Methods and compositions for treating angiotensinogen (AGT)-related disorders

JP2024527304A5Pending Publication Date: 2025-07-09ALNYLAM PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023579695
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-11-08
Filing Date
2022-06-29
Publication Date
2025-07-09

Smart Images

  • Figure 2023278576000001
    Figure 2023278576000001
  • Figure 2023278576000002
    Figure 2023278576000002
Patent Text Reader

Abstract

The present invention relates to methods of inhibiting expression of the AGT gene in a subject using RNAi agents, such as double-stranded RNAi agents, that target the AGT gene, as well as methods of treating a subject with an AGT-related disorder, such as hypertension. The present invention also relates to methods of using such RNAi agents to inhibit expression of the AGT gene and reduce blood pressure levels in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 216,758, filed June 30, 2021, and U.S. Provisional Patent Application No. 63 / 276,808, filed November 8, 2021. The entire contents of each of the foregoing applications are incorporated herein by reference. [Background technology]

[0002] Background of the Invention The renin-angiotensin-aldosterone system (RAAS) plays an important role in regulating blood pressure. The RAAS cascade begins with the release of renin into the circulation by juxtaglomerular cells in the kidney. Renin secretion is stimulated by several factors, including Na+ loading in the distal tubule, β-sympathetic nerve stimulation, or reduced renal perfusion. Active renin in the plasma cleaves angiotensinogen (produced by the liver) to angiotensin I, which is then converted to angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Most of the effects of angiotensin II on the RAAS are exerted through its binding to the angiotensin II type 1 receptor (AT1R), resulting in arterial vasoconstriction, tubular and glomerular actions such as enhanced Na+ reabsorption, or regulation of glomerular filtration rate. Furthermore, together with other stimuli such as adrenocorticotropic hormone, antidiuretic hormone, catecholamines, endothelin, serotonin, and Mg2+ and K+ levels, AT1R stimulation leads to aldosterone release, which in turn promotes Na+ and K+ excretion in the renal distal convoluted tubule.

[0003] For example, dysregulation of the RAAS leading to excessive angiotensin II production or AT1R stimulation results in hypertension, which can lead to, for example, increased oxidative stress, inflammation, hypertrophy, and promoted fibrosis in the heart, kidneys, and arteries, resulting in, for example, left ventricular fibrosis, arterial remodeling, and glomerulosclerosis.

[0004] Hypertension is the most common and manageable disease in developed countries, affecting 20–50% of the adult population. Hypertension is a major risk factor for a variety of diseases, disorders, and conditions, including shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms (e.g., aortic aneurysms), peripheral arterial disease, cardiac damage (e.g., cardiac enlargement or hypertrophy), and other cardiovascular-related diseases, disorders, or conditions. Furthermore, hypertension is a significant risk factor for cardiovascular morbidity and mortality, accounting for or contributing to 62% of all strokes and 49% of all heart disease cases.In 2017, changes to the guidelines for the diagnosis, prevention, and treatment of hypertension were developed, providing lower blood pressure targets to further reduce the risk of developing hypertension-related diseases and disorders (e.g., Reboussin et al. Systematic Review for the 2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41517-8. doi: 10.1016 / j.jacc.2017.11.004, and Whelton et al. (2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41519-1. doi: 10.1016 / j.jacc.2017.11.006).

[0005] Despite the number of antihypertensive drugs available for the treatment of hypertension, more than two-thirds of subjects are not controlled with a single antihypertensive agent and require two or more agents selected from different drug classes. This further reduces the number of subjects whose blood pressure is controlled, as adherence decreases and side effects increase with the increasing number of agents. Furthermore, several studies have suggested a potential relationship between chronic use of antihypertensive medications and declining kidney function, and antihypertensive drugs used to control blood pressure have been shown to affect kidney function independently of their effect on blood pressure (Tomlinson,et al (2013) PLoS ONE 8(11) Article ID e78465; The SPRINT Research Group (2015) NEJM 373(22):2103-2116, ClinicalTrials.gov number, NCT01206062; Kidney Disease: Improving Global Outcomes (KDIGO) CKD Work Group (2013) Kidney International Supplements 3:1-150; Kamaroff,et al. (2018( Hindawi International J Chron Dis Article ID 1382705 | https: / / doi.org / 10.1155 / 2018 / 1382705).

[0006] Thus, there is a need in the art for additional methods and therapies for treating subjects with hypertension. Summary of the Invention

[0007] The present invention provides methods and compositions for inhibiting the expression of the angiotensinogen (AGT) gene, methods and compositions for treating a subject with a disorder that would benefit from reduced AGT expression, methods and compositions for treating a subject with an AGT-related disorder, and methods and compositions for lowering blood pressure in a subject. The methods include administering to the subject a fixed dose of an RNAi agent, such as a double-stranded RNAi agent, that targets the AGT gene.

[0008] In one aspect, the present invention provides a method for inhibiting expression of the angiotensinogen (AGT) gene in a subject. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about A fixed dose of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof is administered to a subject. The fixed dose is 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, for example, about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg. The method includes administering to an elephant a double-stranded RNAi agent or a salt thereof, wherein the double-stranded RNAi agent or a salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10), and the double-stranded RNAi agent or a salt thereof comprises at least one modified nucleotide, wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification, thereby inhibiting expression of the AGT gene in the subject.

[0009] In another aspect, the present invention provides a method of treating a subject who would benefit from reduced angiotensinogen (AGT) expression, e.g., a subject at risk of developing an AGT-related disorder, e.g., hypertension. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 300 mg, about 300 mg to about 400 mg, about 300 mg to about 5 ... A double-stranded ribonucleic acid (RNAi) agent or a salt thereof is administered to a subject at a fixed dose of about 00 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, for example, about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg. administering to a subject that would benefit from reduced AGT expression, wherein the double-stranded RNAi agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10), and wherein the double-stranded RNAi agent or salt thereof comprises at least one modified nucleotide, wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification, thereby treating a subject that would benefit from reduced AGT expression.

[0010] In one aspect, the present invention provides a method for treating a subject having an angiotensinogen (AGT)-related disorder, e.g., hypertension. The method includes administering a dose of AGT to a subject in the range of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, A double-stranded ribonucleic acid (RNAi) agent or a salt thereof is administered at a fixed dose of about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, for example, about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg. administering to a subject a double-stranded RNAi agent or a salt thereof comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10), and wherein the double-stranded RNAi agent or salt thereof comprises at least one modified nucleotide, wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification, thereby treating the subject having an AGT-associated disorder.

[0011] In another aspect, the present invention provides a method for reducing blood pressure levels in a subject, e.g., a subject having an AGT-related disorder, such as hypertension. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, A double-stranded ribonucleic acid (RNAi) agent or a salt thereof is administered at a fixed dose of about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, for example, about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg. administering to a subject a double-stranded RNAi agent or a salt thereof comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10), wherein the double-stranded RNAi agent or a salt thereof comprises at least one modified nucleotide, wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification, thereby reducing blood pressure levels in the subject.

[0012] In some embodiments, the fixed dose is administered to the subject at monthly intervals, in other embodiments, the fixed dose is administered to the subject at quarterly intervals, and in some embodiments, the fixed dose is administered to the subject at semi-annual intervals.

[0013] In some embodiments, the subject is administered a fixed dose of about 50 mg to about 200 mg. In other embodiments, the subject is administered a fixed dose of about 200 mg to about 400 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg to about 800 mg.

[0014] In some embodiments, the subject is administered a fixed dose of about 100 mg. In some embodiments, the subject is administered a fixed dose of about 200 mg. In some embodiments, the subject is administered a fixed dose of about 300 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg. In some embodiments, the subject is administered a fixed dose of about 500 mg. In other embodiments, the subject is administered a fixed dose of about 600 mg. In some embodiments, the subject is administered a fixed dose of about 800 mg.

[0015] In some embodiments, the subject is administered a fixed dose of about 150 mg about once every six months.

[0016] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every six months.

[0017] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every three months.

[0018] In some embodiments, the subject is administered a fixed dose of about 600 mg about once every six months.

[0019] In some embodiments, double-stranded RNAi agent or its salt is administered to subject subcutaneously or intravenously.In some embodiments, subcutaneous administration is subcutaneous injection, for example, subcutaneous self-administration.In other embodiments, intravenous administration is intravenous injection.

[0020] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0021] In other embodiments, the antisense strand comprises a nucleotide sequence comprising at least 21 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0022] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 22 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0023] In some embodiments, the antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0024] In some embodiments, the antisense strand consists of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0025] In some embodiments, substantially all of the nucleotides in the sense strand are modified nucleotides, while in other embodiments, substantially all of the nucleotides in the antisense strand are modified nucleotides.

[0026] In some embodiments, all nucleotides in the sense strand are modified nucleotides. In some embodiments, all nucleotides in the antisense strand are modified nucleotides.

[0027] In some embodiments, at least one of the nucleotide modifications is a deoxy-nucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino modified nucleotide, a 2'-O-allyl modified nucleotide, a 2'-C-alkyl modified nucleotide, a 2'-hydroxyl modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl The modified nucleotide is selected from the group consisting of morpholino nucleotides, phosphoramidates, non-natural base-containing nucleotides, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, nucleotides containing 5'-phosphate mimics, thermally destabilized nucleotides, glycol-modified nucleotides (GNAs), and 2-O-(N-methylacetamide)-modified nucleotides, and combinations thereof.

[0028] In some embodiments, at least one of the nucleotide modifications is selected from the group consisting of deoxy-nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, glycol-modified nucleotides (GNAs), and 2-O-(N-methylacetamide) modified nucleotides, and combinations thereof.

[0029] In some embodiments, the double-stranded region is 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-23 nucleotide pairs in length, or 21 nucleotide pairs in length.

[0030] In some embodiments, each strand is independently 19-23 nucleotides in length, 19-25 nucleotides in length, or 21-23 nucleotides in length, hi some embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0031] In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide or a 3' overhang of at least 2 nucleotides.

[0032] In some embodiments, the double-stranded RNAi agent or its salt further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. In some embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-end of one strand. In some embodiments, the strand is an antisense strand. In other embodiments, the strand is a sense strand.

[0033] In some embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-end of one strand. In some embodiments, the strand is the antisense strand. In other embodiments, the strand is the sense strand.

[0034] In some embodiments, the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5' and 3' ends of one strand, hi some embodiments, the strand is the antisense strand.

[0035] In one aspect, the present invention provides a method for inhibiting expression of the angiotensinogen (AGT) gene in a subject. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg). The method includes administering to a subject a fixed dose of about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or salt thereof, wherein the double-stranded RNAi agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises a modified nucleotide sequence: usGfsuac(Tgn)cucauugUfgGfaugac The sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12), and the chemical modifications are a 2'-O-methyladenosine-3'-phosphate, c 2'-O-methylcytidine-3'-phosphate, g 2'-O-methylguanosine-3'-phosphate, phosphate, u is defined as 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is a phosphorothioate linkage, thereby inhibiting expression of the AGT gene in a subject.

[0036] In another aspect, the present invention provides a method of treating a subject who would benefit from reduced AGT expression, e.g., a subject at risk of developing an AGT-associated disorder, e.g., hypertension. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg). g, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent or salt thereof to a subject, wherein the double-stranded RNAi or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises a modified nucleotide sequence: usGfsuac(Tgn)cucauugUfgGfaugacsgs a (SEQ ID NO: 11), and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12), wherein the chemical modifications are a 2'-O-methyladenosine-3'-phosphate, c 2'-O-methylcytidine-3'-phosphate, and g 2'-O-methylguanosine-3'-phosphate. where u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is a phosphorothioate linkage, thereby treating a subject who would benefit from reduced AGT expression.

[0037] In one aspect, the present invention provides a method for treating a subject having an AGT-related disorder, e.g., hypertension. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg). 0 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent or salt thereof to a subject, wherein the double-stranded RNAi agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises a modified nucleotide sequence: usGfsuac(Tgn)cucauugUfgGfauga The sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12), wherein the chemical modifications are a 2'-O-methyladenosine-3'-phosphate, c 2'-O-methylcytidine-3'-phosphate, and g 2'-O-methylguanosine-3'-phosphate. '-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is a phosphorothioate linkage, thereby treating a subject with an AGT-associated disorder.

[0038] In another aspect, the present invention provides a method for reducing blood pressure levels in a subject. The method includes administering a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 50 0 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent or salt thereof to a subject, wherein the double-stranded RNAi agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises a modified nucleotide sequence: usGfsuac(Tgn)cucauugUfgGfaug the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12), wherein the chemical modifications are a 2'-O-methyladenosine-3'-phosphate, c 2'-O-methylcytidine-3'-phosphate, g 2'-O-methylguanosine-3'-phosphate, and 3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is phosphorothioate linkage, thereby reducing blood pressure levels in a subject.

[0039] In some embodiments, the fixed dose is administered to the subject at monthly intervals, in other embodiments, the fixed dose is administered to the subject at quarterly intervals, and in some embodiments, the fixed dose is administered to the subject at semi-annual intervals.

[0040] In some embodiments, the subject is administered a fixed dose of about 50 mg to about 200 mg. In other embodiments, the subject is administered a fixed dose of about 200 mg to about 400 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg to about 800 mg.

[0041] In some embodiments, the subject is administered a fixed dose of about 100 mg. In some embodiments, the subject is administered a fixed dose of about 200 mg. In some embodiments, the subject is administered a fixed dose of about 300 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg. In some embodiments, the subject is administered a fixed dose of about 500 mg. In other embodiments, the subject is administered a fixed dose of about 600 mg. In some embodiments, the subject is administered a fixed dose of about 800 mg.

[0042] In some embodiments, the subject is administered a fixed dose of about 150 mg about once every six months.

[0043] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every six months.

[0044] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every three months.

[0045] In some embodiments, the subject is administered a fixed dose of about 600 mg about once every six months.

[0046] In some embodiments, the subject is administered a fixed dose of about 800 mg about once every three months.

[0047] In some embodiments, the subject is administered a fixed dose of about 800 mg about once every six months.

[0048] In some embodiments, double-stranded RNAi agent or its salt is administered to subject subcutaneously or intravenously.In some embodiments, subcutaneous administration is subcutaneous injection, for example, subcutaneous self-administration.In other embodiments, intravenous administration is intravenous injection.

[0049] In some embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11), and the sense strand comprises a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0050] In some embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 21 consecutive nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11), and the sense strand comprises a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0051] In some embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 22 consecutive nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11), and the sense strand comprises a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0052] In some embodiments, the antisense strand comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0053] In another embodiment, the antisense strand consists of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand consists of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0054] In some embodiments, the double-stranded RNAi agent or salt thereof further comprises a ligand. In other embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0055] In some embodiments, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In other embodiments, the GalNAc derivative comprises one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branched linker.

[0056] In some embodiments, the ligand is of the formula: [ka]

[0057] In other embodiments, the 3' end of the sense strand is conjugated to a ligand, as shown in the following diagram: [ka] wherein X is O or S.

[0058] In some embodiments, the subject is a human. In some embodiments, the subject has a systolic blood pressure of at least 130 mmHg or a diastolic blood pressure of at least 80 mmHg. In other embodiments, the subject has a systolic blood pressure of at least 140 mmHg or a diastolic blood pressure of at least 80 mmHg.

[0059] In some embodiments, the subject is part of a group prone to salt sensitivity, is overweight, is obese, is pregnant, is planning pregnancy, has type 2 diabetes, has type 1 diabetes, or has reduced renal function.

[0060] In some embodiments, the disorder that would benefit from reduced AGT expression is an AGT-related disorder. In one embodiment, the AGT-related disorder is hypertension. In other embodiments, the AGT-related disorder is hypertension, hypertension, borderline hypertension, primary hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, pulmonary hypertension, pulmonary vascular disease ... In one embodiment, the AGT-related disorder is selected from the group consisting of vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypotension, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome. In one embodiment, the AGT-related disorder is hypertension. In one embodiment, the hypertension is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, and hypertensive nephropathy.

[0061] In some embodiments, the blood pressure comprises systolic blood pressure and / or diastolic blood pressure.

[0062] In some embodiments, administration reduces AGT expression by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, AGT protein levels in a subject's blood or serum sample are reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0063] In some embodiments, administration results in a decrease in systolic and / or diastolic blood pressure, hi some embodiments, the decrease in systolic and / or diastolic blood pressure is at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg, 10 mmHg, or 20 mmHg.

[0064] In some embodiments, the method further comprises administering to the subject an additional therapeutic agent for the treatment of hypertension. In some embodiments, the additional therapeutic agent is selected from the group consisting of diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists, beta-blockers, vasodilators, calcium channel blockers, aldosterone antagonists, alpha-2 agonists, renin inhibitors, alpha-blockers, peripherally acting adrenergic agonists, selective D1 receptor partial agonists, non-selective alpha-adrenergic blockers, synthetics, steroidal mineralocorticoid receptor antagonists, combinations of any of the foregoing, and antihypertensive drugs formulated as a drug combination. In some embodiments, the additional therapeutic agent comprises an angiotensin II receptor antagonist. In other embodiments, the angiotensin II receptor antagonist is selected from the group consisting of losartan, valsartan, olmesartan, eprosartan, irbesartan, and azilsartan.

[0065] In some embodiments, the additional therapeutic agent comprises a therapeutic agent for hypertension. In some embodiments, the therapeutic agent for hypertension is selected from the group consisting of olmesartan, amlodipine, and indapamide. In some embodiments, the method comprises administering to a subject a fixed dose of about 600 mg of a double-stranded RNAi agent of the present invention, such as AD-85481, and a therapeutic agent for hypertension selected from the group consisting of olmesartan, amlodipine, and indapamide.

[0066] In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and olmesartan. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and amlodipine. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and indapamide.

[0067] In some embodiments, the method further comprises selecting a subject whose blood pressure is not adequately controlled by standard of care antihypertensive medication.

[0068] In some embodiments, the RNAi agent is administered as a pharmaceutical composition.

[0069] In some embodiments, the RNAi agent is administered in an unbuffered solution. In some embodiments, the unbuffered solution is saline or water.

[0070] In some embodiments, RNAi agent is administered with a buffer solution.In some embodiments, the buffer solution comprises acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof.In some embodiments, the buffer solution is phosphate buffered saline (PBS).

[0071] The present invention also provides kits for carrying out the methods of the invention as described herein, the kits including: a) an RNAi agent; b) instructions for use; and c) optionally, a means for administering the RNAi agent to a subject.

[0072] In another aspect, the present invention also provides a pharmaceutical composition for treating angiotensinogen (AGT)-associated disorders, comprising a double-stranded ribonucleic acid (RNAi) agent or a salt thereof for inhibiting expression of AGT. The pharmaceutical composition includes a dsRNA agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and the sense strand comprises a nucleotide sequence comprising at least 19 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10), wherein no more than five of the nucleotides comprise no modifications, and at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification, and the double-stranded RNAi agent is administered at a dose of at least 50 mg per dose, no more than once a month, for example. It is administered approximately once a month at a dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 8 00 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, for example, about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg).

[0073] In certain embodiments, the antisense strand comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and in certain embodiments, the sense strand further comprises a nucleotide sequence comprising at least 20 consecutive nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0074] In certain embodiments, the antisense strand comprises a nucleotide sequence comprising at least 21 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0075] In certain embodiments, the antisense strand comprises a nucleotide sequence comprising at least 22 consecutive nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), and in certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0076] In certain embodiments, the antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0077] In certain embodiments, the nucleotide sequence of the antisense strand consists of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the nucleotide sequence of the sense strand further consists of GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0078] In certain embodiments, every nucleotide of the sense strand and every nucleotide of the antisense strand comprises a nucleotide modification.

