Transgenic non-human animals carrying human or chimeric TFR1

Abstract

The present disclosure relates to transgenic non-human animals that express human or chimeric (eg, humanized) TFR1, and methods of use thereof.

Description

[Technical field]

[0001] Claiming priority This application claims the benefit of Chinese Patent Application No. 202110808740.8, filed on June 16, 2021, and Chinese Patent Application No. 202111238943.4, filed on October 25, 2021. The entire contents of the above-mentioned applications are incorporated herein by reference.

[0002] Technical Field The present disclosure relates to transgenic animals that express human or chimeric (eg, humanized) TFR1, and methods of use thereof. [Background technology]

[0003] Transferrin receptor 1 (TFR1), also known as cluster of differentiation 71 (CD71), is widely expressed and can bind transferrin (Tf) with high affinity. TFR1, expressed on endothelial cells of the blood-brain barrier, can be used in preclinical studies to deliver macromolecules, including antibodies, to the brain. Thus, antibodies targeting TFR1 may be important for central nervous system therapeutics. For example, TFR1 can be used to transport macromolecules across the blood-brain barrier to deliver therapeutics to the central nervous system.

[0004] Traditionally, drug research and development for various therapeutic methods involves animal models. However, due to differences between humans and animals, the test results obtained by using traditional experimental animals for in vivo pharmacological testing may not reflect the actual pathology and interactions at the target site, and as a result, the results of many clinical trials are significantly different from those of animal experiments. Therefore, the development of a humanized animal model suitable for screening and evaluating human antibodies can significantly improve the efficiency of new drug development and significantly reduce the cost of drug research and development. Summary of the Invention

[0005] The present disclosure relates to an animal model having human TFR1 or chimeric TFR1. The animal model can express human TFR1 or chimeric TFR1 (e.g., humanized TFR1) protein in vivo. The animal model can be used in the functional study of TFR1 gene, and can be used in the screening and evaluation of anti-human TFR1 antibodies. Furthermore, the animal model prepared by the method described herein can be used in drug screening, pharmacodynamics study, immune-related disease treatment, and cancer treatment of human TFR1 target site; the animal model can also be used to facilitate the development and design of new drugs, and save time and cost. In summary, the present disclosure provides a powerful tool for the functional study of TFR1 protein, and a platform for screening anti-cancer drugs.

[0006] In one aspect, the disclosure relates to a transgenic non-human animal whose genome comprises at least one chromosome comprising a sequence encoding human or chimeric TFR1 (transferrin receptor protein 1). In some embodiments, the sequence encoding human or chimeric TFR1 is operably linked to endogenous regulatory elements at an endogenous TFR1 locus in at least one chromosome. In some embodiments, the sequence encoding human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human TFR1 (NP_003225.2 (SEQ ID NO:2)). In some embodiments, the sequence encoding human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO:9. In some embodiments, the sequence encoding human or chimeric TFR1 includes a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to amino acids 89-760 of SEQ ID NO:2. In some embodiments, the animal is a mammal, such as a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous TFR1 or has reduced levels of expression of endogenous TFR1. In some embodiments, the animal has one or more cells that express human or chimeric TFR1. In some embodiments, the animal has one or more cells that express human or chimeric TFR1, and the expressed human or chimeric TFR1 can interact with human transferrin (Tf) and iron to form an iron-Tf-TFR1 complex to facilitate iron import. In some embodiments, the animal has one or more cells that express human or chimeric TFR1, and the expressed human or chimeric TFR1 can interact with endogenous transferrin (Tf) and iron to form an iron-Tf-TFR1 complex to promote iron import.

[0007] In one aspect, the disclosure relates to a genetically modified non-human animal, in some embodiments, the genome of the animal comprises replacing a sequence encoding a region of endogenous TFR1 at the endogenous TFR1 locus with a sequence encoding a corresponding region of human TFR1. In some embodiments, the sequence encoding the corresponding region of human TFR1 is operably linked to an endogenous control element at the endogenous TFR1 locus, and one or more cells of the animal express human or chimeric TFR1. In some embodiments, the animal does not express endogenous TFR1 or has reduced levels of expression of endogenous TFR1. In some embodiments, the replaced locus is an extracellular region of TFR1. In some embodiments, the animal has one or more cells that express a chimeric TFR1 having a cytoplasmic region, a transmembrane region, and an extracellular region, and in some embodiments, the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identical to the extracellular region of human TFR1. In some embodiments, the extracellular region of the chimeric TFR1 has a sequence having at least 100, 200, 300, 400, 500, 600, 620, 650, 660, 665, 666, 667, 668, 669, 670, 671, or 672 consecutive amino acids that are identical to a consecutive sequence present in the extracellular region of human TFR1. In some embodiments, the sequence encoding a region of endogenous TFR1 comprises exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of the endogenous TFR1 gene, or a portion thereof. In some embodiments, the animal is a mouse. In some embodiments, the animal is heterozygous for a replacement at the endogenous TFR1 gene locus. In some embodiments, the animal is homozygous for the replacement at the endogenous TFR1 gene locus.

[0008] In one aspect, the disclosure relates to a method for producing a transgenic non-human animal, comprising replacing a sequence encoding a region of endogenous TFR1 at an endogenous TFR1 locus in at least one cell of the animal with a sequence encoding a corresponding region of human TFR1. In some embodiments, the sequence encoding the corresponding region of human TFR1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of the human TFR1 gene, or a portion thereof. In some embodiments, the sequence encoding the corresponding region of human TFR1 includes a portion of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and a portion of exon 19 of the human TFR1 gene. In some embodiments, the sequence encoding the corresponding region of human TFR1 encodes amino acids 89-760 of SEQ ID NO: 2. In some embodiments, the region is located within the extracellular region of TFR1. In some embodiments, the sequence encoding a region of endogenous TFR1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19, or a portion thereof, of the endogenous TFR1 gene. In some embodiments, the animal is a mouse, and the sequence encoding a region of endogenous TFR1 comprises a portion of exon 4; exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18; and a portion of exon 19 of the endogenous TFR1 gene.

[0009] In one aspect, the disclosure relates to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric TFR1 polypeptide, in some embodiments, the chimeric TFR1 polypeptide comprises at least 50 contiguous amino acid residues identical to the corresponding contiguous amino acid sequence of human TFR1, and in some embodiments, the animal expresses the chimeric TFR1 polypeptide. In some embodiments, the chimeric TFR1 polypeptide has at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 500, at least 550, at least 600, at least 650, at least 660, at least 670, at least 671, or at least 672 contiguous amino acid residues identical to the corresponding contiguous amino acid sequence of the human TFR1 extracellular domain. In some embodiments, the chimeric TFR1 polypeptide comprises a sequence that is at least 90%, 95%, or 99% identical to amino acids 89-760 of SEQ ID NO:2. In some embodiments, the nucleotide sequence is operably linked to an endogenous TFR1 control element of the animal. In some embodiments, the chimeric TFR1 polypeptide comprises an endogenous TFR1 cytoplasmic region and / or an endogenous TFR1 transmembrane region. In some embodiments, the nucleotide sequence is integrated into an endogenous TFR1 locus of the animal. In some embodiments, the chimeric TFR1 polypeptide has at least one mouse TFR1 activity and / or at least one human TFR1 activity.

[0010] In one aspect, the present disclosure relates to a method for producing a genetically modified animal cell expressing a chimeric TFR1, the method comprising replacing a nucleotide sequence encoding a region of endogenous TFR1 with a nucleotide sequence encoding a corresponding region of human TFR1 at an endogenous TFR1 locus to generate a genetically modified animal cell comprising a nucleotide sequence encoding chimeric TFR1, in some embodiments, the animal cell expresses chimeric TFR1. In some embodiments, the animal is a mouse. In some embodiments, the chimeric TFR1 comprises the cytoplasmic and / or transmembrane regions of mouse TFR1 and the extracellular region of human TFR1. In some embodiments, the nucleotide sequence encoding chimeric TFR1 is operably linked to an endogenous TFR1 regulatory region, e.g., a promoter.

[0011] In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein, hi some embodiments, the additional human or chimeric protein is programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), cytotoxic T-lymphocyte associated protein 4 (CTLA-4), TNF receptor superfamily member 4 (OX40), lymphocyte activation gene 3 (LAG3), T cell immunoglobulin and mucin domain containing 3 (TIM-3), or CD73.

[0012] In one aspect, the disclosure relates to a method for measuring the efficacy of an anti-TFR1 antibody for treating a cancer (e.g., a tumor), comprising: a) administering the anti-TFR1 antibody to an animal described herein, in some embodiments, the animal having a cancer (e.g., a tumor); and b) measuring the inhibitory effect of the anti-TFR1 antibody on the cancer (e.g., the tumor). In some embodiments, the cancer (e.g., the tumor) comprises one or more cells expressing TFR1. In some embodiments, the cancer (e.g., the tumor) comprises one or more cancer cells that are injected into the animal. In some embodiments, measuring the inhibitory effect of the anti-TFR1 antibody on the cancer involves measuring the tumor volume in the animal. In some embodiments, the cancer is a brain tumor, a breast cancer, a colon cancer, a liver cancer, an ovarian cancer, a lung cancer, an osteosarcoma, a leukemia, and / or a lymphoma.

[0013] In one aspect, the disclosure relates to a method of measuring the effectiveness of an anti-TFR1 antibody and an additional therapeutic agent for treating cancer, comprising: a) administering the anti-TFR1 antibody and the additional therapeutic agent to an animal described herein, in some embodiments, the animal having a cancer (e.g., a tumor); and b) measuring the inhibitory effect on the cancer (e.g., the tumor). In some embodiments, the animal further comprises a sequence encoding human or chimeric programmed cell death protein 1 (PD-1). In some embodiments, the animal further comprises a sequence encoding human or chimeric programmed cell death ligand 1 (PD-L1). In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody or an anti-PD-L1 antibody. In some embodiments, the cancer comprises one or more cancer cells expressing TFR1 and / or PD-L1. In some embodiments, the cancer is caused by injecting one or more cancer cells into the animal. In some embodiments, measuring the inhibitory effect of the treatment involves measuring tumor volume in the animal. In some embodiments, the animal has brain cancer, breast cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, osteosarcoma, leukemia, and / or lymphoma.

[0014] In one aspect, the disclosure relates to a method of measuring delivery efficiency of a therapeutic agent across the blood-brain barrier, comprising: a) administering the therapeutic agent to an animal as described herein; and b) measuring the concentration of the therapeutic agent over time in the brain and / or serum of the animal. In some embodiments, the therapeutic agent comprises an anti-TFR1 antibody or an antigen-binding fragment thereof. In some embodiments, the therapeutic agent is a multispecific antibody (e.g., a bispecific antibody) that targets TFR1 (e.g., human TFR1) and a second antigen. In some embodiments, the second antigen is beta-secretase 1 (BACE1) or amyloid beta. In some embodiments, the concentration of the therapeutic agent is measured for at least 5 hours, at least 10 hours, at least 15 hours, at least 20 hours, or at least 25 hours.

[0015] In one aspect, the disclosure relates to a method for measuring the efficacy of an anti-TFR1 antibody for treating a bone disease, comprising: a) administering the anti-TFR1 antibody to an animal described herein, in some embodiments, the animal having the bone disease; and b) measuring the effect of the anti-TFR1 antibody on treating the bone disease. In some embodiments, the bone disease is bone fracture, bone deterioration, arthritis, bone deformation, osteoporosis, and / or femoral head necrosis.

[0016] In one aspect, the disclosure relates to a method for measuring the efficacy of an anti-TFR1 antibody for treating a neurodegenerative disease, comprising: a) administering the anti-TFR1 antibody to an animal described herein, in some embodiments, the animal having the neurodegenerative disease; and b) measuring the effect of the anti-TFR1 antibody on treating the neurodegenerative disease. In some embodiments, the neurodegenerative disease is cerebral ischemia, brain injury or epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and / or spinocerebellar ataxia.

[0017] In one aspect, the disclosure relates to a method for measuring the efficacy of an anti-TFR1 antibody for treating an immune deficiency, comprising: a) administering the anti-TFR1 antibody to an animal described herein, in some embodiments, the animal having the immune deficiency; and b) measuring the effect of the anti-TFR1 antibody for treating the immune deficiency. In some embodiments, the immune deficiency is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autologous immune liver disease, diabetes, pain, and / or neuropathy.

[0018] In one aspect, the disclosure relates to a protein that comprises an amino acid sequence, which in some embodiments is one of the following: (a) an amino acid sequence set forth in SEQ ID NO:1, 2, or 9; (b) an amino acid sequence that is at least 90% identical to SEQ ID NO:1, 2, or 9; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1, 2, or 9; (d) an amino acid sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid from the amino acid sequence set forth in SEQ ID NO:1, 2, or 9; and (e) an amino acid sequence that includes 1, 2, 3, 4, 5, or more amino acid substitutions, deletions, and / or insertions relative to the amino acid sequence set forth in SEQ ID NO:1, 2, or 9.

