~20677、20996~21015、20999~21018、21010~21029、21012~21031、21014~21033、21034~21053、21049~21068、21050~21069、21051~21070、21053~21072、21070~21089、21083~21102、21085~21104、21106~21125、21107~21126、21108~21127、21112~21131、21113~21132、21115~21134、21116~21135、21124~21143、21125~21144、21126~21145、21405~21424、21952~21971、22057~22076、22187~22206、22191~22210、22201~22220、22202~22221、22203~22222、22206~22225、22207~22226、22217~22236、22218~22237、22219~22238、22222~22241、22223~22242、22237~22256、22238~22257、22249~22268、22288~22307、22294~22313、22299~22318、22300~22319、22308~22327、22309~22328、22310~22329、22342~22361、22347~22366、22348~22367、22358~22377、22363~22382、22364~22379、22365~22380、22386~22401、22391~22410、22411~22430、22413~22432、22420~22439、22424~22443、22425~22444、22426~22445、22436~22455、22437~22456、22438~22453、22446~22465、22447~22466、22448~22467、22449~22468、22450~22469、22451~22470、22452~22471、22453~22472、22454~22473、22455~22474、22456~22475、22457~22476、22458~22477、22468~22483、22469~22488、22470~22489、22479~22498、22495~22514、22496~22515、22521~22540、22522~22541、22524~22543、22525~22544、22526~22545、22527~22546、22532~22551、22533~22552、22541~22560、22542~22561、22559~22578、22560~22579、22565~22584、22595~22614、22597~22616、22598~22617、22599~22618、22603~22622、22611~22626、22633~22652、22638~22657、22656~22675、22657~22676、22669~22688、22673~22692、22675~22694、22699~22718、22701~22720、22723~22742、22746~22765、22747~22766、22748~22767、22768~22787、22773~22792、22803~22822、22804~22823、22805~22824、22806~22825、22808~22827、22819~22838、22832~22851、22843~22862、22856~22875、22857~22876、23134~23153、23174~23193、23175~23194、23224~23243、23231~23250、23267~23286、23269~23288、23326~23345、23327~23346、23328~23347、23329~23348、23330~23349、23336~23355、23374~23393、23462~23481、23677~23696、24115~24134、24150~24169、24153~24172、24154~24173、24197~24216、24198~24217、24200~24219、24201~24220、24236~24255、24237~24256、24240~24259、24241~24260、24243~24262、24245~24264、24268~24287、24269~24288、24287~24306、24299~24318、24303~24322、24304~24323、24305~24324、24306~24325、24307~24326、24309~24328、24310~24329、24311~24330、24312~24331、24313~24332、24314~24333、24315~24330、24315~24334、24316~24335、24318~24337、24319~24338、24320~24339、24341~24360、24353~24372、24355~24374、24370~24389、24371~24390、24388~24407、24389~24408、24394~24413、24395~24414、24454~24473、24525~24544、24529~24548、24579~24598、24580~24599、24585~24604、24586~24605、24587~24606、24588~24607、24589~24608、24605~24624、24621~24640、24622~24641、24623~24642、24630~24649、24633~24652、24646~24665、24651~24670、24698~24717、24728~24747、24729~24748、24731~24750、24766~24785、24782~24801、24783~24802、24790~24809、24795~24814、24796~24815、24797~24816、24798~24817、24799~24818、24801~24820、24812~24831、24813~24832、24814~24833、24816~24835、24818~24837、24821~24840、24824~24843、24831~24850、24832~24851、24835~24854、24838~24857、24839~24858、24840~24859、24841~24860、24844~24863、24845~24864、24846~24865、24848~24867、24863~24882、24864~24883、24865~24884、24866~24885、24867~24886、24873~24892、24878~24897、24885~24904、24893~24912、24894~24913、24913~24932、24915~24934、24917~24936、24918~24937、24921~24940、25004~25023、25018~25037、25019~25038、25021~25040、25022~25041、25026~25045、25095~25114、25096~25115、25111~25130、25115~25134、25116~25135、25117~25136、25119~25138、25133~25152、25136~25155、25137~25156、25138~25157、25139~25158、25141~25160、25143~25162、25144~25163、25145~25164、25146~25165、25148~25167、25149~25168、25150~25169、25152~25171、25153~25172、25154~25173、25155~25174、25157~25176、25158~25177、25159~25178、25160~25179、25161~25180、25162~25181、25163~25182、25164~25183、25165~25184、25168~25187、25169~25188、25170~25189、25171~25190、25174~25193、25177~25196、25180~25199、25181~25200、25182~25201、25183~25202、25186~25205、25187~25206、25188~25207、25189~25208、25190~25209、25191~25210、25196~25215、25197~25216、25198~25217、25200~25219、25203~25222、25204~25223、25205~25224、25206~25225、25207~25226、25211~25230、25212~25231、25213~25232、25214~25233、25215~25234、25217~25236、25218~25237、25219~25238、25220~25239、25222~25241、25223~25242、25224~25243、25226~25245、25227~25246、25228~25247、25230~25249、25232~25251、25233~25252、25235~25254、25238~25257、25239~25258、25247~25266、25253~25272、25255~25274、25256~25275、25257~25276、25258~25277、25261~25280、25262~25281、25263~25282、25264~25283、25265~25284、25273~25292、25279~25298、25280~25299、25289~25308、25293~25312、25295~25314、25296~25315、25297~25316、25298~25317、25299~25318、25309~25328、25318~25337、25327~25346、25328~25347、25332~25351、25334~25353、25335~、 25354、25336~25355、25337~25356、25338~25357、25341~25360、25342~25361、25343~25362、25344~25363、25345~25364、25346~25365、25347~25366、25350~25369、25351~25370、25352~25371、25353~25372、25385~25404、25388~25407、25389~25408、25390~25409、25391~25410、25392~25411、25393~25412、25394~25413、25402~25421、25403~25422、25408~25427、25409~25428、25413~25432、25424~25443、25429~25448、25430~25449、25477~25496、25499~25518、25500~25519、25522~25541、25525~25544、25526~25545、25527~25546、25528~25547、25529~25548、25530~25549、25531~25550、25532~25551、25533~25552、25534~25553、25535~25554、25536~25555、25542~25557、25543~25558、25546~25565、25548~25567、25550~25569、25551~25570、25554~25573、25556~25575、25558~25577、25560~25579、25561~25580、25564~25583、25565~25584、25568~25587、25590~25609、25591~25610、25606~25625、25617~25636、25618~25637、25619~25638、25620~25639、25621~25640、25622~25641、25623~25642、25624~25643、25625~25644、25628~25647、25629~25648、25630~25649、25633~25652、25659~25678、25660~25679、25661~25680、25662~25681、25664~25683、25666~25685、25690~25709、25691~25710、25692~25711、25694~25713、25695~25714、25696~25715、25697~25716、25698~25717、25699~25718、25700~25719、25701~25720、25702~25721、25703~25722、25704~25723、25706~25725、25710~25729、25712~25731、25713~25732、25714~25733、25715~25734、25728~25747、25729~25748、25730~25749、25743~25762、25744~25763、25745~25764、25746~25765、25747~25766、25748~25767、25750~25769、25751~25770、25752~25771、25753~25772、25754~25773、25755~25774、25757~25776、25758~25777、25759~25778、25760~25779、25761~25780、25762~25781、25763~25782、25764~25783、25765~25784、25766~25785、25768~25783、25775~25794、25784~25803、25792~25811、25793~25812、25794~25813、25795~25814、25799~25818、25801~25820、25802~25821、25803~25822、25805~25824、25806~25825、25807~25826、25808~25827、25821~25836、25824~25843、25825~25844、25826~25845、25841~25860、25842~25861、25861~25880、25862~25881、25865~25884、25867~25886、25868~25887、25869~25888、25872~25891、25875~25894、25921~25940、25922~25941、25923~25942、25949~25968、25968~25987、25989~26008、25990~26009、26038~26057、26040~26059、26042~26061、26052~26071、26055~26074、26056~26075、26071~26090、26087~26106、26096~26115、26102~26121、26105~26124、26563~26582、26576~26595、26586~26605、26617~26636、26621~26640、26631~26650、26654~26673、26679~26698、26680~26699、26691~26710、26692~26711、26697~26716、26699~26718、26700~26719、26715~26734、26718~26737、26740~26759、26742~26761、26748~26767、26752~26771、26758~26777、26760~26779、26761~26780、26786~26805、26796~26815、26817~26836、26818~26837、26820~26839、26824~26843、26825~26844、26835~26854、26852~26871、26868~26887、26869~26888、26870~26889、26871~26890、26875~26894、26880~26899、26882~26901、26884~26903、26885~26904、26886~26905、26888~26907、26889~26908、26891~26910、26892~26911、26893~26912、26902~26921、26903~26922、26905~26924、26925~26944、26930~26949、26936~26955、26937~26956、26938~26957、26941~26960、26942~26961、26943~26962、26944~26963、26947~26966、26950~26969、26952~26971、26953~26972、26954~26973、26956~26975、26957~26976、26958~26977、26959~26978、26976~26995、26977~26996、26978~26997、26980~26999、26981~27000、26982~27001、26983~27002、26984~27003、26985~27004、26987~27006、27007~27026、27008~27027、27009~27028、27010~27029、27011~27030、27013~27032、27014~27033、27015~27034、27016~27035、27017~27036、27018~27037、27023~27042、27026~27045、27027~27046、27037~27056、27038~27057、27043~27062、27044~27063、27045~27064、27046~27065、27047~27066、27048~27067、27067~27086、27068~27087、27069~27088、27070~27089、27075~27094、27076~27095、27090~27109、27097~27116、27105~27124、27107~27126、27112~27131、27181~27200、27192~27211、27206~27225、27207~27226、27208~27227、27212~27231、27221~27240、27222~27241、27223~27242、27244~27263、27245~27264、27259~27278、27260~27279、27274~27293、27275~27294、27276~27295、27286~27305、27287~27306、27289~27308、27290~27309、27336~27355、27341~27360、27342~27361、27345~27364、27349~27368、27388~27407、27392~27411、27393~27412、27414~27433、27416~27435、27420~27439、27421~27440、27434~27453、27435~27454、27436~27455、27437~27456、27438~27457、27439~27458、27440~27459、27447~27466、27455~27474、27456~27475、27484~27503、27498~27517、27499~27518、27500~27519、27511~27530、27512~27531、27529~27548、27543~27562、27545~27564、27547~27566、27548~27567、27549~27568、27551~27570、27797~27816、27805~27824、27806~27825、27807~27826、27808~27827、27809~27828、27810~27829、27811~27830、27812~27831、27814~27833、27815~27834、27839~27858、27840~27859、27869~27888、27870~27889、27871~27890、27930~27949、27931~27950、27934~27953、27935~27954、27936~27955、27941~27960、27965~27984、27966~27985、27977~27996、27978~27997、27988~28007、27992~28011、28028~28047、28032~28051、28033~28052、28042~28061、28045~28064、28090~28109、28092~28111、28097~28116、28098~28117、28103~28122、28116~28135、28120~28139、28124~28143、28141~28160、28145~28164、28166~28185、28193~28212、28194~28213、28195~28214、28226~28245、28227~28246、28230~28249、28253~28272、28254~28273、28255~28274、28259~28278、28263~28282、28274~28293、28277~28296、28285~28304、28294~28313、28295~28314、28307~28326、28308~28327、28310~28329、28311~28330、28312~28331、28329~28348、28358~28377、28421~28440、28436~28455、28441~28460、28443~28458、28448~28463、28452~28471、28453~28468、28482~28501、28493~28512、28494~28513、28506~28525、28534~28553、28536~28555、28537~28556、28538~28557、28541~28560、28549~28568、28552~28571、28554~28573、 28555~28574、28556~28575、28557~28576、28558~28577、28559~28578、28560~28579、28561~28580、28575~28594、28576~28595、28577~28596、28579~28598、28580~28599、28581~28600、28582~28601、28588~28607、28590~28609、28591~28610、28592~28611、28594~28613、28595~28614、28596~28615、28605~28624、28606~28625、28607~28626、28609~28628、28610~28629、28611~28630、28612~28631、28621~28640、28622~28641、28623~28642、28624~28643、28625~28644、28626~28645、28627~28646、28636~28655、28637~28656、28638~28657、28639~28658、28648~28667、28814~28833、28815~28834、28927~28946、28928~28947、28929~28948、28930~28949、28941~28960、28942~28961、28957~28976、28960~28979、28961~28980、28962~28981、28976~28995、28986~29005、28987~29006、28988~29007、28989~29008、28993~29012、28994~29013、28995~29014、28996~29015、28997~29016、29027~29046、29028~29047、29029~29048、29051~29070、29052~29071、29073~29092、29076~29095、29088~29107、29098~29117、29100~29119、29116~29135、29117~29136、29134~29153、29164~29183、29165~29184、29166~29185、29169~29188、29175~29194、29176~29195、29177~29196、29202~29221、29243~29262、29325~29344、29326~29345、29327~29346、29328~29347、29335~29354、29336~29355、29352~29371、29353~29372、29354~29373、29360~29379、29365~29384、29366~29385、29368~29387、29370~29389、29391~29410、29446~29465、29447~29466、29448~29467、29449~29468、29454~29473、29455~29474、29456~29475、29458~29477、29461~29480、29462~29481、29464~29479、29464~29483、29465~29484、29466~29485、29467~29486、29468~29487、29469~29488、29470~29489、29471~29490、29472~29491、29475~29494、29476~29495、29487~29506、29488~29507、29491~29510、29496~29515、29502~29521、29503~29522、29504~29523、29505~29524、29506~29525、29507~29526、29508~29527、29509~29528、29510~29529、29511~29530、29512~29531、29515~29534、29516~29535、29517~29536、29518~29537、29519~29538、29536~29551、29569~29588、29574~29593、29673~29692、29702~29721、29703~29722、29725~29744、29726~29745、29727~29746、29730~29749、29744~29763、29745~29764、29746~29765、29777~29796、29779~29798、29788~29807、29789~29808、29790~29809、29795~29814、29796~29815、29797~29816、29807~29826、29811~29830、29819~29838、29822~29841、29892~29911、29893~29912、29918~29937、29921~29940、29922~29941、29923~29942、29924~29943、29926~29945、29927~29946、29928~29943、29930~29949、29951~29970、29954~29973、29957~29976、29959~29978、29960~29979、29961~29980、29963~29982、29964~29983、29965~29984、29966~29985、29967~29986、29968~29987、29972~29991、29973~29992、29974~29993、29976~29995、29977~29996、29978~29997、29979~29998、29980~29999、29981~30000、29982~30001、29983~30002、29984~30003、29985~30004、29986~30005、29987~30006、29988~30007、29989~30008、30002~30021、30006~30025、30018~30037、30021~30040、30022~30041、30024~30043、30029~30048、30031~30050、30032~30051、30033~30052、30035~30054、30037~30056、30039~30058、30042~30061、30059~30078、30063~30082、30064~30083、30075~30094、30076~30095、30079~30098、30082~30101、30086~30105、30088~30107、30089~30108、30098~30117、30100~30119、30109~30128、30110~30129、30111~30130、30112~30131、30113~30132、30115~30134、30130~30149、30131~30150、30132~30151、30142~30161、30180~30199、30181~30200、30182~30201、30183~30202、30184~30203、30185~30204、30187~30206、30188~30207、30189~30208、30192~30211、30199~30218、30204~30223、30205~30224、30212~30231、30252~30271、30254~30273、30267~30286、30268~30287、30269~30288、30272~30291、30285~30304、30293~30312、30294~30313、30295~30314、30296~30315、30309~30328、30345~30364、30350~30369、30351~30370、30378~30397、30379~30398、30380~30399、30384~30403、30386~30405、30387~30406、30396~30415、30428~30447、30448~30467、30458~30477、30460~30479、30483~30502、30508~30527、30509~30528、30510~30529、30602~30621、30604~30623、30777~30796、30779~30798、30780~30799、30781~30800、30782~30801、30783~30802、30784~30803、30785~30804、30790~30809、30791~30810、30792~30811、30793~30812、30794~30813、30866~30885、30985~31004、30992~31011、30994~31013、31011~31030、31015~31034、31019~31038、31041~31060、31043~31062、31052~31071、31054~31073、31060~31079、31064~31083、31066~31085、31067~31086、31070~31089、31071~31090、31072~31091、31073~31092、31074~31093、31075~31094、31076~31095、31077~31096、31078~31097、31079~31098、31082~31101、31104~31123、31107~31126、31118~31137、31128~31147、31129~31148、31130~31149、31173~31192、31215~31234、31222~31241、31224~31243、31226~31245、31236~31255、31237~31256、31241~31260、31242~31261、31243~31258、31254~31273、31255~31274、31256~31275、31270~31289、31280~31299、31282~31301、31284~31303、31285~31304、31286~31305、31288~31307、31289~31308、31291~31310、31292~31311、31293~31312、31294~31313、31295~31314、31296~31315、31313~31332、31315~31334、31317~31336、31444~31463、31456~31475、31457~31476、31458~31477、31658~31677、31659~31678、31660~31679、31674~31693、31676~31695、31677~31696、31680~31699、31681~31700、31682~31701、31683~31702、31707~31726、31708~31727、31710~31729、31719~31738、31720~31739、31730~31749、31731~31750、31735~31754、31737~31756、31738~31757、31740~31759、31741~31760、31751~31770、31752~31771、31755~31774、31758~31777、31765~31780、31765~31784、31766~31785、31792~31811、31793~31812、31810~31829、31811~31830、31812~31831、31813~31832、31814~31833、31815~31834、31816~31835、31818~31837、31840~31859、31842~31861、31850~31869、31851~31870、31852~31871、31853~31872、31854~31873、31855~31874、31864~31883、31865~31884、31883~31902、31886~31905、31888~31907、31941~31960、31946~31965、32006~32025、32096~32115、32246~32265、32259~32278、32353~32372、32354~、 32373、32355~32374、32356~32375、32357~32376、32359~32378、32367~32386、32401~32420、32424~32439、32451~32470、32456~32475、32457~32476、32473~32492、32480~32499、32554~32573、32661~32680、32662~32681、32676~32695、32677~32696、32728~32747、32768~32787、32813~32828、32814~32833、32825~32844、32874~32893、32875~32894、32889~32908、32947~32966、32957~32976、32961~32980、32962~32981、32967~32986、32968~32987、32969~32988、32970~32989、33037~33056、33046~33065、33346~33365、33347~33366、33356~33375、33357~33376、33358~33377、33359~33378、33361~33380、33435~33454、33437~33456、33438~33457、33439~33458、33443~33462、33446~33465、33456~33475、33475~33494、33476~33495、33493~33512、33496~33515、33497~33516、33498~33517、33507~33526、33508~33527、33511~33530、33549~33568、33571~33590、33587~33606、33588~33607、33600~33619、33601~33620、33604~33623、33605~33624、33606~33625、33619~33638、33622~33641、33625~33644、33626~33645、33631~33646、33636~33655、33650~33669、33679~33698、33680~33699、33683~33702、33684~33703、33685~33704、33686~33705、33688~33707、33706~33725、33713~33732、33714~33733、33754~33773、33756~33775、33762~33781、33764~33783、33765~33784、33769~33788、33793~33812、33807~33826、33865~33884、33867~33886、33869~33888、33883~33902、33884~33903、33922~33941、33946~33965、33948~33967、33950~33969、33951~33970、33952~33971、33953~33972、33958~33977、33959~33978、34109~34128、34110~34129、34113~34132、34117~34136、34129~34144、34157~34176、34158~34177、34159~34178、34160~34179、34162~34181、34165~34184、34166~34185、34178~34197、34198~34217、34214~34233、34223~34242、34278~34297、34298~34317、34309~34328、34327~34346、34329~34348、34330~34349、34369~34388、34383~34402、34386~34405、34387~34406、34407~34426、34409~34428、34411~34430、34418~34437、34438~34457、34440~34459、34475~34494、34479~34498、34481~34500、34485~34504、34487~34506、34488~34507、34489~34508、34490~34509、34492~34511、34493~34512、34494~34513、34502~34521、34504~34523、34505~34524、34506~34525、34515~34534、34536~34555、34537~34556、34547~34566、34548~34567、34564~34583、34566~34585、34567~34586、34568~34587、34581~34600、34582~34601、34647~34666、34648~34667、34649~34668、34652~34671、34655~34674、34656~34675、34657~34676、34712~34731、34718~34737、34719~34738、35016~35035、35017~35036、35018~35037、35019~35038、35021~35040、35023~35042、35057~35076、35058~35077、35059~35078、35069~35088、35096~35115、35097~35116、35100~35119、35101~35120、35102~35121、35104~35123、35267~35286、35289~35308、35336~35355、35337~35356、35343~35362、35344~35363、35345~35364、35349~35368、35350~35369、35351~35370、35381~35400、35382~35401、35385~35404、35391~35406、35396~35411、35401~35420、35402~35421、35423~35442、35424~35443、35425~35444、35435~35454、35438~35457、35442~35461、35445~35464、35446~35465、35495~35510、35502~35517、35509~35524、35511~35530、35512~35531、35514~35533、35515~35534、35516~35535、35520~35535、35533~35552、35543~35562、35547~35566、35570~35589、35613~35632、35615~35634、35619~35638、35620~35639、35621~35640、35631~35650、35639~35658、35640~35659、35642~35661、35643~35662、35644~35663、35652~35671、35653~35672、35654~35673、35655~35674、35657~35676、35664~35683、35667~35686、35668~35687、35675~35690、35681~35700、35683~35702、35685~35704、35705~35724、35706~35725、35709~35728、35711~35730、35712~35731、35719~35738、35720~35739、35736~35755、35745~35764、35746~35765、35747~35766、35748~35767、35753~35772、35764~35783、35765~35784、35769~35788、35783~35802、35784~35803、35788~35807、35789~35808、35799~35818、35802~35821、35809~35828、35810~35829、35811~35830、35812~35831、35815~35834、35816~35835、35817~35836、35818~35837、35819~35838、35820~35839、35830~35849、35844~35859、35877~35896、35879~35898、35881~35900、35882~35901、35914~35933、35987~36006、35988~36007、35992~36011、35994~36013、35995~36014、35996~36015、35998~36017、36007~36026、36021~36040、36022~36041、36023~36042、36065~36084、36068~36087、36069~36088、36109~36128、36112~36131、36113~36132、36116~36135、36121~36140、36124~36143、36125~36144、36181~36200、36182~36201、36186~36205、36248~36267、36251~36270、36262~36281、36280~36299、36281~36300、36286~36305、36287~36306、36288~36307、36289~36308、36292~36311、36313~36332、36426~36445、36833~36852、36959~36978、36997~37012、37002~37021、37018~37037、37019~37038、37020~37039、37029~37048、37031~37050、37032~37051、37033~37052、37034~37053、37035~37054、37036~37055、37070~37089、37071~37090、37074~37093、37075~37094、37076~37095、37086~37105、37087~37106、37088~37107、37089~37108、37093~37112、37125~37144、37135~37154、37213~37232、37224~37243、37241~37260、37266~37285、37267~37286、37280~37299、37281~37300、37291~37310、37292~37311、37308~37327、37318~37337、37340~37355、37341~37356、37343~37358、37353~37372、37355~37370、37356~37375、37367~37386、37368~37387、37369~37388、37370~37389、37375~37394、37390~37409、37391~37410、37392~37407、37392~37411、37401~37420、37402~37421、37406~37425、37407~37426、37416~37435、37420~37439、37425~37444、37436~37455、37480~37499、37481~37500、37482~37501、37483~37502、37529~37548、37530~37549、37531~37550、37562~37581、37614~37633、37617~37636、37634~37649、37637~37656、37660~37679、37665~37684、37676~37695、37680~37699、37886~37905、37888~37907、37889~37908、37890~37909、37923~37942、37924~37943、37968~37983、38042~38061、38058~38073、38060~38079、38095~38114、38113~38132、38114~38133, 38115~38134, 38116~38135, 38121~38140, 38139~38158, 38140~38159, 38145~38164, 38154~38173, 38155~38174, 38156~38175, 38157~38176, 38159~38178, 38168~38187, 38171~38190, 38172~38191, 38175~38194, 38176~38195, 38177~38196, 38181~38196, 38204~38223, 38205~38224, 38272~38291, 38273~38292, 38277~38296, 38279~38298, 38295~38314, 38318~38337, 38319~38338, 38321~38340, 38322~38341, 38326~38345, 38328~38347, 38361~38380, 38362~38381, 38363~38382, 38367~38386, 38375~38394, 38417~38436, 38468~38487, 38469~38488, 38470~38489, 38516~38535, 38537~38556, 38540~38559, 38542~38561, 38552~38571, 38553~38572, 38557~38576, 38583~38602, 38620~38639, 38623~38642, 38633~38652, 38659~38678, 38698~38717, 38720~38739, 38743~38762, 38745~38764, 38747-38766, 38783-38802, 38785-38804, 38788-38807, 38789-38808, 38790-38809, 38791-38810, 38792-38811, 38829-38848, 38830-38845, 38831-38850, 39011-39026, or 39014-39029. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the IFNAR1 nucleic acid.

