Compounds and methods for reducing IFNAR1 expression

Abstract

Oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of IFNAR1 RNA in a cell or animal, and in certain instances, for reducing the amount of IFNAR1 protein in a cell or animal. Such oligomeric compounds, methods, and pharmaceutical compositions are useful for treating diseases and conditions associated with neuroinflammation, including Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.

Description

[Technical field]

[0001] Sequence Listing This application has been filed in electronic format with a Sequence Listing, which is provided under the filename BIOL0386WOSEQ_ST25.txt, created on June 13, 2022, and is 64KB in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] Oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of IFNAR1 RNA in a cell or animal, and in certain instances, for reducing the amount of IFNAR1 protein in a cell or animal. Such oligomeric compounds, methods, and pharmaceutical compositions are useful for treating neuroinflammation-related neurological diseases or conditions, including Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. [Background technology]

[0003] Aicardi-Goutieres syndrome (AGS) is a progressive inflammatory encephalopathy associated with several neuropathological symptoms, including seizures, feeding difficulties, dystonia, convulsions, motor developmental delay, language developmental delay, and social skill developmental delay. Imaging of AGS patients reveals white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephalopathy, and patients also have elevated levels of interferon alpha (IFNa) and lymphocytosis in the cerebrospinal fluid. AGS is associated with mutations in one of ten genes: TREX1 (DNA exonuclease), RNASEH2A, B or C (subunits of RNASEH2), SAMHD1 (dNTP hydrolase), ADAR1 (RNA editing enzyme), MDA5 (dsRNA sensor), USP18 (negative regulator of type I IFN signaling), LSM11, and RNU7-1 (component of the replication-dependent histone pre-mRNA processing complex). Mutations in any one of these genes result in abnormal activation of the antiviral response and high levels of IFNα (Adang, et al., 2020, J. Child Neurol., 35, 7016; Rodero, et al., 2016, J. Esp. Med., 213, 2527-2538).

[0004] Interferon alpha and beta receptor subunit 1 (IFNAR1) is one of two components of the interferon alpha receptor involved in type I interferon signaling. Type I interferon signaling is elevated in patients with AGS and is thought to be an important mediator of neuropathology. Increased levels of type I interferon signaling have also been associated with diseases or conditions such as stroke, brain injury, Alzheimer's disease, neuropsychiatric systemic lupus erythematosus, neuromyelitis optica, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, and neuroinflammation associated with ataxia-telangiectasia (Wlodarczyk,et al.,2021,Glia 69,943-953; Santer,et al.,2009,J.Immunol.182,1192-1201; Zeng,et al.,2019,Arthritis Res.Ther.21,205.017; Karageorgas,et al.,2011,J Biomed Biotechnol 2011,273907; Roy,et al.,2020,J Clin Invest.130, 1912-1930, Witcher,2021,J.Neurosci.JN-RM-2469-2420, Blank,et al.,2016,Immunity 44,901-912, Hartlova,et al.,2015,Immunity 44,901-912,McDonugh,et al.,2017,J Neurosci.37,8292-8308). Overexpression of IFNa in transgenic mice results in increased levels of type I interferon signaling, leading to neurodegenerative changes, T cell infiltration, B cell infiltration, microglial cell activation, reactive astrocytosis, endothelial cell activation, and calcification in the thalamus and cerebellum (Hofer, et al., 2013, Cytokine & Growth Factor Reviews 24, 257-267; Klok, et al., 2015, Ann. Clin. Transl. Neurol., 2, 774-779).Type I interferon signaling induces the expression of hundreds of genes, including interferon-inducible protein with tetratricopeptide repeats 1 (Ifit1), interferon-inducible protein with tetratricopeptide repeats 3 (Ifit3), and interferon regulatory factor 7 (Irf7) (Li, et al., 2018, J. Biol. Chem. 292, P5845-P5859). By crossing mouse models of Alzheimer's disease with IFNAR1 knockout mice, type I interferon signaling was suppressed, resulting in an anti-inflammatory response in glial cells and reduced neuroinflammation (Minter, MR, et al., 2016, Acta Neuropathologica Commun. 4:72). Summary of the Invention

[0005] Certain embodiments of the oligomeric compounds, methods, and pharmaceutical compositions described herein are useful for reducing or inhibiting IFNAR1 expression in cells or animals. In certain embodiments, IFNAR1 RNA or protein levels can be reduced in cells or animals. In certain embodiments, the subject has Aicardi-Goutieres syndrome. In certain embodiments, the subject has a disease or disorder associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, or RNU7-1.

[0006] Methods of treating a disease or condition associated with elevated type I interferon signaling are also provided, where in certain embodiments the disease or disorder is AGS, stroke, epilepsy, neuroinflammation following traumatic brain injury, neuroautoimmune disease, Alzheimer's disease, post-operative delirium and cognitive decline, cranial radiation induced cognitive decline, viral infection induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" as well as other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit as well as elements and components comprising two or more subunits unless expressly stated otherwise.

[0008] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and papers, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0009] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0010] Unless otherwise stated, the following terms have the following meanings.

[0011] As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside can include a modified nucleobase or can include an RNA nucleobase (uracil).

