Cancer cell therapy by inhibition of monocarboxylate transporter 11

Abstract

The present disclosure provides compositions comprising modified peripheral blood mononuclear cells (PBMCs) with reduced expression of Slc16a11 and / or reduced activity of MCT11. Also provided are siRNAs and gRNAs targeting Slc16a11. Also provided are methods of using the compositions of the present disclosure in the treatment of cancer. The present invention provides, for example, modified peripheral blood mononuclear cells (PBMCs) with reduced expression of Slc16a11, reduced activity of MCT11, or both, comprising 1) an agent that reduces Slc16a11 expression; or 2) a non-naturally occurring genetic modification that reduces the amount of functional MCT11.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 223,453, filed July 19, 2021, which is incorporated by reference herein in its entirety.

[0002] Field The present disclosure relates to immunotherapy, in particular compositions and methods that prevent or reduce T cell exhaustion, and their use to treat cancer or improve immunotherapy. [Background technology]

[0003] background The programmed cell death 1 (PD-1) receptor is a checkpoint receptor that is expressed primarily on mature cytotoxic T lymphocytes. Cancer cells often express PD-1 ligands, such as PD-L1 and PD-L2, resulting in immune tolerance of cancerous cells. Certain cancer treatments target PD-1 or its ligands to reduce immune tolerance and thereby increase T cell-mediated elimination of cancerous cells. However, only a small subset of patients respond to this so-called PD-1 blockade. A potential factor limiting efficacy is the occurrence of T cell exhaustion, an alternative outcome in which T cells differentiate into a dysfunctional state. Exhaustion limits the ability of T cells to target tumor cells or respond to immunotherapy. Thus, increasing the effector function of T cells or resistance to exhaustion may be useful to improve patient responses to various cancer immunotherapies, such as PD-1 blockade. Summary of the Invention [Means for solving the problem]

[0004] overview MCT11 is a transport protein. MCT11 is shown here to be present on the surface of terminally exhausted T cells, particularly those that infiltrate tumors. Reducing the expression of MCT11 is shown to delay the onset of T cell exhaustion, which helps to preserve antitumor functionality. Thus, MCT11 activity may contribute to T cell exhaustion. Without being bound to any particular theory, MCT11 may transport monocarboxylates, such as lactate. Thus, MCT11-mediated uptake of lactate (or another MCT11 substrate) may reduce the antitumor function of T cells. Based on these findings, methods are provided for generating PBMCs, e.g., T cells, with reduced expression of Slc16a11, reduced activity of MCT11, or both, to reduce or prevent T cell exhaustion in PBMCs or T cells used for cancer treatment, e.g., immunotherapy.

[0005] Provided herein is a modified peripheral blood mononuclear cell (PBMC) that has reduced expression of Slc16a11, reduced activity of MCT11, or both. In some embodiments, the modified PBMC comprises an agent that reduces Slc16a11 expression, such as an inhibitory RNA (RNAi) or guide RNA (gRNA) specific to Slc16a11 gene or transcript. In some examples, the RNAi is shRNA, siRNA, or antisense RNA. In some embodiments, the modified PBMC comprises a non-naturally occurring genetic modification of Slc16a11 that reduces the amount of functional MCT11. In some examples, the genetic modification is a point mutation, partial deletion, complete deletion, or insertion in the Slc16a11 gene that reduces expression of Slc16a11 and / or reduces activity of MCT11.

[0006] In some embodiments, the modified PBMC is a T cell, for example, a CD8+ T cell or a CD3+ T cell. In some examples, the T cell is reactive to tumor-specific antigens, for example, CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), or EGFR. In further examples, the T cell is a tumor-infiltrating lymphocyte (TIL), and / or the T cell expresses a chimeric antigen receptor (CAR) or an engineered T cell receptor (TCR). In some examples, the T cell is an exhausted T cell (including terminal exhausted T cell).

[0007] The modified PBMCs of the present disclosure are useful, for example, to improve cancer immunotherapy or to treat cancer or tumors in vivo.

[0008] Also provided herein is a method for generating modified PBMCs disclosed herein, for example, by introducing an agent that reduces Slc16a11 expression or a non-naturally occurring genetic modification that reduces functional MCT11 into PBMCs, thereby generating modified PBMCs with reduced Slc16a11 expression and / or reduced MCT11 activity. In some examples, such methods further include selecting modified PBMCs with reduced Slc16a11 expression, reduced MCT11 activity, or both (e.g., purifying or isolating such cells from cells that do not reduce Slc16a11 expression, do not reduce MCT11 activity, or both). In some examples, such methods are performed ex vivo. In some examples, such selection methods are performed using flow cytometry, panning, or magnetic separation. The methods of the present disclosure, in some examples, further include introducing the selected modified PBMCs having reduced expression of Slc16a11, reduced activity of MCT11, or both, into a subject, such as a subject having a cancer to be treated with the selected modified PBMCs having reduced expression of Slc16a11, reduced activity of MCT11, or both.

[0009] Also provided herein is a method of treating cancer (or tumor) or enhancing cancer immunotherapy by administering modified PBMCs disclosed herein to a subject having cancer (or tumor) and / or undergoing immunotherapy, thereby treating the cancer (or tumor) or enhancing the immunotherapy. In some examples, the subject is undergoing or will undergo cancer immunotherapy, such as a checkpoint inhibitor, such as an anti-PD-1 or anti-PD-L1 monoclonal antibody therapy. In some examples, the subject is administered a small molecule inhibitor of MCT (e.g., MCT11) before, after, or substantially simultaneously with the modified PBMCs.

[0010] The foregoing and other objects and features of the present disclosure will become more apparent from the following detailed description which proceeds with reference to the accompanying drawings. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 shows the typical phenotype of "precursor-like" or "terminally exhausted" T cells. [Figure 2A-B] Figures 2A-2C show that MCT11 is upregulated in exhausted T cells in mice and humans. Figure 2A shows FACS sorting of LN CD8+ and TIL CD8+ cells for RNA-seq (left) and shows that MCT11 is upregulated in exhausted T cells (PD1hiTim3+) (right). Figure 2B shows MCT11 staining of human PBMC, PD1 / TIM3- and PD1 / TIM3+ cells from melanoma (MEL) or head and neck cancer (HNSCC) patients. Human tumor biopsy samples were stained with antibodies against CD8, PD-1, Tim-3, and MCT11 and analyzed by flow cytometry. Figure 2B shows staining of MCT11 as a function of progression to exhaustion (PD-1+Tim3+). FIG. 2C shows MCT11 surface expression on exhausted or non-exhausted tumor-infiltrating lymphocytes (TILs) from MC38 (adenocarcinoma) or MEER (head and neck cancer) models in C56 / BL6J mice. [Figure 2C] Same as above. [Diagram 3] Figures 3A-3B show transcripts per million (TPM) of Slc16a11 from RNA-seq in the indicated cell types. MCT11 is expressed (upregulated) on the surface of exhausted T cells, particularly tumor-infiltrating exhausted T cells (TILs) (Figure 3A). Figure 3B is generated from published data and confirms that Slc16a11 is specific for tumor-infiltrating exhausted T cells. [Figure 4] Figure 4 shows that exhausted T cells specifically take up lactate. A schematic of the experimental design is shown at the top, and the graph below shows lactate uptake after 30 min incubation with lactate for each indicated cell type. [Diagram 5] Figure 5 shows that MCT11-inhibited T cells (by treatment with shRNA specific for Slc16a11) retain antitumor function (top), whereas MCT11 overexpression (by treatment with a vector expressing Slc16a11) promotes T cell exhaustion in a mouse model (bottom). [Figure 6A-B] Figures 6A-D show that mice with conditional deletion of MCT11 (Slc16a11) have smaller tumor volumes, as well as increased T cell infiltration and increased T cell function. Figure 6A shows the experimental setup. Figure 6B shows the tumor volume. Figure 6C shows increased T cell infiltration (percent viable CD8+ cells) within the exhausted T cell compartment and increased T cell function (measured by cytokine production after restimulation). Figure 6D shows that MCT11 mAb does not stain exhausted T cell (Texh) cells in mice with conditional deletion of MCT11. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 7] FIG. 7 shows that CRISPR / Cas9-mediated deletion of Slc16a11 in OT-1 OVA-specific T cells generated superior therapeutic cells (reduced tumor area) after a single dose in a mouse model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Sequence Listing Nucleic acid and amino acid sequences are shown with standard letter abbreviations for nucleotide bases and three letter codes for amino acids as defined in 37 C.FR 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. It is understood that when RNA is coded as DNA, "U" is replaced by "T" and conversely, when DNA is expressed as RNA, "T" is replaced by "U".

[0013] The sequence listing is submitted as a 16,384 byte XML file, "Sequence.xml", created on July 18, 2022, which is incorporated herein by reference. In the attached sequence listing: SEQ ID NO: 1: Exemplary amino acid sequence of human MCT11 [ka] SEQ ID NO:2: An exemplary nucleic acid sequence encoding human SLC16A11 mRNA [ka] [ka] SEQ ID NO:3: Exemplary guide RNA (gRNA) targeting sequence for human SLC16A11 CGGGGGUCCGGCGGGCUGGG SEQ ID NO: 4: Exemplary shRNA targeting human SLC16A11 [ka] SEQ ID NO: 5: Exemplary amino acid sequence of mouse MCT11 [ka] SEQ ID NO: 6: Exemplary nucleic acid sequence encoding mouse Slc16a11 mRNA [ka] [ka] SEQ ID NO: 7: Exemplary guide RNA (gRNA) targeting sequence for mouse Slc16a11 CGCCCCCUUCUAGGCCCAGU SEQ ID NO: 8: An exemplary shRNA targeting mouse Slc16a11 UGGCUUGGUCUUCUCGGCUUU

[0014] Detailed Description Unless otherwise noted, technical terms are used according to normal usage.The definitions of many common terms in molecular biology can be found in Krebs et al. (eds.), Lewin's genes XII, published by Jones & Bartlett Learning, 2017;The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994;and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995;and other similar references.

[0015] As used herein, the singular forms "a", "an" and "the" refer to both the singular and the plural unless the context clearly indicates otherwise. As used herein, the term "comprises" means "includes". Thus, "comprising" means "including" a nucleic acid molecule without excluding other elements. It is further understood that any and all base sizes given for nucleic acids are approximate and are provided for illustrative purposes unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, certain preferred methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will take precedence. In addition, the materials, methods, and examples are merely illustrative and are not intended to be limiting.

[0016] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided.

[0017] About: Unless the context indicates otherwise, "about" refers to plus or minus 5% of the reference value. For example, "about" 100 refers to 95 to 105.

[0018] Administration: Providing or giving an agent, such as modified PBMCs, to a subject by any effective route. Administration can be local or systemic. Exemplary administration routes include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, intratumoral, intraprostatic, intrathecal, intraosseous, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes. In some examples, modified PBMCs (e.g., T cells) provided herein are administered by intravenous injection.

[0019] Adoptive cell transfer (ACT) therapy: A type of immunotherapy in which T cells that have been modified (e.g., modified to recognize tumor antigens) and / or expanded in vitro (or ex vivo) are administered to a patient in need of such therapy. T cells for ACT therapy can be the patient's own T cells or T cells from a donor. ACT therapy includes, for example, chimeric antigen receptor T cell (CAR-T), engineered T cell receptor (TCR), or tumor infiltrating lymphocyte (TIL) therapy. ACT therapy is also sometimes referred to as adoptive cell therapy, cellular adoptive immunotherapy, or T cell transfer therapy.

[0020] Cancer: A malignant tumor characterized by abnormal or uncontrolled cell growth. Other features often associated with cancer include metastasis, interference with the normal function of neighboring cells, release of abnormal levels of cytokines or other secretory products, and suppression or exacerbation of inflammatory or immune responses, invasion of surrounding or distant tissues or organs, e.g., lymph nodes, etc. "Metastatic disease" refers to cancer cells that leave the original tumor site and migrate, e.g., via the bloodstream or lymphatic system, to other parts of the body.

[0021] Cas9: an RNA-guided DNA endonuclease enzyme that participates in CRISPR-Cas immune defense against prokaryotic viruses. Cas9 has two active cleavage sites (HNH and RuvC), one for each strand of the double helix. Thus, the Cas9 protein can be used to edit DNA in combination with an appropriate guide RNA. Cas9 sequences are publicly available. For example, GenBank® Accession Nos. CP012045.1, nucleotides 796693..800799, and CP014139.1, nucleotides 1100046..1104152 disclose exemplary Cas9 nucleic acids, and GenBank® Accession Nos. NP_269215.1, AMA70685.1, and AKP81606.1 disclose exemplary Cas9 proteins.

[0022] The present disclosure also encompasses catalytically inactive (deactivated or inactive) Cas9 (dCas9) protein, which has reduced or eliminated endonuclease activity but still binds to dsDNA.In some examples, dCas9 comprises one or more mutations in RuvC and HNH nuclease domains, such as one or more of the following point mutations: D10A, E762A, D839A, H840A, N854A, N863A, and D986A.Exemplary dCas9 sequences comprise both D10A and H840A substitutions.In one example, dCas9 protein has mutations D10A, H840A, D839A, and N863A (see, for example, Esvelt et al., Nat. Meth. 10:1116-21, 2013). Exemplary dCas9 sequences are provided in GenBank® Accession Nos. AKA60242.1 and KR011748.1.

[0023] Cas13d: an RNA-guided RNA endonuclease enzyme that can cleave or bind to RNA. Cas13d protein specifically recognizes the direct repeat (DR) sequence present in sgRNA with a specific secondary structure. Cas13d protein contains one or two HEPN domains. A natural HEPN domain contains the sequence RXXXXH, where X is any amino acid. Catalytically inactive or "inactive" Cas13d (dCas13d) contains mutated HEPN domain(s) and thus cannot cleave RNA but can process sgRNA, which is also encompassed in the present disclosure. dCas13d can be targeted to cis elements of pre-mRNA to engineer alternative splicing. Exemplary natural and variant Cas13d protein sequences are provided in WO2019 / 040664, US10,876,101, and US10,392,616.