[0019] In one aspect, the disclosure relates to a nucleic acid comprising a nucleotide sequence, which in some embodiments is one of the following: (a) a sequence encoding a protein described herein; (b) SEQ ID NO: 3, 4, 5, 6, 7, or 8; (c) a sequence that is at least 90% identical to SEQ ID NO: 3, 4, 5, 6, 7, or 8; and (d) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3, 4, 5, 6, 7, or 8.

[0020] In one aspect, the disclosure relates to cells comprising the proteins and / or nucleic acids described herein.

[0021] In one aspect, the disclosure relates to animals comprising the proteins and / or nucleic acids described herein.

[0022] In another aspect, the disclosure also provides a genetically modified non-human animal whose genome comprises a disruption in the animal's endogenous TFR1 gene, wherein the disruption of the endogenous TFR1 gene comprises a deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19, or a portion thereof, of the endogenous TFR1 gene.

[0023] In some embodiments, the disruption of the endogenous TFR1 gene comprises a deletion of one or more exons, or portions of exons, selected from the group consisting of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of the endogenous TFR1 gene.

[0024] In some embodiments, the disruption of the endogenous TFR1 gene further comprises a deletion of one or more introns, or portions of introns, selected from the group consisting of intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, and / or intron 18 of the endogenous TFR1 gene.

[0025] In some embodiments, the deletion is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 10 The sequence may include deletions of 00, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400 or more nucleotides.

[0026] In some embodiments, the disruption of the endogenous TFR1 gene is in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 95 including deletions of 0, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 nucleotides (e.g., deletions of at least 180 nucleotides from exon 4, exons 5-18, and at least 200 nucleotides from exon 19).

[0027] The present disclosure further relates to a humanized mouse TFR1 genomic DNA sequence, a DNA sequence identical to or complementary to the DNA sequence and obtained by reverse transcription of the mRNA obtained by transcription thereof; a construct that expresses the amino acid sequence; a cell containing the construct; and a tissue containing the cell.

[0028] The disclosure further relates to the use of the non-human mammal or its progeny, or a tumor-bearing non-human mammal, animal model produced by the methods described herein, in the development of products associated with human cell immunization processes, the production of human antibodies, or in model systems for research in pharmacology, immunology, microbiology, and medicine.

[0029] The disclosure also relates to the use of the non-human mammal or its progeny, or the non-human mammal bearing a tumor, animal model produced by the methods described herein, in the production and utilization of animal experimental disease models of immunization processes involving human cells, in the study of pathogens, or in the development of new diagnostic and / or therapeutic methods.

[0030] The present disclosure further relates to the use of a non-human mammal or its progeny, or a tumor-bearing non-human mammal, an animal model generated by the methods described herein, in the screening, validation, evaluation, or study of TFR1 gene function, human TFR1 antibodies, drugs or efficacy against human TFR1 target sites, and drugs for immune-related diseases and anti-tumor drugs.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art can also be used.Materials, methods, and examples are illustrative only and are not intended to be limiting.All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.

[0032] Other features and advantages of the invention will become apparent from the following detailed description and drawings, and from the claims. [Brief description of the drawings]

[0033] [Figure 1] FIG. 1 is a schematic diagram showing the mouse and human TFR1 gene loci. [Diagram 2] FIG. 1 is a schematic diagram showing the humanized TFR1 gene locus. [Diagram 3] FIG. 1 is a schematic diagram showing the TFR1 gene targeting method. [Figure 4] Southern blot results of cells after recombination using A and Neo probes are shown, WT is the wild type control. [Diagram 5] FIG. 1 is a schematic diagram showing the Flp-Frt recombination process in TFR1 gene-humanized mice. [Figures 6A-6D] Figure 1 shows the PCR identification results of mouse tails of F1 generation mice with primer pairs Frt-F / Frt-R, WT-F / WT-R, Flp-F2 / Flp-R2, and WT-F / Mut-R, respectively. M is the marker. PC is the positive control. WT is the wild-type control. H2O is the water control. [Figure 7A-7C] The results of RT-PCR detection of humanized TFR1 mRNA, mouse TFR1 mRNA, and GAPDH mRNA in splenocytes of wild-type C57BL / 6 mice (+ / +) and TFR1 gene humanized homozygous mice (H / H), respectively, are shown. M is the marker. H2O is the water control. GAPDH is the internal reference. [Figure 8A-8C] Figure 8A shows the PK detection results of anti-human TFR1 antibody Ab in mouse brain tissue measured by ELISA. Human IgG1 (hIgG) is the control. Figure 8B shows the PK detection results of anti-human TFR1 antibody Ab in mouse serum measured by ELISA. Human IgG1 (hIgG) is the control. Figure 8C shows the concentration ratio of anti-human TFR1 antibody Ab over time in mouse brain tissue and serum. Human IgG1 (hIgG) is the control. [Figure 9-1] 1 shows an alignment of the human TFR1 amino acid sequence (NP_003225.2; sequence number 2) with the mouse TFR1 amino acid sequence (NP_035768.1; sequence number 1). [Figure 9-2]1 shows an alignment of the human TFR1 amino acid sequence (NP_003225.2; sequence number 2) with the mouse TFR1 amino acid sequence (NP_035768.1; sequence number 1). [Figure 10-1] 1 shows an alignment of the human TFR1 amino acid sequence (NP_003225.2; sequence number 2) with the rat TFR1 amino acid sequence (NP_073203.1; sequence number 31). [Figure 10-2] 1 shows an alignment of the human TFR1 amino acid sequence (NP_003225.2; sequence number 2) with the rat TFR1 amino acid sequence (NP_073203.1; sequence number 31). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0034] The present disclosure relates to transgenic non-human animals having human or chimeric (eg, humanized) TFR1 and methods of use thereof.

[0035] Iron is an essential element in several biological processes, including oxygen transport, energy production / mitochondrial function, as well as DNA synthesis and repair. In the context of cancer cells, promoting DNA synthesis increases proliferation, while increasing the capacity to repair DNA helps repair DNA damage due to the increased mutational burden common in cancer cells. A central protein in the control of iron metabolism is transferrin (Tf) and its receptor. As the main cellular importer of iron, the function of transferrin receptor 1 (TFR1) is essential for processes involving iron, and uptake of Tf-bound iron by TFR1 is generally the main source of cellular iron import.

[0036] The expression of TFR1 is tightly controlled, because the disruption of iron homeostasis can potentially have harmful consequences for cells. However, TFR1 is often overexpressed in many different types of cancer cells, often at levels several times higher than normal cells. In fact, TFR1 has been identified as a universal cancer marker. Increased expression of TFR1 correlates with the progression of stage and / or poor prognosis in many cancers, such as esophageal squamous cell carcinoma, breast cancer, ovarian cancer, lung cancer, cervical cancer, bladder cancer, osteosarcoma, pancreatic cancer, bile duct cancer, renal cell carcinoma, hepatocellular carcinoma, adrenal cortical carcinoma, and cancer of the nervous system, as well as solid cancers such as acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), and non-Hodgkin's lymphoma (NHL). Therefore, TFR1 is considered as a potential biomarker and therapeutic target for cancer.

[0037] Furthermore, TFR1 expressed on the endothelial cells of the blood-brain barrier can be used to deliver macromolecules, including antibodies, to the brain. Several TFR1-targeting antibodies have been shown to cross the blood-brain barrier without interfering with iron uptake. The affinity of the antibody-TfR interaction appears to be an important measure of the success of transcytotic transport in the endothelial cells of the blood-brain barrier.

[0038] Experimental animal models are essential research tools for studying the effects of these antibodies (e.g., anti-TFR1 antibodies). Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish, etc. However, there are many differences between human and animal gene and protein sequences, and many human proteins cannot bind to the animal homologous proteins to produce biological activity, leading to many clinical trial results being inconsistent with those obtained from animal experiments. Numerous clinical studies are in urgent need of better animal models. As recombinant gene technology is continuously developed and matured, human cells or genes are used to replace or substitute similar endogenous cells or genes of an animal to establish a biological system or disease model closer to humans, and the establishment of humanized experimental animal models (humanized animal models) has provided important tools for new clinical approaches or measures. In this context, recombinant animal models, i.e., recombinant animal models closer to the human genetic system can be established by using genetic engineering technology to replace the homologous genes of an animal with normal or mutant genes of humans. Humanized animal models have various important applications: for example, the presence of human or humanized genes allows the animals to discover proteins with human functions or express parts of said proteins, greatly reducing the difference between human and animal clinical trials and providing the possibility of drug screening at the animal level.

[0039] TFR1 Transferrin receptor 1 (TFR1), also known as cluster of differentiation 71 (CD71), is widely expressed and can bind transferrin (Tf) with high affinity. Human TFR1 is a 90 kDa type II transmembrane glycoprotein of 760 amino acids found as a dimer (180 kDa) linked by disulfide bonds on the cell surface. The TFR1 monomer consists of a large extracellular C-terminal domain of 671 amino acids that contains the Tf-binding site, a transmembrane domain (28 amino acids), and an intracellular N-terminal domain (61 amino acids). The C-terminal extracellular domain contains three N-linked glycosylation sites at asparagine residues 251, 317, and 727, and one O-linked glycosylation site at threonine 104, all of which are required for full function of the receptor.

[0040] Transferrin (Tf) is an 80 kDa glycoprotein composed of two 40 kDa subunits, known as the N- and C-lobes, separated by a short linker sequence. Each subunit contains one free ferric ion (Fe 3+ ), Tf can have up to two atoms of iron bound. Tf in its iron-free form, apoTf, is highly efficient at associating Fe 3+ Binds to Fe 3+ Upon interaction with TFR1, it transports Fe to the cell surface for internalization. As a membrane protein that regulates iron import, TFR1 is involved in the transport of Fe 3+ It is a member of the TFR family that exhibits nanomolar affinity for transferrin (Tf) bound to TFR1. The Tf-TFR1 complex is internalized by clathrin-mediated endocytosis and releases Fe when the pH is reduced to 5.5. 3+ At this pH, apoTf and TFR1 still associate and are recycled to the cell surface at physiological pH, releasing apoTf.

[0041] Accumulating evidence has demonstrated that TFR1 is involved in tumor initiation and progression, and its expression is severely dysregulated in many cancers, since iron uptake by transferrin receptor is an important way for cancer cells to absorb iron. The relationship between TFR1 and cancer has become clear, making TFR1 a valuable pharmaceutical target for cancer intervention.

[0042] TFR1, which is expressed on endothelial cells of the blood-brain barrier, can also be used in preclinical studies to deliver macromolecules, including antibodies, to the brain. Several TFR1-targeting antibodies have been shown to cross the blood-brain barrier without interfering with iron uptake.

[0043] Details of TFR1, Tf, and detailed descriptions of their functions can be found, for example, in Candelaria, PV, et al. “Antibodies targeting the transferrin receptor 1 (TfR1) as direct anti-cancer agents.” Frontiers in Immunology 12 (2021): 607692; and Shen, Y., et al. Transferrin receptor 1 in cancer: a new sight for cancer therapy.” American Journal of Cancer Research 8.6 (2018): 916, each of which is incorporated by reference in its entirety.

[0044] In the human genome, the TFR1 gene (gene ID: 7037) locus has 19 exons, namely exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and exon 19 (Figure 1). The TFR1 protein also has, from the N-terminus to the C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. The nucleotide sequence for human TFR1 mRNA is NM_003234.4, and the amino acid sequence for human TFR1 is NP_003225.2 (SEQ ID NO: 2). The location of each exon and each region within the human TFR1 nucleotide sequence and amino acid sequence is listed below:

[0045] [Table 1]

[0046] The human TFR1 gene (Gene ID: 7037) is located on chromosome 16 of the human genome, which is located at 196018694 to 1960821231 of NC_000003.12. Based on transcript NM_003234.4, the 5'UTR is 196082043-196082090 and 196077100-196077122; exon 1 is 196082090-196082043; the first intron is 196082042-196077123; exon 2 is 196077122-196077064; the second intron is 196077063-196075361; exon 3 is 196075360-196075159; the third intron is 196077063-196075361; intron is 196075158-196074126; exon 4 is 196074125-196073930; fourth intron is 196073929-196072153; exon 5 is 196072152-196072003; fifth intron is 196072002-196071499; exon 6 is 196071498-196071396; sixth intron is 196071395-196069569; exon 7 is 1960695 68~196069455; the 7th intron is 196069454~196068131; exon 8 is 196068130~196068032; the 8th intron is 196068031~196067658; exon 9 is 196067657~196067518; the 9th intron is 196067517~196065601; exon 10 is 196065600~196065443; the 10th intron is 196065442~196064 429; exon 11 is 196064428-196064309; 11th intron is 196064308-196062940; exon 12 is 196062939-196062854; 12th intron is 196062853-196062646; exon 13 is 196062645-196062582; 13th intron is 196062581-196060248; exon 14 is 196060247-196060180;The 14th intron is 196060179-196058633; the 15th exon is 196058632-196058574; the 15th intron is 196058573-196058366; the 16th intron is 196058365-196058284; the 16th intron is 196058283-196055302; the 17th intron is 1960553 01-196055080; intron 17 is 196055079-196053559; exon 18 is 196053558-196053418; intron 18 is 196053417-196052185; exon 19 is 196052184-196049284, and 3'UTR is 196049284-196051941. All information related to the mouse TFR1 locus can be found on the NCBI website under gene ID: 7037.