[0012] As used herein, "2'-MOE" refers to a 2'-O(CH) in place of the 2'-OH group of a furanosyl sugar moiety. 2 ) 2 OCH 3 A "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" refers to a 2'-O(CH) group in place of the 2'-OH group of a furanosyl sugar moiety. 2 ) 2 OCH 3 "MOE" refers to a sugar moiety having a 2'-MOE group. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0013] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0014] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0015] As used herein, "alleviate" in the context of treatment means that at least one symptom or feature is alleviated, compared to the same symptom or feature in the absence of treatment.In certain embodiments, alleviation is a reduction in the severity or frequency of a symptom or feature, or a delay in the onset of a symptom or feature, or a delay in the progression of the severity or frequency of a symptom or feature.In certain embodiments, the symptom or feature is one or more of seizures, feeding difficulties, dystonia, convulsions, motor development delay, language development delay, social skill development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephalopathy.In certain embodiments, the feature is the level of IFNa or lymphocytosis in the cerebrospinal fluid of the subject.

[0016] As used herein, a "population" means multiple molecules of the same molecular formula.

[0017] As used herein, "chirally enriched" in reference to a population refers to a plurality of molecules of the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom, as defined herein. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that include modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesyl phosphoramidate internucleoside linkage.

[0018] As used herein, "chirally controlled" with respect to an internucleoside linkage means that the chirality of that linkage is enriched for a particular stereochemical configuration.

[0019] As used herein, "antisense agent" refers to an antisense compound and, optionally, one or more additional features such as a sense compound. Although RNAi is not claimed, my thinking behind keeping it was that I thought there would need to be a basis for distinguishing the compound from an siRNA sequence.

[0020] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0021] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0022] As used herein, "conjugate linker" means a single bond or a group of atoms that includes at least one bond that links a conjugate moiety to an oligonucleotide.

[0023] As used herein, "conjugate moiety" means a covalently attached group of atoms that modifies one or more properties of a molecule compared to the same molecule lacking the conjugate moiety, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0024] As used herein, "deoxy region" means a region of 5 to 12 contiguous nucleotides, at least 70% of the nucleosides being β-D-2'-deoxyribosyl sugar moieties. In certain embodiments, the deoxy region is the gap of a gapmer.

[0025] As used herein, an "internucleoside linkage" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, a "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage.

[0026] As used herein, "linked nucleosides" are nucleosides that are connected in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0027] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0028] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleic acid / base and / or a modified sugar moiety.

[0029] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0030] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five types of unmodified nucleobases.

[0031] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0032] As used herein, "nucleoside" means a compound or fragment of a compound that includes a nucleobase and a sugar moiety, each of which independently is unmodified or modified.

[0033] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0034] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside bonds, each of which may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0035] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside bonds, each of which may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0036] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a pill, tablet, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0037] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.

[0038] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0039] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula means a chiral center that is not controlled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules with the (S) configuration of the stereorandom chiral center can be, but is not necessarily, the same as the number of molecules with the (R) configuration of the stereorandom chiral center. In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates after synthesis, for example, due to the action of a non-chiral reagent near the enriched stereochemistry of the adjacent sugar moiety. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0040] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0041] As used herein, "symptoms or characteristics" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptoms are evident to the subject or a medical professional who examines or tests the subject. In certain embodiments, the characteristics are evident by invasive diagnostic tests, including but not limited to postmortem examination. In certain embodiments, the characteristics are evident by brain MRI scans.

[0042] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid to which an oligomeric compound is designed to act. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0043] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0044] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0045] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.

[0046] As used herein, "gapmer" refers to a modified oligonucleotide that includes an internal region located between external regions having one or more nucleosides, where the nucleosides that make up the internal region are chemically distinct from the nucleoside(s) that make up the external regions, and the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as a "gap" and the external region may be referred to as a "wing." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5' end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2'-β-D-deoxynucleoside. As used herein, "MOE gapmer" refers to a gapmer having a gap that includes 2'-β-D-deoxynucleosides and wings that include 2'-MOE nucleosides. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0047] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0048] As used herein, "RNAi agent" refers to an antisense agent that acts, at least in part, via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act via RNase H.

[0049] As used herein, "RNase H agent" refers to an antisense agent that acts via RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single stranded. In certain embodiments, the RNase H agent is double stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act primarily via RISC / Ago2.

[0050] As used herein, "treating" refers to improving a disease or condition in a subject by administering an oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms for the same condition in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, or delays the onset of a symptom, or delays the progression of a symptom, or delays the severity or frequency of a symptom.

[0051] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that provides a therapeutic effect to an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0052] Specific Embodiments Embodiment 1. A modified oligonucleotide according to the following chemical structure:

[0053] [ka]

[0054] (SEQ ID NO: 10), or a salt thereof.

[0055] Embodiment 2. The modified oligonucleotide of embodiment 1, which is a sodium or potassium salt.

[0056] Embodiment 3. A modified oligonucleotide according to the following chemical structure:

[0057] [ka]

[0058] (Sequence number 10).

[0059] Embodiment 4. A modified oligonucleotide according to the following chemical structure:

[0060] [ka]

[0061] (SEQ ID NO: 11), or a salt thereof.

[0062] Embodiment 5. The modified oligonucleotide of embodiment 4, which is a sodium or potassium salt.

[0063] Embodiment 6. A modified oligonucleotide according to the following chemical structure:

[0064] [ka]

[0065] (Sequence number 11).