[0079] In certain embodiments, at least one of the nucleotide modifications is a deoxy-nucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino modified nucleotide, a 2'-O-allyl modified nucleotide, a 2'-C-alkyl modified nucleotide, a 2'-hydroxyl modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl The modified nucleotide is selected from the group consisting of: morpholino nucleotide, phosphoramidate, non-natural base-containing nucleotide, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide containing 5'-phosphate, nucleotide containing 5'-phosphate mimic, thermally destabilized nucleotide, glycol-modified nucleotide (GNA), and 2-O-(N-methylacetamide)-modified nucleotide, and combinations thereof. In certain embodiments, at least one of the nucleotide modifications is selected from the group consisting of: deoxy-nucleotide, 2'-O-methyl-modified nucleotide, 2'-fluoro-modified nucleotide, 2'-deoxy-modified nucleotide, glycol-modified nucleotide (GNA), and 2-O-(N-methylacetamide)-modified nucleotide, and combinations thereof.

[0080] In certain embodiments, the nucleotide modification is selected from the group consisting of 2'-methoxyethyl, 2'-fluoro, 2'-deoxy modified nucleotides, and GNA, and combinations thereof.

[0081] In certain embodiments, the double-stranded region is 19 to 23 nucleotide pairs in length, 19 to 21 nucleotide pairs in length, 21 to 23 nucleotide pairs in length, 21 nucleotide pairs in length, 19 to 30 nucleotide pairs in length, 19 to 25 nucleotide pairs in length, or 23 to 27 nucleotide pairs in length. In certain embodiments, the double-stranded region has a length of 19 to 21 nucleotide pairs.

[0082] In certain embodiments, each strand of the double-stranded RNAi or salt thereof is independently a length selected from 19 to 30 nucleotides in length, 19 to 23 nucleotides in length, and 21 to 23 nucleotides in length. In certain embodiments, each strand is independently 21 to 23 nucleotides in length. In certain embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0083] In certain embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0084] In certain embodiments, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. In certain embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-end of one strand. In certain embodiments, the strand is the antisense strand. In certain embodiments, the strand is the sense strand.

[0085] In certain embodiments, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-end of one strand. In certain embodiments, the strand is the antisense strand. In certain embodiments, the strand is the sense strand.

[0086] In certain embodiments, the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5'- and 3'-end of one strand, hi certain embodiments, the strand is the antisense strand.

[0087] The present invention provides a pharmaceutical composition for treating angiotensinogen (AGT)-associated disorders, comprising a double-stranded ribonucleic acid (RNAi) agent or a salt thereof for inhibiting the expression of AGT. The pharmaceutical composition includes a double-stranded RNAi agent or a salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11), and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12), and the chemical modification is a nucleotide sequence in which a is 2'-O-methyladenosine-3'-phosphate dehydrogenase (2'-phosphate dehydrogenase) phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, and s is a phosphorothioate linkage, and the pharmaceutical composition is administered at a dose of at least 50 mg no more than once a month.

[0088] In certain embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the sense strand further comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0089] In certain embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0090] In certain embodiments, the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0091] In certain embodiments, the antisense strand comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0092] In certain embodiments, the modified nucleotide sequence of the antisense strand consists of usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the modified nucleotide sequence of the sense strand consists of gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0093] In certain embodiments, the double-stranded RNAi agent or its salt further comprises a ligand.In certain embodiments, the ligand is conjugated to the 3'-end of the sense strand.In certain embodiments, the ligand is an N-acetylgalactosamine (GalNAc) derivative.In certain embodiments, the GalNAc derivative comprises one or more GalNAc derivatives linked via a monovalent, bivalent, or trivalent branched linker.

[0094] In certain embodiments, the ligand is: [ka]

[0095] In certain embodiments, the 3' end of the sense strand is conjugated to a ligand, as shown in the following diagram: [ka] wherein X is O or S. In certain embodiments, X is O.

[0096] In certain embodiments, the sense strand comprises the nucleotide sequence gsuscaucCfaCfAfAfugagaguaca, and the 3' end of the sense strand is L96(N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol The antisense strand is conjugated to Hyp-(GalNAc-alkyl)3), and the antisense strand contains the nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa, where the chemical modifications are defined as follows: a = 2'-O-methyladenosine-3'-phosphate, c = 2'-O-methylcytidine-3'-phosphate, g = 2'-O-methylguanosine-3'-phosphate, u = 2'-O-methyluridine-3'-phosphate, Af = 2'-fluoroadenosine-3'-phosphate, Cf = 2'-fluorocytidine-3'-phosphate, Gf = 2'-fluoroguanosine-3'-phosphate, Uf = 2'-fluorouridine-3'-phosphate, (Tgn) = thymidine-glycol nucleic acid (GNA) S-isomer, and s = phosphorothioate linkage.

[0097] In certain embodiments, the double-stranded RNAi agent or salt thereof is administered at a dose of 50 mg to 500 mg per administration. In certain embodiments, the double-stranded RNAi agent or salt thereof is administered at a dose of 50 mg to 400 mg per administration. In certain embodiments, the double-stranded RNAi agent or salt thereof is administered at a dose of 50 mg to 300 mg per administration.

[0098] In some embodiments, the double-stranded RNAi agent or salt thereof is administered at a fixed dose of about 50 mg to about 200 mg. In other embodiments, the double-stranded RNAi agent or salt thereof is administered at a fixed dose of about 200 mg to about 400 mg. In some embodiments, the double-stranded RNAi agent or salt thereof is administered at a fixed dose of about 400 mg to about 800 mg.

[0099] In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 100 mg. In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 200 mg. In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 300 mg. In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 400 mg. In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 500 mg. In other embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 600 mg. In some embodiments, the double-stranded RNAi agent or its salt is administered at a fixed dose of about 800 mg.

[0100] In certain embodiments, the pharmaceutical composition is administered once a month to once every six months. In certain embodiments, the pharmaceutical composition is administered once a month to once every three months. In certain embodiments, the pharmaceutical composition is administered once every three months to once every six months.

[0101] In some embodiments, the pharmaceutical composition is administered to the subject at monthly intervals. In other embodiments, the pharmaceutical composition is administered to the subject at quarterly intervals. In some embodiments, the pharmaceutical composition is administered to the subject at semi-annual intervals.

[0102] In certain embodiments, the double-stranded RNAi agent is administered at a dose of 50 to 400 mg per administration, with a frequency of once a month to once every six months.

[0103] In some embodiments, the subject is administered a fixed dose of about 150 mg about once every six months.

[0104] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every six months.

[0105] In some embodiments, the subject is administered a fixed dose of about 300 mg about once every three months.

[0106] In some embodiments, the subject is administered a fixed dose of about 600 mg about once every six months.

[0107] In another embodiment, the subject is administered a fixed dose of about 800 mg about once every three months.

[0108] In yet another embodiment, the subject is administered a fixed dose of about 800 mg about once every six months.

[0109] In certain embodiments, the AGT-related disorder is selected from the group consisting of hypertension, hypertension, borderline hypertension, primary hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, Selected from the group consisting of vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome.

[0110] In certain embodiments, the subject has a systolic blood pressure of at least 130 mmHg or a diastolic blood pressure of at least 80 mmHg. In certain embodiments, the subject has a systolic blood pressure of at least 140 mmHg and a diastolic blood pressure of at least 80 mmHg.

[0111] In certain embodiments, the subject is part of a group prone to salt sensitivity, is overweight, is obese, is pregnant, is planning a pregnancy, has type 2 diabetes, or has type 1 diabetes.

[0112] In certain embodiments, the subject has an AGT-related disorder and is also part of a group prone to salt sensitivity, is overweight, is obese, is pregnant, is planning a pregnancy, has type 2 diabetes, or has type 1 diabetes.

[0113] In certain embodiments, the subject has reduced renal function. In certain embodiments, the subject has an AGT-related disorder and further has reduced renal function.

[0114] In certain embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0115] In certain embodiments, the pharmaceutical composition is for administration by subcutaneous or intravenous injection.

[0116] The invention further provides the use of any of the pharmaceutical compositions in a method for treating an AGT-associated disorder, or in a method for preparing a medicament for use in a method for treating an AGT-associated disorder. [Brief explanation of the drawings]

[0117] [Figure 1] FIG. 1 is a graph showing the percent change in serum AGT relative to AGT baseline on day 0 following a single subcutaneous dose of placebo, 10 mg, 25 mg, 50 mg, 100 mg, or 200 mg of AD-85481. [Figure 2] Figure 2 is a graph showing the change in systolic blood pressure (SBP) and diastolic blood pressure (DBP) relative to baseline at week 8 after a single subcutaneous administration of placebo, 10 mg, 25 mg, 50 mg, 100 mg, or 200 mg of AD-85481. The number of subjects in each group is shown along the x-axis. [Figure 3] Figure 3 is a schematic diagram of the study design for the Phase II study. [Figure 4] FIG. 4 is a schematic diagram of the Phase I clinical trial design to evaluate the safety and efficacy of a single dose of AD-85481 (zilebesiran) after 6 months. [Figure 5] FIG. 5 is a graph showing the percent change in serum AGT relative to baseline AGT at weeks 12 and 24 following a single subcutaneous dose of placebo, 10 mg, 25 mg, 50 mg, 100 mg, 200 mg, 400 mg, or 800 mg of AD-85481. [Figure 6]Figure 6 is a graph showing the change from baseline in systolic blood pressure (SBP) and diastolic blood pressure (DBP) at weeks 8, 12, and 24 after a single subcutaneous administration of placebo, 200 mg, 400 mg, or 800 mg of AD-85481. The median baseline SBP / DBP was 139 / 83 mmHg for 200 mg, 138 / 90 mmHg for 400 mg, and 142 / 88 mmHg for 800 mg. Patients receiving placebo were not required to follow up after week 12. Four patients in the 200 mg dose group, one patient in the 400 mg group, and two patients in the 800 mg group received add-on antihypertensive therapy. [Figure 7] Figure 7 shows the consistent 24-hour blood pressure reduction achieved after a single, fixed-dose subcutaneous administration of AD-85481. The graph on the left shows the change from baseline in daytime / nighttime ABPM at week 8 after a single subcutaneous administration of 200 mg, 400 mg, or 800 mg of AD-85481 or placebo. All patients received dilebesiran alone (no rescue antihypertensive medication) at week 8. Hourly adjusted means: daytime (9:00 AM - 9:00 PM), nighttime (1:00 AM - 6:00 AM). Median baseline SBP / DBP values ​​were 139 / 83 mmHg for 200 mg, 138 / 90 mmHg for 400 mg, and 142 / 88 mmHg for 800 mg. The graph on the right shows 24-hour systolic blood pressure (SBP) at week 8 after administration of a single 800 mg dose of AD-85481. [Figure 8] FIG. 8 is a schematic diagram of the study design to evaluate the tolerability of AD-85481 (zilebesiran) during sodium depletion. [Figure 9] FIG. 9 is a graph showing the change in systolic blood pressure (SBP) and diastolic blood pressure (DBP) relative to baseline at the indicated time points in patients receiving AD-85481 (zilebesiran) or placebo following a low-salt or high-salt diet. [Figure 10] FIG. 10 is a schematic diagram of the study design to evaluate the safety and tolerability of AD-85481 (Zilebesiran) during co-administration of irbesartan. DETAILED DESCRIPTION OF THE INVENTION

[0118] The present invention provides a method for inhibiting expression of the angiotensinogen (AGT) gene. The present invention also provides a method for treating a subject having a disorder that would benefit from reduced AGT expression, or a method for treating an AGT-related disorder in a subject. Additionally, the present invention provides a method for lowering blood pressure levels in a subject. The method includes administering to the subject a fixed dose, e.g., about 50 mg to about 800 mg, of a double-stranded RNAi agent or salt thereof that targets AGT, as described herein.

[0119] The detailed description below discloses methods for inhibiting expression of the AGT gene using a double-stranded RNAi agent or salt thereof that targets AGT, methods for treating subjects who would benefit from reduced expression of the AGT gene, e.g., subjects susceptible to or diagnosed with an AGT-related disorder such as hypertension, and pharmaceutical compositions comprising a fixed dose of such an RNAi agent or salt thereof for inhibiting expression of the AGT gene.

[0120] I. Definition In order that the present invention may be more readily understood, certain terms are first defined. Additionally, it should be noted that whenever a value or range of values ​​for a parameter is listed, it is intended that values ​​and ranges intermediate to the listed values ​​are also intended to be part of the invention.

[0121] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0122] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to."

[0123] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise. For example, "the sense strand or the antisense strand" is understood as "the sense strand or the antisense strand, or the sense strand and the antisense strand."

[0124] The term "about" is used herein to mean within a typical tolerance in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about precedes a series of numbers or ranges, it is understood that "about" can modify each successive number or range. The term "at least" preceding a number or series of numbers, when clear from the context, is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that may logically be included. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides of a 21-nucleotide nucleic acid molecule" means that 19, 20, or 21 nucleotides have the specified property. When at least precedes a series of numbers or ranges, it is understood that "at least" can modify each successive number or range.

[0125] As used herein, "less than" or "less than" refers to the value adjacent to the phrase and, if logical from the context, to zero, to a value or integer that is logically less than the value.For example, a duplex with an overhang of "2 nucleotides or less" has an overhang of 2, 1, or 0 nucleotides.When "less than" is used before a series of numbers or ranges, it is understood that "less than" can modify each of the series of numbers or ranges.As used herein, a range includes both upper and lower limits.

[0126] In the event of a discrepancy between a sequence on a transcript or other sequence and its indicated site, the nucleotide sequence listed herein takes precedence.

[0127] If the chemical structure and chemical name do not match, the chemical structure takes precedence.

[0128] As used herein, "angiotensinogen," used interchangeably with the term "AGT," refers to the well-known gene and polypeptide that is also known in the art as serpin peptidase inhibitor, clade A, member 8, alpha-1 antiproteinase, antitrypsin, SERPINA8, angiotensin I, serpin A8, angiotensin II, alpha-1 antiproteinase angiotensinogen, antitrypsin, preangiotensinogen 2, ANHU, serine proteinase inhibitor, and cysteine ​​proteinase inhibitor.

[0129] The term "AGT" includes human AGT, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:188595658 (NM_000029.3, SEQ ID NO:1); cynomolgus monkey (Macaca fascicularis) AGT, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:90075391 (AB170313.1; SEQ ID NO:3); mouse (Mus musculus) AGT, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:113461997 (NM_007428.3; SEQ ID NO:5); and rat (Rattus norvegicus) AGT, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:51036672 (NM_134432; SEQ ID NO:7).

[0130] Additional examples of AGT mRNA sequences are readily available using public databases such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.

[0131] As used herein, the term "AGT" also refers to naturally occurring DNA sequence variations of the AGT gene, such as single nucleotide polymorphisms (SNPs) in the AGT gene. Exemplary SNPs can be found in the dbSNP database available at www.ncbi.nlm.nih.gov / projects / SNP / snp--_ref.cgi?geneId=183. Non-limiting examples of sequence variations within the AGT gene include those described in, for example, U.S. Patent No. 5,589,584, the entire contents of which are incorporated herein by reference. For example, sequence variations within the AGT gene include (relative to the transcription start site) C → T at position −532, G → A at position −386, G → A at position −218, C → T at position −18, G → A and A → C at positions −6 and −10, C → T at position +10 (untranslated), C → T at position +521 (T174M), T → C at position +597 (P199P), and T → C at position +704 (M235T, e.g., Reference SNP (refSNP) Cluster). See also Report:rs699, available at www.ncbi.nlm.nih.gov / SNP), and may include an A → G (Y248C) at position +743, a C → T (N271N) at position +813, a G → A (L339L) at position +1017, a C → A (L359M) at position +1075, and / or a G → A (V388M) at position +1162.

[0132] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the AGT gene, e.g., an mRNA that is the product of RNA processing of a primary transcript. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-guided cleavage at or near a portion of the nucleotide sequence of an mRNA molecule formed during transcription of the AGT gene. In one embodiment, the target sequence is within the protein-coding region of AGT.

[0133] The target sequence can be about 19 to 36 nucleotides in length, for example, preferably about 19 to 30 nucleotides in length. For example, the target sequence can be about 19 to 30 nucleotides in length, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length. Ranges and lengths that lie between the ranges and lengths recited above are also intended to be part of this invention.

[0134] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides described by a sequence referenced using standard nucleotide nomenclature.

[0135] Generally, "G", "C", "A", "T" and "U" respectively represent the nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as base.However, it is understood that the term "ribonucleotide" or "nucleotide" can also refer to modified nucleotides, as described in more detail below, or alternative replacement moieties (see, for example, Table 2).Those skilled in the art are well aware that guanine, cytosine, adenine and uracil can be substituted with other moieties without substantially changing the base pairing properties of the oligonucleotide that contains the nucleotide with such replacement moieties.For example, but not limited to, the nucleotide that contains inosine as its base can base pair with the nucleotide that contains adenine, cytosine or uracil.Therefore, the nucleotide that contains uracil, guanine or adenine can be substituted with, for example, the nucleotide that contains inosine in the nucleotide sequence of the dsRNA of the present invention. In another example, adenine and cytosine anywhere within an oligonucleotide can be substituted with guanine and uracil, respectively, to form a GU wobble base pair with the target mRNA. Sequences containing such substitutions are suitable for the compositions and methods featured herein.

[0136] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein and mediates cleavage of a target of RNA transcription via the RNA-induced silencing complex (RISC) pathway. iRNAs are responsible for the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNAs regulate, e.g., inhibit, the expression of the AGT gene in a cell, e.g., in a cell of a subject, such as a mammalian subject, preferably a human subject.

[0137] In one embodiment, the RNAi agent of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, e.g., an AGT target mRNA sequence, and mediates cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is degraded into siRNAs by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, an RNase III-like enzyme, processes this dsRNA into 19-23 base pair small interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). siRNA is then incorporated into RNA-induced silencing complex (RISC), where one or more helicases can unwind the siRNA duplex, thereby inducing target recognition to complementary antisense strand (Nykanen, et al., (2001) Cell 107:309).When it binds to the appropriate target mRNA, one or more endonucleases in RISC cleave the target and induce silencing (Elbashir, et al., (2001) Genes Dev.15:188).That is, in one aspect, the present invention relates to the single-stranded RNA (siRNA) that is produced in cells and promotes the formation of RISC complex, resulting in the silencing of target gene, i.e., AGT gene.Therefore, the term " siRNA " is also used herein to refer to the iRNA described above.

[0138] In certain embodiments, the RNAi agent can be a single-stranded siRNA (ssRNAi) that is introduced into a cell or organism to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNA is generally 15-30 nucleotides and chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as the single-stranded siRNA described herein or as the single-stranded siRNA that is chemically modified by the method described in Lima et al., (2012) Cell 150:883-894.