[0024] In one example, the full length (non-truncated) Cas13d protein is between 870-1080 amino acids long. In one example, the Cas13d protein is derived from a genomic or metagenomic sequence of a bacterium of the order Clostridiales. In one example, the corresponding DR sequence of the Cas13d protein is located at the 5' end of a spacer sequence in a molecule comprising the Cas13d gRNA. In one example, the DR sequence in the Cas13d sgRNA is truncated at the 5' end compared to the DR sequence in the unprocessed Cas13d guide array transcript (e.g., truncated by at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, e.g., truncated by 1-3 nucleotides, 3-6 nucleotides, 5-7 nucleotides, or 5-10 nucleotides). In one example, the DR sequence in the Cas13d gRNA is truncated by the Cas13d protein at the 5' end by 5-7 nucleotides. In one example, the Cas13d protein can cleave a target RNA that is flanked by either A, U, G, or C ribonucleotides at the 3' end and either A, U, G, or C ribonucleotides at the 5' end of the spacer-target duplex.

[0025] Checkpoint inhibitors (or checkpoint blockade): Therapeutic agents that target checkpoint proteins. Checkpoint proteins help prevent overactive immune responses or autoimmunity and can sometimes limit the ability of T cells to eliminate cancerous cells. When checkpoints are blocked (e.g., PD-1 blockade), T cells can better target and kill cancerous cells. Examples of checkpoint proteins found in T cells or cancerous cells include PD-1 / PD-L1 / PD-L2, and CTLA-4 / B7-1 / B7-2.

[0026] Exemplary checkpoint inhibitors include ipilimumab (Yervoy®), nivolumab (Opdivo®), pembrolizumab (Keytruda®), atezolizumab (Tencentriq®), avelumab (Bavencio®), durvalumab (Imfinzi®), cemiplimab (Libtayo®), palbociclib (Ibrance®), ribociclib (Kisquali®), pidilizumab, avelumab, and abemaciclib (Verzenio®). Further examples are provided in Qiu et al., Journal of the European Society for Therapeutic Radiology and Oncology, 126(3):450-464, 2018; Visconti et al., J Exp Clin Cancer Res. 35(1): 153, 2016; and Mills et al. Cancer Res. 77(23): 6489-6498, 2017.

[0027] Chimeric antigen receptor (CAR): an artificial engineered T cell receptor that grafts any specificity onto immune effector cells. Typically, these receptors are used to graft the specificity of monoclonal antibodies onto T cells, and the transfer of their coding sequences is facilitated by vectors. Thus, a CAR that is "specifically binding" or "specific" to an antigen is a CAR that binds to the antigen with high affinity and does not significantly bind to other unrelated antigens. Using adoptive cell transfer, CARs can be useful to treat cancer. For example, T cells (obtained from a patient or donor) are modified so that they express a receptor specific for the patient's particular cancer. The modified T cells that can recognize and kill cancer cells are then introduced into the patient. In some examples, the modified PBMCs disclosed herein express a CAR.

[0028] First generation CARs typically contained an intracellular domain from the CD3ζ chain, which is the primary transmitter of signals from the endogenous TCR. Second generation CARs added intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 41BB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to T cells. Third generation CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to increase potency. A multispecific CAR is a single CAR molecule composed of at least two antigen binding domains (e.g., scFv and / or single domain antibodies), each binding to a different antigen or different epitopes on the same antigen (see, e.g., US2018 / 0230225). For example, a bispecific CAR refers to a single CAR molecule with two antigen binding domains, each binding to a different antigen. A bicistronic CAR refers to two complete CAR molecules, each containing an antigen binding moiety that binds to a different antigen. In some examples, bicistronic CAR constructs express two complete CAR molecules linked by a cleavable linker.T cells expressing bispecific or bicistronic CARs can bind to cells expressing both antigens to which the binding moieties are directed (see, for example, Qin et al., Blood 130:810, 2017; and WO / 2018 / 213337).Any of these CARs can be used by the methods described herein.

[0029] Complementarity: The ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence, either by conventional Watson-Crick base pairing or other non-conventional types. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, and 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively).

[0030] In some embodiments, the nucleic acid molecule of the present disclosure (e.g., gRNA or RNAi of the present disclosure) hybridizes with the target nucleic acid, and thus the nucleic acid molecule is complementary to the target sequence.For example, in some cases, the RNAi or gRNA specific for Slc16a11 gene or transcript is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the unique portion of the target gene, e.g., Slc16a11.In some cases, the target sequence is at least 10 consecutive nucleotides, for example, at least 12, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 consecutive nucleotides. In further examples, the target sequence is 10-50 contiguous nucleotides, e.g., 12-40, 12-30, 12-20, 12-15, 15-30, 15-20, 20-30, or 20-40 contiguous nucleotides. In some examples, the target sequence is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a sequence of about 20 nucleotides in length in the Slc16a11 gene or transcript.

[0031] Control: Reference standard. In some embodiments, the control is a negative control. In other embodiments, the control is a positive control. In some cases, a suitable control is a historical control or a standard reference value or range of values ​​(e.g., a group of previously tested control samples, such as a group of patients diagnosed with a disease or condition with a known prognosis or outcome, such as cancer, or a group of samples representing baseline or normal values). In some cases, the control can be a subject that has not been treated with an agent (e.g., the modified PBMC of the present disclosure) or has been treated with an alternative treatment, or a baseline reading of the subject before treatment with the agent.

[0032] The difference between the test sample and the control can be an increase, or conversely, a decrease.The difference can be a qualitative difference or a quantitative difference, for example, a statistically significant difference.In some examples, the difference is an increase compared to the control, for example, an increase of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, or at least about 500%. In other examples, the difference is a decrease compared to the control, e.g., a decrease of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or at least about 100%.

[0033] CRISPR / Cas9 system: a prokaryotic immune system that confers resistance to foreign genetic elements, such as plasmids and phages, and provides a form of adaptive immunity. In the endogenous system, transactivating crRNA (tracrRNA) hybridizes with the repeat sequence of another RNA molecule known as CRISPR RNA (crRNA) to form a unique double RNA hybrid structure that binds to Cas9 endonuclease and forms a ribonucleoprotein (RNP) complex. The crRNA contains a targeting sequence complementary to the target gene, which guides the CRISPR / Cas9 RNP complex to the target. Cas9 then induces double-stranded DNA breaks in the target gene. The CRISPR / Cas9 system can be used to reduce gene expression by targeting a target gene, such as Slc16a11, and inducing double-stranded DNA breaks in the target gene. Similarly, the CRISPR / Cas13 system can be used to cleave RNA.

[0034] Effective amount: An amount of an agent (e.g., modified PBMC, RNAi, gRNA, or other composition disclosed herein) that is sufficient to cause a beneficial or desired result. The effective amount (also called a therapeutically effective amount) may vary depending on one or more of the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the mode of administration, etc., which can be easily determined by one of ordinary skill in the art. Beneficial therapeutic effects may include enabling the determination of a diagnosis; ameliorating a disease, symptom, disorder, or condition; reducing or preventing the onset of a disease, symptom, disorder, or condition; and generally combating a disease, symptom, disorder, or condition.

[0035] In one embodiment, an "effective amount" of a therapeutic agent (e.g., a modified PBMC disclosed herein) is an amount sufficient to reduce tumor volume / size, tumor weight, number of metastases, metastasis volume / size, metastasis weight, or a combination thereof, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 99% (compared to a suitable control, e.g., a control not administered the therapeutic agent). In one embodiment, an "effective amount" of a therapeutic agent (e.g., a gRNA or siRNA disclosed herein) is an amount sufficient to reduce the activity or expression of a target (e.g., MCT11) by, for example, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or even 100% (compared to a suitable control, e.g., expression or activity before administration of the therapeutic agent). In some cases, a combination of these effects is achieved.

[0036] Guide RNA (gRNA): The RNA component of the CRISPR / Cas system that directs the CRISPR / Cas ribonucleoprotein (RNP) complex to a target nucleic acid sequence, such as a target DNA (e.g., a genomic sequence) or a target RNA sequence. A gRNA molecule includes (1) a portion that has sequence complementarity with the target nucleic acid (e.g., at least 80%, at least 90%, at least 95%, or 100% sequence complementarity), and (2) a portion that has a secondary structure that binds to a Cas nuclease. Such portions may be part of the same molecule (e.g., a synthetic chimera that combines sgRNA:crRNA and tracrRNA into a single RNA transcript) or may be split into two or more separate molecules (e.g., a two-part gRNA where the crRNA and tracrRNA are separate RNA transcripts). For simplicity, both types of molecules are referred to herein as gRNA.

[0037] Many techniques for genome editing using the CRISPR / Cas system have been described. Briefly, gRNA directs Cas DNA nuclease (such as Cas9) to the target gene (DNA). Cas9 then introduces a double-stranded break at the target site. Disruptive mutations can be introduced through non-homologous end joining of the cut DNA. Cas9 can also be used to delete larger DNA fragments, for example using two gRNAs that target separate sites, thus causing the deletion of the intervening sequence between the two cut sites. A DNA template with homology to the target site can also be added to introduce an insertion using homologous recombination DNA repair mechanisms.

[0038] In RNA editing, the gRNA directs a Cas RNA nuclease (such as Cas13d) to the target RNA. In one such example, the gRNA includes a crRNA containing (1) a direct repeat (DR) region, and (2) a spacer, from 5' to 3', for example, Cas13a, Cas13c, and Cas 13d nucleases. In one example, the DR is followed by a spacer sequence of about 28-32 nucleotides. In another such example, the gRNA includes a crRNA containing (1) a spacer, and (2) a DR region, from 5' to 3', for example, Cas13b nuclease. In some examples, the gRNA is processed (truncated / modified) by Cas RNA nuclease or other RNase into a shorter "mature" form. The DR is a constant portion of the sgRNA that contains a secondary structure that facilitates the interaction between the Cas RNA nuclease protein and the gRNA. The spacer portion is a variable portion of the gRNA and includes a sequence designed to hybridize to (and in some instances edit) the target RNA sequence. In some instances, the full-length spacer is about 28-32 nucleotides (e.g., 30-32 nucleotides) long, while the mature (processed) spacer is about 14-30 nucleotides.

[0039] The targeting portion of the gRNA can be modified to facilitate targeting of any DNA or RNA sequence of interest. (See CRISPR-Cas9 Structures and Mechanisms. Fuguo Jiang and Jennifer A. Doudna, Annual Review of Biophysics, 46:1, 505-529 (2017)). A gRNA that is "specific" for a target has sufficient complementarity with the target sequence to bind to the target and not significantly hybridize with other unrelated sequences. The targeting sequence of the gRNA is typically about 20 nucleotides, for example, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides. The degree of complementarity between a targeting sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about 50% or more, about 60% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 97.5% or more, about 98% or more, about 99% or more, or more. In some embodiments, the degree of complementarity is 100%. Optimal alignment may be determined by use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transformation (e.g., Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).In some examples, the targeting sequence is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a contiguous amino acid sequence of about 20 nucleotides in length in the Slc16a11 gene or transcript.

[0040] Immunotherapy: Therapy that uses agents that stimulate or suppress the immune system to treat disease, such as cancer. Some examples of cancer immunotherapy include immune checkpoint inhibitors, adoptive cell transfer (ACT) immunotherapy, antibodies, vaccines, and immune system modulators. Specific non-limiting examples include nivolumab, pembrolizumab, pidilizumab, atezolizumab, durvalumab, avelumab, and ipilimumab.

[0041] Increase or decrease: A positive or negative change in amount from a control value (e.g., a value representing no therapeutic agent). An increase is a positive change compared to a control value, such as an increase of at least 25%, at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. A decrease is a negative change compared to a control value, such as a decrease of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100%. In some cases, the increase or decrease is statistically significant compared to a suitable control.

[0042] An agent that reduces the expression or activity of a gene (e.g., Slc16a11) or a gene product (e.g., MCT11) (e.g., RNAi or gRNA specific for Slc16a11 disclosed herein) is a compound that reduces the level of the mRNA or functional product encoded by the gene in a cell or tissue (e.g., PBMC), or reduces (including removes or inhibits) one or more activities of the gene product. In some embodiments, the expression of Slc16a11 is reduced by at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 99%, at least 99.9%, or even 100% compared to a control, e.g., an untreated subject or cell. Conversely, an agent that increases the expression or activity of a gene or a gene product is a compound that increases the level of the mRNA or protein product encoded by the gene in a cell or tissue, or increases one or more activities of the gene product.

[0043] In some embodiments, an agent (e.g., an RNAi or gRNA specific for Slc16a11 as disclosed herein) or a non-naturally occurring genetic modification can increase or decrease the activity of a PBMC (e.g., a T cell) when it is present in the PBMC. For example, in some embodiments, the PBMC is a T cell, and the agent (e.g., an RNAi or gRNA specific for Slc16a11 as disclosed herein) or genetic modification (a point mutation, partial deletion, complete deletion, or insertion that reduces the expression of Slc16a11 as disclosed herein) reduces T cell exhaustion, for example, by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%, compared to a suitable control (e.g., a pre-treatment measurement or a comparison to a non-treated control group). Decreased T cell exhaustion can be measured, for example, by measuring decreased lactate uptake, decreased expression of PD-1 or Tim3, increased cytokine production (e.g., INF-γ, TNFα, or IL-2), increased cytotoxic activity (e.g., increased tumor-specific targeting or killing), or another indicator of T cell effector activity, as compared to a suitable control. In some instances, a combination of these effects is achieved.

[0044] In some embodiments, the agent (e.g., RNAi or gRNA specific for Slc16a11 as disclosed herein) or genetic modification (point mutation, partial deletion, complete deletion, or insertion that reduces expression of Slc16a11 as disclosed herein) increases the activity or function of PBMCs. For example, in some examples, the PBMCs are T cells, and the agent can increase the activity or effector function of the T cells by at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500% compared to a suitable control (e.g., a pre-treatment measurement or a comparison to an untreated control group). Increased T cell effector function can be measured, for example, by decreased lactate uptake, decreased expression of PD-1 or Tim3, increased cytokine production (e.g., INF-γ, TNFα, or IL-2), increased cell proliferation (in vitro or in vivo), or increased cytotoxic activity (e.g., increased tumor-specific targeting or killing) compared to a suitable control, or by another indicator of effector function. In some cases, a combination of these effects is achieved.