[0241] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 216-235, 218-237, 220-239, 521-540, 670-689, 1119-1138, 1283-1302, 1284-1303, 1287-1306, 1288-1307, 1580-1599, 1581-1600 of SEQ ID NO: 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the IFNAR1 nucleic acid.

[0242] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is selected from the group consisting of nucleobases 5084-5133, 19997-20061, 20076-20133, 20528-20611, 20616, 22294-22329, 22453-22476, 22597, 22595-22626, 25530-2556 of SEQ ID NO:1. 5, 25606-25652, 25710-25767, 25768-25827, 28421-28468, 29924-29949, 29968-30021, 31072-31096, 31792-31837, 32353-32386, or 35016-35042. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isometric portion within nucleobases 20003-20022, 20104-20123, 20591-20610, 22455-22474, 22456-22475, 29981-30000 of SEQ ID NO:1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the IFNAR1 nucleic acid.

[0243] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-2687.

[0244] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 12-89.

[0245] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 16 linked nucleosides, the modified oligonucleotide having a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 12-89.

[0246] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 12 to 2687.

[0247] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, the modified oligonucleotide having a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 90-2687.

[0248] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0249] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0250] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, the modified oligonucleotide having a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 1317, 2040, 2625, 2668, 2670, or 2679.

[0251] In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide may be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an IFNAR1 nucleic acid, the IFNAR1 nucleic acid having the nucleobase sequence of SEQ ID NO: 1 or 2.

[0252] In any of the oligomeric compounds provided herein, the modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30 , 16-50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0253] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide may contain a modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic sugar moiety, e.g., -O-CH 2 - and -O-CH(CH 3 )-. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0254] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound may include a sugar surrogate.

[0255] In any of the oligomeric compounds provided herein, at least one internucleoside bond of the modified oligonucleotide can comprise a modified internucleoside bond, for example, a phosphorothioate internucleoside bond.In certain embodiments, each internucleoside bond of the modified oligonucleotide can be a modified internucleoside bond, or each internucleoside bond of the modified oligonucleotide can be a phosphorothioate internucleoside bond.In certain embodiments, at least one internucleoside bond of the modified oligonucleotide can be a phosphodiester internucleoside bond.In certain embodiments, each internucleoside bond of the modified oligonucleotide can be independently selected from a phosphodiester internucleoside bond or a phosphorothioate internucleoside bond.In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside bonds of the modified oligonucleotide can be a phosphodiester internucleoside bond. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

[0256] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide may be a modified nucleobase, such as a 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

[0257] In any of the oligomeric compounds provided herein, the modified oligonucleotide can comprise a deoxy region consisting of 5-12 contiguous 2'-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is disposed 5' to a 5' extrinsic region consisting of 1-6 linked 5' extrinsic region nucleosides and 3' to a 3' extrinsic region consisting of 1-6 linked 3' extrinsic region nucleosides, the 3' most nucleoside of the 5' extrinsic region comprising a modified sugar moiety, and the 5' most nucleoside of the 3' extrinsic region comprising a modified sugar moiety. In certain embodiments, each nucleoside of the 3' exterior region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5' exterior region comprises a modified sugar moiety.

[0258] 1. Compound number 1489477 In certain embodiments, compound number 1489477 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') CTTTTTCTGCTCTTATACGC (SEQ ID NO: 2668), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, 19 to 20, 20 to 22, 21 to 23, 22 to 24, 23 to 25, 24 to 26, 25 to 27, 26 to 28, 27 to 29, 28 to 30, 29 to 31, 30 to 32, 31 to 33, 32 to 34, 33 to 35, 34 to 36, 35 to 37, 36 to 38, 37 to 39, 38 to 40, 39 to 41, 39 to 51, 39 to 52, 39 to 62, 39 to 73, 39 to 84, 39 to 95, 39 to 106, 39 to 117, 39 to 128, 39 to 138, 39 to 14 The internucleoside linkages at nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0259] In certain embodiments, compound number 1489477 has the following chemical representation: m C es T eo T eo T eo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (SEQ ID NO: 2668), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0260] In certain embodiments, compound number 1489477 has the following chemical structure:

[0261] [ka]

[0262] (sequence number 2668). Structure 1. Compound number 1489477

[0263] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 1.

[0264] In certain embodiments, the sodium salt of compound number 1489477 has the following chemical structure:

[0265] [ka]

[0266] (sequence number 2668). Structure 2. Sodium salt of compound number 1489477

[0267] 2. Compound number 1489494 In certain embodiments, compound number 1489494 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') CTGTTTTACATTTTTTTTCC (SEQ ID NO: 2040), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and nucleosides 2 to 3, 3 to 4, 4 to 5 are 2'-MOE nucleosides, and The internucleoside linkages at nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0268] In certain embodiments, compound number 1489494 has the following chemical designation: m C es T eo G eo T eo T eo T eo T ds Ads m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m C e (SEQ ID NO: 2040), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0269] In certain embodiments, compound number 1489494 has the following chemical structure:

[0270] [ka]

[0271] (sequence number 2040). Structure 3. Compound number 1489494

[0272] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 3.