[0139] In certain embodiments, the "iRNA" used in the compositions, uses, and methods of the present invention is double-stranded RNA, and is referred to herein as a "double-stranded RNA agent," a "double-stranded RNA (dsRNA) molecule," a "dsRNA agent," or a "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel, substantially complementary nucleic acid strands, referred to as having a "sense" or "antisense" orientation with respect to the target RNA, i.e., the AGT gene. In some embodiments of the present invention, the double-stranded RNA (dsRNA) induces the degradation of the target RNA, for example, mRNA, via a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0140] Generally, the majority of the nucleotides in each strand of dsRNA molecules are non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides.In addition, as used herein, "iRNA" can include ribonucleotides with chemical modifications, and iRNA can include substantial modifications in multiple nucleotides.As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase, or any combination thereof.Therefore, the term modified nucleotide encompasses the substitution, addition, or removal of, for example, functional groups or atoms, in the internucleoside linkage, sugar moiety, or nucleobase.The modifications suitable for use in the agent of the present invention include all types of modifications disclosed herein or known in the art.When used in siRNA-type molecules, all such modifications are encompassed by "iRNA" or "RNAi agent" for the purpose of this specification and claims.

[0141] The duplex region can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can range from about 19 to 36 base pairs in length, e.g., about 19 to 30 base pairs in length, e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, e.g., about 19 to 30, 19 to 29, 19 to 28 The length of the duplex region may be, for example, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or about 21-22 base pairs. In certain embodiments, the duplex region is 19-21 base pairs in length. Ranges and lengths between the ranges and lengths listed above are also contemplated as part of the present invention.

[0142] The two strands forming the duplex structure can be different portions of a larger RNA molecule, or they can be separate RNA molecules. When the two strands are portions of a larger molecule and are therefore connected by an uninterrupted chain of nucleotides between the 3' end of one strand and the corresponding 5' end of the other strand, the connected RNA strands are called "hairpin loops." A hairpin loop can contain at least one unpaired nucleotide. In some embodiments, a hairpin loop can contain at least 4, 5, 6, 7, 8, 9, 10, 20, 23, or more unpaired nucleotides. In some embodiments, a hairpin loop can be 10 or fewer nucleotides. In some embodiments, a hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, a hairpin loop can be 4 to 10 unpaired nucleotides. In some embodiments, a hairpin loop can be 4 to 8 nucleotides.

[0143] When the two substantially complementary strands of dsRNA are composed of separate RNA molecules, these molecules can, but do not necessarily, be covalently linked.When the two strands are covalently linked by a means other than the uninterrupted chain of nucleotides between the 3'-end of one strand and the 5'-end of the corresponding other strand that form a double-stranded structure, this connecting structure is called "linker".RNA strands can have the same or different number of nucleotides.The maximum number of base pairs is the number of nucleotides in the shortest strand of dsRNA minus any overhangs present in the double-stranded structure.In addition to the double-stranded structure, RNAi can also contain one or more nucleotide overhangs.

[0144] In certain embodiments, an iRNA agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, eg, the AGT gene, and directs cleavage of the target RNA.

[0145] In some embodiments, the iRNA of the invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, such as an AGT target mRNA sequence, and mediates cleavage of the target RNA.

[0146] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double-stranded iRNA. For example, a nucleotide overhang exists when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa. A dsRNA may contain at least one nucleotide overhang, or the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. A nucleotide overhang may comprise or consist of a nucleotide / nucleoside analog, such as a deoxynucleotide / nucleoside. An overhang may be on the sense strand, the antisense strand, or any combination thereof. Furthermore, a certain overhanging nucleotide may be present on the 5'-end, the 3'-end, or both ends of either the antisense strand or the sense strand of a dsRNA.

[0147] In certain embodiments, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3' or 5' end, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In certain embodiments, the overhang on the sense strand or the antisense strand, or both strands, can comprise an extended length greater than 10 nucleotides, e.g., 1 to 30 nucleotides, 2 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, or 10 to 15 nucleotides in length. In certain embodiments, the extended overhang is on the sense strand of the duplex. In certain embodiments, the extended overhang is on the 3' end of the sense strand of the duplex. In certain embodiments, the extended overhang is on the 5' end of the sense strand of the duplex. In certain embodiments, the extended overhang is on the antisense strand of the duplex. In certain embodiments, the extended overhang is present on the 3'-end of the antisense strand of the double strand.In certain embodiments, the extended overhang is present on the 5'-end of the antisense strand of the double strand.In certain embodiments, one or more of the nucleotides in the extended overhang are replaced with nucleoside thiophosphate.In certain embodiments, the overhang comprises a self-complementary portion, so that the overhang can form a stable hairpin structure under physiological conditions.

[0148] " Blunt " or " blunt end " means that there are no unpaired nucleotides at the end of a double-stranded RNA agent, i.e., there are no nucleotide overhangs.A " blunt-ended " double-stranded RNA agent is double-stranded throughout its entire length, i.e., there are no nucleotide overhangs at either end of the molecule.The RNAi agent of the present invention includes an RNAi agent that does not have a nucleotide overhang at one end (i.e., an agent that has one overhang and one blunt end), or an RNAi agent that does not have a nucleotide overhang at either end.In most cases, these molecules will be double-stranded throughout their entire length.

[0149] The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, that includes a region that is substantially complementary to a target sequence, e.g., AGT mRNA. As used herein, the term "region of complementarity," as defined herein, refers to a region on the antisense strand that is substantially complementary to a sequence, e.g., a target sequence, e.g., an AGT nucleotide sequence. If the region of complementarity is not perfectly complementary to the target sequence, the mismatch can be within an internal or terminal region of the molecule. Generally, the most tolerable mismatch is in the terminal region, e.g., within 5, 4, or 3 nucleotides of the 5' or 3' end of the iRNA. In some embodiments, a double-stranded RNA agent of the present invention includes a nucleotide mismatch in the antisense strand. In some embodiments, a double-stranded RNA agent of the present invention includes a nucleotide mismatch in the sense strand. In some embodiments, the nucleotide mismatch is, e.g., within 5, 4, or 3 nucleotides from the 3' end of the iRNA. In another embodiment, the nucleotide mismatch is, e.g., within the 3' terminal nucleotide of the iRNA.

[0150] The term "sense strand" or "passenger strand," as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand, as those terms are defined herein.

[0151] As used herein, "substantially all of the nucleotides are modified" means extensively but not entirely modified and may include no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0152] As used herein, the term "cleavage region" refers to the region located immediately adjacent to the cleavage site. The cleavage site is the site on the target where cleavage occurs. In some embodiments, the cleavage region comprises three bases directly adjacent to either end of the cleavage site. In some embodiments, the cleavage region comprises two bases directly adjacent to either end of the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and this cleavage region comprises nucleotides 11, 12, and 13.

[0153] A complementary sequence in an iRNA, such as in a dsRNA described herein, includes base pairing of an oligonucleotide or polynucleotide comprising a first nucleotide sequence with an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as "fully complementary" to each other. However, when a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences may be fully complementary, or they may form one or more, but generally no more than 5, 4, 3, or 2, mismatched base pairs during hybridization for a duplex of up to 30 base pairs, while maintaining the ability to hybridize under conditions most relevant to its final application, such as inhibiting gene expression via the RISC pathway. However, if two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, these overhangs shall not be considered mismatches when determining complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, where the longer oligonucleotide comprises a 21-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, may still be referred to as "fully complementary" for purposes described herein.

[0154] "Complementary" sequences, as used herein, may also include or be formed entirely of non-Watson-Crick base pairs, or base pairs formed from non-naturally occurring modified nucleotides, so long as they meet the above requirements for their ability to hybridize, including, but not limited to, G:U wobble or Hoogsteen base pairing.

[0155] The terms "complementary," "fully complementary," and "substantially complementary" herein may be used in reference to base matching between the sense and antisense strands of a dsRNA or between the antisense strand of a double-stranded RNA agent and a target sequence, as will be understood from the context of their use.

[0156] As used herein, a polynucleotide that is "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding an AGT gene). For example, a polynucleotide is complementary to at least a portion of an AGT mRNA if the sequence is substantially complementary to an uninterrupted portion of the mRNA encoding the AGT gene.

[0157] Thus, in some embodiments, the sense strand polynucleotides and antisense polynucleotides disclosed herein are fully complementary to the target AGT sequence. In other embodiments, the sense strand polynucleotides or antisense polynucleotides disclosed herein are substantially complementary to the target AGT sequence, and comprise a contiguous nucleotide sequence that is at least 80% complementary, e.g., at least 90%, or 95%, or 100% complementary, over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs: 1 and 2, or to a fragment of any one of SEQ ID NOs: 1 and 2.

[0158] Thus, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target AGT sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target AGT sequence, comprising a contiguous nucleotide sequence that is at least about 90% complementary, e.g., about 90% or 95% complementary, over its entire length to an equivalent region of the nucleotide sequence of SEQ ID NO: 1 or to a fragment of SEQ ID NO: 1. In certain embodiments, the fragment of SEQ ID NO: 1 is nucleotides 638-658 of SEQ ID NO: 1.

[0159] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, an iRNA of the invention further comprises a sense strand comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0160] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, an iRNA of the invention further comprises a sense strand comprising the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0161] In certain embodiments, the nucleotide sequence of the antisense strand of an iRNA of the invention consists of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, an iRNA of the invention further comprises a sense strand, the nucleotide sequence of which consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).

[0162] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the iRNA of the invention further comprises a sense strand comprising a modified nucleotide sequence comprising at least 19 consecutive nucleotides of gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12). The chemical modifications are: a = 2'-O-methyladenosine-3'-phosphate; c = 2'-O-methylcytidine-3'-phosphate; g = 2'-O-methylguanosine-3'-phosphate; u = 2'-O-methyluridine-3'-phosphate; Af = 2'-fluoroadenosine-3'-phosphate; Cf = 2'-fluorocytidine-3'-phosphate; Gf = 2'-fluoroguanosine-3'-phosphate; U = 2'-O-methyluridine-3'-phosphate; where f is defined as 2'-fluorouridine-3'-phosphate, (Tgn) is the thymidine-glycol nucleic acid (GNA) S-isomer, and s is a phosphorothioate linkage, and the 3' end of the sense strand is optionally covalently linked to a ligand, e.g., N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol (also referred to as Hyp-(GalNAc-alkyl)3 or L96).

[0163] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the iRNA of the invention further comprises a sense strand comprising the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0164] In certain embodiments, the modified nucleotide sequence of the antisense strand of an iRNA of the invention consists of usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, an iRNA of the invention further comprises a sense strand, and the modified nucleotide sequence of the sense strand consists of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).

[0165] Generally, "iRNA" includes ribonucleotides with chemical modifications. Such modifications can include all types of modifications disclosed herein or known in the art. All of these modifications, when used in dsRNA molecules, are encompassed by "iRNA" for the purposes of this specification and claims.

[0166] In one embodiment of the present invention, an agent for use in the methods and compositions of the present invention is a single-stranded antisense oligonucleotide molecule that inhibits a target mRNA via an antisense inhibition mechanism. The single-stranded antisense oligonucleotide molecule is complementary to a sequence within the target mRNA. The single-stranded antisense oligonucleotide can stoichiometrically inhibit translation by base pairing with the mRNA and physically interfering with the translation machinery. See Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The single-stranded antisense oligonucleotide molecule may be about 14 to about 30 nucleotides in length and may have a sequence complementary to the target sequence. For example, the single-stranded antisense oligonucleotide molecule may comprise a sequence that is at least about 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense sequences described herein.

[0167] The phrase "contacting a cell with an iRNA" such as dsRNA as used herein includes contacting a cell by any possible means. Contacting a cell with an iRNA includes contacting a cell with an iRNA in vitro or contacting a cell with an iRNA in vivo. Contacting can be performed directly or indirectly. Thus, for example, an iRNA can be physically contacted with a cell by performing a method separately, or the iRNA can be placed in a situation that allows or causes it to contact a cell later.

[0168] Contacting cells in vitro can be achieved, for example, by incubating cells with iRNA.Contacting cells in vivo can be achieved, for example, by injecting iRNA into or near the tissue where the cells are present, or by injecting iRNA into another region, for example, into the bloodstream or subcutaneous cavity, so that the agent subsequently reaches the tissue where the cells to be contacted are present.For example, iRNA can contain or be bound to a ligand, such as GalNAc, which guides iRNA to a target site, such as the liver.Combination of in vitro and in vivo contacting methods is also possible.For example, cells can be contacted with iRNA in vitro and then transplanted into a subject.

[0169] In certain embodiments, contacting a cell with an iRNA includes "introducing" or "delivering the iRNA into a cell" by promoting or causing uptake or absorption into the cell. Absorption or uptake of the iRNA can occur through spontaneous diffusion or active intracellular processes, or by auxiliary agents or devices. Introduction of the iRNA into a cell can be in vitro or in vivo. For example, for in vivo introduction, the iRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell can include methods known in the art, such as electroporation and lipofection. Additional approaches are described herein below or known in the art.

[0170] The term "lipid nanoparticle" or "LNP" refers to a vesicle comprising a lipid layer that encapsulates a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which the iRNA is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0171] As used herein, a "subject" is an animal, such as a mammal, including a primate (e.g., a human, a non-human primate, e.g., a monkey and a chimpanzee), or a non-primate (e.g., a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse), that expresses a target gene, either endogenously or heterologously. In certain embodiments, the subject is a human, e.g., a human being treated or evaluated for a disease or disorder that would benefit from reduced AGT expression, a human being at risk for a disease or disorder that would benefit from reduced AGT expression, a human being with a disease or disorder that would benefit from reduced AGT expression, or a human being treated for a disease or disorder that would benefit from reduced AGT expression as described herein. Diagnostic criteria for an AGT-associated disorder, e.g., hypertension, are provided below. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In certain embodiments, the subject is part of a population prone to salt sensitivity, e.g., a black person or an elderly person (over 65 years of age). In certain embodiments, the subject is overweight or obese, for example, a subject suffering from central obesity.In certain embodiments, the subject is sedentary.In certain embodiments, the subject is pregnant or planning to become pregnant.In certain embodiments, the subject has reduced renal function.In certain embodiments, the subject has type 1 diabetes.In certain embodiments, the subject has type 2 diabetes.

[0172] As used herein, the term "treat" or "treatment" refers to a beneficial or desired outcome, such as reducing at least one sign or symptom of an AGT-related disorder, e.g., hypertension, in a subject. Treatment may also be used to treat one or more signs or symptoms associated with undesired AGT expression, whether detectable or undetectable (e.g., angiotensin II type 1 receptor activation (AT1R) (e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysm, peripheral arterial disease, heart disease, increased oxidative stress (e.g., superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin inhibition, increased myocyte and smooth muscle hypertrophy), increased collagen synthesis, stimulation of vascular fibrosis, myocardial fibrosis and renal fibrosis, increased rate and force of cardiac contractions, changes in heart rate (e.g., increased arrhythmias), stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion), pregnancy-associated hypertension (e.g., pre-eclampsia and eclampsia), symptoms associated with malignant hypertension, symptoms associated with hyperaldosteronism, whether detectable or undetectable). and reducing the degree of undesired AT1R activation and stabilizing (i.e., not worsening) the state of chronic AT1R activation, and reducing the risk of undesired AT1R activation (e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral arterial disease, heart disease, increased oxidative stress (e.g., superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin inhibition, increased myocyte and smooth muscle hypertrophy), increased collagen synthesis, vascular fibrosis, and and amelioration or alleviation of obesity, liver steatosis / fatty liver, e.g., nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome."Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0173] As used herein, "reduced renal function" can be diagnosed using any of several recognized criteria, such as glomerular filtration rate (GFR), albuminuria, creatinine, or BUN. As used herein, renal function reduction can be transient or chronic. A GFR of at least 60 is considered normal. A GFR of 60 or less indicates reduced renal function, a GFR of 15 to over 60 indicates renal disease, and a GFR of less than 15 indicates renal failure. GFR is typically determined based on urinary creatinine levels; higher creatinine levels indicate poorer renal function. The presence of albumin in urine also indicates reduced renal function. Absolute albumin levels can be determined to diagnose renal function reduction. The albumin-to-creatinine ratio can also be determined to assess renal function. A urinary albumin-to-creatinine ratio of 30 mg / g or less indicates normal renal function. A urinary albumin-to-creatinine ratio of greater than 30 mg / g indicates reduced renal function.

[0174] The term "reducing" in the context of the level of AGT gene expression or agt protein production in a subject, or a disease marker or symptom, refers to a statistically significant decrease in such level. The decrease can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection by a detection method in relevant cells or tissues, e.g., hepatocytes, or other subject samples, e.g., blood or serum derived therefrom, urine. In certain embodiments, "reducing" is a reduction in AGT protein in serum after administration of one or more doses of an iRNA agent provided herein, relative to the AGT protein level in serum before administration of any dose of an iRNA agent provided herein.

[0175] As used herein, "prevention" or "preventing," when used in reference to a disease or disorder that would benefit from reducing the expression of the AGT gene or the production of agt protein in a subject who is predisposed to an AGT-related disorder due to, for example, aging, genetic factors, hormonal changes, diet, and a sedentary lifestyle, refers to a condition in which the subject has not yet met the diagnostic criteria for an AGT-related disorder. As used herein, prevention can be understood as the administration of a drug to a subject who has not yet met the diagnostic criteria for an AGT-related disorder to delay or reduce the likelihood that the subject will develop an AGT-related disorder. Because the drug is a pharmaceutical, it is understood that administration is typically under the direction of a medical professional who can identify a subject who has not yet met the diagnostic criteria for an AGT-related disorder as being predisposed to developing an AGT-related disorder. The diagnostic criteria for hypertension and risk factors for hypertension are listed below. In certain embodiments, the disease or disorder includes, for example, symptoms of undesired AT1R activation, such as hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysm, peripheral arterial disease, heart disease, increased oxidative stress (e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin inhibition, myocyte and smooth muscle hypertrophy), increased collagen synthesis, stimulation of vascular fibrosis, myocardial fibrosis and renal fibrosis, increased rate and force of cardiac contraction, changes in heart rate (e.g., increased arrhythmias), stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion. AGT-related disorders can also include obesity, hepatic steatosis / fatty liver, e.g., nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome. For example, if an individual with one or more risk factors for hypertension either does not develop hypertension or develops less severe hypertension compared to a population with the same risk factors as described herein but not receiving treatment, the likelihood of developing hypertension is reduced. Not developing an AGT-related disorder, such as hypertension, or delaying the time to develop hypertension by several months or years is considered effective prevention.In the case of iRNA agents, prevention may require the administration of two or more doses.Suitable methods are provided for identifying subjects at risk of developing any of the above-mentioned AGT-related diseases, and the iRNA agents provided herein can be used as pharmaceuticals for or in methods for preventing AGT-related diseases.The risk factors for various AGT-related diseases are described below.

[0176] As used herein, the term "angiotensinogen-related disease" or "AGT-related disease" refers to a disease or disorder caused by or associated with renin-angiotensin-aldosterone system (RAAS) activation, or a disease or disorder whose symptoms or progression respond to RAAS inactivation. The term "angiotensinogen-related disease" includes diseases, disorders, or conditions that would benefit from reduced AGT expression. Such diseases are typically associated with hypertension. Non-limiting examples of angiotensinogen-related disorders include hypertension, e.g., borderline hypertension (also known as prehypertension), primary hypertension (also known as essential or idiopathic hypertension), secondary hypertension (also known as non-essential hypertension), isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., pre-eclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, These conditions include systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic stenosis, aortic aneurysm, ventricular fibrosis, sleep apnea, heart failure (e.g., left ventricular systolic dysfunction, heart failure with reduced ejection fraction), myocardial infarction, angina pectoris, stroke, renal disease, for example, chronic kidney disease or diabetic nephropathy, optionally in the setting of pregnancy, renal failure, for example, chronic renal failure, and systemic sclerosis (e.g., scleroderma renal crisis). In certain embodiments, the AGT-related disease comprises intrauterine growth restriction (IUGR) or fetal growth restriction. In certain embodiments, AGT-related disorders may also include obesity, hepatic steatosis / fatty liver, e.g., nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome, and nocturnal hypotension.