[0045] Isolated: An "isolated" biological component (e.g., cell, PBMC, nucleic acid, protein) is substantially separated from, produced separately from, or purified from other biological components in the cells or tissues of the organism in which it is present, e.g., other cells (e.g., RBC), chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids and proteins that are "isolated" include nucleic acids and proteins purified by standard purification methods. The term also encompasses nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. For example, PBMCs or TILs isolated from a patient's blood, tumor, or other sample are at least 50% pure, e.g., at least 60%, e.g., at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more pure.

[0046] Operably linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence when the promoter affects the transcription or expression of the coding sequence (e.g., a promoter driving the expression of a heterologous nucleic acid sequence encoding an siRNA or gRNA as disclosed herein). Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, are in the same reading frame.

[0047] Programmed cell death protein 1 (PD-1): A cell surface receptor that belongs to the immunoglobulin superfamily and is expressed on T cells and pro-B cells. PD-1 binds to two ligands, PD-L1 and PD-L2. The human form is a type 1 transmembrane protein of 268 amino acids. PD-1 is an inhibitory receptor that suppresses T cell activity and mediates T cell exhaustion. PD-1 sequences are published, for example, in the GenBank® sequence database (e.g., accession numbers NP_005009.2 (mature peptide is amino acids 21-288), CAA48113.1, NP_001301026.1 (mature peptide is amino acids 25-288), and CAA48113.1 (mature peptide is amino acids 21-288) provide exemplary PD-1 protein sequences, and accession numbers L27440.1, NM_005018.2, X67914.1, AB898677.1, and EU295528.2 provide exemplary PD-1 nucleic acid sequences).

[0048] Pharmaceutically acceptable carriers: Pharmaceutically acceptable carriers useful in the present invention are conventional. Remington's Pharmaceutical Sciences, 23rd Edition, Academic Press, Elsevier, (2020) describes compositions and formulations suitable for pharmaceutical delivery of therapeutic agents, such as modified PBMCs disclosed herein.

[0049] Generally, the nature of the carrier depends on the particular mode of administration used.For example, parenteral formulations usually contain injectable fluids that contain pharma- ceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, 5% human serum albumin, glycerol, etc., as a vehicle.In addition to physiologically neutral carriers, the pharmaceutical compositions to be administered may contain small amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, such as sodium acetate or sorbitan monolaurate.Supplementary active compounds can also be incorporated into the composition.

[0050] Promoter: A group of nucleic acid control sequences that direct the transcription of a nucleic acid. Promoters include necessary nucleic acid sequences near the start site of transcription, such as, for example, in the case of a polymerase II type promoter, a TATA element. Promoters also include distal enhancer or repressor elements, which may be located as far as several thousand base pairs from the transcription start site, as necessary.

[0051] Examples of promoters include, but are not limited to, SV40 promoter, CMV enhancer-promoter, CMV enhancer / β-actin promoter, EF1a promoter, or PGK promoter. In one example, the expression of gRNA is driven by a polymerase III promoter, such as U6 or H1, for example, human or mouse U6 or H1 promoter. Both constitutive and inducible promoters are included (see, for example, Bitter et al., Methods in Enzymology 153:516-544, 1987). Also included are those promoter elements that are sufficient to make promoter-dependent gene expression cell type-specific, tissue-specific, or inducible by external signals or agents; such elements can be located in the 5' or 3' region of the gene. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide transcription of nucleic acid sequences.

[0052] Prevent: Preventing a condition refers to reducing, delaying, or inhibiting the full onset of the condition, e.g., preventing, reducing, or delaying the progression of a T cell to an exhausted T cell. In one example, an agent that reduces Slc16a11 expression, or a non-naturally occurring genetic modification that reduces the amount of functional MCT11, when present in a PBMC, such a T cell, e.g., a CAR or TCR, prevents or reduces the likelihood that the cell will become exhausted (e.g., the T cell overexpresses programmed cell death 1 (PD1 hi ) and / or be positive for T-cell immunoglobulin-mucin domain-containing protein 3 (TIM3 +) or may slow the progression of cells to an exhausted state. In some examples, the modified PBMCs, e.g., modified T cells, of the present disclosure are not exhausted. In some examples, the modified PBMCs, e.g., modified T cells, of the present disclosure exhibit reduced exhaustion compared to unmodified PBMCs or T cells, e.g., at least 10% (least 10%), at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 99%, or at least 99.9% reduction. In some examples, the modified PBMCs, e.g., modified T cells, of the present disclosure exhibit slower progression to exhaustion, e.g., at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 99% increase in days to exhaustion compared to unmodified PBMCs or T cells.

[0053] RNA interference or interfering RNA (RNAi): A cellular process that inhibits the expression of genes, including cellular and viral genes. RNAi is a form of antisense-mediated gene silencing that involves the introduction of double-stranded RNA-like oligonucleotides, resulting in sequence-specific reduction of RNA transcripts. RNA molecules that inhibit gene expression through the RNAi pathway can include siRNA, miRNA, gRNA, and shRNA. In one example, RNAi is specific to Slc16a11 and can specifically hybridize with Slc16a11 nucleic acid molecules.

[0054] Sequence identity: The similarity between amino acid or nucleotide sequences is expressed in terms of the similarity between the sequences or is otherwise referred to as sequence identity. Sequence identity is often measured in terms of percentage identity (or similarity or homology). The higher the percentage, the more similar the two sequences are. Polypeptide (or nucleotide sequence) homologs have a relatively high degree of sequence identity when aligned using standard methods.

[0055] Methods for aligning sequences for comparison have been described. Various programs and alignment algorithms are described in Smith and Waterman, Adv. Appl. Math. 2:482, 1981;Needleman and Wunsch, J. Mol. Biol. 48:443, 1970;Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988;Higgins and Sharp, Gene 73:237, 1988;Higgins and Sharp, CABIOS 5:151, 1989;Corpet et al., Nucleic Acids Research 16:10881, 1988;and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., Nature Genet. 6:119, 1994, presents a detailed consideration of sequence alignment methods and homology calculations.

[0056] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and the Internet, for use in conjunction with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. A description of how to use this program to determine sequence identity is available on the Internet at the NCBI website.

[0057] Short Hairpin RNA (shRNA): A sequence of RNA that can create a tight hairpin turn and be used to silence gene expression via the RNAi pathway. The shRNA hairpin structure is cleaved into siRNA by the cellular machinery. An shRNA that is "specific" for a target sequence (e.g., Slc16a11) has sufficient complementarity with the target sequence so that it binds to the target and does not significantly hybridize with other unrelated sequences.

[0058] Solute carrier family 16 member 11 (Slc16a11) and monocarboxylate transporter 11 (MCT11): Slc16a11 is a gene encoding MCT11 protein. MCT11 is a recently characterized transport protein that can transport monocarboxylates, such as lactate. SEQ ID NO:1 discloses an exemplary amino acid sequence of MCT11. SEQ ID NO:2 discloses an exemplary nucleic acid sequence of Slc16a11. The sequence of MCT11 / Slc16a11 has been published, see, e.g., UniProt accession number Q8NCK7; GenBank accession numbers KJ900348.1, NM_153081.3, NM_153357.3, and NM_001370549.1 provide exemplary Slc16a11 nucleic acid sequences; and GenBank accession numbers NP_001357478.1, NP_694721.2, and NP_001099267.2 provide exemplary MCT11 protein sequences. In one example, the MCT11 protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:1, GenBank Accession Nos. NP_001357478.1, NP_694721.2, or NP_001099267.2, or UniProt Accession No. Q8NCK7. In one example, the Slc16a11 nucleic acid molecule has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:2, GenBank Accession Nos. KJ900348.1, NM_153081.3, NM_153357.3, or NM_001370549.1, or UniProt Accession No. Q8NCK7.

[0059] Small interfering RNA (siRNA): A double-stranded nucleic acid molecule that modulates gene expression through the RNAi pathway. siRNA molecules are generally 15-40 nucleotides long, e.g., 20-30 or 20-25 nucleotides long, with 0-5 (e.g., 2) nucleotide overhangs at each 3' end. However, siRNAs can also be blunt-ended. Generally, one strand of an siRNA molecule is at least partially complementary to a target nucleic acid, e.g., a target mRNA. siRNAs are also referred to as "small inhibitory RNAs." An siRNA that is "specific" for a target sequence (e.g., Slc16a11) has sufficient complementarity with the target sequence so that it binds to the target and does not significantly hybridize to other unrelated sequences.

[0060] Small molecule inhibitor: A molecule that typically has a molecular weight of less than about 1000 Daltons, or in some embodiments, less than about 500 Daltons, and can modulate the activity of target molecule (e.g., MCT11) to some measurable extent. In some examples, the small molecule inhibitor is an MCT inhibitor (e.g., 7ACC1, AR-C155858, UK5099, SR13800, CHC, AR-C141990 hydrochloride, AZD3965, or BAY8002).

[0061] Subject: a vertebrate, for example a mammal, for example a human. Mammals include, but are not limited to, mice, monkeys, humans, farm animals, sport animals, and pets. In one embodiment, the subject is a non-human mammalian subject, for example a monkey or other non-human primate, mouse, rat, rabbit, pig, goat, sheep, dog, cat, horse, or cow. In some examples, the subject has a cancer (or tumor) that can be treated using modified PBMCs disclosed herein. In some examples, the subject is a laboratory animal / organism, for example a mouse, rabbit, or rat.

[0062] T cell agonist: An immunotherapy that activates T cells to promote anti-tumor function. Non-limiting examples include urelumab and utomirumab.

[0063] T cell: A white blood cell (lymphocyte) that is a key mediator of the immune response. T cells include, but are not limited to, CD3 + T cells, CD4 + T cells, and CD8 + Contains T cells. CD4 + T cells are immune cells that have a marker on their surface also known as "cluster of differentiation 4" (CD4). These cells, also known as helper T cells, help coordinate immune responses, including antibody responses as well as killer T cell responses. CD8 + T cells bear the "cluster of differentiation 8" (CD8) marker. In some instances, CD8 + T cells are cytotoxic T lymphocytes (CTLs). CD3+ T cells bear the "cluster of differentiation 3" (CD3) marker, a multimeric protein complex also known historically as the T3 complex.

[0064] Activated T cells can be detected by increased cell proliferation and / or increased expression or secretion of one or more cytokines (e.g., IL-2, IL-4, IL-6, IFN-γ, or TNFα). + T cell activation can also be detected by increased cytolytic activity in response to antigen. "Exhausted T cells" are dysfunctional T cells (hyporesponsive) commonly found in the cancer environment. T cell exhaustion is characterized by progressive loss of effector function (e.g., loss of IL-2, TNF-α, and IFN-γ production) and persistent expression of inhibitory receptors such as PD-1, T cell immunoglobulin domain-mucin domain-containing protein 3 (Tim-3), CTLA-4, lymphocyte activation gene 3 (LAG-3), and CD160. In some instances, exhausted T cells are characterized by CD3 + T cells or CD8 + In some instances, exhausted T cells are terminally exhausted T cells (exhausted, terminally differentiated T cells). Terminally exhausted T cells express Tim3 and are capable of regulating other T cells (Tim3 + PD-1 hi T cells) have high and persistent expression of PD-1. +and / or PD-1 hi The T cells that are exhausted can be determined by FACs analysis, for example, FACs analysis of T cell population. In some examples, terminal exhausted T cells express MCT11. The possible cause of T cell exhaustion is chronic activation or persistent antigen stimulation. In some examples, the modified PBMC is exhausted T cells, including terminal exhausted T cells.

[0065] A "therapeutic T cell" is a T cell used in therapy, for example, immunotherapy (e.g., cancer immunotherapy). Therapeutic T cells are administered to a subject for the treatment of a particular disease, for example, cancer or an immune disease. In some examples, therapeutic T cells recognize and kill target cells, for example, cancer-like cells, thereby treating a disease, for example, cancer. Therapeutic T cells can be autologous or allogeneic to a subject. In some examples, therapeutic T cells are T cells used in adoptive cell transfer (ACT) immunotherapy. In further examples, therapeutic T cells express chimeric antigen receptors (CARs) or engineered T cell receptors (TCRs) and / or are tumor infiltrating lymphocytes (TILs).

[0066] T cell receptor (TCR): a receptor found on the surface of T lymphocytes (or T cells) involved in the recognition of fragments of antigens as peptides bound to major histocompatibility complex (MHC) molecules. The TCR is composed of two different protein chains. In humans, in 95% of T cells, the TCR consists of alpha (α) and beta (β) chains, whereas in 5% of T cells, the TCR consists of gamma and delta (γ / δ) chains. This ratio varies during ontogeny and in disease situations, as well as in different species. When the TCR engages an antigenic peptide and MHC (peptide / MHC), the T lymphocyte is activated through signal transduction, a series of biochemical events mediated by associated enzymes, co-receptors, specialized adaptor molecules, and activated or released transcription factors. In one example, the TCR is a recombinant TCR, such as the TCR used in TCR engineered T cells for ACT therapy.

[0067] Therapeutic Agent: refers to one or more molecules or compounds that impart some beneficial effect when administered to a subject. Beneficial therapeutic effects can include enabling the determination of a diagnosis; ameliorating a disease, symptom, disorder, or condition; reducing or preventing the onset of a disease, symptom, disorder, or condition; and generally combating a disease, symptom, disorder, or condition.

[0068] Transformed: A transformed cell is a cell (e.g., a PBMC, e.g., a T cell) into which a nucleic acid molecule has been introduced by molecular biology techniques. As used herein, the term transformed and the like (e.g., transformation, transfection, transduction, etc.) encompasses all techniques by which a nucleic acid molecule may be introduced into such a cell, including viral vectors, plasmid vectors, nucleic acid-protein complexes (e.g., ribonucleoproteins), or naked nucleic acids (e.g., oligonucleotides).

[0069] Exemplary transformation methods include chemical methods (e.g., calcium phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), lipofection, nucleofection, receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope / capsid-DNA complexes), particle gun accelerators (gene guns), and biological infection with viruses, such as recombinant viruses (Wolff, JA, ed, Gene Therapeutics, Birkhauser, Boston, USA (1994)). In the case of infection with retroviruses, the infectious retroviral particles are absorbed by the target cell, resulting in reverse transcription of the retroviral RNA genome and integration of the resulting provirus into cellular DNA.