[0273] In certain embodiments, the sodium salt of compound number 1489494 has the following chemical structure:

[0274] [ka]

[0275] (sequence number 2040). Structure 4. Sodium salt of compound number 1489494

[0276] 3. Compound number 1489525 In certain embodiments, compound number 1489525 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') TTTATCCAATTATCCATCCC (SEQ ID NO: 2670), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-β-D-deoxynucleosides. The internucleoside linkages of nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0277] In certain embodiments, compound number 1489525 has the following chemical designation: T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C esm C e (SEQ ID NO: 2670), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0278] In certain embodiments, compound number 1489525 has the following chemical structure:

[0279] [ka]

[0280] (sequence number 2670). Structure 5. Compound number 1489525

[0281] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 5.

[0282] In certain embodiments, the sodium salt of compound number 1489525 has the following chemical structure:

[0283] [ka]

[0284] (sequence number 2670). Structure 6. Sodium salt of compound number 1489525

[0285] 4. Compound number 1492069 In certain embodiments, compound number 1492069 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') TCGCCTAATTTTTCTCTCAC (SEQ ID NO: 2679), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5 are 2'-β-D-deoxynucleosides. The internucleoside linkages of nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0286] In certain embodiments, compound number 1492069 has the following chemical representation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 2679), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0287] In certain embodiments, compound number 1492069 has the following chemical structure:

[0288] [ka]

[0289] (sequence number 2679). Structure 7. Compound number 1492069

[0290] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 7.

[0291] In certain embodiments, the sodium salt of compound number 1492069 has the following chemical structure:

[0292] [ka]

[0293] (sequence number 2679). Structure 8. Sodium salt of compound number 1492069

[0294] 5. Compound number 1492082 In certain embodiments, compound number 1492082 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') TTTCATATTTGTTACTTCCT (SEQ ID NO: 2625), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and nucleosides 2 to 3, 3 to 4, 4 to 5 are 2'-β-D-deoxynucleosides. The internucleoside linkages at nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0295] In certain embodiments, compound number 1492082 has the following chemical representation: T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds T eo m C es m C es T e (SEQ ID NO: 2625), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0296] In certain embodiments, compound number 1492082 has the following chemical structure:

[0297] [ka]

[0298] (sequence number 2625). Structure 9. Compound number 1492082

[0299] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 9.

[0300] In certain embodiments, the sodium salt of compound number 1492082 has the following chemical structure:

[0301] [ka]

[0302] (sequence number 2625). Structure 10. Sodium salt of compound number 1492082

[0303] 6. Compound number 1492131 In certain embodiments, compound number 1492131 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') TTCGCCTAATTTTTCTCTCA (SEQ ID NO: 1317), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, 19 to 20, 20 to 22, 21 to 23, 22 to 24, 23 to 25, 24 to 26, 25 to 27, 26 to 28, 27 to 29, 28 to 30, 29 to 31, 30 to 32, 31 to 33, 32 to 34, 33 to 35, 34 to 36, 35 to 37, 36 to 38, 37 to 39, 38 to 40, 39 to 50, 39 to 51, 39 to 62, 39 to 73, 39 to 84, 39 to 95, 39 to 106, 39 to 117, 39 to 128, 39 to 139, 39 to 140, 39 to 1 The internucleoside linkages at nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0304] In certain embodiments, compound number 1492131 has the following chemical representation: T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO: 1317), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0305] In certain embodiments, compound number 1492131 has the following chemical structure:

[0306] [ka]

[0307] (sequence number 1317). Structure 11. Compound number 1492131

[0308] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 11.

[0309] In certain embodiments, the sodium salt of compound number 1492131 has the following chemical structure:

[0310] [ka]

[0311] (sequence number 1317). Structure 12. Sodium salt of compound number 1492131

[0312] Specific oligomeric duplexes Certain embodiments are directed to an oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound.