[0177] Hypertension thresholds and stages of hypertension are discussed in detail below.

[0178] In one embodiment, the angiotensinogen-related disorder is primary hypertension. "Primary hypertension" is the result of environmental or genetic causes (e.g., the result of no apparent underlying disease cause).

[0179] In one embodiment, the angiotensinogen-related disorder is secondary hypertension. "Secondary hypertension" has an identifiable underlying disease that can have multiple etiologies, including renal, vascular, and endocrine causes, such as renal parenchymal disease (e.g., polycystic kidney disease, glomerular, or interstitial disease), renal vascular disease (e.g., renal artery stenosis, fibromuscular dysplasia), endocrine disorders (e.g., corticosteroid or mineralocorticoid excess, pheochromocytoma, hyper- or hypothyroidism, growth hormone excess, hyperparathyroidism), aortic stenosis, and oral contraceptive use.

[0180] In one embodiment, the angiotensinogen-related disorder is pregnancy-associated hypertension, such as chronic hypertension of pregnancy, gestational hypertension, preeclampsia, eclampsia, chronic hypertension-aggravated preeclampsia, HELLP syndrome, and gestational hypertension (also known as transient hypertension of pregnancy, chronic hypertension identified in the second half of pregnancy, and pregnancy-induced hypertension (PIH)). The diagnostic criteria for pregnancy-associated hypertension are set out below.

[0181] In one embodiment, the angiotensinogen-related disorder is resistant hypertension. "Resistant hypertension" is blood pressure that remains above target (for example, systolic above 130 mmHg or diastolic above 90 mmHg) despite the simultaneous use of three antihypertensive drugs of different classes, one of which is a thiazide diuretic. Subjects whose blood pressure is controlled with four or more drugs are also considered to have resistant hypertension.

[0182] A "therapeutically effective amount" or a "prophylactically effective amount" also includes that amount of an RNAi agent that produces some desired effect at a reasonable benefit / risk ratio applicable to any treatment. The iRNAs used in the methods of the invention can be administered in amounts sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0183] The phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions or dosage forms that are suitable for use in contact with the tissues of human and animal subjects, within the scope of sound medical judgment, without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0184] The phrase "pharmaceutically acceptable carrier" as used herein refers to a pharmaceutically acceptable material, composition, or vehicle involved in the transport or transfer of the subject compound from one organ or body part to another, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium talc, calcium or zinc stearate, or stearic acid), or solvent encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0185] The term "sample," as used herein, encompasses similar bodily fluids, cells, or tissues isolated from a subject, as well as collections of bodily fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum, and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, and the like. Tissue samples can include samples from tissues, organs, or localized regions. For example, samples can be derived from specific organs, parts of organs, or bodily fluids or cells within those organs. In certain embodiments, samples can be derived from the liver (e.g., the entire liver or a specific segment of the liver, or a specific type of cell within the liver, such as hepatocytes). In some embodiments, a "sample derived from a subject" refers to urine obtained from a subject. A "sample derived from a subject" can also refer to blood from a subject or serum or plasma derived from blood.

[0186] II. The Methods of the Invention The present invention provides methods for inhibiting expression of the angiotensinogen (AGT) gene. The present invention also provides methods for treating a subject who would benefit from reduced AGT expression (e.g., a subject at risk of developing an AGT-related disorder, e.g., hypertension), or for treating an AGT-related disorder, e.g., hypertension, in a subject. Additionally, the present invention provides methods for lowering blood pressure levels in a subject, e.g., a subject with an AGT-related disorder, such as hypertension. The methods include administering to the subject a fixed dose, e.g., about 50 mg to about 800 mg, of a double-stranded RNAi agent targeting AGT, as described herein.

[0187] Thus, in one aspect, the present invention provides a method for inhibiting expression of the angiotensinogen (AGT) gene in a subject. The method includes administering to the subject about 50 mg to about 800 mg, e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, or about 200 mg to about 500 mg. This includes administering a fixed dose of about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg. Values ​​and ranges intermediate to the aforementioned recited values ​​are also contemplated as part of this invention.

[0188] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating," "suppressing," and other similar terms, and includes any level of inhibition.

[0189] The phrase "inhibiting expression of AGT" is intended to refer to the inhibition of expression of any AGT gene (e.g., a mouse AGT gene, a rat AGT gene, a monkey AGT gene, or a human AGT gene), as well as variants or mutants of the AGT gene. Thus, the AGT gene can be a wild-type AGT gene, a mutant AGT gene, or a transgenic AGT gene in the context of a genetically engineered cell, group of cells, or organism.

[0190] "Inhibiting the expression of the AGT gene" includes inhibiting the AGT gene at any level, for example, at least partially suppressing the expression of the AGT gene. The expression of the AGT gene can be evaluated based on the level or change in level of any variable associated with AGT gene expression, such as AGT mRNA level or AGT protein level. This level can be evaluated in individual cells or cell groups, including, for example, samples derived from a subject. It is understood that AGT is primarily expressed in the liver, but is also expressed in the brain, gallbladder, heart, and kidney, and is present in the circulation.

[0191] Inhibition can be assessed by the absolute or relative reduction of one or more variables associated with AGT expression compared to a control level. The control level can be any type of control level used in the art, such as a pre-administration baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as a buffer-only control or an inactive drug control).

[0192] In some embodiments of the methods of the present invention, expression of the AGT gene is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the detection level of the assay. In preferred embodiments, expression of the AGT gene is inhibited by at least 50%. It is further understood that inhibition of AGT expression in specific tissues, such as, for example, the liver, without significant inhibition of expression in other tissues, such as, for example, the brain, may be desired. In preferred embodiments, expression levels are determined at an siRNA concentration of 10 nM in an appropriate species-matched cell line using the assay method provided in Example 2 of PCT Application No. PCT / US2019 / 032150.

[0193] In certain embodiments, inhibition of in vivo expression is determined by knocking down a human gene in rodents expressing the human gene, e.g., in AAV-infected mice expressing a human target gene (i.e., AGT), when administered as a single dose at 3 mg / kg with a nadir of RNA expression. Knockdown of endogenous gene expression in a model animal system can also be determined, for example, after administration as a single dose at 3 mg / kg with a nadir of RNA expression. This system is useful when the nucleic acid sequences of the human gene and the model animal gene are sufficiently similar that the human iRNA effectively knocks down the model animal gene. RNA expression in the liver is determined using the PCR method provided in Example 2 of PCT Application No. PCT / US2019 / 032150.

[0194] Inhibition of expression of the AGT gene may be manifested by a reduction in the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) that has been treated (e.g., by contacting the cells with an iRNA of the invention or by administering an iRNA of the invention to a subject in which the cells are or were present) such that the AGT gene is transcribed and expression of the AGT gene is inhibited, compared to a second cell or group of cells that is substantially identical to the first cell or group of cells but has not been so treated (control cells that are not treated with an iRNA or an iRNA targeting a gene of interest). In a preferred embodiment, inhibition is assessed by the method provided in Example 2 of PCT Application No. PCT / US2019 / 032150, using an siRNA concentration of, for example, 10 nM in a species-matched cell line and expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells using the following formula:

number

[0195] In other embodiments, inhibition of AGT gene expression can be assessed in terms of a reduction in a parameter functionally linked to AGT gene expression, such as AGT protein levels in the blood or serum from a subject. AGT gene silencing can be determined in any cell that expresses AGT, either endogenously or heterologously from an expression construct, by any assay known in the art.

[0196] The inhibition of AGT protein expression can be manifested by the reduction of the AGT protein level expressed by cell or cell group or in the sample of the subject (for example, the protein level in the blood sample from the subject).As explained above, for the assessment of mRNA suppression, the inhibition of protein expression level in treated cell or cell group can also be expressed as the percentage change of protein level in control cell or cell group, or in the sample of the subject, for example, blood or serum from the subject.

[0197] The control cell, group of cells or subject sample that can be used to evaluate the inhibition of AGT gene expression includes the cell, group of cells or subject sample that has not yet been contacted with the RNAi agent of the present invention.For example, the control cell, group of cells or subject sample can be derived from an individual subject (e.g., human or animal subject) before the subject is treated with RNAi agent or from a suitable matched population control.

[0198] The level of AGT mRNA expressed by a cell or group of cells can be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of AGT expression in a sample is determined by detecting a transcribed polynucleotide, or a portion thereof, such as the mRNA of the AGT gene. RNA can be extracted from cells using RNA extraction techniques, including, for example, acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), the RNeasy™ RNA preparation kit (Qiagen®), or PAXgene™ (PreAnalytix™, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, ribonuclease protection assays, Northern blotting, in situ hybridization, and microarray analysis.

[0199] In some embodiments, the expression level of AGT is determined using a nucleic acid probe. As used herein, the term "probe" refers to any molecule that can selectively bind to a specific AGT. Probes can be synthesized by those skilled in the art or derived from suitable biological preparations. Probes can also be specifically designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, protein, antibody, and organic molecules.

[0200] The isolated mRNA can be used in hybridization or amplification assays, including, but not limited to, Southern or Northern analysis, polymerase chain reaction (PCR) analysis, and probe arrays. One method for determining mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to AGT mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with the probe, for example, by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe is immobilized on a solid surface and the mRNA is contacted with the probe, for example, in an Affymetrix® gene chip array. Those skilled in the art can easily adapt known mRNA detection methods for use in determining AGT mRNA levels.

[0201] Alternative methods for determining the expression level of AGT in a sample include, for example, RT-PCR (an experimental embodiment described in U.S. Pat. No. 4,683,202 to Mullis in 1987), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-beta replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (U.S. Patent No. 5,854,033 to Lizardi et al.), or any other nucleic acid amplification method, followed by detection of the amplified molecules using techniques well known to those skilled in the art. These detection schemes are particularly useful for detecting nucleic acid molecules when they are present in very low numbers. In certain aspects of the present invention, the expression level of AGT is determined by quantitative fluorescent RT-PCR (i.e., TaqMan™ system). In a preferred embodiment, the expression level is determined by the method provided in Example 2 of PCT Application No. PCT / US2019 / 032150, using an siRNA concentration of 10 nM in a species-matched cell line.

[0202] The level of AGT protein expression can be determined using any method known in the art for measuring protein levels, including, for example, high performance liquid chromatography (HPLC), absorption spectroscopy, colorimetry, spectrophotometry, flow cytometry, immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay, etc.

[0203] In some embodiments, the effectiveness of the method of the present invention is evaluated by the reduction of AGT mRNA or protein level (for example, in liver biopsy).In certain embodiments, puncture liver biopsy specimen serves as the tissue material for monitoring the reduction of AGT gene or protein expression.In other embodiments, blood sample serves as the subject's sample for monitoring the reduction of agt protein expression.

[0204] In some embodiments of the methods of the present invention, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. Inhibition of AGT expression can be assessed using measurements of, or changes in, the levels of AGT mRNA or AGT protein in a sample derived from a fluid or tissue from a specific site within the subject (e.g., liver or blood).

[0205] As used herein, the term detecting or determining the level of an analyte is understood to mean carrying out a step to determine whether a substance, e.g., protein, RNA, is present or not. As used herein, a detecting or determining method includes detecting or determining a level of an analyte below the level of detection of the method used.

[0206] In another aspect, the present invention provides a method for treating a subject having an AGT-related disorder, e.g., high blood pressure, e.g., hypertension. The method includes administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values ​​and ranges intermediate to the aforementioned recited values ​​are also contemplated as part of the present invention.

[0207] In some embodiments, the AGT-related disorder is selected from the group consisting of hypertension, hypertension, borderline hypertension, primary hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, Selected from the group consisting of vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome.

[0208] In one embodiment, the AGT-related disorder is hypertension. In one embodiment, the hypertension is borderline hypertension, primary hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, hypertensive heart disease, or hypertensive nephropathy.

[0209] In a further aspect, the present invention provides a method of treating a subject who would benefit from reduced AGT expression. The method comprises administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits AGT expression. Values ​​and ranges intermediate to the aforementioned recited values ​​are also contemplated as part of the present invention.

[0210] In a further aspect, the present invention provides a method for lowering blood pressure levels, e.g., systolic blood pressure and / or diastolic blood pressure, in a subject. The method includes administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT. Values ​​and ranges intermediate to the aforementioned recited values ​​are also contemplated as part of the present invention.

[0211] In the methods of the invention, a cell, e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an AGT-associated disorder), may be contacted with the siRNA in vitro or in vivo, i.e., the cell may be within the subject.

[0212] The cells suitable for treatment using the method of the present invention can be any cell that expresses AGT gene, such as liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells.The cells suitable for use in the method of the present invention can be mammalian cells, such as primate cells (human cells, including human cells in chimeric non-human animals, or non-human primate cells, such as monkey cells or chimpanzee cells), or non-primate cells.In certain embodiments, the cells are human cells, such as human liver cells.In the method of the present invention, AGT expression is inhibited in cells by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or to a level below the detection level of the assay.

[0213] In one embodiment, a dsRNA agent targeting AGT is used to treat a subject's cells, tissue, blood, urine, or other tissue or fluid, e.g., to increase AGT levels by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 140%, 114%, 115%, 116%, 117%, 118%, %, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more reduction in the level of vasopressin produced by the antibody.

[0214] In another embodiment, a dsRNA agent targeting AGT is administered to a subject such that the subject's blood pressure levels, e.g., systolic and / or diastolic blood pressure, are reduced by at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mmHg or more.

[0215] The administration of dsRNA agent by the method and use of the present invention can cause the severity, signs, symptoms and / or markers of such disease or disorder to be reduced in patients with primary hyperoxaluria.In this context, " reduction " means the statistically significant reduction of this level.Reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or about 100%.

[0216] The effectiveness of disease treatment or prevention can be evaluated by, for example, measuring the level of disease progression, disease remission, symptom severity, pain reduction, quality of life, the dosage of medication required to maintain the treatment effect, disease markers, or any other measurable parameter appropriate for the given disease being treated or targeted for prevention.It is well within the capabilities of those skilled in the art to monitor the effectiveness of treatment or prevention by measuring any one of these parameters or any combination of parameters.For example, the effectiveness of the treatment of primary hyperoxaluria can be evaluated by, for example, regularly monitoring the oxalate level in the treated subject.Comparing the subsequent measurement with the initial measurement provides the doctor with an indication of whether the treatment is effective.It is well within the capabilities of those skilled in the art to monitor the effectiveness of treatment or prevention by measuring such parameters or any combination of parameters. In the context of administration of a dsRNA agent targeting AGT or pharmaceutical composition thereof, "effective against" primary hyperoxaluria indicates that administration in a clinically relevant manner will result in a beneficial effect for at least a statistically significant percentage of patients, such as improvement in symptoms, cure, reduction in disease, extension of life expectancy, improvement in quality of life, or other effect that would normally be recognized as positive by a physician familiar with the treatment of primary hyperoxaluria and related causes.

[0217] Therapeutic or preventive effect is evident when there is statistically significant improvement in one or more parameters of disease state, or when there is no worsening or otherwise expected symptoms do not occur.For example, the measurable parameters of disease can be favorably changed by at least 10%, preferably at least 20%, 30%, 40%, 50% or more, as the indicator of effective treatment.The effectiveness of a given dsRNA agent drug or its drug formulation can also be determined using the experimental animal model of a given disease, as known in the art.When using experimental animal model, the effectiveness of treatment is evident when there is a statistically significant reduction in markers or symptoms observed.

[0218] For example, any positive change resulting in a decrease in disease severity as measured using an appropriate scale is indicative of appropriate treatment using a dsRNA agent or dsRNA agent formulation as described herein.

[0219] The in vivo method of the present invention can include administering to a subject a composition containing an iRNA, the iRNA comprising a nucleotide sequence complementary to at least a portion of an RNA transcript of an AGT gene in a mammal to which the RNAi agent is to be administered. The composition can be administered by any means known in the art, including, but not limited to, parenteral routes, including oral, intraperitoneal, or intracranial (e.g., intracerebroventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection. In certain embodiments, the composition is administered by intramuscular injection.

[0220] In some embodiments, administration is by depot injection.Depot injection can release dsRNA agent consistently for a long time.Therefore, depot injection can reduce the number of times that it is necessary to take medication to obtain desired effect, for example, desired AGT inhibition or therapeutic or preventive effect.Depot injection can also provide more consistent serum concentration.Depot injection can include subcutaneous injection or intramuscular injection.In a preferred embodiment, depot injection is subcutaneous injection.

[0221] In some embodiments, administration is by pump.The pump can be external pump or surgically implanted pump.In certain embodiments, the pump is a subcutaneously implanted osmotic pump.In other embodiments, the pump is an infusion pump.The infusion pump can be used for intravenous, subcutaneous, arterial or epidural infusion.In preferred embodiments, the infusion pump is a subcutaneous infusion pump.In other embodiments, the pump is a surgically implanted pump that delivers dsRNA agent to the liver.

[0222] Other administration modes include epidural, intracerebral, intraventricular, intranasal administration, intraarterial, intracardiac, intraosseous injection, intrathecal, intravitreal and pulmonary.Administration mode can be selected according to whether local or systemic treatment is desired and based on the area to be treated.Administration route and site can be selected to enhance targeting.

[0223] iRNA is preferably administered subcutaneously, i.e., by subcutaneous injection.One or more injections may be used to deliver the desired dose of iRNA to the subject.Injections may be repeated over a period of time.

[0224] Administration can be repeated periodically. In certain embodiments, the iRNA is administered about once a month to about once a quarter, i.e., about every three months, or about once a quarter to about twice a year, i.e., about once every six months. In certain embodiments, the iRNA is administered monthly. In other embodiments, the iRNA is administered every three months or quarterly. In yet other embodiments, the iRNA is administered every six months or twice a year.

[0225] The dsRNA agent of the present invention can be administered in "naked" form or as "free dsRNA agent". Naked dsRNA agent is administered without pharmaceutical composition. Naked dsRNA agent can be in a suitable buffer solution. The buffer solution can contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolality of the buffer solution containing the dsRNA agent can be adjusted to be suitable for administration to a subject.

[0226] Alternatively, the iRNA of the present invention can be administered as a pharmaceutical composition, for example, as a dsRNA liposome formulation. The RNAi agent can be administered as a pharmaceutical composition in a non-buffered solution. The non-buffered solution can include saline or water. Alternatively, the RNAi agent can be administered as a pharmaceutical composition in a buffered solution. The buffered solution can include acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffered solution is phosphate-buffered saline (PBS).

[0227] The subject who will benefit from the inhibition of AGT gene expression is a subject who is prone to or has been diagnosed with AGT-related diseases or disorders, such as high blood pressure, for example, hypertension.The subject can have a systolic blood pressure of at least 130, 135, 140, 145, 150, 155, or 160 mmHg, or a diastolic blood pressure of at least 80, 85, 90, 95, 100, 105, or 110 mmHg.The subject can be prone to salt sensitivity, overweight, obese, pregnant, or planning to become pregnant.The subject can have type 2 diabetes, type 1 diabetes, or reduced renal function.

[0228] The method further includes administering to the subject an additional therapeutic agent for treating hypertension. Exemplary therapeutic agents for use as combination therapy include, but are not limited to, diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists, beta-blockers, vasodilators, calcium channel blockers, aldosterone antagonists, alpha2-agonists, renin inhibitors, alpha-blockers, peripherally acting adrenergic agonists, selective D1 receptor partial agonists, non-selective alpha-adrenergic blockers, synthetic compounds, steroidal mineralocorticoid receptor antagonists, combinations of any of the foregoing, and antihypertensive agents formulated as drug combinations. In some embodiments, the additional therapeutic agent includes an angiotensin II receptor antagonist, such as losartan, valsartan, olmesartan, eprosartan, irbesartan, and azilsartan.