[0070] Treating, treatment, and therapy: Any success or indicator of success in attenuating or reversing an injury, pathology, or condition, including any objective or subjective parameter, such as alleviation, remission, reduction of symptoms, or making the condition more tolerable to the patient, slowing the rate of deterioration or decline, making the end point of deterioration less debilitating, improving the subject's physical or mental well-being, or extending survival. Treatment can be evaluated by objective or subjective parameters, including the results of physical examination, blood, and other clinical tests, and the like. In some examples, treatment by the methods of the present disclosure results in a reduction in the number, volume, and / or weight of tumors and / or metastases.

[0071] Tumor-infiltrating lymphocyte (TIL): Lymphocyte that invades tumor tissue. For example, T cells found in tumor samples. In ACT therapy, TIL therapy generally involves isolating TIL from a patient's tumor, activating and expanding TIL in culture, and then reperfusing it into the patient. In some examples, the modified PBMC disclosed herein is TIL.

[0072] Tumor, Neoplasia, or Malignancy: A neoplasm is an abnormal growth of tissue or cells resulting from excessive cell division. Neoplastic growth may result in a tumor. The amount of tumor in an individual is the "tumor burden," which can be measured as the number, volume, or weight of tumors. A "non-cancerous tissue" is a tissue from the same organ in which a malignant neoplasm has formed but does not have the pathology characteristic of a neoplasm. Generally, non-cancerous tissue appears histologically normal. A "normal tissue" is a tissue from an organ that is not afflicted by cancer or another disease or disorder of that organ. A "cancer-free" subject has not been diagnosed with cancer in that organ and does not have detectable cancer.

[0073] Exemplary tumors, e.g., cancers, that can be treated using the modified PBMCs of the present disclosure include solid tumors, e.g., breast cancer (e.g., lobular and ductal carcinomas, e.g., triple negative breast cancer), sarcomas, cancers of the lung (e.g., non-small cell carcinoma, large cell carcinoma, squamous cell carcinoma, and adenocarcinoma), pulmonary mesothelioma, colorectal adenocarcinoma, gastric carcinoma, prostate adenocarcinoma, ovarian cancer (e.g., serous cystadenocarcinoma and mucinous cystadenocarcinoma), ovarian germ cell tumors, testicular cancer and germ cell tumors, pancreatic adenocarcinoma, bile duct adenocarcinoma, hepatocellular carcinoma, bladder cancer (including, by way of example, transitional cell carcinoma, adenocarcinoma, and squamous cell carcinoma), renal cell adenocarcinoma, endometrial cancer (including, by way of example, adenocarcinoma and mixed Mullerian tumor (carcinosarcoma)), endocervical , cervical and vaginal cancers (e.g., adenocarcinomas and squamous cell carcinomas thereof), skin tumors (e.g., squamous cell carcinoma, basal cell carcinoma, malignant melanoma, skin adnexal tumors, Kaposi's sarcoma, cutaneous lymphoma, skin adnexal tumors, and various types of sarcomas and Merkel cell carcinoma), esophageal cancer, nasopharyngeal and oropharyngeal cancers (including squamous cell carcinomas and adenocarcinomas thereof), salivary gland cancer, brain and central nervous system tumors (including, e.g., tumors of glial, neuronal, and meningeal origin), peripheral nerve tumors, soft tissue sarcomas, and sarcomas of bone and cartilage, head and neck squamous cell carcinoma, and lymphatic tumors (including B-cell and T-cell malignant lymphoma). In one example, the tumor is a melanoma. In one example, the tumor is a head and neck squamous cell carcinoma (HNSCC), e.g., HPV-positive HNSCC.

[0074] The modified PBMCs of the present disclosure can also be used to treat liquid tumors, such as lymphatic, leukocyte tumors, or other types of leukemia. In certain examples, the tumor to be treated is a hematological tumor, such as a leukemia (e.g., acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), T-cell prolymphocytic leukemia (T-PLL), large granular lymphocytic leukemia, and adult T-cell leukemia), lymphoma (e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma), or myeloma.

[0075] Vector: A nucleic acid molecule that can be introduced (e.g., by transfection or transformation) into a host cell, thereby producing a transformed host cell (e.g., transformed PBMC). A recombinant DNA vector is a vector that has recombinant DNA. A vector can contain a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector can also contain one or more selectable marker genes and other genetic elements. A viral vector (e.g., AVV) is a recombinant nucleic acid vector that has at least some nucleic acid sequence derived from one or more viruses. A replication-defective viral vector is a vector that lacks at least one replication-essential gene function and therefore requires complementation of one or more regions of the viral genome required for replication.

[0076] Overview Immunotherapy, most notably the blockade of checkpoint receptors as well as the use of engineered tumor-specific T cells for therapy, has changed the paradigm of cancer treatment. However, a potential factor that limits the effectiveness of these modalities is the occurrence of T cell exhaustion, i.e., the alternative differentiation of T cells into a more dysfunctional state. Exhaustion limits the ability of T cells to respond to immunotherapy. Exhausted T cells also have distinct metabolic profiles that limit their function. For example, they compete poorly for glucose and suppress the production of new mitochondria. However, these cells persist in the tumor microenvironment, and therefore certain metabolic pathways or metabolites that support these cells may interfere with antitumor function.

[0077] Herein, it is shown that terminally exhausted T cells specifically upregulate MCT11 expression. Terminally exhausted T cells can also specifically take up monocarboxylates, such as lactate. This indicates that MCT11 transporter has a role in providing nutrient flow to terminally exhausted T cells. Lack of MCT11 activity in tumor-specific T cells transferred into tumor-bearing mice resulted in increased T cell function and reduced exhaustion. Furthermore, overexpression of MCT11 in tumor-specific T cells accelerated the development of exhausted dysfunction phenotype. Thus, without being bound to any particular theory, MCT11 likely supports lactate uptake, which may limit the effector function of exhausted T cells. Thus, reducing or eliminating MCT11 function or expression in T cells can be used to increase effector activity and / or reduce T cell exhaustion, for example, to prevent exhaustion of T cells used in cancer therapy. Thus, in some examples, modified T cells of the present disclosure with reduced or eliminated MCT11 expression and / or activity can be generated ex vivo to prevent or delay the ability of T cells to become exhausted, and the modified cells can be administered to subjects with cancer for immunotherapy. The use of PBMCs, e.g., therapeutic T cells, in such treatments can provide stronger immune responses and better cancer treatment.

[0078] I. RNAi and gRNA Disclosed herein is an interfering RNA (RNAi) or guide nucleic acid (gRNA) specific for Slc16a11 (SLC16A11). The RNAi or gRNA targets a Slc16a11 nucleic acid molecule, e.g., a gene or transcript, to reduce the expression of Slc16a11. In some examples, the RNAi or gRNA is introduced into a cell, e.g., a PBMC, a T cell, or an exhausted T cell (including a terminal exhausted T cell). In some examples, the RNAi or gRNA molecule is directly introduced into a cell, e.g., as an oligonucleotide. In some examples, the RNAi or (of) gRNA molecule is expressed from a vector introduced into a cell. In examples where the guide RNA is expressed (e.g., from an expression cassette or vector), the guide RNA can be encoded as DNA.

[0079] In some embodiments, RNAi specific to Slc16a11 gene or transcript is used to reduce or inhibit the expression of Slc16a11. The specificity of RNAi to Slc16a11 allows the RNAi molecule to hybridize with Slc16a11 DNA or RNA, thereby reducing or inhibiting Slc16a11 expression. RNAi generally refers to the cellular process of inhibiting the expression of genes by inhibiting transcription and / or translation. Molecules that inhibit gene expression through the RNAi pathway include siRNA, miRNA, antisense RNA, and shRNA. In some examples, RNAi specific to Slc16a11 comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% complementary to a unique (e.g., not found anywhere in the genome of the cell or organism to which the RNAi is introduced) continuous portion (e.g., a portion of SEQ ID NO: 2) of Slc16a11 gene or transcript. In some examples, an RNAi specific for Slc16a11 consists of a sequence that is at least 90% complementary (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to a unique contiguous portion of the Slc16a11 gene or transcript (e.g., a portion of SEQ ID NO:2).

[0080] In certain non-limiting examples, the RNAi is a shRNA specific to Slc16a11 gene or transcript. Methods for designing shRNA are described, see, for example, Moore et al. (2010) Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown, Methods Mol. Biol., 629:141-158, which is incorporated herein by reference in its entirety. In some examples, the shRNA is specific to a unique continuous portion of a sequence that has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:2. In some examples, the shRNA is specific to a unique continuous portion of a sequence that has at least 90% sequence identity with SEQ ID NO:2.

[0081] In some examples, the shRNA comprises a targeting sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to nucleotides 5-25 of SEQ ID NO:4. In some examples, the shRNA comprises a targeting sequence having at least 95% sequence identity to nucleotides 5-25 of SEQ ID NO:4. In some examples, the shRNA has at least 70%, at least 80%, at least 90%, at least 95%, at least 90%, at least 99%, or 100% sequence identity to SEQ ID NO:4. For example, the shRNA may have at least 95% sequence identity to SEQ ID NO:4. In some examples, the shRNA comprises or consists of SEQ ID NO:4.

[0082] In other examples, the RNAi is an siRNA specific for the Slc16a11 gene or transcript, for example, the siRNA is specific for a sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with a unique contiguous portion of SEQ ID NO: 2. For example, the siRNA can be specific for a sequence having at least 95% sequence identity with a unique contiguous portion of SEQ ID NO: 2.

[0083] In some embodiments, gRNA specific to Slc16a11 gene or transcript is used to reduce or inhibit the expression of Slc16a11. For example, CRISPR / Cas method can be used with gRNA specific to Slc16a11 gene or transcript to reduce or inhibit the expression of Slc16a11. The specificity of gRNA to Slc16a11 can be combined with Cas nuclease or inactive nuclease (e.g., Cas9, dCas9, dCas13d, or Cas13d) to allow hybridization of gRNA molecule with Slc16a11 DNA or RNA, thereby editing (e.g., mutating, e.g., knocking down or knocking out) Slc16a11 and reducing or inhibiting its expression. In some examples, Cas nuclease (or inactive Cas nuclease) sequence is codon-optimized for expression in host cell. In some examples, the gRNA molecule and the Cas nuclease are expressed from a vector introduced into a host cell (e.g., a PBMC, a T cell, or an exhausted T cell). In some examples, an RNP complex containing the gRNA molecule and the Cas nuclease is introduced into a cell (e.g., a PBMC, a T cell, or an exhausted T cell). In some examples, the gRNA is introduced into a cell, for example, as an oligonucleotide.

[0084] In some examples, the gRNA is specific for the Slc16a11 (SLC16A11) gene or transcript. For example, the gRNA is specific for a sequence that has at least 70% (at 70%), at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with the unique continuous portion of SEQ ID NO:2. In some examples, the gRNA is specific for a sequence that has at least 90% sequence identity with the unique continuous portion of SEQ ID NO:2. In some examples, the gRNA includes a targeting sequence (sometimes called a spacer) that is specific for the Slc16a11 gene or transcript, for example, by having a targeting sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the unique continuous portion of SEQ ID NO:2. The targeting sequence of the gRNA is typically about 20 nucleotides, for example, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides. In a specific, non-limiting example, the targeting sequence is about 20 nucleotides. The degree of complementarity between the targeting sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about 50% or more, about 60% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 97.5% or more, about 98% or more, about 99% or more, or more. In some embodiments, the degree of complementarity is about 100%.Optimal alignment can be determined by the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transformation (e.g., Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some examples, the targeting sequence is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a unique contiguous amino acid sequence of about 20 nucleotides in length in the Slc16a11 gene or transcript.

[0085] In some examples, the gRNA specific for the Slc16a11 gene or transcript comprises a contiguous sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3. In some examples, the gRNA specific for the Slc16a11 gene or transcript comprises SEQ ID NO: 3. In some examples, the targeting sequence portion of the gRNA has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3. In some examples, the targeting sequence portion of the gRNA comprises or consists of SEQ ID NO: 3.

[0086] In some examples, the gRNA is a sgRNA specific for the Slc16a11 gene or transcript. In some examples, the sgRNA comprises a contiguous sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:3. In some examples, the sgRNA comprises SEQ ID NO:3. In some examples, the targeting sequence portion of the sgRNA has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:3. In some examples, the targeting sequence portion of the sgRNA comprises or consists of SEQ ID NO:3.

[0087] Methods for designing gRNAs and determining suitable targeting sequences have been described (see, for example, Hanna and Doench (2020) Design and analysis of CRISPR-Cas experiments, Nature Biotechnology, 38:813-823(2020), which is incorporated herein by reference in its entirety). CRISPR-Cas experiments can be designed and analyzed using a number of software tools, including resources for designing optimal gRNAs for various modes of operation and for analyzing the results of such experiments. Online databases of validated gRNAs are also readily available (see addgene.org / crispr / reference / grna-sequence / and genscript.com / gRNA-database.html).

[0088] II. Nucleic Acids and Expression Vectors Also provided herein are nucleic acids (e.g., heterologous nucleic acids or isolated nucleic acid molecules, e.g., DNA, cDNA, RNA (e.g., mRNA)) encoding RNAi, gRNA, and / or Cas proteins. The nucleic acids can be readily produced using the sequences of the disclosure provided herein, sequences available in the art, and the genetic code.

[0089] Degenerate variants of the nucleic acid sequences of the present disclosure are also disclosed.Silent mutations in coding sequences are due to the degeneracy (i.e. redundancy) of genetic code, whereby more than one codon can code for the same amino acid residue.Thus, for example, leucine can be coded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be coded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be coded by AAT or AAC; aspartic acid can be coded by GAT or GAC; cysteine ​​can be coded by TGT or TGC; alanine can be coded by GCT, GCC, GCA, or GCG; glutamine can be coded by CAA or CAG; tyrosine can be coded by TAT or TAC; and isoleucine can be coded by ATT, ATC, or ATA.

