Selective targeting of host CD70+ alloreactive cells to extend the persistence of allogeneic CAR T cells

JP2024526090A5Pending Publication Date: 2025-11-17ALLOGENE THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023577355
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-10
Filing Date
2022-06-15
Publication Date
2025-11-17

Smart Images

  • Figure 00000093_0000
    Figure 00000093_0000
  • Figure 00000093_0001
    Figure 00000093_0001
  • Figure 00000093_0002
    Figure 00000093_0002
Patent Text Reader

Abstract

Provided herein are CD70 binding proteins comprising a CD70 binding domain and a transmembrane domain, engineered immune cells comprising the CD70 binding proteins, and methods of making and using the same. Also provided herein are engineered immune cells, e.g., CAR (chimeric antigen receptor) T cells, for administration to patients to treat cancer (e.g., solid tumors and hematological tumors) and other undesirable conditions. The cells are engineered to functionally express a first antigen binding molecule, e.g., a CD70 CAR, and a second antigen binding molecule, e.g., a second CAR that binds to a target molecule that is characteristic of cancer or other disease or undesirable conditions. The cells may be further engineered to reduce the functional expression level of one or more of TRAC, CD52, and CD70. Also provided are methods of making and using the engineered cells, compositions, and kits comprising them, as well as methods of treatment by administering them.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 210,979, filed June 15, 2021, and U.S. Provisional Patent Application No. 63 / 351,223, filed June 10, 2022, the contents of which are incorporated by reference in their entireties herein.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. This ASCII copy, created on June 13, 2022, is named AT-049_03_SL.txt and is 319,200 bytes in size.

[0003] The present disclosure relates generally to the use of engineered immune cells (e.g., T cells) for therapeutic applications. [Background technology]

[0004] Adoptive transfer of immune cells genetically modified to recognize malignant tumor-associated antigens has shown promise as a new approach to treat cancer (see, e.g., Brenner et al., Current Opinion in Immunology, 22(2):251-257 (2010); Rosenberg et al., Nature Reviews Cancer, 8(4):299-308 (2008)). Immune cells can be genetically modified to express chimeric antigen receptors (CARs), fusion proteins consisting of an antigen recognition moiety and a T cell activation domain (see, e.g., Eshhar et al., Proc. Natl. Acad. Sci. USA, 90(2):720-724 (1993)). CAR-containing immune cells, e.g., CAR-T cells (CAR-T), are engineered to have antigen specificity while retaining or enhancing their ability to recognize and kill target cells.

[0005] However, the generation of CAR-modified autologous cell therapies is expensive, requires a multi-week process and quality testing, and results in a product of variable potency depending on the initial quality and quantity of patient-specific T cells employed. Allogeneic CAR-modified cell therapies, in which cells from healthy donors are modified with CARs and then administered to multiple patients, promise a cheaper and more robust product than autologous therapies that can be delivered immediately on demand (see, e.g., Graham et al., Cells 2018, 7, 155; doi:10.3390 / cells7100155). In addition, allogeneic therapies allow for the selection of desirable product characteristics (e.g., gene editing efficiency, integration site, lack of deleterious off-target gene editing, haplotype, etc.) and facilitate more sophisticated cell engineering (e.g., multiple gene edits to improve potency, persistence, homing, etc.). A major hurdle to implementing allogeneic CAR-modified cell therapies is the potential rejection of the product (donor) by the patient's immune system (host).

[0006] Although allogeneic cell therapy has many advantages over autologous cell therapy, allogeneic cells also face rejection by host or recipient immune system cells that react with T and NK epitope determinants on the surface of the allogeneic cell product that differ from the host. The present disclosure provides the advantage of improved allogeneic therapy resulting in increased persistence of administered cells despite the recipient's natural defenses. Summary of the Invention

[0007] Provided herein are immune cells that have been engineered, e.g., genetically engineered, to improve their persistence in the host or recipient into which the cells are introduced, compositions and populations that include the engineered cells, and methods of using the same to treat a condition, e.g., cancer, in a patient. The immune cells of the present disclosure are engineered to functionally express a first antigen binding protein and a second distinct antigen binding protein, e.g., a first CAR and a second CAR. The first antigen binding protein, e.g., CAR, is selected for its suitability for therapeutic treatment of a condition, e.g., cancer, in a patient. For example, the first antigen binding protein can be a CAR that recognizes an expressed antigen, e.g., an antigen that is characteristic of a cell that causes the condition, e.g., a cancer cell and / or a tumor cell. The second antigen binding protein, e.g., a CD70 binding protein such as a CAR, has binding specificity for CD70, which is expressed, e.g., on recipient immune cells in response to allogeneic CAR T cells. Thus, the engineered cells can defend themselves against the recipient's immune response, thereby extending the survival of the allogeneic cells after administration. Alternatively, one antigen binding protein, e.g., one CAR, may contain both therapeutic binding activity and CD70 binding activity. Thus, the present disclosure provides, for example, a method of increasing the persistence of an allogeneic CAR T cell or any other allogeneic CAR immune cell (e.g., a CAR NK cell), the method comprising engineering a CAR cell, e.g., a CAR T cell, a CAR NK cell, a CAR monocyte, or a CAR macrophage, to functionally express a first antigen binding protein, e.g., a CD70 binding protein, such as an anti-CD70 antigen binding protein, e.g., an anti-CD70 CAR, in addition to the CAR that the cell functionally expresses.

[0008] This approach may provide a safer alternative to deep lymphodepletion regimens, as CD70-negative immune cells are not expected to be targeted by CD70 CARs, thus avoiding long-term immunosuppression. Furthermore, CD70 is also expressed by malignant cells in a variety of tumors, including renal cell carcinoma, lymphoma, and acute myeloid leukemia. Therefore, engineering T cells to express a CAR against CD70 and a second tumor-specific target, such as CD19 or CD20, either as separate CARs or as a single CAR with bispecificity, may enhance the antitumor efficacy and persistence of CAR T cells and delay rejection by the host immune system.

[0009] Thus, in one aspect, the disclosure provides a method of inhibiting the proliferation and / or activity of CD70 positive cells in vitro or in a patient, comprising contacting the CD70 positive cells with engineered immune cells that comprise or functionally express a CD70 binding protein that comprises an extracellular ligand binding domain (or CD70 binding domain) that binds to CD70 and a transmembrane domain. In a related aspect, the disclosure provides a method of lymphodepletion in a patient in need thereof, comprising administering to the patient engineered immune cells, the engineered immune cells comprising or functionally expressing a CD70 binding protein that comprises an extracellular ligand binding domain (or CD70 binding domain) that binds to CD70 and a transmembrane domain, the engineered immune cells inhibiting the proliferation and / or activity of CD70 positive cells in the patient. In some embodiments, the CD70 positive cells are T cells, B cells, or NK cells. In some embodiments, the CD70 positive cells are normal or non-cancerous lymphocytes. In some embodiments, the CD70 positive cells are activated lymphocytes. In some embodiments, the CD70 positive cells are activated T cells.

[0010] In another aspect, the disclosure provides engineered immune cells that functionally express a protein comprising a first antigen binding domain and a protein comprising a second antigen binding domain, where the first antigen binding domain specifically binds to a target of interest and the second antigen binding domain specifically binds to CD70 (e.g., a CD70 binding protein). In various embodiments, the protein comprising the first antigen binding domain is a first protein and the protein comprising the second antigen binding domain is a second protein that is separate and distinct from the first protein. In various embodiments, the protein comprising the first antigen binding domain is a first CAR and the protein comprising the second antigen binding domain is a second CAR, i.e., a CD70 CAR. In various embodiments, one antigen binding protein, e.g., one CAR, comprises both a first antigen binding domain and a second antigen binding domain, e.g., the CAR is a bispecific CAR that recognizes both the target of interest and CD70. In other embodiments, the protein comprising the first antigen binding domain that recognizes the target of interest and the protein comprising the second antigen binding domain, i.e., a CD70 binding protein, are different proteins.

[0011] In some embodiments, the target of interest of the first antigen binding domain, e.g., the target of interest of the first CAR, is any molecule of interest, including, but not limited to, CD70, BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD22, CD23, CD30, CD38, CD33, CD133, WT1, TSPAN10, MHC-PRAME, HER2, MSLN, PSMA, PSCA, GPC3, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2 or (also referred to as Claudin18 isoform 2), DLL3 (also referred to as Delta-like protein 3, Drosophila delta homolog 3, Delta3), Muc17, Muc3, Muc16, FAP alpha (fibroblast activation protein alpha), Ly6G6D (also referred to as lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), or RNF43 (E3 ubiquitin-protein ligase RNF43, also referred to as RING finger protein 43), specifically including the human form of any of the exemplary targets listed. The target of interest may be, for example, any molecule, e.g., any protein, that is expressed on the surface of a cell and is in some way characteristic of a condition or disease, such as any form of cancer, the inhibition, reduction or elimination of which is therapeutically beneficial or otherwise desirable.

[0012] In some embodiments, the protein comprising a second antigen-binding domain that specifically binds to CD70 (e.g., a CD70 binding protein) is or comprises a CD70 CAR. In some embodiments, the protein comprising a second antigen-binding domain comprises an anti-CD70 scFv, an anti-CD70 VH, or a receptor for CD70, or any two or more of these. In some embodiments, the receptor for CD70 is CD27 or a fragment of CD70 that retains binding specificity for CD27, e.g., a CD70-binding fragment of CD27. In some embodiments, CD27 has or comprises the amino acid sequence of human CD27 disclosed in UniProtKB entry P26842. In some embodiments, the protein comprising a second antigen-binding domain is a CAR comprising a CD3 intracellular signaling domain. In some embodiments, the protein comprising a second antigen-binding domain is a CAR comprising one or more costimulatory domains. In some embodiments, the protein comprising a second antigen-binding domain is a CAR comprising a CD3 intracellular signaling domain without a costimulatory domain (a first generation CAR). In some embodiments, the protein comprising the second antigen binding domain is a CAR comprising a CD3 intracellular signaling domain and a costimulatory domain (a second generation CAR). In some embodiments, the protein comprising the second antigen binding domain is a CAR that does not comprise a costimulatory domain. In some embodiments, the protein comprising the second antigen binding domain, e.g., a CD70 binding protein, does not comprise an intracellular signaling domain. In some embodiments, the protein comprising the second antigen binding domain is a CAR that optionally comprises one or more costimulatory domains. In various embodiments of the protein comprising the second antigen binding domain, the protein further comprises an intracellular signaling domain, such as a CD3 zeta intracellular signaling domain and / or one or more costimulatory domains. In some embodiments, the protein comprising the second antigen binding domain comprises full-length CD27 or a CD70 binding fragment of CD27, and further comprises a CD3 zeta intracellular signaling domain.

[0013] In various embodiments, the engineered immune cells functionally express one or more of CD70, TRAC, and CD52 at reduced levels. In some embodiments, the reduced expression level, presented as compared to the expression level in a corresponding but unengineered immune cell, is, for example, 0% when both chromosomal copies of the gene are knocked out, or, for example, 50% when one of the two chromosomal copies of the gene is knocked out and there is no compensatory increase in expression of the other chromosomal copy of the gene (i.e., 50% of the level in a non-engineered control immune cell). In some embodiments, the cells express one or more of CD70, TRAC, and CD52 at levels that are 90% or less, 75% or less, 50% or less, 25% or less, or 10% or less of the expression level in a non-engineered immune cell. In some embodiments, the expression level of one or more of CD70, TRAC, and CD52 in the engineered immune cell is any value between 0% and 90% of the level in a corresponding non-engineered control cell for CD70, TRAC, and / or CD52. In some embodiments, expression levels in engineered cells are, for example, 10%-90%, 25%-90%, 25%-75%, 10%-50%, 25%-50%, 50%-90%, or 50%-75% of the levels in control cells. In some embodiments, reduced expression levels other than 0% or 50% are obtained, for example, when only one chromosomal copy of a gene is knocked out and compensatory mechanisms cause increased expression levels of the remaining chromosomal copy, or when reduced expression is achieved by methods other than gene knockout, such as known knockdown methods, for example, using any of a variety of RNA-based technologies (e.g., antisense RNA, miRNA, shRNA, siRNA; see, e.g., Lam et al., Mol. Ther.-Nucleic Acids 4:e252 (2015), doi:10.1038 / mtna.2015.23; Sridharan and Gogtay, Brit. J. Clin. Pharmacol. 82:659-72 (2016)).In some embodiments, the engineered immune cells disclosed herein exhibit reduced expression levels of MHC class I proteins or complexes at the cell surface compared to a suitable control. In various embodiments, the cell is a T cell, e.g., a human T cell. In some embodiments, the cell comprises a mutation in one or more of the CD70, CD52, and TRAC loci or genes and / or a disruption in one or more of the CD70, CD52, and TRAC loci or genes (which causes reduced functional expression of the disrupted loci or genes). In one embodiment, the mutation or disruption is introduced into one or more of the CD70, CD52, and TRAC genes or loci by any genetic mutation or gene editing technique, including, but not limited to, known homologous recombination techniques, and techniques using any one or more of meganucleases, TALENs, zinc fingers, shRNA, Cas-CLOVER, and CRISPR / Cas systems. In some embodiments, the cell is a non-human cell, e.g., a primate cell or a non-primate mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the mutation or disruption occurs by knocking in a nucleic acid, e.g., a nucleic acid that encodes one or more proteins or gene products expressed in the cell. In some embodiments, the nucleic acid encodes either or both of the first and second CARs.

[0014] Provided herein are engineered immune cells that functionally express a protein comprising a first antigen-binding domain and a protein comprising a second antigen-binding domain, where the first antigen-binding domain specifically binds to a target of interest and the second antigen-binding domain specifically binds to CD70 (or a CD70 binding protein), and uses thereof are provided.

[0015] In various embodiments, the protein comprising the first antigen binding domain is a first CAR, and the protein comprising the second antigen binding domain is a second CAR. In some embodiments, the second antigen binding domain is a CAR, e.g., a second CAR comprising one or more costimulatory domains. In some embodiments, the second antigen binding domain is a CAR, e.g., a second CAR that does not comprise a costimulatory domain. In some embodiments, the second antigen binding domain is a CAR, e.g., a second CAR that optionally comprises one or more costimulatory domains.

[0016] In various embodiments, a single protein comprises both a first antigen binding domain and a second antigen binding domain, hi certain embodiments, the single protein is a bispecific CAR.

[0017] In certain embodiments, the target of interest is CD70, BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD22, CD23, CD30, CD38, CD33, CD133, WT1, TSPAN10, MHC-PRAME, HER2, MSLN, PSMA, PSCA, GPC3, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2, or Claudin1 8 isoform 2), DLL3 (Delta-like protein 3, Drosophila delta homolog 3, Delta3), Muc17, Muc3, Muc16, FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), or RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43). In certain embodiments, the target of interest is CD70, BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD22, CD23, CD30, CD38, CD33, CD133, WT1, TSPAN10, MHC-PRAME, HER2, MSLN, PSMA, PSCA, GPC3, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2, or Claudin 18 antibody). isoform 2), DLL3 (Delta-like protein 3, Drosophila delta homolog 3, Delta3), Muc17, Muc3, Muc16, FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), or RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43).

[0018] In various embodiments, the engineered immune cells disclosed herein further comprise one or more genetic modifications of one or more of the endogenous TRAC gene, the endogenous CD52 gene, and the endogenous CD70 gene. In certain embodiments, the cells comprise a knockout in one or both alleles of TRAC, a knockout in one or both alleles of CD52, or a knockout in one or both alleles of CD70, or a knockout in one or both alleles of one or more of TRAC, CD52, and CD70. In various embodiments, the engineered immune cells express one or more of TRAC, CD52, and CD70 at levels that are 90% or less, 75% or less, 50% or less, 25% or less, or 10% or less of the expression levels in non-engineered immune cells.

[0019] In various embodiments, the engineered immune cells disclosed herein are engineered T cells. In various embodiments, the engineered immune cells disclosed herein are engineered NK cells.

[0020] In various embodiments, the engineered immune cells disclosed herein comprise a first nucleic acid encoding a protein comprising a first antigen-binding domain and a second nucleic acid encoding a protein comprising a second antigen-binding domain. In certain embodiments, the first vector comprises the first nucleic acid and the second vector comprises the second nucleic acid. In some embodiments, one or both vectors are lentiviral vectors. In some embodiments, one or both vectors are adeno-associated viral (AAV) vectors. In certain embodiments, the first nucleic acid and / or the second nucleic acid are located within the disrupted TRAC, CD52 or CD70 locus. In certain embodiments, one vector comprises both the first and second nucleic acids. In some embodiments, the vector is a lentiviral vector or an AAV vector.

[0021] In certain embodiments, the engineered immune cell comprises a single nucleic acid encoding both a protein comprising a first antigen-binding domain and a protein comprising a second antigen-binding domain. In some embodiments, the vector comprises a single nucleic acid. In some embodiments, the vector is a lentiviral vector or an AAV vector. In certain embodiments, the single nucleic acid is located within the disrupted TRAC, CD52 or CD70 locus.

[0022] In various embodiments, the engineered immune cells include or further include one or more genetic modifications, e.g., modifications of one or both alleles of an endogenous gene locus, e.g., one or more of the following: endogenous CD70 gene, endogenous TCRa gene, and endogenous CD52 gene. In various embodiments, the one or more genetic modifications cause a reduction or absence of functional expression of the gene comprising the modification. In various embodiments, the modification includes a disruption, e.g., a knockout, knockdown, or knockin, of the locus. In various embodiments, the disruption includes an insertion of a first nucleic acid encoding a protein comprising a first antigen binding domain and / or a second nucleic acid encoding a protein comprising a second antigen binding domain. In various embodiments, the modification causes a reduction or absence of functional expression of the gene by knockdown, e.g., antisense RNA, siRNA, miRNA, shRNA mediated knockdown.

[0023] The engineered immune cells provided herein can be derived or prepared from cells from any of a variety of sources. The engineered immune cells can be prepared or derived from one or more cells, e.g., stem cells or immune cells, from a person other than the person to whom the engineered immune cells are administered, e.g., a donor other than the recipient (e.g., a healthy volunteer), or can be prepared or derived from cells, e.g., stem cells or immune cells, from the person to whom the engineered immune cells are administered (the recipient), or can be derived from one or more induced pluripotent stem cells (iPSCs). In various embodiments, the engineered immune cells disclosed herein are or are derived from immune cells obtained from a healthy volunteer, obtained from a patient, or derived from iPSCs.

[0024] Also provided herein are populations of engineered immune cells as disclosed herein. In various embodiments, the populations are selected from the group consisting of the 10 3 ~10 10 10 engineered immune cells, e.g. 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 or any range between any two of those values. In certain embodiments, no more than 75%, no more than 50%, or no more than 25% of the engineered immune cells of the population functionally express any one of TRAC, CD52, and CD70, or any two or more of TRAC, CD52, and CD70. In certain embodiments, no more than 75%, no more than 50%, or no more than 25% of the engineered immune cells of the population functionally express TRAC. In certain embodiments, no more than 75%, no more than 50%, or no more than 25% of the engineered immune cells of the population functionally express CD52. In certain embodiments, no more than 75%, no more than 50%, or no more than 25% of the engineered immune cells of the population functionally express TRAC and no more than 75%, no more than 50%, or no more than 25% of the engineered immune cells of the population functionally express CD52.

[0025] Also provided herein are populations of cells, the populations of cells comprising at least 10% of the engineered immune cells disclosed herein, at least 20% of the engineered immune cells disclosed herein, at least 30% of the engineered immune cells disclosed herein, at least 40% of the engineered immune cells disclosed herein, at least 50% of the engineered immune cells disclosed herein, at least 75% of the engineered immune cells disclosed herein, or at least 90% of the engineered immune cells disclosed herein. In certain embodiments, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, or at least 90% of the engineered cells comprise one or more genetic modifications of one or more of the endogenous TCRa (or TRAC) gene, the endogenous CD52 gene, and the endogenous CD70 gene. In various embodiments, the populations of cells comprise at least 10% of the engineered immune cells, at least 20% of the engineered immune cells, at least 30% of the engineered immune cells, at least 40% of the engineered immune cells, at least 50% of the engineered immune cells, at least 75% of the engineered immune cells, or at least 90% of the engineered immune cells. 3 ~10 10 Contains cells.

[0026] In various embodiments, the cells and engineered immune cell populations disclosed herein are derived from one or more immune cells obtained from healthy volunteers, one or more immune cells obtained from a patient, or one or more induced pluripotent stem cells (iPSCs).

[0027] Also provided herein are pharmaceutical compositions comprising one or more of the engineered immune cells disclosed herein, or comprising cells or populations of engineered immune cells disclosed herein, and further comprising at least one pharma- ceutically acceptable carrier or excipient.

[0028] Further disclosed herein are methods of making the engineered immune cells disclosed herein comprising one or more genetic modifications of one or more of the endogenous TCRa gene, the endogenous CD52 gene and the endogenous CD70 gene, the methods including the use of one or more gene editing techniques selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas systems, and / or any known gene knockdown methods, such as various RNA-based techniques (e.g., shRNA, antisense RNA, miRNA, siRNA; see, e.g., Lam et al., Mol. Ther.-Nucleic Acids 4:e252(2015), doi:10.1038 / mtna.2015.23; Sridharan and Gogtay, Brit. J. Clin. Pharmacol. 82:659-72 (2016)).

[0029] Further provided herein is a method of making an engineered immune cell as disclosed herein, comprising introducing into an immune cell a first nucleic acid encoding a protein comprising a first antigen binding domain and a second nucleic acid encoding a protein comprising a second antigen binding domain. In certain embodiments, one vector comprises both the first and second nucleic acids. In various embodiments, the vector is a lentiviral vector. In various embodiments, the first vector comprises the first nucleic acid and the second vector comprises the second nucleic acid. In certain embodiments, either or both of the first and second vectors are lentiviral vectors. In various embodiments, the protein comprising the first antigen binding domain is a CAR and / or the protein comprising the second antigen binding domain is a CD70 CAR. In various embodiments, the protein comprising the first antigen binding domain and the protein comprising the second antigen binding domain (i.e., CD70 binding domain) are physically separate and distinct proteins. In certain embodiments, the separate and distinct proteins are expressed from a bicistronic expression cassette, separated, for example, by a P2A or T2A peptide. In some embodiments, the protein comprising the first antigen binding domain is N-terminal to the protein comprising the CD70 binding domain. In some embodiments, the protein comprising the CD70 binding domain is N-terminal to the protein comprising the first antigen binding domain. In various embodiments, the protein comprising the first antigen binding domain and the protein comprising the second antigen binding domain (i.e., CD70 binding domain) are the same protein, e.g., a bispecific CAR.

[0030] Also provided herein are methods of treating a condition or disease in a patient, comprising administering to the patient any one or more of the engineered immune cells disclosed herein, or a cell or population of engineered immune cells disclosed herein, or one or more of the compositions disclosed herein. In various embodiments, the condition or disease is a solid tumor or a hematological tumor. In various embodiments, the condition or disease can be a viral disease, a bacterial disease, a cancer, an inflammatory disease, an immune disease, or an age-related disease. In various embodiments, the condition or disease can be selected from the group consisting of gastric cancer, sarcoma, lymphoma (including non-Hodgkin's lymphoma), leukemia, head and neck cancer, thymic cancer, epithelial cancer, salivary gland cancer, liver cancer, stomach cancer, thyroid cancer, lung cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, leukemia, multiple myeloma, renal cell carcinoma, bladder cancer, cervical cancer, choriocarcinoma, colon cancer, oral cancer, skin cancer, and melanoma. In various embodiments, patients are previously treated adult subjects with locally advanced or metastatic melanoma, squamous cell head and neck cancer (SCHNC), ovarian cancer, sarcoma, or relapsed or refractory classical Hodgkin lymphoma (cHL).