[0047] In mouse, the TFR1 locus has 19 exons, namely exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and exon 19 (Figure 1). From the N-terminus to the C-terminus, the mouse TFR1 protein also has a cytoplasmic domain, a transmembrane domain, and an extracellular domain. The nucleotide sequence for mouse TFR1 mRNA is NM_011638.4, and the amino acid sequence for mouse TFR1 is NP_035768.1 (SEQ ID NO: 1). The location of each exon and each region within the mouse TFR1 nucleotide and amino acid sequences is listed below:

[0048] [Table 2]

[0049] The mouse TFR1 gene (Gene ID: 22042) is located on chromosome 16 of the mouse genome, which is located at 32427714 to 32451612 of NC_000082.7. Based on transcript NM_011638.4, the 5'UTR is 32427738-32427854 and 32431986-32432008; exon 1 is 32427738-32427854; the first intron is 32427855-32431985; exon 2 is 32431986-32432044; the second intron is 32432045-32433383; exon 3 is 32433384-32433585; and the third intron is 32433586. ~32434010; exon 4 is 32434011~32434212; fourth intron is 32434213~32435566; exon 5 is 32435567~32435716; fifth intron is 32435717~32435914; exon 6 is 32435915~32436017; sixth intron is 32436018~32437035; exon 7 is 32437036~32437149; seventh intron is 324371 exon 8 is 32437451 to 32437549; the eighth intron is 32437550 to 32437854; exon 9 is 32437855 to 32437994; the ninth intron is 32437995 to 32439183; exon 10 is 32439184 to 32439341; the tenth intron is 32439342 to 32439992; exon 11 is 32439993 to 32440115; the eleventh intron is exon 12 is 32441875-32441960; the 12th intron is 32441961-32442189; exon 13 is 32442190-32442253; the 13th intron is 32442254-32443186; exon 14 is 32443187-32443254; the 14th intron is 32443255-32443585; exon 15 is 32443586-32443644;the 15th intron is from 32443645 to 32443801; exon 16 is from 32443802 to 32443883; the 16th intron is from 32443884 to 32445366; exon 17 is from 32445367 to 32445588; the 17th intron is from 32445589 to 32447293; exon 18 is from 32447294 to 32447434; the 18th intron is from 32447435 to 32448911; exon 19 is from 32448912 to 32451612; and the 3'UTR is from 32449155 to 32451612. All information related to the mouse TFR1 locus can be found at the NCBI website under gene ID: 22042, which is incorporated herein by reference in its entirety.

[0050] Figure 9 shows an alignment of the human TFR1 amino acid sequence (NP_003225.2; SEQ ID NO: 2) with the mouse TFR1 amino acid sequence (NP_035768.1; SEQ ID NO: 1). Thus, corresponding amino acid residues or regions between human and mouse TFR1 can be found in Figure 9.

[0051] TFR1 genes, proteins, and loci of other species are also known in the art. For example, the gene ID of TFR1 of Norway rat (rat) is 64678, the gene ID of TFR1 of Felis norvegicus (cat) is 493880, the gene ID of TFR1 of Felis domestica (dog) is 403703, and the gene ID of TFR1 of Sus scrofa (pig) is 397062. Information related to these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, for example, in the NCBI database, which is incorporated herein by reference in its entirety. Figure 10 shows the alignment of the human TFR1 amino acid sequence (NP_003225.2; SEQ ID NO: 2) with the rat TFR1 amino acid sequence (NP_073203.1; SEQ ID NO: 31). Thus, the corresponding amino acid residues or regions between human and rodent TFR1 can be found in Figure 10.

[0052] The present disclosure provides human or chimeric (e.g., humanized) TFR1 nucleotide and / or amino acid sequences. In some embodiments, the entire mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, cytoplasmic region, transmembrane region, and / or extracellular region sequences are replaced with the corresponding human sequences. In some embodiments, a "region" or "portion" of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, cytoplasmic region, transmembrane region, and / or extracellular region is replaced with the corresponding human sequence. The term "region" or "portion" refers to a region or portion of a sequence that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 nucleotides or a region that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 36 It can mean 0, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 660, or 670 amino acid residues.In some embodiments, a "region" or "portion" can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, the cytoplasmic region, the transmembrane region, or the extracellular region. In some embodiments, a region, portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19). is replaced by a region, portion, or the entire sequence of human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19).

[0053] In some embodiments, a "region" or "portion" of the cytoplasmic region, transmembrane region, extracellular region, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 is deleted.

[0054] In some embodiments, the disclosure relates to a transgenic non-human animal whose genome comprises a chimeric (e.g., humanized) TFR1 nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) TFR1 nucleotide sequence encodes a TFR1 protein comprising an extracellular region. In some embodiments, the extracellular region described herein is at least 80%, 85%, 90%, 95%, or 100% identical to amino acids 89-760 of SEQ ID NO:2. In some embodiments, the extracellular region comprises all or a portion of the human TFR1 extracellular region. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:3, 4, 5, 6, 7, 8, or 10.

[0055] In some embodiments, the transgenic non-human animals described herein comprise a sequence encoding a human or humanized TFR1 protein. In some embodiments, the TFR1 protein comprises, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. In some embodiments, the humanized TFR1 protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized TFR1 protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized TFR1 protein comprises a human or humanized transmembrane region. In some embodiments, the humanized TFR1 protein comprises an endogenous transmembrane region. In some embodiments, the humanized TFR1 protein comprises a human or humanized extracellular region. In some embodiments, the humanized TFR1 protein comprises an endogenous extracellular region.

[0056] In some embodiments, the transgenic non-human animals described herein comprise a human or humanized TFR1 gene. In some embodiments, the humanized TFR1 gene comprises 19 exons. In some embodiments, the humanized TFR1 gene comprises endogenous or humanized exon 1, endogenous or humanized exon 2, endogenous or humanized exon 3, human or humanized exon 4, human or humanized exon 5, human or humanized exon 6, human or humanized exon 7, human or humanized exon 8, human or humanized exon 9, human or humanized exon 10, human or humanized exon 11, human or humanized exon 12, human or humanized exon 13, human or humanized exon 14, human or humanized exon 15, human or humanized exon 16, human or humanized exon 17, human or humanized exon 18, and / or human or humanized exon 19. In some embodiments, the humanized TFR1 gene comprises endogenous or humanized intron 1, endogenous or humanized intron 2, human or humanized intron 3, human or humanized intron 4, human or humanized intron 5, human or humanized intron 6, human or humanized intron 7, human or humanized intron 8, human or humanized intron 9, human or humanized intron 10, human or humanized intron 11, human or humanized intron 12, human or humanized intron 13, human or humanized intron 14, human or humanized intron 15, human or humanized intron 16, human or humanized intron 17, and / or human or humanized intron 18. In some embodiments, the humanized TFR1 gene comprises a human or humanized 5'UTR. In some embodiments, the humanized TFR1 gene comprises a human or humanized 3'UTR. In some embodiments, the humanized TFR1 gene comprises an endogenous 5'UTR. In some embodiments, the humanized TFR1 gene comprises the endogenous 3'UTR.

[0057] Thus, in some embodiments, the disclosure also provides chimeric (e.g., humanized) TFR1 nucleotide and / or amino acid sequences, in which in some embodiments at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence is a chimeric (e.g., humanized) TFR1 nucleotide and / or amino acid sequence, The sequence is identical to or derived from an mRNA sequence (e.g., NM_011638.4), a mouse TFR1 amino acid sequence (e.g., SEQ ID NO:1), or a portion thereof (e.g., exon 1, exon 2, exon 3; part of exon 4, and part of exon 19), and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence is identical to or derived from a human TFR1 It is identical to or derived from an mRNA sequence (e.g., NM_003234.4), a human TFR1 amino acid sequence (e.g., SEQ ID NO: 2), or a portion thereof (e.g., a portion of exon 4; exons 5 to 18; and a portion of exon 19).

[0058] In some embodiments, the sequence encoding amino acids 89-763 of mouse TFR1 (SEQ ID NO:1) is replaced. In some embodiments, the sequence is replaced with a sequence encoding the corresponding region of human TFR1 (e.g., amino acids 89-760 of human TFR1 (SEQ ID NO:2)).

[0059] In some embodiments, the nucleic acids described herein are operably linked to a promoter or control element, e.g., the endogenous mouse TFR1 promoter, an inducible promoter, an enhancer, and / or a mouse or human control element.

[0060] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides), that differs from part or all of the mouse TFR1 nucleotide sequence (e.g., part of exon 4; exons 5-18; and part of exon 19 of NM_011638.4).

[0061] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is identical to part or all of the mouse TFR1 nucleotide sequence (e.g., exons 1-3; part of exon 4; and part of exon 19 of NM_011638.4).

[0062] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides), that differs from a portion or all of the human TFR1 nucleotide sequence (e.g., exon 1, exon 2, exon 3; part of exon 4, and part of exon 19 of NM_003234.4).

[0063] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is identical to part or all of the human TFR1 nucleotide sequence (e.g., part of exon 4; exons 5-18; and part of exon 19 of NM_003234.4).

[0064] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., consecutive or non-consecutive amino acid residues) that differs from part or all of the mouse TFR1 amino acid sequence (e.g., amino acids 89 to 763 of NP_035768.1 (SEQ ID NO: 1)).

[0065] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., consecutive or non-consecutive amino acid residues) that is the same as part or all of the mouse TFR1 amino acid sequence (e.g., amino acids 1 to 88 of NP_035768.1 (SEQ ID NO:1)).

[0066] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., consecutive or non-consecutive amino acid residues) that differs from part or all of the human TFR1 amino acid sequence (e.g., amino acids 1 to 88 of NP_003225.2 (SEQ ID NO: 2)).

[0067] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., consecutive or non-consecutive amino acid residues) that is the same as part or all of the human TFR1 amino acid sequence (e.g., amino acids 89 to 760 of NP_003225.2 (SEQ ID NO: 2)).

[0068] The present disclosure provides a humanized TFR1 mouse amino acid sequence, the amino acid sequence comprising: a) the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; b) an amino acid sequence that has at least 90% homology or is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; c) an amino acid sequence encoded by a nucleic acid sequence, said nucleic acid sequence being capable of hybridizing under low stringency or strict stringency conditions to a nucleotide sequence encoding the amino acid set forth in SEQ ID NO: 1, 2 or 9; d) an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9; e) an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or f) an amino acid sequence containing one or more amino acid substitutions, deletions, and / or insertions relative to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; Also provided is an amino acid sequence selected from the group consisting of:

[0069] The present disclosure relates to a humanized TFR1 amino acid sequence, the amino acid sequence comprising: a) all or part of amino acids 89 to 760 of SEQ ID NO:2; b) an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to amino acids 89 to 760 of SEQ ID NO:2; c) an amino acid sequence that differs from amino acids 89 to 760 of SEQ ID NO:2 by 10, 9, 8, 7, 6, 5, 4, 3, 2 or less amino acids, or by 1 or less amino acids; and d) an amino acid sequence containing one or more amino acid substitutions, deletions, and / or insertions relative to amino acids 89 to 760 of SEQ ID NO: 2; Also provided is an amino acid sequence selected from the group consisting of:

[0070] The present disclosure relates to a humanized TFR1 amino acid sequence, the amino acid sequence comprising: a) all or part of amino acids 1 to 88 of SEQ ID NO:1; b) an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to amino acids 1 to 88 of SEQ ID NO:1; c) an amino acid sequence that differs from amino acids 1 to 88 of SEQ ID NO:1 by 10, 9, 8, 7, 6, 5, 4, 3, 2 or less amino acids, or by 1 or less amino acids; and d) an amino acid sequence containing one or more amino acid substitutions, deletions, and / or insertions relative to amino acids 1 to 88 of SEQ ID NO: 1; Also provided is an amino acid sequence selected from the group consisting of:

[0071] The present disclosure also relates to TFR1 nucleic acid (e.g., DNA or RNA) sequences, the nucleic acid sequences being a) a nucleic acid sequence encoding the nucleic acid sequence set forth in SEQ ID NO: 3, 4, 5, 6, 7, or 8, or a homologous TFR1 amino acid sequence of humanized mouse TFR1; b) a nucleic acid sequence capable of hybridizing under low stringency or strict stringency conditions to the nucleotide sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8; c) a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or being at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 3, 4, 5, 6, 7, or 8; d) a nucleic acid sequence encoding an amino acid sequence that has at least 90% homology or is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9; e) a nucleic acid sequence encoding an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9; f) a nucleic acid sequence encoding an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; and / or g) a nucleic acid sequence encoding an amino acid sequence containing one or more amino acid substitutions, deletions, and / or insertions relative to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9. The compound may be selected from the group consisting of:

[0072] The present disclosure further relates to a humanized mouse TFR1 genomic DNA sequence, the DNA sequence being obtained by reverse transcription of mRNA that corresponds to or is complementary to a DNA sequence that is homologous to the sequence shown in SEQ ID NO: 5 or 8, obtained by transcription thereof.