[0090] The codon preference and codon usage table for a particular species can be used to engineer an isolated nucleic acid molecule that encodes a protein product, such as Cas9, that utilizes the codon usage preference of that particular species.For example, the nucleic acid can be designed to have the codons that are preferentially used by a particular organism of interest (e.g., the source organism of the PBMC to be modified, or the organism to which the nucleic acid is administered).In some examples, the nucleic acid is codon-optimized for expression in humans.Thus, in some examples, the Cas nuclease (or inactive nuclease) sequence is codon-optimized for expression in human PBMC (e.g., T cells, exhausted T cells).

[0091] The nucleic acid of the present disclosure can be prepared by any suitable method, including, for example, cloning of suitable sequence, or by direct chemical synthesis by standard method.Chemical synthesis produces single-stranded oligonucleotide.This can be converted into double-stranded DNA by hybridization with complementary sequence, or by polymerization by DNA polymerase using single strand as template.

[0092] Nucleic acid sequences can be synthesized using any suitable method including, for example, cloning of appropriate sequences, or by the phosphotriester method of Narang et al., Meth. Enzymol. 68:90-99, 1979; the phosphodiester method of Brown et al., Meth. Enzymol. 68:109-151, 1979; the diethyl phosphoramidite method of Beaucage et al., Tetra. Lett. 22:1859-1862, 1981; the diethyl phosphoramidite method of Beaucage & Caruthers, Tetra. Letts. 22(20):1859-1862, 1981, e.g., Needham-VanDevanter et al., Nucl. Acids Res. 12:6159-6168, It can be prepared by direct chemical synthesis, such as the solid-phase phosphoramidite triester method using an automatic synthesizer described in 1984; and the solid-phase support method of U.S. Patent No. 4,458,066.Chemical synthesis produces single-stranded oligonucleotides.This can be converted into double-stranded DNA by hybridization with complementary sequence, or by polymerization with DNA polymerase using single strand as template.Those skilled in the art will recognize that chemical synthesis of DNA is generally limited to sequences of about 100 bases, but longer sequences can be obtained by ligating shorter sequences.

[0093] The nucleic acids of the present disclosure can be prepared by cloning techniques. Examples of suitable cloning and sequencing techniques can be found, for example, in Green and Sambrook (Molecular Cloning: A Laboratory Manual, 4 thed., New York: Cold Spring Harbor Laboratory Press, 2012) and Ausubel et al. (Eds.) (Current Protocols in Molecular Biology, New York: John Wiley and Sons, including supplements). Nucleic acids can also be prepared by amplification methods. Amplification methods include polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription-based amplification system (TAS), self-sustained sequence replication system (3SR), and Qβ replicase amplification system (QB). A wide variety of cloning and in vitro amplification methodologies are known to those skilled in the art.

[0094] In some embodiments, the nucleic acid of the disclosure is included in an expression vector (e.g., a viral vector, a plasmid, or other vehicle) for expression in a host, or in particular a target cell (e.g., a PBMC, a T cell, or an exhausted T cell (including terminal exhausted T cell)). In some examples, the expression vector includes a promoter operably linked to the nucleic acid molecule of the disclosure. For example, the promoter can be operably linked to an RNAi, a gRNA, or a Cas nuclease (or an inactive nuclease) to drive its expression. In some examples, the vector encodes both a Cas nuclease (or an inactive nuclease) and a gRNA. Additional expression control sequences, such as one or more enhancers, transcription and / or translation terminators, and initiation sequences, can also be included in the expression vector. In some embodiments, the nucleic acid of the disclosure is included in a viral vector. Exemplary viral vectors that can be used include, but are not limited to, polyoma, SV40, adenovirus, vaccinia virus, adeno-associated virus (AAV), herpesviruses including HSV and EBV, Sindbis virus, alphavirus, and retroviruses of avian, murine, and human origin. Baculovirus (Autographa californica multiple nucleopolyhedrovirus; AcMNPV) vectors can also be used. Other suitable vectors include orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, suipox vectors, lentivirus vectors, alphavirus vectors, and poliovirus vectors. Certain exemplary vectors are poxvirus vectors, such as vaccinia virus, fowlpox virus, and highly attenuated vaccinia virus (MVA), adenovirus, baculovirus, and the like. Poxviruses that can be used include orthopox, suipox, avipox, and capripox viruses. Orthopox include vaccinia, ectromelia, and raccoonpox. One example of an orthopox used is vaccinia. Avipox include chickenpox, canarypox, and pigeonpox. Capripox include goatpox and sheeppox.In one example, the swiftpox is swinepox. Other viral vectors that can be used include other DNA viruses, such as herpesviruses and adenoviruses, and RNA viruses, such as retroviruses and polio. Biologically functional viral and plasmid DNA vectors capable of expression and replication in cells (e.g., PBMCs, T cells, or exhausted T cells, including terminally exhausted T cells) are known, and one of skill in the art can identify suitable vectors. In some examples, the vector includes a selectable marker (e.g., an antibiotic resistance gene (e.g., puromycin) or a reporter gene (e.g., green fluorescent protein (GFP)). In other examples, the selectable marker and / or reporter is not included in the vector.

[0095] The nucleic acids of the present disclosure can be introduced into a host cell by DNA transfer (e.g., oligonucleotides) or can be introduced and expressed in a suitable host cell (e.g., expression cassettes or vectors). In some examples, the expression product is RNA (e.g., siRNA or gRNA), and in other examples, the expression product is a protein (e.g., Cas9). The cell can be a prokaryotic or eukaryotic cell. In some embodiments, the host cell is a PBMC (e.g., T cells or exhausted T cells). Transient or stable transfer methods can be used. Transient transfer indicates that the foreign nucleic acid is only present transiently (e.g., degraded after a period of time, removed by the host cell, or otherwise not stably replicated). Stable transfer indicates that the foreign nucleic acid is persistently maintained in the host.

[0096] To obtain optimal expression of the nucleic acid of the present disclosure, the expression cassette can contain, for example, a strong promoter to direct transcription, and can use a ribosome binding site (e.g., an internal ribosome binding sequence) for translation initiation, and a transcription / translation terminator. For expression in E. coli, a promoter, for example, T7, trp, lac, or lambda promoter, a ribosome binding site, and preferably a transcription termination signal can be used. For eukaryotic cells, such as PBMCs, the control sequences can include, for example, promoters and / or enhancers derived from immunoglobulin genes, HTLV, SV40, or cytomegalovirus, and polyadenylation sequences, and can further include splice donor and / or acceptor sequences (e.g., CMV and / or HTLV splice acceptor and donor sequences). Additional functional elements include, but are not limited to, leader sequences, stop codons, polyadenylation signals, and any other sequences necessary for proper transcription and subsequent translation of the nucleic acid sequence.

[0097] The nucleic acid or vector of the present disclosure can be introduced into a host cell by any suitable method (e.g., transformation). Numerous transformation methods are known, such as chemical methods (e.g., calcium phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), lipofection, nucleofection, receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope / capsid-DNA complexes), particle gun accelerators (gene guns), and biological infection with viruses, such as recombinant viruses (Wolff, JA, ed, Gene Therapeutics, Birkhauser, Boston, USA (1994)). In the case of infection with retroviruses, the infecting retroviral particles are absorbed by the target cell, thereby resulting in reverse transcription of the retroviral RNA genome and integration of the resulting provirus into the cellular DNA. Successfully transformed cells can be selected by resistance to antibiotics conferred by genes contained in the vector, such as the amp, gpt, neo, and hyg genes. In some examples, the nucleic acid (e.g., gRNA) of the present disclosure is incorporated into a ribonucleoprotein (RNP) complex (e.g., a gRNA-Cas complex). The RNP can be introduced into a host cell by transformation, e.g., nucleofection.

[0098] Modifications can be made to the nucleic acid of the present disclosure without impairing the biological activity of the encoded product.For example, modifications can be made to facilitate the cloning, expression, or incorporation of targeting molecules into fusion proteins.Such modifications include, for example, stop codons, sequences for creating conventionally positioned restriction sites, and methionine at the amino terminus to provide an initiation site, or sequences for adding additional amino acids (e.g., polyHis) to aid in purification steps.

[0099] III. Modified PBMCs Provided herein is a modified peripheral blood mononuclear cell (PBMC) that has reduced Slc16a11 expression, reduced MCT11 activity, or both.In some examples, the expression of Slc16a11 is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% compared to a suitable control (e.g., PBMC before modification).In some examples, the activity of MCT11 is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% compared to a suitable control (e.g., PBMC before modification). Reducing activity includes reducing any measurable biological function of MCT11, for example by reducing the transport of monocarboxylate (e.g., lactate) to modified PBMCs. In some examples, modified PBMCs with reduced Slc16a11 expression, reduced MCT11 activity, or both have increased effector activity (e.g., anti-tumor) compared to a suitable control (e.g., unmodified PBMCs). In some examples, the modified PBMCs are T cells, and the T cells have increased resistance to T cell exhaustion compared to a suitable control (e.g., unmodified PBMCs).

[0100] The modified PBMCs may further comprise additional modifications, for example, the PBMCs may express or otherwise contain a chimeric antigen receptor (CAR) or an engineered T cell receptor (TCR).

[0101] In some examples, the modified PBMC is a T cell, for example, a CD8+ or CD3+ T cell. The T cell can be reactive to tumor-specific antigens, for example, CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), or EGFR. In some examples, the T cell is a tumor-infiltrating lymphocyte (TIL). In some examples, the T cell is a therapeutic T cell or is used as a therapeutic T cell, for example, as an ACT therapy. In some examples, the T cell is an exhausted T cell (including terminal exhausted T cell). Exhausted T cells are dysfunctional T cells characterized by a progressive loss of effector function (e.g., loss of IL-2, TNF-α, and IFN-γ production) and persistent expression of inhibitory receptors, such as PD-1, T cell immunoglobulin domain-mucin domain-containing protein 3 (Tim-3), CTLA-4, lymphocyte activation gene 3 (LAG-3), and CD160. In some instances, exhausted T cells exhibit high and persistent expression of programmed cell death 1 (PD1 hi ) and positive for T-cell immunoglobulin-mucin domain-containing protein 3 (TIM3 + ) terminally exhausted T cells.

[0102] In some embodiments, the modified PBMCs comprise one or more agents that reduce Slc16a11 expression, such as an inhibitory RNA (RNAi) of the present disclosure specific to the Slc16a11 gene or transcript, or one or more guide RNAs (gRNAs) specific to the Slc16a11 gene or transcript (e.g., in combination with a Cas nuclease or an inactive Cas nuclease, e.g., an RNP).

[0103] In some examples, the agent that reduces Slc16a11 expression is an inhibitory RNA (RNAi) of the present disclosure specific to Slc16a11, such as one or more of small hairpin RNA (shRNA), small interfering RNA (siRNA), microRNA (miRNA), or antisense RNA. In a specific, non-limiting example, the RNAi is an shRNA specific to the Slc16a11 gene or transcript, for example, the siRNA is specific to a sequence that comprises at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:2. In some examples, the shRNA is specific to a sequence that has at least 90% sequence identity with a unique continuous portion of SEQ ID NO:2. In some examples, the shRNA has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:4. For example, the shRNA can have at least 90% sequence identity to SEQ ID NO: 4. In some examples, the shRNA consists of or comprises SEQ ID NO: 4.

[0104] In some examples, the agent is a gRNA of the present disclosure specific for the Slc16a11 gene or transcript, for example, the gRNA is specific for a sequence having 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2. For example, the gRNA can be specific for a sequence having at least 90% sequence identity to SEQ ID NO: 2. In some examples, the gRNA comprises a targeting sequence specific for the Slc16a11 gene or transcript, for example, by having a targeting sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a unique contiguous portion of SEQ ID NO: 2.

[0105] In some examples, the gRNA specific for the Slc16a11 gene or transcript comprises a contiguous sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:3. In some examples, the gRNA specific for the Slc16a11 gene or transcript comprises SEQ ID NO:3. In some examples, the targeting sequence portion of the gRNA has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:3. In some examples, the targeting sequence comprises or consists of SEQ ID NO:3. In some examples, the modified PBMC comprises an RNP complex comprising a gRNA of the present disclosure and a Cas nuclease, for example, Cas9, dCas9, dCas13d, or Cas13d.

[0106] In some examples, the modified PBMC comprises a heterologous nucleic acid molecule encoding one or more of the nucleic acids of the present disclosure encoding RNAi (e.g., shRNA, siRNA, antisense RNA) or gRNA. The RNAi or gRNA can be encoded as DNA (e.g., encoded in a DNA vector), but can be expressed as RNA. In some examples, the heterologous nucleic acid molecule encodes a gRNA of the present disclosure specific for Slc16a11 and a Cas nuclease (or an inactive Cas nuclease). In certain examples, the Cas nuclease is a Cas9 nuclease. In other examples, the Cas nuclease is a Cas13d nuclease.

[0107] In some embodiments, the modified PBMC comprises a vector of the present disclosure encoding an RNAi or gRNA. Thus, in some examples, the modified PBMC expresses an RNAi or gRNA. When using gRNA, a Cas nuclease (e.g., Cas9, dCas9, dCas13d, or Cas13d) can also be encoded in the same or different vector, for example, to co-express a Cas nuclease (or an inactive Cas nuclease) and one or more gRNAs specific for Slc16a11 in the modified PBMC. In some examples, the gRNA comprises a spacer sequence and a DR sequence (e.g., DR-spacer-DR-spacer), the Cas nuclease is Cas13d, and the Slc16a11 RNA is edited. In some examples, the gRNA comprises a crRNA and a tracrRNA (expressed either as two separate molecules or as one fusion molecule, e.g., sgRNA), and the Cas nuclease is Cas9. In some examples, the vector comprises a cassette containing two or more gRNAs specific for Slc16a11, where the two or more gRNAs have the same or different targeting sequences (e.g., may target two different regions of Slc16a11).

[0108] The nucleic acid or vector can be transiently or stably introduced into PBMCs (e.g., T cells). In certain non-limiting examples, the vector is stably introduced into modified PBMCs, thereby resulting in stable expression of the RNAi or gRNA in the modified PBMCs. In some examples, the nucleic acid encoding the RNAi or gRNA is operably linked to a cell-specific promoter (e.g., a T cell-specific promoter) in the vector. The expression of the RNAi or gRNA can be constitutive or inducible. Exemplary promoters include NFAT, EF1a, PGK, U6, or H1. In one example, the gRNA is expressed from the U6 or H1 promoter. In one example, the Cas nuclease (or inactive Cas nuclease) is expressed from the CMV promoter.