[0229] In some embodiments, the additional therapeutic agent comprises a therapeutic agent for hypertension. In some embodiments, the therapeutic agent for hypertension is selected from the group consisting of olmesartan, amlodipine, and indapamide. In some embodiments, the method comprises administering to a subject a fixed dose of about 600 mg of a double-stranded RNAi agent of the present invention, such as AD-85481, and a therapeutic agent for hypertension selected from the group consisting of olmesartan, amlodipine, and indapamide.

[0230] In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and olmesartan. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and amlodipine. In some embodiments, the method comprises administering to the subject a fixed dose of about 600 mg of AD-85481 and indapamide.

[0231] Administration of iRNA according to the methods of the invention can result in the prevention or treatment of an AGT-related disorder, such as high blood pressure, e.g., hypertension. Diagnostic criteria for various types of hypertension are provided below.

[0232] III. Diagnostic Criteria, Risk Factors, and Treatment of Hypertension In recent years, guidelines for the prevention and treatment of hypertension have been revised. Extensive reporting has been done by Reboussin et al. (Systematic Review for the 2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: (2017 ACC / AHA / AAPA / ABC / ACPM / AGS / APhA / ASH / ASPC / NMA / PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology / American Heart Association Task Force on Clinical Practice Guidelines. J Am Coll Cardiol. 2017 Nov 7. pii: S0735-1097(17)41519-1. doi: 10.1016 / j.jacc.2017.11.006. Some highlights of the new guidelines are provided below. However, the guidelines should be understood as providing the knowledge of one skilled in the art regarding the diagnostic and monitoring criteria and treatment of hypertension at the time of filing of this application, and are incorporated herein by reference.

[0233] A. Diagnostic Criteria Although a continuum exists between high blood pressure and increased cardiovascular disease risk, categorizing blood pressure levels is useful for clinical and public health decision-making. Blood pressure can be classified into four levels: normal, elevated, and stage 1 or 2 hypertension, based on the mean blood pressure measured in a medical setting (clinic blood pressure), as shown in the table below (from Whelton et al., 2017). [Table 1]

[0234] Blood pressure refers to a blood pressure based on the average of two or more careful readings taken on two or more occasions. Best practices for obtaining careful blood pressure readings are detailed in Whelton et al., 2017 and are known in the art.

[0235] This classification differs from the previous recommendation in the JNC7 report (Chobanian et al., The National High Blood Pressure Education Program Coordinating Committee. Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension. 2003;42:1206-52), in which stage 1 hypertension was defined as a systolic blood pressure (SBP) of 130-139 mmHg or a diastolic blood pressure of 80-89 mmHg, whereas stage 2 hypertension in this document corresponds to stages 1 and 2 in the JNC7 report. The rationale for this classification is based on observational data on the correlation between SBP / DBP and cardiovascular disease risk, randomized clinical trials of lifestyle modifications to lower blood pressure, and randomized clinical trials of antihypertensive drug treatment to prevent cardiovascular disease.

[0236] The increased risk of cardiovascular disease in adults with stage 2 hypertension is well established. A growing number of individual studies and meta-analyses of observational data have reported a progressively higher cardiovascular disease risk gradient from normal to elevated blood pressure and stage 1 hypertension. In many of these meta-analyses, the hazard ratios for coronary heart disease and stroke were 1.1–1.5 for SBP / DBP 120–129 / 80–84 mmHg compared with <120 / 80 mmHg, and 1.5–2.0 for SBP / DBP 130–139 / 85–89 mmHg compared with <120 / 80 mmHg. This risk gradient was consistent across subgroups defined by sex and race / ethnicity. In older adults, the relative increase in cardiovascular disease risk associated with hypertension was attenuated but still present. Lifestyle modifications and pharmacologic antihypertensive treatment are recommended for individuals with elevated blood pressure and stage 1 and 2 hypertension. Even if blood pressure is not normalized by treatment, clinical benefit can be obtained by reducing the stage of high blood pressure.

[0237] B. Risk Factors Hypertension is a complex disease resulting from a combination of factors, including but not limited to genetics, lifestyle, diet, and secondary risk factors. Hypertension may also be associated with pregnancy. Due to the complex nature of hypertension, it is understood that multiple interventions may be required to treat hypertension. Furthermore, non-pharmacological interventions, including dietary and lifestyle modifications, may be useful in preventing and treating hypertension. Furthermore, interventions may provide clinical benefit even if they do not completely normalize an individual's blood pressure.

[0238] 1. Genetic risk factors Although several monogenic forms of hypertension have been identified, such as glucocorticoid-responsive aldosteronism, Liddle syndrome, Gordon syndrome, and others in which a single gene mutation completely explains the pathophysiology of hypertension, these disorders are rare. The current table of known genetic variants that contribute to blood pressure and hypertension includes more than 25 rare mutations and more than 120 single nucleotide polymorphisms. However, although genetic factors may contribute to hypertension in some individuals, genetic variation is estimated to explain only approximately 3.5% of blood pressure variability.

[0239] 2. Diet and alcohol intake Common environmental and lifestyle risk factors that lead to hypertension include an inadequate diet, insufficient physical activity, and excessive alcohol consumption. These factors can lead to overweight or obesity, further increasing the likelihood of developing or worsening hypertension. Elevated blood pressure is even more strongly correlated with increases in waist-to-hip ratio or other measures of central fat distribution. Early and persistent obesity are strongly correlated with later hypertension. Achieving a normal weight can reduce the risk of developing hypertension to the same level as someone who has never been obese.

[0240] Sodium, potassium, magnesium, and calcium intakes can also have significant effects on blood pressure. Sodium intake is positively correlated with blood pressure and accounts for a large portion of the age-related increase in blood pressure. Certain groups are more sensitive to increased sodium consumption than others, including blacks and older adults (over 65 years of age), as well as those with higher levels of blood pressure or comorbid conditions such as chronic kidney disease, diabetes, or metabolic syndrome. Collectively, these groups comprise more than half of all adults in the United States. Salt sensitivity may be a marker of increased cardiovascular disease and all-cause mortality, independent of blood pressure. Currently, techniques for recognizing salt sensitivity are not practical in clinical settings. Therefore, salt sensitivity is best considered as a group characteristic.

[0241] Potassium intake is negatively correlated with blood pressure and stroke, and higher potassium levels appear to blunt the effect of sodium on blood pressure. A lower sodium-to-potassium ratio is associated with lower blood pressure than that recorded for the corresponding sodium or potassium levels per se. Similar observations have been made with cardiovascular disease risk.

[0242] Alcohol consumption has long been associated with hypertension. In the United States, it is estimated that alcohol consumption accounts for approximately 10% of the population burden of hypertension, with the burden being greater in men than in women.

[0243] It is understood that changes in diet or alcohol consumption can be an aspect of preventing or treating hypertension.

[0244] 3. Physical activity It is well established that there is an inverse correlation between physical activity / fitness and blood pressure levels. Even moderate levels of physical activity have been demonstrated to be beneficial in reducing hypertension.

[0245] It is understood that increased physical activity can be an aspect of the prevention or treatment of hypertension.

[0246] 4. Secondary risk factors Secondary hypertension may underlie severe elevations in blood pressure, pharmacologically resistant hypertension, sudden onset of hypertension, elevated blood pressure in patients with previously drug-controlled hypertension, the development of diastolic hypertension in elderly patients, and target organ damage disproportionate to the duration or severity of hypertension. Secondary hypertension should be suspected in younger patients (<30 years) with elevated blood pressure; however, primary hypertension is not uncommon in younger patients, particularly blacks, and some forms of secondary hypertension, such as renovascular disease, are more common in older patients (≥65 years). Many causes of secondary hypertension are strongly associated with clinical findings or groups of findings suggestive of a specific disorder. In such cases, treatment of the underlying disease may resolve the elevated blood pressure findings without the administration of medications typically used to treat hypertension.

[0247] 5. Pregnancy Pregnancy is a risk factor for hypertension, and hypertension during pregnancy is a risk factor for later cardiovascular disease and hypertension. A report on pregnancy-associated hypertension was published by the American College of Obstetrics and Gynecology (ACOG) in 2013 (American College of Obstetricians and Gynecologists, Task Force on Hypertension in Pregnancy. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol. 2013;122:1122-31). The gist of the report is provided below. However, this report should be understood as providing the knowledge of those skilled in the art regarding the diagnostic and monitoring criteria and treatment of hypertension during pregnancy at the time of filing of this application, and is incorporated herein by reference.

[0248] The diagnostic criteria for preeclampsia are provided in the table below (Table 1 of the ACOG report, 2013). [Table 2]

[0249] Blood pressure management during pregnancy is complicated because many commonly used antihypertensive medications, including ACE inhibitors and ARBs, are contraindicated during pregnancy due to potential harm to the fetus. The goals of antihypertensive treatment during pregnancy include preventing severe hypertension and potentially extending gestational age to allow more time for the fetus to mature before delivery. A review of the treatment of severe pregnancy-related hypertension found insufficient evidence to recommend specific medications. Rather, clinician experience is recommended in this situation. (Duley L, Meher S, Jones L. Drugs for treatment of very high blood pressure during pregnancy. Cochrane Database Syst Rev. 2013;7:CD001449.)

[0250] C.Treatment The treatment of hypertension is complex because it is often accompanied by other comorbidities, including impaired renal function, for which the patient may also be receiving treatment. Clinicians managing adults with hypertension should focus on the patient's overall health, with a particular emphasis on reducing the risk of future adverse cardiovascular outcomes. All patients' risk factors should be managed in an integrated manner with comprehensive non-pharmacological and pharmacological strategies. Blood pressure control should be intensified as a patient's blood pressure and risk of future cardiovascular events increase.

[0251] Although treating hypertension with blood pressure-lowering medications based solely on blood pressure level is considered cost-effective, using absolute cardiovascular disease risk in combination with blood pressure level to guide such treatment is more efficient and cost-effective in reducing cardiovascular disease risk than using blood pressure level alone. Many patients initiated on a single medication subsequently require two or more medications from different pharmacological classes to achieve their blood pressure goals. Knowledge of each medication's pharmacological mechanism of action is important. In drug regimens with complementary activities, a second antihypertensive agent may be used to block compensatory responses to the first agent or to affect a different pressor mechanism, resulting in additive blood pressure reduction. For example, thiazide diuretics may stimulate the renin-angiotensin-aldosterone system. Adding an ACE inhibitor or ARB to a thiazide can achieve additive blood pressure-lowering effects. The use of combination therapy may also improve adherence. There are several two- and three-drug fixed-dose combinations available for antihypertensive therapy, with complementary mechanisms of action between the components.

[0252] Table 18 from Whelton et al. (2017) lists oral antihypertensive medications and provides the classes of medications used to treat hypertension and the medications within those classes. Also provided are dose ranges, frequency, and notes. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0253] IV. Delivery of iRNA Agents for Use in the Methods of the Invention Delivery of an iRNA agent to a cell, e.g., a cell in a subject, e.g., a human subject (e.g., a subject in need thereof, e.g., a subject with an AGT-associated disorder, e.g., hypertension), for use in the methods of the invention can be achieved in several different ways. For example, delivery can be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery can also be performed directly by administering a composition containing an iRNA, e.g., a dsRNA, to the subject. Alternatively, in vivo delivery can be performed indirectly by administering one or more vectors that encode the iRNA and induce its expression. These options are further described below.

[0254] Generally, any method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the iRNAs of the present invention (see, e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5):139-144 and WO 94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider for delivering iRNA molecules include, for example, the biological stability of the delivered molecule, prevention of nonspecific effects, and accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, such as by direct injection or implantation into the tissue or by local administration of the preparation. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure to systemic tissues that may otherwise be harmed by or degrade the agent, and allows for a lower total dosage of the iRNA molecule to be administered. Several studies have demonstrated successful knockdown of gene products when iRNAs are administered locally. For example, intraocular delivery of VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injection in mice (Reich, SJ. et al. (2003) Mol. Vis. 9:210-216) have both been shown to prevent neovascularization in experimental models of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA in mice can reduce tumor volume (Pille, J., et al. (2005) Mol. Ther. 11:267-274) and prolong the survival of tumor-bearing mice (Kim, WJ., et al., (2006) Mol. Ther. 14:343-350, Li, S., et al., (2007) Mol. Ther. 15:515-523).RNA interference has been shown to be successful when delivered locally to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, GT., et al (2004) Neuroscience 129:521-528; Thakker, ER., et al (2004) Proc. Natl. Acad. Sci. USA 101:17270-17275; Akaneya,Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, KA., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). When iRNA is administered systemically for disease treatment, the RNA can be modified or alternatively delivered using a drug delivery system, both of which function to prevent rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier can also enable targeting of iRNA compositions to target tissues and avoid undesirable off-target effects. iRNA molecules can be modified, for example, by chemical conjugation to lipophilic groups such as cholesterol, to enhance cellular uptake and prevent degradation. For example, iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice, resulting in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178).Conjugation of iRNA to aptamers has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol. 24:1005-1015). In alternative embodiments, iRNA can be delivered using drug delivery systems, such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems promote binding of iRNA molecules (which are negatively charged) and also enhance their interaction with negatively charged cell membranes, thereby enabling efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can bind to iRNA or be induced to form vesicles or micelles that encapsulate iRNA (see, e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2):107-116). The formation of vesicles or micelles also prevents degradation of iRNAs when administered systemically. Methods for producing and administering cationic iRNA complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen, DR., et al (2003) J. Mol. Biol 327:761-766; Verma, UN., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entireties).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, DR., et al (2003), ibid.; Verma, UN, et al., (2003), ibid.), oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS, et al., (2006) Nature 441:111-114), cardiolipin (Chien, PY, et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A, et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME, et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA, et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, iRNAs are complexed with cyclodextrins for systemic administration. Methods of administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7,427,605, which is incorporated herein by reference in its entirety.

[0255] A. Vector-encoding iRNA for use in the methods of the invention

[0256] iRNAs targeting the AGT gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A, et al., PCT International Publication No. 00 / 22113; Conrad, PCT International Publication No. 00 / 22114; and Conrad, U.S. Patent No. 6,054,299). Expression can be transient (on the order of hours to weeks) or persistent (weeks to months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative. Transgenes can also be constructed to allow them to be passaged as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0257] Each strand of iRNA can be transcribed from a promoter on an expression vector.When two separate strands are expressed, for example, to produce dsRNA, two separate expression vectors can be simultaneously introduced into target cells (for example, by transfection or infection).Alternatively, each separate strand of dsRNA can be transcribed by a promoter located on the same expression plasmid.In one embodiment, dsRNA is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, so that dsRNA has a stem-and-loop structure.

[0258] iRNA expression vectors are generally DNA plasmids or viral vectors. Recombinant constructs for expressing the iRNAs described herein can be produced using expression vectors compatible with eukaryotic cells, preferably expression vectors compatible with vertebrate cells. Eukaryotic cell expression vectors are well known in the art and are available from numerous commercial sources. Typically, such vectors are provided containing convenient restriction sites for the insertion of desired nucleic acid segments. iRNA expression vectors can be delivered systemically, for example, by intravenous or intramuscular administration, by administration to target cells removed from a patient and then reintroduced into the patient, or by any other means that allows for introduction into desired target cells.

[0259] iRNA expression plasmids can be transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid transfections targeting different regions of a target RNA for iRNA-mediated knockdown over a period of a week or more are also contemplated by the present invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled using a reporter, such as a fluorescent marker like green fluorescent protein (GFP). Stable transfection of cells ex vivo can be ensured using a marker that provides transfected cells with resistance to certain environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0260] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors, (b) retroviral vectors, such as, but not limited to, lentiviral vectors and Moloney murine leukemia virus, (c) adeno-associated viral vectors, (d) herpes simplex viral vectors, (e) SV40 vectors, (f) polyoma viral vectors, (g) papilloma viral vectors, (h) picorna viral vectors, (i) pox viral vectors, such as orthopox, e.g., vaccinia viral vectors, or avian pox, e.g., canarypox or fowlpox, and (j) helper-dependent or gutless adenoviruses. Replication-deficient viruses may also be advantageous. Different vectors may or may not become integrated into the cellular genome. The construct can include viral sequences for transfection, if desired. Alternatively, the constructs can be incorporated into vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant expression of iRNAs will generally require regulatory elements, such as promoters, enhancers, etc., to ensure expression of the iRNA in target cells. Other aspects of vectors and constructs to consider are further discussed below.

[0261] Vectors useful for delivery of iRNA contain sufficient regulatory elements (promoters, enhancers, etc.) for expression of the iRNA in the desired target cells or tissues. Regulatory elements can be selected to provide either constitutive or regulated / inducible expression.

[0262] The expression of iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to specific physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J.8:20-24).Such inducible expression systems suitable for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-beta-D1-thiogalactopyranoside (IPTG).Those skilled in the art will be able to select an appropriate regulatory / promoter sequence based on the intended use of iRNA transgene.

[0263] Viral vectors containing nucleic acid sequences encoding iRNAs can be used. For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for correct packaging of the viral genome and integration into host cell DNA. The nucleic acid sequences encoding iRNAs are cloned into one or more vectors, which facilitates delivery of the nucleic acid to patients. More details about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to make them more resistant to chemotherapy. Other references demonstrating the use of retroviral vectors in gene therapy include: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, HIV-based vectors described in U.S. Patent Nos. 6,143,520, 5,665,557, and 5,981,276, which are incorporated herein by reference.

[0264] Adenoviruses are also contemplated for use in delivering the iRNAs of the present invention. Adenoviruses are particularly attractive vehicles for delivering genes to, for example, respiratory epithelia. Adenoviruses naturally infect respiratory epithelia, causing a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscles. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993), provide a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994), demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other examples of the use of adenovirus in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94 / 12649; and Wang, et al., Gene Therapy 2:775-783 (1995). Suitable AV vectors for expressing the iRNAs featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors to target cells are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0265] Adeno-associated virus (AAV) vectors can also be used to deliver iRNAs of the invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No. 5,436,146). In one embodiment, the iRNAs can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors to target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher KJ et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941, International Patent Application No. 94 / 13788, and International Patent Application No. 93 / 24641, the entire disclosures of which are incorporated herein by reference.

[0266] Another viral vector suitable for delivery of iRNA of the invention is a poxvirus, such as vaccinia virus, e.g., an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, or an avian pox, such as fowlpox or canarypox virus.

[0267] The tropism of viral vectors can be modified by pseudotyping the vector with envelope proteins or surface antigens from other viruses, or by replacing different viral capsid proteins as needed.For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc.AAV vectors can be engineered to target different cells by engineering the vector to express different capsid protein serotypes, see, for example, Rabinowitz JE et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

[0268] The pharmaceutical preparation of the vector can include the vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, the complete gene delivery vector can be produced intact from recombinant cells, such as retroviral vectors, and the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

[0269] V. Double-Stranded iRNA Agents for Use in the Methods of the Invention Double-stranded RNAi agents suitable for use in the methods of the invention comprise an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed upon expression of the AGT gene. The complementary region is about 19-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucleotides in length). When contacted with a cell expressing the AGT gene, the iRNA inhibits expression of the AGT gene (e.g., human, primate, non-primate, or rat AGT gene) by at least 50%, as assayed, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, e.g., using Western blotting or flow cytometry techniques. In a preferred embodiment, inhibition of expression is determined by the qPCR method provided in the Examples, particularly Example 2 of PCT Application No. PCT / US2019 / 032150, using siRNA at a concentration of 10 nM in the appropriate biological cell line provided therein. In a preferred embodiment, inhibition of expression in vivo is determined by knocking down a human gene in rodents expressing the human gene, such as mice expressing a human target gene or AAV-infected mice, when administered as a single dose, e.g., at a nadir of RNA expression of 3 mg / kg. RNA expression in the liver is determined using the PCR method provided in Example 2 of PCT Application No. PCT / US2019 / 032150.