[0031] In various embodiments, the method comprises administering about 10 of the compounds disclosed herein per kg of body weight. 3 or 10 4 ~about 10 9 10 engineered immune cells or approximately 10 5 ~about 10 6 10 engineered immune cells, or approximately 0.1 x 10 6 ~5×10 6 The method includes administering the engineered immune cells to a patient.

[0032] In various embodiments, the cells are administered as a single dose. In various embodiments, the cells may be administered as more than one dose over a period of time. [Brief description of the drawings]

[0033] [Figure 1] FIG. 1 illustrates the function of an allogeneic CAR T cell that contains both a first CAR capable of recognizing and binding to a tumor antigen and a second CAR, referred to in the figure as "CD70 Dagger," capable of recognizing and binding to CD70. The first anti-tumor antigen CAR lyses the recognized tumor cells. The second, anti-CD70 CAR, also known as CD70 Dagger, causes lysis of immune cells (e.g., NK and / or T cells) of the patient (the recipient of the allogeneic CAR T cells) that respond to and / or attack the allogeneic CAR T cells. The allogeneic CAR T cells thereby persist longer by preventing or limiting attack by the patient's immune cells.

[0034] [Figure 2-1] Figures 2A-2D. Graft donor CD70 CAR T cells are protected from killing by recipient alloreactive T cells. PBMCs from eight recipient donors were cocultured with irradiated graft donor T cells for 7 days to allow for priming and expansion of alloreactive recipient T cells (RTCs). Figure 2A. Primed alloreactive RTCs were then isolated and cocultured with either graft donor T cell receptor alpha constant (TRAC) knockout (KO) CD70 CAR T cells or graft donor T cell receptor alpha constant (TRAC) knockout (KO) non-transduced T cells (NTD) at a 1:1 ratio for 48 h. Graft donor cell killing was assessed by flow cytometry. Figure 2B. Killing rates of non-transduced and CD70 CAR T cells after coculture with low and high alloreactive RTCs. Figure 2C. Representative flow cytometry plots showing killing of CD70+ RTCs. Figure 2D. Absolute numbers (Abs. No.) and survival of CD4 and CD8 RTCs. Symbols represent individual RTC donors. Data are representative of two independent experiments. [Figure 2-2] Same as above.

[0035] [Diagram 3]Figures 3A-3B. Graft donor CD70 CAR T cells from multiple donors demonstrate killing of RTCs. PBMCs from recipient donors were co-cultured with graft donor TRAC KO CD70 CAR T cells generated from three different donors at a 1:1 ratio for 6 days. Recipient T cell killing was assessed by flow cytometry. Figure 3A, absolute counts, and Figure 3B, viability of CD4 and CD8 RTCs. Symbols represent individual CAR T cell graft donors.

[0036] [Figure 4-1] Figures 4A-4B. Graft donor CD70 CAR T cells demonstrate killing of CD70 positive recipient B, T, and NK cells. PBMCs from recipient donors were co-cultured with graft donor TRAC KO CD19 or CD70 CAR T cells at a 2:1 ratio for 6 days. Killing of CD70 positive recipient cells was assessed by flow cytometry. Figure 4A. Flow cytometry plots demonstrate upregulation of CD70 on activated B, T, and NK cells, as well as killing of CD70+ recipient cells by CD70 CAR T cells. Figure 4B. Absolute numbers of CD70+ recipient B, T, and NK cells. [Figure 4-2] Same as above.

[0037] [Figure 5-1] Figures 5A-5C. Activated human T cells were transduced with LVV encoding the broad CD70dagger protein (CD70dg) and cells were analyzed by flow cytometry. The percentage of CD70dagger+ cells 14 days after activation is shown in Figure 5A. The CD4:CD8 ratio 14 days after activation is shown in Figure 5B. The activation status of the transduced cells was assessed by measuring the expression of CD25 and 4-1BB 9 days after activation (Figure 5C). Circles represent either NTD control or CD70dagger, a first generation CAR, and triangles indicate CD70dagger, a second generation CAR. Error bars represent the mean ± SEM. MFI: mean fluorescence intensity. [Figure 5-2] Same as above.

[0038] [Figure 6-1] Figure 6A-F. T cells expressing CD70dagger (or CD70 binding protein) deplete alloreactive T cells and resist T cell-mediated rejection. Alloreactive T cell MLR (Figure 6A) and PBMC MLR (Figure 6B) were performed using TRACKO graft donor T cells expressing CD70dagger. Cells were analyzed by flow cytometry on day 9 to measure the absolute number of remaining host T cells and NK cells. Data in Figure 6C-D show that activated host T cells and NK cells were eliminated by T cells expressing CD70dagger in the PBMC MLR. Data are representative of two independent experiments. Symbols represent unique graft-host donor pairs. Figure 6E-F show the results of PBMC MLR assays of additional CD70dagger constructs, second generation CARs carrying variant CD3z signaling domains (bbz1XX and bbzXX3). Error bars represent the mean ± SEM. [Figure 6-2] Same as above. [Figure 6-3] Same as above.

[0039] [Figure 7-1]Figure 7A-G. T cells expressing CD70dagger introduced by site-specific integration. Activated human T cells were engineered to express different CD70dagger proteins encoded from AAV vectors introduced by site-specific integration, and cells were analyzed by flow cytometry. Figure 7A shows the percentage of CD70dagger positive cells, and Figure 7B shows both CD70dagger expression levels 14 days after activation. Expression of activation markers CD25 and 4-1BB 9 days after activation is shown in Figure 7C, and CD4:CD8 ratios determined by flow cytometry 14 days after activation are shown in Figure 7D. The dotted line indicates the average value of cells expressing CD70dagger, a second generation CAR with CD3ζ and 4-1BB signaling domains, indicated as "CD70 CAR". Circles and triangles represent CD70dagger, a first generation CAR and a second generation CAR, respectively (Figure 7E-G). PBMC MLR was performed using TRAC-KO T cells expressing different CD70 Dagger proteins and cell numbers were measured over time. Data in Figure 7E show that CD70 Dagger T cells resisted host rejection and expanded in PBMC MLR assays. Data in Figures 7F-G show that host T cell and NK cell expansion was inhibited by CD70 Dagger T cells. Data are the combined results of four unique graft-host donor pairs in panels of Figures 7E-G. Error bars represent the mean ± SEM. [Figure 7-2] Same as above. [Figure 7-3] Same as above.

[0040] [Figure 8-1] Figures 8A-C show amino acid residues of CD70 important for different antibody binding to the CD70 trimeric complex, and Figures 8D-E show the results of host T cell inhibition and resistance to host rejection by graft cells expressing CD70 dagger proteins containing the CD70 binding domain from anti-CD70 antibody clones 4F11, 8C8, or 8F8. [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 8-4] Same as above.

[0041] [Figure 9] FIG. 9 shows the cytotoxicity results of T cells expressing an anti-tumor antigen CAR, e.g., CD19 CAR alone or in combination with CD70 Dagger. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] The present disclosure provides a strategy for providing a therapeutic allogeneic cell (e.g., CAR T cell) product that can overcome or reduce the effects of rejection by the recipient's immune system. This allows the cell product to persist longer in the recipient, thus promoting and / or improving therapeutic efficacy. The strategy provides the allogeneic cells with protection against host immune cells that are activated against the allogeneic cells. This protection includes expression by the allogeneic cells of CD70 binding proteins, e.g., CD70 CAR. Thus, the strategy selectively targets CD70 (cluster of differentiation 70) protein on the host or recipient, e.g., patient's T cells and NK cells.

[0043] general technology The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) Cold Spring Harbor Press, Oligonucleotide Synthesis (MJ Gait, ed., 1984), Methods in Molecular Biology, Humana Press, Cell Biology: A Laboratory Notebook (JECellis, ed., 1998) Academic Press, Animal Cell Culture (RIFreshney, ed., 1987), Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press, Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JBGriffiths, and DG Newell, eds., 1993-1998) J. Wiley and Sons, Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (DMWeir and CCBlackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (JEColigan et al., eds.).,1991); Short Protocols in Molecular Biology (Wiley and Sons,1999); Immunobiology (CA Janeway and P. Travers,1997); Antibodies (P. Finch,1997); Antibodies: a practical approach (D. Catty.,ed.,IRL Press,1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean,eds.,Oxford University Press,2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press,1999); The Antibodies (M. Zanetti and JD Capra,eds.,Harwood Academic Publishers,1995). For example, gene editing techniques using TALEN, CRISPR / Cas9, and megaTAL nucleases are within the skill of the art and are described in T. Gaj et al. This is explained thoroughly in literature such as (1999) et al., Genome-Editing Technologies: Principles and Applications, Cold Spring Harb Perspect Biol 2016;8:a023754, and in the citations therein.

[0044] definition As used herein, "autologous" refers to a cell, cell line, or cell population obtained from a subject that is used to treat said subject.

[0045] As used herein, "allogeneic" means that the cells or cell population used to treat a subject do not originate from the subject, but rather from a donor.

[0046] As used herein, the term "endogenous" refers to any material that is produced from or within an organism, cell, tissue, or system.

[0047] As used herein, the term "exogenous" refers to any material that is introduced from or produced outside an organism, cell, tissue, or system.

[0048] As used herein, "immune cells" refer to cells of hematopoietic origin that are functionally involved in the initiation and / or execution of innate and / or adaptive immune responses. Examples of immune cells include T cells, such as alpha / beta T cells and gamma / delta T cells, regulatory T (Treg) cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

[0049] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0050] As used herein, "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to a nucleotide sequence to be expressed. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate a recombinant polynucleotide.

[0051] In various embodiments, the engineered immune cells of the present disclosure functionally express a first antigen binding protein and a second CD70 binding protein, e.g., a first CAR and a second CD70 CAR, and optionally further include additional features. For example, they can include genetic modifications, e.g., mutations, in endogenous genes, such as one or more of CD70, TCRa, and CD52, that reduce or eliminate functional expression of the genes, and / or can express one or more additional proteins. They can also include one or more other genetic modifications that reduce or eliminate functional expression of the genes, e.g., by gene knockdown. The antigen binding protein and one or more additional proteins can be expressed from an exogenous nucleic acid encoding the protein (with or without a signal sequence) that is introduced into the cell by the techniques described herein. As described herein, the engineered immune cells of the present disclosure can be derived, e.g., prepared, from cells, e.g., immune cells obtained from various sources.

[0052] As used herein, "functionally expressing" a gene means that the gene is expressed and that the expression results in a functional gene end product. For example, if the gene codes for a protein, a cell functionally expresses the gene if the expression of the gene ultimately produces a properly functioning protein. Thus, a gene is not functionally expressed if it is not transcribed, or if the expression of the gene ultimately produces RNA that is not translated, or if the translation produces only a non-functional protein, e.g., the protein is not folded correctly or transported to its site of action (e.g., the membrane for membrane-bound proteins). Functional expression can be measured directly (e.g., by assaying the gene product itself) or indirectly (e.g., by assaying the effect of the gene product).

[0053] As used herein, "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence if it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).

[0054] As used herein, "expression control sequence" refers to a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or inducible promoter, or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed.

[0055] "Promoter" and "promoter sequence" are used interchangeably and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' to the promoter sequence. It is understood by those skilled in the art that different promoters can induce the expression of a gene in different tissues or cell types, or at different developmental stages, or in response to different environmental or physiological conditions.

[0056] In any of the vectors of the present disclosure, the vector optionally comprises a promoter as disclosed herein.

[0057] A "host cell" includes an individual cell or cell culture that can be or has been a recipient of a vector for incorporation of a polynucleotide insert. A host cell includes the progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected in vivo with a polynucleotide of the disclosure.

[0058] As used herein, the term "extracellular ligand-binding domain" refers to an oligopeptide or polypeptide capable of binding to a ligand. Preferably, the domain is capable of interacting with a cell surface molecule. For example, the extracellular ligand-binding domain can be selected to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state. The term "stalk domain" is used herein to refer to any oligopeptide or polypeptide that functions to link a transmembrane domain to an extracellular ligand-binding domain. In particular, the stalk domain is used to provide additional flexibility and accessibility to the extracellular ligand-binding domain.

[0059] The term "intracellular signaling domain" refers to the portion of a protein that transduces effector functional signals and induces the cell to carry out a specialized function.

[0060] As used herein, a "costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors. Examples of costimulatory molecules include ligands that specifically bind to CD27, CD28, CD8, 4-1BB (CD137), OX40, CD30, CD40, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and CD83, etc.

[0061] A "costimulatory ligand" refers to a molecule on an antigen-presenting cell that specifically binds to a cognate costimulatory signal molecule on a T cell, thereby providing a signal that mediates T cell responses, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided by engagement of the TCR / CD3 complex with, e.g., a peptide-loaded MHC molecule. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), 4-1 BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, M1 CB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, Toll ligand receptor, and ligands that specifically bind to B7-H3. Costimulatory ligands also encompass antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, ligands that specifically bind to CD27, CD28, 4-1 BB, OX40, CD30, CD40, ICOS, lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LTGHT, NKG2C, B7-H3, CD83, among others.

[0062] An "antibody" is an immunoglobulin molecule capable of specific binding to a target, such as a carbohydrate, polynucleotide, lipid, or polypeptide, via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term encompasses intact polyclonal or monoclonal antibodies, as well as antigen-binding fragments thereof (such as Fab, Fab', F(ab')2, and Fv), and any other modified configuration of an immunoglobulin molecule that contains an antigen recognition site, including, for example, but not limited to, single chain (scFv) and domain antibodies (including, for example, shark antibodies and camelid antibodies), and fusion proteins that contain antibodies. Antibodies include antibodies of any class (or subclass thereof), such as IgG, IgA, or IgM, and an antibody need not be of any particular class. Depending on the antibody amino acid sequence of the constant region of its heavy chain, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, several of which can be further divided into subclasses (isotypes), e.g., lgG1, lgG2, lgG3, lgG4, lgA1, and lgA2. The heavy chain constant regions that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0063] As used herein, the term "antigen-binding fragment" or "antigen-binding portion" of an antibody refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen. The antigen-binding function of an antibody can be performed by a fragment of an intact antibody. Examples of binding fragments encompassed within the term "antigen-binding fragment" of an antibody include Fab, Fab', F(ab')2, an Fd fragment consisting of the VH and CH1 domains, an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, a single-domain antibody (dAb) fragment (see, e.g., Ward et al., Nature 341:544-546, 1989), and isolated complementarity-determining regions (CDRs).

[0064] An antibody, antibody conjugate, or polypeptide that "specifically binds" to a target is a term well understood in the art, and methods for determining such specific binding are also well known in the art. A molecule is said to exhibit "specific binding" if it reacts or associates with a particular cell or substance more frequently, more rapidly, with a longer duration, and / or with a higher affinity than with another cell or substance. An antibody "specifically binds" to a target if it binds with higher affinity, avidity, more readily, and / or with a longer duration than it binds to other substances. Under this definition, it is also understood that, for example, an antibody (or moiety or epitope) that specifically binds to a first target may or may not specifically bind to a second target. Thus, "specific binding" does not necessarily require (although it can include) exclusive binding.

[0065] The "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. As known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three complementarity determining regions (CDRs), also known as hypervariable regions. The CDRs in each chain are held together in close proximity by the FRs and, together with the CDRs from the other chain, contribute to the formation of the antigen-binding site of the antibody. There are several techniques for determining CDRs, for example, approaches based on interspecies sequence variability (i.e., Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda MD)), and approaches based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al., 1997, J. Molec. Biol. 273:927-948), the Chothia system (i.e., Chothia and Lesk, J. Mol. Biol. (1987) 196(4):901-917). As used herein, CDRs may refer to CDRs defined by either approach or by a combination of both approaches.

[0066] The "CDRs" of a variable domain are the amino acid residues within the variable region identified according to the Kabat, Chothia definition, the combined Kabat and Chothia, AbM, contact, and / or structural definitions, or any method of CDR determination known in the art. Antibody CDRs can be identified as hypervariable regions as originally defined by Kabat et al. See, e.g., Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington DC. The locations of CDRs may also be identified as structural loop structures as originally described by Chothia et al. See, e.g., Chothia et al., Nature 342:877-883, 1989. Other approaches to CDR identification include the "AbM definition," a compromise between Kabat and Chothia, derived using Oxford Molecular's AbM antibody modeling software (now Accelrys®), or the "contact definition" of CDRs based on observed antigen contacts as described in MacCallum et al., J. Mol. Biol., 262:732-745, 1996. In another approach, referred to herein as the "structural definition" of CDRs, the positions of CDRs may be identified as residues that contribute enthalpic wise to antigen binding. See, e.g., Makabe et al., Journal of Biological Chemistry, 283:1 156-1 166, 2008. Still other CDR boundary definitions may not strictly follow one of the above approaches, but they may nevertheless be shortened or extended in light of predictions or experimental findings that certain residues or groups of residues, or even entire CDRs, do not significantly affect antigen binding, but overlap with at least a portion of a Kabat CDR. As used herein, CDR may refer to a CDR defined by any approach known in the art, including a combination of approaches.The methods used herein may utilize CDRs defined according to any of these approaches. In any given embodiment containing two or more CDRs, the CDRs may be defined according to any of the Kabat, Chothia, extended, AbM, contact, AHo and / or structural definitions.

[0067] The antibodies (and CARs) of the present disclosure can be produced using techniques well known in the art, such as recombinant techniques, phage display techniques, synthetic techniques, or a combination of such techniques or other techniques readily known in the art (see, e.g., Jayasena, SD, Clin. Chem., 45:1628-50, 1999, and Fellouse, FA, et al, J. Mol. Biol., 373(4):924-40, 2007).

[0068] As known in the art, "polynucleotide" or "nucleic acid" as used interchangeably herein refers to a chain of nucleotides of any length, including DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the chain. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, "cap" substitutions with one or more analogs of naturally occurring nucleotides, internucleotide modifications such as those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of polynucleotides. Additionally, any of the hydroxyl groups normally present in the sugar may be replaced by, for example, phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to provide for additional linkages to additional nucleotides, or conjugated to a solid support. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups.Polynucleotides can also contain similar forms of ribose or deoxyribose sugars commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, alpha or beta anomeric sugars, epimeric sugars such as arabinose, xylose, or lyxose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs, and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which phosphate is replaced by P(O)S ("thioate"), P(S)S ("dithioate"), (O)NR2 ("amidate"), P(O)R, P(O)OR', CO, or CH2 ("formacetal"), where each R or R' is independently H, or a substituted or unsubstituted alkyl (1-20C) optionally containing an ether (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need be identical. The foregoing description applies to all polynucleotides referred to herein, including RNA and DNA.

[0069] As used herein, "transfection" refers to the uptake of exogenous or heterologous RNA or DNA by a cell. A cell is "transfected" by exogenous or heterologous RNA or DNA when such RNA or DNA is introduced into the cell. A cell is "transformed" by exogenous or heterologous RNA or DNA when the transfected RNA or DNA affects a phenotypic change. The transforming RNA or DNA may be integrated (covalently linked) into chromosomal DNA constituting the genome of the cell.

[0070] As used herein, "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms.

[0071] As used herein, "substantially pure" refers to a material that is at least 50% pure (i.e., free from contaminants), more preferably at least 90% pure, more preferably at least 95% pure, even more preferably at least 98% pure, and most preferably at least 99% pure. The term "compete" as used herein with respect to antibodies means that a first antibody, or an antigen-binding fragment (or portion) thereof, binds to an epitope in a manner sufficiently similar to the binding of a second antibody or an antigen-binding portion thereof, such that the result of binding of the first antibody to its cognate epitope is detectably reduced in the presence of the second antibody, compared to the binding of the first antibody in the absence of the second antibody. The alternative possibility that binding of the second antibody to its epitope is also detectably reduced in the presence of the first antibody may be true, but need not be. That is, a first antibody can inhibit binding of a second antibody to its epitope without that second antibody inhibiting binding of the first antibody to its respective epitope. However, if each antibody detectably inhibits the binding of the other antibody to its cognate epitope or ligand, whether to the same extent, a greater extent, or a lesser extent, the antibodies are said to "cross-compete" with each other for binding of their respective epitopes. Both competing and cross-competing antibodies are encompassed by the present disclosure. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or portion thereof), one of skill in the art will understand, based on the teachings provided herein, that such competing and / or cross-competing antibodies are encompassed and may be useful in the methods disclosed herein.

[0072] As used herein, "treatment" is an approach to obtain a beneficial or desired clinical outcome. For purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: reduction (or destruction) of tumor or cancer cell proliferation, inhibition of metastasis of tumor cells, reduction or decrease in tumor size, amelioration of a disease (e.g., cancer), reduction of symptoms caused by a disease (e.g., cancer), improvement in the quality of life of a person suffering from a disease (e.g., cancer), reduction in the dosage of other drugs required to treat a disease (e.g., cancer), delay in progression of a disease (e.g., cancer), cure of a disease (e.g., cancer), and / or prolongation of survival of a subject with a disease (e.g., cancer).

[0073] "Ameliorating" refers to the alleviation or improvement of one or more symptoms compared to no treatment. "Ameliorating" also includes shortening or reducing the duration of symptoms. As used herein, an "effective dosage" or "effective amount" of a drug, compound, or pharmaceutical composition is an amount sufficient to produce any one or more beneficial or desired results. For prophylactic use, beneficial or desired results include eliminating or reducing the risk, reducing the severity, or delaying the onset of a disease, including biochemical, histological, and / or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes manifested during the development of the disease. For therapeutic use, beneficial or desired results include clinical results such as reducing or improving the incidence of one or more symptoms of various diseases or conditions (e.g., cancer, etc.), reducing the dose of other drugs required to treat the disease, enhancing the effect of another drug, and / or delaying the progression of the disease. An effective dosage may be administered in one or more administrations. For purposes of this disclosure, an effective dosage of a drug, compound, or pharmaceutical composition is an amount sufficient to achieve prophylactic or therapeutic treatment, either directly or indirectly. As understood in a clinical context, an effective dosage of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition. Thus, an "effective dosage" may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desired result can be or is achieved.

[0074] As used herein, a "subject" is any mammal, e.g., a human or a monkey. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, mice, and rats. In an exemplary embodiment, the subject is a human. In an exemplary embodiment, the subject is a monkey, e.g., a cynomolgus monkey.

[0075] As used herein, "vector" refers to a construct capable of delivering and preferably expressing one or more genes or sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as production cells.

[0076] As used herein, "pharmaceutical acceptable carrier" or "pharmaceutical acceptable excipient" includes any material that, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers, such as phosphate buffered saline, water, emulsions such as oil / water emulsions, and various types of wetting agents. A preferred diluent for aerosol or parenteral administration is phosphate buffered saline (PBS) or normal (0.9%) saline. The compositions of the present disclosure that include such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, and Remington, The Science and Practice of Pharmacy 21 st Ed. Mack Publishing, 2005).

[0077] As used herein, "allo-reactivity" refers to the ability of T cells to recognize MHC complexes not present during thymic development. Alloreactivity is manifested clinically as host-versus-graft rejection or reaction and graft-versus-host disease.

[0078] References herein to "about" in conjunction with a value or parameter include (and describe) embodiments that are directed to plus or minus 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% of the value or parameter itself. For example, a reference to "about X" includes the reference to "X." Numeric ranges are inclusive of the numbers defining the range.

[0079] Wherever embodiments are described herein with the term "comprising," it is understood that otherwise similar embodiments are also provided that are described in terms of "consisting of" and / or "consisting essentially of."