[0109] In some embodiments, modified PBMCs comprise a non-naturally occurring genetic modification that reduces the amount of functional MCT11. Reducing functional MCT11 comprises a genetic modification that reduces Slc16a11 expression in modified PBMCs (e.g., reduces the transcription or translation of Slc16a11 gene or transcript). In some examples, the genetic modification is a non-naturally occurring genetic modification of the Slc16a11 gene. In other examples, the genetic modification is a non-naturally occurring genetic modification of the regulatory element of Slc16a11 (e.g., promoter, response element, enhancer, transcription factor, or other regulatory factor that affects the expression of Slc16a11). The regulatory element can be cis-acting or trans-acting.

[0110] In some examples, non-naturally occurring genetic modification is a modification that reduces the amount of functional MCT11 in modified PBMC.For example, genetic modification can lead to the production of dysfunctional MCT11.In some examples, genetic modification leads to the production of unstable MCT11, thereby reducing the accumulation of functional MCT11.Gene modification can be any non-naturally occurring modification that leads to the reduction of the amount of MCT11.Non-limiting examples of genetic modification include point mutation, partial deletion, complete deletion, or insertion.

[0111] In some embodiments, modified PBMC comprises an inhibitor of MCT, for example, a small molecule inhibitor.In some examples, the small molecule inhibitor of MCT is one or more of 7ACC1, AR-C155858, UK5099, SR13800, CHC, AR-C141990 hydrochloride, AZD3965, or BAY8002.In a specific non-limiting example, modified PBMC comprises a small molecule inhibitor of MCT11.

[0112] How to generate modified PBMCs Also provided herein is a method of generating modified PBMCs of the present disclosure by introducing an agent, a non-naturally occurring genetic modification, or an inhibitor into PBMCs, thereby generating modified PBMCs with reduced Slc16a11 expression and / or reduced MCT11 activity. In some embodiments, PBMCs are obtained from a subject before introducing an agent, a non-naturally occurring genetic modification, or an inhibitor. PBMCs can be, for example, collected or isolated from a subject's blood sample, for example, a venous blood sample. Several techniques are known for isolating PBMCs, such as density centrifugation (Ficoll approach), isolation by cell preparation tubes (CPT), or isolation by SepMate™ tubes. In some examples, apheresis or leukapheresis is used to collect PBMCs. Red blood cell contamination can be evaluated, for example, by microscopic analysis of the sample. Flow cytometry techniques (e.g., FACS) can be used to assess the composition of isolated PBMC populations to identify, for example, monocytes (e.g., CD14), T cells (e.g., CD3, CD8, CD4), B cells (e.g., CD20), or NK cells (e.g., CD56). FACS techniques can also be used to enrich or deplete specific cell types from PBMCs (e.g., enrich or deplete CD14, CD3, CD8, CD4, CD28, CD20, CD56, or combinations thereof).

[0113] In some examples, T cells are isolated from a PBMC sample, or the PBMC sample is enriched for T cells, e.g., CD3 + or CD8 + The sample is isolated or enriched for T cells. In some examples, the sample is enriched by negative selection, e.g., by selecting and removing unwanted cell types from the sample (e.g., cell types other than T cells, and / or naive or memory T cells). In some examples, FACS is used to enrich for specific PBMCs, e.g., enrich for T cells (e.g., CD3 or CD8 positive T cells). FACS can also be used to isolate exhausted T cells, or in particular terminally exhausted T cells (PD-1 hi , TIM3+ ) can be assessed for the presence of T cells in a PBMC sample, or a PBMC sample can be sorted to enrich for or remove exhausted T cells, including terminally exhausted T cells. Antigen responsiveness of PBMCs can be assessed by measuring the release of cytokines, e.g., IFNγ, IL-1β, IL-6, IL-8, and TNFα.

[0114] In some examples, PBMCs are obtained from the subject to be treated, for example, the subject with cancer.In other examples, PBMCs are obtained from a donor subject, for example, the subject without cancer.In some examples, exhausted T cells are obtained from tumor biopsy or sample (for example, tumor infiltrating lymphocytes).

[0115] In some examples, the agent, non-naturally occurring genetic modification, or inhibitor is introduced into PBMC ex vivo. In such examples, such methods may further include selecting modified PBMCs with reduced Slc16a11 expression, reduced MCT11 activity, or both (e.g., purifying or isolating such cells from cells with no reduced Slc16a11 expression, no reduced MCT11 activity, or both). Such methods may also further include selecting modified PBMCs that are T cells, for example, T cells that are CD3+ or CD8+. Exemplary selection methods include using flow cytometry, panning, or magnetic separation. In some examples, the methods of the present disclosure may further include introducing the selected modified PBMCs with reduced Slc16a11 expression, reduced MCT11 activity, or both into a subject, for example, a subject with cancer to be treated by the selected modified PBMCs with reduced Slc16a11 expression, reduced MCT11 activity, or both.

[0116] In some examples, the agent, non-naturally occurring genetic modification, or inhibitor is administered to a subject, and the agent, non-naturally occurring genetic modification, or inhibitor is introduced in vivo into PBMCs (e.g., T cells or exhausted T cells (including terminal exhausted T cells)).

[0117] In some embodiments, the method of generating modified PBMCs further includes selecting a PBMC or cell type (e.g., T cells, exhausted T cells (including terminal exhausted T cells)), e.g., from a sample (e.g., tumor biopsy, blood, T cell population) prior to introducing the inhibitor, agent, or non-naturally occurring genetic modification. In some examples, the selected PBMCs are reactive to one or more of tumor-specific antigens, e.g., CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), or EGFR. In some examples, the selected PBMCs are T cells. In some examples, the T cells are CD8+ or CD3+. In some examples, the T cells are T cells of adoptive cell transfer (ACT) therapy, e.g., the selected exhausted T cells may include a chimeric antigen receptor (CAR) or an engineered T cell receptor (TCR) specific for a tumor antigen. In a further example, the selected PBMCs are tumor infiltrating lymphocytes (TILs). In some examples, the T cells are exhausted T cells, e.g., T cells that highly express programmed cell death 1 (PD1 hi ), positive for T-cell immunoglobulin-mucin domain-containing protein 3 (TIM3 + ) terminally exhausted T cells.

[0118] In some examples, the agent (RNAi or gRNA) or inhibitor (e.g., small molecule inhibitor) is introduced, for example, by contacting the PBMC with the agent or inhibitor, thereby generating modified PBMCs. In other examples, the inhibitor or agent is introduced by transfecting or transforming the PBMC with a nucleic acid molecule of the present disclosure encoding the inhibitor or agent, or a vector encoding a nucleic acid molecule of the present disclosure, thereby generating modified PBMCs. Methods for transforming or transfecting host cells are described herein and may include chemical methods (e.g., calcium phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), nucleofection, receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope / capsid-DNA complexes), and biological infection with viruses, e.g., recombinant viruses. In the case of infection with retroviruses, infectious retroviral particles are taken up by the target cell, resulting in reverse transcription of the retroviral RNA genome and integration of the resulting provirus into the cellular DNA. In some examples, ribonucleoprotein (RNP) complexes containing gRNA and Cas nuclease or inactive nuclease (e.g., Cas9 or Cas13d) are directly introduced into PBMCs. Methods for introducing RNP complexes into host cells have been described. For example, PBMCs can be nucleofected with RNP. In some examples, PBMCs are transfected with RNP by electroporation (see, e.g., Seki and Rutz, (2018) J Exp Med. 215(3): 985-997). In some examples, lipid-containing oligoaminoamides (lipo-OAAs) are used as carriers for intracellular delivery of RNP complexes (see, e.g., Kuhn et al. (2020) Bioconjugate Chem. 31(3):729-742).

[0119] In a specific, non-limiting example, the agent to be introduced is shRNA, and the shRNA is introduced into PBMC through infection with a viral vector that codes for shRNA.The introduction with a viral vector allows stable incorporation of shRNA and long-term knockdown of targeted gene.In another specific, non-limiting example, the agent to be introduced is siRNA, and the siRNA is introduced into the cytoplasm of transfectable host cell.

[0120] In some embodiments, non-naturally occurring genetic modification is introduced into PBMC. The genetic modification can be any non-naturally occurring modification that reduces the expression of Slc16a11 or reduces the activity of MCT11. Non-limiting examples of genetic modification include point mutation, partial deletion, complete deletion, or insertion. In some examples, the genetic modification is induced by targeted genome editing technology of Slc16a11 gene, such as CRISPR / Cas, zinc finger nuclease, or TALEN modification. Genome editing methods have been previously described, for example, in Nemudryi et al. (2014) Acta Naturae; 6(3): 19-40, the entirety of which is incorporated herein by reference. In some examples, the genetic modification reduces Slc16a11 expression, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or 100%. In some cases, the genetic modification reduces MCT11 activity, for example, by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or 100%. In some cases, the genetic modification reduces the lactate transport activity of MCT11, for example, by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or 100%.

[0121] In some embodiments, the modified PBMCs are incubated with at least one cytokine selected from the group consisting of interleukin 2 (IL-2), interleukin 7 (IL-7), and interleukin 15 (IL-15).

[0122] In some embodiments, introducing an agent, a non-naturally occurring genetic modification, or an inhibitor reduces the activity of MCT11 in modified PBMCs by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% compared to a suitable control (e.g., unmodified PBMC). In some examples, the genetic modification reduces the lactate transport activity of MCT11 by, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or 100% compared to a suitable control. In some cases, introducing an agent, a non-naturally occurring genetic modification, or an inhibitor reduces the protein level of MCT11 by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more compared to a suitable control. In some cases, introducing an agent, a non-naturally occurring genetic modification, or an inhibitor reduces the activity of MCT11 by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more compared to a suitable control. Reducing activity includes reducing any measurable biological function of MCT11, for example, by reducing the transport of monocarboxylate (e.g., lactate) to modified PBMCs.

[0123] In some embodiments, the expression of Slc16a11 or the decrease in activity of MCT11 in PBMCs increases effector function, reduces exhaustion, increases resistance to exhaustion, or a combination thereof. In some examples, the PBMCs are T cells, and the expression of Slc16a11 or the decrease in activity of MCT11 in PBMCs increases effector function of T cells, reduces exhaustion of T cells, or both. In further examples, the PBMCs are T cells, and the expression of Slc16a11 or the decrease in activity of MCT11 in PBMCs increases resistance to T cell exhaustion. In some examples, the modified PBMCs, e.g., modified T cells, of the present disclosure are not exhausted (e.g., PD1 hi and TIM3 + In some examples, the modified PBMCs, e.g., modified T cells, of the present disclosure become exhausted at a slower rate, e.g., do not become exhausted cells (e.g., PD1 hi and TIM3 + ) is increased by at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, or at least 99% compared to PBMC / T cells with native MCT11 expression / activity. In some examples, the modified PBMCs, e.g., modified T cells of the present disclosure, e.g., produce fewer exhausted cells (e.g., PD1 cells) compared to PBMCs / T cells with native MCT11 expression / activity. hi and TIM3 + ), resulting in a population of modified PBMCs, e.g., a modified T cell population, having exhausted cells reduced, e.g., by at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, or at least 99%.

[0124] IV. Pharmaceutical Compositions Also disclosed herein is a pharmaceutical composition useful for treating cancer or increasing response to immunotherapy.In some examples, the pharmaceutical composition comprises: (1) one or more of the RNAi of the present disclosure specific to Slc16a11, one or more gRNAs specific to Slc16a11, nucleic acid or vector encoding RNAi or gRNA, inhibitor (e.g., MCT11 inhibitor), or modified PBMC; and (2) a pharmaceutically acceptable carrier.In a specific non-limiting example, the pharmaceutical composition comprises modified PBMC and a pharmaceutically acceptable carrier.

[0125] In some examples, the pharmaceutical composition comprises one or more of: (1) RNAi specific to Slc16a11, gRNA specific to Slc16a11, nucleic acid or vector encoding RNAi or gRNA, MCT11 inhibitor, or modified PBMC; (2) cancer immunotherapy; and (3) a pharmaceutical acceptable carrier. In some examples, the cancer immunotherapy is ACT therapy (e.g., CAR-T, TCR, TIL), monoclonal antibody (e.g., anti-PD-1, anti-EGFR, anti-CTLA4), T cell agonist antibody, or oncolytic virus. In a specific non-limiting example, the pharmaceutical composition comprises modified PBMC, antibody cancer immunotherapy, and a pharmaceutical acceptable carrier. In another non-limiting example, the pharmaceutical composition comprises one or more of RNAi specific to Slc16a11, gRNA specific to Slc16a11, nucleic acid or vector encoding RNAi or gRNA; ACT immunotherapy (e.g., CAR-T, TCR, TIL); and a pharmaceutical acceptable carrier.

[0126] A "pharmaceutical acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., compatible with pharmaceutical administration (see, for example, Remington's Pharmaceutical Sciences, 23rd Edition, Academic Press, Elsevier, (2020)). Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, balanced salt solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles, such as fixed oils, may also be used. Supplementary active compounds may also be incorporated into the composition. Actual methods for preparing administrable compositions include those provided in Remington's Pharmaceutical Sciences, 23rd Edition, Academic Press, Elsevier, (2020). In some examples, the pharmaceutical composition is formulated for intravenous administration.

[0127] V. Methods of Treating Cancer Also disclosed herein is a method of treating cancer or tumor in a subject, by administering to the subject an effective amount of the disclosed composition (RNAi specific for Slc16a11, gRNA specific for Slc16a11, and Cas nuclease or inactive Cas nuclease (which may be administered as an RNP complex), a nucleic acid or vector encoding the RNAi or gRNA (in some examples, the vector also expresses Cas nuclease or inactive Cas nuclease), MCT11 inhibitor, modified PBMC, or pharmaceutical composition disclosed herein (hereinafter collectively referred to as "composition")), the cancer or tumor is treated. In certain non-limiting examples, the composition administered is an effective amount of modified PBMC disclosed herein. In some examples, PBMC are taken from the subject and modified ex vivo as disclosed herein, followed by introducing the modified cells into the subject. In some examples, PBMCs are modified in vivo, for example, by introducing into the subject a therapeutic molecule provided herein (e.g., an RNAi specific for Slc16a11, a gRNA specific for Slc16a11).