[0270] dsRNA comprises two RNA strands, which are complementary and hybridize to form a duplex structure under the conditions in which the dsRNA is used. One strand of the dsRNA (the antisense strand) contains a complementary region that is substantially complementary, and generally completely complementary, to the target sequence. The target sequence can be obtained from the sequence of the mRNA formed during the expression of the AGT gene. The other strand (the sense strand) contains a region that is complementary to the antisense strand, so that the two strands hybridize to form a duplex structure when combined under suitable conditions. As described elsewhere herein and known in the art, the complementary sequences of dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, rather than being present on separate oligonucleotides.

[0271] Generally, the duplex structure is 19-30 base pairs in length. Similarly, the region of complementarity to the target sequence is 19-30 nucleotides in length.

[0272] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21 to 23 nucleotides in length can function as substrates for Dicer. As those skilled in the art will recognize, the region of an RNA targeted for cleavage is most often a portion of a longer RNA molecule, often an mRNA molecule. In relevant cases, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to allow it to serve as a substrate for RNAi-dependent cleavage (i.e., cleavage via the RISC pathway).

[0273] Those skilled in the art will appreciate that the duplex region is the primary functional portion of the dsRNA, and may comprise, for example, about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, It will also be recognized that a duplex region of 21-23 or 21-22 base pairs is also acceptable. In certain embodiments, the duplex region is 19-21 base pairs. That is, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA, as long as it is processed into a functional duplex of, for example, 15-30 base pairs that targets the desired RNA for cleavage. Thus, one skilled in the art will recognize that in one embodiment, an miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting AGT gene expression is not generated in a target cell by cleavage of a larger dsRNA.

[0274] The dsRNA described herein can further comprise one or more single-stranded nucleotide overhangs, such as 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleotides. dsRNAs with at least one nucleotide overhang can have superior inhibitory properties compared to their blunt-ended counterparts. The nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, such as a deoxynucleotide / nucleoside. The overhang can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhanging nucleotide can be present at the 5'-end, 3'-end, or both ends of the antisense strand or the sense strand of the dsRNA.

[0275] The overhang can be the result of one strand being longer than the other, or the result of two strands of the same length being twisted.This overhang can form a mismatch with the target mRNA, or can be complementary to the target gene sequence, or can be another sequence.The first and second strands can also be linked by additional bases, such as forming hairpins, or by other non-basic linkers.

[0276] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be modified or unmodified nucleotides, including, but not limited to, modified 2'-sugars, such as 2-F, 2'-O-methyl thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.For example, TT can be the overhang sequence for either end on either strand.This overhang can form a mismatch with target mRNA, or can be complementary to the target gene sequence, or can be another sequence.

[0277] The 5'- or 3'-overhang of the sense strand, antisense strand, or both strands of the RNAi agent can be phosphorylated.In some embodiments, the overhang region contains two nucleotides with phosphorothioate between them, and these two nucleotides can be the same or different.In one embodiment, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands.In one embodiment, this 3'-overhang is present in the antisense strand.In one embodiment, this 3'-overhang is present in the sense strand.

[0278] RNAi agents can contain only a single overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, the single-stranded overhang can be located at the 3'-end of the sense strand or at the 3'-end of the antisense strand.RNAi can also have a blunt end located at the 5'-end of the antisense strand (or the 3'-end of the sense strand), or vice versa.Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end, and the 5'-end is blunt.Without wishing to be bound by theory, the asymmetry between the blunt end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand is favorable for the insertion of the guide strand into the RISC process.

[0279] In some embodiments, the double-stranded RNAi agent for use in the method of the present invention is not modified.In other embodiments, the double-stranded RNAi agent for use in the method of the present invention is modified, and comprises, for example, chemical modification that can inhibit the expression of target gene (i.e., AGT gene) in vivo, or chemical modification that can enhance the stability or other beneficial features of the agent.In some embodiments, the double-stranded RNAi agent comprises thermally destabilizing nucleotide modification.

[0280] As described in more detail below, in certain aspects of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. An iRNA of the invention in which "substantially all of the nucleotides are modified" may be largely, but not entirely, modified and may contain no more than 5, 4, 3, 2, or 1 unmodified nucleotide.

[0281] dsNA can be synthesized by standard methods known in the art.Double-stranded RNAi compounds of the present invention can be prepared using a two-step method.First, each strand of double-stranded RNA molecules is prepared separately.Then, the strands of these components are annealed.The individual strands of siRNA compounds can be prepared using solution phase or solid phase organic synthesis or both.Organic synthesis has the advantage that it can easily prepare oligonucleotide strands that contain unnatural nucleotides or modified nucleotides.Similarly, single-stranded oligonucleotides of the present invention can be prepared using solution phase or solid phase organic synthesis or both.

[0282] VI. Modified iRNAs of the Invention In certain embodiments, the RNA of the iRNA of the present invention, e.g., dsRNA, is unmodified and does not contain, for example, chemical modifications or conjugations known in the art and described herein. In other embodiments, the RNA of the iRNA of the present invention, e.g., dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the present invention, substantially all of the nucleotides of the iRNA of the present invention are modified. In other embodiments of the present invention, all of the nucleotides of the iRNA, or substantially all of the nucleotides of the iRNA, are modified, i.e., no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 unmodified nucleotide is present in any strand of the iRNA.

[0283] Nucleic acids featured in the present invention can be synthesized or modified by methods such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference in its entirety. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted ligation) or 3'-end modifications (conjugation, DNA nucleotides, inverted ligation, etc.), base modifications, such as substitution with a stabilizing base, a destabilizing base, or a base that base-pairs with an extended repertoire partner, base removal (abasic nucleotide) or conjugated base, sugar modifications (e.g., at the 2' or 4' position) or sugar substitution, or backbone modifications, including modification or substitution of a phosphodiester linkage. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or non-natural internucleoside linkages. RNAs with modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For purposes of this specification, as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered oligonucleosides. In some embodiments, modified iRNAs will have a phosphorus atom in their internucleoside backbone.

[0284] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.Various salts, such as sodium salts, mixed salts, and free acid forms, are also included.

[0285] Representative U.S. patents that teach the preparation of the above-described phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808, 4,469,863, 4,476,301, 5,023,243, 5,177,195, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,7 No. 17, No. 5,321,131, No. 5,399,676, No. 5,405,939, No. 5,453,496, No. 5,455,233, No. 5,466,677, No. 5,47 No. 6,925, No. 5,519,126, No. 5,536,821, No. 5,541,316, No. 5,550,111, No. 5,563,253, No. 5,571,799, No. 5 , 587,361, 5,625,050, 6,028,188, 6,124,445, 6,160,109, 6,169,170, 6,172,209 , No. 6,239,265, No. 6,277,603, No. 6,326,199, No. 6,346,614, No. 6,444,423, No. 6,531,590, No. 6,534,6 Nos. 39, 6,608,035, 6,683,167, 6,858,715, 6,867,294, 6,878,805, 7,015,315, 7,041,816, 7,273,933, 7,321,029 and U.S. Patent No. RE39464, the contents of each of which are incorporated herein by reference in their entirety.

[0286] Modified RNA backbones that do not contain a phosphorus atom in the backbone have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages, including those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S and CH2 constituent moieties.

[0287] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,64,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, Nos. 5,489,677, 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0288] RNA mimics suitable for use in the iRNA provided herein are contemplated, in which both the sugar and internucleoside linkages of the nucleotide units, i.e., the backbone, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, in which RNA mimics have been found to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, the entire contents of each of which are incorporated herein by reference. Further PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0289] Some embodiments featured in the present invention include RNA with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2-- (known as the methylene (methylimino) or MMI backbone), --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2-- (representing the natural phosphodiester backbone as --O--P--O--CH2--) of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNA featured herein has the morpholino backbone structure of the above-referenced US Pat. No. 5,034,506.

[0290] Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein, may include one of the following at the 2' position: OH, F, O-, S-, or N-alkyl, O-, S-, or N-alkenyl, O-, S-, or N-alkynyl, or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It can be alkenyl or alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA includes one of the following at the 2' position: C1 to C 10The modifications include lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, interfering substances, groups for improving the pharmacokinetic or pharmacodynamic properties of iRNA, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described herein below in the Examples, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Further exemplary modifications include 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers within these three families), 2'-alkoxyalkyl, and 2'-NMA (N-methylacetamide).

[0291] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3'-terminal nucleotide or in a 2'-5'-linked dsRNA and the 5' position of the 5'-terminal nucleotide. An iRNA can also have a sugar mimic, such as a cyclobutyl moiety, in place of the pentofuranosyl sugar.

[0292] iRNAs may also contain modifications or substitutions of nucleobases (often simply referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil ... Examples include cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine.Further nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. L. ed. John Wiley & Sons, 1990, those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed in Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, Crooke, ST, and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are a further exemplary base substitution, especially when combined with a 2'-O-methoxyethyl sugar modification.

[0293] Representative United States patents that teach the preparation of some of the above-mentioned modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patent Nos. 3,687,808, 4,845,205, 5,130,30, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, 5,587,469, 5,587,469, 5,592,177, 5,593,178, 5,594,187, 5,595,188, 5,596,189, 5,597,189, 5,598,190, 5,599,255, 5,902,191, 5,902,192, 5,902,193, 5,902,194, 5,902,195, 5,902,196, 5,902,197, 5,902,198, 5,902,19 ... ,594,121, 5,596,091, 5,614,617, 5,681,941, 5,750,692, 6,015,886, 6,147,200, 6,166,197, 6,222,025, 6,235,887, 6,380,368, 6,528,640, 6,639,062, 6,617,438, 7,045,610, 7,427,672 and 7,495,088, the entire contents of each of which are incorporated herein by reference.

[0294] The RNA of iRNA can also be modified to contain one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with modified ribose moieties, in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0295] Additional representative United States patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Pat. Nos. 6,268,490, 6,670,461, 6,794,499, 6,998,484, 7,053,207, 7,084,125, and 7,399,845, the entire contents of each of which are incorporated herein by reference.

[0296] In some embodiments, the RNA of an iRNA may also be modified to include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanose ring modified by bridging two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring. Thus, in some embodiments, an agent of the present invention may include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of a locked nucleic acid to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, but are not limited to, nucleosides comprising a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agent of the present invention includes one or more bicyclic nucleosides comprising a 4' to 2' bridge.Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CHOCH3)-O-2' (and analogs, see e.g., U.S. Pat. No. 7,399,845), 4'-C(CH3)(CH3)-O-2' (and analogs, No. 8,278,283), 4'-CH2-N(OCH3)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Patent Application Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2', where R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C(=CH2)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426).

[0297] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226).

[0298] The RNA of an iRNA can also be modified to contain one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge. In one embodiment, the constrained ethyl nucleotide is in the S conformation and is referred to herein as an "S-cEt."

[0299] The iRNA of the present invention may also contain one or more "conformationally restricted nucleotides" ("CRNs"). A CRN is a nucleotide analogue with a linker connecting the C2' and C4' carbons or the C3 and C5' carbons of ribose. The CRN locks the ribose ring into a stable conformation, increasing hybridization affinity to mRNA. The linker is long enough to position the oxygen in an optimal position for stability and affinity, thereby reducing puckering of the ribose ring.

[0300] In some embodiments, the iRNA of the present invention includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNAs are unlocked acyclic nucleic acids in which any of their sugar linkages have been removed to form an unlocked "sugar" residue. In one example, UNAs also encompass monomers in which the C1'-C4' linkage has been removed (i.e., a covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' sugar linkage (i.e., a covalent carbon-carbon bond between the C2' and C3' carbons) has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).

[0301] Potential stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT (idT), and others. Disclosure of this modification can be found in PCT Publication WO 2011 / 005861.

[0302] Other modifications of the nucleotides of the iRNA of the present invention include 5' phosphates or 5' phosphate mimics, such as 5' terminal phosphates or phosphate mimics on the antisense strand of the iRNA. Suitable phosphate mimics are disclosed, for example, in U.S. Patent Application Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0303] A. Modified iRNAs Containing Motifs of the Invention In certain aspects of the present invention, the double-stranded RNA agent of the present invention includes agents with chemical modifications, such as those disclosed in International Publication No. 2013 / 075035, the entire contents of which are incorporated herein by reference.International Publication No. 2013 / 075035 provides three identical modifications on three consecutive nucleotides in the sense strand or antisense strand of dsRNAi agent, particularly at or near the cleavage site.In some embodiments, the sense strand and antisense strand of dsRNAi agent can be completely modified differently.The introduction of these motifs interrupts the modification pattern of the sense strand or antisense strand, if present.This dsRNAi agent can optionally be conjugated with GalNAc derivative ligand, for example, on the sense strand.

[0304] More specifically, gene silencing activity of a dsRNAi agent was observed when the sense and antisense strands of the double-stranded RNA agent were fully modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the dsRNAi agent.

[0305] Thus, the present invention provides double-stranded RNA agents capable of inhibiting expression of a target gene (i.e., the AGT gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent can be, for example, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0306] The sense strand and antisense strand typically form a duplex, double-stranded RNA ("dsRNA"), also referred to herein as a "dsRNAi agent." The duplex region of a dsRNAi agent can be, for example, a duplex region that can be 27-30 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0307] In certain embodiments, a dsRNAi agent may contain one or more overhang regions or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs may independently be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length. In certain embodiments, the overhang region may include an extended overhang region, as described above. The overhang may be the result of one strand being longer than the other, or the result of two strands of the same length being twisted. The overhang may form a mismatch with the target mRNA, be complementary to the targeted gene sequence, or be a different sequence. The first and second strands may also be linked by additional bases, for example, to form a hairpin, or by other non-basic linkers.

[0308] In certain embodiments, the nucleotides in the overhang region of dsRNAi agent can be independently modified or unmodified nucleotides, including but not limited to 2'-sugar modifications, such as 2'-F, 2'-O-methyl thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.For example, TT can be the overhang sequence for either end on either strand.This overhang can form mismatch with target mRNA, or can be complementary to the target gene sequence, or can be another sequence.

[0309] The 5'- or 3'-overhang of the sense strand, antisense strand, or both strands of dsRNAi agent can be phosphorylated.In some embodiments, the overhang region contains two nucleotides with phosphorothioate between them, and these two nucleotides can be the same or different.In some embodiments, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands.In some embodiments, this 3'-overhang is present in the antisense strand.In some embodiments, this 3'-overhang is present in the sense strand.

[0310] dsRNAi agent can only contain a single overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, single-stranded overhang can be located at the 3' end of sense strand or at the 3' end of antisense strand.RNAi can also have a blunt end located at the 5' end of antisense strand (or the 3' end of sense strand), or vice versa.Generally, the antisense strand of dsRNAi agent has a nucleotide overhang at the 3' end, and its 5' end is blunt.Without wishing to be bound by theory, the asymmetry between the blunt end at the 5' end of antisense strand and the 3' end overhang of antisense strand is favorable for the insertion of guide strand into RISC process.

[0311] In certain embodiments, the dsRNAi agent is 19 nucleotides in length and blunt-ended at both ends, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0312] In other embodiments, the dsRNAi agent is 20 nucleotides in length and blunt-ended at both ends, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0313] In yet other embodiments, the dsRNAi agent is 21 nucleotides in length and blunt-ended at both ends, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0314] In certain embodiments, dsRNAi agent comprises 21 nucleotide sense strand and 23 nucleotide antisense strand, wherein sense strand comprises at least one motif of three 2'-F modification on three consecutive nucleotides at 9, 10, 11 positions from 5' end, and antisense strand comprises at least one motif of three 2'-O-methyl modification on three consecutive nucleotides at 11, 12, 13 positions from 5' end, and one end of RNAi agent is blunt, and the other end comprises 2 nucleotide overhang.Preferably, 2 nucleotide overhang is at the 3' end of antisense strand.

[0315] When 2-nucleotide overhang is at the 3'-end of antisense strand, there can be two phosphorothioate internucleotide linkages between the three nucleotides at the end, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to the overhanging nucleotide.In one embodiment, the RNAi agent further has two phosphorothioate internucleotide linkages between the three nucleotides at the 5'-end of sense strand and the 5'-end of antisense strand.In certain embodiments, all nucleotides in the sense strand and antisense strand of dsRNAi agent, including the nucleotide that is part of a motif, are modified nucleotides.In certain embodiments, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example, in an alternating motif.Optionally, the dsRNAi agent further comprises a ligand (for example, GalNAc3).

[0316] In certain embodiments, the dsRNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25 to 30 nucleotide residues in length and, starting from the 5'-most nucleotide (position 1), comprises at least 8 ribonucleotides at positions 1 to 23 of the first strand; the antisense strand is 36 to 66 nucleotide residues in length and, starting from the 3'-most nucleotide, comprises at least 8 ribonucleotides at positions 1 to 23 of the sense strand, forming a duplex; at least the 3'-most nucleotide of the antisense strand is unpaired with the sense strand, and up to 6 consecutive 3'-most nucleotides are unpaired with the sense strand, thereby forming a 3' single-stranded overhang of 1 to 6 nucleotides; and the 5' end of the antisense strand comprises 10 to 30 consecutive ribonucleotides that are not paired with the sense strand. the sense strand comprises nucleotides corresponding to the 2'-F modification on three consecutive nucleotides, thereby forming a single-stranded 5' overhang of 10 to 30 nucleotides, at least the 5'- and 3'-terminal nucleotides of the sense strand base-pair with nucleotides of the antisense strand when the sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplex region between the sense and antisense strands, the antisense strand is complementary to the target RNA along at least 19 ribonucleotides of the antisense strand length sufficient to reduce target gene expression when the double-stranded nucleic acid is introduced into a mammalian cell, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides, at least one of the motifs occurring at or near the cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

[0317] In certain embodiments, the dsRNAi agent comprises a sense strand and an antisense strand, the dsRNAi agent comprises a first strand having a length of at least 25 nucleotides and at most 29 nucleotides, and a second strand having a length of at most 30 nucleotides, with at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, the 3' end of the first strand and the 5' end of the second strand form a blunt end, the second strand is 1-4 nucleotides longer than the first strand at its 3' end, the duplex region is at least 25 nucleotides in length, the second strand is sufficiently complementary to the target mRNA along at least 19 nucleotides in length so that the RNAi agent reduces target gene expression when introduced into mammalian cells, and Dicer cleavage of the dsRNAi agent preferably results in an siRNA comprising the 3' end of the second strand, thereby reducing the expression of the target gene in mammalian cells. Optionally, the dsRNAi agent further comprises a ligand.

[0318] In certain embodiments, the sense strand of the dsRNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, one of which occurs at the cleavage site in the sense strand.

[0319] In certain embodiments, the antisense strand of the dsRNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, one of which occurs at or near the cleavage site in the antisense strand.