[0313] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid base sequence of the first modified oligonucleotide is any one of nucleic acid bases 3964 to 3983, 4050 to 4069, 4573 to 4592, 4574 to 4593, 4600 to 4619, 4601 to 4620, 4603 to 4622, 4606 to 4625, 4619 to 4638, 4620 to 4639, 4681 to 4700, 4716 to 4735, 4717 to 4736, 4724 to 4743, 4725 to 4744, 4731 to 4750, 4732 to 4756, 4731 to 4758, 4733 to 4759, 4746 to 4748, 4759 to 4761, 4762 to 4763, 4764 to 4765, 4766 to 4767, 4770 to 4771, 4772 to 4773, 4774 to 4775, 4776 to 4777, 4778 to 4779, 4780 to 4781, 4782 to 4783, 4784 to 4785, 4786 to 4787, 4788 to 4789, 4790 to 4800, 4791 to 4801, 4792 to 4802, 4793 to 4803, 4794 to 48 32~4751, 4733~4752, 4740~4759, 4744~4763, 4771~4790, 4772~4791, 4773~4792, 4786~4805, 4788~4807, 4797~4816, 4798~4817, 4801~4820, 4808~4 827, 4812~4831, 4814~4833, 4815~4834, 4823~4838, 4825~4844, 4827~4846, 4841~4860, 4846~4865, 4847~4866, 4862~4881, 4875~4894, 4888~4907, 4 889~4908, 4905~4924, 4906~4925, 4942~4961, 4952~4971, 4957~4976, 4958~4977, 5035~5054, 5036~5055, 5061~5080, 5082~5101, 5083~5102, 5084~ 5103, 5085~5104, 5086~5101, 5086~5105, 5087~5102, 5087~5106, 5089~5104, 5089~5108, 5090~5105, 5096~5115, 5113~5132, 5114~5133, 5137~5156, 5142~5161, 5147~5162, 5166~5185, 5179~5198, 5181~5200, 5182~5201, 5183~5202, 5519~5538, 5532~5551, 5533~5552, 5537~5556, 5546~5565, 5598~ 5617, 5599~5618, 5600~5619, 5637~5656, 5653~5672, 5657~5676, 5669~5688, 5673~5692, 5701~5720, 5702~5721, 5703~5722, 5709~5728, 5755~5774,5757~5776、5761~5780、5850~5869、5878~5897、5901~5920、5902~5921、5904~5923、5907~5926、5910~5929、5915~5934、5916~5935、5917~5936、5920~5939、5921~5940、5922~5941、5923~5942、5924~5943、5931~5950、5934~5953、5935~5954、5955~5974、5984~6003、5985~6004、6028~6047、6033~6052、6035~6054、6051~6070、6052~6071、6090~6109、6111~6130、6112~6131、6113~6132、6145~6164、6170~6189、6171~6190、6195~6214、6203~6222、6204~6223、6206~6225、6207~6226、6237~6256、6264~6283、6279~6298、6306~6325、6357~6376、6361~6380、6407~6426、6408~6427、6409~6428、6412~6431、6420~6439、6425~6444、6481~6500、6482~6501、6512~6527、6672~6691、6674~6689、6710~6729、6734~6753、6749~6768、6759~6778、6760~6779、6831~6850、6835~6854、6838~6857、6916~6935、6919~6938、6921~6940、6926~6945、6935~6954、6936~6955、6941~6960、6945~6964、7211~7230、7230~7249、7234~7253、7237~7256、7307~7326、7310~7329、7311~7330、7312~7331、7315~7334、7331~7350、7437~7456、7438~7457、7443~7462、7458~7477、7526~7545、7528~7547、7543~7562、7545~7564、7569~7588、7570~7589、7585~7604、7588~7607、7589~7608、7590~7609、7591~7610、7592~7607、7592~7611、7593~7608、7593~7612、7595~7610、7595~7614、7596~7611、7602~7621、7614~7633、7617~7636、7618~7637、7619~7638、7639~7658、7640~7659、7644~7663、7649~7664、7661~7680、7662~7681、7663~7682、7665~7684、7667~7686、7668~7687、7681~7700、7683~7702、7684~7703、7685~7704、7747~7766、7771~7790、7772~7791、7773~7792、7774~7793、7775~7794、7777~7796、7778~7797、7781~7800、7782~7801、7784~7803、7785~7804、7787~7806、7788~7807、7790~7809、7803~7822、7805~7824、7806~7825、7831~7850、7867~7882、7931~7950、7957~7976、7978~7997、7979~7998、7980~7999、8144~8163、8196~8215、8210~8229、8211~8230、8226~8245、8227~8246、8231~8250、8232~8251、8261~8280、8271~8286、8300~8319、8301~8320、8310~8329、8324~8343、8325~8344、8339~8358、8343~8362、8347~8366、8351~8370、8356~8375、8357~8376、8359~8378、8360~8379、8361~8380、8362~8381、8364~8383、8366~8385、8368~8387、8369~8388、8383~8402、8387~8406、8388~8407、8391~8410、8392~8411、8393~8412、8394~8413、8398~8417、8408~8427、8409~8428、8421~8440、8425~8444、8428~8447、8429~8448、8433~8452、8443~8462、8444~8463、8524~8543、8549~8568、8550~8569、8551~8570、8584~8603、8624~8643、8626~8645、8627~8646、8629~8648、8630~8649、8631~8650、8632~8651、8636~8655、8637~8656、8652~8671、8653~8672、8656~8675、8657~8676、8659~8678、8660~8679、8661~8680、8682~8701、8698~8717、8716~8735、8717~8736、8721~8740、8722~8741、8724~8743、8731~8750、8733~8752、8748~8767、8761~8780、8762~8781、8763~8782、8764~8783、8765~8784、8770~8789、8776~8795、8777~8796、8778~8797、8782~8801、8791~8806、8791~8810、8792~8811、8793~8808、8793~8812、8794~8809、8794~8813、8795~8810、8795~8814、8807~8826、8808~8827、8809~8828、8822~8841、8831~8850、8834~8853、8835~8854、8836~8855、8857~8876、8938~8957、8939~8958、8957~8972、8980~8999、9021~9040、9022~9041、9025~9044、9026~9041、9026~9045、9038~9057、9156~9175、9164~9183、9204~9223、9205~9224、9252~9271、9253~9272、9254~9273、9255~9274、9257~9276、9319~9338、9329~9348、9374~9393、9375~9394、9376~9395、9377~9396、9379~9398、9388~9407、9393~9412、9394~9413、9414~9433、9416~9435、9419~9438、9421~9440、9422~9441、9423~9442、9425~9444、9446~9465、9467~9486、9469~9488、9499~9518、9557~9576、9560~9579、9561~9580、9563~9582、9564~9583、9566~9585、9567~9586、9568~9587、9569~9588、9570~9589、9571~9590、9578~9597、9579~9598、9667~9686、9668~9687、9676~9695、9677~9696、9685~9704、9707~9726、9713~9732、9714~9733、9715~9734、9740~9759、9741~9760、9742~9761、9743~9762、9744~9763、9748~9767、9805~9824、9806~9825、9817~9836、9896~9915、10107~10126、10137~10156、10150~10169、10270~10289、10274~10293、10420~10439、10421~10440、10628~10647、10635~10654、10691~10710、10700~10719、10702~10721、10704~10723、10705~10724、10779~10798、10780~10799、11007~11026、11008~11027、11009~11028、11016~11035、11067~11086、11127~11146、11168~11187、11170~11189、11173~11192、11174~11193、11175~11194、11288~11307、11378~11397、11379~11398、11394~11413、11411~11430、11412~11431、11413~11432、11415~11434、11417~11436、11421~11440、11422~11441、11423~11442、11424~11443、11426~11445、11429~11448、11495~11514、11496~11515、11520~11539、11521~11540、11522~11541、11548~11567、11549~11568、11552~11571、11572~11591、11574~11593、11610~11629、11614~11633、11666~11685、11667~11686、11669~11688、11698~11717、11706~11725、11752~11771、11799~11818、11812~11831、11816~11835、11817~11836、11818~11837、11847~11866、11853~11872、11855~11870、11882~11897、11883~11902、11895~11914、11896~、 11915、11897~11916、11899~11918、11900~11919、11901~11920、11903~11922、11904~11923、11906~11925、11910~11929、11911~11930、11915~11930、11960~11979、11964~11983、11965~11984、11999~12018、12025~12044、12046~12065、12085~12104、12086~12105、12100~12119、12148~12167、12180~12199、12181~12200、12185~12204、12187~12206、12189~12204、12189~12208、12191~12210、12212~12227、12245~12264、12247~12266、12248~12267、12250~12269、12309~12324、12310~12325、12311~12326、12313~12332、12314~12333、12315~12334、12347~12366、12350~12369、12355~12374、12377~12396、12381~12400、12385~12404、12386~12405、12387~12406、12426~12445、12427~12446、12432~12451、12433~12452、12471~12490、12472~12491、12479~12498、12482~12501、12487~12506、12498~12517、12499~12518、12500~12519、12502~12521、12503~12522、12504~12523、12573~12592、12575~12594、12576~12595、12577~12596、12968~12987、12969~12988、13011~13030、13034~13053、13177~13196、13178~13197、13213~13232、13215~13234、13217~13236、13220~13239、13337~13356、13338~13357、13339~13358、13367~13386、13413~13432、13414~13433、13427~13446、13428~13447、13429~13448、13430~13449、13431~13450、13461~13480、13490~13509、13491~13510、13492~13511、13493~13512、13496~13515、13497~13516、13498~13517、13499~13518、13500~13519、13505~13524、13510~13529、13511~13530、13532~13551、13557~13576、13567~13586、13568~13587、13569~13588、13570~13589、13580~13599、13581~13600、13582~13601、13586~13605、13587~13606、13589~13608、13590~13609、13591~13610、13608~13627、13644~13663、13645~13664、13663~13682、13718~13737、13725~13744、13727~13746、13728~13747、13729~13748、13736~13755、13737~13756、13738~13757、13740~13759、13743~13762、13754~13773、13755~13774、13776~13795、13818~13837、13819~13838、13820~13839、13830~13849、13832~13851、13845~13864、13864~13883、13865~13884、13878~13897、13911~13930、13913~13932、13921~13940、13924~13943、13954~13973、13974~13993、14016~14035、14017~14036、14018~14037、14019~14038、14020~14039、14021~14040、14023~14042、14024~14043、14025~14044、14026~14045、14052~14071、14114~14133、14141~14160、14160~14179、14161~14180、14163~14182、14177~14196、14296~14315、14300~14319、14338~14357、14341~14360、14343~14362、14454~14469、14521~14540、14549~14568、14582~14601、14583~14602、14598~14617、14599~14618、14607~14626、14613~14632、14640~14659、14642~14661、14644~14663、14721~14740、14804~14819、14830~14849、14834~14853、14845~14864、14848~14867、15610~15629、15611~15630、15626~15645、15979~15998、16046~16065、16055~16074、16056~16075、16059~16078、16060~16079、16061~16080、16062~16081、16063~16082、16064~16083、16252~16271、16253~16272、16254~16273、16269~16288、16292~16311、16293~16312、16295~16314、16296~16315、16297~16316、16323~16342、16324~16343、16327~16346、16334~16353、16350~16369、16352~16371、16353~16372、16354~16373、16356~16375、16357~16376、16360~16379、16361~16380、16363~16382、16365~16384、16408~16427、16450~16469、16463~16482、16464~16483、16465~16484、16466~16485、16472~16491、16479~16498、16539~16558、16543~16558、16559~16578、16577~16596、16580~16599、16591~16610、16650~16669、16702~16721、16703~16722、16705~16724、16727~16746、16728~16747、16730~16749、16873~16892、16875~16894、16907~16926、16915~16934、16946~16965、16947~16966、16951~16970、16968~16987、16980~16999、16983~17002、17081~17100、17084~17103、17109~17128、17134~17153、17135~17154、17136~17155、17137~17156、17195~17214、17236~17255、17392~17411、17556~17575、17557~17576、17558~17577、17617~17636、17618~17637、17627~17646、17631~17650、17632~17651、17634~17653、17649~17668、17659~17678、17660~17679、17708~17727、18056~18075、18057~18076、18058~18077、18059~18078、18061~18080、18088~18107、18091~18110、18092~18111、18093~18112、18138~18157、18139~18158、18149~18168、18151~18170、18158~18177、18159~18178、18160~18179、18161~18180、18165~18184、18166~18185、18167~18186、18171~18190、18174~18193、18212~18231、18231~18250、18232~18251、18241~18260、18242~18261、18244~18263、18248~18267、18279~18298、18281~18300、18282~18301、18312~18331、18313~18332、18316~18335、18318~18337、18324~18343、18327~18346、18329~18348、18330~18349、18344~18363、18345~18364、18351~18370、18352~18371、18367~18386、18368~18387、18405~18424、18420~18439、18425~18444、18473~18492、18487~18506、18488~18507、18530~18549、18533~18552、18534~18553、18545~18564、18564~18583、18565~18584、18584~18603、18590~18609、18606~18625、18607~18626、18608~18627、18611~18630、18628~18647、18714~18733、19081~19100、19165~19184、19173~19192、19176~19195、19182~19201、19210~19229、19212~19231、19216~19235、19237~19256、19238~19257、19239~19258、19283~19302、19285~19304、19310~19329、19311~19330、19407~19426、19555~19574、19587~19606、19588~19607、19589~19608、19593~19612、19594~19613、19640~19659、19656~19671、19659~19674、19685~19704、19687~19706、19688~19707、19725~19744、19741~19760、19762~19781、19763~19782、19778~19797、19785~19804、19786~19805、19793~19812、19797~19816、19799~19818、19800~19819、19801~19820、19806~19825、19813~19832、19814~19833、19815~19834、19820~19839、19829~19844、19838~19857、19841~19860、19863~19882、19900~19919、19922~19941、19997~20016、19998~20017、19999~20018、20000~20019、20001~20020、20002~20021、20003~20022、20004~20023、20008~20027、20012~20031、20013~20032、20014~20033、20015~20034、20024~20043、20032~20051、20033~20052、20037~20052、20038~20057、20044~20059、20046~20061、20075~20094、20076~20095、20086~20105、20087~20106、20088~20107、20090~20109、20091~20110、20102~20121、20104~20123、20105~20124、20106~20125、20107~20126、20108~20127、20109~20128、 20110~20129、20111~20130、20112~20131、20113~20132、20114~20133、20135~20154、20137~20156、20138~20157、20165~20184、20166~20185、20167~20186、20169~20188、20171~20190、20172~20191、20176~20195、20192~20211、20203~20222、20207~20226、20240~20259、20250~20269、20255~20270、20300~20319、20342~20361、20388~20407、20389~20408、20390~20409、20416~20435、20479~20498、20485~20504、20487~20506、20489~20508、20491~20510、20492~20511、20493~20512、20495~20514、20496~20515、20497~20516、20498~20517、20499~20518、20500~20519、20501~20520、20503~20522、20505~20524、20506~20525、20508~20527、20517~20536、20528~20547、20538~20557、20539~20558、20587~20606、20588~20607、20589~20608、20590~20609、20591~20610、20592~20611、20593~20612、20594~20613、20595~20614、20596~20615、20597~20616、20638~20657、20639~20658、20653~20672、20658~20677、20996~21015、20999~21018、21010~21029、21012~21031、21014~21033、21034~21053、21049~21068、21050~21069、21051~21070、21053~21072、21070~21089、21083~21102、21085~21104、21106~21125、21107~21126、21108~21127、21112~21131、21113~21132、21115~21134、21116~21135、21124~21143、21125~21144、21126~21145、21405~21424、21952~21971、22057~22076、22187~22206、22191~22210、22201~22220、22202~22221、22203~22222、22206~22225、22207~22226、22217~22236、22218~22237、22219~22238、22222~22241、22223~22242、22237~22256、22238~22257、22249~22268、22288~22307、22294~22313、22299~22318、22300~22319、22308~22327、22309~22328、22310~22329、22342~22361、22347~22366、22348~22367、22358~22377、22363~22382、22364~22379、22365~22380、22386~22401、22391~22410、22411~22430、22413~22432、22420~22439、22424~22443、22425~22444、22426~22445、22436~22455、22437~22456、22438~22453、22446~22465、22447~22466、22448~22467、22449~22468、22450~22469、22451~22470、22452~22471、22453~22472、22454~22473、22455~22474、22456~22475、22457~22476、22458~22477、22468~22483、22469~22488、22470~22489、22479~22498、22495~22514、22496~22515、22521~22540、22522~22541、22524~22543、22525~22544、22526~22545、22527~22546、22532~22551、22533~22552、22541~22560、22542~22561、22559~22578、22560~22579、22565~22584、22595~22614、22597~22616、22598~22617、22599~22618、22603~22622、22611~22626、22633~22652、22638~22657、22656~22675、22657~22676、22669~22688、22673~22692、22675~22694、22699~22718、22701~22720、22723~22742、22746~22765、22747~22766、22748~22767、22768~22787、22773~22792、22803~22822、22804~22823、22805~22824、22806~22825、22808~22827、22819~22838、22832~22851、22843~22862、22856~22875、22857~22876、23134~23153、23174~23193、23175~23194、23224~23243、23231~23250、23267~23286、23269~23288、23326~23345、23327~23346、23328~23347、23329~23348、23330~23349、23336~23355、23374~23393、23462~23481、23677~23696、24115~24134、24150~24169、24153~24172、24154~24173、24197~24216、24198~24217、24200~24219、24201~24220、24236~24255、24237~24256、24240~24259、24241~24260、24243~24262、24245~24264、24268~24287、24269~24288、24287~24306、24299~24318、24303~24322、24304~24323、24305~24324、24306~24325、24307~24326、24309~24328、24310~24329、24311~24330、24312~24331、24313~24332、24314~24333、24315~24330、24315~24334、24316~24335、24318~24337、24319~24338、24320~24339、24341~24360、24353~24372、24355~24374、24370~24389、24371~24390、24388~24407、24389~24408、24394~24413、24395~24414、24454~24473、24525~24544、24529~24548、24579~24598、24580~24599、24585~24604、24586~24605、24587~24606、24588~24607、24589~24608、24605~24624、24621~24640、24622~24641、24623~24642、24630~24649、24633~24652、24646~24665、24651~24670、24698~24717、24728~24747、24729~24748、24731~24750、24766~24785、24782~24801、24783~24802、24790~24809、24795~24814、24796~24815、24797~24816、24798~24817、24799~24818、24801~24820、24812~24831、24813~24832、24814~24833、24816~24835、24818~24837、24821~24840、24824~24843、24831~24850、24832~24851、24835~24854、24838~24857、24839~24858、24840~24859、24841~24860、24844~24863、24845~24864、24846~24865、24848~24867、24863~24882、24864~24883、24865~24884、24866~24885、24867~24886、24873~24892、24878~24897、24885~24904、24893~24912、24894~24913、24913~24932、24915~24934、24917~24936、24918~24937、24921~24940、25004~25023、25018~25037、25019~25038、25021~25040、25022~25041、25026~25045、25095~25114、25096~25115、25111~25130、25115~25134、25116~25135、25117~25136、25119~25138、25133~25152、25136~25155、25137~25156、25138~25157、25139~25158、25141~25160、25143~25162、25144~25163、25145~25164、25146~25165、25148~25167、25149~25168、25150~25169、25152~25171、25153~25172、25154~25173、25155~25174、25157~25176、25158~25177、25159~25178、25160~25179、25161~25180、25162~25181、25163~25182、25164~25183、25165~25184、25168~25187、25169~25188、25170~25189、25171~25190、25174~25193、25177~25196、25180~25199、25181~25200、25182~25201、25183~25202、25186~25205、25187~25206、25188~25207、25189~25208、25190~25209、25191~25210、25196~25215、25197~25216、25198~25217、25200~25219、25203~25222、25204~25223、25205~25224、25206~25225、25207~25226、25211~25230、25212~25231、25213~25232、25214~25233、25215~25234、25217~25236、25218~25237、25219~25238、25220~25239、25222~25241、25223~25242、25224~25243、25226~25245、25227~25246、25228~25247、25230~25249、25232~25251、25233~25252、25235~25254、25238~25257、25239~25258、25247~25266、25253~25272、25255~25274、25256~25275、25257~25276、25258~25277、25261~25280、25262~25281、25263~25282、25264~25283、25265~25284、25273~25292、25279~25298、25280~25299、25289~25308、25293~25312、25295~25314、25296~25315、25297~25316、25298~25317、25299~25318、25309~25328、25318~25337、25327~、 25346、25328~25347、25332~25351、25334~25353、25335~25354、25336~25355、25337~25356、25338~25357、25341~25360、25342~25361、25343~25362、25344~25363、25345~25364、25346~25365、25347~25366、25350~25369、25351~25370、25352~25371、25353~25372、25385~25404、25388~25407、25389~25408、25390~25409、25391~25410、25392~25411、25393~25412、25394~25413、25402~25421、25403~25422、25408~25427、25409~25428、25413~25432、25424~25443、25429~25448、25430~25449、25477~25496、25499~25518、25500~25519、25522~25541、25525~25544、25526~25545、25527~25546、25528~25547、25529~25548、25530~25549、25531~25550、25532~25551、25533~25552、25534~25553、25535~25554、25536~25555、25542~25557、25543~25558、25546~25565、25548~25567、25550~25569、25551~25570、25554~25573、25556~25575、25558~25577、25560~25579、25561~25580、25564~25583、25565~25584、25568~25587、25590~25609、25591~25610、25606~25625、25617~25636、25618~25637、25619~25638、25620~25639、25621~25640、25622~25641、25623~25642、25624~25643、25625~25644、25628~25647、25629~25648、25630~25649、25633~25652、25659~25678、25660~25679、25661~25680、25662~25681、25664~25683、25666~25685、25690~25709、25691~25710、25692~25711、25694~25713、25695~25714、25696~25715、25697~25716、25698~25717、25699~25718、25700~25719、25701~25720、25702~25721、25703~25722、25704~25723、25706~25725、25710~25729、25712~25731、25713~25732、25714~25733、25715~25734、25728~25747、25729~25748、25730~25749、25743~25762、25744~25763、25745~25764、25746~25765、25747~25766、25748~25767、25750~25769、25751~25770、25752~25771、25753~25772、25754~25773、25755~25774、25757~25776、25758~25777、25759~25778、25760~25779、25761~25780、25762~25781、25763~25782、25764~25783、25765~25784、25766~25785、25768~25783、25775~25794、25784~25803、25792~25811、25793~25812、25794~25813、25795~25814、25799~25818、25801~25820、25802~25821、25803~25822、25805~25824、25806~25825、25807~25826、25808~25827、25821~25836、25824~25843、25825~25844、25826~25845、25841~25860、25842~25861、25861~25880、25862~25881、25865~25884、25867~25886、25868~25887、25869~25888、25872~25891、25875~25894、25921~25940、25922~25941、25923~25942、25949~25968、25968~25987、25989~26008、25990~26009、26038~26057、26040~26059、26042~26061、26052~26071、26055~26074、26056~26075、26071~26090、26087~26106、26096~26115、26102~26121、26105~26124、26563~26582、26576~26595、26586~26605、26617~26636、26621~26640、26631~26650、26654~26673、26679~26698、26680~26699、26691~26710、26692~26711、26697~26716、26699~26718、26700~26719、26715~26734、26718~26737、26740~26759、26742~26761、26748~26767、26752~26771、26758~26777、26760~26779、26761~26780、26786~26805、26796~26815、26817~26836、26818~26837、26820~26839、26824~26843、26825~26844、26835~26854、26852~26871、26868~26887、26869~26888、26870~26889、26871~26890、26875~26894、26880~26899、26882~26901、26884~26903、26885~26904、26886~26905、26888~26907、26889~26908、26891~26910、26892~26911、26893~26912、26902~26921、26903~26922、26905~26924、26925~26944、26930~26949、26936~26955、26937~26956、26938~26957、26941~26960、26942~26961、26943~26962、26944~26963、26947~26966、26950~26969、26952~26971、26953~26972、26954~26973、26956~26975、26957~26976、26958~26977、26959~26978、26976~26995、26977~26996、26978~26997、26980~26999、26981~27000、26982~27001、26983~27002、26984~27003、26985~27004、26987~27006、27007~27026、27008~27027、27009~27028、27010~27029、27011~27030、27013~27032、27014~27033、27015~27034、27016~27035、27017~27036、27018~27037、27023~27042、27026~27045、27027~27046、27037~27056、27038~27057、27043~27062、27044~27063、27045~27064、27046~27065、27047~27066、27048~27067、27067~27086、27068~27087、27069~27088、27070~27089、27075~27094、27076~27095、27090~27109、27097~27116、27105~27124、27107~27126、27112~27131、27181~27200、27192~27211、27206~27225、27207~27226、27208~27227、27212~27231、27221~27240、27222~27241、27223~27242、27244~27263、27245~27264、27259~27278、27260~27279、27274~27293、27275~27294、27276~27295、27286~27305、27287~27306、27289~27308、27290~27309、27336~27355、27341~27360、27342~27361、27345~27364、27349~27368、27388~27407、27392~27411、27393~27412、27414~27433、27416~27435、27420~27439、27421~27440、27434~27453、27435~27454、27436~27455、27437~27456、27438~27457、27439~27458、27440~27459、27447~27466、27455~27474、27456~27475、27484~27503、27498~27517、27499~27518、27500~27519、27511~27530、27512~27531、27529~27548、27543~27562、27545~27564、27547~27566、27548~27567、27549~27568、27551~27570、27797~27816、27805~27824、27806~27825、27807~27826、27808~27827、27809~27828、27810~27829、27811~27830、27812~27831、27814~27833、27815~27834、27839~27858、27840~27859、27869~27888、27870~27889、27871~27890、27930~27949、27931~27950、27934~27953、27935~27954、27936~27955、27941~27960、27965~27984、27966~27985、27977~27996、27978~27997、27988~28007、27992~28011、28028~28047、28032~28051、28033~28052、28042~28061、28045~28064、28090~28109、28092~28111、28097~28116、28098~28117、28103~28122、28116~28135、28120~28139、28124~28143、28141~28160、28145~28164、28166~28185、28193~28212、28194~28213、28195~28214、28226~28245、28227~28246、28230~28249、28253~28272、28254~28273、28255~28274、28259~28278、28263~28282、28274~28293、28277~28296、28285~28304、28294~28313、28295~28314、28307~28326、28308~28327、28310~28329、28311~28330、28312~28331、28329~28348、28358~28377、28421~28440、28436~28455、28441~28460、28443~28458、28448~28463、28452~28471、28453~28468、28482~28501、28493~28512、28494~28513、28506~28525、28534~28553、28536~28555、28537~28556、28538~28557、 28541~28560、28549~28568、28552~28571、28554~28573、28555~28574、28556~28575、28557~28576、28558~28577、28559~28578、28560~28579、28561~28580、28575~28594、28576~28595、28577~28596、28579~28598、28580~28599、28581~28600、28582~28601、28588~28607、28590~28609、28591~28610、28592~28611、28594~28613、28595~28614、28596~28615、28605~28624、28606~28625、28607~28626、28609~28628、28610~28629、28611~28630、28612~28631、28621~28640、28622~28641、28623~28642、28624~28643、28625~28644、28626~28645、28627~28646、28636~28655、28637~28656、28638~28657、28639~28658、28648~28667、28814~28833、28815~28834、28927~28946、28928~28947、28929~28948、28930~28949、28941~28960、28942~28961、28957~28976、28960~28979、28961~28980、28962~28981、28976~28995、28986~29005、28987~29006、28988~29007、28989~29008、28993~29012、28994~29013、28995~29014、28996~29015、28997~29016、29027~29046、29028~29047、29029~29048、29051~29070、29052~29071、29073~29092、29076~29095、29088~29107、29098~29117、29100~29119、29116~29135、29117~29136、29134~29153、29164~29183、29165~29184、29166~29185、29169~29188、29175~29194、29176~29195、29177~29196、29202~29221、29243~29262、29325~29344、29326~29345、29327~29346、29328~29347、29335~29354、29336~29355、29352~29371、29353~29372、29354~29373、29360~29379、29365~29384、29366~29385、29368~29387、29370~29389、29391~29410、29446~29465、29447~29466、29448~29467、29449~29468、29454~29473、29455~29474、29456~29475、29458~29477、29461~29480、29462~29481、29464~29479、29464~29483、29465~29484、29466~29485、29467~29486、29468~29487、29469~29488、29470~29489、29471~29490、29472~29491、29475~29494、29476~29495、29487~29506、29488~29507、29491~29510、29496~29515、29502~29521、29503~29522、29504~29523、29505~29524、29506~29525、29507~29526、29508~29527、29509~29528、29510~29529、29511~29530、29512~29531、29515~29534、29516~29535、29517~29536、29518~29537、29519~29538、29536~29551、29569~29588、29574~29593、29673~29692、29702~29721、29703~29722、29725~29744、29726~29745、29727~29746、29730~29749、29744~29763、29745~29764、29746~29765、29777~29796、29779~29798、29788~29807、29789~29808、29790~29809、29795~29814、29796~29815、29797~29816、29807~29826、29811~29830、29819~29838、29822~29841、29892~29911、29893~29912、29918~29937、29921~29940、29922~29941、29923~29942、29924~29943、29926~29945、29927~29946、29928~29943、29930~29949、29951~29970、29954~29973、29957~29976、29959~29978、29960~29979、29961~29980、29963~29982、29964~29983、29965~29984、29966~29985、29967~29986、29968~29987、29972~29991、29973~29992、29974~29993、29976~29995、29977~29996、29978~29997、29979~29998、29980~29999、29981~30000、29982~30001、29983~30002、29984~30003、29985~30004、29986~30005、29987~30006、29988~30007、29989~30008、30002~30021、30006~30025、30018~30037、30021~30040、30022~30041、30024~30043、30029~30048、30031~30050、30032~30051、30033~30052、30035~30054、30037~30056、30039~30058、30042~30061、30059~30078、30063~30082、30064~30083、30075~30094、30076~30095、30079~30098、30082~30101、30086~30105、30088~30107、30089~30108、30098~30117、30100~30119、30109~30128、30110~30129、30111~30130、30112~30131、30113~30132、30115~30134、30130~30149、30131~30150、30132~30151、30142~30161、30180~30199、30181~30200、30182~30201、30183~30202、30184~30203、30185~30204、30187~30206、30188~30207、30189~30208、30192~30211、30199~30218、30204~30223、30205~30224、30212~30231、30252~30271、30254~30273、30267~30286、30268~30287、30269~30288、30272~30291、30285~30304、30293~30312、30294~30313、30295~30314、30296~30315、30309~30328、30345~30364、30350~30369、30351~30370、30378~30397、30379~30398、30380~30399、30384~30403、30386~30405、30387~30406、30396~30415、30428~30447、30448~30467、30458~30477、30460~30479、30483~30502、30508~30527、30509~30528、30510~30529、30602~30621、30604~30623、30777~30796、30779~30798、30780~30799、30781~30800、30782~30801、30783~30802、30784~30803、30785~30804、30790~30809、30791~30810、30792~30811、30793~30812、30794~30813、30866~30885、30985~31004、30992~31011、30994~31013、31011~31030、31015~31034、31019~31038、31041~31060、31043~31062、31052~31071、31054~31073、31060~31079、31064~31083、31066~31085、31067~31086、31070~31089、31071~31090、31072~31091、31073~31092、31074~31093、31075~31094、31076~31095、31077~31096、31078~31097、31079~31098、31082~31101、31104~31123、31107~31126、31118~31137、31128~31147、31129~31148、31130~31149、31173~31192、31215~31234、31222~31241、31224~31243、31226~31245、31236~31255、31237~31256、31241~31260、31242~31261、31243~31258、31254~31273、31255~31274、31256~31275、31270~31289、31280~31299、31282~31301、31284~31303、31285~31304、31286~31305、31288~31307、31289~31308、31291~31310、31292~31311、31293~31312、31294~31313、31295~31314、31296~31315、31313~31332、31315~31334、31317~31336、31444~31463、31456~31475、31457~31476、31458~31477、31658~31677、31659~31678、31660~31679、31674~31693、31676~31695、31677~31696、31680~31699、31681~31700、31682~31701、31683~31702、31707~31726、31708~31727、31710~31729、31719~31738、31720~31739、31730~31749、31731~31750、31735~31754、31737~31756、31738~31757、31740~31759、31741~31760、31751~31770、31752~31771、31755~31774、31758~31777、31765~31780、31765~31784、31766~31785、31792~31811、31793~31812、31810~31829、31811~31830、31812~31831、31813~31832、31814~31833、31815~31834、31816~31835、31818~31837、31840~31859、31842~31861、31850~31869、31851~31870、31852~31871、31853~31872、31854~31873、31855~31874、31864~31883、31865~31884、31883~31902、31886~31905、31888~31907、31941~31960、31946~31965、32006~32025、32096~、 32115、32246~32265、32259~32278、32353~32372、32354~32373、32355~32374、32356~32375、32357~32376、32359~32378、32367~32386、32401~32420、32424~32439、32451~32470、32456~32475、32457~32476、32473~32492、32480~32499、32554~32573、32661~32680、32662~32681、32676~32695、32677~32696、32728~32747、32768~32787、32813~32828、32814~32833、32825~32844、32874~32893、32875~32894、32889~32908、32947~32966、32957~32976、32961~32980、32962~32981、32967~32986、32968~32987、32969~32988、32970~32989、33037~33056、33046~33065、33346~33365、33347~33366、33356~33375、33357~33376、33358~33377、33359~33378、33361~33380、33435~33454、33437~33456、33438~33457、33439~33458、33443~33462、33446~33465、33456~33475、33475~33494、33476~33495、33493~33512、33496~33515、33497~33516、33498~33517、33507~33526、33508~33527、33511~33530、33549~33568、33571~33590、33587~33606、33588~33607、33600~33619、33601~33620、33604~33623、33605~33624、33606~33625、33619~33638、33622~33641、33625~33644、33626~33645、33631~33646、33636~33655、33650~33669、33679~33698、33680~33699、33683~33702、33684~33703、33685~33704、33686~33705、33688~33707、33706~33725、33713~33732、33714~33733、33754~33773、33756~33775、33762~33781、33764~33783、33765~33784、33769~33788、33793~33812、33807~33826、33865~33884、33867~33886、33869~33888、33883~33902、33884~33903、33922~33941、33946~33965、33948~33967、33950~33969、33951~33970、33952~33971、33953~33972、33958~33977、33959~33978、34109~34128、34110~34129、34113~34132、34117~34136、34129~34144、34157~34176、34158~34177、34159~34178、34160~34179、34162~34181、34165~34184、34166~34185、34178~34197、34198~34217、34214~34233、34223~34242、34278~34297、34298~34317、34309~34328、34327~34346、34329~34348、34330~34349、34369~34388、34383~34402、34386~34405、34387~34406、34407~34426、34409~34428、34411~34430、34418~34437、34438~34457、34440~34459、34475~34494、34479~34498、34481~34500、34485~34504、34487~34506、34488~34507、34489~34508、34490~34509、34492~34511、34493~34512、34494~34513、34502~34521、34504~34523、34505~34524、34506~34525、34515~34534、34536~34555、34537~34556、34547~34566、34548~34567、34564~34583、34566~34585、34567~34586、34568~34587、34581~34600、34582~34601、34647~34666、34648~34667、34649~34668、34652~34671、34655~34674、34656~34675、34657~34676、34712~34731、34718~34737、34719~34738、35016~35035、35017~35036、35018~35037、35019~35038、35021~35040、35023~35042、35057~35076、35058~35077、35059~35078、35069~35088、35096~35115、35097~35116、35100~35119、35101~35120、35102~35121、35104~35123、35267~35286、35289~35308、35336~35355、35337~35356、35343~35362、35344~35363、35345~35364、35349~35368、35350~35369、35351~35370、35381~35400、35382~35401、35385~35404、35391~35406、35396~35411、35401~35420、35402~35421、35423~35442、35424~35443、35425~35444、35435~35454、35438~35457、35442~35461、35445~35464、35446~35465、35495~35510、35502~35517、35509~35524、35511~35530、35512~35531、35514~35533、35515~35534、35516~35535、35520~35535、35533~35552、35543~35562、35547~35566、35570~35589、35613~35632、35615~35634、35619~35638、35620~35639、35621~35640、35631~35650、35639~35658、35640~35659、35642~35661、35643~35662、35644~35663、35652~35671、35653~35672、35654~35673、35655~35674、35657~35676、35664~35683、35667~35686、35668~35687、35675~35690、35681~35700、35683~35702、35685~35704、35705~35724、35706~35725、35709~35728、35711~35730、35712~35731、35719~35738、35720~35739、35736~35755、35745~35764、35746~35765、35747~35766、35748~35767、35753~35772、35764~35783、35765~35784、35769~35788、35783~35802、35784~35803、35788~35807、35789~35808、35799~35818、35802~35821、35809~35828、35810~35829、35811~35830、35812~35831、35815~35834、35816~35835、35817~35836、35818~35837、35819~35838、35820~35839、35830~35849、35844~35859、35877~35896、35879~35898、35881~35900、35882~35901、35914~35933、35987~36006、35988~36007、35992~36011、35994~36013、35995~36014、35996~36015、35998~36017、36007~36026、36021~36040、36022~36041、36023~36042、36065~36084、36068~36087、36069~36088、36109~36128、36112~36131、36113~36132、36116~36135、36121~36140、36124~36143、36125~36144、36181~36200、36182~36201、36186~36205、36248~36267、36251~36270、36262~36281、36280~36299、36281~36300、36286~36305、36287~36306、36288~36307、36289~36308、36292~36311、36313~36332、36426~36445、36833~36852、36959~36978、36997~37012、37002~37021、37018~37037、37019~37038、37020~37039、37029~37048、37031~37050、37032~37051、37033~37052、37034~37053、37035~37054、37036~37055、37070~37089、37071~37090、37074~37093、37075~37094、37076~37095、37086~37105、37087~37106、37088~37107、37089~37108、37093~37112、37125~37144、37135~37154、37213~37232、37224~37243、37241~37260、37266~37285、37267~37286、37280~37299、37281~37300、37291~37310、37292~37311、37308~37327、37318~37337、37340~37355、37341~37356、37343~37358、37353~37372、37355~37370、37356~37375、37367~37386、37368~37387、37369~37388、37370~37389、37375~37394、37390~37409、37391~37410、37392~37407、37392~37411、37401~37420、37402~37421、37406~37425、37407~37426、37416~37435、37420~37439、37425~37444、37436~37455、37480~37499、37481~37500、37482~37501、37483~37502、37529~37548、37530~37549、37531~37550、37562~37581、37614~37633、37617~37636、37634~37649、37637~37656、37660~37679、37665~37684、37676~37695、37680~37699、37886~37905、37888~37907、37889~37908、37890~37909、37923~37942、37924~37943、37968~37983、38042~38061、38058~38073、38060~38079、38095~38114、38113~38132、38114~38133、38115~38134、38116~38135、38121~38140、38139~38158、38140~38159、38145~38164、38154~38173、 38155~38174, 38156~38175, 38157~38176, 38159~38178, 38168~38187, 38171~38190, 38172~38191, 38175~38194, 38176~38195, 38177~38196, 38181~38196, 38204~38223, 38205~38224, 38272~38291, 38273~38292, 38277~38296, 38279~38298, 38295~38314, 38318~38337, 3 8319~38338, 38321~38340, 38322~38341, 38326~38345, 38328~38347, 38361~38380, 38362~38381, 38363~38382, 38367~38386, 38375~38394, 38417~38436, 38468~38487, 38469~38488, 38470~38489, 38516~38535, 38537~38556, 38540~38559, 38542~38561, 38552~38571, 385 53~38572, 38557~38576, 38583~38602, 38620~38639, 38623~38642, 38633~38652, 38659~38678, 38698~38717, 38720~38739, 38743~38762, 38745~38764, 38747~38766, 38783~38802, 38785~38804, 38788~38807, 38789~38808, 38790~38809, 38791~38810, 38792~38811, 38829 or at least 80% complementary to an isometric portion within nucleobases 216-235, 218-237, 220-239, 521-540, 670-689, 1119-1138, 1283-1302, 1284-1303, 1287-1306, 1288-1307, 1580-1599, 1581-1600 of SEQ ID NO: 2; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an IFNAR1 nucleic acid.