[0066] Embodiment 7. A modified oligonucleotide according to the following chemical structure:

[0067] [ka]

[0068] (SEQ ID NO: 12), or a salt thereof.

[0069] Embodiment 8. The modified oligonucleotide of embodiment 7, which is a sodium or potassium salt.

[0070] Embodiment 9. A modified oligonucleotide according to the following chemical structure:

[0071] [ka]

[0072] (Sequence number 12).

[0073] Embodiment 10. A modified oligonucleotide according to the following chemical structure:

[0074] [ka]

[0075] (SEQ ID NO: 9), or a salt thereof.

[0076] Embodiment 11. The modified oligonucleotide of embodiment 10, which is a sodium or potassium salt.

[0077] Embodiment 12. A modified oligonucleotide according to the following chemical structure:

[0078] [ka]

[0079] (Sequence number 9).

[0080] Embodiment 13. A modified oligonucleotide according to the following chemical structure:

[0081] [ka]

[0082] (SEQ ID NO: 13), or a salt thereof.

[0083] Embodiment 14. The modified oligonucleotide of embodiment 13, which is a sodium or potassium salt.

[0084] Embodiment 15. A modified oligonucleotide according to the following chemical structure:

[0085] [ka]

[0086] (Sequence number 13).

[0087] Embodiment 16. A modified oligonucleotide according to the following chemical structure:

[0088] [ka]

[0089] (SEQ ID NO: 14), or a salt thereof.

[0090] Embodiment 17. The modified oligonucleotide of embodiment 16, which is a sodium or potassium salt.

[0091] Embodiment 18. A modified oligonucleotide according to the following chemical structure:

[0092] [ka]

[0093] (Sequence number 14).

[0094] Embodiment 19. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 10), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0095] Embodiment 20. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T eo T eo Teo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (SEQ ID NO: 11), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0096] Embodiment 21. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m Ce (SEQ ID NO: 12), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0097] Embodiment 22. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (SEQ ID NO: 9), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0098] Embodiment 23. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds T eo m C es m C es T e (SEQ ID NO: 13), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0099] Embodiment 24. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es T eo m C eo G eo m C eo m C eo Tds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO: 14), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0100] Embodiment 25. A population of modified oligonucleotides of any of embodiments 1-18, or a population of oligomeric compounds of any of embodiments 19-24, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0101] Embodiment 26. A pharmaceutical composition comprising a modified oligonucleotide according to any one of embodiments 1 to 18, an oligomeric compound according to any one of embodiments 19 to 24, or a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, and a pharma- ceutically acceptable diluent.

[0102] Embodiment 27. The pharmaceutical composition of embodiment 26, wherein the pharma- ceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline.

[0103] Embodiment 28. The pharmaceutical composition of embodiment 27, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide, said oligomeric compound, or said population, and artificial cerebrospinal fluid or phosphate buffered saline.

[0104] Embodiment 29. A method comprising administering to a subject a modified oligonucleotide according to any one of embodiments 1-18, an oligomeric compound according to any one of embodiments 19-24, or a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, or a pharmaceutical composition according to any one of embodiments 26-28.

[0105] Embodiment 30. A method for treating a disease associated with type I interferon signaling, comprising administering to a subject having a disease associated with type I interferon signaling a therapeutically effective amount of a modified oligonucleotide according to any one of embodiments 1-18, an oligomeric compound according to any one of embodiments 19-24, or a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, or a pharmaceutical composition according to any one of embodiments 26-28, thereby treating the disease associated with type I interferon signaling.

[0106] Embodiment 31. The method of embodiment 30, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.

[0107] Embodiment 32 The method of embodiment 30 or 31, wherein the disease is associated with elevated levels of interferon alpha.

[0108] Embodiment 33. The method of any one of embodiments 30-32, wherein administering the modified oligonucleotide, the oligomeric compound, the population of modified oligonucleotides or the population of oligomeric compounds, or the pharmaceutical composition reduces seizures, dystonia, convulsions, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, or cerebellar myelopathy in the subject, improves feeding, motor development, language development, or social skill development in the subject, or reduces interferon alpha or lymphocytosis in the cerebrospinal fluid of the subject.

[0109] Embodiment 34. A method for reducing expression of IFNAR1 in a cell, comprising contacting the cell with a modified oligonucleotide according to any one of embodiments 1 to 18, an oligomeric compound according to any one of embodiments 19 to 24, a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, or a pharmaceutical composition according to any one of embodiments 26 to 28.

[0110] Embodiment 35 The method of embodiment 34, wherein the cell is a neuron or a glial cell, and optionally, the cell is an astrocyte or a microglial cell.

[0111] Embodiment 36 The method of any one of embodiments 29 to 33, wherein the subject is a human.

[0112] Embodiment 37 The method of embodiment 34 or 35, wherein the cell is a human cell.

[0113] Embodiment 38. Use of a modified oligonucleotide according to any of embodiments 1 to 18, an oligomeric compound according to any of embodiments 19 to 24, a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, or a pharmaceutical composition according to any of embodiments 26 to 28 for treating a disease associated with type I interferon signaling.