[0073] The present disclosure also provides amino acid sequences having at least 90% homology or at least 90% identity to the sequence set forth in SEQ ID NO: 1, 2, or 9, and having protein activity. In some embodiments, the homology to the sequence set forth in SEQ ID NO: 1, 2, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0074] In some embodiments, the percent identity to the sequence set forth in SEQ ID NO: 1, 2, or 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the percent identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0075] The present disclosure also provides nucleotide sequences having at least 90% homology or at least 90% identity to the sequence set forth in SEQ ID NO: 3, 4, 5, 6, 7, or 8 and encoding a polypeptide having protein activity. In some embodiments, the homology to the sequence set forth in SEQ ID NO: 3, 4, 5, 6, 7, or 8 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0076] In some embodiments, the percent identity to the sequence set forth in SEQ ID NO:3, 4, 5, 6, 7, or 8 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the percent identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0077] The present disclosure also provides nucleic acid sequences that are at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any of the nucleotide sequences described herein, and Also provided are amino acid sequences that are at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any of the amino acid sequences described herein. In some embodiments, the present disclosure relates to a nucleotide sequence encoding any of the peptides described herein or any amino acid sequence encoded by any of the nucleotide sequences described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.

[0078] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences described herein.

[0079] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences described herein.

[0080] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison (e.g., gaps may be introduced in one or both of the first and second amino acid or nucleic acid sequences for optimal alignment for comparison, and non-homologous sequences may be ignored). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced to optimally align the two sequences and the length of each gap. For example, sequence comparison and percent identity determination between two sequences can be performed using the Blossum62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0081] The percentage of residues that conserve similar physicochemical properties (percent homology), such as leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues with similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In many cases, the percentage of homology is higher than the percentage of identity.

[0082] Also provided are cells, tissues, and animals (e.g., mice) that contain the nucleotide sequences described herein, as well as cells, tissues, and animals (e.g., mice) that express human or chimeric (e.g., humanized) TFR1 from an endogenous non-human TFR1 locus.

[0083] Transgenic animals As used herein, the term "transgenic non-human animal" refers to a non-human animal that has exogenous DNA in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of the cells, of the transgenic non-human animal have exogenous DNA in their genome. The cells that have exogenous DNA can be a variety of cells, e.g., endogenous cells, somatic cells, immune cells, T cells, B cells, antigen-presenting cells, macrophages, dendritic cells, germ cells, blastocysts, or endogenous tumor cells. In some embodiments, a transgenic non-human animal is provided that includes a recombinant endogenous TFR1 locus that includes a replacement of a foreign sequence (e.g., a human sequence), e.g., a non-human sequence, with one or more human sequences. The animal is generally capable of transmitting the recombinant to offspring, i.e., through germline transmission.

[0084] As used herein, the term "chimeric gene" or "chimeric nucleic acid" refers to a gene or nucleic acid where two or more portions of the gene or nucleic acid are derived from different species, or where at least one of the sequences of the gene or nucleic acid does not correspond to the wild-type nucleic acid of the animal. In some embodiments, a chimeric gene or nucleic acid has at least a portion of a sequence derived from two or more different sources, e.g., a sequence that encodes a different protein, or a sequence that encodes the same (or homologous) protein of two or more different species. In some embodiments, a chimeric gene or nucleic acid is a humanized gene or nucleic acid.

[0085] As used herein, the term "chimeric protein" or "chimeric polypeptide" refers to a protein or polypeptide in which two or more portions of said protein or polypeptide are derived from different species, or in which at least one of the sequences of said protein or polypeptide does not correspond to the wild-type amino acid sequence of an animal. In some embodiments, a chimeric protein or polypeptide has at least a portion of a sequence derived from two or more different sources, e.g., the same (or homologous) protein of different species. In some embodiments, a chimeric protein or polypeptide is a humanized protein or polypeptide.

[0086] As used herein, the term "humanized protein" or "humanized polypeptide" refers to a protein or polypeptide, where at least a portion of the protein or polypeptide is a human protein or polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

[0087] As used herein, the term "humanized nucleic acid" refers to a nucleic acid, wherein at least a portion of the nucleic acid is derived from a human. In some embodiments, the entire nucleic acid of a humanized nucleic acid is derived from a human. In some embodiments, the humanized nucleic acid is a humanized exon. The humanized exon can be, for example, a human exon or a chimeric exon.

[0088] In some embodiments, the chimeric gene or nucleic acid is a humanized TFR1 gene or nucleic acid. In some embodiments, at least one or more portions of the gene or nucleic acid are derived from a human TFR1 gene and at least one or more portions of the gene or nucleic acid are derived from a non-human TFR1 gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding a TFR1 protein. The encoded TFR1 protein is functional or has at least one activity of a human or non-human TFR1 protein, for example, interacting with transferrin, controlling cellular uptake of iron by endocytosis, and maintaining iron homeostasis.

[0089] In some embodiments, the chimeric protein or chimeric polypeptide is a humanized TFR1 protein or polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a human TFR1 protein and at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a non-human TFR1 protein. The humanized TFR1 protein or polypeptide is functional or has at least one activity of the human TFR1 protein or the non-human TFR1 protein.

[0090] In some embodiments, the cytoplasmic region is human or humanized. In some embodiments, the cytoplasmic region is endogenous. In some embodiments, the transmembrane region is human or humanized. In some embodiments, the transmembrane region is endogenous. In some embodiments, the extracellular region is human or humanized. In some embodiments, the extracellular region is endogenous.

[0091] The genetically modified non-human animals can be a variety of animals, such as mice, rats, rabbits, pigs, bovines (e.g., cows, bulls, buffalo), deer, sheep, goats, chickens, cats, dogs, ferrets, primates (e.g., marmosets, rhesus monkeys). For non-human animals for which suitable genetically modified embryonic stem (ES) cells are not readily available, other methods are used to generate the genetically modified non-human animals. Such methods include, for example, recombining the genome of a non-ES cell (e.g., a fibroblast or an induced pluripotent cell) and transferring the recombinant genome into a suitable cell, such as an oocyte, using nuclear transfer, and gestation of the recombinant cell (e.g., the recombinant oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art and are described, for example, in A. Nagy, et al., "Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition)," Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference in its entirety herein.

[0092] In one aspect, the animal is a mammal, for example, a superfamily of Jerboidea or Murine. In some embodiments, the transgenic animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the transgenic animal is from a family selected from Kangaroo Hamster (e.g., Kangaroo Hamster), Cricetidae (e.g., Hamster, New World Rats and Mice, Field Mouse), Muridae (True Mice and Rats, Gerbils, Spiny Mice, Crested Rat), Tetranychus (Climbing Mice, Rock Mice, White-tailed Mice, Malagasy Rats and Mice), Dormiceidae (e.g., Spiny Dormouse), and Mole Rats (e.g., Mole Rats, Bamboo Mice, and Zokor). In some embodiments, the transgenic rodent is selected from True Mice or Rat (family Muridae), Gerbils, Spiny Mice, and Crested Rat. In some embodiments, the non-human animal is a mouse.

[0093] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of strains that are 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, for example, in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10:836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), both of which are incorporated by reference herein in their entireties. In some embodiments, the transgenic mouse is a mix of 129 and C57BL / 6 strains. In some embodiments, the mouse is a mix of 129 strains or a mix of BL / 6 strains. In some embodiments, the mouse is a BALB strain, e.g., a BALB / c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid strain (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In some embodiments, the non-human animal is a rodent.In some embodiments, the non-human animal is a mouse with a BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr, and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H background.

[0094] In some embodiments, the animal is a rat. The rat can be selected from Wistar rats, LEA strains, Sprague Dawley strains, Fischer strains, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0095] The animal may have one or more other genetic modifications and / or other modifications suitable for the particular purpose for which the humanized TFR1 animal is generated. For example, a mouse suitable for supporting a xenograft (e.g., a human cancer or tumor) may have one or more modifications that impair, inactivate, or destroy all or part of the immune system of the non-human animal. Impairing, inactivating, or destroying the immune system of a non-human animal may include, for example, destruction of hematopoietic and / or immune cells by chemical means (e.g., administration of a toxin), physical means (e.g., irradiation of the animal), and / or genetic modification (e.g., knockout of one or more genes). Non-limiting examples of such mice include, for example, NOD mice, SCID mice, NOD / SCID mice, IL2Rγ knockout mice, NOD / SCID / γc mice, and NOD / SCID / γc mice. null Mouse (Ito, M. et al., NOD / SCID / γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100(9):3175-3182, 2002), nude mice, and Rag1 and / or Rag2 knockout mice. The mice can be optionally irradiated or otherwise treated to destroy one or more immune cell types. Thus, in various embodiments, transgenic mice are provided that can include humanization of at least a portion of the endogenous non-human TFR1 locus, and further include modifications that render incompetent, inactivated, or destroyed all or part of the immune system (or one or more cell types of the immune system) of the non-human animal. In some embodiments, the modifications include, for example, NOD mice, SCID mice, NOD / SCID mice, IL-2Rγ knockout mice, NOD / SCID / γc mice, and the like. null Mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag1 - / - -IL2rg - / - (NRG) Mouse, Rag2 - / - -IL2rg - / - (RG) mice, and combinations thereof. These transgenic animals are described in US20150106961, the entire specification of which is incorporated by reference herein. In some embodiments, the mouse can include replacing all or part of the mature TFR1 coding sequence with a human mature TFR1 coding sequence.

[0096] The genetically modified non-human animal comprises a recombination of an endogenous non-human TFR1 locus. In some embodiments, the recombination comprises a human nucleic acid sequence that encodes at least a portion of a mature TFR1 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a mature TFR1 protein sequence). Genetically modified cells (e.g., ES cells, somatic cells) that can comprise the recombinations described herein are also provided, although in many embodiments, the genetically modified non-human animal comprises a recombination of an endogenous TFR1 locus in the germline of the animal.

[0097] The transgenic animal can express human TFR1 and / or chimeric (e.g., humanized) TFR1 from an endogenous mouse locus, where the endogenous mouse TFR1 gene has been replaced with a human TFR1 gene and / or nucleotide sequence encoding a region of the human TFR1 sequence, or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the human TFR1 sequence. In various embodiments, all or a portion of the endogenous non-human TFR1 locus is engineered to include a human nucleic acid sequence that encodes at least one protein coding sequence of a mature TFR1 protein.

[0098] In some embodiments, the transgenic mouse expresses human TFR1 and / or chimeric TFR1 (e.g., humanized TFR1) from an endogenous locus under the control of a mouse promoter and / or mouse regulatory elements. Replacement at the endogenous mouse locus results in a non-human animal that expresses human TFR1 or chimeric TFR1 (e.g., humanized TFR1) in the appropriate cell type and in a manner that does not result in potential pathology observed in some other transgenic mice known in the art. The human TFR1 or chimeric TFR1 (e.g., humanized TFR1) expressed in the animal can maintain one or more functions of wild-type mouse or human TFR1 in the animal. For example, human or non-human TFR1 ligands (e.g., transferrin) can bind to the expressed TFR1. Additionally, in some embodiments, the animal does not express endogenous TFR1. In some embodiments, the animal expresses a lower level of endogenous TFR1 compared to wild-type animals. As used herein, the term "endogenous TFR1" refers to the TFR1 protein expressed from the endogenous TFR1 nucleotide sequence of a non-human animal (eg, a mouse) prior to any genetic modification.

[0099] The genome of the animal can include a sequence that encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human TFR1 (NP_003225.2) (SEQ ID NO: 2). In some embodiments, the genome includes a sequence that encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 9.

[0100] The genome of the transgenic animal can comprise, at the endogenous TFR1 locus, a sequence encoding a region of endogenous TFR1 with a sequence encoding the corresponding region of human TFR1. In some embodiments, the replaced sequence is any sequence within the endogenous TFR1 gene locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, 5'-UTR, 3'-UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, etc. In some embodiments, the replaced sequence is within the regulatory region of the endogenous TFR1 gene. In some embodiments, the replaced sequence is exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, or a portion thereof, of the endogenous mouse TFR1 gene locus.

[0101] The transgenic animal can have one or more cells that express a human or chimeric TFR1 (e.g., a humanized TFR1) having, from the N-terminus to the C-terminus, a cytoplasmic domain, a transmembrane domain, and an extracellular domain. In some embodiments, the extracellular domain comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% identical to the extracellular domain of human TFR1. In some embodiments, the extracellular region of humanized TFR1 has a sequence having at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 620, 650, 660, 665, 666, 667, 668, 669, 670, 671, or 672 amino acids (e.g., contiguous or non-contiguous) that is identical to human TFR1. In some embodiments, the extracellular region of humanized TFR1 has a sequence that is 5 to 760, or 10 to 672 amino acids (e.g., contiguous or non-contiguous). In many cases, human TFR1 and non-human TFR1 (e.g., mouse TFR1) are different, so that an antibody that binds to human TFR1 does not necessarily have the same binding affinity or effect on non-human TFR1. Thus, a transgenic animal with a human or humanized extracellular domain can be used to better evaluate the effect of an anti-human TFR1 antibody in an animal model. In some embodiments, the genome of the transgenic animal includes a sequence that encodes an amino acid sequence corresponding to part or all of the sequence of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of human TFR1, part or all of the sequence of the extracellular domain of human TFR1, or part or all of the sequence of amino acids 89 to 760 of SEQ ID NO:2.