[0128] Also disclosed herein is the method for increasing the response to immunotherapy in a subject by administering an effective amount of the composition of the present disclosure, thereby increasing the response to immunotherapy.In a specific non-limiting example, the method is the method for increasing the response to immunotherapy in a subject, and the composition is the vector of the present disclosure that codes for RNAi or gRNA, or MCT11 inhibitor.

[0129] In some examples, the subject has a tumor or cancer. In some examples, the subject has a solid tumor or cancer, such as breast cancer (e.g., lobular carcinoma and ductal carcinoma, e.g., triple-negative breast cancer), sarcoma, cancer of the lung (e.g., non-small cell carcinoma, large cell carcinoma, squamous cell carcinoma, and adenocarcinoma), mesothelioma of the lung, colorectal adenocarcinoma, gastric carcinoma, prostate adenocarcinoma, ovarian cancer (e.g., serous cystadenocarcinoma and mucinous cystadenocarcinoma), ovarian germ cell tumor, testicular cancer and germ cell tumor, pancreatic adenocarcinoma, bile duct adenocarcinoma, hepatocellular carcinoma, bladder cancer (including, for example, transitional cell carcinoma, adenocarcinoma, and squamous cell carcinoma), renal cell adenocarcinoma, endometrial cancer (including, for example, adenocarcinoma and mixed Mullerian tumor (carcinosarcoma)), endocervical, epicervical, and vaginal cancer (e.g., and squamous cell carcinomas of each of these), tumors of the skin (e.g., squamous cell carcinoma, basal cell carcinoma, malignant melanoma, skin adnexal tumors, Kaposi's sarcoma, cutaneous lymphoma, tumors of the skin adnexal and various types of sarcomas and Merkel cell carcinoma), esophageal cancer, cancer of the nasopharynx and oropharynx (including squamous cell carcinomas and adenocarcinomas thereof), salivary gland cancer, tumors of the brain and central nervous system (including, e.g., tumors of glial, neuronal, and meningeal origin), tumors of the peripheral nerves, soft tissue sarcomas and sarcomas of bone and cartilage, head and neck squamous cell carcinoma (e.g., HPV-positive HNSCC), and lymphatic tumors (including B-cell and T-cell malignant lymphomas).

[0130] In some cases, the subject has a blood tumor or cancer, such as lymphatic, leukemia, or other types of leukemia.In certain cases, the tumor to be treated is a blood tumor, such as leukemia (e.g., acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), T-cell prolymphocytic leukemia (T-PLL), large granular lymphocytic leukemia, and adult T-cell leukemia), lymphoma (e.g., Hodgkin's lymphoma or non-Hodgkin's lymphoma), or myeloma.

[0131] In a non-limiting example, the subject has leukemia, colorectal cancer, cervical cancer, lung cancer, bladder cancer, head and neck cancer, pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), renal cell carcinoma, sarcoma, or adrenal cancer. In another non-limiting example, the subject has melanoma.

[0132] In some embodiments, the subject is receiving, has received, or will receive immunotherapy, such as a checkpoint inhibitor that targets PD-1, PD-L1, CTLA-4, CDK4, and / or CDK6. Exemplary checkpoint inhibitors include ipilimumab, nivolumab, pembrolizumab, atezolizumab, avelumab, durvalumab, cemiplimab, palbociclib, ribociclib, and abemaciclib. In some examples, the effective amount of the composition is an amount that increases the subject's response to immunotherapy (e.g., checkpoint inhibitor or ACT), such as an amount that is more effective in treating cancer or tumor when administered with immunotherapy compared to administering the immunotherapy (or composition) alone. In some examples, the effective amount is an amount that is synergistic when administered with immunotherapy, such as an amount that synergistically prevents, treats, reduces, and / or ameliorates one or more signs or symptoms of cancer.

[0133] In some examples, the effective amount of the composition is an amount sufficient to prevent, treat, reduce, and / or ameliorate one or more signs or symptoms of cancer in a subject.For example, an amount sufficient to reduce tumor size or tumor mass in a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%, compared to baseline measurements or suitable controls for the same subject.In some examples, the effective amount is an amount sufficient to inhibit or delay metastasis in a subject.For example, by reducing the spread of tumor in a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%, compared to baseline measurements or suitable controls for the same subject. In some examples, an effective amount is an amount that increases the life expectancy of a subject, for example, by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 400%, or more.In other examples, an effective amount is an amount that is sufficient to reduce tumor density in a subject, for example, by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%, compared to the baseline measurement of the same subject or other suitable control.Non-limiting examples of suitable controls include untreated subjects or subjects that do not receive the composition (e.g., subjects that receive other agents or alternative treatments). In further examples, an effective amount is an amount sufficient to target and eliminate tumor cells, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or even 100%, as compared to a suitable control.

[0134] In some examples, the method reduces the expression of Slc16a11 or the activity of MCT11 in a target tissue or cell in a subject, such as PBMC, T cell, or exhausted T cell (including terminal exhausted T cell). In some examples, the expression of Slc16a11 or the activity of MCT11 is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% compared to a suitable control (e.g., an untreated subject or the baseline reading of the same subject before treatment). In some examples, the method reduces the protein level of MCT11 (or functional MCT11) by, for example, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% compared to a suitable control (e.g., untreated subject or baseline reading of the same subject before treatment). In some examples, the method reduces the expression or accumulation of mRNA transcripts of Slc16a11 by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% compared to a suitable control (e.g., untreated subject or baseline reading of the same subject before treatment).

[0135] In some examples, reducing the expression of Slc16a11 or the activity of MCT11 increases T cell effector function or reduces T cell exhaustion.In some examples, reducing the expression of Slc16a11 or the activity of MCT11 reduces (including prevents or inhibits) T cell exhaustion or increases resistance to T cell exhaustion (including prevents or inhibits T cell exhaustion).In some examples, increasing T cell response or reducing T cell exhaustion in a subject increases the response to immunotherapy in a subject.

[0136] In a specific, non-limiting example, the method includes administering modified PBMCs and a pharma- ceutically acceptable carrier to a subject. When PBMCs of the present disclosure are administered, the composition contains about 10% modified PBMCs. 4 ~10 12 (e.g., about 10 cells 4 ~10 8 pieces, about 10 cells 6 ~10 8 pieces, about 10 cells 6 ~10 12 pieces, about 10 cells 8 ~10 12 Approximately 10 pieces or cells 9 ~10 10 For example, the composition may comprise about 10 modified PBMCs. 4 ~10 10 (e.g., about 10 cells 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 In some cases, about 10 cells / kg may be administered to a subject. 10 In certain examples, the composition comprises at least 10 modified PBMCs / kg. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 In a specific, non-limiting example, about 10 modified PBMCs 8 ~10 10 The subject is administered with a small molecule inhibitor of MCT (e.g., MCT11) before, after, or substantially simultaneously with modified PBMC.The appropriate dose can be determined by a skilled clinician based on factors such as the subject, the cancer to be treated, treatment history, tumor mass and type, clinical stage and grade of disease, subject's overall health, and other factors.In some examples, the subject is administered with a small molecule inhibitor of MCT (e.g., MCT11) before, after, or substantially simultaneously with modified PBMC.

[0137] In some examples, non-modified lymphocytes are depleted in the subject prior to administering the composition of the present disclosure. In some examples, the subject is also administered one or more cytokines (e.g., IL-2, IL-7, IL-15, IL-21, and / or IL-12), and / or additional ACT therapy administered to the subject in combination, for example, to support the survival and / or growth of the modified PBMCs of the present disclosure. In certain non-limiting examples, at least one of IL-2, IL-7, and IL-15 is also administered to the subject. The cytokine(s) are administered before, after, or substantially simultaneously with the composition. In certain examples, at least one cytokine (e.g., IL-2, IL-7, and / or IL-15) is administered, for example, simultaneously with the composition. In some examples, the modified PBMCs are reactive to tumor-specific antigens in the subject with cancer. In some examples, the antigen is one or more of CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), or EGFR.

[0138] The administration of any of the compositions of the present disclosure can be local or systemic.Exemplary administration routes include, but are not limited to, oral, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous), sublingual, rectal, transdermal (e.g., external), intranasal, vaginal, and inhalation routes.In some cases, the agent is injected or injected into or near the tumor (local administration), or administered into the peritoneal cavity.The appropriate administration route can be determined by a skilled clinician based on factors such as the subject, the condition being treated, and other factors.

[0139] Multiple doses of the composition can be administered to the subject.For example, the composition can be administered daily, every 2 days, twice a week, weekly, every 2 weeks, every 3 weeks, monthly, or less frequently.A skilled clinician can select the administration schedule based on the subject, the condition to be treated, the history of previous treatment, and other factors.

[0140] In some examples, the subject receives one or more of a treatment in addition to the composition, such as surgery, radiation therapy, chemotherapy, biotherapy, immunotherapy, or other therapeutic agent. Exemplary chemotherapeutic agents include (but are not limited to) alkylating agents, such as nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, melphalan, uracil mustard, or chlorambucil), alkylsulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomustine, semustine, streptozocin, or dacarbazine); antimetabolites, such as folic acid analogs (e.g., methotrexate), pyrimidine analogs (e.g., 5-FU or or cytarabine), and purine analogs, such as mercaptopurine or thioguanine; or natural products, such as vinca alkaloids (e.g., vinblastine, vincristine, or vindesine), epipodophyllotoxins (e.g., etoposide or teniposide), antibiotics (e.g., dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, or mitomycin C), and enzymes (e.g., L-asparaginase). Additional agents include platinum conformational complexes (e.g., cis-diamine-dichloroplatinum II, also known as cisplatin), substituted ureas (e.g., hydroxyurea), methylhydrazine derivatives (e.g., procarbazine), and adrenocrotical suppressants (e.g., mitotane and aminoglutethimide); hormones and antagonists such as corticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate), estrogens (e.g., diethylstilbestrol and ethinyl estradiol), antiestrogens (e.g., tamoxifen), and androgens (e.g., testosterone proprionate and fluoxymesterone).Examples of the most commonly used chemotherapy drugs include adriamycin, melphalan (Alkeran®), Ara-C (cytarabine), carmustine, busulfan, lomustine, carboplatin, cisplatin, cyclophosphamide (Cytoxan®), daunorubicin, dacarbazine, 5-fluorouracil, fludarabine, hydroxyurea, idarubicin, ifosfamide, methotrexate, mithramycin, mitomycin, mitoxantrone, nitrogen mustard, paclitaxel ( or other taxanes, e.g., docetaxel), vinblastine, vincristine, VP-16, while newer drugs include gemcitabine (Gemzar®), trastuzumab (Herceptin®), irinotecan (CPT-11), leustatin, navelbine, rituximab (Rituxan®) imatinib (STI-571), topotecan (Hycamtin®), capecitabine, ibritumomab (Zevalin®), and calcitriol. A skilled clinician can select an appropriate additional treatment for a subject (from the treatments described herein or other current treatments) depending on factors such as the subject, the cancer being treated, treatment history, and other factors.

[0141] In some examples, the subject is administered an additional therapeutic agent, such as a monoclonal antibody cancer immunotherapy (e.g., anti-CTLA-4, anti-PD1, or anti-PDL1), a T cell agonist antibody, an oncolytic virus, an adoptive cell transfer (ACT) therapy, or any combination of two or more thereof. The administration of the additional therapeutic agent may be before, after, or substantially simultaneously with the administration of the composition of the present disclosure. In some examples, the additional therapeutic agent is a cell cycle inhibitor or a checkpoint inhibitor. In some examples, the checkpoint inhibitor targets PD-1, PD-L1, CTLA-4, CDK4, and / or CDK6. Exemplary inhibitors include ipilimumab, nivolumab, pembrolizumab, atezolizumab, avelumab, durvalumab, cemiplimab, palbociclib, ribociclib, and abemaciclib.

[0142] In some examples, the subject is administered an ACT therapy, such as a chimeric antigen receptor (CAR)-expressing T cell, an engineered TCR T cell, or a tumor infiltrating lymphocyte (TIL). In some examples, the subject is administered an effective amount of the composition and the ACT therapy, the effective amount of the composition being an amount that increases the effectiveness of the ACT (e.g., increases the removal of cancerous cells compared to the ACT therapy alone).

[0143] The additional therapeutic agent may be administered substantially simultaneously with the composition of the present disclosure. In some examples, the additional therapeutic agent is administered, for example, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 12 days, at least 14 days, at least 3 weeks, at least 4 weeks, at least 1 month, or more, before administration of the composition. Multiple doses of the additional therapeutic agent may be administered to the subject, for example, twice daily, once daily, every 2 days, twice weekly, weekly, every other week, every 3 weeks, monthly, or less frequently. A skilled clinician can select the administration schedule based on the subject, the condition being treated, the history of previous treatments, tumor volume and type, the clinical stage and grade of the disease, and the subject's general health, as well as other factors.

[0144] VI. Kits Also provided are compositions and kits that can be used with the methods of the present disclosure. In some examples, the composition or kit comprises one or more of the following: RNAi specific to Slc16a11, gRNA specific to Slc16a11, a nucleic acid or vector encoding RNAi or gRNA, MCT11 inhibitor, and modified PBMC, for example, together with a pharma- ceutically acceptable carrier. In some examples, the kit comprises one or more gRNAs specific to Slc16a11 and Cas nuclease or Cas inactive nuclease (can be RNP complex). In a specific, non-limiting example, the kit comprises a vector encoding one or more gRNAs specific to Slc16a11, and the vector can further encode Cas nuclease or Cas inactive nuclease. In some examples, the kit comprises one or more of the RNAi of the present disclosure that is specific to Slc16a11. In a further example, the kit comprises modified PBMC of the present disclosure.