[0080] When aspects or embodiments of the present disclosure are described in terms of a Markush group or other alternative grouping, the present disclosure encompasses not only the entire group recited as a whole, but also each individual member of the group and all possible subgroups of the main group, as well as the absence of one or more of the group members in the main group. The present disclosure also envisions the explicit exclusion of any one or more of the group members in the disclosed and / or claimed embodiments.

[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification, including definitions, shall control. Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising" shall be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. Unless otherwise required by context, the singular shall include the plural, and the plural shall include the singular.

[0082] Exemplary methods and materials are described herein, although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure. The materials, methods, and examples are illustrative only and are not intended to be limiting.

[0083] An "antigen binding protein" comprises one or more antigen binding domains. As used herein, "antigen binding domain" refers to any polypeptide that binds to a specified target antigen. In some embodiments, the antigen binding domain binds to an antigen on a tumor cell. In some embodiments, the antigen binding domain binds to an antigen on a cell involved in a hyperproliferative disease, or to a viral or bacterial antigen.

[0084] Antigen-binding domains include, but are not limited to, antibody binding regions that are immunologically functional fragments. The term "immunologically functional fragment" (or "fragment") of an antigen-binding domain is a species of antigen-binding domain that contains a portion of an antibody that lacks at least some of the amino acids present in the full-length chain, but is still capable of specifically binding to a target antigen (regardless of how the portion is obtained or synthesized). Such fragments are biologically active in that they bind to the target antigen and can compete with other antigen-binding domains, including intact antibodies, for binding to a given epitope.

[0085] Immunologically functional immunoglobulin fragments include, but are not limited to, scFv fragments, Fab fragments (Fab', F(ab')2, etc.), one or more complementarity determining regions ("CDRs"), diabodies (a heavy chain variable domain and a light chain variable domain on the same polypeptide linked via a short peptide linker that is too short to allow pairing between the two domains on the same chain), domain antibodies, bivalent antigen-binding domains (comprising two antigen-binding sites), multispecific antigen-binding domains, and single-chain antibodies. These fragments may be derived from any mammalian source, including, but not limited to, human, mouse, rat, camelid, or rabbit. As will be appreciated by those skilled in the art, the antigen-binding domain may comprise non-proteinaceous components.

[0086] Variable regions typically exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions (CDRs). The CDRs of the two chains of each pair are typically aligned by the framework regions, which may allow binding to a specific epitope. From the N-terminus to the C-terminus, both light chain variable regions and heavy chain variable regions typically include the domains FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. By convention, the CDR regions in the heavy chain are typically referred to as HC CDR1, CDR2, and CDR3. The CDR regions in the light chain are typically referred to as LC CDR1, CDR2, and CDR3.

[0087] In some embodiments, an antigen-binding domain comprises one or more complementary binding regions (CDRs) present in a full-length light or heavy chain of an antibody, and in some embodiments comprises a single heavy and / or light chain or a portion thereof. These fragments may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of the antigen-binding domain comprising an intact antibody.

[0088] In some embodiments, the antigen-binding domain is an antibody or fragment thereof and comprises one or more of its complementarity determining regions (CDRs). In some embodiments, the antigen-binding domain is a single chain variable fragment (scFv) comprising light chain CDRs CDR1, CDR2, and CDR3, and heavy chain CDRs CDR1, CDR2, and CDR3.

[0089] The assignment of amino acids to each of the framework, CDR, and variable domains is typically based on the Kabat numbering (see, e.g., Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., NIH Publication 91-3242, Bethesda Md. 1991), Chothia numbering (see, e.g., Chothia & Lesk, (1987), J Mol Biol 196:901-917; Al-Lazikani et al., (1997) J Mol Biol 273:927-948; Chothia et al., (1992) J Mol Biol 227:799-817; Tramontano et al., (1990) J Mol Biol 215(1):175-82; and U.S. Pat. No. 7,709,226), contact numbering, the AbM scheme (Antibody Modeling program, Oxford The numbering scheme follows that of the AHo system (Honneger and Pluckthun, J Mol Biol (2001) 309(3):657-70).

[0090] In some embodiments, the antigen-binding domain is a recombinant antigen receptor. As used herein, the term "recombinant antigen receptor" refers broadly to a non-naturally occurring surface receptor that includes an extracellular antigen-binding domain or an extracellular ligand-binding domain, a transmembrane domain, and an intracellular domain. In some embodiments, the recombinant antigen receptor is a chimeric antigen receptor (CAR). Chimeric antigen receptors (CARs) are well known in the art. A CAR is a fusion protein that includes an antigen recognition portion, a transmembrane domain, and a T cell activation domain (see, e.g., Eshhar et al., Proc. Natl. Acad. Sci. USA, 90(2):720-724 (1993)).

[0091] In some embodiments, the intracellular domain of the recombinant antigen receptor comprises a costimulatory domain and an ITAM-containing domain, hi some embodiments, the intracellular domain of the recombinant antigen receptor comprises an intracellular protein or a functional variant thereof (e.g., truncation, insertion, deletion, or substitution).

[0092] As used herein, the term "extracellular ligand-binding domain" or "extracellular antigen-binding domain" refers to a polypeptide capable of binding to a ligand or antigen or interacting with a cell surface molecule such as a ligand or surface antigen. For example, an extracellular ligand-binding domain or antigen-binding domain may be selected to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state, e.g., a tumor-specific antigen. In some embodiments, the antigen-binding domain comprises an antibody, or an antigen-binding fragment or portion of an antibody. In some embodiments, the antigen-binding domain comprises an Fv or scFv, a Fab or scFab, a F(ab')2 or scF(ab')2, an Fd, a monobody, an affibody, a camelid antibody, a VHH antibody, a single domain antibody, or a DARPin. In some embodiments, the ligand-binding domain comprises a ligand that binds to a surface receptor, or a binding pair partner such as an ectodomain of a surface receptor that binds to the ligand.

[0093] The terms "stalk domain" or "hinge domain" are used interchangeably herein to refer to any polypeptide that functions to link a transmembrane domain to an extracellular ligand-binding domain. In particular, stalk domains are often used to provide additional flexibility and accessibility to the extracellular ligand-binding domain.

[0094] The term "intracellular signaling domain" refers to the portion of a protein that transduces effector functional signals and induces the cell to carry out a specialized function.

[0095] vector Expression vectors and methods for administration of polynucleotide compositions are known in the art and are further described herein.

[0096] In another aspect, the disclosure provides a method of making any of the polynucleotides described herein.

[0097] Polynucleotides complementary to any such sequences are also encompassed by the present disclosure. Polynucleotides may be single-stranded (coding or antisense) or double-stranded and may be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include hnRNA molecules, which contain introns and correspond one-to-one to DNA molecules, and mRNA molecules, which do not contain introns. Additional coding or non-coding sequences can be, but need not be, present within the polynucleotides of the present disclosure, and polynucleotides can be, but need not be, linked to other molecules and / or supporting materials.

[0098] A polynucleotide may comprise a native sequence (i.e., an endogenous sequence encoding an antibody or a portion thereof) or may comprise a variant of such a sequence. A polynucleotide variant contains one or more substitutions, additions, deletions, and / or insertions such that the immunoreactivity of the encoded polypeptide is not reduced compared to the native immunoreactive molecule. The effect on the immunoreactivity of the encoded polypeptide can generally be assessed as described herein. A variant preferably exhibits at least about 70% identity, more preferably at least about 80% identity, even more preferably at least about 90% identity, and most preferably at least about 95% identity to a polynucleotide sequence encoding a native antibody or a portion thereof. Two polynucleotide or polypeptide sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences are the same when aligned for maximum correspondence as described below. Comparison between two sequences is typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. As used herein, a "comparison window" refers to a segment of at least about 20, usually 30 to about 75, or 40 to about 50 contiguous positions, in which a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

[0099] Optimal alignment of sequences for comparison can be performed using the Megalign program of the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.) using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, MO, 1978, A model of evolutionary change in proteins-Matrices for detecting distant relationships. In Dayhoff, MO (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3, pp. 345-358; Hein J., 1990, Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, CA; Higgins, DG and Sharp, PM, 1989, CABIOS 5: 151-153; Myers, EW and Muller W., 1988, CABIOS 4: 1 1-17; Robinson, ED, 1971, Comb. Theor. 1 1:105, Santou, N., Nes, M., 1987, Mol. Biol. Evol. 4:406-425, Sneath, PHA and Sokal, RR, 1973, Numerical Taxonomy the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, CA, Wilbur, WJand. Lipman, DJ, 1983, Proc. Natl. Acad. Sci. USA 80:726-730.

[0100] In some embodiments, "percent sequence identity" is determined by comparing two optimally aligned sequences over a comparison window of at least 20 positions, where the portion of the polynucleotide or polypeptide sequence within the comparison window can contain up to 20 percent, typically 5-15 percent, or 10-12 percent additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which identical nucleic acid bases or amino acid residues occur in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size), and multiplying the result by 100 to obtain the percentage sequence identity.

[0101] Variants may also, or alternatively, be substantially homologous to a native gene, or a portion or complement thereof. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA sequence encoding a native antibody (or a complementary sequence).

[0102] Preferred "moderately stringent conditions" include a prewash in a solution of 5x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization overnight in 5x SSC at 50°C to 65°C, followed by two washes for 20 minutes each in 2x, 0.5x, and 0.2x SSC containing 0.1% SDS at 65°C.

[0103] As used herein, "highly stringent conditions" or "high stringency conditions" refers to (1) low ionic strength and high temperature for washing, e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50° C., and (2) the use of a denaturing agent such as formamide during hybridization, e.g., 50% (v / v) formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (3) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (4) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (5) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (6) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (7) or (3) 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg / m), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes in 0.2×SSC (sodium chloride / sodium citrate) at 42° C. and 50% formamide at 55° C., followed by a high stringency wash consisting of 0.1×SSC containing EDTA at 55° C. One of skill in the art will know how to adjust temperature, ionic strength, etc. as necessary to accommodate factors such as probe length.

[0104] It will be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that code for the polypeptides described herein. Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. Nevertheless, polynucleotides that differ due to differences in codon usage are specifically contemplated by this disclosure. Additionally, alleles of genes comprising the polynucleotide sequences provided herein are within the scope of this disclosure. An allele is an endogenous gene that is altered as a result of one or more mutations, such as deletions, additions, and / or substitutions of nucleotides. The resulting mRNA and protein can, but need not, have an altered structure or function. Alleles can be identified using standard techniques, such as hybridization, amplification, and / or database sequence comparison.

[0105] The polynucleotide of the present disclosure can be obtained by chemical synthesis, recombinant methods, or PCR.Methods of chemical polynucleotide synthesis are well known in the art and do not need to be described in detail herein.Those skilled in the art can use the sequences provided herein and commercially available DNA synthesis equipment to produce desired DNA sequences.

[0106] To prepare a polynucleotide using recombinant methods, as further described herein, a polynucleotide containing a desired sequence can be inserted into a suitable vector, and the vector can be introduced into a suitable host cell for replication and amplification. The polynucleotide can be inserted into the host cell by any means known in the art. The cell is transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, F-mating, or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or can be integrated into the host cell genome. The polynucleotide thus amplified can be isolated from the host cell by methods well known in the art. See, for example, Sambrook et al., 1989.

[0107] Alternatively, PCR allows the reproduction of DNA sequences. PCR technology is well known in the art and is described, for example, in U.S. Patent Nos. 4,683,195, 4,800,159, 4,754,065, and 4,683,202, and in PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston, 1994.

[0108] RNA can be obtained by using the isolated DNA in an appropriate vector and inserting it into a suitable host cell. When the cell replicates and the DNA is transcribed into RNA, the RNA can be isolated using methods well known to those skilled in the art, for example, as described in Sambrook et al., 1989 (see above).

[0109] A suitable cloning vector can be constructed according to standard techniques or can be selected from the numerous cloning vectors available in the art. While the cloning vector selected may vary depending on the host cell intended to be used, useful cloning vectors are generally capable of autonomous replication, may have a single target for a specific restriction endonuclease, and / or may carry a marker gene that may be used to select clones containing the vector. Suitable examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Strategene, and Invitrogen.

[0110] An expression vector is generally a replicable polynucleotide construct containing a polynucleotide according to the present disclosure. It is implied that an expression vector must be replicable in a host cell, either as an episome or as an integral part of chromosomal DNA. Suitable expression vectors include, but are not limited to, plasmids, viral vectors including adenoviruses, adeno-associated viruses, retroviruses, cosmids, and expression vectors disclosed in International Publication WO 87 / 04462. Vector components may generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, suitable transcription control elements (such as promoters, enhancers, and terminators). For expression (i.e., translation), one or more translation control elements are also usually required, such as a ribosome binding site, a translation initiation site, and a stop codon.

[0111] A vector containing a polynucleotide of interest can be introduced into a host cell by any of a number of suitable means, including electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other agents, microprojectile bombardment, lipofection, and infection (e.g., where the vector is an infectious agent such as vaccinia virus). The choice of introduction vector or polynucleotide often depends on the characteristics of the host cell.

[0112] A polynucleotide encoding an antigen binding protein (e.g., CAR) can be present in an expression cassette or expression vector (e.g., a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transfection of a mammalian host cell). In some embodiments, the polynucleotide or vector can include a nucleic acid sequence encoding a ribosomal skipping sequence, such as, but not limited to, a sequence encoding a 2A peptide. The 2A peptide, identified in the aphthovirus subgroup of picornaviruses, causes the ribosomal "skip" from one codon to the next without the formation of a peptide bond between the two amino acids encoded by the codon (see, e.g., Donnelly and Elliott 2001; Atkins, Wills et al. 2007; Doronina, Wu et al. 2008). By "codon" is meant three nucleotides on an mRNA (or on the sense strand of a DNA molecule) that are translated by the ribosome into one amino acid residue. Thus, two polypeptides can be synthesized from a single adjacent open reading frame within an imRNA if the polypeptides are separated by a 2A oligopeptide sequence that is in frame. Such ribosomal skipping mechanisms are well known in the art and are known to be used by several vectors for the expression of several proteins encoded by a single messenger RNA.

[0113] To direct the transmembrane polypeptide into the secretory pathway of the host cell, in some embodiments, a secretory signal sequence (also known as a leader sequence, prepro sequence, or pre sequence) is provided in the polynucleotide sequence or vector sequence. The secretory signal sequence is operably linked to the transmembrane nucleic acid sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell. Secretory signal sequences are generally positioned 5' to the nucleic acid sequence encoding the polypeptide of interest, although certain secretory signal sequences can be positioned elsewhere in the nucleic acid sequence of interest (see, e.g., Welch et al., U.S. Pat. No. 5,037,743; Holland et al., U.S. Pat. No. 5,143,830). One skilled in the art will recognize that considerable sequence variation is possible among these polynucleotide molecules, given the degeneracy of the genetic code. In some embodiments, the nucleic acid sequences of the present disclosure are codon-optimized for expression in mammalian cells, preferably for expression in human cells. Codon optimization refers to the replacement in a sequence of interest of codons that are generally rare in highly expressed genes of a given species with codons that are generally frequent in highly expressed genes of such species, such codons encoding the same amino acid as the codons being replaced.

[0114] Provided herein are methods of preparing immune cells for use in immunotherapy. In some embodiments, the methods include introducing an antigen binding protein (e.g., a CAR) into one or more immune cells, or introducing a polynucleotide encoding an antigen binding protein (e.g., a CAR), and expanding the cells. In some embodiments, the present disclosure relates to a method of engineering immune cells, the method including providing an immune cell and expressing at least one antigen binding protein (e.g., a CAR) on the surface of the cell. In some embodiments, the method includes transfecting the cell with at least one polynucleotide encoding an antigen binding protein (e.g., a CAR) and expressing the at least one polynucleotide in the cell.

[0115] In some embodiments, the polynucleotide encoding the antigen binding protein (e.g., CAR) is present in one or more expression vectors for stable expression in a cell. In some embodiments, the polynucleotide is present in a viral vector for stable expression in a cell. In some embodiments, the viral vector can be, for example, a lentiviral vector or an adenoviral vector.

[0116] In some embodiments, the polynucleotide encoding the polypeptide according to the present disclosure can be, for example, an mRNA that is directly introduced into cells by electroporation. In some embodiments, CytoPulse technology can be used to transiently permeabilize live cells to deliver materials into cells. Parameters can be modified to determine conditions for high transfection efficiency with minimal mortality.

[0117] Also provided herein is a method for transfecting immune cells, such as T cells. In general, any conventional method known to those skilled in the art can be used, such as introducing either RNA, DNA or protein into cells by electroporation. See, for example, Luft and Ketteler, J. Biomolec Screening 20(8):932(2015) (DOI:10.1177 / 1087057115579638). In some embodiments, the method includes contacting a T cell with RNA and applying to the T cell an agile pulse sequence consisting of: (a) an electrical pulse having a voltage range of about 2250-3000 V / centimeter; (b) a pulse width of 0.1 ms; (c) a pulse interval of about 0.2-10 ms between the electrical pulses of steps (a) and (b); (d) an electrical pulse having a voltage range of about 2250-3000 V / centimeter, with a pulse width of about 100 ms and a pulse interval of about 100 ms between the electrical pulse of step (b) and the first electrical pulse of step (c); and (e) four electrical pulses having a voltage of about 325 V, with a pulse width of about 0.2 ms and a pulse interval of 2 ms between each of the four electrical pulses.In some embodiments, a method of transfecting a T cell includes contacting the T cell with RNA and administering to the T cell (a) an electrical pulse having a voltage of about 1600, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2400, 2450, 2500, 2600, 2700, 2800, 2900, or 3000 V / centimeter, (b) a pulse width of 0.1 ms, (c) and a pulse interval of about 0.2, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ms between the electrical pulses of steps (a) and (b), (d) a pulse width of 100 ms, and and applying an agile pulse sequence including one electric pulse having a voltage range of about 2250-3000 V / centimeter, for example, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2400, 2450, 2500, 2600, 2700, 2800, 2900, or 3000 V / centimeter, with a pulse interval of 100 ms between the pulse and the first electric pulse of step (c), and (e) four electric pulses having a voltage of about 325 V, with a pulse width of about 0.2 ms, and a pulse interval of about 2 ms between each of the four electric pulses. Any value included in the above value range is disclosed in the present application. The electroporation medium can be any suitable medium known in the art. In some embodiments, the electroporation medium has a conductivity ranging from about 0.01 to about 1.0 millisiemens.

[0118] In some embodiments, the method may further comprise genetically engineering the cells, for example, but not limited to, by inactivating (e.g., knocking out) or reducing the expression level of at least one gene expressing a component of the TCR (e.g., TRAC) and / or a target of an immunosuppressant. By inactivating a gene, it is intended that the gene of interest is not expressed in the form of a functional protein. In some embodiments, the inactivated gene is selected from the group consisting of, for example, but not limited to, TCRα, TCRβ, CD52 and CD70. In some embodiments, the method comprises inactivating or reducing the expression level of one or more genes by introducing into the cells a low-frequency-cutting endonuclease that can selectively inactivate the gene by selective DNA cleavage. In some embodiments, the low-frequency-cutting endonuclease may be, for example, a transcription activator-like effector nuclease (TALE-nuclease or TALEN®), a megaTAL nuclease, or a Cas9 endonuclease.

[0119] In another embodiment, the step of genetically modifying or engineering immune cells, e.g., T cells, can include modifying immune cells, e.g., T cells, by inactivating at least one gene expressing a target of an immunosuppressant, and optionally growing the cells in the presence of an immunosuppressant. Immunosuppressants are drugs that suppress immune function by one of several mechanisms of action. Immunosuppressants can reduce the extent and / or voracity of an immune response. Non-limiting examples of immunosuppressants include calcineurin inhibitors, target of rapamycin, interleukin-2 alpha chain blockers, inhibitors of inosine monophosphate dehydrogenase, inhibitors of dihydrofolate reductase, corticosteroids, and immunosuppressant antimetabolites. Some cytotoxic immunosuppressants act by inhibiting DNA synthesis. Other cytotoxic immunosuppressants may act via activation of T cells or by inhibiting activation of helper cells. The method according to the present disclosure allows for conferring immunosuppression resistance to T cells for immunotherapy, e.g., by inactivating the target of the immunosuppressant in the T cells. As non-limiting examples, the target of an immunosuppressant may be a receptor for the immunosuppressant, such as, but not limited to, CD52, glucocorticoid receptor (GR), FKBP family gene members, and cyclophilin family gene members.

[0120] Provided herein are compositions and methods for functionally expressing an antigen binding protein, e.g., a CAR, in a cell (e.g., an engineered immune cell) in conjunction with a CD70 binding protein, e.g., a CD70 CAR (CAR that specifically recognizes CD70), functionally expressed in the same cell. Also provided are uses of such compositions and methods for improving the functional activity of immune cells, e.g., T cells, such as CAR-T cells. The methods and compositions provided herein are useful for improving the in vivo persistence and therapeutic efficacy of immune cells, e.g., allogeneic immune cells (e.g., allogeneic T cells, allogeneic CAR-T cells).

[0121] In various embodiments, the engineered immune cells, e.g., the engineered T cells provided herein, functionally express a first antigen binding protein, e.g., a first chimeric antigen receptor (CAR), and a second antigen binding protein, e.g., a second CAR, where the second CAR is a CD70 CAR. Advantageously, the engineered immune cells provided herein exhibit improved persistence in vivo and / or increased resistance to rejection by the recipient's immune system compared to non-engineered cells. For example, a population of cells comprising a first CAR and a second CD70 CAR persists longer than a population of cells comprising the same first CAR and either no second CAR or a second CAR that does not specifically bind to CD70.

[0122] One or more antigen binding proteins, e.g., one or more CARs, can be synthesized in situ in the cell after introducing a polynucleotide construct encoding the protein into the cell. Alternatively, the antigen binding protein (e.g., CAR) can be produced outside the cell and then introduced into the cell. Methods for introducing a polynucleotide construct into a cell are known in the art. In some embodiments, stable transformation methods can be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, transient transformation methods can be used to transiently express the polynucleotide construct, and the polynucleotide construct is not integrated into the genome of the cell. In other embodiments, viral-mediated methods can be used. The polynucleotide can be introduced into the cell by any suitable means, such as, for example, a recombinant viral vector (e.g., retrovirus (including lentivirus), adenovirus), liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or particle bombardment. The polynucleotide can be included in a vector, such as, for example, a plasmid vector or a viral vector.

[0123] In some embodiments of the engineered immune cells (e.g., T cells) provided herein, each CAR expressed by the cell can include an extracellular ligand-binding domain (e.g., a single-chain variable fragment (scFv)), a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular ligand-binding domain, the transmembrane domain, and the intracellular signaling domain are in one polypeptide, i.e., in a single chain. Multi-chain CARs and polypeptides are also provided herein. In some embodiments, a multi-chain CAR contains a first polypeptide that includes a transmembrane domain and at least one extracellular ligand-binding domain, and a second polypeptide that includes a transmembrane domain and at least one intracellular signaling domain, where the polypeptides are assembled together to form a multi-chain CAR.

[0124] The extracellular ligand binding domain specifically binds to a target of interest. In some embodiments, the target of interest, e.g., the target of interest of the first CAR, can be any molecule of interest, including, but not limited to, CD70, BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD22, CD23, CD30, CD38, CD33, CD133, WT1, TSPAN10, MHC-PRAME, HER2, MSLN, PSMA, PSCA, GPC3, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18.2), and the like. n-18A2, or Claudin18 isoform 2), DLL3 (Delta-like protein 3, Drosophila delta homolog 3, Delta3), Muc17, Muc3, Muc16, FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), or RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43), specifically including the human form of any of the exemplary targets listed.