[0102] In some embodiments, the genome of the transgenic animal comprises a portion of exon 4, exons 5-18, and a portion of exon 19 of the human TFR1 gene. In some embodiments, the portion of exon 4 comprises at least 50, 70, 100, 130, 150, 160, 165, 166, 167, 168, 169, 170, 180, 190, or 196 nucleotides. In some embodiments, the portion of exon 19 comprises at least 100, 200, 220, 230, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 250, 270, 300, 500, 700, 1000, 1300, 1500, 1700, 2000, 2200, 2500, 2700, 2900, or 2901 nucleotides. In some embodiments, the genome of the transgenic animal comprises about 20-63430, about 20-22158, about 20-5224, or about 20-2016 nucleotides (contiguous or non-contiguous nucleotides) of the human TFR1 gene sequence.

[0103] In some embodiments, the non-human animal can have a nucleotide sequence encoding a chimeric human / non-human TFR1 polypeptide at an endogenous TFR1 gene locus, the human portion of the chimeric human / non-human TFR1 polypeptide comprising a portion of the human TFR1 extracellular domain, and the animal expresses functional TFR1 at the cell surface of the animal. The human portion of the chimeric human / non-human TFR1 polypeptide can comprise an amino acid sequence encoded by a portion of exon 4; exons 5-18; and / or a portion of exon 19 of human TFR1. In some embodiments, the human portion of the chimeric human / non-human TFR1 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99% identical to amino acids 89-760 of SEQ ID NO:2. In some embodiments, the cytoplasmic region comprises a sequence corresponding to all or a portion of amino acids 1-65 of SEQ ID NO:1. In some embodiments, the transmembrane region comprises a sequence corresponding to all or a portion of amino acids 66-88 of SEQ ID NO:1.

[0104] In some embodiments, the non-human portion of the chimeric human / non-human TFR1 polypeptide comprises a transmembrane and / or cytoplasmic region of an endogenous non-human TFR1 polypeptide.

[0105] Furthermore, the transgenic animals can be heterozygous for the replacement at the endogenous TFR1 locus or can be homozygous for the replacement at the endogenous TFR1 locus.

[0106] In some embodiments, the humanized TFR1 locus lacks the human TFR1 5'-UTR. In some embodiments, the humanized TFR1 locus includes the endogenous (e.g., mouse) 5'-UTR. In some embodiments, the humanization includes the endogenous (e.g., mouse) 3'-UTR. Where appropriate, it may be reasonable to assume that the mouse and human TFR1 genes are likely to be similarly regulated based on the similarity of their 5' flanking sequences. As shown in this disclosure, humanized TFR1 mice that include a replacement at the endogenous mouse TFR1 locus, including humanization of the TFR1 coding sequence, while retaining mouse regulatory elements, do not exhibit pathology. Both transgenic mice that are heterozygous or homozygous for humanized TFR1 are grossly normal.

[0107] The present disclosure further relates to a non-human mammal produced by the above-described method, in some embodiments, whose genome contains human genes.

[0108] In some embodiments, the non-human mammal is a rodent, preferably, the non-human mammal is a mouse.

[0109] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TFR1 gene.

[0110] Furthermore, the present disclosure also relates to a tumor-bearing non-human mammal model, characterized in that the non-human mammal model is obtained by the method described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse).

[0111] The disclosure further relates to cells or cell lines, or primary cell cultures thereof, derived from a non-human mammal or its progeny, or a non-human mammal having a tumor; tissues, organs, or cultures thereof derived from a non-human mammal or its progeny, or a non-human mammal having a tumor; and tumor tissue derived from a non-human mammal or its progeny, or a non-human mammal having a tumor, when the non-human mammal or its progeny has a tumor.

[0112] The disclosure also provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal is provided, the transgenic animal containing DNA encoding a human or humanized TFR1 within the genome of the animal.

[0113] In some embodiments, the non-human mammal comprises a genetic construct described herein (e.g., a genetic construct shown in Figures 2, 3, and 5). In some embodiments, a non-human mammal is provided that expresses human or humanized TFR1. In some embodiments, tissue-specific expression of human or humanized TFR1 protein is provided.

[0114] In some embodiments, expression of human or humanized TFR1 in transgenic animals can be controlled by adding a specific inducer or repressor substrate. In some embodiments, the specific inducer is selected from the Tet-Off System / Tet-On System, or the Tamoxifen System.

[0115] The non-human mammal can be any non-human animal known in the art and can be used in the methods described herein.Preferred non-human mammals are mammals (e.g., rodents).In some embodiments, the non-human mammal is a mouse.

[0116] Genetic, molecular, and behavioral analyses of the non-human mammals described above can be performed. The present disclosure also relates to progeny produced by the non-human mammals provided herein when mated with the same or other genotypes.

[0117] The present disclosure also provides cell lines or primary cell cultures derived from non-human mammals or their descendants.Models based on cell culture can be prepared, for example, by the following methods.Cell cultures can be obtained by isolation from non-human mammals, or cells can be obtained from established cell cultures using the same construct and standard cell transfection techniques.The integration of the gene construct containing the DNA sequence encoding human TFR1 protein can be detected by various methods.

[0118] There are many analytical methods available for detecting exogenous DNA, including methods at the nucleic acid level (including mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting and in situ hybridization), and methods at the protein level (including histochemistry, immunoblot analysis, and in vitro binding studies). In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Quantitative measurements can be completed using many standard analytical methods. For example, transcription levels can be measured using RT-PCR and hybridization methods, including RNase protection, Southern blot analysis, and RNAdot analysis. Immunohistochemical staining, flow cytometry, and Western blot analysis can also be used to evaluate the presence of human or humanized TFR1 protein.

[0119] vector The present disclosure relates to a targeting vector comprising: a) a DNA fragment homologous to the 5' end (5' arm) of a modifiable region selected from a TFR1 gene genomic DNA of 100 to 10,000 nucleotides in length; b) a desired / donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3' end (3' arm) of a modifiable region selected from a TFR1 gene genomic DNA of 100 to 10,000 nucleotides in length.

[0120] In some embodiments, a) the DNA fragment homologous to the 5' end (5' arm) of the modifiable conserved region is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000082.7; and c) the DNA fragment homologous to the 3' end (3' arm) of the modifiable region is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000082.7.

[0121] In some embodiments, a) the DNA fragment homologous to the 5' end (5' arm) of the modifiable region is selected from nucleotides from position 32429794 to position 32434036 of NCBI Accession No. NC_000082.7; and c) the DNA fragment homologous to the 3' end (3' arm) of the modifiable region is selected from nucleotides from position 32449155 to position 32453445 of NCBI Accession No. NC_000082.7.

[0122] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be greater than about 3 kb, about 4 kb, about 5 kb, about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 15 kb, about 20 kb, about 21 kb, about 22 kb, about 23 kb, about 24 kb, or about 25 kb.

[0123] In some embodiments, the modifiable region is exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of the TFR1 gene (e.g., a portion of exon 4; exons 5-18; and a portion of exon 19 of the mouse TFR1 gene).

[0124] The targeting vector can further include one or more selectable markers, such as a positive or negative selectable marker. In some embodiments, the positive selectable marker is a Neo gene or a Neo cassette. In some embodiments, the negative selectable marker is a DTA gene.

[0125] In some embodiments, the sequence of the 5' arm is set forth in SEQ ID NO:3 and the sequence of the 3' arm is set forth in SEQ ID NO:4.

[0126] In some embodiments, the sequence is derived from human (e.g., 196051942-196074099 of NC_000003.12). For example, the target region of the targeting vector is a portion or the entire nucleotide sequence of human TFR1, preferably exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of human TFR1. In some embodiments, the nucleotide sequence of humanized TFR1 encodes all or a portion of the human TFR1 protein of NCBI Accession No. NP_003225.2 (SEQ ID NO:2).

[0127] The present disclosure also relates to a cell comprising the above-mentioned targeting vector.

[0128] In addition, the disclosure further relates to a non-human mammalian cell comprising any one of the aforementioned targeting vectors and one or more in vitro transcripts of the constructs described herein. In some embodiments, the cell comprises Cas9 mRNA or an in vitro transcript thereof.

[0129] In some embodiments, the gene in the cell is heterozygous. In some embodiments, the gene in the cell is homozygous.

[0130] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0131] Methods for producing genetically modified animals Transgenic animals can be produced by several techniques known in the art, including, for example, non-homologous end joining (NHEJ), homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate transgenic animals. Many of these genome editing techniques are known in the art and are described, for example, in Yin et al., "Delivery technologies for genome editing," Nature Reviews Drug Discovery 16.6 (2017): 387-399, which publication is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, for example, microinjection of a transgenic nucleus into an enucleated oocyte and fusion of the enucleated oocyte with another transgenic cell.

[0132] Thus, in some embodiments, the disclosure provides for replacing a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human or chimeric TFR1 at the endogenous TFR1 locus in at least one cell of an animal. In some embodiments, the replacement occurs in a germ cell, somatic cell, blastocyst, fibroblast, or the like. The nucleus of the somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0133] Figure 3 shows a method for humanizing the mouse TFR1 locus. In Figure 3, the targeting method involves a vector that includes a 5'-end homology arm, a human TFR1 gene fragment, and a 3' homology arm. The process can involve replacing the endogenous TFR1 sequence with a human sequence by homologous recombination. In some embodiments, cleavage can be performed upstream and downstream of the target site (e.g., by zinc finger nuclease, TALEN, or CRISPR), resulting in a DNA double-strand break, and homologous recombination can be used to replace the endogenous TFR1 sequence with a human TFR1 sequence.

[0134] Thus, in some embodiments, a method for producing a transgenic humanized animal can include replacing a nucleic acid encoding a sequence encoding a region of endogenous TFR1 at the endogenous TFR1 locus (or site) with a sequence encoding the corresponding region of human TFR1. The sequence can include a region (e.g., a portion or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of the human TFR1 gene. In some embodiments, the sequence includes a portion of exon 4; exons 5-18; and a portion of exon 19 (e.g., nucleic acids 548-2566 of NM_003234.4) of the human TFR1 gene. In some embodiments, the region is located within the extracellular region of TFR1 (e.g., amino acids 89-760 of SEQ ID NO:2; or amino acids 89-763 of SEQ ID NO:1). In some embodiments, the endogenous TFR1 locus is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and / or exon 19 of mouse TFR1. In some embodiments, the sequence includes a portion of exon 4; exons 5-18; and a portion of exon 19 (e.g., nucleic acids 429-2456 of NM_011638.4) of the mouse TFR1 gene.

[0135] In some embodiments, a method for modifying a mouse TFR1 locus to express a chimeric human / mouse TFR1 peptide can include generating a sequence encoding a chimeric human / mouse TFR1 by replacing a nucleotide sequence encoding mouse TFR1 with a nucleotide sequence encoding human TFR1 at the endogenous mouse TFR1 locus.

[0136] In some embodiments, the nucleotide sequence encoding the chimeric human / mouse TFR1 can include a first nucleotide sequence encoding the cytoplasmic and transmembrane regions of mouse TFR1; and a second nucleotide sequence encoding the extracellular region of human TFR1.

[0137] In some embodiments, the nucleotide sequences described herein do not overlap with each other (e.g., a first nucleotide sequence and a second nucleotide sequence do not overlap). In some embodiments, the amino acid sequences described herein do not overlap with each other.

[0138] The present disclosure relates to (a) providing a cell (e.g., a fertilized egg cell) according to a method described herein; (b) culturing the cells in a liquid medium; (c) implanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal and growing the cells in the uterus of the female non-human mammal; (d) identifying germline transmission in the progeny genetically modified humanized non-human mammal of the pregnant female of step (c); The present invention further provides a method for establishing a TFR1 gene humanized animal model, comprising:

[0139] In some embodiments, the non-human mammal in the aforementioned methods is a mouse (eg, a C57BL / 6 mouse).

[0140] In some embodiments, the non-human mammal in step (c) is a pseudopregnant (or phantom pregnant) female.

[0141] In some embodiments, the fertilized eggs for the above-mentioned methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0142] The fertilized egg can be derived from any non-human animal, for example, any of the non-human animals described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The genetic construct can be introduced into the fertilized egg by microinjection of DNA. For example, the fertilized egg can be cultured after microinjection, and the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, which then produces a non-human mammal, thereby generating the non-human mammal mentioned in the above method.

[0143] In some embodiments, the method for producing a transgenic animal includes modifying the coding frame of the TFR1 gene of a non-human animal, for example, by inserting a nucleotide sequence (e.g., a cDNA sequence) encoding a human or humanized TFR1 protein immediately after the endogenous regulatory elements of the TFR1 gene of the non-human animal. For example, one or more functional region sequences of the TFR1 gene of the non-human animal can be knocked out or inserted into such that the non-human animal is unable to express endogenous TFR1 protein or expresses low levels of endogenous TFR1 protein. In some embodiments, the coding frame of the modified TFR1 gene of a non-human animal can be the entire or a part of the nucleotide sequence of exon 1 to exon 19 of the TFR1 gene of the non-human animal.