[0314] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, the nucleic acid base sequence of the first modified oligonucleotide being any one of nucleic acid bases 5084 to 5133, 19997 to 20061, 20076 to 20133, 20528 to 20611, 20616, 22294 to 22329, 22453 to 22476, 2259722 of SEQ ID NO: 1. 595-22626, 25530-25565, 25606-25652, 25710-25767, 25768-25827, 28421-28468, 29924-29949, 29968-30021, 31072-31096, 31792-31837, 32353-32386, or 35016-35042; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an IFNAR1 nucleic acid.

[0315] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 12 to 2687, wherein each thymine is replaced by uracil; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an IFNAR1 nucleic acid.

[0316] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0317] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 12 to 89, in which each thymine is replaced with uracil; and A second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0318] In certain embodiments, the first oligomeric compound is an antisense compound.In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide.In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0319] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, such as bicyclic sugar moieties comprising a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-, and non-bicyclic sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F sugar moieties and 2'-OMe sugar moieties.

[0320] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which may be GNA.

[0321] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond.

[0322] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0323] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0324] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0325] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the 5'-stabilizing phosphate group includes a cyclopropylphosphonate or an (E)-vinylphosphonate.

[0326] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0327] In any of the oligomeric duplexes described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0328] In certain embodiments, the antisense agent comprises an antisense compound, which comprises an oligomeric compound or oligomeric duplex as described herein. In certain embodiments, the antisense agent, which may comprise an oligomeric compound or oligomeric duplex as described herein, is an RNAi agent capable of reducing the amount of IFNAR1 nucleic acid by activating RISC / Ago2.