[0125] In some embodiments, the extracellular ligand binding domain comprises an scFv containing the light chain variable (VL) and heavy chain variable (VH) regions of a monoclonal antibody specific for a target antigen, which are linked by a flexible linker. Single chain variable region fragments are generated by linking the light and / or heavy chain variable regions by using a short linking peptide (Bird et al., Science 242:423-426, 1988). One example of a linking peptide is the GS linker, which has the amino acid sequence (GGGGS)3 (SEQ ID NO: 16), which bridges approximately 3.5 nm between the carboxy terminus of one variable region and the amino terminus of the other variable region. Linkers of other sequences have been designed and used (Bird et al., 1988, supra). In general, the linker may be a short flexible polypeptide, preferably consisting of about 20 or fewer amino acid residues. Furthermore, the linker may be modified for additional functions, such as, for example, attachment of a drug or attachment to a solid support. Single chain variants can be produced recombinantly or synthetically. For synthetic production of scFvs, an automated synthesizer can be used. For recombinant production of scFvs, a suitable plasmid or other vector containing a polynucleotide encoding the scFv can be introduced into a suitable host cell, either a eukaryotic cell such as a yeast cell, a plant cell, an insect cell, or a mammalian cell, or a prokaryotic cell such as E. coli. A polynucleotide encoding the desired scFv can be produced by routine manipulations such as polynucleotide ligation. The resulting scFv can be isolated using standard protein purification techniques known in the art.

[0126] The intracellular signaling domain of the CAR according to the present disclosure is involved in intracellular signaling following binding of the extracellular ligand binding domain to a target, resulting in activation of immune cells and immune responses. The intracellular signaling domain has the ability to activate at least one of the normal effector functions of the immune cell in which the CAR is expressed. For example, the effector function of a T cell may be a cytolytic activity or a helper activity, including cytokine secretion.

[0127] In some embodiments, the intracellular signaling domain for use in the CAR may be, for example, but not limited to, the cytoplasmic sequences of T cell receptors and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences, and any synthetic sequences with the same function. The intracellular signaling domain contains two distinct classes of cytoplasmic signaling sequences: sequences that initiate antigen-dependent primary activation, and sequences that act in an antigen-independent manner to generate secondary or costimulatory signals. Primary cytoplasmic signaling sequences can include signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs. ITAMs are well-defined signaling motifs found in the intracytoplasmic tails of various receptors that serve as binding sites for the syk / zap70 class of tyrosine kinases. Examples of ITAMs used in the present disclosure can include, by way of non-limiting example, ITAMs derived from ΤCRζ, FcRγ, FcRβ, FcRε, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, or variants thereof. In some embodiments, the intracellular signaling domain of a CAR may contain a CD3ζ signaling domain or a variant of a CD3ζ domain. In some embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a domain of a costimulatory molecule.

[0128] In some embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a portion of a costimulatory molecule selected from the group consisting of fragments of 4-1BB (GenBank: AAA53133) and CD28 (NP_006130 and its isoforms).

[0129] CARs are expressed on the surface membrane of cells. Thus, each CAR can contain a transmembrane domain. Suitable transmembrane domains for the CARs disclosed herein have the ability to (a) be expressed on the surface of a cell, such as an immune cell, for example, but not limited to, a lymphocytic cell (e.g., T cell) or a natural killer (NK) cell, and (b) interact with a ligand binding domain and an intracellular signaling domain to induce a cellular response of the immune cell against a given target cell. The transmembrane domain can be derived from either natural or synthetic sources. The transmembrane domain can be derived from any membrane-bound or transmembrane protein. As non-limiting examples, the transmembrane polypeptide can be a domain of the T cell receptor, such as the α, β, γ, or δ polypeptides that make up the CD3 complex, the IL-2 receptor, e.g., p55 (α chain), p75 (β chain or γ chain), the Fc receptor, particularly a subunit chain of the Fcγ receptor III, or a CD protein. Alternatively, the transmembrane domain can be synthetic and contain primarily hydrophobic residues such as leucine and valine. In some embodiments, the transmembrane domain is derived from the human CD8 α chain (e.g., NP_001139345.1) or is a human CD8 α chain transmembrane domain. In some embodiments, the transmembrane domain comprises a human CD28 transmembrane domain or is derived from a human CD28 protein transmembrane domain. The transmembrane domain may further contain a stalk domain between the extracellular ligand binding domain and said transmembrane domain. The stalk domain may comprise up to 300 amino acids, e.g., 10-100 amino acids or 25-50 amino acids. The stalk region may be derived from all or a portion of a naturally occurring molecule, such as all or a portion of the extracellular region of CD8, CD4, or CD28, or all or a portion of an antibody constant region. Alternatively, the stalk domain may be a synthetic sequence that corresponds to a natural stalk sequence, or may be a synthetic stalk sequence in its entirety. In some embodiments, the stalk domain is part of the human CD8 α chain (e.g., NP_001139345 and its isoforms). In another specific embodiment, the transmembrane domain comprises a portion of the human CD8 α chain.In some embodiments, a CAR disclosed herein and functionally expressed in an engineered immune cell disclosed herein can include an extracellular ligand binding domain that specifically binds to CD70 or any of the targets of interest disclosed herein, a CD8α human stalk and transmembrane domain, a CD3ζ signaling domain, and a 4-1BB signaling domain. In some embodiments, a CAR disclosed herein and functionally expressed in an engineered immune cell disclosed herein can include an extracellular ligand binding domain that specifically binds to CD70 (e.g., a CD70 antigen binding domain or a CD70 binding domain) and a transmembrane domain, with or without one or more intracellular signaling domains. In some embodiments, a nucleic acid encoding a CAR can be introduced into an immune cell as a transgene via a vector, e.g., a plasmid vector or a lentiviral vector. In some embodiments, a vector, e.g., a plasmid vector, can also contain a selection marker that provides, for example, for identification and / or selection of cells that have received the vector.

[0130] The CAR polypeptide may be synthesized in situ within the cell after introduction of a polynucleotide encoding the CAR polypeptide into the cell. Alternatively, the CAR polypeptide may be produced outside the cell and then introduced into the cell. Methods for introducing a polynucleotide construct into a cell are known in the art. In some embodiments, stable transformation methods may be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, transient transformation methods may be used to transiently express the polynucleotide construct and the polynucleotide construct that is not integrated into the genome of the cell. In other embodiments, viral-mediated methods may be used. The polynucleotide may be introduced into the cell by any suitable means, such as, for example, a recombinant viral vector (e.g., a retrovirus (e.g., a lentivirus), an adenovirus), a liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or particle bombardment. The polynucleotide may be included in a vector, such as, for example, a plasmid vector or a viral vector.

[0131] Also provided herein are immune cells, such as isolated T cells or peripheral blood mononuclear cells (PBMCs) obtained according to any one of the methods described herein. Any immune cell capable of expressing heterologous DNA can be used to express an antigen binding protein of interest (e.g., CAR) and even engineered to have reduced levels of expression of NLRC5 and / or TAP2. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell can be derived from a stem cell, for example, but not limited to, a stem cell. The stem cell can be an adult stem cell, a non-human embryonic stem cell, more particularly, a non-human stem cell, an umbilical cord blood stem cell, a progenitor cell, a bone marrow stem cell, an induced pluripotent stem cell, a totipotent stem cell, or a hematopoietic stem cell. A representative human cell is a CD34+ cell. The isolated cell can also be a dendritic cell, a killer dendritic cell, a mast cell, a NK cell, a B cell, or a T cell selected from the group consisting of an inflammatory T lymphocyte, a cytotoxic T lymphocyte, a regulatory T lymphocyte, or a helper T lymphocyte. In some embodiments, the cells can originate from the group consisting of CD4+ T-lymphocytes and CD8+ T-lymphocytes. In some embodiments, immune cells (e.g., T cells), such as isolated T cells, are further modified, e.g., engineered by the methods described herein (e.g., TALEN, CRISPR / Cas9, or megaTAL nucleases to partially or completely delete or disrupt one or more loci, e.g., CD70, TRAC, and CD52), such that they express reduced levels of the corresponding functional protein compared to comparable cells that have not been engineered.

[0132] The engineered immune cells provided herein can include one or more mimotope sequences that allow for cell sorting to enrich for a population of cells engineered as described herein, e.g., cells expressing an antigen binding protein, and / or provide a safety switch mechanism to inactivate the immune cells, e.g., limit adverse effects, after the cells are administered to a patient or recipient. Such mimotope sequences and their use in cell sorting and as safety switches are known in the art and are described, for example, in US2018 / 0002435, which is incorporated herein by reference in its entirety.

[0133] Prior to expansion and genetic modification, the cell source can be obtained from a subject through a variety of non-limiting methods. Cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, any number of T cell lines available and known to those skilled in the art can be used. In some embodiments, the cells can be derived from a healthy donor, a subject diagnosed with cancer, or a subject diagnosed with an infectious disease. In some embodiments, the cells can be part of a mixed population of cells that exhibit different phenotypic characteristics.

[0134] Also provided herein are cell lines obtained from immune cells, e.g., engineered T cells, modified, e.g., transformed or engineered, according to any of the methods described herein. In some embodiments, the engineered immune cells, e.g., engineered T cells according to the present disclosure, comprise a first polynucleotide encoding a first antigen binding protein, e.g., a CAR, and a second polynucleotide encoding a second CD70 binding protein, e.g., a CD70 CAR, and are optionally further modified or engineered, e.g., genetically modified, to express one or more of CD70, TRAC, and CD52 at reduced levels (e.g., modified to include a knockout of either or both loci). In some embodiments, one polynucleotide encodes both the first antigen binding protein, e.g., a CAR, and the second CD70 binding protein, e.g., a CD70 CAR.

[0135] Immune cells, e.g., T cells, of the present disclosure can be derived from, or can be expressed in, any of the manner described in, for example, but not limited to, U.S. Patent Nos. 6,352,694, 6,534,055, 6,905,680, 6,692,964, 5,858,358, 6,887,466, 6,905,681, 7,144,575, 7,067,318, 7,172, 7,182, 7,183, 7,184, 7,185, 7,186, 7,187, 7,188, 7,189, 7,203, 7,204, 7,205, 7,206, 7,207, 7,208, 7,209, 7,303, 7,304, 7,305, 7,306, 7,307, 7,308, 7,309, 7,401, 7,402, 7,403 ... The cells can be activated and expanded either before or after modification using methods generally described in U.S. Patent Application Publication Nos. 20060121005, 20060121005, 200702223, 20070 ... For example, chemicals such as calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitogenic lectins such as phytohemagglutinin (PHA) can be used to generate activation signals for immune cells, e.g., T cells.

[0136] In some embodiments, a population of T cells may be stimulated in vitro, for example, by contact with an anti-CD3 antibody or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in combination with a calcium ionophore. Co-stimulation of an accessory molecule on the surface of the T cells uses a ligand that binds to the accessory molecule. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions appropriate to stimulate proliferation of the T cells. Suitable conditions for T cell culture include an appropriate medium (e.g., Minimum Essential Medium, RPMI Medium 1640, or X-VIVO™ 5, (Lonza)) that can contain factors necessary for growth and survival, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGFβ, and TNF, or any other additives for cell growth known to those of skill in the art. Other additives for cell growth include, but are not limited to, detergents, Plasmanate®, and reducing agents such as N-acetyl-cysteine ​​and 2-mercaptoethanol. The medium can include RPMI 1640 (as described herein), AIM V, DMEM, MEM, alpha-MEM, F-12, X-VIVO™ 10, X-VIVO™ 15 and X-VIVO™ 20, OpTmizer™, with additional amino acids, sodium pyruvate and vitamins, and is serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones and / or cytokines in sufficient amounts for the growth and proliferation of T cells. Antibiotics, such as penicillin and streptomycin, are included only in the experimental cultures and not in the cultures of cells injected into the subject. Target cells are maintained under conditions necessary to support proliferation, such as, for example, an appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air+5% CO2). Immune cells, such as T cells, exposed to various stimulation times can exhibit different characteristics.

[0137] In some embodiments, the cells of the present disclosure can be expanded by co-culturing with tissue or cells. The cells can also be expanded in vivo, for example, in the blood of a subject after administration of the cells to the subject.

[0138] In another aspect, the disclosure provides a composition (such as a pharmaceutical composition) comprising any of the cells of the disclosure or a population comprising such cells. In some embodiments, the composition comprises an engineered immune cell, e.g., an engineered T cell according to the disclosure, comprising a first polynucleotide encoding a first antigen binding protein, e.g., a CAR, and a second polynucleotide encoding a second CD70 binding protein, e.g., a CD70 CAR, and optionally further modified or engineered, e.g., genetically modified, to express one or more of CD70, TRAC, and CD52 at a reduced level compared to unmodified cells (e.g., modified to include a knockout of either or both loci). In some embodiments, one polynucleotide encodes both the first antigen binding protein, e.g., a CAR, and a second CD70 binding protein, e.g., a CD70 CAR. In some embodiments, the composition comprises a population of such engineered immune cells, e.g., engineered T cells, e.g., 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 such engineered immune cells, e.g., engineered T cells, or some number of cells between any two of these values. In various embodiments, the compositions disclosed herein further comprise one or more pharma- ceutically acceptable carriers or excipients.

[0139] In some embodiments, primary cells isolated from a donor are manipulated as described herein to provide a cell population in which a subpopulation of the resulting cells (e.g., a percentage less than 100%, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) contains all of the desired modifications. Such a resulting population, including a mixture of cells that contain and do not contain all of the modifications, can be used in the therapeutic methods of the present disclosure and to prepare the compositions of the present disclosure. Alternatively, this cell population (the "starting population") can be manipulated by known methods, such as cell sorting and / or expansion of cells having the desired modifications, to provide a cell population enriched for cells that contain one or more desired modifications (e.g., enriched for cells that express both of the desired antigen binding proteins, and optionally further enriched for cells that express one or more of CD70, TRAC, and CD52 at reduced levels compared to comparable cells that have not been manipulated for CD70, TRAC, and / or CD52), i.e., containing a higher percentage of such modified or engineered cells than the starting population. The enriched population of modified cells can then be used in the therapeutic methods of the disclosure and, for example, to prepare compositions of the disclosure. In some embodiments, the enriched cell population contains, or at least contains, e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of cells that have one or more of the modifications. In other embodiments, the percentage of cells in the enriched cell population that contain one or more of the modifications is at least 30% higher than the percentage of cells in the starting population of cells that contain the desired modifications.

[0140] CD70 binding proteins or CD70-specific CARs and methods for producing same In a related aspect, the disclosure provides a CD70 binding protein as described herein, which comprises an extracellular ligand or antigen binding domain that binds to CD70 (or a CD70 binding domain) and a transmembrane domain, the CD70 binding protein is not entirely comprised in one or more intracellular signaling domains as described herein.

[0141] The present disclosure provides CD70 binding proteins, including but not limited to CARs that bind to CD70 (e.g., human CD70 (e.g., SEQ ID NO: 601)), such as those deposited under the provisions of the Budapest Treaty and assigned accession number P32970-1. CD70-specific CARs provided herein include single-chain CARs and multi-chain CARs. In some embodiments, CARs have the ability to utilize the antigen-binding properties of monoclonal antibodies to redirect T cell specificity and reactivity to CD70 in a non-MHC-restricted manner. Non-MHC-restricted antigen recognition provides CAR-expressing T cells the ability to recognize antigens independent of antigen processing, thereby bypassing a major mechanism of tumor escape.

[0142] In some embodiments, the CD70 binding proteins provided herein comprise an extracellular domain (e.g., a single chain variable fragment (scFv)) and a transmembrane domain. In some embodiments, the CD70 binding proteins or CD70 CARs provided herein comprise an extracellular ligand binding domain (e.g., an scFv), a transmembrane domain, and an intracellular signaling domain. In some embodiments, the CD70 binding proteins comprise one or more intracellular signaling domains selected from the group consisting of a CD3ζ signaling domain, a CD3δ signaling domain, a CD3γ signaling domain, a CD3ε signaling domain, a CD28 signaling domain, a CD2 signaling domain, an OX40 signaling domain, and a 4-1BB signaling domain, or a variant thereof. In some embodiments, the intracellular signaling domain comprises one or more amino acid sequences of SEQ ID NOs: 265, 271-278, 281-295, 311-337, 580-591, or 616-617. In some embodiments, the intracellular signaling domain comprises one or more of the amino acid sequences of SEQ ID NOs: 271, 616, 272, 617, 276, 275, 582, 583, 585, or 586. In some embodiments, the CD70 binding protein comprises a CD3ζ or CD3γ signaling domain, or a variant thereof, and does not comprise a costimulatory domain. In some embodiments, the CD70 binding protein comprises a 4-1BB signaling domain, or a variant thereof, and does not comprise a CD3 signaling domain. In some embodiments, the CD70 binding protein comprises a 4-1BB signaling domain and a CD3ζ signaling domain. In some embodiments, the CD70 binding protein does not comprise an intracellular signaling domain. Different intracellular signaling domains or combinations thereof may confer different signaling strengths that may contribute to T cell proliferation, potency, survival, persistence, and / or resistance to host immune cell rejection. Described herein are CD70 binding proteins that do not comprise one or more intracellular signaling domains.

[0143] In some embodiments, engineered immune cells comprising the CD70 binding proteins described herein may exhibit different levels of persistence and / or resistance to rejection by host immune cells and may be suitable for use in in vivo lymphodepletion when administered to a patient. In some embodiments, engineered immune cells comprising the CD70 binding proteins described herein may inhibit host immune cell proliferation and / or activity to different degrees, which may allow fine tuning of the depth of in vivo lymphodepletion when administered to a patient. For example, engineered immune cells comprising CD70 binding proteins that have shown prolonged expansion and / or inhibition of host immune cell proliferation or activity in an MLR assay may be used for prolonged lymphodepletion. In contrast, engineered immune cells comprising CD70 binding proteins that show less prolonged expansion and / or inhibition of host immune cells in the same or similar assay may be used when complete lymphodepletion or complete lymphodepletion is desired.

[0144] In some embodiments, the CARs provided herein further comprise a "hinge" or "stalk" domain, which may be located between the extracellular ligand-binding domain and the transmembrane domain. In some embodiments, the extracellular ligand-binding domain, the transmembrane domain, and the intracellular signaling domain are in one polypeptide, i.e., in a single chain. Multi-chain CARs and polypeptides are also provided herein. In some embodiments, the multi-chain CAR contains a first polypeptide comprising a transmembrane domain and at least one extracellular ligand-binding domain, and a second polypeptide comprising a transmembrane domain and at least one intracellular signaling domain, where the polypeptides are assembled together to form the multi-chain CAR. In some embodiments, the CAR is inducible, such as by a small molecule (e.g., AP1903) or a protein (e.g., Epo, Tpo, or PD-1). In some embodiments, the CD70-specific multi-chain CAR is based on the high affinity receptor for IgE (FcεRI). FcεRI, expressed on mast cells and basophils, induces allergic reactions. FcεRI is a tetrameric complex composed of a single α subunit, a single β subunit, and two disulfide-linked γ subunits. The α subunit contains the IgE binding domain. The β and γ subunits contain ITAMs that mediate signal transduction. In some embodiments, the extracellular domain of the FcRα chain is deleted and replaced by a CD70-specific extracellular ligand binding domain. In some embodiments, the multi-chain CD70-specific CAR comprises an scFv that specifically binds to CD70, a CD8α hinge, and an ITAM of the FcRβ chain. In some embodiments, the CAR may or may not include an FcRγ chain.

[0145] In some embodiments, the extracellular ligand binding domain comprises an scFv containing the light chain variable (VL) and heavy chain variable (VH) regions of a monoclonal antibody specific for a target antigen (i.e., CD70), which are linked by a flexible linker. Single chain variable region fragments are generated by linking the light and / or heavy chain variable regions by using a short linking peptide (Bird et al., Science 242:423-426, 1988). One example of a linking peptide is the GS linker, which has the amino acid sequence (GGGGS)3 (SEQ ID NO: 296), which bridges approximately 3.5 nm between the carboxy terminus of one variable region and the amino terminus of the other variable region. Linkers of other sequences have been designed and used (Bird et al., 1988, supra). Other exemplary linkers can include other GS linkers, which can generally include (GGGGS)x, where x is 1, 2, 3, 4, 5 (SEQ ID NO: 604). In some embodiments, x is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or any integer less than about 20. In some embodiments, the linker is (GGGGS) 4(In some embodiments, the linker is GSTSGSGKPGSGEGSTKG (SEQ ID NO: 602), as described in Whitlow et al, Protein Eng. (1993) 6(8):989-895. Generally, the linker may be a short flexible polypeptide, generally consisting of about 20 or less amino acid residues. Furthermore, the linker may be modified for additional functions, such as, for example, attachment of drugs or attachment to a solid support. The single chain variants may be produced recombinantly or synthetically. For synthetic production of scFvs, an automated synthesizer may be used. For recombinant production of scFvs, a suitable plasmid containing a polynucleotide encoding the scFv may be introduced into a suitable host cell, either a eukaryotic cell, such as a yeast cell, a plant cell, an insect cell, or a mammalian cell, or a prokaryotic cell, such as E. coli. A polynucleotide encoding the scFv of interest may be generated by routine manipulations, such as ligation of polynucleotides. The resulting scFv can be isolated using standard protein purification techniques known in the art.

[0146] In another aspect, a CAR is provided that specifically binds CD70, wherein the CAR comprises an extracellular ligand binding domain comprising a VH region comprising VH CDR1, VH CDR2, and VH CDR3 of the VH sequence set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48; and / or a VL region comprising VL CDR1, VL CDR2, and VL CDR3 of the VL sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47. In some embodiments, the VH and VL are linked to each other by a flexible linker. In some embodiments, the flexible linker comprises the amino acid sequence set forth in SEQ ID NO:296.

[0147] In some embodiments, a CAR of the disclosure comprises an extracellular ligand binding domain having any one of the partial light chain sequences listed in Table 1 and / or any one of the partial heavy chain sequences listed in Table 1. In Table 1, the underlined sequences are the CDR sequences according to Kabat and those according to Chothia are in bold. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0148] Also provided herein are CDR portions of the extracellular ligand binding domain of a CAR against CD70, including Chothia, Kabat CDRs, and CDR contact regions. Determination of CDR regions is well within the skill of the art. It is understood that in some embodiments, the CDRs may be a combination of Kabat and Chothia CDRs (also referred to as combined CRs or extended CDRs). In some embodiments, the CDRs are Kabat CDRs. In other embodiments, the CDRs are Chothia CDRs. In other words, in embodiments having two or more CDRs, the CDRs may be either Kabat, Chothia, combined CDRs, or combinations thereof. Tables 2A-2B provide examples of CDR sequences provided herein. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 3-1] [Table 3-2] [Table 3-3]

[0149] The present disclosure encompasses modifications to CARs and polypeptides comprising the sequences shown in Tables 1 or 2A-2B, including functionally equivalent CARs with modifications that do not significantly affect their properties, as well as variants with enhanced or reduced activity and / or affinity. For example, amino acid sequences can be mutated to obtain antibodies with desired binding affinity to CD70. Modification of polypeptides is routine practice in the art and need not be described in detail herein. Examples of modified polypeptides include polypeptides with conservative substitutions of amino acid residues, polypeptides with one or more deletions or additions of amino acids that do not significantly deleteriously alter the functional activity or mature (enhance) the affinity of the polypeptide for its ligand, or polypeptides using chemical analogs.

[0150] Amino acid sequence insertions include amino- and / or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing 100 or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue or the antibody fused to an epitope tag. Other insertional variants of antibody molecules include the fusion to the N- or C-terminus of the antibody of an enzyme or a polypeptide which increases the half-life of the antibody in the blood circulation.