[0114] Embodiment 39. Use of a modified oligonucleotide according to any of embodiments 1 to 18, an oligomeric compound according to any of embodiments 19 to 24, a population of modified oligonucleotides or oligomeric compounds according to embodiment 25, or a pharmaceutical composition according to any of embodiments 26 to 28 in the manufacture of a medicament for the treatment of a disease associated with type I interferon signaling.

[0115] Embodiment 40. The use according to embodiment 38 or 39, wherein the disease is associated with elevated levels of interferon alpha.

[0116] Embodiment 41. The use according to any of embodiments 38 to 40, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.

[0117] 1. Compound number 1489477 In certain embodiments, compound number 1489477 is characterized as a 6-10-4 MOE gapmer having a sequence (5' to 3') of CTTTTTCTGCTCTTATACGC (SEQ ID NO: 11), wherein nucleosides 1-6 and 17-20 (5' to 3') are each a 2'-MOE nucleoside, nucleosides 7-16 are each a 2'-β-D-deoxynucleoside, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, between 6 and 7 , and between 17 and 18 are phosphodiester internucleoside linkages, and between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0118] In certain embodiments, compound number 1489477 is represented by the following chemical notation: m C es T eo T eo T eo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (SEQ ID NO: 11), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0119] In one particular embodiment, compound number 1489477 is represented by the following chemical structure:

[0120] [ka]

[0121] (SEQ ID NO:11) Structure 1. Compound number 1489477

[0122] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 1.

[0123] In one particular embodiment, the sodium salt of compound number 1489477 is represented by the following chemical structure:

[0124] [ka]

[0125] (SEQ ID NO:11) Structure 2. Sodium salt of compound number 1489477

[0126] 2. Compound number 1489494 In certain embodiments, compound number 1489494 is characterized as a 6-10-4 MOE gapmer having a sequence (5' to 3') of CTGTTTTACATTTTTTTTCC (SEQ ID NO: 12), wherein nucleosides 1-6 and 17-20 (5' to 3') are each a 2'-MOE nucleoside, nucleosides 7-16 are each a 2'-β-D-deoxynucleoside, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, between 6 and 7 , and between 17 and 18 are phosphodiester internucleoside linkages, and between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0127] In certain embodiments, compound number 1489494 is represented by the following chemical notation: m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m C e (SEQ ID NO: 12), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0128] In certain embodiments, compound number 1489494 is represented by the following chemical structure:

[0129] [ka]

[0130] (SEQ ID NO:12) Structure 3. Compound number 1489494

[0131] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 3.

[0132] In one particular embodiment, the sodium salt of compound number 1489494 is represented by the following chemical structure:

[0133] [ka]

[0134] (SEQ ID NO:12) Structure 2. Sodium salt of compound number 1489494

[0135] 3. Compound number 1489525 In certain embodiments, compound number 1489525 is characterized as a 5-10-5 MOE gapmer having a sequence (5' to 3') of TTTATCCAATTATCCATCCC (SEQ ID NO:9), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 16 and 17, and between 17 and 18. and 18 is a phosphodiester internucleoside bond, and the internucleoside bond between nucleosides 1 and 2, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 18 and 19, and 19 and 20 is a phosphorothioate internucleoside bond, and each cytosine is a 5-methylcytosine.

[0136] In certain embodiments, compound number 1489525 is represented by the following chemical notation: T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (SEQ ID NO: 9), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0137] In certain embodiments, compound number 1489525 is represented by the following chemical structure:

[0138] [ka]

[0139] (SEQ ID NO:9) Structure 5. Compound number 1489525

[0140] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 5.

[0141] In certain embodiments, the sodium salt of compound number 1489525 is represented by the following chemical structure:

[0142] [ka]

[0143] (SEQ ID NO:9) Structure 6. Sodium salt of compound number 1489525

[0144] 4. Compound number 1492069 In certain embodiments, compound number 1492069 is characterized as a 5-10-5 MOE gapmer having a sequence (5' to 3') of TCGCCTAATTTTTCTCTCAC (SEQ ID NO: 10), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 16 and 17, and between 17 and 20. and 18 is a phosphodiester internucleoside bond, and the internucleoside bond between nucleosides 1 and 2, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 18 and 19, and 19 and 20 is a phosphorothioate internucleoside bond, and each cytosine is a 5-methylcytosine.

[0145] In certain embodiments, compound number 1492069 is represented by the following chemical notation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 10), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0146] In certain embodiments, compound number 1492069 is represented by the following chemical structure:

[0147] [ka]

[0148] (SEQ ID NO:10) Structure 7. Compound number 1492069

[0149] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 7.

[0150] In one particular embodiment, the sodium salt of compound number 1492069 is represented by the following chemical structure:

[0151] [ka]

[0152] (SEQ ID NO:10) Structure 8. Sodium salt of compound number 1492069

[0153] 5. Compound number 1492082 In certain embodiments, compound number 1492082 is characterized as a 6-10-4 MOE gapmer having a sequence (5' to 3') of TTTCATATTTGTTACTTCCT (SEQ ID NO: 13), wherein nucleosides 1-6 and 17-20 (5' to 3') are each a 2'-MOE nucleoside, nucleosides 7-16 are each a 2'-β-D-deoxynucleoside, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, between 6 and 7 , and between 17 and 18 are phosphodiester internucleoside linkages, and between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0154] In certain embodiments, compound number 1492082 is represented by the following chemical notation: T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds T eo m C es m C es T e (SEQ ID NO: 13), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0155] In certain embodiments, compound number 1492082 is represented by the following chemical structure:

[0156] [ka]

[0157] (SEQ ID NO:13) Structure 9. Compound number 1492082

[0158] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 9.