[0329] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together at their 3' ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, e.g., a tetraethylene glycol linker. Certain such compounds are described, for example, in Alterman, et al., Nature Biotech., 37:844-894, 2019.

[0330] I. Specific Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides that consist of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides include at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides include at least one modified nucleoside (including modified sugar moieties and / or modified nucleobases) and / or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0331] A. Certain Modified Nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified oligonucleotides:

[0332] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to those of other types of modified sugar moieties.

[0333] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of a non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include 2'-F, 2'-OCH 3("OMe" or "O-methyl"), and 2'-O(CH 2 ) 2 OCH 3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O.C. 1 -C 10 Alkoxy, OC 1 -C 10 Substituted alkoxy, OC 1 -C 10 Alkyl, OC 1 -C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(=O)-N(R m )(R n ), wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 Alkyl, -O(CH 2 ) 2 ON(CH 3 ) 2 ("DMAOE"), 2'-O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2("DMAEOE"), as well as the 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable 4' substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5' substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as, for example, 2'-F-5'-methyl sugar moieties, and the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0334] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH 2 , N 3 , OCF 3 , O.C.H. 3 , O(CH 2 ) 3 NH 2 , C.H. 2 CH=CH 2 , O.C.H. 2 CH=CH 2 , O(CH2 ) 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamides (OCH 2 C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 It is an alkyl.

[0335] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside is F, OCF 3 , O.C.H. 3 , O(CH 2 ) 2 OCH 3 (MOE), O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , O(CH 2 ) 2 ON(CH 3 ) 2 ("DMAOE"), O.C.H. 2 OCH 2 N(CH 2 ) 2 ("DMAEOE"), and OCH 2 C(=O)-N(H)CH3 ("NMA").

[0336] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, OCH 3 , and O(CH 2 ) 2 OCH 3 The sugar moiety comprises a non-bridging 2'-substituent selected from:

[0337] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2' position relative to the 2'-deoxyfuranosyl sugar moiety. Thus, such sugar moieties can have a total of 16 isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0338] In naturally occurring nucleic acids, sugars are linked to each other at 3' and 5'.In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as 2'-position, or linked back from 5' to 3'.For example, when linkage is at 2'-position, 2'-substituent may be at 3'-position instead.

[0339] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring to form a second ring resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4' and 2' bridging sugar substituents include 4'-CH 2 -2',4'-(CH 2 ) 2 -2',4'-(CH 2 ) 3 -2',4'-CH 2 -O-2' ("LNA"), 4'-CH 2 -S-2',4'-(CH 2 ) 2 -O-2' ("ENA"), 4'-CH(CH 3 )-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH 2 -O-CH 2 -2',4'-CH 2 -N(R)-2',4'-CH(CH 2 OCH 3 )-O-2' ("constrained MOE" or "cMOE") and its analogs (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 8,022,193), 4'-C(CH 3 )(CH 3 )-O-2' and its analogs (see, e.g., Seth et al., US8,278,283), 4'-CH 2 -N(OCH 3 )-2' and its analogs (see, e.g., Prakash et al., US 8,278,425), 4'-CH 2-ON(CH 3 )-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH 2 -C(H)(CH 3 )-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH 2 -C(=CH 2 )-2' and its analogs (see, e.g., Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2',4'-CH 2 -ON(R)-2' and 4'-CH 2 -N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C 1 -C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0340] In certain embodiments, such 4' and 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a ) 2 -, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, a hydroxyl, C 1 -C 12 Alkyl, substituted C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, substituted C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, Substituted C 2 -C 12 Alkynyl, C 5 -C 20 Aryl, Substituted C 5 -C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C 5 -C 7 Alicyclic radicals, substituted C 5 -C 7 Alicyclic radicals, halogens, OJ 1 , N.J. 1 J 2 , S.J. 1 , N 3 , COOJ 1 , acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) 2 -J 1 ), or sulfoxyl (S(=O)-J 1 ) and each J 1 and J 2 are independently H, C 1 -C 12 Alkyl, substituted C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, substituted C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, Substituted C 2 -C 12 Alkynyl, C 5 -C 20 Aryl, Substituted C 5 -C20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C 1 -C 12 Aminoalkyl, substituted C 1 -C 12 aminoalkyl, or a protecting group.

[0341] The particle size of the solution was determined by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456、Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7、Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243、Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al.US6,770,748,Imanishi et al al.,USRE44,779; Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644; al.,US8,153,365、Wengel et al.,US7,572,582、Ramasamy et al.,US6,525,191,Torsten et al.,WO2004 / 106356,Wengel et al.,WO1999 / 014226、Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in either the α-L or β-D configuration.

[0342] [ka]

[0343] α-L-Methyleneoxy(4'-CH 2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general term bicyclic nucleosides includes both isomeric configurations. Where the positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0344] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).

[0345] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, the modified sugar moiety also includes bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5' position.

[0346] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0347] [ka]

[0348] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), as well as nucleosides including the additional modified THP compound having the formula:

[0349] [ka]

[0350] wherein, for each of the modified THP nucleosides above, independently Bx is a nucleobase moiety, T 3 and T 4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or 3 and T 4 is an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide, and T 3 and T4 the other is H, a hydroxyl protecting group, a conjugate group, or a 5' or 3' terminal group; q 1 , q 2 , q 3 , q 4 , q 5 , q 6 , and q 7 are each independently H, C 1 -C 6 Alkyl, substituted C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl, substituted C 2 -C 6 Alkenyl, C 2 -C 6 Alkynyl, or substituted C 2 -C 6 is alkynyl, R 1 and R 2 Each of is independently hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 , S.J. 1 , N 3 ,OC(=X)J 1 ,OC(=X)NJ 1 J 2 , N.J. 3 C(=X)NJ 1 J 2 and CN, where X is O, S, or NJ 1 and each J 1 , J 2 , and J 3 are independently H or C 1 -C 6 It is an alkyl.

[0351] In certain embodiments, q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 and each is H. In certain embodiments, q 1 , q2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 At least one of R is methyl. 1 and R 2 and R is F. In certain embodiments, R 1 is F and R 2 is H, and in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy, R 2 is H.

[0352] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685, Summerton et al., US 5,166,315, Summerton et al., US 5,185,444, and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:

[0353] [ka]

[0354] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0355] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0356] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked acyclic nucleic acid in which one of the sugar linkages has been removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0357] In certain embodiments, the sugar surrogate is glycerol, found in the GNA (glycol nucleic acid) nucleoside shown below:

[0358] [ka]

[0359] In the formula, Bx represents any nucleic acid base.

[0360] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art and can be used in the modified nucleosides.

[0361] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobases.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, which are referred to as abasic nucleosides.In certain embodiments, modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides that contain hypoxanthine nucleobases).

[0362] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH 3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenos ... The base is selected from the group consisting of cytosine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal base, hydrophobic base, promiscuous base, size-expanded base and fluorinated base. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases also include those in which the purine or pyrimidine base is replaced by other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0363] Publications teaching the preparation of some of the above and other modified nucleobases include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0364] 3. Specific modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphates including phosphorodithioates ("HS-P=S"). Exemplary internucleoside linkage groups that do not contain phosphorus include methylenemethylimino (-CH 2 -N(CH 3 )-O-CH 2 -), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH 2 -O-), and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-). Compared to naturally occurring phosphate linkages, modified internucleoside linkages can be used to modify, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0365] In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage comprises the following formula:

[0366] [ka]

[0367] wherein, independently for each internucleoside linkage group of the modified oligonucleotide: X is selected from O or S; R 1 , H, C 1 -C 6 Alkyl and substituted C 1 -C 6 alkyl, T is SO 2 R 2 , C(=O)R 3 , and P(=O)R 4 R 5 where: R 2 is an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, C 1 -C 6 Alkoxy, C 1 -C 6 Alkyl, C 1 -C 6 Alkenyl, C 1 -C 6 Alkynyl, Substituted C 1 -C 6 Alkyl, substituted C 1 -C 6 Alkenyl-substituted C 1 -C 6 alkynyl, and a conjugate group; R 3 is aryl, substituted aryl, CH 3 , N(CH 3 ) 2 , O.C.H. 3 and a conjugate group; R 4 is OCH 3 , O.H., C. 1 -C 6 Alkyl, substituted C 1 -C 6 alkyl, and a conjugate group; R 5 is OCH 3, O.H., C. 1 -C 6 Alkyl and substituted C 1 -C 6 is selected from alkyl.

[0368] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula:

[0369] [ka]

[0370] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidates each comprise one or more of the following formulae, where "B" represents a nucleobase:

[0371] [ka]

[0372] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides that contain internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides that contain stereorandom internucleoside linkages, or as a population of modified oligonucleotides that contain phosphorothioate or other linkages that contain chiral centers in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, where all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the population of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, where all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be made using a synthesis method in which the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage is randomly selected. Nevertheless, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereochemical configuration.In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate or mesyl phosphoramidate internucleoside bonds in a specific stereochemical configuration that is independently selected.In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate bond is present in at least 65% of the molecules of the population.In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate bond is present in at least 70% of the molecules of the population.In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate bond is present in at least 80% of the molecules of the population.In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate bond is present in at least 90% of the molecules of the population.In certain embodiments, the particular arrangement of the particular phosphorothioate or mesyl phosphoramidate bond is present in at least 99% of the molecules of the population. Such chiral enriched population of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Rp) configuration. In certain embodiments, the (Rp) and / or (Sp) phosphorothioate-containing modified oligonucleotides each comprise one or more of the following formulae, where "B" represents a nucleobase:

[0373] [ka]

[0374] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0375] Neutral internucleoside linkages include phosphotriesters, methylphosphonates, and MMI (3'-CH 2 -N(CH 3 )-O-5'), Amide-3 (3'-CH 2 -C(=O)-N(H)-5'), amide-4 (3'-CH 2 -N(H)-C(=O)-5'), formacetal (3'-O-CH 2 -O-5'), methoxypropyl (MOP), and thioform acetal (3'-S-CH 2-O-5'). Further neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include N, O, S, and CH 2 Examples of the nonionic bond include a mixture of the components:

[0376] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides as shown below:

[0377] [ka]

[0378] In the formula, each Bx independently represents any nucleobase.

[0379] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of an oligonucleotide) and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) may be attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to one or both ends of an oligonucleotide.

[0380] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., attached to the last nucleoside at one end of the oligonucleotide), and thus, there is only one internucleoside bond. In certain such embodiments, further features (such as conjugate groups) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties may be attached to one or both ends of the oligonucleotide.

[0381] In certain embodiments, the nucleic acids may be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below.

[0382] [ka]

[0383] In the formula, each Bx represents any nucleobase.

[0384] B. Specific motifs In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and different modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif refers to modifications to nucleobases independent of the sequence of nucleobases).

[0385] 1. Specific glycomotifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in defined patterns or sugar motifs along the oligonucleotide or a region thereof, optionally including, but not limited to, any of the sugar modifications discussed herein.

[0386] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions, or "wings," and a central or internal region, or "gap." The three regions of the gapmer motif (the 5' wing, the gap, and the 3' wing) form a contiguous nucleoside sequence in which at least some of the sugar moieties of each nucleoside in both wings are different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0387] In certain embodiments, a gapmer wing comprises 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0388] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0389] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-OMe sugar moiety.

[0390] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer would consist of each wing containing three linked nucleosides and a gap containing 10 linked nucleosides. When such a designation is followed by a specific modification, the modification is of each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer would consist of a 5'-wing containing five linked 2'-MOE nucleosides, a gap containing 10 linked 2'-β-D-deoxynucleosides, and a 3'-wing containing five linked 2'-MOE nucleosides. The 6-10-4MOE gapmer consists of a 5'-wing containing 6 linked 2'-MOE nucleosides, a gap containing 10 linked 2'-β-D-deoxynucleosides, and a 3'-wing containing 4 linked 2'-MOE nucleosides. The 3-10-3cEt gapmer consists of a 5'-wing containing 3 linked cEt nucleosides, a gap containing 10 linked 2'-β-D-deoxynucleosides, and a 3'-wing containing 3 linked cEt nucleosides.

[0391] In certain embodiments, modified oligonucleotides have a sugar motif selected from, from 5' to 3': eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0392] In certain embodiments, modified oligonucleotides have a sugar motif selected from, from 5' to 3': eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0393] In certain embodiments, modified oligonucleotides have a sugar motif from 5' to 3': kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt modified sugar moiety.

[0394] In certain embodiments, modified oligonucleotides have a sugar motif from 5' to 3': eeeeedyddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "y" represents a 2'-OMe sugar moiety.

[0395] In certain embodiments, modified oligonucleotides have a sugar motif from 5' to 3': eeeeeedyddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "y" represents a 2'-OMe sugar moiety.

[0396] In certain embodiments, modified oligonucleotides have a sugar motif from 5' to 3': kkkdyddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "k" represents a cEt modified sugar moiety, and each "y" represents a 2'-OMe sugar moiety.

[0397] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0398] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases.In certain such embodiments, the block is at the 3' end of the oligonucleotide.In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide.In certain embodiments, the block is at the 5' end of the oligonucleotide.In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0399] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside that comprises a modified nucleobase. In certain such embodiments, one nucleoside that comprises a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of such nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0400] 3. Specific internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0401] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages in the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in both wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, where the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in both wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0402] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sosoosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sossoosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'):sssossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'):sssssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sosooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sosssosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sooossssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soooossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sooooosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the internucleoside linkage motif (5' to 3'): soossssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soossssssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soosoosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): soossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): ssooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sssoosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the internucleoside linkage motif (5' to 3'): ssssossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): ssoooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif (5' to 3'): sssooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the internucleoside linkage motif (5' to 3'): ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0403] In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif that comprises one or more mesyl phosphoramidate linkage groups.In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motif herein are replaced with mesyl phosphoramidate linkage groups.

[0404] C. A specific length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides, 13-25 nucleobases long, for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases long containing 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0405] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X≦Y. For example, in certain embodiments, the oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13~16 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces,17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 1 8~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19 ~29 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~ 27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces , 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, 2 It consists of 4 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0406] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0407] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0408] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further represented by their nucleobase sequences.In certain embodiments, oligonucleotides have nucleobase sequences that are complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.In certain embodiments, a region or full length of an oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0409] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to one or both termini and / or any internal position of the oligonucleotide. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of an oligonucleotide.

[0410] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0411] A. Specific Conjugation Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to the pharmacodynamic properties, pharmacokinetic properties, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.

[0412] In certain embodiments, one or more properties of the modified oligonucleotide can be optimized by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to the modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, for example, a non-carbohydrate (preferably cyclic) carrier with a carbohydrate ligand attached. The ribonucleotide subunit in which the ribose sugar of the subunit is replaced in this manner is referred to herein as a modified sugar moiety, ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon ring system, i.e., one or more ring atoms can be heteroatoms, for example, nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, for example, fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0413] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, for example, a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been described previously, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids, 1999, 10, 1024-1026), and the like. Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1995, 36, 3651-3654). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid, palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0414] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0415] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, whose alkyl chains have one or more unsaturated bonds.