[0151] Substitutional variants have at least one amino acid residue in the antibody molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include the hypervariable regions, although FR changes are also contemplated. Conservative substitutions are shown under the heading of "conservative substitutions" in Table 3. If such substitutions result in a change in biological activity, more substantial changes, designated "exemplary substitutions" in Table 3 or further described below for amino acid classes, can be introduced and the products screened. [Table 4]

[0152] In some embodiments, the present disclosure provides a CD70 binding protein, e.g., a CD70 binding protein that binds to CD70 and is capable of binding to 31H1, 63B2, 40E3, 42C3, 45F11, 64F9, 72C2, 2F10, 4F11, 10H10, 17G6, 65E11, P02B10, P07D03, P08A02, P08E02, P08F08, P08G02, P12B09, P12F02, P12G07, P13F04, P15D02, P16C0

[0023] In one embodiment, the present invention provides a CD70 CAR that comprises an extracellular ligand binding domain that competes for binding to CD70 with a CAR described herein, including a CAR that comprises an extracellular domain that comprises an ScFv comprising the sequence of:

[0153] In some embodiments, the extracellular ligand binding domain that binds to CD70 (or the CD70 binding domain) comprises an scFv comprising the amino acid sequence of SEQ ID NO: 599, or an antibody, optionally as an scFv that competes for binding to CD70 with an scFv comprising the amino acid sequence of SEQ ID NO: 599. In some embodiments, the extracellular ligand binding domain that binds to CD70 (or the CD70 binding domain) comprises an scFv comprising the amino acid sequence of SEQ ID NO: 600, or an scFv that competes for binding to CD70 with an scFv comprising the amino acid sequence of SEQ ID NO: 600. In some embodiments, the extracellular ligand binding domain that binds to CD70 (or the CD70 binding domain) comprises an scFv comprising the amino acid sequence of SEQ ID NO: 370 and 371, or an scFv that competes for binding to CD70 with an scFv comprising the amino acid sequence of SEQ ID NO: 370 and 371. Methods for determining binding competition are known in the art and include, for example, ELISA or Biacore SPR assays.

[0154] In some embodiments, the CD70 binding domain comprises an anti-CD70 antibody that binds to the membrane distal portion of CD70. In some embodiments, the CD70 binding domain comprises an anti-CD70 antibody that binds to the membrane proximal portion of CD70. CD70 structural analysis can be found, for example, in Liu et al., 2021, J. Biol. Chem. Structural delineation and phase-dependent activation of the costimulatory CD27:CD70 complex. 297(4):101102.

[0155] In some embodiments, the disclosure provides a CAR that specifically binds to CD70, wherein the CAR comprises a VH region comprising the sequence set forth in SEQ ID NO:20 and / or a VL region comprising the sequence set forth in SEQ ID NO:19. In some embodiments, the disclosure provides a CAR that specifically binds to CD70, wherein the CAR comprises a VH region comprising the sequence set forth in SEQ ID NO:22 and / or a VL region comprising the sequence set forth in SEQ ID NO:21. In some embodiments, the disclosure provides a CAR that specifically binds to CD70, wherein the CAR comprises a VH region comprising the sequence set forth in SEQ ID NO:28 and / or a VL region comprising the sequence set forth in SEQ ID NO:27. In some embodiments, the disclosure provides a CAR that specifically binds to CD70, wherein the CAR comprises a VH region comprising the sequence set forth in SEQ ID NO:36 and / or a VL region comprising the sequence set forth in SEQ ID NO:35. In some embodiments, a CAR is provided herein that specifically binds to CD70, wherein the CAR comprises a VH region comprising the sequence set forth in SEQ ID NO:46 and / or a VL region comprising the sequence set forth in SEQ ID NO:45. In some embodiments, a CAR is provided herein that specifically binds to CD70, the CAR comprising a VH region comprising the sequence set forth in SEQ ID NO: 18 and / or a VL region comprising the sequence set forth in SEQ ID NO: 17. In some embodiments, a CAR is provided herein that specifically binds to CD70, the CAR comprising a VH region comprising the sequence set forth in SEQ ID NO: 34 and / or a VL region comprising the sequence set forth in SEQ ID NO: 33. In some embodiments, the present disclosure also provides a CAR comprising a CDR portion of an antibody based on the CDR contact regions to a CD70 antibody. A CDR contact region is a region of an antibody that confers specificity to an antigen. In general, a CDR contact region includes residue positions in the CDRs and Vernier zone that are constrained to maintain the appropriate loop structure for the antibody to bind to a particular antigen. See, e.g., Makabe et al., J.Biol. Chem., 283:1156-1166, 2007. Determining CDR contact regions is well within the skill of the art.

[0156] The binding affinity (KD) of the ligand-binding domain of a CD70-specific CAR described herein for CD70 (e.g., human CD70) can be, for example, about 0.1 to about 1000 nM, for example, about 0.5 nM to about 500 nM, or for example, about 1 nM to about 250 nM. In some embodiments, the binding affinity is about any of 1000 nm, 750 nm, 500 nm, 400 nm, 300 nm, 250 nm, 200 nM, 100 nM, 90 nM, 80 nM, 70 nM, 60 nM, 50 nM, 45 nM, 40 nM, 35 nM, 30 nM, 25 nM, 20 nM, 19 nm, 18 nm, 17 nm, 16 nm, 15 nM, 10 nM, 8 nM, 7.5 nM, 7 nM, 6.5 nM, 6 nM, 5.5 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.5 nM, 0.3 nM, or 0.1 nM.

[0157] In some embodiments, the binding affinity (KD) of the scFv of the ligand binding domain of a CD70-specific CAR described herein for CD70 is about 10 nM to about 100 nM, about 10 nM to about 90 nM, about 10 nM to about 80 nM, about 20 nM to about 70 nM, about 25 nM to about 75 nM, or about 40 nM to about 110 nM. In some embodiments, the binding affinity of the scFv described in this paragraph is for human CD70.

[0158] In some embodiments, the binding affinity is less than about any of 1000 nm, 900 nm, 800 nm, 250 nM, 200 nM, 100 nM, 50 nM, 30 nM, 20 nM, 10 nM, 7.5 nM, 7 nM, 6.5 nM, 6 nM, or 5 nM.

[0159] The intracellular signaling domain of the CAR according to the present disclosure is involved in intracellular signaling following binding of the extracellular ligand binding domain to a target, resulting in activation of immune cells and immune responses. The intracellular signaling domain has the ability to activate at least one of the normal effector functions of the immune cell in which the CAR is expressed. For example, the effector function of a T cell may be a cytolytic activity or a helper activity, including cytokine secretion.

[0160] In some embodiments, the intracellular signaling domain for use in the CAR may be, for example, but not limited to, the cytoplasmic sequences of T cell receptors and co-receptors that act in concert to initiate signaling following antigen receptor engagement, as well as any derivatives or variants of these sequences, and any synthetic sequences with the same function. The intracellular signaling domain includes two distinct classes of cytoplasmic signaling sequences: sequences that initiate antigen-dependent primary activation, and sequences that act in an antigen-dependent manner to generate secondary or costimulatory signals. Primary cytoplasmic signaling sequences may contain signaling motifs known as ITAM immune receptor tyrosine-based activation motifs. ITAMs are well-defined signaling motifs found in the cytoplasmic tails of various receptors that serve as binding sites for the syk / zap70 class of tyrosine kinases. Examples of ITAMs used in the present disclosure include, by way of non-limiting example, ITAMs derived from TCRzeta, FcRgamma, FcRbeta, FcRepsilon, CD3gamma, CD3delta, CD3epsilon, CD5, CD22, CD79a, CD79b, and CD66d. In some embodiments, the intracellular signaling domain of a CAR may comprise a CD3 zeta signaling domain having an amino acid sequence having at least about 70%, at least 80%, at least 90%, 95%, 97%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 272 or 617. In some embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a domain of a costimulatory molecule.

[0161] In some embodiments, the intracellular signaling domain of a CAR of the disclosure comprises a portion of a costimulatory molecule selected from the group consisting of a fragment of 41BB (GenBank: AAA53133.) and CD28 (NP_006130.1). In some embodiments, the intracellular signaling domain of a CAR comprises an amino acid sequence that comprises at least 70%, at least 80%, at least 90%, 95%, 97%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 271 or 616. In some embodiments, the intracellular signaling domain of a CAR of the disclosure comprises an amino acid sequence that comprises at least 70%, at least 80%, at least 90%, 95%, 97%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 271 or 616, and / or at least 70%, at least 80%, at least 90%, 95%, 97%, or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 276.

[0162] CARs are expressed on the surface membrane of cells. Thus, CARs can contain a transmembrane domain. Suitable transmembrane domains of the CARs disclosed herein include (a) in some embodiments, e.g., T helper (T h ) cells, cytotoxic T (T c ) cells, T regulatory (T reg(b) capable of being expressed on the surface of a cell, which may be an immune cell, such as a lymphoid cell, such as a leukocyte (IL-1) cell, or a lymphoid cell, such as a natural killer (NK) cell, and / or (b) capable of interacting with a ligand binding domain and an intracellular signaling domain to induce a cellular response in order to direct the cellular response of the immune cell against a predefined target cell. The transmembrane domain may be derived from either natural or synthetic sources. The transmembrane domain may be derived from any membrane-bound or transmembrane protein. As non-limiting examples, the transmembrane polypeptide may be a sequence or subunit of a T-cell receptor, such as the α, β, γ, or δ polypeptides constituting the CD3 complex, the IL-2 receptor p55 (α chain), p75 (β chain), or γ chain, an Fc receptor, particularly a subunit chain of the Fcγ receptor III, or a CD protein. Alternatively, the transmembrane domain may be synthetic and may comprise primarily hydrophobic residues, such as leucine and valine. In some embodiments, the aforementioned transmembrane domain is derived from the human CD8 α chain (e.g., NP_001139345.1). The transmembrane domain may further contain a stalk domain between the extracellular ligand binding domain and said transmembrane domain. The stalk domain may comprise up to 300 amino acids, in some embodiments 10-100 amino acids, or in some embodiments 25-50 amino acids. The stalk region may be derived from all or a portion of a naturally occurring molecule, such as all or a portion of the extracellular region of CD8, CD4, CD28, 4-1BB, or IgG (particularly the hinge region of IgG), or all or a portion of an antibody heavy chain constant region. Alternatively, the stalk domain may be a synthetic sequence that corresponds to a naturally occurring stalk sequence, or may be a synthetic stalk sequence in its entirety. In some embodiments, the stalk domain is a portion of the human CD8 α chain (e.g., NP_001139345.1). In another specific embodiment, the hinge and transmembrane domain comprises a portion of the human CD8 alpha chain that, in some embodiments, comprises at least 70%, at least 80%, at least 90%, 95%, 97%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 268 and 270.In some embodiments, the stalk domain of the CARs described herein comprises a subsequence of CD8α, IgG1, or FcγRIIIα, particularly the hinge region of either CD8α, IgG1, or FcγRIIIα. In some embodiments, the stalk domain comprises a human CD8α hinge, a human IgG1 hinge, or a human FcγRIIIα hinge, and in some embodiments, the CARs disclosed herein may comprise an extracellular ligand binding domain that specifically binds to CD70. In some embodiments, the CARs disclosed herein comprise an scFv, a CD8α human hinge and transmembrane domain, a CD3ζ signaling domain, and a 4-1BB signaling domain.

[0163] Table 4 provides exemplary sequences of domains that can be used in the CARs disclosed herein. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5]

[0164] Downregulation or mutation of target antigens is commonly seen in cancer cells, generating antigen loss avoidance variants. Thus, to counteract tumor evasion and make immune cells more specific in their targets, CD70-specific CARs may contain one or more additional extracellular ligand binding domains that simultaneously bind to different elements in the target, thereby enhancing immune cell activation and function. In some embodiments, the extracellular ligand binding domains may be arranged in tandem on the same transmembrane polypeptide, optionally separated by a linker. In some embodiments, the different extracellular ligand binding domains may be arranged on different transmembrane polypeptides that make up the CAR. In some embodiments, the disclosure relates to a population of CARs, each of which comprises a different extracellular ligand binding domain. In particular, the disclosure relates to a method of engineering an immune cell, comprising providing an immune cell and expressing a population of CARs on the surface of the cell, each of which comprises a different extracellular ligand binding domain. In another particular embodiment, the disclosure relates to a method of engineering an immune cell, comprising providing an immune cell and introducing into the cell a cellular polynucleotide encoding a polypeptide that constitutes a population of CARs, each of which comprises a different extracellular ligand binding domain. A population of CARs refers to at least two, three, four, five, six or more CARs, each of which contains a different extracellular ligand binding domain. The different extracellular ligand binding domains according to the present disclosure can, in some embodiments, simultaneously bind to different elements in a target, thereby enhancing the activation and function of the immune cell. The present disclosure also relates to an isolated immune cell comprising a population of CARs, each of which contains a different extracellular ligand binding domain.

[0165] In another aspect, the disclosure provides a polynucleotide encoding any of the CARs and polypeptides described herein. Polynucleotides can be made and expressed by procedures known in the art.

[0166] In another aspect, the present disclosure provides a composition (such as a pharmaceutical composition) comprising any of the cells of the present disclosure. In some embodiments, the composition comprises a cell comprising a polynucleotide encoding any of the CARs described herein. In yet other embodiments, the composition comprises any or both of the polynucleotides set forth in the following: SEQ ID NO:297 and SEQ ID NO:298, SEQ ID NO:299 and SEQ ID NO:300, SEQ ID NO:301 and SEQ ID NO:302, SEQ ID NO:303 and SEQ ID NO:304, SEQ ID NO:305 and SEQ ID NO:306, SEQ ID NO:307 and SEQ ID NO:308, or SEQ ID NO:309 and SEQ ID NO:310. 4F11 heavy chain variable region CAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGTAATGCTAGAATGGGTGTGACCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACGAAAAAATCCTACAGTACA TCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACTTCCAAAACCCAGGTGGTCCTTACCATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATACGAGATTACTATGACATTAGTAGTTATTATGACTACTGGGCCAGGGAACCCTGGTCAGCGTCTCCTCA (SEQ ID NO: 297) 4F11 light chain variable region GACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGACATTAGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCGCCTGATCTATGCTGCATCCAGTTTGCAA AGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCGGGGACAGAATTCACTCTCACAATCAGCAGCCTGCTGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCTTAATAGTTTCCCGTTCACTTTTGGCGGAGGGACCAAGGTGGAGATCAAC (SEQ ID NO: 298)

[0167] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:299 and SEQ ID NO:300. 17G6 heavy chain variable region GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGTAGCCTCTGGATTCACCTTTAGTAGTTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAGCATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTG TGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCAGTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGGTGTGTATTACTGTGCGAGAGAAGGAGTCAACTGGGGATGGAGACTCTACTGGCACTTCGATCTCTGGGGCCGTGGAACCCTGGTCACTGTCTCCTCA (SEQ ID NO: 299) 17G6 light chain variable region GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTACAACAATAAGAACTACGTAGCTTGGTACCAGCAGAAACCAGGACAACCTCCTAACCTACTCATTTTCTGGGCATC TACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTACTACTGTCAGCAATATTATAGTACGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAA (SEQ ID NO: 300).

[0168] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:301 and SEQ ID NO:302. 10H10 heavy chain variable region GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGTCTCTGGATTCACCTTCAGTAACCATAACATACACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGATTTCATACATTAGTCGAAGTAGTAGTACCATATATTACGCA GACTCTGTGAAGGGCCGATTCACAATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGACGAAGACACGGCTGTGTATTACTGTGCGAGAGATCACGCTCAGTGGTACGGTATGGACGTTTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 301). 10H10 light chain variable region GACATCCAGATGACCCAGTCTCCATCTTCCGTGTCTGCATCGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGGTCCTGATCTATGCTGCATCCAGTTTGCAA AGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTTTCAGTTTCCCATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAA (SEQ ID NO: 302).

[0169] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:303 and SEQ ID NO:304. P07D03 Heavy chain variable region GAAGTGCAGCTTGTCCAGAGCGGAGCCGAAGTGAAGAAGCCTGGCGAGAGCCTGAAGATCAGCTGCAAGGGCTCGGATATCGCTTCACAAGTTACTGGATAGGGTGGGTGCGCCAGATGCCTGGTAAGGGACTGGAATGGATGGGCTCTATATATCCTGATGATTCCGACACACGTTATAGCCCAA GCTTTCAGGGCCAGGTCACAATCAGCGCTGACAAGAGCATCAGCACCGCCTACCTTCAGTGGTCGTCTCTGAAGGCCAGCGACACCGCAATGTACTACTGCGCCTCTAGCACAGTTGACTACCCGGGATACAGTTACTTCGACTACTGGGGCCAAGGTACACTGGTCACCGTCAGCAGC (SEQ ID NO: 303) P07D03 Light chain variable region GAGCTCCAGAGCGTGCTGACCCAGCCTCCTAGCGCAAGCGGCACCCCTGGACAGCGTGTGACAATTAGCTGTAGCGGAAGTCGTAGCAATATCGGATCAAACTATGTGTATTGGTATCAGCAATTGCCCGGTACAGCACCCAAATTGCTCATATATAGAAATAATCAGAGAC CTAGCGGAGTGCCTGATCGTTTTAGCGGTAGCAAAAGCGGCACCAGCGCATCACTGGCAATTTCAGGCCTGCGTAGCGAAGATGAGGCGGATTATTACTGTGCGAGTTGGGATGGTTCGCTGAGTGCTGTTGTGTTCGGCACCGGTACAAAACTGACCGTTCTG (SEQ ID NO: 304)

[0170] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:305 and SEQ ID NO:306. P08G02 Heavy chain variable region GAAGTGCAGCTTGTCCAGAGCGGAGCCGAAGTGAAGAAGCCTGGCGAGAGCCTGAAGATCAGCTGCAAGGGCTCGGATACACCTTTCCTTCATCATGGATAGGTTGGGTGCGCCAGATGCCTGGTAAGGGACTGGAATGGATGGGCATCATATACCCTGATACTAGCCATACCCGTTACAGCCCAAGCTTTC AGGGCCAGGTCACAATCAGCGCTGACAAGAGCATCAGCACCGCCTACCTTCAGTGGTCGTCTCTGAAGGCCAGCGACACCGCAATGTACTACTGTGCCCGTGCGAGCTATTTCGATCGTGGAACAGGGTATAGTTCTTGGTGGATGGATGTGTGGGGCCAAGGTACACTGGTCACCGTCAGCAGC (SEQ ID NO: 305) P08G02 Light chain variable region GAGCTCGATATTCAGATGACCCAGAGCCCTAGCAGCCTGAGCGCAAGCGTGGGCGATAGAGTGACCATTACCTGTAGGGCCTCACAATCCATATACGACTATTTGCACTGGTATCAGCAGAAACCCGGGAAAGCACCCAAACTGCTGATTTACGATGCTTCCAACCTAC AGAGTGGCGTTCCTTCACGTTTTAGCGGTAGCGGTTCAGGCACCGATTTCACCCTGACCATTAGCAGCCTTCAGCCCGAAGATTTCGCTACGTATTATTGCCATCATACACCACGCCGTTGTTTACATTCGGCCAGGGTACCAAAGTGGAAATCAAA (SEQ ID NO: 306)

[0171] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:307 and SEQ ID NO:308. P08F08 Heavy chain variable region GAAGTGCAGCTTGTCCAGAGCGGAGCCGAAGTGAAGAAGCCTGGCGAGAGCCTGAAGATCAGCTGCAAGGGCTCGGATACGGATTCACAAGTTATTGGATAGGTTGGGTGCGCCAGATGCCTGGTAAGGGACTGGAATGGATGGGTATCATTCATCCCGATGATAGCGACACCAAATACAGCCCAA GCTTTCAGGGCCAGGTCACAATCAGCGCTGACAAGAGCATCAGCACCGCCTACCTTCAGTGGTCGTCTCTGAAGGCCAGCGACACCGCAATGTACTACTGTGCCTCTAGCTATTTGCGTGGCTTGTGGGGAGGCTATTTTGACTATTGGGGCCAAGGTACACTGGTCACCGTCAGCAGC (SEQ ID NO: 307) P08F08 Light chain variable region GAGCTCCAGAGCGTGCTGACCCAGCCTCCTAGCGCAAGCGGCACCCCTGGACAGCGTGTGACAATTAGCTGTAGCGGATCAAGCTCAAACATTGGCTCAAATTATGTGAATTGGTATCAGCAATTGCCCGGTACAGCACCCAAACTGCTCATTTATGGAGATTATCAACGACCT AGCGGAGTGCCTGATCGTTTTAGCGGTAGCAAAAGCGGCACCAGCGCATCACTGGCAATTTCAGGCCTGCGTAGCGAAGATGAGGCGGATTATTACTGTGCTACCCGCGACGATTCGTTATCTGGGTCTGTCGTTTTTGGCACCGGTACAAAACTGACCGTGCTG (SEQ ID NO: 308)

[0172] In yet other embodiments, the composition comprises either or both of the following polynucleotides set forth in SEQ ID NO:309 and SEQ ID NO:310. P15D02 heavy chain variable region GAAGTGCAGCTTGTCCAGAGCGGAGCCGAAGTGAAGAAGCCTGGCGAGAGCCTGAAGATCAGCTGCAAGGGCTCGGATACAGTTTTGCCTCATACTGGATCGGTTGGGTGCGCCAGATGCCTGGTAAGGGACTGGAATGGATGGGCGTAATTTACCCCGGAACTAGCGAGACACGTTACAGCCCAA GCTTTCAGGGCCAGGTCACAATCAGCGCTGACAAGAGCATCAGCACCGCCTACCTTCAGTGGTCGTCTCTGAAGGCCAGCGACACCGCAATGTACTACTGCGCTAAAGGGTTGAGTGCGAGTGCAAGTGGATATTTCTTTCCAATATTGGGGCCAAGGTACACTGGTCACCGTCAGCAGC (SEQ ID NO: 309) P15D032 light chain variable region GAGCTCGATATTCAGATGACCCAGAGCCCTAGCAGCCTGAGCGCAAGCGTGGGCGATAGAGTGACCATTACCTGTAGGGCCTCACAAAGCATCGACACATATTTAAACTGGTATCAGCAGAAACCCGGGAAAGCACCCAAACTGCTGATTTATTCAGCTAGTAGCCTAC ACAGTGGCGTTCCTTCACGTTTTAGCGGTAGCGGTTCAGGCACCGATTTCACCCTGACCATTAGCAGCCTTCAGCCCGAAGATTTCGCTACGTATTATTGCCAACAATCATACAGCACAACTGCTTGGACATTCGGCCAGGGTACCAAAGTGGAAATCAAA (SEQ ID NO: 310)

[0173] Expression vectors and administration of the polynucleotide compositions are further described herein.

[0174] In another aspect, the disclosure provides a method of making any of the polynucleotides described herein.

[0175] Polynucleotides complementary to any such sequences are also encompassed by the present disclosure. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include hnRNA molecules, which contain introns and correspond one-to-one to DNA molecules, and mRNA molecules, which do not contain introns. Additional coding or non-coding sequences may, but need not, be present within the polynucleotides of the present disclosure, and polynucleotides may, but need not be, linked to other molecules and / or supporting materials.

[0176] The polynucleotide may comprise a native sequence (i.e., an endogenous sequence encoding an antibody or a portion thereof) or may comprise a variant of such a sequence. A polynucleotide variant contains one or more substitutions, additions, deletions, and / or insertions such that the immunoreactivity of the encoded polypeptide is not reduced as compared to the native immunoreactive molecule. The effect on the immunoreactivity of the encoded polypeptide may generally be assessed as described herein. Embodiments of variants exhibit at least about 70% identity, at least about 80% identity, at least about 90% identity, or at least about 95% identity to a polynucleotide sequence encoding a native antibody or portion thereof.