[0159] In one particular embodiment, the sodium salt of compound number 1492082 is represented by the following chemical structure:

[0160] [ka]

[0161] (SEQ ID NO:13) Structure 10. Sodium salt of compound number 1492082

[0162] 6. Compound number 1492131 In certain embodiments, compound number 1492131 is characterized as a 6-10-4 MOE gapmer having a sequence (5' to 3') of TTCGCCTAATTTTTCTCTCA (SEQ ID NO: 14), wherein nucleosides 1-6 and 17-20 (5' to 3') are each a 2'-MOE nucleoside, nucleosides 7-16 are each a 2'-β-D-deoxynucleoside, and between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, between 6 and 7 , and between 17 and 18 are phosphodiester internucleoside linkages, and between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0163] In certain embodiments, compound number 1492131 is represented by the following chemical notation: T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO: 14), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0164] In certain embodiments, compound number 1492131 is represented by the following chemical structure:

[0165] [ka]

[0166] (SEQ ID NO:14) Structure 11. Compound number 1492131

[0167] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 11.

[0168] In certain embodiments, the sodium salt of compound number 1492131 is represented by the following chemical structure:

[0169] [ka]

[0170] (SEQ ID NO:14) Structure 12. Sodium salt of compound number 1492131

[0171] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that comprise oligonucleotides that are composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (nucleoside that contains a modified sugar and / or modified nucleobase) and / or at least one modified internucleoside linkage.

[0172] A. Certain modified nucleosides A modified nucleoside contains a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0173] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-O(CH 2 ) 2 OCH 3 ("MOE" or "O-methoxyethyl").

[0174] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position compared to 2'-deoxyfuranosyl sugar moieties; thus, such sugar moieties have a total of 16 possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0175] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobase.Examples of modified nucleobase include 5-methylcytosine.

[0176] This is a slightly different type of snowflake Then there is the manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al al.,US5,175,273、Urdea et al.,US5,367,066、Benner et al.,US5,432,272、Matteucci et al.,US5,434,257、Gmeiner et al.,US5,457,187、Cook et al al.,US5,459,255、Froehler et al.,US5,484,908、Matteucci et al.,US5,502,177、Hawkins et al.,US5,525,711、Haralambidis et al.,US5,552,540、Cook et al al.,US5,587,469、Froehler et al.,US5,594,121、Switzer et al.,US5,596,091、Cook et al.,US5,614,617、Froehler et al.,US5,645,985、Cook et al al.,US5,681,941 Cook et al.,US5,811,534 Cook et al.,US5,750,692 Cook et al.,US5,948,903 Cook et al.,US5,587,470 Cook et al al.,US5,763,588, Froehler et al.,US5,830,653, Cook et al.,US5,808,027, Cook et al.,US6,166,199, and Matteucci et al al.,US6,005,096.

[0177] 3. Certain modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is the 3'-5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked together using one or more modified internucleoside linkages. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates, including phosphodiester linkages ("P=O") (also referred to as unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of an oligonucleotide compared to native phosphate linkages. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0178] Representative internucleoside linkages with chiral centers include, but are not limited to, phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate or other linkages containing chiral centers in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:

[0179] [ka]

[0180] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0181] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0182] 1. Certain glycomotifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif, hi certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0183] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, the sugar moiety of at least the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0184] In certain embodiments, a gapmer wing comprises 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0185] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0186] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-OMe sugar moiety.

[0187] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing, and the gap nucleosides include a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. The 6-10-4MOE gapmer is composed of 6 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 4 linked 2'-MOE nucleosides in the 3'-wing. The 3-10-3cEt gapmer is composed of 3 linked cEt nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3'-wing.

[0188] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer.

[0189] In certain embodiments, modified oligonucleotides have a sugar motif selected from, from 5' to 3': eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0190] In certain embodiments, modified oligonucleotides have a sugar motif selected from, from 5' to 3': eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0191] In certain embodiments, modified oligonucleotides have a sugar motif selected from, from 5' to 3': kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt modified sugar moiety.

[0192] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0193] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety.

[0194] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0195] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages in the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0196] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):sooossssssssssssooss phosphorothioate internucleoside linkages, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'):sooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0197] II. Certain Oligomeric Compounds In certain embodiments, oligomeric compounds are provided herein that consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group can be attached to either or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0198] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.

[0199] A. Certain Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties and clearance properties.

[0200] In certain embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to the modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. The ribonucleotide subunit in which the ribose sugar of the subunit is so replaced is referred to herein as the modified sugar moiety ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon ring system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0201] In certain embodiments, the conjugate group confers new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids, 1997, 10, 1021-1025), and the like. Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0202] In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0203] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C17 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0204] In certain embodiments, the conjugate group is a lipid having the following structure:

[0205] [ka]

[0206] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0207] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0208] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In certain oligomeric compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In certain embodiments, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.