[0416] In certain embodiments, the conjugate group is a lipid having the following structure:

[0417] [ka]

[0418] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0419] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbituric acid, cephalosporin, sulfa drug, antidiabetic drug, antibacterial drug or antibiotic.

[0420] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In certain oligomeric compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In certain embodiments, said conjugate linker comprises a chain structure such as hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0421] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0422] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0423] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate moiety to a compound such as an oligonucleotide provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a specific site on the compound, and the other is selected to react with the conjugate moiety. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, a bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0424] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C 1 -C 10 Alkyl, substituted or unsubstituted C 2 -C 10 Alkenyl, or substituted or unsubstituted C 2 -C 10 and alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0425] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is usually desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are usually linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0426] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and not comprising a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises only 1 linker nucleoside.

[0427] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable that the conjugate group is cleaved to release the unconjugated or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0428] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide.In certain embodiments, the cleavable bond is one or both esters of phosphodiester.In certain embodiments, the cleavable moiety comprises phosphate or phosphodiester.In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0429] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, the cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0430] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0431] [ka]

[0432] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0433] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0434] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand, hi certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branching group.

[0435] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0436] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0437] [ka]

[0438] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0439] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0440] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0441] B. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphonates, including but not limited to 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0442] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that they cause significant undesired antisense activity.

[0443] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides are tolerated within the gapmer gap.

[0444] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0445] In certain embodiments, the hybridization of antisense compounds to target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the change of splicing of the target nucleic acid.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with proteins or other nucleic acids.In certain embodiments, the hybridization of antisense compounds to target nucleic acid results in the change of translation of the target nucleic acid.

[0446] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting changes in the amount of target nucleic acid or the amount of protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in phenotype in cells or animals.

[0447] IV. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA (including introns, exons, and untranslated regions). In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is located at least 50% within an intron.

[0448] A. Complementarity / Mismatch and Double-Stranded Complementarity to Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or completely complementary to the target nucleic acid. In certain embodiments, the region of complete complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0449] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Moreover, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem oligonucleotides consisting of 14 nucleobases, as well as 28 and 42 nucleobase oligonucleotides containing two or three of the tandem oligonucleotide sequences, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of these three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lesser extent than the 28 or 42 nucleobase oligonucleotides.

[0450] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity with respect to the target is reduced by such mismatches, but the activity with respect to the non-target is more greatly reduced. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located in the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain embodiments, the mismatches are at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain embodiments, the mismatches are at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain embodiments, the mismatches are at 4, 3, 2, or 1 positions from the 3' end of the wing region.

[0451] B.IFNAR1 In certain embodiments, the oligomeric agent or oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, and the target nucleic acid is an IFNAR1 nucleic acid. In certain embodiments, the IFNAR1 nucleic acid has a sequence as shown in SEQ ID NO: 1 (GENBANK Accession No. NC_000021.9, truncated from nucleoside 33321001 to 33363000) or SEQ ID NO: 2 (GENBANK Accession No. NM_000629.2). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of IFNAR1 RNA, and in certain embodiments reduces the amount of IFNAR1 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0452] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in a pharmacologically relevant cell. In certain embodiments, the pharmacologically relevant cell is a neuron or a glial cell. In certain embodiments, the pharmacologically relevant cell is an astrocyte or a microglial cell. In certain embodiments, the pharmacologically relevant cell is a vascular smooth muscle cell, a vascular endothelial cell, or a pericyte.

[0453] V. SPECIFIC METHODS AND USES Certain embodiments provided herein relate to methods of inhibiting expression of IFNAR1, which may be useful in treating diseases associated with neuroinflammation in a subject, such as diseases associated with elevated type I interferon signaling or overexpression of type I interferon, by administering an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid.

[0454] Examples of diseases that can be treated with the oligomeric agents, oligomeric compounds, modified oligonucleotides, oligomeric duplexes, and methods provided herein include neurological diseases or conditions associated with neuroinflammation, e.g., diseases associated with elevated type I interferon signaling or overexpression of type I interferon, selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, a method comprises administering to a subject an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, all of which have a nucleobase sequence complementary to an IFNAR1 nucleic acid. In certain embodiments, the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, a method of treating a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia in a subject comprises administering to the subject a therapeutically effective amount of an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, each of which has a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby treating the subject. In certain embodiments, administering the therapeutically effective amount of the oligomeric agent, oligomeric compound, or modified oligonucleotide ameliorates a symptom or characteristic of the disease or condition associated with neuroinflammation.In certain embodiments, the symptom or feature is selected from epilepsy, feeding difficulties, dystonia, spasticity, motor development delay, language development delay, social development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and cerebellar myelopathy. In certain embodiments, administering the therapeutically effective amount of the oligomeric agent, oligomeric compound, or modified oligonucleotide reduces type I IFN signaling or lymphocytosis in the cerebrospinal fluid of the subject.

[0455] In certain embodiments, the method of inhibiting the expression of IFNAR1 nucleic acid, for example, RNA, in a subject with a disease associated with neuroinflammation, for example, the disease associated with the increase in the signal transduction of type I interferon or the overexpression of type I interferon, comprises administering to the subject an oligomeric agent, an oligomeric compound, a modified oligonucleotide, or an oligomeric duplex, each of which has a nucleobase sequence complementary to IFNAR1 nucleic acid, thereby inhibiting the expression of IFNAR1 nucleic acid in the subject.In certain embodiments, administering the oligomeric agent, the oligomeric compound, the modified oligonucleotide, or the oligomeric duplex inhibits the expression of IFNAR1 in the brain or spinal cord. In certain embodiments, the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, a method of inhibiting expression of an IFNAR1 nucleic acid in a cell comprises contacting the cell with an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, each of which has a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby inhibiting expression of an IFNAR1 nucleic acid in the cell. In certain embodiments, the cell is a glial cell, e.g., an astrocyte or a microglial cell. In certain embodiments, the cells are present in a subject having a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia.

[0456] In certain embodiments, there are provided oligomeric agents, oligomeric compounds, modified oligonucleotides, or oligomeric duplexes, each of which has a nucleobase sequence complementary to an IFNAR1 nucleic acid, for use in treating a disease associated with neuroinflammation, e.g., a disease associated with elevated type I interferon signaling or overexpression of IFNa. In certain embodiments, the disease is a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for use in ameliorating a symptom or characteristic of a disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the symptom or characteristic is selected from epilepsy, feeding difficulties, dystonia, spasticity, motor development delay, language development delay, social development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and cerebellar myelopathy. In certain embodiments, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of a subject.

[0457] In certain embodiments, there is provided an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid, for the manufacture or preparation of a medicament for the treatment of a disease associated with neuroinflammation, e.g., a disease associated with elevated type I interferon signaling or overexpression of IFNa. In certain embodiments, the disease is a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for the amelioration of symptoms or characteristics associated with Aicardi-Goutières syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the symptoms or characteristics are selected from epilepsy, feeding difficulties, dystonia, spasticity, motor development delay, language development delay, social development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and cerebellar myelopathy. In certain embodiments, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of a subject.

[0458] In any of the methods or uses described herein, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex may be any described herein.

[0459] VI. Certain Pharmaceutical Compositions In certain embodiments, provided herein is a pharmaceutical composition comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0460] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0461] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0462] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0463] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0464] In certain embodiments, the pharmaceutical composition comprising the oligomeric compound includes any pharma- ceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprising one or more oligonucleotides can provide (directly or indirectly) a biologically active metabolite or residue thereof upon administration to an animal, including a human. Thus, for example, the present disclosure also relates to pharma- ceutically acceptable salts of the oligomeric compound, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0465] Lipid moieties are used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made of a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase distribution of drugs to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase distribution of drugs to adipose tissue. In certain embodiments, lipid moieties are selected to increase distribution of drugs to muscle tissue.

[0466] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0467] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0468] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may be varied significantly without significantly altering their solubility and toxicity. Furthermore, the identity of the co-solvent components may be varied, for example, other surfactants may be substituted for Polysorbate 80™, the fraction size of polyethylene glycol may be changed, other biocompatible polymers, such as polyvinylpyrrolidone, may replace polyethylene glycol, and other sugars or polysaccharides may replace dextrose.

[0469] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are contained in unit dosage form, such as ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0470] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in a protonated (free acid) form or in an ionized (salt) form associated with a cation, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anionic and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms that are all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily show a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, structures showing the free acid of a compound followed by the term "or a salt thereof" explicitly include all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain instances, one or more specific cations are identified.

[0471] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl until the desired pH is reached.

[0472] In this specification, a certain dose is described. The dose may be in the form of a dose unit. For clarity, a dose (or a dose unit) in milligrams of a modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with an anionic form and a salt form. However, for the purpose of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to be present as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when a modified oligonucleotide or oligomeric compound is contained in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of this proton is taken into account in the weight of the dose, and the mass of the Na+ ion is not taken into account in the weight of the dose. Thus, for example, a dose or dose unit of compound number 1492069 of 10 mg is equal to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.76 mg of solvent-free, sodium acetate-free, anhydrous sodiated compound number 1492069. When an oligomeric compound contains a conjugate group, the mass of the conjugate group can be included in calculating the dosage of such oligomeric compound. When the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating dosage.

[0473] VII. Specific Hotspot Areas 1. Nucleic acid bases 5085 to 5133 of SEQ ID NO:1 In certain embodiments, nucleobases 5085-5133 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 5085-5133 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0474] The nucleobase sequences of SEQ ID NOs: 31, 33, 37, 69, 376, 411, 528, 616, 709, 766, 838, and 945 are complementary to equal-length portions of nucleobases 5085 to 5133 of SEQ ID NO:1.

[0475] The nucleobase sequences of compound numbers 1273156, 1273157, 1273160, 1273190, 1321435, 1322469, 1322618, 1322678, 1322794, 1322801, 1323239, and 1323343 are complementary to an isometric portion of nucleobases 5085 to 5133 of SEQ ID NO:1.

[0476] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 5085-5133 of SEQ ID NO:1 achieve at least 38% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 5085-5133 of SEQ ID NO:1 achieve an average of 61% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0477] 2. Nucleic acid bases 19997 to 20061 of SEQ ID NO: 1 In certain embodiments, nucleobases 19997-20061 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 19997-20061 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0478] The nucleobase sequences of SEQ ID NOs: 13, 15, 18, 116, 187, 1604, 1657, 1779, 1809, 1868, 1955, 2079, 2156, 2231, 2304, 2334, 2434, 2531, 2669, 2670, and 2669 are complementary to an isometric portion of nucleobases 19997 to 20061 of SEQ ID NO:1.

[0479] Compound numbers 1273127, 1273129, 1273132, 1321102, 1321374, 1321458, 1321651, 1321671, 1321717, 1321779, 1321943, 1322460, 1322611, 1322887, 1322962, 1323010, 1323056, 1323090, 1489524, 1489525, 1489527, 1489531, 1489532, 1489533, 1489534, 1489535, 1489536, 1521445, 1521446, 1521447, The nucleobase sequences of 1521448, 1521449, 1521593, 1521594, 1521595, 1521596, 1521597, 1521598, 1521599, 1521600, 1521601, 1521602, 1521603, 1521604, 1521608, 1521609, 1521610, 1521611, 1521612, 1521613, 1521614, 1521615, 1521616, 1521617, and 1521618 are complementary to an isometric portion within nucleobases 19997 to 20061 of SEQ ID NO:1.

[0480] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19997-20061 of SEQ ID NO:1 achieve at least a 28% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 19997-20061 of SEQ ID NO:1 achieve an average of a 65% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0481] 3. Nucleic acid bases 20076 to 20133 of SEQ ID NO: 1 In certain embodiments, nucleobases 20076-20133 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 20076-20133 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0482] The nucleobase sequences of SEQ ID NOs: 709, 714, 811, 818, 933, 943, 1004, 1017, 1091, 1120, 1240, 1266, 1416, 1424, 2556, 2557, 2664, 2665, 2666, 2667, 2668, and 2682 are complementary to an isometric portion of nucleobases 20076 to 20133 of SEQ ID NO:1.

[0483] Compound numbers 1320982, 1321049, 1321230, 1321330, 1321817, 1322707, 1322793, 1323059, 1323169, 1323314, 1410683, 1413523, 1413529, 1489455, 1489456, 1489457, 1489458, The nucleobase sequences of 1489459, 1489477, 1489478, 1489479, 1489480, 1489481, 1489482, 1489483, 1489484, 1489485, 1489486, and 1489487 are complementary to an isometric portion of nucleobases 20076 to 20133 of SEQ ID NO:1.

[0484] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 20076-20133 of SEQ ID NO:1 achieve at least a 28% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 20076-20133 of SEQ ID NO:1 achieve an average of a 60% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0485] 4. Nucleic acid bases 20528 to 20616 of SEQ ID NO:1 In certain embodiments, nucleobases 20528-20616 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal length portion within nucleobases 20528-20616 of SEQ ID NO:1. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0486] The nucleobase sequences of SEQ ID NOs: 1952, 1980, 2040, 2069, 2164, 2195, 2272, 2299, 2388, 2641, 2642, 2643, 2644, 2645, 2646, 2683, and 2684 are complementary to an equal length portion of nucleobases 20528 to 20616 of SEQ ID NO:1.

[0487] Compound numbers 1321408, 1321541, 1321751, 1321878, 1323173, 1323224, 1413519, 1489468, 1489469, 1489471, 1489472, 1489473, 1489474, 1489475, 1489476, 1489488, 1489489, 1489491, 1489493, 1489 The nucleobase sequences of 494, 1489497, 1489498, 1489500, 1489503, 1489505, 1489508, 1521467, 1521468, 1521469, 1521470, 1521471, 1521472, 1521473, and 1521474 are complementary to an isometric portion of nucleobases 20528 to 20616 of SEQ ID NO:1.

[0488] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 20528-20616 of SEQ ID NO:1 achieve at least 60% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 20528-20616 of SEQ ID NO:1 achieve an average of 71% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0489] 5. Nucleic acid bases 22294 to 22329 of SEQ ID NO:1 In certain embodiments, nucleobases 22294-22329 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal length portion within nucleobases 22294-22329 of SEQ ID NO:1. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0490] The nucleobase sequences of SEQ ID NOs: 440, 525, 607, 677, 783, and 850 are complementary to equal-length portions of nucleobases 22294 to 22329 of SEQ ID NO:1.

[0491] The nucleobase sequences of compound numbers 1322270, 1322424, 1322428, 1322725, 1322905, and 1323347 are complementary to an equal length portion of nucleobases 22294 to 22329 of SEQ ID NO:1.

[0492] In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22294-22329 of SEQ ID NO:1 achieve at least 65% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22294-22329 of SEQ ID NO:1 achieve an average of 84% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0493] 6. Nucleic acid bases 22453 to 22476 of SEQ ID NO:1 In certain embodiments, nucleobases 22453-22476 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 22453-22476 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0494] The nucleobase sequences of SEQ ID NOs: 1210, 1317, 1366, 1449, and 2679 are complementary to equal-length portions of nucleobases 22453 to 22476 of SEQ ID NO:1.