[0177] Two polynucleotide or polypeptide sequences are said to be "identical" if the sequences of nucleotides or amino acids in the two sequences are the same when aligned for maximum correspondence as described below. Comparison between two sequences is typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. As used herein, a "comparison window" refers to a segment of at least about 20, usually 30 to about 75, or 40 to about 50 contiguous positions, and a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

[0178] Optimal alignment of sequences for comparison can be performed using the Megalign program of the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wl) using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, MO, 1978, A model of evolutionary change in proteins-Matrices for detecting distant relationships. In Dayhoff, MO (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3, pp. 345-358; Hein J., 1990, Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, CA; Higgins, DG and Sharp, PM, 1989, CABIOS 5: 151-153; Myers, EW and Muller W., 1988, CABIOS 4:11-17, Robinson, ED, 1971, Comb. Theor. 11:105, Santou, N., Nes, M., 1987, Mol. Biol. Francisco, CA, Wilbur, W Jand Lipman, DJ, 1983, Proc. Natl. Acad. Sci. USA 80:726-730.

[0179] "Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window of at least 20 positions, where the portion of the polynucleotide or polypeptide sequence within the comparison window may contain up to 20 percent, usually 5-15 percent, or 10-12 percent additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where an identical nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size), and multiplying the result by 100 to obtain the percentage of sequence identity.

[0180] Variants may also, or alternatively, be substantially homologous to a native gene, or a portion or complement thereof. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA sequence encoding a native antibody (or a complementary sequence).

[0181] Preferred "moderately stringent conditions" include a prewash in a solution of 5x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization overnight in 5x SSC at 50°C to 65°C, followed by two washes for 20 minutes each in 2x, 0.5x, and 0.2x SSC containing 0.1% SDS at 65°C.

[0182] As used herein, "highly stringent conditions" or "high stringency conditions" refers to (1) low ionic strength and high temperature for washing, e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50° C., and (2) the use of a denaturing agent such as formamide during hybridization, e.g., 50% (v / v) formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (3) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (4) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (5) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (6) the use of a denaturing agent such as formamide in 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate, and (7) or (3) 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes in 0.2×SSC (sodium chloride / sodium citrate) at 42° C. and 50% formamide at 55° C., followed by a high stringency wash consisting of 0.1×SSC containing EDTA at 55° C. One of skill in the art will know how to adjust temperature, ionic strength, etc. as necessary to accommodate factors such as probe length.

[0183] It will be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that code for the polypeptides described herein. Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. Nevertheless, polynucleotides that differ due to differences in codon usage are specifically contemplated by this disclosure. Additionally, alleles of genes comprising the polynucleotide sequences provided herein are within the scope of this disclosure. An allele is an endogenous gene that is altered as a result of one or more mutations, such as deletions, additions, and / or substitutions of nucleotides. The resulting mRNA and protein may, but need not, have an altered structure or function. Alleles can be identified using standard techniques, such as hybridization, amplification, and / or database sequence comparison.

[0184] The polynucleotide of the present disclosure can be obtained by chemical synthesis, recombinant methods, or PCR.Methods of chemical polynucleotide synthesis are well known in the art and do not need to be described in detail herein.Those skilled in the art can use the sequences provided herein and commercially available DNA synthesis equipment to produce desired DNA sequences.

[0185] To prepare a polynucleotide using recombinant methods, as further discussed herein, a polynucleotide containing a desired sequence can be inserted into a suitable vector, and the vector can be introduced into a suitable host cell for replication and amplification. The polynucleotide can be inserted into the host cell by any means known in the art. The cell is transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, F-mating, or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or can be integrated into the host cell genome. The polynucleotide thus amplified can be isolated from the host cell by methods well known in the art. See, for example, Sambrook et al., 1989.

[0186] Alternatively, PCR allows the reproduction of DNA sequences. PCR technology is well known in the art and is described in U.S. Patent Nos. 4,683,195, 4,800,159, 4,754,065, and 4,683,202, and in PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston, 1994.

[0187] RNA can be obtained by using the isolated DNA in an appropriate vector and inserting it into a suitable host cell. When the cell replicates and the DNA is transcribed into RNA, the RNA can be isolated using methods well known to those skilled in the art, for example, as described in Sambrook et al., 1989 (see above).

[0188] A suitable cloning vector may be constructed according to standard techniques or may be selected from a large number of cloning vectors available in the art. The cloning vector selected may vary depending on the host cell intended to be used, but useful cloning vectors generally have the ability to replicate autonomously, may have a single target for a specific restriction endonuclease, and / or may carry a marker gene that can be used to select clones containing the vector. Suitable examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Strategene, and Invitrogen.

[0189] An expression vector is generally a replicable polynucleotide construct containing a polynucleotide according to the present disclosure. It is implied that an expression vector must be replicable in a host cell, either as an episome or as an integral part of chromosomal DNA. Suitable expression vectors include, but are not limited to, plasmids, viral vectors including adenoviruses, adeno-associated viruses, retroviruses, cosmids, and expression vectors disclosed in WO 87 / 04462, and the lentiviral pLVX vector available from Clonetech. Vector components may generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, suitable transcriptional control elements (such as promoters, enhancers, and terminators). For expression (i.e., translation), one or more translational control elements are also usually required, such as a ribosome binding site, a translation initiation site, and a stop codon.

[0190] A vector containing a polynucleotide of interest can be introduced into a host cell by any of a number of suitable means, including electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other agents, microprojectile bombardment, lipofection, and infection (e.g., where the vector is an infectious agent such as vaccinia virus). The choice of introduction vector or polynucleotide often depends on the characteristics of the host cell.

[0191] A polynucleotide encoding a CD70-specific CAR disclosed herein can be present in an expression cassette or expression vector (e.g., a plasmid for introduction into a bacterial host cell, or a viral vector such as a baculovirus vector for transfection of an insect host cell, or a plasmid or viral vector such as a lentivirus for transfection of a mammalian host cell). In some embodiments, the polynucleotide or vector can include a nucleic acid sequence encoding a ribosomal skipping sequence, such as, but not limited to, a sequence encoding a 2A peptide. The 2A peptide identified in the aphthovirus subgroup of picornaviruses causes the ribosomal "skip" from one codon to the next without the formation of a peptide bond between the two amino acids encoded by the codon (see (Donnelly and Elliott 2001; Atkins, Wills et al. 2007; Doronina, Wu et al. 2008)). By "codon" is meant three nucleotides on an mRNA (or on the sense strand of a DNA molecule) that are translated by the ribosome into one amino acid residue. Thus, two polypeptides can be synthesized from a single adjacent open reading frame within an mRNA if the polypeptides are separated by an in-frame 2A oligopeptide sequence. Such ribosomal skipping mechanisms are well known in the art and are known to be used by several vectors for the expression of several proteins encoded by a single messenger RNA.

[0192] To direct the transmembrane polypeptide to the secretory pathway of the host cell, in some embodiments, a secretory signal sequence (also known as a leader sequence, prepro sequence, or pre sequence) is provided in the polynucleotide sequence or vector sequence. The secretory signal sequence is operably linked to the transmembrane nucleic acid sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide to the secretory pathway of the host cell. Secretory signal sequences are generally positioned 5' to the nucleic acid sequence encoding the polypeptide of interest, although certain secretory signal sequences may be positioned elsewhere in the nucleic acid sequence of interest (see, e.g., Welch et al., U.S. Pat. No. 5,037,743; Holland et al., U.S. Pat. No. 5,143,830). In some embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 266 or 277. Those skilled in the art will recognize that considerable sequence variation is possible among these polynucleotide molecules, given the degeneracy of the genetic code. In some embodiments, the nucleic acid sequences of the present disclosure are codon-optimized for expression in mammalian cells, or in some embodiments, for expression in human cells. Codon optimization refers to replacing codons that are generally rare in highly expressed genes of a given species with codons that are generally frequent in highly expressed genes of such species in a sequence of interest, such that such codons code for the amino acid as the replaced codon.

[0193] Immune cells containing or functionally expressing CD70 binding proteins and methods of use thereof - Patents.com Provided herein are engineered immune cells that contain or functionally express a CD70 binding protein, e.g., a CD70 CAR described herein, and methods of use thereof.

[0194] In one aspect, the disclosure provides a method of lymphodepletion in a patient in need thereof, comprising administering to the patient engineered immune cells that comprise or functionally express a CD70 binding protein, wherein the engineered immune cells inhibit the proliferation and / or activity of CD70 positive cells in the patient. In some embodiments, the engineered immune cells are derived or developed or prepared from peripheral blood mononuclear cells (PBMCs), T cells, NK cells, monocytes or macrophages, or a mixture thereof, or derived or developed or prepared from iPSCs. In some embodiments, the engineered immune cells are autologous or allogeneic to the patient. In some embodiments, the patient has or is predicted to have a host-versus-graft rejection or host-versus-graft reaction. In some embodiments, the patient requires a transplant, including but not limited to a bone marrow transplant, stem cell transplant, or tissue transplant, and the transplant shows longer persistence or more resistance to host rejection in the patient compared to a control not administered the engineered immune cells. In some embodiments, the patient is undergoing adoptive cell therapy, and optionally, the adoptive cell therapy is chimeric antigen receptor (CAR) T cell therapy. In some embodiments, the patient is undergoing allogeneic CAR T therapy.

[0195] In some embodiments, administering the engineered immune cells disclosed herein, or administering a population of cells comprising such engineered immune cells disclosed herein, reduces host rejection in a patient, e.g., of a transplant or adoptive cell therapy, compared to a control receiving comparable but unengineered cells, or a comparable population not including such engineered cells. In some embodiments, engineered immune cells comprising or functionally expressing a CD70 binding protein as described herein are administered to a patient in conjunction with (e.g., before, simultaneously with, or after) one or more lymphodepleting agents, and optionally, a portion of the lymphodepleting agent may be removed or administered at a lower level than in a patient not receiving the engineered immune cells as described herein. In some embodiments, the one or more lymphodepleting agents are chemotherapeutic agents or antibodies. In some embodiments, the one or more lymphodepleting agents are fludarabine, cyclophosphamide, or an anti-CD52 antibody, e.g., alemtuzumab.

[0196] In certain embodiments, the engineered immune cells comprise or functionally express an additional antigen binding domain specific for a target of interest, optionally the antigen binding domain comprises an antibody that binds to the target of interest. In some embodiments, one protein comprises an additional antigen binding domain and a CD70 binding protein, the additional antigen binding domain comprises an antibody that binds to the target of interest, optionally the additional antigen binding domain comprises an scFv. In some embodiments, the additional antigen binding protein is expressed as a separate protein from the CD70 binding protein. In some embodiments, engineered immune cells comprising or functionally expressing a CD70 binding protein as described herein are administered to a patient in conjunction with (e.g., before, simultaneously with, or after) one or more lymphodepleting agents, advantageously a portion of which may be removed or administered at a lower level than a control that has not received the engineered immune cells as described herein.

[0197] CD70-specific antibodies and methods for producing same Provided herein are CD70 antibodies.

[0198] In some embodiments, a CD70 antibody of the disclosure comprises any one of the partial light chain sequences listed in Table 1 and / or any one of the partial heavy chain sequences listed in Table 1. In Table 1, the underlined sequences are the CDR sequences according to Kabat and those according to Chothia are in bold.

[0199] Tables 2A-2B provide examples of CDR sequences for the CD70 antibodies provided herein.

[0200] In some embodiments, the disclosure provides antibodies (including antibody fragments, such as, for example, single chain variable fragments (scFv) that specifically bind to cluster of differentiation 70 (CD70), the antibodies comprising: (a) (i) SEQ ID NOs: 49, 50, 51, 55, 56, 57, 61, 62, 63, 67, 68, 69, 73, 74, 75, 79, 80, 81, 85, 86, 87, 91, 92, 93, 97, 98, 99, 103, 104, 105, 109, 110, 111, 115, 116, 117, 121, 122, 123, 127, 128, 129, 133, 134, 135, 139, 140, 141, 145, 146, 147, 151, 152, 153, 157, 158, 159, 163, 164, 165, 169, 170, 171, 175, 176, 177, 18 1, 182, 183, 187, 188, 189, 382, ​​383, 384, 388, 389, 390, 394, 395, 396, 400, 401, 402, 406, 407, 408, 412, 413, 414, 418, 419, 420, 424, 425, 426, 430, 431, 432, 607, 608, 609, 436, 437, 438, 442, 443, 444 a VH complementarity determining region 1 (CDR1) comprising the sequence set forth in any one of the following: 4, 448, 449, 450, 454, 455, 456, 460, 461, 462, 466, 467, 468, 472, 473, 474, 478, 479, 480, 484, 485, 486, 490, 491, 492, 496, 497, 498, 502, 503, 504, 508, 509, or 510;(ii) SEQ ID NOs: 52, 53, 58, 59, 64, 65, 70, 71, 76, 77, 82, 83, 88, 89, 94, 95, 100, 101, 106, 107, 112, 113, 118, 119, 124, 125, 130, 131, 136, 137, 142, 143, 148, 149, 154, 155, 160, 161, 166, 167, 172, 173, 178, 179, 184, 185, 190, 191, 385, 386 , 391, 392, 397, 398, 403, 404, 409, 410, 415, 416, 421, 422, 427, 428, 433, 434, 610, 661, 439, 440, 445, 446, 451, 452, 457, 458, 463, 464, 469, 470, 475, 476, 481, 482, 487, 488, 493, 494, 499, 500, 505, 506, 511, or 512. CDR2; and iii) a VH comprising the sequence set forth in SEQ ID NO: 54, 60, 66, 72, 78, 84, 90, 96, 102, 108, 114, 120, 126, 132, 138, 144, 150, 156, 162, 168, 174, 180, 186, 192, 387, 393, 399, 405, 411, 417, 423, 429, 435, 612, 441, 447, 453, 459, 465, 471, 477, 483, 489, 495, 501, 507, or 513. a heavy chain variable (VH) region comprising a CDR3; and / or (i) a VL CDR1 comprising the sequence set forth in SEQ ID NO: 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 235, 238, 241, 244, 247, 250, 253, 256, 259, 262, 514, 517, 520, 523, 526, 529, 532, 535, 538, 613, 541, 544, 547, 550, 553, 556, 559, 562, 565, 568, 571, 574, or 577;(ii) a VL comprising the sequence set forth in SEQ ID NO: 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 239, 242, 245, 248, 251, 254, 257, 260, 263, 515, 518, 521, 524, 527, 530, 533, 536, 539, 614, 542, 545, 548, 551, 554, 557, 560, 563, 566, 569, 572, 575, or 578 and (iii) a light chain variable (VL) region comprising a VL CDR3 comprising the sequence set forth in SEQ ID NO: 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 516, 519, 522, 525, 528, 531, 534, 537, 540, 615, 543, 546, 549, 552, 555, 558, 561, 564, 567, 570, 573, 576, or 579;

[0201] In some embodiments, the disclosure provides an antibody (e.g., scFv) that specifically binds cluster of differentiation 70 (CD70), the antibody comprising a VH CDR1, a VH CDR2, and a VH CDR3 of the VH sequence set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 339, 341, 343, 345, 347, 349, 351, 353, 355, 606, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, or 381. and / or a light chain variable (VL) region comprising a VL CDR1, a VL CDR2, and a VL CDR3 of the VL sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 338, 340, 342, 344, 346, 348, 350, 352, 354, 605, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, or 380.

[0202] In some embodiments, the disclosure provides an isolated antibody that specifically binds to CD70 and competes with any of the aforementioned antibodies.

[0203] In some embodiments, the present invention provides a method for the preparation of antibodies that bind to CD70 and are selected from the group consisting of 31H1, 63B2, 40E3, 42C3, 45F11, 64F9, 72C2, 2F10, 4F11, 10H10, 17G6, 65E11, P02B10, P07D03, P08A02, P08E02, P08F08, P08G02, P12B09, P12F02, P12G07, P1 Antibodies that compete with the antibodies described herein are provided, including 3F04, P15D02, P16C05, 10A1, 10E2, 11A1, 11C1, 11D1, 11E1, 12A2, 12C4, 12C5, 12D3, 12D6, 12D7, 12F5, 12H4, 8C8, 8F7, 8F8, 9D8, 9E10, 9E5, 9F4 or 9F8.

[0204] In some embodiments, the present invention also provides the CDRs of an antibody to a CD70 antibody based on the CDR contact regions. CDR contact regions are regions of an antibody that confer specificity to an antigen to the antibody. In general, CDR contact regions include residue positions in the CDRs and Vernier zones that are constrained to maintain the proper loop structure for the antibody to bind to a particular antigen. See, e.g., Makabe et al., J.Biol.Chem., 283:1156-1166, 2007. Determining CDR contact regions is well within the skill of the art.

[0205] The binding affinity (K D) may be about 0.001 to about 5000 nM. In some embodiments, the binding affinity is approximately: 5000nM, 4500nM, 4000nM, 3500nM, 3000nM, 2500nM, 2000nM, 1789nM, 1583nM, 1540nM, 1500nM, 1490nM, 1064nM, 1000nM, 933nM, 894nM, 750nM, 705nM, 678nM, 532nM, 500nM, 494nM, 400nM, 349nM, 340nM, 353nM, 300nM, 250nM, 244nM, 231nM, 225nM, 207nM, 200nM, 186nM, 172nM , 136nM, 113nM, 104nM, 101nM, 100nM, 90nM, 83nM, 79nM, 74nM, 54nM, 50nM, 45nM, 42nM, 40nM, 35nM, 32nM, 30nM, 25nM, 24nM, 22nM, 20nM, 19nM, 18nM, 17nM, 16nM, 15nM, 12nM, 10nM, 9nM, 8nM, 7.5nM, 7nM, 6.5nM, 6nM, 5.5nM, 5nM, 4nM, 3nM, 2nM, 1nM, 0.5nM, 0.3nM, 0.1nM, 0.01nM, or 0.001nM. In some embodiments, the binding affinity is less than about any of: 5000nM, 4000nM, 3000nM, 2000nM, 1000nM, 900nM, 800nM, 250nM, 200nM, 100nM, 50nM, 30nM, 20nM, 10nM, 7.5nM, 7nM, 6.5nM, 6nM, 5nM, 4.5nM, 4nM, 3.5nM, 3nM, 2.5nM, 2nM, 1.5nM, 1nM, or 0.5nM.

[0206] In some embodiments, the disclosure provides a nucleic acid encoding any of the aforementioned isolated antibodies. In some embodiments, the disclosure provides a vector comprising such a nucleic acid. In some embodiments, the disclosure provides a host cell comprising such a nucleic acid.

[0207] The disclosure further provides any of the aforementioned antibodies for use as a medicament. In some embodiments, the medicament is for use in treating a CD70-associated cancer selected from the group consisting of renal cell carcinoma, glioblastoma, glioma such as low-grade glioma, non-Hodgkin's lymphoma (NHL), Hodgkin's disease (HD), Waldenstrom's hypergammaglobulinemia, acute myeloid leukemia, multiple myeloma, diffuse large cell lymphoma, follicular lymphoma, or non-small cell lung cancer.

[0208] In some embodiments, the disclosure provides a method of treating a subject in need thereof comprising providing any of the aforementioned antibodies and administering the antibody to the subject.

[0209] In some embodiments, the disclosure provides a pharmaceutical composition comprising any of the aforementioned antibodies.

[0210] In some embodiments, the present disclosure provides a method of treating a condition associated with malignant cells expressing CD70 in a subject, comprising administering to a subject in need thereof an effective amount of any one of the aforementioned antibodies or a pharmaceutical composition comprising any one of the aforementioned antibodies. In some embodiments, the condition is cancer. In some embodiments, the cancer is a CD70-associated cancer selected from the group consisting of renal cell carcinoma, glioblastoma, glioma such as low-grade glioma, non-Hodgkin's lymphoma (NHL), Hodgkin's disease (HD), Waldenstrom's hypergammaglobulinemia, acute myeloid leukemia, multiple myeloma, diffuse large cell lymphoma, follicular lymphoma, or non-small cell lung cancer.

[0211] In some embodiments, the present disclosure provides a method of inhibiting tumor growth or progression in a subject having malignant cells that express CD70, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the present disclosure.

[0212] In some embodiments, the present disclosure provides a method of inhibiting metastasis of malignant cells expressing CD70 in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the present disclosure.

[0213] In some embodiments, the present disclosure provides a method of inducing tumor regression in a subject having malignant cells that express CD70, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the present disclosure.

[0214] Some embodiments include culturing a host cell of the disclosure under conditions that result in the production of the antibody, and isolating the antibody from the host cell or culture.

[0215] Antibodies useful in the present invention may include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heteroconjugate antibodies, single chain (ScFv), mutants thereof, fusion proteins containing antibody portions (e.g., domain antibodies), humanized antibodies, and any other modified configuration of an immunoglobulin molecule containing an antigen recognition site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. Antibodies may be murine, rat, human, or any other origin, including chimeric or humanized antibodies.

[0216] In some embodiments, the CD70 monospecific antibodies described herein are monoclonal antibodies, e.g., the CD70 monospecific antibodies are human monoclonal antibodies.