[0209] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0210] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0211] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for attaching a conjugate moiety to a compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to react with a specific site of the compound, and the other is selected to react with the conjugate moiety. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0212] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C 1 -C 10 Alkyl, substituted or unsubstituted C 2 -C 10 Alkenyl, or substituted or unsubstituted C 2 -C 10 Included are alkynyls, and a non-limiting list of preferred substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0213] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0214] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group is present. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.

[0215] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable that the conjugate group is cleaved to release the non-conjugate or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0216] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide.In certain embodiments, the cleavable bond is one or both esters of phosphodiester.In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester.In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or the conjugate group.

[0217] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxyribonucleoside that is linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and is covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate bond or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0218] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0219] [ka]

[0220] In the formula, n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or more, j is 1 or 0, and k is 1 or 0.

[0221] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0222] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand, hi certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branching group.

[0223] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0224] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0225] [ka]

[0226] In the formula, n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or more, j is 1 or 0, and k is 1 or 0.

[0227] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0228] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0229] III. Certain End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0230] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that they result in significant undesired antisense activity.

[0231] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein as being "DNA-like" enough to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0232] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0233] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the change of splicing of the target nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with a protein or other nucleic acid.In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the change of translation of the target nucleic acid.

[0234] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity includes observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0235] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0236] A.IFNAR1 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being an IFNAR1 nucleic acid. In certain embodiments, the IFNAR1 nucleic acid has a sequence as set forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000021.9 truncated at 33321001-33363000) or SEQ ID NO: 2 (GENBANK Accession No. NM_000629.2). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of IFNAR1 RNA, and in certain embodiments, reduces the amount of IFNAR1 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0237] B. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in a pharmacologically relevant cell. In certain embodiments, the pharmacologically relevant cell is a neuron or a glial cell. In certain embodiments, the pharmacologically relevant cell is an astrocyte or a microglial cell. In certain embodiments, the pharmacologically relevant cell is a vascular smooth muscle cell, a vascular endothelial cell, or a pericyte.

[0238] VI. Certain Methods and Uses Certain embodiments provided herein relate to methods of inhibiting IFNAR1 expression, which may be useful for treating diseases associated with neuroinflammation, such as diseases associated with elevated type I interferon signaling, or diseases associated with overexpression of type I interferon in a subject, by administration of an oligomeric compound, modified oligonucleotide, or oligomeric duplex comprising a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid.

[0239] Examples of diseases treatable with the oligomeric compounds, modified oligonucleotides, oligomeric duplexes, and methods provided herein include neurological diseases or conditions associated with neuroinflammation, such as diseases associated with elevated type I interferon signaling or overexpression of type I interferon, selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the method comprises administering to a subject an oligomeric compound, modified oligonucleotide, or oligomeric duplex having a nucleobase sequence complementary to an IFNAR1 nucleic acid. In certain embodiments, the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cranial radiation induced cognitive decline, viral infection induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, a method for treating a neurological disease or condition associated with neuroinflammation in a subject selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia comprises administering to the subject a therapeutically effective amount of an oligomeric compound, modified oligonucleotide, or oligomeric duplex having a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby treating the subject. In certain embodiments, administering a therapeutically effective amount of the oligomeric compound or modified oligonucleotide ameliorates a symptom or characteristic of a disease or condition associated with neuroinflammation.In certain embodiments, the symptom or feature is selected from seizures, feeding difficulties, dystonia, convulsions, motor development delay, language development delay, social skill development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephalopathy. In certain embodiments, administering a therapeutically effective amount of an oligomeric compound or modified oligonucleotide reduces type I IFN signaling or lymphocytosis in the cerebrospinal fluid of the subject.

[0240] In certain embodiments, a method for inhibiting expression of an IFNAR1 nucleic acid, e.g., RNA, in a subject with a disease associated with neuroinflammation, e.g., a disease associated with elevated type I interferon signaling or a disease associated with overexpression of type I interferon, comprises administering to the subject an oligomeric compound, modified oligonucleotide, or oligomeric duplex having a nucleobase sequence complementary to an IFNAR1 nucleic acid, thereby inhibiting expression of the IFNAR1 nucleic acid in the subject. In certain embodiments, administering the oligomeric compound, modified oligonucleotide, or oligomeric duplex inhibits expression of IFNAR1 in the brain or spinal cord. In certain embodiments, the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the method of inhibiting the expression of IFNAR1 nucleic acid in a cell comprises contacting the cell with an oligomeric compound, modified oligonucleotide, or oligomeric duplex having a nucleobase sequence complementary to IFNAR1 nucleic acid, thereby inhibiting the expression of IFNAR1 nucleic acid in the cell.In certain embodiments, the cell is a glial cell, for example, an astrocyte or a microglial cell.In certain embodiments, the cell is in a subject with a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.

[0241] Certain embodiments are presented for oligomeric compounds, modified oligonucleotides, or oligomeric duplexes having a nucleobase sequence complementary to an IFNAR1 nucleic acid for use in treating diseases associated with neuroinflammation, such as diseases associated with elevated type I interferon signaling or diseases associated with overexpression of IFNa. In certain embodiments, the disease is a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disease, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric duplex is used to improve symptoms or characteristics of a disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disease, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the symptoms or characteristics are selected from seizures, feeding difficulties, dystonia, convulsions, motor development delay, language development delay, social skill development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephalopathy. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric duplex is for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of a subject.