[0144] In some embodiments, the method for producing a transgenic animal comprises inserting a nucleotide sequence encoding a human or humanized TFR1 protein and / or an auxiliary sequence after the endogenous regulatory elements of the TFR1 gene of a non-human animal. In some embodiments, the auxiliary sequence can be a stop codon that allows the TFR1 gene humanized animal model to express human or humanized TFR1 protein in vivo, but not the TFR1 protein of the non-human animal. In some embodiments, the auxiliary sequence comprises a WPRE (WHP post-transcriptional response element) and / or a polyA.

[0145] How to use genetically modified animals Substitution of a human gene in a non-human animal with a homologous or orthologous human gene or sequence under the control of an endogenous promoter and / or control element at an endogenous non-human locus can result in a non-human animal with qualities and characteristics that may be substantially different from a normal knockout+transgene animal. In a normal knockout+transgene animal, the endogenous locus is removed or damaged and a complete human transgene is inserted into the animal's genome, possibly randomly integrated into the genome. Usually, the location of the integrated transgene is unknown; expression of human proteins is measured by transcription of the human gene and / or protein assays and / or functional assays. It is clearly presumed that the inclusion of upstream and / or downstream human sequences in the human transgene is sufficient to provide adequate support for expression and / or control of the transgene.

[0146] In some cases, transgenes containing human regulatory elements may be anti-physiologically or otherwise poorly expressed and may actually be harmful to the animal. The present disclosure discloses that replacement with human sequences at endogenous loci, under the control of endogenous regulatory elements, results in physiologically appropriate expression patterns and levels resulting in useful humanized animals in which the physiology of the replaced gene is useful and appropriate in the context of the physiology of the humanized animal.

[0147] For example, genetically modified animals expressing human or humanized TFR1 protein in a physiologically relevant manner provide a variety of uses, including, but not limited to, the development of therapeutics for human diseases and disorders, and the evaluation of the toxicity and / or efficacy of these human therapeutics in animal models.

[0148] In various aspects, genetically modified animals are provided that express human or humanized TFR1, which can reduce or block the interaction of TFR1 with a TFR1 ligand (e.g., transferrin) or with an anti-human TFR1 antibody, and are useful for testing agents to determine whether the agent can increase or decrease an immune response and / or to determine whether the agent is a TFR1 agonist or antagonist. The genetically modified animals can be, for example, animal models of human diseases, for example, where the disease is genetically induced (knock-in or knock-out). In various embodiments, the genetically modified non-human animals further include non-human animals genetically modified to sustain or maintain a deficiency of the immune system, for example, a human xenograft, for example, a human solid tumor or a blood cell tumor (e.g., leukemia, lymphoma, or B or T cell tumor). In some embodiments, the anti-TFR1 antibody blocks or inhibits a TFR1-related signaling pathway.

[0149] In some embodiments, the anti-TFR1 antibodies described herein can block the interaction of TFR1 with transferrin, e.g., inhibiting iron import by endocytosis. In some embodiments, the anti-TFR1 antibodies described herein can block the interaction of TFR1 with gamma-aminobutyric acid-related protein (GABARAP) or human homeostatic iron regulatory protein (HFE).

[0150] In some embodiments, transgenic animals can be used to measure the effectiveness of anti-TFR1 antibodies for the treatment of cancer. The method involves administering an anti-TFR1 antibody (e.g., an anti-human TFR1 antibody) to an animal described herein, the animal having a tumor, and measuring the inhibitory effect of the anti-TFR1 antibody on the tumor. Measurable inhibitory effects can include, for example, a reduction in tumor size or tumor volume, a reduction in tumor growth, a decrease in the rate of increase in tumor volume in the subject (e.g., compared to the rate of increase in tumor volume in the same subject before treatment or in another subject without such treatment), a decrease in the risk of developing metastases or the risk of developing one or more additional metastases, an increase in survival rate, and an increase in life expectancy. Tumor volume in a subject can be measured by a variety of methods, for example, measured by direct measurement, MRI, or CT. Furthermore, TFR1 is also expressed in many other cells, so these antibodies require a delicate balance. Therefore, since humanized TFR1 functions in much the same way as endogenous TFR1, it is important to use results in humanized animals to predict the efficacy or toxicity of these therapeutics in humans. In some embodiments, anti-TFR1 antibodies can be directly targeted to cancer cells expressing TFR1, for example, by inducing complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC) to kill the cancer cells.

[0151] In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-TFR1 antibody prevents transferrin from binding to TFR1. In some embodiments, the anti-TFR1 antibody does not prevent transferrin from binding to TFR1.

[0152] In some embodiments, the transgenic animals can be used to measure whether an anti-TFR1 antibody is a TFR1 agonist or antagonist. In some embodiments, the methods described herein are designed to also measure the effect of an agent (e.g., an anti-TFR1 antibody) on TFR1, such as whether the agent can stimulate or inhibit immune cells (e.g., T cells, B cells, or NK cells), whether the agent can increase or decrease the production of cytokines, whether the agent can activate or inactivate immune cells (e.g., T cells, B cells, or NK cells), whether the agent can cross the blood-brain barrier; whether the agent can upregulate or downregulate immune responses, and / or whether the agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, the transgenic animals can be used to measure the effective dose of a therapeutic agent for treating a disease, such as cancer, in a subject.

[0153] The tumor inhibitory effect can be measured by methods known in the art, for example, by measuring tumor volume in animals and / or by tumor (volume) inhibition percentage (TGI TV The percentage of tumor growth inhibition can also be measured by measuring the TGI TV The tumor volume (or weight) can be calculated using the formula: (%)=(1-TVt / TVc)×100, where TVt and TVc are the mean tumor volume (or weight) in the treatment and control groups.

[0154] In some embodiments, the anti-TFR1 antibodies are designed to treat various cancers. As used herein, the term "cancer" refers to cells with autonomous growth potential, i.e., an abnormal situation or condition characterized by rapidly proliferating cell proliferation. The term is meant to include any kind of cancerous growth or oncogenic process, metastatic tissue or malignantly transformed cells, tissues, or organs, regardless of the type of tissue change or stage of invasiveness. As used herein, the term "tumor" refers to a cancerous cell, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of various organ systems, such as those affecting the lung, breast, thyroid, lymphatic system, gastrointestinal, and genitourinary tract, as well as adenocarcinomas, including malignancies such as most colon cancers, renal cell carcinoma, prostate cancer, and / or testicular cancer, non-small cell carcinoma of the lung, small intestine cancer, and esophageal cancer. In some embodiments, the agents described herein are designed to treat or diagnose carcinoma in a subject. The term "carcinoma" is art-recognized and refers to malignant tumors of epithelial or endocrine tissue, including respiratory, digestive, genitourinary, testicular, breast, prostate, endocrine, and melanoma. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, which include, for example, malignant tumors composed of carcinomatous and sarcomatous tissue. "Adenocarcinoma" refers to carcinomas derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art-recognized and refers to malignant tumors of mesenchymal origin.

[0155] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, uterine cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, osteosarcoma, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferative syndrome, and sarcoma. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom's macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In certain embodiments, the tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, renal cancer, lung cancer, or liver cancer.

[0156] In some embodiments, the cancer described herein is a solid cancer (e.g., esophageal squamous cell carcinoma, breast cancer, ovarian cancer, lung cancer, cervical cancer, bladder cancer, osteosarcoma, pancreatic cancer, cholangiocarcinoma, renal cell carcinoma, hepatocellular carcinoma, adrenocortical carcinoma), a cancer of the nervous system, or a hematopoietic malignancy (e.g., acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), or non-Hodgkin's lymphoma (NHL)).

[0157] In some embodiments, the TFR1 antibody is designed to treat brain cancer, breast cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, osteosarcoma, leukemia, and / or lymphoma.

[0158] In some embodiments, the anti-TFR1 antibody is designed to treat various autoimmune diseases, including rheumatoid arthritis, Crohn's disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel disease (IBD), ulcerative colitis, or scleroderma. In some embodiments, the anti-TFR1 antibody is designed to treat various immune disorders, including allergy, asthma, and / or atopic dermatitis. Thus, the methods described herein can be used to measure the effectiveness of the anti-TFR1 antibody in inhibiting immune responses. In some embodiments, the immune disorders described herein include allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, and / or neuropathy.

[0159] In some embodiments, the anti-TFR1 antibody is designed to treat various bone diseases, such as bone fractures, bone degeneration, arthritis, bone deformity, osteoporosis, and / or femoral head necrosis. In some embodiments, the anti-TFR1 antibody is designed to treat various neurodegenerative diseases, such as cerebral ischemia, brain injury or epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and / or spinocerebellar ataxia.

[0160] The disclosure also provides a method of measuring the toxicity of an antibody (e.g., an anti-TFR1 antibody). The method involves administering the antibody to an animal as described herein. The animal's weight change, red blood cell count, hematocrit, and / or hemoglobin are then evaluated. In some embodiments, the antibody can reduce red blood cells (RBCs), hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animal can have a weight that is at least 5%, 10%, 20%, 30%, or more than 40% lower than the weight of a control group (e.g., the average weight of animals not treated with the antibody).

[0161] In some embodiments, the transgenic animals described herein can be used to measure the effectiveness of anti-TFR1 antibodies for treating a disease or condition. In some embodiments, the disease or condition is associated with iron uptake or iron-related metabolism. The method can involve administering an anti-TFR1 antibody (e.g., an anti-human TFR1 antibody) to an animal described herein and measuring the effect of the anti-TFR1 antibody on the disease or condition.

[0162] In some embodiments, the transgenic animals described herein can be used to measure the delivery efficiency of a therapeutic agent across the blood-brain barrier. The method can involve administering a therapeutic agent (e.g., comprising an anti-TFR1 antibody or antigen-binding fragment thereof; or an anti-TFR1 bispecific or multispecific antibody or antigen-binding fragment thereof) to the animal and measuring the concentration (e.g., pharmacokinetics) of the therapeutic agent in the brain and / or serum of the animal over time. In some embodiments, the therapeutic agent comprises an anti-TFR1 antibody or antigen-binding fragment thereof. In some embodiments, the agent binds to an anti-TFR1 antibody or antigen-binding fragment thereof (e.g., the C-terminus of an anti-TFR1 antibody). In some embodiments, the anti-TFR1 bispecific or multispecific antibody or antigen-binding fragment thereof can also target a second antigen. In some embodiments, the second antigen is a protein implicated in Alzheimer's disease (e.g., BACE1 or amyloid beta).

[0163] In some embodiments, the transgenic animals described herein can be used to measure the effectiveness of a therapeutic agent to treat a disease in the central nervous system. The method can involve administering a therapeutic agent (e.g., including an anti-TFR1 antibody or antigen-binding fragment thereof; or an anti-TFR1 bispecific or multispecific antibody or antigen-binding fragment thereof) to the animal and measuring the effect of the agent on the disease.

[0164] In some embodiments, upon administration, the concentration of the anti-TFR1 antibody (e.g., any of the monospecific, bispecific, or multispecific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% greater than the concentration of a control antibody (e.g., human IgG) in the brain of the animal. In some embodiments, upon administration, the concentration of an anti-TFR1 antibody (e.g., any of the monospecific, bispecific, or multispecific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% of the concentration of a control antibody (e.g., human IgG) in the serum of the animal. In some embodiments, the concentration of a therapeutic agent described herein (e.g., any of the monospecific, bispecific, or multispecific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is measured over a period of at least 5 hours, at least 10 hours, at least 15 hours, at least 20 hours, or at least 25 hours. At a particular time point (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hours after administration), the ratio of antibody concentration in the brain to the antibody concentration in the serum can be calculated.In some cases, the ratio is at least 0.5, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 to a therapeutic agent described herein (e.g., any of the monospecific, bispecific, or multispecific anti-TFR1 antibodies or antigen-binding fragments thereof described herein). In some embodiments, the ratio to a therapeutic agent described herein is at least 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or 100-fold compared to the ratio to a control antibody (e.g., human IgG).

[0165] The disclosure also relates to the use of the animal models generated by the methods described herein in the development of products associated with human cellular immunization processes, the production of human antibodies, or in model systems for research in pharmacology, immunology, microbiology, and medicine.

[0166] In some embodiments, the present disclosure provides for the use of animal models generated by the methods described herein in the production and utilization of animal experimental disease models of immunization processes involving human cells, in the study of pathogens, or in the development of new diagnostic and / or therapeutic methods.

[0167] The present disclosure also relates to the use of animal models generated by the methods described herein in screening, validating, evaluating, or studying TFR1 gene function, human TFR1 antibodies, drugs for the human TFR1 target site; drugs or efficacy against the human TFR1 target site; drugs for immune-related diseases, and anti-tumor drugs.