[0217] The present disclosure further provides the following exemplary embodiments. 1. An isolated antibody that specifically binds to cluster of differentiation 70 (CD70), (a) (i) SEQ ID NOs: 49, 50, 51, 55, 56, 57, 61, 62, 63, 67, 68, 69, 73, 74, 75, 79, 80, 81, 85, 86, 87, 91, 92, 93, 97, 98, 99, 103, 104, 105, 109, 110, 111, 115, 116, 117, 121, 122, 123, 127, 128, 129, 133, 134, 135, 139, 140, 141, 145, 146, 147, 151, 152, 153, 157, 158, 159, 163, 164, 165, 169, 170, 171, 175, 1 76, 177, 181, 182, 183, 187, 188, 189, 382, ​​383, 384, 388, 389, 390, 394, 395, 396, 400, 401, 402, 406, 407, 408, 412, 413, 414, 418, 419, 420, 424, 425, 426, 430, 431, 432, 607, 608, 609, 436, 437, 438, 442, 443, 444, 448, 449, 450, 454, 455, 456, 460, 461, 462, 466, 467, 468, 472, 473, 474, 478, 4 79, 480, 484, 485, 486, 490, 491, 492, 496, 497, 498, 502, 503, 504, 508, 509, or 510; (ii) a VH complementarity determining region (CDR1) comprising the sequence set forth in SEQ ID NO: 52, 53, 58, 59, 64, 65, 70, 71, 76, 77, 82, 83, 88, 89, 94, 95, 100, 101, 106, 107, 112, 113, 118, 119, 124, 125, 130, 131, 136, 137, 142, 143, 148, 149, 154, 155, 160, 161 , 166, 167, 172, 173, 178, 179, 184, 185, 190, 191, 385, 386, 391, 392, 397, 398, 403, 404, 409, 410, 415, 416, 421, 422, 427, 428, 433, 434, 610, 611, 439, 440, 445, 446, 451, 452, 457, 458, 463, 464, 469, 470, 475, 476, 481, 482, 487, 488, 493, 494, 499, 500, 505, 506, 511, or 512;and (iii) a heavy chain variable (VH) region comprising a VH CDR3 comprising the sequence set forth in SEQ ID NO: 54, 60, 66, 72, 78, 84, 90, 96, 102, 108, 114, 120, 126, 132, 138, 144, 150, 156, 162, 168, 174, 180, 186, 192, 387, 393, 399, 405, 411, 417, 423, 429, 435, 612, 441, 447, 453, 459, 465, 471, 477, 483, 489, 495, 501, 507, or 513; and / or (b)(i) a VL comprising the sequence set forth in SEQ ID NO: 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 235, 238, 241, 244, 247, 250, 253, 256, 259, 262, 514, 517, 520, 523, 526, 529, 532, 535, 538, 613, 541, 544, 547, 550, 553, 556, 559, 562, 565, 568, 571, 574, or 577 (ii) a VL comprising the sequence set forth in SEQ ID NO: 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 239, 242, 245, 248, 251, 254, 257, 260, 263, 515, 518, 521, 524, 527, 530, 533, 536, 539, 614, 542, 545, 548, 551, 554, 557, 560, 563, 566, 569, 572, 575, or 578. and (iii) a VL CDR3 comprising the sequence set forth in SEQ ID NO: 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 516, 519, 522, 525, 528, 531, 534, 537, 540, 615, 543, 546, 549, 552, 555, 558, 561, 564, 567, 570, 573, 576, or 579. 2. An isolated antibody that specifically binds to cluster of differentiation 70 (CD70), (a) a VH region comprising the VH CDR1, VH CDR2, and VH CDR3 of the VH sequence set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 339, 341, 343, 345, 347, 349, 351, 353, 355, 606, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, or 381; and / or (b) an antibody comprising a VL region comprising VL CDR1, VL CDR2, and VL CDR3 of the VL sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 338, 340, 342, 344, 346, 348, 350, 352, 354, 605, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, or 380. 3. An isolated antibody that specifically binds to CD70 and competes with the antibody of embodiment 1. 4. A nucleic acid encoding the antibody of any one of embodiments 1 to 3. 5. A vector comprising the nucleic acid of embodiment 4. 6. A host cell comprising the nucleic acid of embodiment 4. 7. The antibody according to any one of embodiments 1 to 3 for use as a medicament. 8. The antibody of embodiment 7, wherein the medicament is for use in the treatment of a CD70-associated cancer selected from the group consisting of renal cell carcinoma, glioblastoma, glioma such as low-grade glioma, non-Hodgkin's lymphoma (NHL), Hodgkin's disease (HD), Waldenstrom's hypergammaglobulinemia, acute myeloid leukemia, multiple myeloma, diffuse large cell lymphoma, follicular lymphoma, or non-small cell lung cancer. 9. A method of treating a subject in need thereof, comprising: a. providing an antibody according to any one of embodiments 1 to 3; and b. administering said antibody to said subject. 10. A pharmaceutical composition comprising the antibody of any one of embodiments 1 to 3. 11. A method for treating a condition associated with malignant cells expressing CD70 in a subject, comprising administering to a subject in need thereof an effective amount of an antibody of any one of embodiments 1-3 or the pharmaceutical composition of embodiment 10. 12. The method of embodiment 11, wherein the condition is cancer. 13. The method of embodiment 12, wherein the cancer is a CD70-associated cancer selected from the group consisting of renal cell carcinoma, glioblastoma, glioma such as low-grade glioma, non-Hodgkin's lymphoma (NHL), Hodgkin's disease (HD), Waldenstrom's hypergammaglobulinemia, acute myeloid leukemia, multiple myeloma, diffuse large cell lymphoma, follicular lymphoma, or non-small cell lung cancer. 14. A method for inhibiting tumor growth or progression in a subject having malignant cells expressing CD70, comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of embodiment 10. 15. A method for inhibiting metastasis of malignant cells expressing CD70 in an elephant, comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of embodiment 10 to the subject. 16. A method for inducing tumor regression in a subject having malignant cells expressing CD70, comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of embodiment 10. 17. A method of producing an antibody, comprising culturing a host cell of embodiment 6 under conditions that result in the production of the antibody, and isolating the antibody from the host cell or culture.

[0218] Treatment method The engineered immune cells, e.g., the engineered T cells described herein, optionally the engineered T cells obtained by the methods described herein, the cell lines described herein resulting from such engineered immune cells or engineered T cells, and the compositions described herein comprising such cells can be used as medicaments. In some embodiments, such medicaments can be used to treat disorders such as, for example, viral diseases, bacterial diseases, cancer, inflammatory diseases, immune diseases, or age-related diseases. In some embodiments, the cancer can be selected from the group consisting of gastric cancer, sarcoma, lymphoma (including non-Hodgkin's lymphoma), leukemia, head and neck cancer, thymic cancer, epithelial cancer, salivary gland cancer, liver cancer, stomach cancer, thyroid cancer, lung cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, leukemia, multiple myeloma, renal cell carcinoma, bladder cancer, cervical cancer, choriocarcinoma, colon cancer, oral cancer, skin cancer, and melanoma. In some embodiments, the subject is a previously treated adult subject with locally advanced or metastatic melanoma, squamous cell head and neck cancer (SCHNC), ovarian cancer, sarcoma, or relapsed or refractory classical Hodgkin lymphoma (cHL).

[0219] In some embodiments, an engineered immune cell, e.g., an engineered T cell, or a cell line derived from an engineered immune cell, e.g., an engineered T cell, according to the present disclosure may be used in the manufacture of a medicament for treating a disorder in a subject in need thereof. In some embodiments, the disorder may be, for example, cancer, an autoimmune disorder, host-versus-graft rejection, or an infectious disease.

[0220] Also provided herein are methods for treating a subject. In some embodiments, the methods include administering or providing the engineered immune cells of the present disclosure, such as engineered T cells, or a composition comprising such cells, to a subject in need thereof. In some embodiments, the methods include administering the engineered immune cells of the present disclosure, such as engineered T cells, or a composition comprising such cells, to a subject in need thereof.

[0221] In some embodiments, the engineered immune cells of the present disclosure, e.g., engineered T cells, can undergo robust in vivo cell proliferation and can persist for extended periods of time. The therapeutic methods of the present disclosure can be ameliorative, curative, or preventative. The methods of the present disclosure can be part of either an autoimmunotherapy or an allogeneic immunotherapeutic treatment. The present disclosure is particularly suitable for allogeneic immunotherapy. The engineered immune cells, e.g., engineered T cells, provided by a donor can be transformed into non-allo-reactive cells using standard protocols and regenerated as needed, thereby producing CAR-T cells, which can be administered, for example, to a subject or multiple subjects. Such CAR-T cell therapy can be made available as an allogeneic ALLO CAR T™ therapeutic product.

[0222] In another aspect, the disclosure provides a method of inhibiting tumor growth or progression in a subject having a tumor, the method comprising administering to the subject an effective amount of engineered immune cells, e.g., engineered T cells described herein. In another aspect, the disclosure provides a method of inhibiting or preventing metastasis of cancer cells in a subject, the method comprising administering to a subject in need thereof an effective amount of engineered immune cells, e.g., engineered T cells described herein. In another aspect, the disclosure provides a method of inducing tumor regression in a subject having a tumor, the method comprising administering to the subject an effective amount of engineered immune cells, e.g., engineered T cells described herein.

[0223] In some embodiments, the immune cells provided herein, such as T cells, can be administered parenterally to a subject. In some embodiments, the subject is a human.

[0224] In some embodiments, the method can further include administering an effective amount of a second therapeutic agent, e.g., crizotinib, palbociclib, an anti-CTLA4 antibody, an anti-4-1 BB antibody, a PD-1 antibody, or a PD-L1 antibody.

[0225] Also provided is the use of any of the immune cells, e.g., T cells, provided herein in the manufacture of a medicament for treating cancer or inhibiting tumor growth or progression in a subject in need thereof.

[0226] In certain embodiments, in an engineered immune cell of the present disclosure, the functional expression level of any gene that is knocked down or knocked out according to the present disclosure is reduced by, or at least by, about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% compared to the corresponding expression level in a suitable control cell. The expression level may be determined by any known method, such as FACS or MAC. In some embodiments, an engineered immune cell disclosed herein functionally expresses any gene that is knocked down or knocked out according to the present disclosure at a level of 75% or less, 50% or less, 25% or less, 10% or less, or 0% of the expression level in a suitable control cell, e.g., a non-engineered immune cell (otherwise the same as the engineered immune cell, e.g., containing the same components as the engineered immune cell). In some embodiments, both alleles of a gene are knocked out, such that the expression level of the gene in an engineered immune cell disclosed herein is 0% of that of a control cell. In some embodiments, one of the two alleles of a gene is knocked out, such that the expression level of the gene in an engineered immune cell disclosed herein is 50% or about 50% of that of a corresponding unengineered cell (e.g., where compensatory mechanisms result in greater than normal expression of the remaining allele). Intermediate expression levels may be observed, for example, when expression is reduced by some means other than knockout, as described herein.

[0227] In some embodiments, the expression levels of any genes engineered according to the present disclosure in engineered cells of the present disclosure can be measured by assaying the cells for gene products and their properties using standard techniques known to those of skill in the art (e.g., RT-qPCR, nucleic acid sequencing, antibody staining, flow cytometry, or any combination of techniques). These measurements can be compared to corresponding measurements made on comparable cells that have not been engineered to reduce the functional expression level of the corresponding gene. In a cell population that includes engineered cells, e.g., engineered immune cells of the present invention, a pooled sample of material (e.g., RNA or protein or cells) that is measured will reflect the fact that some cells do not express the gene of interest, some cells have both alleles knocked out, e.g., some cells express the gene of interest at 50% or about 50% of the unengineered level, and some cells express the gene of interest at normal levels when only one allele has been knocked out and the population includes cells that are not engineered.

[0228] In some embodiments, administering engineered cells, e.g., engineered T cells as disclosed herein, or administering a population of cells comprising such engineered immune cells, e.g., engineered T cells, reduces host rejection of the administered cell or cell population compared to comparable but non-engineered cells or a comparable population not including such engineered cells. In some embodiments, administering engineered immune cells, e.g., engineered T cells of the present disclosure, comprising an antigen binding protein, e.g., a CAR and a CD70 binding protein or a CD70 CAR, or administering a population of cells comprising such engineered immune cells, e.g., engineered T cells, reduces host rejection of the administered cell or cell population compared to comparable but non-engineered cells or a population not including such engineered cells. For example, such administration reduces host rejection by 1%-99%, e.g., by 5%-95%, 10%-90%, 50%-90%, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, compared to host rejection of identical cells but not engineered to express CD70 CAR. In some embodiments, host rejection is reduced by more than 90%.

[0229] In some embodiments, immune cells of the disclosure, in some embodiments, include an antigen binding protein, e.g., a CAR, and a CD70 binding protein, e.g., a CD70 CAR. For example, administering T cells, or administering a population of cells including such immune cells, e.g., T cells, enhances or improves persistence and / or increases the persistence of the cells compared to the persistence of identical cells, but not engineered to express a CD70 CAR. In some embodiments, the persistence is increased, e.g., by 1-7 days, by 1-12 weeks (e.g., 1-4 weeks, 4-8 weeks, or 8-12 weeks), or by 1-12 months, or by a particular length of time that falls within these ranges. In some embodiments, the difference in persistence is measured by comparing the half-life of the administered cells in the population or composition, e.g., the half-life is increased, e.g., by 1-7 days, by 1-12 weeks (e.g., 1-4 weeks, 4-8 weeks, or 8-12 weeks), or by 1-12 months, or by a particular length of time that falls within these ranges. In some embodiments, the difference in persistence is measured by comparing the length of time that the administered cells can be detected after administration. In some embodiments, the improved persistence is measured in vitro by comparing the survival of CD70 CAR and non-CD70 CAR cells in the presence of immune cells, such as T cells or NK cells, for example, at about 72 hours, 5 days, 7 days, or 13 days after mixing. In some embodiments, in such in vitro assays, the engineered cells survive about 1.5-10 times more than the unengineered cells at the time of measurement. The degree of improved persistence or survival of CD70 CAR-expressing cells depends, in part, on the level of expression of CD70 in the co-incubated (e.g., "attacking" or host) immune cells.

[0230] In some embodiments, the reduction in host rejection and / or increased persistence of the administered cells disclosed herein is determined by any of a variety of techniques known to one of skill in the art, in some embodiments, any one or combination of flow cytometry, PCR, e.g., quantitative PCR, and ex vivo co-culture with patient or recipient immune cells is used.

[0231] In some embodiments, the treatment may be in combination with one or more therapies for cancer selected from the group of antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser phototherapy, and radiation therapy.

[0232] In some embodiments, the treatment may be administered to a subject undergoing immunosuppressive therapy. Indeed, the present disclosure may rely on a cell or cell population that has been rendered resistant to at least one immunosuppressive agent due to inactivation of a gene encoding a receptor for such an immunosuppressive agent (e.g., in some embodiments, engineered immune cells administered to treat may include a CD52 knockout to avoid the action of anti-CD52 lymphodepleting antibodies such as alemtuzumab). In this aspect, the immunosuppressive therapy may assist in the selection and expansion of T cells according to the present disclosure in the subject.

[0233] Administration of cells or cell populations according to the present disclosure may be by any convenient method, including aerosol inhalation, injection, ingestion, infusion, injection, implantation, or transplantation. The compositions described herein may be administered to a subject subcutaneously, intradermally, intratumorally, intranodal, intramedullary, intramuscularly, intravenously or intralymphatically, or intraperitoneally. In one embodiment, the cell composition of the present disclosure is administered by intravenous injection.

[0234] In some embodiments, administration of cells or cell populations according to the present disclosure may be, for example, at a dose of about 10 3 Or 10 4 pieces ~ about 10 9In some embodiments, the administration of a cell or cell population can include administration of about 10 per kg of body weight of an engineered immune cell disclosed herein, including all integer values ​​of the number of cells within those ranges. ... 5 ~about 10 6 of the engineered immune cells disclosed herein (including all integer cell numbers within this range), or 0.1 x 10 engineered immune cells disclosed herein per kg of body weight. 6 ~5×10 6 or a total of 0.1×10 engineered immune cells disclosed herein 8 ~5×10 8 The administration of the cells or cell population may include administration of one or more doses. In some embodiments, an effective amount of cells may be administered as a single dose. In some embodiments, an effective amount of cells may be administered as two or more doses over a period of time. The timing of administration is within the judgment of the attending physician and depends on the clinical condition of the subject. The cells or cell population may be obtained from any source, such as a blood bank or a donor. While individual needs vary, the determination of the optimal range of effective amounts of a given cell type for a particular disease or condition is within the skill of the art. By effective amount is meant an amount that provides a therapeutic or prophylactic benefit. The dosage administered depends on the age, health, and weight of the recipient, the type of concomitant treatment, if any, frequency of treatment, and the nature of the desired effect. In some embodiments, an effective amount of the cells or a composition comprising the cells is administered parenterally. In some embodiments, administration may be intravenous. In some embodiments, administration may be by injection directly into the tumor.

[0235] In some embodiments of the present disclosure, the cells are administered to a subject in conjunction with (e.g., prior to, concurrently with, or subsequent to) any number of relevant therapeutic modalities, including, but not limited to, treatment with agents such as monoclonal antibody therapy, CCR2 antagonists (e.g., INC-8761), antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or nataliziimab treatment for MS subjects, or efaliztimab treatment for psoriasis subjects, or other treatments for PML subjects. In some embodiments, the BCMA-specific CAR-T cells are administered to the subject in combination with one or more of an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody (e.g., avelumab, atezolizumab, or durvalumab), an anti-OX40 antibody, an anti-4-1 BB antibody (e.g., Utolimumab), an anti-MCSF antibody, an anti-GITR antibody, and / or an anti-TIGIT antibody. In further embodiments, the immune cells, e.g., T cells, of the present disclosure may be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolic acid, and FK506, antibodies, or other immunoablative agents such as CAMPATH (alemtuzumab), anti-CD3 antibodies, or other antibody therapies, cytoxan, fludarabine, cyclophosphamide, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and / or irradiation. These drugs either inhibit the calcium-dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit p70S6 kinase, which is important in growth factor-induced signal transduction (rapamycin) (Henderson, Naya et al. Immunology. 1991 Jul;73(3):316-321; Liu, Albers et al. Biochemistry 1992 Apr 28;31(16):3896-901; Bierer, Hollander et al. Curr Opin Immunol. 1993 Oct;5(5):763-73).

[0236] In further embodiments, the cell composition of the present disclosure is administered to the subject in conjunction with (e.g., before, simultaneously with, or after) a T cell ablative therapy using either a bone marrow transplant, a chemotherapeutic agent such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or an antibody such as CAMPATH (alemtuzumab). In some embodiments, the cell composition of the present disclosure is administered after a B cell ablative therapy, such as an agent that reacts with CD20, e.g., Rituxan. For example, in one embodiment, the subject can receive standard treatment with high-dose chemotherapy followed by a peripheral blood stem cell transplant. In certain embodiments, after transplant, the subject receives an infusion of the expanded immune cells of the present disclosure. In some embodiments, the expanded cells are administered before or after surgery.

[0237] kit The present disclosure also provides kits for use in the methods. The kits of the present disclosure include one or more containers containing the compositions of the present disclosure, or immune cells, e.g., T cells, or cell populations including immune cells, e.g., engineered T cells, of the present disclosure. In various embodiments, the immune cells, e.g., T cells, contain one or more polynucleotide(s) encoding a first and a second antigen binding protein, e.g., a first CAR and a second CD70 CAR as described herein, and are further, optionally, engineered to express reduced levels of TRAC and / or CD52. The kits further include instructions for use with any of the methods of the present disclosure described herein. Generally, these instructions include instructions for administration of the compositions, immune cells, e.g., T cells, or cell populations described herein for the therapeutic treatments described above.

[0238] The instructions for use of the kit components generally include information regarding dosages, dosing schedules, and routes of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages), or sub-unit doses. The instructions supplied with kits of the present disclosure are typically written instructions on a label or insert (e.g., a paper sheet included with the kit), although machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.

[0239] The kit of the present disclosure is in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. Packages for use in combination with specific devices, such as inhalers, nasal administration devices (e.g., atomizers), or injection devices, such as mini-pumps, are also contemplated. The kit may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). At least one active agent in the composition is an immune cell, e.g., T cell, according to the present disclosure. The container may further comprise a second pharmacologic active agent.

[0240] The kit may optionally be provided with additional components, such as buffers and interpretive information. Typically, the kit includes a container and a label or package insert on or associated with the container.

[0241] Sorting and depletion methods In some embodiments, a method is provided for in vitro sorting of a population of immune cells, a subset of the population of immune cells comprising immune cells engineered to express one or more antigen binding proteins as described herein. In various embodiments, the method comprises contacting the population of immune cells with a monoclonal antibody specific for an epitope (e.g., a mimotope such as those described in US2018 / 0002435) unique to the engineered cells (e.g., an epitope of the antigen binding protein, or a mimotope incorporated into the antigen binding protein) and selecting immune cells that bind the monoclonal antibody to obtain a cell population enriched for engineered immune cells expressing the antigen binding protein.

[0242] In some embodiments, the monoclonal antibody specific for the epitope is optionally conjugated to a fluorophore, in which case the step of selecting cells that bind to the monoclonal antibody can be performed by fluorescence activated cell sorting (FACS).

[0243] In some embodiments, the monoclonal antibody specific for the epitope is optionally conjugated to a magnetic particle. In this embodiment, the step of selecting cells that bind to the monoclonal antibody can be performed by magnetic activated cell sorting (MACS).

[0244] In some embodiments, the mAb used in the method for sorting immune cells expressing an antigen binding protein (such as a CAR) is alemtuzumab, ibritumomab tiuxetan, muromonab-CD3, tositumomab, abciximab, basiliximab, brentuximab, Selected from vedotin, cetuximab, infliximab, rituximab, bevacizumab, certolizumab pegol, daclizumab, eculizumab, efalizumab, gemtuzumab, natalizumab, omalizumab, palivizumab, ranibizumab, tocilizumab, trastuzumab, vedolizumab, adalimumab, belimumab, canakinumab, denosumab, golimumab, ipilimumab, ofatumumab, panitumumab, QBEND-10 and / or ustekinumab. In some embodiments, the mAb is rituximab. In another embodiment, the mAb is QBEND-10.

[0245] In some embodiments, the population of CAR-expressing immune cells obtained when using the methods for in vitro sorting of CAR-expressing immune cells described above comprises at least 70%, 75%, 80%, 85%, 90%, 95% CAR-expressing immune cells. In some embodiments, the population of CAR-expressing immune cells obtained when using the methods for in vitro sorting of CAR-expressing immune cells comprises at least 85% CAR-expressing immune cells.

[0246] In some embodiments, the population of CAR-expressing immune cells obtained when using the above-mentioned in vitro sorting method of CAR-expressing immune cells exhibits increased cytotoxic activity in vitro compared to the initial (unsorted) cell population. In some embodiments, said cytotoxic activity is increased by 10%, 20%, 30%, or 50% in vitro. In some embodiments, the immune cells are T cells.

[0247] The CAR-expressing immune cells administered to the recipient can be enriched in vitro from a source population. Methods for expanding the source population can include using a combination of density centrifugation, immunomagnetic bead purification, affinity chromatography, and fluorescence-activated cell sorting to select cells that express an antigen, such as the CD34 antigen.

[0248] Flow cytometry can be used to quantify specific cell types in a cell population.Generally, flow cytometry is a method for quantifying the components or structural features of cells mainly by optical means.By quantifying structural features, different cell types can be distinguished, so that flow cytometry and cell sorting can be used to count and sort cells of different phenotypes in a mixture.

[0249] Flow cytometry analysis involves two major steps: 1) labeling a selected cell type with one or more labeling markers, and 2) determining the number of labeled cells relative to the total number of cells in a population. In some embodiments, the method of labeling a cell type involves binding a labeled antibody to a marker expressed by a particular cell type. The antibody can be directly labeled with a fluorescent compound or indirectly labeled, for example, using a fluorescently labeled second antibody that recognizes the first antibody.

[0250] In some embodiments, the method used to sort T cells expressing CAR is magnetic activated cell sorting (MACS). Magnetic activated cell sorting (MACS) is a method for separating different cell populations according to their surface antigens (CD molecules) by using superparamagnetic nanoparticles and columns. Using MACS, pure cell populations can be obtained. Cells in single cell suspension can be magnetically labeled with microbeads. The sample is applied to a column made of ferromagnetic spheres, covered with a cell-friendly coating, allowing for a fast and gentle separation of cells. Unlabeled cells pass through, while magnetically labeled cells are retained in the column. The flow-through can be collected as the unlabeled cell fraction. After a washing step, the column is removed from the separator and the magnetically labeled cells are eluted from the column.

[0251] Detailed protocols for the purification of specific cell populations, such as T cells, can be found in Basu S et al. (2010) (Basu S, Campbell HM, Dittel BN, Ray A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (41): 1546). EXAMPLES

[0252] Example 1. CD70 Dagger can prevent allogeneic rejection and improve the anti-tumor efficacy of CAR T cells. FIG. 1 shows how CD70 Dagger (or CD70 Dagger protein or CD70 binding protein) protects allogeneic CAR T cells from allogeneic rejection. Cells with CD70 Dagger can recognize CD70 on the cell surface of activated alloreactive cells. Thus, they recognize and kill any activated alloreactive cells that approach the CD70 Dagger CAR T cells (FIG. 1). Removing alloreactive cells then allows the CD70 Dagger CAR T cells to persist longer and perform tumor cell killing.