[0145] The kit may include additional reagents, such as one or more of anti-CD3, anti-CD28, IL-2, and IL-15. In some examples, the reagents are in separate containers. In one example, anti-CD3 and anti-CD28 are in the same container, for example, on beads. In some examples, the kit further includes one or more of transfection reagents, culture media, antibiotics, cytokines (e.g., IL-2, IL-15, and IL-7), and optionally such reagents are in separate containers. In some examples, the kit or composition includes a medium capable of culturing or expanding PBMCs ex vivo, such as AIM V® medium. EXAMPLES

[0146] Example 1 material and method This example provides the materials and methods used to generate the data discussed in the following examples.

[0147] RNA-seq C57 / BL6 mice were implanted with B16 melanoma. When tumors reached 7 mm in either direction, lymph nodes and tumors were harvested and processed to detect CD8 + T cells were sorted based on CD44, PD-1, and Tim-3 expression from lymph nodes (LNs) and tumor-infiltrating lymphocytes (TILs). RNA-seq was performed on 1,000 cells isolated from the following compartments: LN CD44 hi , TIL PD-1 lo , TIL PD-1 mid , TIL PD-1 hi , and TIL PD-1 hi Tim3 + CD4 from LNs and TILs + T cells were sequenced from separate experiments. RNA was prepared from cell lysates of 1000 cells using the Clontech SMARTer® kit and sequenced on an Illumina NextSEQ®. TPM was calculated after alignment with the mouse genome (mm9 assembly). A plot of transcripts per million (TPM) of Slc16a11 (encoding MCT11) is shown (Figure 3A).

[0148] Lactate uptake C57 / BL6 mice were implanted with B16 melanoma as described above to generate TIL preparations. TILs were loaded with pH-sensitive dye pHrodo® Red and incubated in Hank's Balanced Salt Solution (HBSS). Lactic acid was pulsed for 30 minutes, and pH changes were measured by flow cytometry as described in Watson et al. (2021) Nature, 591: 645-651, the entirety of which is incorporated herein by reference.

[0149] Gain- and loss-of-function mutants OT-I (OVA-specific) Thy1.1+ congenic T cells were activated overnight with cognate peptide and splenocytes, after which T cells were retrovirally transduced with an shRNA construct targeting Slc16a11 and then transferred into congenic mismatched (Thy1.2+) hosts bearing B16-OVA tumors. Eight days later, TILs were harvested and stained for PD-1 and Tim-3 as a readout of terminal differentiation. Separate TIL preparations were also stained intracellularly for IFN-γ and TNFα to measure cytokine production after overnight restimulation with OVA peptide in the presence of brefeldin A.

[0150] Conditional knockout of MCT11 (Slc16a11) We generated conditional knockout mice of Slc16a11 (MCT11) COIN ×CD4 cre ). Wild-type mice or MCT11 conditional knockout (MCT11 COIN ×CD4 cre ) Mice were inoculated with B16 tumor cells. Tumor growth was followed. T cell infiltration (percent viable CD8+ cells per tumor area) and cytokine production after restimulation were also recorded.

[0151] Cas9-gRNA nucleofection OT-I T cells were isolated from TCR-Tg mice and nucleofected with Cas9:gRNA ribonucleoprotein complexes targeting Slc16a11 (gRNA of SEQ ID NO: 7) using a Lonza 4D-Nucleofector®. Cells were then activated with anti-CD3 / CD28 and expanded to therapeutic doses in vitro using recombinant IL-2. In parallel, host mice were inoculated with B16-OVA cells. When tumors reached a diameter of 3 mm, the expanded T cells (cells 10 7 Tumor sizes were measured three times weekly until tumors reached 15 mm in either direction or until day 30 of the experiment.

[0152] Example 2 Discovery of MCT11 in exhausted T cells Using RNA-seq and metabolic profiling, we found that terminally exhausted T cells (functionally impaired T cells common in the cancer milieu) highly express a novel nutrient transporter called MCT11 (encoded by Slc16a11) (Figures 3A and 3B). MCT11 likely transports monocarboxylates, short-chain carbon sources, e.g., lactate, pyruvate, and short-chain fatty acids. We confirmed the upregulation of MCT11 in human and mouse exhausted T cells by flow cytometry and RNA-Seq (see Figures 2A-2C and Figures 3A-3B). Furthermore, we confirmed that terminally exhausted T cells specifically take up monocarboxylates, e.g., lactate (Figure 4). However, MCT11 is not expressed on the surface of exhausted T cells induced by chronic viral infection. These findings suggest that MCT11 may be important in providing nutrient influx to terminally exhausted T cells.

[0153] Example 3 MCT11 gain- and loss-of-function T cells in which MCT11 was knocked down did not progress to complete exhaustion (PD1 hi However, Tim-3 + In companion experiments, OT-I T cells were transduced with a retroviral overexpression vector encoding Slc16a11. These T cells were then subjected to a PD1 hi Tim3 + ) and demonstrated poor cytokine production (Figure 5). Thus, deletion of MCT11 in tumor-specific T cells transferred into tumor-bearing mice led to increased T cell function and reduced exhaustion, whereas overexpression of MCT11 in tumor-specific T cells accelerated the development of an exhausted and dysfunctional phenotype.

[0154] Tumor growth and T cell function were analyzed using T cell (MCT11 COIN ×CD4cre The effect of Slc16a11 on the expression of MCT11 in wild-type (WT) mice was investigated. COIN ×CD4 cre Mice were inoculated with B16 melanoma (Figure 6A). COIN ×CD4 cre Mice had smaller tumor volumes (Figure 6B), increased T cell infiltration, and increased T cell function (as measured by cytokine production after restimulation) (Figure 6C) compared to WT. MCT11 knockout was confirmed by antibody staining; MCT11 mAb did not stain exhausted T cells in mice with conditional deletion of MCT11 (Figure 6D).

[0155] Example 4 CRISPR / Cas9-mediated deletion of Slc16a11 OT-I OVA-specific T cells were nucleofected with Cas9:gRNA ribonucleoprotein complex to delete Slc16a11. Mice transferred with MCT11 knockout T cells (MCT11 KO OT-I) had smaller tumor areas than either control (no T cell control or treated with control OT-I cells) (Figure 7). Thus, MCT11 KO T cells were superior therapeutic cells after only one administration, showing lymphodepletion or supplemental IL-2.

[0156] Example 5 Improving cell therapy In this example, Slc16a11 is functionally deleted from T cells used in adoptive cell transfer (ACT) therapy. Functional deletion can be achieved, for example, by using CRISPR / Cas system or RNAi (e.g., siRNA duplex or shRNA vector) to reduce Slc16a11 expression in T cells. In one example, Cas9 or dCas9 is used to target / edit Slc16a11 gene in T cells. In another example, Cas13d, dCas13d or RNAi is used to target / reduce Slc16a11 RNA in T cells.

[0157] In one example, CRISPR / Cas (e.g., Cas9, dCas9, dCas13d, or Cas13) or RNAi is used to functionally delete Slc16a11 in peripheral blood mononuclear cell (PBMC)-derived T cells (e.g., target / edit gene or target / reduce mRNA). The resulting Slc16a11 KO T cells are activated and transduced with a vector encoding a chimeric antigen receptor (CAR) that recognizes tumor-associated antigens. Exemplary tumor targets include, but are not limited to, CD19, BCMA, mesothelin, and MUC1. A subject with a tumor that expresses a tumor-associated antigen is administered a therapeutically effective amount of Slc16a11 KO CAR-T cells to treat cancer or tumor.

[0158] In another example, CRISPR-Cas9 or RNAi is used to functionally delete Slc16a11 in tumor infiltrating lymphocyte (TIL) T cells isolated from a patient with cancer, for example, from a tumor biopsy of the patient. The Slc16a11 KO TIL T cells are expanded with IL-2, and then administered to the patient in a therapeutically effective amount to treat cancer or tumor. In yet another example, CRISPR-Cas9 or RNAi is used to functionally delete Slc16a11 in T cell receptor (TCR)-engineered T cells (e.g., NY-ESO-1). A therapeutically effective amount of Slc16a11 KO TCR T cells is administered to a patient in need of cancer or tumor treatment.

[0159] In view of the many possible embodiments to which the principles of this disclosure may be applied, it should be recognized that the illustrated embodiments are merely examples of the disclosure and should not be construed as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. Modified peripheral blood mononuclear cells (PBMCs) with reduced Slc16a11 expression, reduced MCT11 activity, or both, wherein 1) an agent that reduces Slc16a11 expression; or 2) a non-naturally occurring genetic modification that reduces the amount of functional MCT11 are included in the modified peripheral blood mononuclear cells (PBMCs).

2. The modified PBMC according to claim 1, comprising the agent that reduces Slc16a11 expression, wherein the agent comprises an inhibitory RNA (RNAi) specific for Slc16a11 or a guide RNA (gRNA) specific for Slc16a11.

3. The modified PBMC according to claim 2, wherein the RNAi is a small hairpin RNA (shRNA) molecule, a small interfering RNA (siRNA) molecule, or an antisense RNA molecule.

4. The agent is a) the RNAi specific for the Slc16a11 gene or transcript, wherein the RNAi specific for Slc16a11 comprises at least 90% complementarity with a part of the Slc16a11 gene or transcript, b) the gRNA specific for the Slc16a11 gene or transcript, wherein the gRNA specific for Slc16a11 comprises at least 90% sequence identity with a part of the Slc16a11 gene or transcript, or c) the gRNA specific for the Slc16a11 gene or transcript, wherein the gRNA specific for Slc16a11 comprises at least 90% sequence identity with a part of the Slc16a11 gene or transcript, and a heterologous nucleic acid molecule encoding a Cas nuclease are included in the modified PBMC according to claim 2.

5. The modified PBMC according to claim 4, comprising an expression vector encoding the heterologous nucleic acid.

6. c) the modified PBMC according to claim 4, comprising the gRNA specific for the Slc16a11 gene or transcript and the Cas nuclease, wherein the Cas nuclease is a Cas9, dCas9, Cas13d, or dCas13d nuclease.

7. The modified PBMC according to claim 1, wherein the genetic modification is a point mutation, partial deletion, complete deletion, or insertion of Slc16a11 that reduces Slc16a11 expression and / or reduces MCT11 activity.

8. The modified PBMC according to claim 1, which is a T cell.

9. The modified PBMC according to claim 8, wherein the T cell is a CD8+ T cell or a CD3+ T cell.

10. The modified PBMC according to claim 8, wherein the T cell is a therapeutic T cell.

11. The modified PBMC according to claim 8, wherein the T cell is a tumor infiltrating lymphocyte (TIL).

12. The modified PBMC according to claim 8, wherein the T cell comprises a chimeric antigen receptor (CAR) or an engineered T cell receptor (TCR).

13. The modified PBMC according to claim 8, wherein the T cell is reactive to a tumor specific antigen.

14. The modified PBMC according to claim 13, wherein the tumor specific antigen is one or more of CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), or EGFR.

15. The modified PBMC according to claim 8, wherein the T cell is an exhausted T cell.

16. A method for generating the modified PBMC according to claim 1, comprising introducing into the PBMC (1) the agent that reduces the expression of Slc16a11, or (2) the non-naturally occurring genetic modification that reduces the amount of functional MCT11, thereby generating the modified PBMC in which the expression of Slc16a11 is reduced, the activity of MCT11 is reduced, or both.

17. The method according to claim 16, wherein the PBMC is a T cell.

18. The method according to claim 16, further comprising incubating the modified PBMC with interleukin 2 (IL-2), interleukin 7 (IL-7), interleukin 15 (IL-15), or a combination thereof.

19. The method according to claim 16, wherein the modified PBMC is reactive to a tumor specific antigen.

20. The method according to claim 19, wherein the tumor specific antigen is one or more of CD19, CD20, BCMA, MUC1, PSA, CEA, HER1, HER2, TRP-2, EpCAM, GPC3, mesothelin 1 (MSLN), and EGFR.

21. The method according to claim 16, wherein the reduction of the expression of Slc16a11, the reduction of the activity of MCT11, or both increases the effector function of the T cell.

22. The method according to claim 16, wherein a reduction in the expression of Slc16a11, a reduction in the activity of MCT11, or both, reduces the exhaustion of said T cells.

23. Selecting said modified PBMCs in which the expression of Slc16a11 is reduced, the activity of MCT11 is reduced, or both; further comprising, and optionally, said selected modified PBMCs in which the expression of Slc16a11 is reduced, the activity of MCT11 is reduced, or both, are for introduction into a subject, the method according to claim 16.

24. The method according to claim 23, wherein said selecting step comprises the use of flow cytometry, panning, or magnetic separation.

25. The method according to claim 23, wherein said subject has cancer.

26. Modified PBMCs according to any one of claims 1 to 15, or modified PBMCs generated by the method according to any one of claims 16 to 25; and a pharmaceutically acceptable carrier A pharmaceutical composition comprising.

27. The pharmaceutical composition according to claim 26, for use in a method for treating cancer or a tumor in a subject.

28. A composition for use in a method for treating cancer or a tumor in a subject, said composition comprising modified PBMCs according to any one of claims 1 to 15, or modified PBMCs generated by the method according to any one of claims 16 to 25.

29. The composition according to claim 28, wherein said modified PBMCs are autologous to said subject.

30. The composition according to claim 28, wherein said modified PBMCs are allogeneic to said subject.

31. The composition according to claim 28, wherein a therapeutically effective amount of IL-2, IL-7, and / or IL-15 is further administered to said subject.

32. The composition according to claim 28, wherein said subject is further treated by one or more of surgery, radiation therapy, chemotherapy, biotherapy, or immunotherapy.

33. The composition according to claim 28, wherein a therapeutically effective amount of one or more of a checkpoint inhibitor, a T cell agonist antibody, an oncolytic virus, or adoptive cell transfer (ACT) immunotherapy is further administered to said subject.

34. The composition according to claim 28, wherein non-modified lymphocytes are depleted in the subject prior to administration of the modified PBMCs.

35. The composition according to claim 28, wherein the cancer or tumor is leukemia, colorectal cancer, melanoma, cervical cancer, lung cancer, ovarian cancer, bladder cancer, breast cancer, pancreatic cancer, renal cell carcinoma, prostate cancer, or head and neck cancer.

36. The pharmaceutical composition according to claim 26, which is an intravenous formulation.

Images