[0168] In some embodiments, the disclosure provides a method for validating the in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T cell adoptive transfer therapy). For example, the method includes implanting human tumor cells into an animal described herein and applying human CAR-T to the animal bearing human tumor cells. The efficacy of CAR-T therapy can be measured and evaluated. In some embodiments, the animal is selected from a TFR1 genetic humanized non-human animal prepared by the methods described herein, a TFR1 genetic humanized non-human animal described herein, a bi- or multi-humanized non-human animal (or its progeny) generated by the methods described herein, a non-human animal expressing a human or humanized TFR1 protein, or a tumor-bearing or inflammatory animal model described herein. In some embodiments, TCR-T, CAR-T, and / or other immunotherapies can treat a TFR1-associated disease described herein. In some embodiments, TCR-T, CAR-T, and / or other immunotherapies provide a research method for treating a TFR1-associated disease described herein.

[0169] Transgenic animal models carrying two or more human or chimeric genes The present disclosure further relates to methods for generating transgenic animal models having two or more human or chimeric genes. The animals can include a human or chimeric TFR1 gene and sequences encoding additional human or chimeric proteins.

[0170] In some embodiments, the additional human or chimeric protein can be programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), TNF receptor superfamily member 4 (OX40), lymphocyte activation gene 3 (LAG3), T-cell immunoglobulin and mucin domain containing 3 (TIM-3), or CD73.

[0171] Methods for generating transgenic animal models that contain two or more human or chimeric genes (e.g., humanized genes) include: (a) obtaining a transgenic non-human animal using a method for introducing a human or chimeric TFR1 gene as described herein; (b) mating the transgenic non-human animal with another transgenic non-human animal and then sequencing the progeny to obtain a transgenic non-human animal having two or more human or chimeric genes; may include.

[0172] In some embodiments, in step (b) of the method, the transgenic animal can be bred with a transgenic non-human animal having human or chimeric PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73. Some of these transgenic non-human animals are described, for example, in PCT / CN2018 / 110069, PCT / CN2017 / 090320, PCT / CN2017 / 099574, PCT / CN2017 / 099577, PCT / CN2017 / 099575, PCT / CN2017 / 110435, PCT / CN2019 / 127084, PCT / CN2017 / 110494, and PCT / CN2019 / 119793, each of which is incorporated by reference in its entirety.

[0173] In some embodiments, TFR1 humanization is performed directly in transgenic animals harboring human or chimeric PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73 genes.

[0174] These proteins may have different mechanisms, so a combination therapy targeting two or more of these proteins may be a more effective treatment. In fact, many related clinical trials are ongoing and have shown good effects. To measure the effectiveness of a combination therapy targeting two or more of these proteins, such as an anti-TFR1 antibody and an additional therapeutic agent for cancer treatment, a transgenic animal model with two or more human or humanized genes can be used. The method includes administering an anti-TFR1 antibody and an additional therapeutic agent to an animal, the animal having a tumor, and measuring the inhibitory effect of the combination treatment on the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab), or an anti-PD-L1 antibody.

[0175] In some embodiments, the animal further comprises a sequence encoding human or humanized PD-1, a sequence encoding human or humanized PD-L1, or a sequence encoding human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and / or PD-L2.

[0176] In some embodiments, the combination therapy is designed to treat various cancers described herein, such as melanoma, non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), bladder cancer, prostate cancer (e.g., metastatic hormone refractory prostate cancer), advanced breast cancer, advanced ovarian cancer, and / or advanced refractory solid tumors. In some embodiments, the combination therapy is designed to treat metastatic solid tumors, NSCLC, melanoma, B-cell non-Hodgkin's lymphoma, colorectal cancer, and multiple myeloma. In some embodiments, the combination therapy is designed to treat melanoma, carcinoma (e.g., pancreatic cancer), mesothelioma, hematological malignancies (e.g., non-Hodgkin's lymphoma, lymphoma, chronic lymphocytic leukemia), or solid tumors (e.g., advanced solid tumors). In some embodiments, the combination therapy is designed to treat breast cancer, colon cancer, cervical cancer, fibrosarcoma, liver cancer, lung cancer, non-small cell lung cancer (NSCLC), melanoma, ovarian cancer, renal cancer, skin cancer, plasmacytoma, lymphoma, and / or leukemia.

[0177] In some embodiments, the methods described herein can be used to evaluate combination treatments with several other methods. Methods of treating cancer that can be used alone or in combination with the methods described herein include, for example, treating a subject with chemotherapy, such as camptothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosourea, dactinomycin, daunorubicin, bleomycin, plicamycin, mitomycin, etoposide, belampir, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristine, vinblastine, and / or methotrexate. Alternatively, or in addition, the method can include performing surgery on the subject to remove at least a portion of the cancer, for example, removing part or all of the tumor from the patient. EXAMPLES

[0178] Working Example The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0179] Materials and Methods The following materials were used in the examples below.

[0180] DraIII, EcoRV, and AseI restriction enzymes were purchased from NEB (catalog numbers: R3510V, R3195V, and R0101M, respectively).

[0181] C57BL / 6 mice and Flp transgenic mice were purchased from the National Rodent Experimental Animal Center, China Food and Drug Research Institute.

[0182] Purified anti-mouse CD16 / 32 antibody was purchased from BioLegend (catalog number: 101302).

[0183] Brilliant Violet 510 TM Anti-mouse CD45 antibody was purchased from BioLegend (catalog number: 103138).

[0184] PerCP / Cy5.5 anti-mouse TCRβ antibody was purchased from BioLegend (catalog number: 109228).

[0185] FITC anti-mouse CD19 antibody was purchased from BioLegend (catalog number: 115506).

[0186] Brilliant Violet 605 TM Anti-mouse TER-119 / red blood cell antibody was purchased from BioLegend (catalog number: 116239).

[0187] PE anti-mouse CD43 antibody was purchased from BioLegend (catalog number: 143205).

[0188] APC anti-human CD43 antibody was purchased from BioLegend (catalog number: 343205).

[0189] APC anti-human CD71 antibody was purchased from BioLegend (catalog number: 334107).

[0190] Zombie NIR TM Fixable Viability kit was purchased from BioLegend (catalog number: 423106).

[0191] Brilliant Violet 605 TM Anti-mouse TER-119 / red blood cell antibody was purchased from BioLegend (catalog number: 116239).

[0192] PE anti-mouse CD71 antibody was purchased from BioLegend (catalog number: 113807).

[0193] Example 1: Generation of mice with a humanized TFR1 gene The genome of a non-human animal (e.g., a mouse) can be engineered to include a nucleic acid sequence encoding all or a portion of the human TFR1 protein such that the genetically engineered non-human animal is capable of expressing a human or humanized TFR1 protein. The mouse TFR1 gene (NCBI Gene ID: 22042, Primary Source: MGI: 98822, UniProt ID: Q62351) is located at 32427714-32451612 on chromosome 16 (NC_000082.7), and the human TFR1 gene (NCBI Gene ID: 7037, Primary Source: HGNC: 117631, UniProt ID: P02786) is located at 196018694-196082123 on chromosome 3 (NC_000003.12). The mouse TFR1 transcript is NM_011638.4 and the corresponding protein sequence NP_035768.1 is shown in SEQ ID NO: 1. The human TFR1 transcript is NM_003234.4 and the corresponding protein sequence NP_003225.2 is shown in SEQ ID NO: 2. The mouse and human TFR1 gene loci are shown in FIG.

[0194] All or part of the nucleotide sequence encoding the human TFR1 protein can be introduced into the mouse endogenous TFR1 locus, causing the mouse to express a human or humanized TFR1 protein. Specifically, the mouse TFR1 gene was humanized by using the nucleotide sequence encoding the human TFR1 protein under the control of mouse TFR1 gene regulatory elements to replace the corresponding mouse sequence using gene editing techniques, resulting in the humanized TFR1 gene locus shown in FIG. 2.

[0195] As shown in the schematic diagram of the targeting method in Figure 3, the targeting vector contains the upstream and downstream homologous arm sequences of the mouse TFR1 gene, as well as the "A fragment" containing the DNA sequence of the human TFR1 gene. Specifically, the sequence of the upstream homologous arm (5' homologous arm, SEQ ID NO: 3) is identical to the nucleotide sequence of 32429794 to 32434036 in NCBI Accession No. NC_000082.7, and the sequence of the downstream homologous arm (3' homologous arm, SEQ ID NO: 4) is identical to the nucleotide sequence of 32449155 to 32453445 in NCBI Accession No. NC_000082.7. The human genomic DNA sequence (SEQ ID NO: 5) derived from the TFR1 gene is identical to the nucleotide sequence of 196051942 to 196074099 in NCBI Accession No. NC_000003.12.

[0196] The targeting vector also contains an antibiotic resistance gene (neomycin phosphotransferase gene, or Neo) for screening of positive clones, and two Frt recombination sites flanking the antibiotic resistance gene forming a Neo cassette. The junction of the 5' end of the Neo cassette with the human sequence is 5'-TAGCCTCCTTTAGAATTTTAACCTTAGAAGATTAGC ATTAGCCAATT GCATCTGGCGAATCGGACCCACAAGAGCACTGAGGTCGGAAGTTCCTATTCTCTAGAAA-3' (SEQ ID NO: 6), ATTAGC "C" in " is the last nucleotide in the human sequence, CAATTThe "C" in " is the first nucleotide of the Neo cassette. The junction between the 3' end of the Neo cassette and the human sequence is 5'-TCATCAGTCCAGGATACATAGATTACCACAACTC CGAGCCTGGT TCTCAGCATTCTTTTTTCCTTACTCTGCTATAGAAA-3' (SEQ ID NO: 7), CGAGC "C" in " is the last nucleotide of the Neo cassette and corresponds to the sequence " CTGGT " in is the first nucleotide of the human sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA)) was also constructed downstream of the 3' homology arm of the targeting vector. The humanized recombinant mouse TFR1 mRNA sequence and its encoded protein sequence are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively.

[0197] For example, the targeting vector was constructed by restriction enzyme digestion and ligation. The constructed targeting vector sequence was previously confirmed by restriction enzyme digestion and then verified by sequencing. The correct targeting vector was transfected into C57BL / 6 mouse embryonic stem cells by electroporation. The cells were screened using a positive selectable marker gene, and the integration of the exogenous gene was confirmed by PCR (PCR primers are shown in the table below) and Southern blot.

[0198] [Table 3]

[0199] Specifically, after transfecting mouse embryonic stem cells with the targeting vector, the clones identified as positive by PCR were verified by Southern blot (cell DNA was digested with DraIII, EcoRV, and AseI, respectively, and hybridized with three probes) to screen for the correct positive clone cells. The restriction enzymes, probes, and target fragment sizes are shown in the table below. The detection results of Southern blot are shown in Figure 4. The results show that four PCR-positive embryonic stem cells (ES-1 to ES-4) were verified as positive clones without random insertions.

[0200] [Table 4]

[0201] The following primers were used for Southern blot identification: A probe: A probe-F: 5'-GGTGAGAAGAAACTAAACTATGCCA -3' (SEQ ID NO: 14), A probe-R: 5'-TCTGGTTCACCCAGGTTAGAGC -3' (SEQ ID NO: 15); Neo Probe: Neo probe-F: 5'-GGATCGGCCATTGAACAAGAT-3' (SEQ ID NO: 18), Neo probe R: 5'-CAGAAGAACTCGTCAAGAAGGC-3' (sequence number 19).

[0202] The screened positive clones (black mice) were introduced into isolated blastocysts (white mice), and the resulting chimeric blastocysts were transferred to culture medium for a short period of time and then implanted into the oviducts of recipient mothers (white mice) to generate F0 chimeric mice (black and white). The F0 generation chimeric mice were backcrossed with wild-type mice to obtain F1 generation mice, and then F2 generation homozygous mice were obtained by mating the F1 generation heterozygous mice with each other. The positive mice were also mated with Flp transgenic mice to remove the positive selectable marker gene (schematic diagram shown in Figure 5), and then the heterozygous mice were mated with each other to obtain humanized homozygous mice containing the humanized TFR1 gene.

[0203] The genotype of the TFR1 gene humanized mice was verified by PCR using the primers shown in the table below. The identification results of exemplary F1 generation mice (Neo cassette removed) are shown in Figures 6A-6D, and two mice numbered F1-01 and F1-02 were identified as positive heterozygous mice. The PCR primers used are shown in the table below.

[0204] [Table 5] The results show that transgenic mice containing a humanized TFR1 gene can be constructed using the methods described herein. The mice can be stably passaged without random insertions.

[0205] For example, the expression of humanized TFR1 protein in positive mice can be confirmed by flow cytometry or fluorescence-activated cell sorting (FACS). Specifically, one 7-week-old female C57BL / 6 wild-type mouse and one 7-week-old female TFR1 gene humanized heterozygous mouse were selected. After euthanasia by cervical dislocation, bone marrow tissue was collected and the cells were incubated with purified anti-mouse CD16 / 32 antibody (anti-mouse CD16 / 32 antibody); Brilliant Violet 510 TMAnti-mouse CD45 antibody (anti-mouse CD45 antibody); PerCP / Cy5.5 Anti-mouse TCRβ antibody (anti-mouse TCRβ antibody); FITC Anti-mouse CD19 antibody (anti-mouse CD19 antibody); Brilliant Violet 605 TM After staining with anti-mouse TER-119 / red blood cell antibody (anti-mouse TER-119 antibody), PE anti-mouse CD43 antibody (anti-mouse CD43 antibody), APC anti-human CD43 antibody (hCD43-PE; anti-human CD43 antibody), PE anti-mouse CD71 antibody (mTFR1; anti-mouse TFR1 antibody), and APC anti-human CD71 antibody (hTFR1; anti-human TFR1 antibody), flow cytometry detection was performed.