[0320] For dsRNAi agents having a duplex region 19-23 nucleotides in length, the cleavage sites in the antisense strand are typically at approximately positions 10, 11, and 12 from the 5' end. Thus, three identical modification motifs can occur at positions 9, 10, 11, 10, 11, 12, 11, 12, 13, 12, 13, 14, or 13, 14, 15 of the antisense strand, where these numbers start from the first nucleotide from the 5' end of the antisense strand, or where these numbers start from the first paired nucleotide in the duplex region from the 5' end of the antisense strand. The cleavage site in the antisense strand can also vary depending on the length of the duplex region of the dsRNAi agent from the 5' end.

[0321] The sense strand of dsRNAi agent can contain at least one motif of three identical modifications on three consecutive nucleotides at the break site of strand, and antisense strand can have at least one motif of three identical modifications on three consecutive nucleotides at or near the break site of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand can be aligned so that one motif of three nucleotides on sense strand and one motif of three nucleotides on antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pairing.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.

[0322] In some embodiments, the sense strand of a dsRNAi agent may contain two or more motifs of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand, and the other motifs may be wing modifications. As used herein, the term "wing modification" refers to a motif that occurs in another part of the strand that is separated from a motif at or near the cleavage site of the same strand. The wing modification is adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other, the chemical nature of the motifs is distinct from each other, and when the motifs are separated by one or more nucleotides, the chemical nature may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may occur at one end of the first motif at or near the cleavage site, or on either side of the lead motif.

[0323] Similar to sense strand, the antisense strand of dsRNAi agent can contain two or more motifs of three identical modifications on three consecutive nucleotides, and at least one of these motifs occurs at or near the break site of strand.This antisense strand can also contain one or more wing modifications in the same alignment as the wing modifications that can exist on sense strand.

[0324] In some embodiments, wing modifications on the sense or antisense strand of a dsRNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

[0325] In other embodiments, wing modifications on the sense or antisense strand of a dsRNAi agent typically do not include the first one or two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

[0326] When the sense and antisense strands of a dsRNAi agent each contain at least one wing modification, the wing modifications can be at the same end of the duplex region and have an overlap of 1, 2, or 3 nucleotides.

[0327] When the sense or antisense strand of a dsRNAi agent each contains at least two wing modifications, the sense and antisense strands can be aligned such that two modifications from each single strand are at one end of a duplex region with an overlap of 1, 2, or 3 nucleotides, two modifications from each single strand are at the other end of a duplex region with an overlap of 1, 2, or 3 nucleotides, and two modifications from each single strand are on either side of a lead motif within the duplex region with an overlap of 1, 2, or 3 nucleotides.

[0328] In some embodiments, any nucleotide in the sense strand and antisense strand of dsRNAi agent, including the nucleotide that is part of motif, can be modified.Each nucleotide can be modified with the same or different modifications, and this modification can include one or more of the following: one or both of non-linked phosphate oxygen or one or more of linked phosphate oxygens, the modification of ribose sugar components, for example, the modification of the 2' hydroxyl on ribose sugar, the large-scale replacement of phosphate moiety with " dephosphorylation " linker, the modification or replacement of naturally occurring base, and the replacement or modification of ribose phosphate backbone.

[0329] Because nucleic acid is a polymer of subunits, many modifications occur at positions that are repeated within nucleic acid, such as modifications of bases or phosphate moieties, or unlinked O of phosphate moieties.In some cases, modifications occur at all target positions in nucleic acid, but in many cases, they do not occur.For example, modifications can occur only at the 3'-end or 5'-end position, or only at terminal regions, such as at the terminal nucleotide position of the chain, or at the last 2, 3, 4, 5, or 10 nucleotides of the chain.Modifications can occur in double-stranded regions, single-stranded regions, or both.Modifications can occur only in the double-stranded region of RNA, or only in the single-stranded region of RNA. For example, phosphorothioate modifications at non-linked O positions can occur only at one or both termini, can occur only in terminal regions, e.g., at the terminal nucleotide of the strand or within the last 2, 3, 4, 5, or 10 nucleotides of the strand, or can occur in double-stranded and single-stranded regions, especially at the termini. The 5' termini can be phosphorylated.

[0330] This may, for example, enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide substitutes in the single-stranded overhang, for example, in the 5' overhang or 3' overhang, or in both overhangs.For example, it may be desirable to include purine nucleotides in the overhang.In some embodiments, all or part of the bases in the 3' overhang or 5' overhang can be modified, for example, with the modifications described herein.Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar with modifications known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl, instead of the ribosugar of the nucleic acid base, and modifications at the phosphate group, for example, phosphorothioate modifications.The overhang does not need to be homologous to the target sequence.

[0331] In some embodiments, each residue of sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl or 2'-fluoro.Strands can contain two or more modifications.In one embodiment, each residue of sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0332] At least two different modifications are typically present on the sense and antisense strands, which may be 2'-O-methyl or 2'-fluoro modifications, for example.

[0333] In certain embodiments, N a or N b includes an alternating pattern of modifications. The term "alternating motif," as used herein, refers to a motif having one or more modifications, each modification occurring on alternating nucleotides in a single strand. Alternating nucleotides can refer to one every other nucleotide or one every three nucleotides, or similar patterns. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif could be "ABABABABABAB...," "AABBAABBAABB...," "AABAABAABAAB...," "AAABAAABAAAB...," "AAABBBAAABBB...," or "ABCABCABCABC...," etc.

[0334] The types of modifications contained within an alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications on every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possible modifications within the alternating motif, such as "ABABAB...," "ACACAC...," "BDBDBD...," or "CDCDCD...."

[0335] In some embodiments, the dsRNAi agents of the present invention comprise an alternating motif modification pattern on the sense strand that is shifted relative to the alternating motif modification pattern on the antisense strand. This shift can be made so that the modified groups of the nucleotides of the sense strand correspond to the differently modified groups of the nucleotides of the antisense strand, or vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA duplex, the alternating motif in the sense strand can begin with "ABABAB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can begin with "BABABA" from 5' to 3' of the strand in the duplex region. As another example, the alternating motif in the sense strand can begin with "AABBAABB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can begin with "BBAABBAA" from 5' to 3' of the strand in the duplex region, resulting in a complete or partial shift in the modification pattern between the sense and antisense strands.

[0336] In some embodiments, dsRNAi agent comprises the alternating motif pattern of 2'-O-methyl modification and 2'-F modification on sense strand, and first has a relative shift with respect to the alternating motif pattern of 2'-O-methyl modification and 2'-F modification on antisense strand, that is, comprises 2'-O-methyl modified nucleotide on base pair of sense strand and 2'-F modified nucleotide on antisense strand, and vice versa.Position 1 of sense strand can start with 2'-F modification, and position 1 of antisense strand can start with 2'-O-methyl modification.

[0337] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into sense strand or antisense strand interrupts the original modification pattern existing in sense strand or antisense strand.The interruption of the modification pattern of sense strand or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides into sense strand or antisense strand can enhance the gene silencing activity for target gene.

[0338] In some embodiments, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modification of the nucleotide adjacent to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif may be designated "...N a YYYN b ...", where "Y" represents a modification of a motif of three identical modifications on three consecutive nucleotides, and "N a " and "N b " represents a modification to the nucleotide adjacent to the motif "YYY" that is different from the modification of Y, and N a and N b may be the same or different modifications. Alternatively, when wing modifications are present, N a or N b may or may not be present.

[0339] The iRNA may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur at any nucleotide in the sense strand, the antisense strand, or both strands at any position in the strand. For example, the internucleotide linkage modification may occur at every nucleotide in the sense strand or the antisense strand, each internucleotide linkage modification may occur in an alternating pattern on the sense strand or the antisense strand, or the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide linkage modifications on the sense strand may be the same as or different from that of the antisense strand, and the alternating pattern of internucleotide linkage modifications on the sense strand may have a shift relative to the alternating pattern of internucleotide linkage modifications on the antisense strand. In one embodiment, the double-stranded RNAi agent comprises 6 to 8 phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5' end or the 3' end.

[0340] In some embodiments, dsRNAi agent comprises phosphorothioate or methylphosphonate internucleotide linkage modification in overhang region.For example, overhang region can contain two nucleotides with phosphorothioate or methylphosphonate internucleotide linkage between two nucleotides.Internucleotide linkage modification can also be made to connect overhang nucleotide with the terminal paired nucleotide in double-stranded region.For example, at least 2, 3, 4 or all overhang nucleotides can be linked by phosphorothioate or methylphosphonate internucleotide linkage, and optionally there can be another phosphorothioate or methylphosphonate internucleotide linkage that connects overhang nucleotide with the paired nucleotide adjacent to overhang nucleotide.For example, there can be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, where two of the three nucleotides are overhang nucleotides and the third is the paired nucleotide adjacent to overhang nucleotide. These terminal three nucleotides can be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, or the 5' end of the antisense strand.

[0341] In some embodiments, the 2-nucleotide overhang is at the 3'-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to the overhanging nucleotide.Optionally, the dsRNAi agent can also have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.

[0342] In one embodiment, the dsRNAi agent comprises mismatches or combinations thereof in the duplex with the target. Mismatches can occur in the overhang region or in the duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (for example, based on the free energy of association or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but then adjacent or similar analysis can also be used). In terms of promoting dissociation, A:U is more preferable than G:C, G:U is more preferable than G:C, and I:C is more preferable than G:C (I=inosine). Mismatches, for example, non-standard pairings or non-standard pairings (described elsewhere in this specification), are more preferable than standard (A:T, A:U, G:C) pairings, and pairings that include universal bases are more preferable than standard pairings.

[0343] In certain embodiments, the dsRNAi agent comprises the first 1, 2, 3, 4, or 5 base pairs within the duplex region from the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and at least one mismatch pair, e.g., a non-canonical pairing or a non-canonical pairing or a pairing containing a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.

[0344] In certain embodiments, the nucleotide at position 1 in the double-stranded region from the 5' end of the antisense strand is selected from A, dA, dU, U and dT.Alternatively, at least one of the first 1, 2 or 3 base pairs in the double-stranded region from the 5' end of the antisense strand is an AU base pair.For example, the first base pair in the double-stranded region from the 5' end of the antisense strand is an AU base pair.

[0345] In other embodiments, the nucleotide at the 3' end of the sense strand is deoxythymine (dT), or the nucleotide at the 3' end of the antisense strand is deoxythymine (dT). For example, a short sequence of deoxythymine nucleotides, e.g., two dT nucleotides, is present on the 3' end of the sense strand, the antisense strand, or both strands.

[0346] In certain embodiments, the sense strand sequence has formula (I): 5' n p -N a -(XXX) i -N b -YYY -N b -(ZZZ) j -N a -n q 3' (I) It can be expressed as During the ceremony, i and j each independently represent 0 or 1; p and q each independently represent 0 to 6; each N a independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p and n q independently represent overhanging nucleotides, wherein Nb and Y do not have the same modification, and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably, YYY are all 2'-F modified nucleotides.

[0347] In some embodiments, N a or N b includes alternating pattern modifications.

[0348] In some embodiments, YYY motif occurs at or near the cleavage site of sense strand.For example, when dsRNAi agent has the double-stranded region of 17-23 nucleotides in length, YYY motif can occur at or near the cleavage site of sense strand (for example, can occur at 6,7,8 position, 7,8,9 position, 8,9,10 position, 9,10,11 position, 10,11,12 position, or 11,12,13 position), and this number starts from the first nucleotide from 5' end, or optionally this number starts from the first paired nucleotide in double-stranded region from 5' end.

[0349] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand has the following formula: 5' n p -N a -YYY-N b -ZZZ-N a -n q 3' (Ib), 5' n p -N a -XXX-N b -YYY-N a -n q 3' (Ic), or 5' n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id).

[0350] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0351] When the sense strand is represented by formula (Ic), N brepresents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0352] When the sense strand is represented by formula (Id), each N b independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6. Each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0353] Each of X, Y and Z may be the same or different from one another.

[0354] In other embodiments, i is 0 and j is 0 and the sense strand has the formula: 5' n p -N a -YYY- N a -n q 3'(Ia).

[0355] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0356] In one embodiment, the antisense strand sequence of the RNAi has the formula (II): 5' n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3' (II), During the ceremony, k and l each independently represent 0 or 1; p' and q' each independently represent 0 to 6; each N a each independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p ' and n q ' independently represent an overhanging nucleotide; In the formula, N b ' and Y' do not have the same modification, and X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0357] In some embodiments, N a ' or N b ' includes alternating pattern modifications.

[0358] Y'Y'Y' motif occurs at or near the cleavage site of antisense strand.For example, when dsRNAi agent has a double-stranded region of 17-23 nucleotides in length, Y'Y'Y' motif can occur at the 9th, 10th, 11th, 10th, 11th, 12th, 11th, 12th, 13th, 12th, 13th, 14th, or 13th, 14th, 15th positions of antisense strand, and this number starts from the first nucleotide from the 5' end, or optionally this number starts from the first paired nucleotide in double-stranded region from the 5' end.Preferably, Y'Y'Y' motif occurs at the 11th, 12th, 13th positions.

[0359] In certain embodiments, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0360] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 1.

[0361] Thus, the antisense strand has the formula: 5' n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3' (IIb), 5' n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3' (IIc), or 5' n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3' (IId).

[0362] When the antisense strand is represented by formula (IIb), N b ’ represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0363] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0364] When the antisense strand is represented by formula (IId), each N bEach N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6.

[0365] In other embodiments, k is 0 and l is 0, and the antisense strand has the formula 5' n p’ -N a’ -Y'Y'Y'- N a’ -n q’ 3' (Ia).

[0366] When the antisense strand is represented by formula (IIa), each N a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. Each of X', Y' and Z' may be the same as or different from one another.

[0367] Each nucleotide of sense strand and antisense strand can be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.Each X, Y, Z, X', Y' and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification.

[0368] In some embodiments, the sense strand of the dsRNAi agent can contain a YYY motif occurring at positions 9, 10, and 11 of the strand when the duplex region is 21nt (nucleotides), the numbers starting from the first nucleotide from the 5' end, or optionally the numbers starting from the first paired nucleotide in the duplex region from the 5' end, and Y represents a 2'-F modification. The sense strand can further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region, and XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0369] In some embodiments, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, or 13 of the strand, where the numbering starts from the first nucleotide from the 5' end, or optionally, the numbering starts from the first paired nucleotide in the duplex region from the 5' end, and Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region, and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0370] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic) and (Id) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc) and (IId).

[0371] Thus, the dsRNAi agents used in the methods of the invention can include a sense strand and an antisense strand, each strand having 14-30 nucleotides, and the iRNA duplex can have the following formula (III): Sense: 5' n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3' n p ’ -N a ’ -(X'X'X') k -N b ’ -Y'Y'Y'-N b ’ -(Z'Z'Z') l -N a ’ -n q ’ 5' (III) During the ceremony, i, j, k, and l each independently represent 0 or 1; p, p', q and q' each independently represent 0 to 6; each N a and N a ’ independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b and N b ’ independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; In the formula, each n p ',n p , n q ' and n q each of which may or may not be present independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0372] In one embodiment, i is 0 and j is 0, or i is 1 and j is 0, or i is 0 and j is 1, or i and j are both 0, or i and j are both 1. In another embodiment, k is 0 and l is 0, or k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 0, or k and l are both 1.

[0373] Exemplary combinations of sense and antisense strands that form iRNA duplexes include the following formulas: 5' n p - N a -YYY -N a -n q 3' 3' n p ’ -N a ’ -Y'Y'Y'-N a ’ n q ’ 5' (IIIa) 5' n p -N a -YY YN b -ZZ ZN a -n q 3' 3' n p ’ -N a ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ n q ’ 5' (IIIb) 5' n p -N a -XX XN b -YY YN a -n q 3' 3' n p ’ -N a ’ -X'X'X'-Nb ’ -Y'Y'Y'-N a ’ -n q ’ 5' (IIIc) 5' n p -N a -XX XN b -YY YN b -ZZ ZN a -n q 3' 3' n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a -n q ’ 5' (IIId)

[0374] When the dsRNAi agent has formula (IIIa), each N a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0375] When the dsRNAi agent has formula (IIIb), each N b independently represent an oligonucleotide sequence containing 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0376] When the dsRNAi agent has formula (IIIc), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0377] When the dsRNAi agent has formula (IIId), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a ’ independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b , and N b ’ each independently comprises an alternating pattern of modifications.

[0378] Each of X, Y, and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from one another.

[0379] When the dsRNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can be base-paired with one of the Y' nucleotides. Alternatively, at least two Y nucleotides are base-paired with the corresponding Y' nucleotide, or all three Y nucleotides are base-paired with the corresponding Y' nucleotide.

[0380] When the dsRNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can form a base pair with one of the Z' nucleotides. Alternatively, at least two Z nucleotides form a base pair with the corresponding Z' nucleotide, or all three Z nucleotides form a base pair with the corresponding Z' nucleotide.

[0381] When the dsRNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides can form a base pair with one of the X' nucleotides.Alternatively, at least two of the X nucleotides can form a base pair with the corresponding X' nucleotide, or all three of the X nucleotides can form a base pair with the corresponding X' nucleotide.

[0382] In certain embodiments, the modification on a Y nucleotide is different from the modification on a Y' nucleotide, or the modification on a Z nucleotide is different from the modification on a Z' nucleotide, or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0383] In certain embodiments, when the dsRNAi agent has formula (IIId), N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In other embodiments, when the RNAi agent has formula (IIid), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, and p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to the adjacent nucleotide via a phosphorothioate linkage. a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p In another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker (described below). a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p' are linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker.

[0384] In some embodiments, when the dsRNAi agent has Formula (IIIa), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, n p '>0 and at least one n p ' are linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker.

[0385] In some embodiments, dsRNAi agent is a multimer that contains at least two double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and said double strands are connected by linker.This linker can be cleavable or not cleavable.Optionally, said multimer further comprises ligand.Each double strand can target the same gene or two different genes, or each double strand can target the same gene at two different target sites.

[0386] In some embodiments, dsRNAi agent is a multimer that contains 3, 4, 5, 6 or more double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and said double strands are connected by linker.This linker can be cleavable or not cleavable.Optionally, said multimer further comprises ligand.Each double strand can target the same gene or two different genes, or each double strand can target the same gene at two different target sites.

[0387] In one embodiment, two dsRNAi agents represented by at least one of formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5' end and at one or both of the 3' ends, and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes, or each of the agents can target the same gene at two different target sites.

[0388] In certain embodiments, the RNAi agent of the present invention may contain a small number of nucleotides containing 2'-fluoro modifications, for example, 10 or fewer nucleotides with 2'-fluoro modifications. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides with 2'-fluoro modifications. In certain embodiments, the RNAi agent of the present invention contains 10 nucleotides with 2'-fluoro modifications, for example, 4 nucleotides with 2'-fluoro modifications in the sense strand and 6 nucleotides with 2'-fluoro modifications in the antisense strand. In another specific embodiment, the RNAi agent of the present invention contains 6 nucleotides with 2'-fluoro modifications, for example, 4 nucleotides with 2'-fluoro modifications in the sense strand and 2 nucleotides with 2'-fluoro modifications in the antisense strand.

[0389] In other embodiments, the RNAi agent of the present invention may contain a very small number of nucleotides containing 2'-fluoro modifications, for example, two or fewer nucleotides containing 2'-fluoro modifications. For example, the RNAi agent may contain two, one, or zero nucleotides with 2'-fluoro modifications. In certain embodiments, the RNAi agent may contain two nucleotides with 2'-fluoro modifications, for example, zero nucleotides with 2'-fluoro modifications in the sense strand and two nucleotides with 2'-fluoro modifications in the antisense strand.