[0242] Certain embodiments are provided for oligomeric compounds, modified oligonucleotides, or oligomeric duplexes, any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to an IFNAR1 nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with neuroinflammation, such as a disease associated with elevated type I interferon signaling, or a disease associated with overexpression of IFNa. In certain embodiments, the disease is a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disease, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of a subject. In certain embodiments, the symptom or characteristic is selected from seizures, feeding difficulties, dystonia, convulsions, motor development delay, language development delay, social skill development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, and microencephalopathy. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric duplex is for the manufacture or preparation of a medicament for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of a subject.

[0243] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, or oligomeric duplex may be any of those described herein.

[0244] VII. Certain Pharmaceutical Compositions In certain embodiments, provided herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0245] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0246] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0247] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0248] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0249] In certain embodiments, the pharmaceutical composition comprising the oligomeric compound includes any pharma- ceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprising one or more oligonucleotides can provide (directly or indirectly) a biologically active metabolite or residue thereof upon administration to an animal, including a human. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of the oligomeric compound, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0250] Lipid moieties are used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0251] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0252] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0253] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0254] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0255] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and associated with cations (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms that are all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The structures depicted necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are intended to include the corresponding forms as well. In this specification, structures of the free acid of a compound followed by the term "or a salt thereof" expressly include all such forms that may be fully or partially protonated / deprotonated / associated with cations. In certain instances, one or more specific cations are identified.

[0256] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0257] In the present specification, certain doses are described. The doses may be in the form of dosage units. For clarity of explanation, the dose (or dosage unit) of the modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still counted in the weight of the dose, and the mass of the Na+ ions is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 10 mg of compound number 1492069 is equal to the number of fully protonated molecules having a weight of 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1492069. When an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such oligomeric compound. When the conjugate group also contains an acid, the conjugate group is likewise assumed to be fully protonated for purposes of calculating dosage.

[0258] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0259] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each of the references, GenBank accession numbers, ENSEMBL identifiers, etc. listed in this application are incorporated herein by reference in their entirety.

[0260] Although the sequence listing accompanying this application identifies as either "RNA" or "DNA" where appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or an RNA with a modified base (thymine instead of uracil (methylated uracil) of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with such compounds that contain RNA bases, such as, but not limited to, those having the sequence "AUCGAUCG", as well as those having some DNA bases and some RNA bases, such as "AUCGATCG". m and oligomeric compounds having other modified nucleobases such as "AACGAUCG", m C denotes a cytosine base containing a methyl group at the 5-position.

[0261] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms), unless otherwise specified. Similarly, tautomeric forms of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0262] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution can provide oligomeric compounds with new properties that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0263] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for additional oligonucleotides having the same or similar motifs.Furthermore, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0264] Example 1: Design of modified oligonucleotides complementary to human IFNAR1 nucleic acid Modified oligonucleotides complementary to human IFNAR1 nucleic acids were designed as set forth in the table below. "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End Site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NC_000021.9 truncated from 33321001 to 33363000), SEQ ID NO:2 (GENBANK Accession No. NM_000629.2), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0265] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length and the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (5' to 3'): soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0266] [Table 1]

[0267] The modified oligonucleotide in the table below is a 6-10-4 MOE gapmer. The gapmer is 20 nucleosides long and the sugar motif of the gapmer is (5' to 3'): eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has an internucleoside linkage motif of (5' to 3'): soooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0268] [Table 2]

[0269] Example 2: Activity of modified oligonucleotides complementary to human IFNAR1 in transgenic mice The modified oligonucleotides described above were tested in a human IFNAR1 transgenic mouse model. Transgenic mice expressing the human IFNAR1 transcript were generated.

[0270] Exons 1-6 and approximately 4.9 kB of upstream sequence of the human IFNAR1 gene from fosmid ABCS-41091_400N2 were subcloned into a BAC, CTD-2289N21, containing exons 7-11 of the human IFNAR1 gene and 56 kB of downstream sequence to generate the complete IFNAR1 transgene. The engineered BAC was digested with Not1 to remove the BAC backbone. The purified BAC fragment containing the complete human IFNAR1 gene was introduced into fertilized eggs of C57BL / 6 mice by pronuclear injection to generate three founder strains. Strain 17505 was used for the experiments described herein.

[0271] treatment The transgenic mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 300 μg of the modified oligonucleotide. Groups of 2 to 4 mice received PBS as a negative control.

[0272] RNA analysis After 2 weeks of treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure the amount of IFNAR1 RNA using human primer probe set RTS44352 (forward sequence CTTTCAAGTTCAGTGGCTCCA, designated herein as SEQ ID NO:6; reverse sequence CGTTTTGAGGAAAGACACACTG, designated herein as SEQ ID NO:7; probe sequence AGTTTTGACATTTTCACAGTCAGGTATTTGTTTCC, designated herein as SEQ ID NO:8). Results are expressed as a percentage of human IFNAR1 relative to PBS control, normalized to 18S ribosomal RNA. 18S ribosomal RNA was amplified using mouse 18S prime probe set PPS54360 (forward sequence GGAACTGAGGCCATGATTAAGA, designated herein as SEQ ID NO:3; reverse sequence ACCTCCGACTTTCGTTCTTG, designated herein as SEQ ID NO:4; probe sequence AAGACGGACCAGAGCGAAAGCAT, designated herein as SEQ ID NO:5).