[0206] The results showed that 50.6% of B cells (characterized by mCD45+mCD19+) in the spleen of C57BL / 6 mice were mTFR1 positive (characterized by mCD45+mCD19+mTFR1+), and 0.20% were hTFR1 positive (characterized by mCD45+mCD19+hTFR1+). In the spleen of TFR1 gene humanized heterozygous mice, 32.9% of B cells were mTFR1 positive (characterized by mCD45+mCD19+mTFR1+), and 11.3% were hTFR1 positive (characterized by mCD45+mCD19+hTFR1+). The results showed that expression of mouse TFR1, but not humanized TFR1, was detected in splenocytes of wild-type mice; meanwhile, expression of both mouse TFR1 and humanized TFR1 was detected in TFR1 gene humanized heterozygous mice in vivo. The above experimental results demonstrate that TFR1 can be normally expressed in TFR1 gene-humanized mice.

[0207] F2 generation TFR1 gene humanized homozygous mice were obtained by crossing F1 generation heterozygous mice. The transcription of mRNA in the TFR1 gene humanized homozygous mice was detected by RT-PCR. Specifically, one 7-week-old female C57BL / 6 wild-type mouse and one TFR1 gene humanized homozygous mouse (generated using the method described herein) were selected. After euthanasia by cervical dislocation, mouse splenocytes were collected. TRIzolTM Cellular RNA was extracted according to the kit's instructions. The extracted cellular RNA was then reverse transcribed into cDNA and then detected by RT-PCR using the primers shown below. As shown in Figures 7A-7C, only mouse TFR1 mRNA, but not humanized TFR1 mRNA, was detected in C57BL / 6 wild-type mice. In contrast, only humanized TFR1 mRNA, but not mouse TFR1 mRNA, was detected in TFR1 gene-humanized homozygous mice.

[0208] The following primers were used in the RT-PCR detection: PCR-F1: 5'-CTCTGCTTTGCAGCTATTGCAC-3' (SEQ ID NO: 27), PCR-R1: 5'-CAGGATTCTCCACCAGGTAAACA-3' (SEQ ID NO: 28), PCR-F2: 5'-GTTCGAGAGTCACCACGCTGAG-3' (SEQ ID NO: 29), PCR-R2: 5'-GGCAACCCTGATGACTGAGATG-3' (SEQ ID NO: 30); GAPDH-F: 5'-TCACCATCTTCCAGGAGCGAGA-3' (SEQ ID NO: 16), GAPDH-R: 5'-GAAGGCCATGCCAGTGAGCTT-3' (sequence number 17).

[0209] Using the same method using flow cytometry as described above, the expression of humanized TFR1 protein in TFR1 gene humanized homozygous mice can be detected. Specifically, one 7-week-old female C57BL / 6 wild-type mouse and one 7-week-old female TFR1 gene humanized homozygous mouse were selected. After euthanasia by cervical dislocation, bone marrow tissue was collected and the cells were incubated with purified anti-mouse CD16 / 32 antibody (anti-mouse CD16 / 32 antibody); Brilliant Violet 605 TMAfter staining with anti-mouse TER-119 / red blood cell antibody (anti-mouse TER-119 antibody), PE anti-mouse CD71 antibody (mTFR1; anti-mouse TFR1 antibody), and APC anti-human CD71 antibody (hTFR1; anti-human TFR1 antibody), flow cytometry detection was performed. The results showed that 14.2% of red blood cells (characterized as mTer119+) in the bone marrow of C57BL / 6 mice were mTFR1 positive (characterized as mTer119+mTFR1+), and 0.087% were hTFR1 positive (characterized as mTer119+hTFR1+). In the bone marrow of TFR1 gene humanized homozygous mice, 0.04% of red blood cells were mTFR1 positive, and 10.1% were hTFR1 positive. The results demonstrate that TFR1 genetically humanized mice generated using the methods described herein are able to successfully express humanized TFR1 protein in vivo.

[0210] In addition, the leukocytes and T cells in the spleen, lymph nodes, and peripheral blood of wild-type C57BL / 6 mice and TFR1 gene humanized homozygous mice were collected for immunophenotype detection by flow cytometry. Routine blood tests and biochemical tests were also performed. The results showed that the percentages of leukocyte subtypes (including B cells, T cells, NK cells, CD4+T cells, CD8+T cells, granulocytes, dendritic cells (DC cells), macrophages, and monocytes) and T cell subtypes (including CD4+T cells, CD8+T cells, and Treg cells), as well as the routine blood tests and biochemical tests in each tissue sample of TFR1 gene humanized homozygous mice, were basically the same as those detected in C57BL / 6 wild-type mice. The results showed that the humanization of the TFR1 gene did not significantly affect the differentiation of leukocytes and T cells in mice; the growth and distribution of leukocytes and T cells in the spleen, lymphatic tissue, and peripheral blood.

[0211] Example 2: Pharmacokinetic (PK) detection of anti-human TFR1 antibodies in mice The PK process of anti-human TFR1 antibody in mouse brain tissue and serum was detected as follows. TFR1 gene humanized homozygous mice were selected and randomly divided into a control group and a treatment group. The control group mice were injected with 10 mg / kg of control human IgG1 (hIgG), and the treatment group mice were injected with an equimolar amount (10.9 mg / kg) of anti-human TFR1 antibody Ab via the tail vein. The mouse brain tissue and serum samples were collected, and the concentration of anti-human TFR1 antibody Ab in the mouse brain tissue and serum samples was measured by ELISA using anti-human Fc antibody. As shown in Figures 8A-8C, the Ab concentration in the brain tissue of the treatment group mice was maintained at a high level throughout the experimental period (Figure 8A); the Ab concentration in the serum decreased over time (Figure 8B); and the Ab concentration ratio in the brain tissue of the treatment group mice to that in the serum was significantly higher than that of the control group mice (Figure 8C). The results show that the brain of TFR1 gene-humanized mice can take up intravenously administered anti-human TFR1 antibody.Therefore, the TFR1 gene-humanized mice described herein can be used as an animal model to evaluate the effective delivery of protein therapeutics to the central nervous system (CNS) and to evaluate their efficacy.

[0212] Example 3: In vivo validation The TFR1 gene humanized mice generated herein can be used to evaluate the efficacy of modulators targeting human TFR1. For example, the TFR1 gene humanized homozygous mice described herein can be subcutaneously inoculated with mouse colon cancer cells MC38. Tumors grow to approximately 100 mm 3 Once the tumors have grown to 100%, the mice are randomly divided into a control group and several treatment groups based on tumor size. Treatment group mice can be randomly selected to receive a drug (e.g., an antibody) that targets human TFR1, and the control group can be administered an equal volume of saline. The tumor volume and weight of the mice can be measured, and the results can be used to efficiently evaluate the in vivo safety and efficacy of the drug, for example, by comparing the changes in tumor volume and weight of the mice.

[0213] Example 4: Generation of double or multigene humanized mice The TFR1 gene humanized mice generated using the methods described herein can also be used to generate double or multi-gene humanized mouse models. For example, in Example 1, embryonic stem (ES) cells for blastocyst microinjection can be selected from mice containing other genetic modifications, such as recombinant (e.g., human or humanized) PD-1, PD-L1, CTLA-4, OX40, LAG3, TIM3, and / or CD73 genes. Alternatively, embryonic stem cells from the humanized TFR1 mice described herein can be isolated, and a double or multi-gene mouse model of TFR1 and other genetic modifications can be obtained using genetic targeting techniques. Furthermore, the homozygous or heterozygous TFR1 gene humanized mice obtained by the methods described herein can be mated with other genetic modifications homozygous or heterozygous mice, and the progeny can be screened. According to Mendel's law, it is possible to generate double or multi-gene heterozygous mice containing recombinant (e.g., human or humanized) TFR1 genes and other genetic modifications. Heterozygous mice can then be bred to obtain homozygous bi- or multi-gene mice, which can be used for in vivo validation of gene regulators targeting human TFR1 and other genes.

[0214] Other embodiments Although the present invention has been described in conjunction with its detailed description, it should be understood that the above description is for illustrative purposes only and is not intended to limit the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

**Claim 1** A genetically modified non-human animal, wherein the genome comprises at least one chromosome containing a sequence encoding human or chimeric TFR1 (transferrin receptor protein 1), wherein the sequence encoding the human or chimeric TFR1 is operably linked to an endogenous control element at the endogenous TFR1 gene locus within the at least one chromosome. A genetically modified non-human animal. **Claim 2** The animal according to claim 1, wherein the sequence encoding the human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human TFR1 (NP_003225.2 (SEQ ID NO: 2)). **Claim 3** The animal according to claim 1, wherein the sequence encoding the human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO:

9. **Claim 4** The animal according to claim 1, wherein the sequence encoding the human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to amino acids 89 to 760 of SEQ ID NO:

2. **Claim 5** The animal according to claim 1, wherein the animal is a mouse. **Claim 6** A genetically modified non-human animal, wherein the genome of the animal comprises replacing, at the endogenous TFR1 gene locus, a sequence encoding a region of endogenous TFR1 with a sequence encoding the corresponding region of human TFR1, wherein the replaced locus is the extracellular region of TFR1. A genetically modified non-human animal. **Claim 7** The animal according to claim 6, wherein the animal has one or more cells expressing chimeric TFR1 having a cytoplasmic region, a transmembrane region, and an extracellular region, and the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identical to the extracellular region of human TFR1. **Claim 8** The animal according to claim 6, wherein the animal is heterozygous or homozygous with respect to the replacement at the endogenous TFR1 gene locus. **Claim 9** A method for producing a genetically modified non-human animal, A method comprising replacing, in at least one cell of the animal, at an endogenous TFR1 gene locus, a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human TFR1.

10. The method according to claim 9, wherein the sequence encoding the corresponding region of human TFR1 comprises a part of exon 4 of the human TFR1 gene; exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18; and a part of exon 19.

11. A method for measuring the efficacy of an anti-TFR1 antibody against the treatment of cancer, comprising: a) administering the anti-TFR1 antibody to an animal according to any one of claims 1 to 8, wherein the animal has cancer, and said administering; b) measuring the inhibitory effect of the anti-TFR1 antibody against the cancer. Including Preferably, the cancer is a brain tumor, breast cancer, colorectal cancer, liver cancer, ovarian cancer, lung cancer, osteosarcoma, leukemia, and / or lymphoma.

12. A method for measuring the efficacy of an anti-TFR1 antibody and an additional therapeutic agent against the treatment of cancer, comprising: a) administering the anti-TFR1 antibody and the additional therapeutic agent to an animal according to any one of claims 1 to 8, wherein the animal has cancer, and said administering; b) measuring the inhibitory effect in the cancer. Including Preferably, the animal further comprises a sequence encoding human or chimeric programmed cell death protein 1 (PD-1); and / or the animal further comprises a sequence encoding human or chimeric programmed cell death ligand 1 (PD-L1); and / or the additional therapeutic agent is an anti-PD-1 antibody or an anti-PD-L1 antibody; and / or the cancer comprises one or more cancer cells expressing TFR1 and / or PD-L1; Preferably, the animal has a brain tumor, breast cancer, colorectal cancer, liver cancer, ovarian cancer, lung cancer, osteosarcoma, leukemia, and / or lymphoma.

13. A method for measuring the delivery efficiency of a therapeutic agent passing through the blood-brain barrier, comprising: a) administering the therapeutic agent to an animal according to any one of claims 1 to 8; b) measuring the concentration of the therapeutic agent in the brain and / or serum of the animal over time. Including

14. A method for measuring the efficacy of an anti-TFR1 antibody for treating bone diseases, comprising: a) administering the anti-TFR1 antibody to an animal according to any one of claims 1 to 8, wherein the animal has the bone disease, and said administering; b) measuring the effect of the anti-TFR1 antibody on the treatment of the bone disease; and preferably, the bone disease is fracture, bone alteration, arthritis, bone deformation, osteoporosis, and / or osteonecrosis of the femoral head.

15. A method for measuring the efficacy of an anti-TFR1 antibody for treating neurodegenerative diseases, comprising: a) administering the anti-TFR1 antibody to an animal according to any one of claims 1 to 8, wherein the animal has the neurodegenerative disease, and said administering; b) measuring the effect of the anti-TFR1 antibody on the treatment of the neurodegenerative disease; and preferably, the neurodegenerative disease is cerebral ischemia, brain injury or epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and / or spinocerebellar ataxia.

16. A method for measuring the efficacy of an anti-TFR1 antibody for treating immunodeficiency, comprising: a) administering the anti-TFR1 antibody to an animal according to any one of claims 1 to 8, wherein the animal has the immunodeficiency, and said administering; b) measuring the effect of the anti-TFR1 antibody on the treatment of the immunodeficiency; and preferably, the immunodeficiency is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, and / or neuropathy.

Images