[0253] Example 2. CD70 CAR exhibits anti-rejection function against primed alloreactive T cells. Alloreactive T cells are believed to be the primary mediators of allorejection. Therefore, a primed alloreactive T cell mixed lymphocyte reaction (MLR) was performed using CD70 CAR T cells as target cells to evaluate the CD70 CAR as a potential anti-rejection dagger (CD70 dagger). The CD70 CAR tested in this experiment contains the CD70 binding domain from the anti-CD70 clone 4F11 in the form of an scFv, the CD3ζ signaling domain, and the 4-1BB costimulatory domain. Briefly, PBMCs from eight recipient donors were co-cultured with irradiated graft donor T cells for 7 days to allow for the priming and expansion of alloreactive recipient T cells ("RTC"). Primed alloreactive RTCs (effector cells) were then isolated and co-cultured with either graft donor T cell receptor alpha constant (TRAC) knockout (KO) CD70 CAR T cells or graft donor T cell receptor alpha constant (TRAC) knockout (KO) non-transduced T cells at a 1:1 ratio for 48 hours (Figure 2A). Graft donor cell killing was assessed by flow cytometry. Non-transduced control T cells (NTD) were efficiently killed by alloreactive RTCs, while the majority of CD70 CAR T cells survived in the presence of alloreactive RTCs (Figure 2B). CD70 CAR T cell survival correlated with a reduction in CD70+ RTCs (Figures 2C and 2D), indicating expression of CD70 CAR, which functions as a CD70 dagger, leading to the killing of alloreactive cells and improving the persistence of graft cells.

[0254] Example 3. Testing CD70 Dagger activity on allogeneic PBMC . To determine whether the findings from Example 2 extend to a more physiologically relevant scenario, PBMC MLR was performed using CD70 CAR T cells as target cells. Here, CD70 Dagger activity was assessed using multiple graft donors instead of recipient donors. PBMCs from recipient donors were co-cultured with graft donor TRAC KO CD70 CAR T cells generated from three different donors at a 1:1 ratio for 6 days. Recipient T cell killing was assessed by flow cytometry. The results were consistent with the findings from Example 2 in that CD70 CAR T cells acting as CD70 Daggers reduced RTC counts and frequencies (Figures 3A and 3B). In addition to depleting CD70+ RTCs, CD70 CAR T cells also depleted CD70+ allogeneic B cells and NK cells (Figures 4A and 4B). In summary, these data indicate that CD70 Daggers can be used to reduce allogeneic rejection of allogeneic CAR T cells by host immune cells.

[0255] Example 4. Investigation of engineered T cells expressing different CD70daggers (CD70 binding proteins) generated by LVV transduction. We generated a series of clonal 4F11-based CD70 Dagger constructs that were either first generation CARs (i.e., without a costimulatory domain) or second generation CARs (i.e., with a costimulatory domain). Additionally, we tested constructs with or without a mimotope-based safety switch. The results are shown in Figure 5A-C. All CD70 Daggers tested contain the wild-type CD3z signaling domain ("z") and CD8 transmembrane domain unless otherwise indicated. Among the first generation CARs, CD70 Dagger: QR3z, which further contains a QR3 safety switch (a two-part safety switch containing Rituximab mimotope R (SEQ ID NO: 592) followed by SEQ ID NO: 595); QQz, which further contains a QQ safety switch (SEQ ID NO: 596); Qz, which further contains a Q safety switch (SEQ ID NO: 594); and QR328TMz, which, in addition to the QR3 safety switch, further contains a CD28 transmembrane domain instead of a CD8 transmembrane domain. All constructs, which are second generation CARs, contain a costimulatory 4-1BB signaling domain in addition to the CD8 transmembrane domain and the CD3z signaling domain, among which the "CD70 CAR" further contains a QR3 safety switch, and the names QQbbz, Qbbz, and bbz contain a QQ safety switch, a Q safety switch, and no safety switch, respectively. All cells were further modified to knock out the TRAC locus.

[0256] Primary T cells were isolated and transduced with lentiviral vectors (LVV) expressing different CD70 Dagger constructs. All cells transduced with the tested constructs were successfully generated, with constructs designated Qz, z and Qbbz showing the highest levels of expression (Figure 5A), and constructs Qz and z having the lowest levels of activation marker expression (Figure 5C). Overall, CD70 Dagger expressing cells showed similar CD4:CD8 T cell ratios (Figure 5B) and differentiation status (data not shown) compared to NTD cells.

[0257] To evaluate the activity of CD70 Dagger constructs, we performed alloreactive T cell MLRs with selected CD70 Dagger expressing cells. For alloreactive T cell MLRs and MLTCs, primed alloreactive T cells were co-cultured with graft T cells, or a combination of graft T cells and tumor targets, in round-bottom 96-well plates in 200 μL of RPMI medium supplemented with 10% FBS and 20 U / mL of recombinant human IL-2, at the indicated ratios. If the MLR co-culture lasted more than 4 days, half of the medium was replaced on day 4. The medium was then replaced every 2–3 days. Cells were analyzed by flow cytometry at the indicated time points. For PBMC MLRs, host PBMCs were co-cultured with graft T cells at a ratio of 10:1 in round-bottom 96-well plates in 200 μL of RPMI medium supplemented with 10% FBS and 20 U / mL of recombinant human IL-2. To prime alloreactive T cells, unedited graft donor T cells were irradiated at 30 Gy and co-cultured with host PBMCs at a 1:1 ratio in RPMI supplemented with 10% FBS and 20 U / mL recombinant human IL-2, IL-7 and IL-15. On day 4 of co-culture, half of the medium was replaced with fresh RPMI supplemented with 10% FBS. On day 7, T cells were isolated using the EasySep™ Human T Cell Isolation Kit (STEMCELL Technologies) as directed by the manufacturer's protocol.

[0258] As shown in Figure 6A, T cells expressing "CD70 CAR Dagger" resisted alloreactive T cell-mediated rejection, while NTD T cells completely rejected. CD70dg-Qbbz, CD70dg-Qz, and CD70dg-z expressing T cells showed improved survival to various degrees compared to NTD T cells (Figure 6A). We next tested the activity of CD70 Dagger in PBMC MLR and demonstrated that NK cell alloreactivity contributes to rejection and host T cell priming dynamics naturally occur in response to allogeneic T cells. In PBMC MLR assays, all CD70 Daggers tested significantly increased graft T cell survival compared to NTD control cells, which were eliminated by day 9 (Figure 6B). In the same PBMC MLR assays, CD70 Dagger T cells significantly reduced the absolute numbers of HTC and host NK cells, evidence of effective Dagger activity. See Figures 6C-D. Conversely, HTCs and host NK cells expanded when cocultured with NTD T cells.

[0259] Additional constructs containing modifications in the CD3z signaling domain were also tested, including the CD3z domain containing ITAM variants designated 1XX and XX3 (SEQ ID NOs: 585 and 586, respectively). See Feucht et al. Nat Med. 2019, 25(1):82-88. Cells were further modified to knock out the TRAC locus. CD70 Dagger activity was tested in an MLR assay incubated with allogeneic PBMCs. Graft cells expressing CD3z variants expanded equally or better than graft cells expressing wild-type CD3z (Figure 6E), and all graft cells showed comparable levels of killing of host T cells (Figure 6F). Thus, CD70 Dagger activity was not significantly affected by modifications of the CD3z intracellular domain.

[0260] Example 5. Testing the CD70Dagger activity of engineered immune cells expressing different CD70 binding proteins (CD70Dagger) generated by site-specific integration. We then generated cells expressing various CD70dagger constructs and introduced the constructs into T cells by site-specific integration (SSI). In this experiment, the CD70dagger constructs were introduced into the CD52 locus by homologous recombination. In this experiment, additional constructs were tested. CD28HTMz: contains CD28 hinge and transmembrane domain and CD3z signaling domain; CD8H-CD28TM-z: contains CD8 hinge and CH28 transmembrane domain and CD3z domain; bbz, refers to the 4-1BB signaling domain in addition to the CD3 signaling domain.

[0261] SSI-derived T cells expressing the first generation CAR, CD70 dagger construct, had higher levels of surface expression and lower levels of activation markers compared to the second generation variants (Figure 7A-C). We observed a slight increase in the CD4:CD8 ratio in SSI-derived CD70 dagger T cells compared to T cells expressing the CD70 CAR derived from LVV or NTD T cell controls (Figure CD7D). Selected CD70 dagger cells were then tested in a PBMC MLR assay. All CD70 dagger T cells tested expanded or persisted on day 13, except for CD70dg-QR3z; see Figure 7E. CD70dg-QR3z T cells persisted longer than the NTD T cell control, but ultimately rejected by day 13. All CD70 dagger cells showed activity against host T cells and host NK cells (Figure 7F-G). CD70dg-z expanded to the highest extent of all CD70 Dagger constructs tested and demonstrated comparable Dagger activity to cells expressing CD70 CAR.

[0262] Example 6. CD70 Daggers containing different CD70 binding domains. Next, we tested CD70 Dagger, which contains the CD70 binding domain from an anti-CD70 antibody, in addition to clone 4F11. The binding affinities of clones 4F11, 8C8 and 8F8 in the form of scFv are within 10-fold of each other. See WO2019 / 152742.

[0263] The binding toxicity of anti-CD70 antibodies was further analyzed when expressed as scFvs in second-generation CARs. Luciferase-expressing ACHN cells were transduced with CAR LVV and stained with 2.5 μg / mL His-tagged Fab, followed by 1:50 dilution of anti-His antibody. The binding sites (i.e., epitopes) of different anti-CD70 antibodies were analyzed in a masking assay. Briefly, the scFv expressed in the extracellular domain of each CD70 CAR binds to the antigen CD70 protein on the surface of ACHN cells. The binding masks the epitope of the CD70 protein on the cell surface, blocking the binding of other anti-CD70 antibodies (Fabs) from binding to the same epitope, but allowing the binding of other anti-CD70 Fabs that bind to different epitopes. The results showed that CARs expressing 8F8 scFv blocked the binding of 4F11 Fab to cells and vice versa (data not shown). Thus, 8F8 and 4F11 competed for binding to CD70, and thus could bind to the same or overlapping epitopes. On the other hand, CAR expressing 8C8 scFv did not block the binding of 8F8 or 4F11 Fab to cells (data not shown). Thus, clone 8C8 did not compete with either 4F11 or 8F8 for binding to CD70, and likely binds to a different epitope than 4F11 and 8F8.

[0264] The binding site of each clone was confirmed by protein structure and mutagenesis analysis. 28 residues on the exposed surface of the CD70 trimer complex were individually mutated to generate a panel of CD70 trimer mutants. The binding region of the anti-CD70 chimeric antigen receptor (CAR) was reformatted as an antibody fragment and assessed for binding to the various trimer mutants by biosensor analysis. SPR analysis of the CD70 antigen single point mutant supernatant samples was determined on a Biacore T200 SPR instrument (Cytiva, Marlborough, MA). All CD70 antigen single point mutant samples were site-specifically biotinylated via co-expression with BirA, followed by dialysis and filtration before SPR analysis. All these biotinylated CD70 samples were captured as native supernatants on the CAP surface of the Biacore. All flow cells were then blocked with 20 μM amine-PEG2-biotin (APB). Buffer and 100 nM of all tested anti-CD70 Fabs were injected as analytes for 2 min, and dissociation was monitored for 15 min at 30 μL / min. Surfaces were regenerated according to the manufacturer's protocol. All interactions were measured in triplicate using three independent analyte dilution series and capture samples. All sensorgrams were double-referenced with data from buffer analyte injections (Myszka, 1999). Data were fitted to a 1:1 Langmuir binding model with mass transfer using Biacore T200 evaluation software (version 2.0).

[0265] Residues critical for binding of each CAR were identified and mapped onto the structure of the CD70 trimeric complex to either the membrane-distal CAR binding or the membrane-proximal CAR binding. The structural illustrations in Figure 8A-C show the residues critical for binding to the CD70 trimeric complex, i.e., binding site or epitope, of clones 8F8, 4F11, and 8C8, respectively. Mutagenesis studies showed that clones 4F11 and 8F8 bind to the membrane-distal site of the CD70 protein, and clone 8C8 binds to the membrane-proximal site of the CD70 trimeric complex.

[0266] Next, CD70dagger constructs were generated containing anti-CD70 antibody clones 8C8, 8F8, and 4F11 in the form of scFv. T cells expressing different CD70daggers by LVV transduction were tested in a T cell MLR assay. All three CD70daggers contain the CD3ζ intracellular signaling domain and the 4-1BB costimulatory domain. As shown in Figure 8D-E, all CD70dagger-expressing T cells expanded in the MLR assay but showed varying degrees of persistence. All three CD70dagger constructs inhibited host T cell proliferation with 4F11- and 8F8-derived CD70dagger binding to the membrane-distal site of CD70 being more effective than 8C8-derived CD70dagger.

[0267] The results show that all CD70 Dagger constructs tested, which had different CD70 binding domains that bind different epitopes and / or different intracellular signaling domains, generated either by LVV transduction or site-specific integration, exhibited Dagger activity by reducing host T cells and / or NK cells. The varying degrees of expansion and Dagger activity exhibited by the different constructs suggest that CD70 Dagger activity can be fine-tuned to achieve a desired level of lymphodepletion for use in, for example, adoptive cell therapy or CAR T cell therapy.

[0268] Example 7. CD70Dagger was expressed in conjunction with a CAR specific for a non-CD70 target. Next, we investigate the CD70 Dagger activity when expressed in conjunction with a CAR specific for non-CD70 tumor targets. We constructed a tandem CAR that includes anti-CD70 clone 4F11 scFv and anti-CD19 clone 4G7 scFv (US10,874,693). CAR T cells expressing the tandem CAR are tested in T cell MLR assay or PBMC MLR assay or MLTC assay. The expansion of CD70 Dagger-expressing CAR T cells and the inhibition of host T cells and / or NK cells are measured in MLR assay.

[0269] We investigated whether Dagger would affect the cytotoxicity of CD19-CD70 tandem CAR T cells against CD19-expressing target cells. The results in Figure 9 show that CD19-CD70 tandem CAR T cells showed robust cytotoxicity against the CD19 target cell line Raji, as determined by measuring residual luciferase activity 48 hours after co-culture of effector cells and luciferase-labeled target cells. In this experiment, Dagger cells alone, which do not have a CD19 binding domain, also showed cytotoxic activity due to the presence of CD70 on Raji cells. The results show that the presence of the CD70 binding domain in the tandem CAR did not adversely affect the cytotoxic activity of the CD19 CAR. Similar results were observed when CD70 Dagger was expressed on separate T cells, and the presence of separate CD70 Dagger cells did not adversely affect the cytotoxicity of CAR T cells specific for another non-CD70 target in a long-term killing assay (data not shown). The data from this experiment show that CD70Dagger, whether expressed on separate Dagger cells or on the same CAR T cell (e.g., as part of a tandem CAR), did not adversely affect the cytotoxic activity of the CAR against its specific tumor antigen.

Claims

1. A pharmaceutical composition for lymphodepletion in a patient in need thereof, comprising engineered immune cells, wherein said engineered immune cells comprise or functionally express a CD70 binding protein comprising a CD70 binding domain and a transmembrane domain, and said engineered immune cells inhibit the proliferation and / or activity of CD70-positive cells in the patient.

2. The pharmaceutical composition of claim 1, wherein the CD70 binding domain comprises an anti-CD70 antibody or a CD70-binding fragment thereof, and optionally, the anti-CD70 antibody comprises an scFv.

3. The pharmaceutical composition of claim 2, wherein the CD70 binding protein further comprises a hinge domain, and optionally, the hinge domain comprises a CD8 hinge.

4. The pharmaceutical composition of claim 2, wherein the CD70 binding protein further comprises one or more intracellular signaling domains selected from the group consisting of a CD3ζ signaling domain, a CD3δ signaling domain, a CD3γ signaling domain, a CD3ε signaling domain, a CD28 signaling domain, a CD2 signaling domain, an OX40 signaling domain, and a 4-1BB signaling domain, or variants thereof.

5. The pharmaceutical composition described in claim 2, wherein the CD70 binding protein comprises a CD3ζ or CD3γ signaling domain and does not comprise a costimulatory domain.

6. The pharmaceutical composition described in claim 2, wherein the CD70 binding protein comprises a 4-1BB signaling domain, a CD2 signaling domain, or a CD28 signaling domain, or a variant thereof, and does not comprise a CD3ζ signaling domain.

7. The pharmaceutical composition described in claim 4, wherein the one or more intracellular domains comprise one or more amino acid sequences selected from SEQ ID NOs: 265, 271-278, 281-295, 311-337, 580-591, or 616-617.

8. The pharmaceutical composition of claim 2, wherein the CD70 binding protein does not contain an intracellular signaling domain.

9. The pharmaceutical composition described in claim 2, wherein the CD70-positive cells are normal or non-cancerous lymphocytes in the patient selected from T cells, B cells, or NK cells and activated T cells.

10. The pharmaceutical composition of claim 1, wherein the engineered immune cells are autologous or allogeneic selected from peripheral blood mononuclear cells (PBMCs), T cells, NK cells, or a mixture thereof, or are derived or developed from iPSCs.

11. The pharmaceutical composition of claim 1, wherein the engineered immune cells further comprise one or more genetic modifications of one or more of the endogenous TCRa gene, the endogenous CD52 gene, and the endogenous CD70 gene, and wherein the engineered immune cells exhibit reduced levels of expression and / or activity of TCRa, CD52 and / or CD70 protein compared to control immune cells that do not have one or more of the genetic modifications.

12. The pharmaceutical composition of claim 1, wherein the patient requires a bone marrow transplant, stem cell transplant, or tissue transplant, and the transplant exhibits longer durability in the patient compared to a control that does not receive the engineered immune cells.

13. An engineered immune cell that functionally expresses a protein comprising a first antigen-binding domain and a protein comprising a second antigen-binding domain, wherein the first antigen-binding domain specifically binds to a target of interest and the second antigen-binding domain specifically binds to CD70, and optionally, the second antigen-binding domain comprises an anti-CD70 antibody, an anti-CD70 scFv, an anti-CD70 VHH, or an anti-CD70 VH, or a CD70-binding fragment thereof.

14. The engineered immune cell of claim 13, wherein the protein comprising the first antigen-binding domain is a first chimeric antigen receptor (CAR), and the protein comprising the second antigen-binding domain is a second CAR.

15. The engineered immune cell of claim 13, wherein the first antigen-binding domain and the second antigen-binding domain are present in a bispecific CAR.

16. The method of claim 1, wherein the target of interest is BCMA, EGFRvIII, Flt-3, WT-1, CD20, CD22, CD23, CD30, CD38, CD33, CD133, WT1, TSPAN10, MHC-PRAME, HER2, MSLN, PSMA, PSCA, GPC3, Liv1, ADAM10, CHRNA2, LeY, NKG2D, CS1, CD44v6, ROR1, CD19, Claudin-18.2 (Claudin-18A2, or Claudin 18 isoform 2), DLL3 (D 14. The engineered immune cell of claim 13, wherein the ubiquitin-binding domain is a protein selected from the group consisting of: elta-like protein 3, Drosophila delta homolog 3, Delta3), Mucl7, Muc3, Mucl6, FAP alpha (fibroblast activation protein alpha), Ly6G6D (lymphocyte antigen 6 complex locus protein G6d, c6orf23, G6D, MEGT1, NG25), or RNF43 (E3 ubiquitin-protein ligase RNF43, RING finger protein 43).

17. The engineered immune cell of claim 13, further comprising one or more genetic modifications of one or more of the endogenous TCRα gene, the endogenous CD52 gene, and the endogenous CD70 gene.

18. The engineered immune cells of claim 13, wherein the engineered immune cells express one or more of TRAC, CD52, and CD70 at levels that are 90% or less, 75% or less, 50% or less, 25% or less, or 10% or less of the expression levels in unengineered immune cells, wherein the reduction is achieved by gene knockout or knockdown.

19. The engineered immune cell of claim 13, wherein the engineered immune cell comprises a first nucleic acid encoding a protein comprising a first antigen-binding domain and a second nucleic acid encoding a protein comprising a second antigen-binding domain.

20. The engineered immune cell described in claim 13, wherein the single nucleic acid comprises both the first nucleic acid and the second nucleic acid.

21. The engineered immune cell of claim 19 or 20, comprising a first vector encoding a protein comprising a first antigen-binding domain and a second vector encoding a protein comprising a second antigen-binding domain, optionally wherein one or both vectors are a lentiviral vector or an adeno-associated viral (AAV) vector.

22. The engineered immune cells of claim 13, which are or are derived from immune cells obtained from healthy volunteers, obtained from a patient, or derived from iPSCs.

23. The engineered immune cell population of claim 13, wherein 75% or less of the engineered immune cells functionally express one or more of TRAC, CD52, and CD70.

24. The engineered immune cell population of claim 23, wherein the engineered immune cell population comprises at least 10% engineered T cells, at least 20% engineered T cells, at least 30% engineered T cells, at least 40% engineered T cells, at least 50% engineered T cells, at least 75% engineered T cells, or at least 90% engineered T cells, and the engineered T cells comprise one or more genetic modifications of one or more of the endogenous TCRα gene, the endogenous CD52 gene, and the endogenous CD70 gene.

25. A pharmaceutical composition comprising one or more of the engineered immune cells of claim 13, and further comprising at least one pharmaceutically acceptable carrier or excipient.

26. A method for producing the engineered immune cell of claim 13, comprising reducing functional expression of one or more of TRAC, CD52 and CD70 in the immune cell using one or more gene editing techniques selected from the group consisting of TALEN, zinc finger, Cas-CLOVER, and CRISPR / Cas system.

27. The method of claim 26, comprising introducing into an immune cell a first nucleic acid encoding a protein comprising a first antigen-binding domain and a second nucleic acid encoding a protein comprising a second antigen-binding domain.

28. The method of claim 27, wherein a first vector comprises the first nucleic acid, a second vector comprises the second nucleic acid, and optionally, either or both of the first vector and the second vector are lentiviral vectors, or either or both of the first vector and the second vector are adeno-associated viral vectors.

29. The method of claim 27, wherein the first nucleic acid and the second nucleic acid are introduced into the engineered immune cells by site-specific integration, and optionally, either or both of the first vector and the second vector are adeno-associated virus vectors.

30. A method of treating a condition or disease in a patient, comprising administering to the patient one or more engineered immune cells of claim 13, wherein the engineered immune cells inhibit the proliferation and / or activity of CD70-positive lymphocytes in the patient.

31. The method of claim 30, wherein the condition or disease is a solid tumor or a blood tumor.

32. The method of claim 30, wherein the condition or disease is selected from the group consisting of gastric cancer, sarcoma, lymphoma (including non-Hodgkin's lymphoma), leukemia, head and neck cancer, thymic cancer, epithelial cancer, salivary gland cancer, liver cancer, stomach cancer, thyroid cancer, lung cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, leukemia, multiple myeloma, renal cell carcinoma, bladder cancer, cervical cancer, choriocarcinoma, colon cancer, oral cancer, skin cancer, and melanoma.

33. The method of claim 30, comprising administering about 10 3 or 10 4 to about 10 9 engineered immune cells per kg of patient body weight, or about 10 5 to about 10 6 engineered immune cells per kg of patient body weight, or 0.1×10 6 to 5×10 6 engineered immune cells per kg of patient body weight.

34. The method of claim 30, wherein the cells are administered as a single dose or as two or more doses over a period of time.

35. The method of claim 30, wherein the patient is administered a chemotherapeutic agent before, simultaneously with, or after the patient is administered the engineered immune cells, and optionally the chemotherapeutic agent is cyclophosphamide.

36. The method described in claim 35, wherein the patient is not administered fludarabine before, simultaneously with, or after the patient is administered the engineered immune cells.

37. The method of any one of claims 30 to 36, wherein the engineered immune cells exhibit longer persistence in patients administered engineered immune cells comprising the CD70 binding protein compared to controls administered engineered immune cells not comprising the CD70 binding protein.

38. A recombinant CD70 binding protein comprising a CD70 antibody or antigen-binding fragment thereof, a transmembrane domain, and a CD3 intracellular signaling domain, wherein the recombinant CD70 binding protein does not include a costimulatory domain.

39. The recombinant CD70 binding protein of claim 38, which does not contain a CD28 signaling domain, an OX40 signaling domain, or a 4-1BB signaling domain.