[0273] [Table 3]

[0274] [Table 4]

[0275] Example 3: Efficacy of modified oligonucleotides complementary to human IFNAR1 RNA in transgenic mice The modified oligonucleotides described above were tested in human IFNAR1 transgenic mice (described herein above).

[0276] treatment Human IFNAR1 transgenic mice were divided into groups of 4 mice each. Each mouse was administered a single ICV bolus of modified oligonucleotide at the doses shown in the table below. Groups of 4 mice were administered PBS as a negative control.

[0277] RNA analysis After 2 weeks of treatment, mice were sacrificed and RNA was extracted from spinal cord, cerebral cortex, and cerebellum for quantitative real-time RTPCR analysis of IFNAR1 RNA expression using primer probe set RTS44352 (described hereinabove). Results are expressed as a percentage of human IFNAR1 RNA relative to PBS control, adjusted for 18S PCR (described hereinabove).

[0278] The 50% maximum effective dose (ED 50 ) was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). 50 Values ​​were calculated from dose and IFNAR1 RNA levels of individual animals using the following custom equation: Agonist vs. Response - Variable Slope (4 parameters) Y=Bottom+(Top-Bottom) / (1+(10^logED50 / X)^HillSlope), with the following constraints: bottom>0, top=100.

[0279] As shown in the table below, treatment with the modified oligonucleotides resulted in a dose-responsive reduction in IFNAR1 RNA compared to the PBS control.

[0280] [Table 5]

[0281] [Table 6]

Claims

1. A modified oligonucleotide according to the following chemical structure 【Chemical 1】 (SEQ ID NO: 10), or a salt thereof.

2. The modified oligonucleotide according to Claim 1, which is a sodium salt or a potassium salt.

3. A modified oligonucleotide according to the following chemical structure 【Chemical Formula 2】 (SEQ ID NO: 10).

4. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, T ｅｓ ｍ C ｅｏ G ｅｏ ｍ C ｅｏ ｍ C ｅｓ T ｄｓ A ｄｓ A ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ T ｄｓ ｍ C ｅｏ T ｅｏ ｍ C ｅｓ A ｅｓ ｍ C ｅ (SEQ ID NO: 10), wherein A is an adenine nucleobase, ｍ C is a 5-methylcytosine nucleobase, and G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside internucleoside linkage, o is a phosphodiester nucleoside internucleoside linkage, the above oligomeric compound.

5. A population of the modified oligonucleotides according to Claim 1, wherein all of the phosphorothioate nucleoside internucleoside linkages of the modified oligonucleotides are stereorandom, the above population.

6. A pharmaceutical composition comprising the modified oligonucleotide according to Claim 1 and a pharmaceutically acceptable diluent.

7. The pharmaceutical composition according to Claim 6, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

8. The pharmaceutical composition according to Claim 7, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

9. A population of the modified oligonucleotides according to Claim 3, wherein all of the phosphorothioate nucleoside internucleoside linkages of the modified oligonucleotides are stereorandom, the above population.

10. A pharmaceutical composition comprising the modified oligonucleotide according to Claim 3 and a pharmaceutically acceptable diluent.

11. The pharmaceutical composition according to Claim 10, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

12. The pharmaceutical composition according to Claim 11, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

13. A population of the oligomeric compounds according to Claim 4, wherein all of the phosphorothioate nucleoside internucleoside linkages of the modified oligonucleotides are stereorandom, the above population.

14. A pharmaceutical composition comprising the oligomer compound according to claim 4 and a pharmaceutically acceptable diluent.

15. The pharmaceutical composition according to claim 14, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

16. The pharmaceutical composition according to claim 15, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

17. A pharmaceutical composition comprising a population of modified oligonucleotides according to claim 5 and a pharmaceutically acceptable diluent.

18. The pharmaceutical composition according to claim 17, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

19. A pharmaceutical composition comprising a population of modified oligonucleotides according to claim 9 and a pharmaceutically acceptable diluent.

20. The pharmaceutical composition according to claim 19, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

21. A pharmaceutical composition comprising a population of oligomer compounds according to claim 13 and a pharmaceutically acceptable diluent.

22. The pharmaceutical composition according to claim 21, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or sterile water.

23. A pharmaceutical composition for treating a disease associated with type I interferon signaling, the composition being the pharmaceutical composition according to any one of claims 6 - 8, 10 - 12 and 14 - 22, and the treatment comprising administering a therapeutically effective amount of the pharmaceutical composition to a subject having a disease associated with type I interferon signaling.

24. The pharmaceutical composition according to claim 23, wherein the disease associated with type I interferon signaling is Aicardi - Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuro - autoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation - induced cognitive decline, virus - infection - induced cognitive decline, neuromyelitis optica, or ataxia - telangiectasia.

25. The pharmaceutical composition according to claim 24, wherein the disease is associated with an increase in the level of interferon alpha.

26. Administering the pharmaceutical composition reduces seizures, dystonia, spasms, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglia calcification, or cerebellar myelopathy in a subject, improves feeding, motor development, language development, or social skill development in a subject, or reduces interferon alpha or lymphocyte increase in the cerebrospinal fluid of a subject, the pharmaceutical composition according to claim 24.

27. The pharmaceutical composition according to claim 23, wherein the subject is a human.

Images