[0390] Various publications describe multimeric iRNAs that can be used in the methods of the invention, including WO 2007 / 091269, U.S. Patent No. 7,858,769, WO 2010 / 141511, WO 2007 / 117686, WO 2009 / 014887, and WO 2011 / 031520, the entire contents of each of which are incorporated herein by reference.

[0391] As described in more detail below, iRNAs containing one or more carbohydrate moieties conjugated to the iRNA can optimize one or more properties of the iRNA. Often, the carbohydrate moiety will be attached to a modified subunit of the iRNA. For example, the ribose sugar of one or more ribonucleotide subunits of the iRNA can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, e.g., fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.

[0392] The ligand can be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone attachment point," preferably two "backbone attachment points," and (ii) at least one "tethering attachment point." As used herein, "backbone attachment point" refers to a functional group, e.g., a hydroxyl group, or generally a bond that is available and suitable for incorporating the carrier into the backbone of a ribonucleic acid, e.g., a phosphate or a modified phosphate backbone, e.g., sulfur-containing. In some embodiments, a "tethering attachment point" (TAP) refers to a ring atom, e.g., a carbon atom or heteroatom (other than the atom that provides the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety can be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier by an intervening tether. Thus, cyclic carriers often contain functional groups, e.g., amino groups, or generally bonds, that provide a linkage suitable for the incorporation or tethering of another chemical entity, e.g., a ligand, to the constituent ring.

[0393] The iRNA can be conjugated to the ligand via a carrier, which can be a cyclic or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; and preferably, the acyclic group is a serinol skeleton or a diethanolamine skeleton.

[0394] In another embodiment of the invention, the iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides. [ka] (L), which can be expressed as: In formula (L), B1, B2, B3, B1', B2', B3', and B4' are each independently a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe modification. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe modification or a 2'-F modification. In one embodiment, at least one of B1, B2, B3, B1', B2', B3', and B4' contains a 2'-ON-methylacetamide (2'-O-NMA) modification.

[0395] C1 is a thermally destabilizing nucleotide located opposite the seed region of the antisense strand (i.e., positions 2-8 of the 5' end of the antisense strand). For example, C1 is located in the sense strand at a position that pairs with the nucleotide at positions 2-8 of the 5' end of the antisense strand. In one example, C1 is located at position 15 from the 5' end of the sense strand. The C1 nucleotide carries a thermally destabilizing modification that may include an abasic modification, a mismatch with the opposing nucleotide in the duplex, and a sugar modification, such as a 2'-deoxy modification, or an acyclic nucleotide, such as an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA). In one embodiment, C1 is: i) a mismatch with the opposing nucleotide in the antisense strand; ii) an abasic modification selected from the group consisting of: [ka] and iii) a sugar modification selected from the group consisting of: [ka] where B is a modified or unmodified nucleobase and R 1 and R 2are independently H, halogen, OR3, or alkyl, and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar modification. In one embodiment, the thermally destabilizing modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T, and optionally at least one nucleobase in the mismatch pair is a 2'-deoxynucleobase. In one example, the thermally destabilizing modification in C1 is GNA or [ka] is.

[0396] T1, T1', T2', and T3' each independently represent a nucleotide containing a modification that provides the nucleotide with steric bulk equal to or less than that of the 2'-OMe modification. Steric bulk refers to the sum of the steric effects of the modifications. Methods for determining the steric effect of a nucleotide modification are known to those skilled in the art. The modification may be at the 2'-position of the ribose sugar of the nucleotide, or may be a non-ribose nucleotide, an acyclic nucleotide, or a modification to the backbone of the nucleotide that is similar or equivalent to the 2'-position of the ribose sugar, and provides the nucleotide with steric bulk equal to or less than that of the 2'-OMe modification. For example, T1, T1', T2', and T3' are each independently selected from DNA, RNA, LNA, 2'-F, and 2'-F-5'-methyl. In one embodiment, T1 is DNA. In one embodiment, T1' is DNA, RNA, or LNA. In one embodiment, T2' is DNA or RNA. In one embodiment, T3' is DNA or RNA. n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length. n 5 , q 3 , and q 7 are independently 1 to 6 nucleotides in length. n 4 , q 2 , and q 6 are independently 1 to 3 nucleotides in length, or n 4 is 0 nucleotides long. q 5 are independently 0 to 10 nucleotides in length. n 2 , and q 4 are independently 0 to 3 nucleotides in length.

[0397] Or, n 4 is 0 to 3 nucleotides in length.

[0398] In one embodiment, n 4 can be 0. In one embodiment, n 4 is 0 and q 2 and q 6 is 1. In another example, n 4 is 0 and q 2 and q 6 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand).

[0399] In one embodiment, n 4 , q 2 , and q 6 are each 1.

[0400] In one embodiment, n 2 , n 4 , q 2 , q 4 , and q 6 are each 1.

[0401] In one embodiment, C1 is selected from the group consisting of a sense strand having a length of 19 to 22 nucleotides and a 4When C1 is 1, it is at positions 14 to 17 of the 5' end of the sense strand. In one embodiment, C1 is at position 15 of the 5' end of the sense strand.

[0402] In one embodiment, T3' begins at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand and 6 is equal to 1.

[0403] In one embodiment, T1' begins at position 14 from the 5' end of the antisense strand. 2 is equal to 1.

[0404] In an exemplary embodiment, T3' starts at position 2 from the 5' end of the antisense strand, and T1' starts at position 14 from the 5' end of the antisense strand. In one example, T3' starts at position 2 from the 5' end of the antisense strand, and q 6 is equal to 1, and T1' starts at position 14 from the 5' end of the antisense strand, and q 2 is equal to 1.

[0405] In one embodiment, T1' and T3' are separated by a length of 11 nucleotides (ie, not counting the T1' and T3' nucleotides).

[0406] In one embodiment, T1' is at position 14 from the 5' end of the antisense strand. In one example, T1' is at position 14 from the 5' end of the antisense strand, and 2 is equal to 1, and non-ribose acyclic or backbone modifications at the 2' position are less sterically bulky than 2'-OMe ribose.

[0407] In one embodiment, T3' is at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand, and 6is equal to 1, and non-ribose acyclic or backbone modifications at the 2' position are less or equally sterically bulky than 2'-OMe ribose.

[0408] In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at the cleavage site of the sense strand, where the sense strand is 19-22 nucleotides in length and n 2 is 1, it is at position 11 from the 5' end of the sense strand. In an exemplary embodiment, T1 is at position 11 from the 5' end of the sense strand when the sense strand is 19-22 nucleotides in length and n 2 When is 1, it is at the cleavage site of the sense strand, which is at position 11 from the 5' end of the sense strand.

[0409] In one embodiment, T2' begins at position 6 from the 5' end of the antisense strand. In one example, T2' is at positions 6-10 from the 5' end of the antisense strand, and 4 is 1.

[0410] In an exemplary embodiment, T1 is at the cleavage site of the sense strand, e.g., the sense strand is 19-22 nucleotides in length and 2 When T1' is 1, it is located at the 11th position from the 5' end of the sense strand, and T1' is located at the 14th position from the 5' end of the antisense strand. 2 is equal to 1, and the modification to T1' is at the 2' position of the ribose sugar or at a non-ribose acyclic or intra-backbone position that is less sterically bulky than 2'-OMe ribose, T2' is at positions 6-10 from the 5' end of the antisense strand, and q 4 is 1, and T3' is at the second position from the 5' end of the antisense strand, and q 6 is equal to 1, and the modification to T3' is at the 2' position or at a non-ribose acyclic or intrabackbone position that is less sterically bulky than 2'-OMe ribose.

[0411] In one embodiment, T2' starts at position 8 from the 5' end of the antisense strand. In one example, T2' starts at position 8 from the 5' end of the antisense strand and 4 is 2.

[0412] In one embodiment, T2' begins at position 9 from the 5' end of the antisense strand. 4 is 1.

[0413] In one embodiment, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0414] In one embodiment, n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0415] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0416] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0417] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0418] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0419] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0420] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0421] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, optionally with at least 2 additional TTs at the 3' end of the antisense strand.

[0422] In one embodiment, B1 is 2'-OMe or 2'-F, and n1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, optionally with at least two additional TTs at the 3' end of the antisense strand, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), and with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0423] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6is 1, B4' is 2'-OMe, and q 7 is 1.

[0424] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 (counting from the 5' end) of the antisense strand.

[0425] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.

[0426] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0427] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.

[0428] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0429] The RNAi agent can include a phosphorus-containing group at the 5'-end of the sense or antisense strand. The 5'-terminal phosphorus-containing group can be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos), or 5'-deoxy-5'-C-malonyl ( [ka] When the 5'-terminal phosphorus-containing group is a 5'-terminal vinyl phosphonate (5'-VP), the 5'-VP may be a 5'-E-VP isomer (i.e., trans-vinyl phosphate, [ka] ), 5'-Z-VP isomer (i.e., cis-vinyl phosphate, [ka] ), or a mixture thereof.

[0430] In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the sense strand.In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the antisense strand.

[0431] In one embodiment, the RNAi agent comprises a 5'-P. In one embodiment, the RNAi agent comprises a 5'-P in the antisense strand.

[0432] In one embodiment, the RNAi agent comprises a 5'-PS. In one embodiment, the RNAi agent comprises a 5'-PS in the antisense strand.

[0433] In one embodiment, the RNAi agent comprises a 5'-VP. In one embodiment, the RNAi agent comprises a 5'-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-Z-VP in the antisense strand.

[0434] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-PS2 in the antisense strand.

[0435] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-deoxy-5'-C-malonyl in the antisense strand.

[0436] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0437] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0438] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0439] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0440] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0441] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0442] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0443] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0444] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0445] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0446] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0447] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The dsRNA agent also includes a 5'-PS.

[0448] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0449] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0450] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0451] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-P.

[0452] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS.

[0453] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0454] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2.

[0455] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0456] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0457] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0458] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0459] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The dsRNAi RNA agent also includes a 5'-PS2.

[0460] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0461] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0462] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0463] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0464] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0465] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0466] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0467] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0468] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0469] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0470] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0471] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0472] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0473] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0474] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0475] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0476] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.

[0477] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0478] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand.

[0479] In one embodiment, the 5'-VP is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.

[0480] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.

[0481] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0482] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0483] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0484] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0485] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0486] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0487] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.

[0488] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0489] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0490] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe...

Claims

1. A pharmaceutical composition for inhibiting the expression of the angiotensinogen (AGT) gene in a subject, wherein the composition comprises a fixed dose of about 50 mg to about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof, wherein the double-stranded RNAi agent or a salt thereof comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfaAfAfugagagucaca of SEQ ID NO: 12, wherein a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, s is phosphorothioate linkage, and the subject has a treatment history with antihypertensive drugs, the pharmaceutical composition.

2. A pharmaceutical composition for treating a subject who would benefit from a reduction in AGT expression, wherein the composition comprises a fixed dose of about 50 mg to about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof, wherein the double-stranded RNAi agent or a salt thereof comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfaAfAfugagagucaca of SEQ ID NO: 12, a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, s is phosphorothioate linkage, and The pharmaceutical composition, wherein the subject has a treatment history with antihypertensive drugs.

3. A pharmaceutical composition for treating a subject having an AGT-related disorder, wherein the composition comprises a fixed dose of about 50 mg to about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof, the double-stranded RNAi agent or a salt thereof comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCf aCfAfAfugagagua ca of SEQ ID NO: 12, a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, s is phosphorothioate linkage, and The pharmaceutical composition, wherein the subject has a treatment history with antihypertensive drugs.

4. A pharmaceutical composition for reducing blood pressure levels in a subject, The composition contains a fixed dose of about 50 mg to about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof, The double-stranded RNAi agent or a salt thereof contains a sense strand and an antisense strand that form a double-stranded region, The antisense strand contains a modified nucleotide sequence including at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand contains a modified nucleotide sequence including at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCf aCfAfAfugagagucaca of SEQ ID NO: 12, a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is a thymidine-glycol nucleic acid (GNA) S-isomer, s is a phosphorothioate linkage, and The subject has a treatment history with antihypertensive drugs, a pharmaceutical composition.

5. The pharmaceutical composition according to any one of claims 1 to 4 and 32, wherein the antisense strand contains a modified nucleotide sequence including at least 20 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand contains a modified nucleotide sequence including at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCf aCfAfAfugagagucaca of SEQ ID NO:

12.

6. The antisense strand contains a modified nucleotide sequence comprising at least 21 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand contains a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagagucaca of SEQ ID NO:

12. The pharmaceutical composition according to any one of claims 1 to 4 and 32.

7. The antisense strand contains a modified nucleotide sequence comprising at least 22 consecutive nucleotides of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand contains a modified nucleotide sequence comprising at least 20 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagagucaca of SEQ ID NO:

12. The pharmaceutical composition according to any one of claims 1 to 4 and 32.

8. The antisense strand contains the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand contains the modified nucleotide sequence gsuscaucCfaCfAfAfugagagucaca of SEQ ID NO:

12. The pharmaceutical composition according to any one of claims 1 to 4 and 32.

9. The antisense strand consists of the modified nucleotide sequence usGfsua c(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand consists of the modified nucleotide sequence gsuscaucCfaCfAfAfugagagucaca of SEQ ID NO:

12. The pharmaceutical composition according to any one of claims 1 to 4 and 32.

10. The double-stranded RNAi agent or a salt thereof further contains a ligand. The pharmaceutical composition according to any one of claims 1 to 4 and 32.

11. The pharmaceutical composition according to claim 10, wherein the ligand is conjugated to the 3'-end of the sense strand.

12. The pharmaceutical composition according to claim 10, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

13. The pharmaceutical composition according to claim 12, wherein the GalNAc derivative comprises one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

14. The pharmaceutical composition according to claim 12, wherein the ligand is as follows. 【Chemical Formula 1】

15. The 3'-end of the sense strand is conjugated to the ligand as shown in the following scheme, [Chemical 2] wherein X is O or S, or X is O, the pharmaceutical composition according to claim 14.

16. The pharmaceutical composition according to any one of claims 1 to 4 and 32, wherein the subject is human.

17. The pharmaceutical composition according to claim 16, wherein the subject has a systolic blood pressure of at least 130 mmHg or a diastolic blood pressure of at least 80 mmHg.

18. The pharmaceutical composition according to claim 16, wherein the subject has a systolic blood pressure of at least 140 mmHg or a diastolic blood pressure of at least 80 mmHg.

19. The pharmaceutical composition according to any one of claims 1 to 4, wherein the subject is part of a group prone to salt sensitivity, overweight, obese, pregnant, planning to become pregnant, has type 2 diabetes, has type 1 diabetes, or has reduced renal function.

20. The pharmaceutical composition according to claim 2, wherein the disorder that would benefit from the reduction of AGT expression is an AGT-related disorder.

21. The pharmaceutical composition according to claim 3 or 20, wherein the AGT-related disorder is selected from the group consisting of hypertension, hypertensive disease, borderline hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, episodic hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension, mild to moderate hypertension, hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disorder, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrillation, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic scleroderma, intrauterine growth retardation (IUGR), fetal hypoplasia, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), impaired glucose tolerance, type 2 diabetes, and metabolic syndrome.

22. The pharmaceutical composition according to claim 4, wherein the blood pressure includes systolic blood pressure and / or diastolic blood pressure.

23. The pharmaceutical composition according to any one of claims 1 to 4 and 32, wherein the use of the composition results in a decrease in AGT expression of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

24. The pharmaceutical composition according to claim 23, wherein the AGT protein level in the blood or serum sample of the subject is reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

25. The pharmaceutical composition according to any one of claims 1 to 4 and 32, wherein the use of the composition results in a decrease in systolic blood pressure and / or diastolic blood pressure.

26. The pharmaceutical composition according to claim 25, wherein the systolic blood pressure and / or diastolic blood pressure is reduced by at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg, or 10 mmHg.

27. The pharmaceutical composition according to claims 1 to 4 and 32, wherein the composition comprises a non-buffered solution.

28. The pharmaceutical composition according to claim 27, wherein the non-buffered solution is physiological saline or water.

29. The pharmaceutical composition according to claims 1 to 4 and 32, wherein the composition comprises a buffered solution.

30. The pharmaceutical composition according to claim 29, wherein the buffer solution comprises an acetate, a citrate, a prolamine, a carbonate, or a phosphate, or a combination of any of these.

31. The pharmaceutical composition according to claim 30, wherein the buffer solution is phosphate buffered saline (PBS).

32. A pharmaceutical composition for treating a subject having mild to moderate hypertension, wherein the composition comprises a fixed dose of from about 50 mg to about 800 mg of a double-stranded ribonucleic acid (RNAi) agent or a salt thereof, wherein the double-stranded RNAi agent or a salt thereof comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence usGfsuaac(Tgn)cucauugUfgGfaugacsgsa of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 consecutive nucleotides of the modified nucleotide sequence gsuscaucCfaCfaAfAfugagaguaaca of SEQ ID NO: 12, wherein a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'-fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-isomer, s is a phosphorothioate linkage, and the pharmaceutical composition, wherein the subject has a treatment history with antihypertensive drugs.

33. The pharmaceutical composition according to claims 1 to 4 and 32, further comprising measuring the levels of plasma renin, aldosterone, AngI, and / or AngII in the subject.

34. The pharmaceutical composition according to claims 1 to 4 and 32, wherein the subject has discontinued administration of antihypertensive drugs prior to administration of the composition.

35. The pharmaceutical composition according to claim 34, wherein the subject has discontinued administration of antihypertensive drugs for at least 2 weeks or 4 weeks prior to administration of the composition.

36. The pharmaceutical composition according to claims 1 to 4 and 32, wherein the antihypertensive agent is selected from the group consisting of an angiotensin-converting enzyme inhibitor, an angiotensin II receptor blocker, a renin inhibitor, a calcium channel blocker, a thiazide diuretic, and / or a thiazide-like diuretic.

37. The pharmaceutical composition according to claim 32, wherein the subject has a daytime average systolic blood pressure (SBP) of 135 mmHg or more and 160 mmHg or less by ABPM at least 4 weeks before administration of the composition.

38. The pharmaceutical composition according to claim 32, wherein the subject does not have secondary hypertension or orthostatic hypotension.

39. The pharmaceutical composition according to claims 1 to 4 and 32, further comprising determining the blood pressure in the subject.

40. The pharmaceutical composition according to claim 39, wherein a blood pressure reduction, a time-regulated change in blood pressure, and / or a change in daytime average and nighttime average blood pressure in the subject after 6 months are determined.

41. The pharmaceutical composition according to any one of claims 1 to 4 and 32, further comprising selecting a subject whose blood pressure is not appropriately managed by antihypertensive agents of standard treatment.

42. The pharmaceutical composition according to any one of claims 1 to 4 and 32, which is for subcutaneous administration.

43. The pharmaceutical composition according to claim 42, which is for subcutaneous injection.

44. The pharmaceutical composition according to any one of claims 1 to 4 and 32, comprising a fixed dose of about 200 to 400 mg.

45. The pharmaceutical composition according to claim 44, comprising a fixed dose of about 300 mg.

46. The pharmaceutical composition according to any one of claims 1 to 4 and 32, which is for administration once every 6 months.

47. The pharmaceutical composition according to any one of claims 1 to 4 and 32, comprising a fixed dose of about 200 to 400 mg and being for administration once every 6 months.

48. The pharmaceutical composition according to claim 47, comprising a fixed dose of about 300 mg and being for subcutaneous administration once every 6 months.