[0495] The nucleobase sequences of compound numbers 1322169, 1322319, 1322497, 1323084, 1492069, 1492128, 1492129, 1492130, 1492131, 1492132, 1521478, 1521479, 1521480, 1521481, 1521482, 1521483, 1521484, 1521485, 1521486, 1521487, 1521488, and 1521489 are complementary to an isometric portion of nucleobases 22453 to 22476 of SEQ ID NO:1.

[0496] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22453-22476 of SEQ ID NO:1 achieve at least a 42% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22453-22476 of SEQ ID NO:1 achieve an average of a 56% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0497] 7. Nucleic acid bases 22595 to 22626 of SEQ ID NO:1 In certain embodiments, nucleobases 22595-22626 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 22595-22626 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0498] The nucleobase sequences of SEQ ID NO:22, 1985, 2059, 2157, 2199, and 2574 are complementary to equal-length portions of nucleobases 22595 to 22626 of SEQ ID NO:1.

[0499] The nucleobase sequences of compound numbers 1273136, 1322165, 1322183, 1322197, 1323110, 1413580, and 1413741 are complementary to an equal length portion of nucleobases 22595 to 22626 of SEQ ID NO:1.

[0500] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22595-22626 of SEQ ID NO:1 achieve at least 66% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 22595-22626 of SEQ ID NO:1 achieve an average of 85% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0501] 8. Nucleic acid bases 25530 to 25565 of SEQ ID NO:1 In certain embodiments, nucleobases 25530-25565 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 25530-25565 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0502] The nucleobase sequences of SEQ ID NOs: 67, 71, 1836, 1887, 1980, 2029, 2115, 2242, 2253, and 2394 are complementary to equal-length portions of nucleobases 25530 to 25565 of SEQ ID NO:1.

[0503] The nucleic acid base sequences of compound numbers 1273181, 1273185, 1321177, 1321321, 1321687, 1321737, 1322093, 1322468, 1322976, 1323187, and 1413682 are complementary to an equal length portion within nucleic acid bases 25530 to 25565 of SEQ ID NO:1.

[0504] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25530-25565 of SEQ ID NO:1 achieve at least a 33% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25530-25565 of SEQ ID NO:1 achieve an average of a 72% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0505] 9. Nucleic acid bases 25606 to 25652 of SEQ ID NO:1 In certain embodiments, nucleobases 25606-25652 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to an equal length portion within nucleobases 25606-25652 of SEQ ID NO:1. In certain embodiments, a modified oligonucleotide is 16 nucleobases in length. In certain embodiments, a modified oligonucleotide is 20 nucleobases in length. In certain embodiments, a modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0506] The nucleobase sequences of SEQ ID NOs: 201, 287, 341, 415, 547, 587, 676, 754, 2659, 2660, 2661, 2662, 2663, and 2687 are complementary to an equal length portion of nucleobases 25606 to 25652 of SEQ ID NO:1.

[0507] Compound numbers 1321332, 1321475, 1322045, 1322057, 1322202, 1322364, 1322670, 1323172, 1413742, 1489461, 1489462, 1489463, 1489464, 1489467, 1489513, 1489514, 1489515, 1489516, 1489517, 1489518, 1489519, 1489520, 1492087, 1492088, 1492089, 1492090, The nucleobase sequences of 1492091, 1492092, 1492136, 1492137, 1492138, 1492139, 1492140, 1492141, 1492142, 1492143, 1521502, 1521503, 1521504, 1521505, 1521506, 1521507, 1521508, 1521509, 1521510, 1521511, and 1521512 are complementary to an isometric portion of nucleobases 25606 to 25652 of SEQ ID NO:1.

[0508] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25606-25652 of SEQ ID NO:1 achieve at least 56% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25606-25652 of SEQ ID NO:1 achieve an average of 72% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0509] 10. Nucleic acid bases 25710 to 25767 of SEQ ID NO:1 In certain embodiments, nucleobases 25710-25767 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within nucleobases 25710-25767 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 16 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a cEt gapmer. In certain embodiments, the sugar motif of these gapmers is selected from (5' to 3'): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, and kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt modified sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by a combination of phosphodiester and phosphorothioate internucleoside linkages. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate internucleoside linkages.In certain embodiments, the internucleoside linkage motifs of these gapmers are (5' to 3'): sssssssssssssss, sosoossssssssssss, sossoossssssssssss, sossosssssssssssss, sosssssssssssss, sosooosssssssssss, soossssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, sooooossssssssss, sooooossssssssss, sooooosssssssss ssssoss, soososssssssssssooss, soosssssssssssssooss, soososssssssssssoss, sooss ossssssssssoss, soossssssssssssssoss, ssoosssssssssssooss, sssoosssssssssssooss , ssssssssssssooss, ssoooossssssssssss, sssooossssssssssss, and ssssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0510] The nucleobase sequences of SEQ ID NOs: 139, 229, 275, 369, 468, 540, 581, 691, 773, 790, 900, 1013, 1024, and 2566 are complementary to an equal length portion of nucleobases 25710 to 25767 of SEQ ID NO:1.

[0511] The nucleobase sequences of compound numbers 1321062, 1321192, 1321571, 1322116, 1322170, 1322334, 1322395, 1322997, 1323021, 1323043, 1323098, 1323219, 1323315, and 1413560 are complementary to an isometric portion of nucleobases 25710 to 25767 of SEQ ID NO:1.

[0512] In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25710-25767 of SEQ ID NO:1 achieve at least a 40% reduction in IFNAR1 RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to an isometric portion within nucleobases 25710-25767 of SEQ ID NO:1 achieve an average of a 58% reduction in IFNAR1 RNA in vitro in a standard cell assay.

[0513] 11. Nucleic acid bases 25768 to 25827 of SEQ ID NO:1 In certain embodiments, nucleobases 25...

Claims

**Claim 1** An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal-length portion of the IFNA1 nucleic acid, the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage, and the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal-length portion within nucleobases 20528 - 20616, 5085 - 5133, 19997 - 20061, 20076 - 20133, 22294 - 22329, 22453 - 22476, 22595 - 22626, 25530 - 25565, 25606 - 25652, 25710 - 25767, 25768 - 25827, 28421 - 28468, 29924 - 29949, 29968 - 30021, 31072 - 31096, 31792 - 31837, 32353 - 32386, or 35016 - 35042 of SEQ ID NO:

1. **Claim 2** An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NO: 2040, 12 - 2039, and 2041 - 2687, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. **Claim 3** The nucleobase sequence of the modified oligonucleotide is SEQ ID NO: 2040, 1952, 1980, 2069, 2164, 2195, 2272, 2299, 2388, 2641, 2642, 2643, 2644, 2645, 2646, 2683, and 2684; SEQ ID NO: 31, 33, 37, 69, 376, 411, 528, 616, 709, 766, 838, and 945; SEQ ID NO: 13, 15, 18, 116, 187, 1604, 1657, 1779, 1809, 1868, 1955, 2079, 2156, 2231, 2304, 2334, 2434, 2531, 2669, 2670, and 2669; Array numbers 709, 714, 811, 818, 933, 943, 1004, 1017, 1091, 1120, 1240, 1266, 1416, 1424, 2556, 2557, 2664, 2665, 2666, 2667, 2668, and 2682; Array numbers 440, 525, 607, 677, 783, and 850; Array numbers 1210, 1317, 1366, 1449, and 2679; Array numbers 22, 1985, 2059, 2157, 2199, and 2574; Array numbers 67, 71, 1836, 1887, 1980, 2029, 2115, 2242, 2253, and 2394; Array numbers 201, 287, 341, 415, 547, 587, 676, 754, 2659, 2660, 2661, 2662, 2663, and 2687; Array numbers 139, 229, 275, 369, 468, 540, 581, 691, 773, 790, 900, 1013, 1024, and 2566; Array numbers 80, 450, 532, 559, 643, 772, 842, 895, 1008, 1065, 1111, 1200, 1247, 1377, and 2637; Array numbers 21, 30, 33, 449, 522, 617, and 660; Array numbers 78, 693, 759, 799, and 875; Array numbers 1500, 1625, 1677, 1733, 1790, 1896, 1981, 2036, 2106, 2217, 2620, 2625, 2636, 2654, 2655, 2656, 2657, 2658, and 2685; Array numbers 125, 210, 289, 335, 2509, and 2614; Array numbers 1345, 1452, 1477, 1626, 1685, 1775, 1838, 1866, 2014, and 2083; Array numbers 99, 2151, 2210, 2320, 2353, 2408, and 2483; and Array numbers 1814, 1933, 1962, 2056, 2130, and 2237; The oligomeric compound according to claim 2, comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences.

4. The nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equi-length portion of the IFNA1 nucleic acid, and the IFNA1 nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO:

2. The oligomeric compound according to any one of claims 1 to 3.

5. a) The modified oligonucleotide is i) 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides; or ii) 20 linked nucleosides; consisting of; and / or b) At least one nucleoside of the modified oligonucleotide contains a modified sugar moiety, optionally i) The modified sugar moiety contains a bicyclic sugar moiety, and optionally, the bicyclic sugar moiety contains a 2'-4' bridge selected from -O-CH ２ - and -O-CH(CH ３ )-; or ii) The modified sugar moiety contains a non-bicyclic modified sugar moiety, and further optionally, the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety; The oligomeric compound according to any one of claims 1 to 3.

6. a) At least one nucleoside of the modified oligonucleotide compound contains a sugar surrogate; and / or b) The modified oligonucleotide contains at least one modified internucleoside linkage, optionally i) At least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; or ii) The modified oligonucleotide contains a nucleoside linkage motif (5' to 3') selected from sssssssssssssssssss, sooosossssssssssooss, sooosossssssssssssooss, soososossssssssssooss, soossssssssssssssssooss, sosooosossssssssssooss, sososossssssssssooss, sossssssssssssssssooss, ssooossssssssssssssooss, sssosossssssssssssssooss, sssssosossssssssssssssooss, sooososososssssssssssos, sooosossssssssssssssos, sooososososssssssssssos, sooososssssssssssssssos, soosooososssssssssssos, soosososssssssssssos, soosssssssssssssssos, sosoooososssssssssssos, sosososssssssssssos, sosssssososssssssssssos, ssooosososssssssssssos, sssososososssssssssssos, and sssssososssssssssssssos, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage; The oligomeric compound according to any one of claims 1 to 3.

7. a) Each nucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester nucleoside linkage or a phosphorothioate nucleoside linkage; and / or b) At least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 nucleoside linkages of the modified oligonucleotide are phosphorothioate nucleoside linkages; and / or c) The modified oligonucleotide contains at least one modified nucleobase, optionally the modified nucleobase is 5-methylcytosine, and further optionally each cytosine is 5-methylcytosine; The oligomeric compound according to any one of claims 1 to 3.

8. a) Each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, and i) each internucleoside linkage is a phosphorothioate internucleoside linkage, or ii) at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages; and / or b) At least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage; and / or c) The modified oligonucleotide contains at least one modified nucleobase, optionally the modified nucleobase is 5-methylcytosine, and further optionally each cytosine is 5-methylcytosine; The oligomeric compound according to any one of claims 1 to 3.

9. The modified oligonucleotide contains a deoxy region, i) each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside; and / or ii) the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides; and / or iii) each nucleoside directly adjacent to the deoxy region contains a modified sugar moiety; The oligomeric compound according to any one of claims 1 to 3.

10. The deoxy region is arranged with a 5' external region consisting of 1 to 6 linked 5' external region nucleosides on the 5' side and a 3' external region consisting of 1 to 6 linked 3' external region nucleosides on the 3' side, the 3'-most nucleoside of the 5' external region contains a modified sugar moiety, and the 5'-most nucleoside of the 3' external region contains a modified sugar moiety, The oligomeric compound according to claim 9.

11. Each nucleoside of the 3' external region contains a modified sugar moiety, and / or each nucleoside of the 5' external region contains a modified sugar moiety, optionally, a) The modified oligonucleotide has a 5' external region consisting of 5 linked nucleosides, a deoxy region consisting of 10 linked nucleosides, and a 3' external region consisting of 5 linked nucleosides, each of the 5' external region nucleosides and each of the 3' external region nucleosides are 2'-MOE nucleosides; or b) The modified oligonucleotide has A 5' external region consisting of 6 linked nucleosides, A deoxy region consisting of 10 linked nucleosides, and A 3' external region consisting of 4 linked nucleosides, and Each of the 5' external region nucleosides and each of the 3' external region nucleosides is a 2'-MOE nucleoside; or c) The modified oligonucleotide is A 5' external region consisting of 3 linked nucleosides, A deoxy region consisting of 10 linked nucleosides, and A 3' external region consisting of 3 linked nucleosides, and Each of the 5' external region nucleosides and each of the 3' external region nucleosides is a cEt nucleoside; or d) The modified oligonucleotide is A 5' external region consisting of 1 to 6 linked nucleosides, A deoxy region consisting of 6 to 10 linked nucleosides, and A 3' external region consisting of 1 to 6 linked nucleosides, and Each of the 5' external region nucleosides and each of the 3' external region nucleosides is a cEt nucleoside or a 2'-MOE nucleoside, and each of the deoxy region nucleosides is a 2'-β-D-deoxynucleoside; The oligomeric compound according to claim 10.

12. A population of oligomeric compounds according to any one of claims 1 to 3, wherein all of the phosphorothioate nucleoside internucleotide linkages of the modified oligonucleotide are stereorandom, said population.

13. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound according to any one of claims 1 to 3, the second modified oligonucleotide consists of 8 to 80 linked nucleosides, and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide, said oligomeric duplex.

14. A pharmaceutical composition comprising the oligomeric compound according to any one of claims 1 to 3, the population according to claim 12, or the oligomeric duplex according to claim 13, and a pharmaceutically acceptable diluent or carrier, wherein optionally, the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid, and further optionally, the pharmaceutical composition consists essentially of the oligomeric compound, the population, or the oligomeric duplex, and phosphate buffered saline or artificial cerebrospinal fluid, the above pharmaceutical composition.

15. The pharmaceutical composition according to claim 14 for the treatment of a disease associated with the signal transduction of type I interferon.

16. i) The diseases associated with the signal transduction of type I interferon are Ehlers-Danlos syndrome, stroke, neuropsychiatric lesions due to systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cognitive decline caused by cranial irradiation, cognitive decline caused by viral infection, neuromyelitis optica, or ataxia telangiectasia; and / or ii) The disease is associated with an increase in the level of interferon alpha in the subject; and / or iii) The oligomeric compound, the population, the oligomeric duplex, or the pharmaceutical composition is administered to a subject having a mutation in a gene selected from TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, and RNU7-1; and / or iv) Administration of the oligomeric compound, the population, the oligomeric duplex, or the pharmaceutical composition to the subject results in a decrease in seizures, dystonia, spasticity, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, or cerebellar myelopathy in the subject, or an improvement in ingestion, motor development, language development, or social ability development in the subject; and / or v) Administration of the oligomeric compound, the population, the oligomeric duplex, or the pharmaceutical composition to the subject results in a decrease in interferon alpha and / or lymphocyte increase in the cerebrospinal fluid of the subject; and / or vi) The oligomeric compound, the population, the oligomeric duplex, or the pharmaceutical composition is administered to humans; The pharmaceutical composition according to claim 15.

Images