Combination cancer therapy with epithelial cell adhesion molecule (EPCAM) inhibitors and WNT inhibitors

Abstract

The present invention relates to a combination therapy of cancer using an epithelial cell adhesion molecule (EpCAM) inhibitor and a Wnt signaling inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). This combination therapy is effective in inducing apoptosis of cancer cells, inhibiting cancer stemness, tumor progression and / or metastasis, and / or prolonging the survival of cancer patients.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of priority under 35 U.S.C. § 119 to U.S. Provisional Application No. 63 / 215,036, filed June 25, 2021, the entire contents of which are incorporated herein by reference.

[0002] Technical Field The present invention relates to a combination therapy of cancer using an epithelial cell adhesion molecule (EpCAM) inhibitor and a Wnt inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). This combination therapy is effective in inducing apoptosis of cancer cells, suppressing cancer stemness, inhibiting tumor progression and / or metastasis, and / or prolonging the survival of cancer patients. [Background technology]

[0003] 2. Background of the Invention Epithelial cell adhesion molecule (EpCAM, also known as CD326) is highly expressed in many cancer types, including colorectal cancer (CRC). Distinct from its cell adhesion function in healthy epithelial cells, this protein is activated by cleavage at the plasma membrane to release its extracellular domain (EpEX) and intracellular domain (EpICD), which are involved in proliferation, epithelial-mesenchymal transition (EMT), stemness and differentiation to promote tumor progression (Chen et al., 2020; Gires et al., 2009; Gires et al., 2020; Liang et al., 2018; Lin et al., 2012; Maetzel et al., 2009; Sankpal et al., 2017). In this regard, EpEX has been reported to directly bind to EGFR and stimulate its downstream signaling, including EGFR phosphorylation and PD-L1 stabilization (Chen et al., 2020; Liang et al., 2018; Pan et al., 2018). Importantly, EpCAM has been shown to be a potent cancer stem cell (CSC) antigen; however, its exact role is poorly understood (Gires et al., 2009; Gires et al., 2020; Lin et al., 2012). Herein, one pathway known to play a central role in the pathobiology of CSCs is Wnt-β-catenin signaling, which is involved in promoting several malignant tumor-associated features, such as tumorigenicity, tumor plasticity, and drug resistance, making this pathway an interesting therapeutic target in cancer (Kahn, 2014; Nusse and Clevers, 2017). It has been suggested that targeting CSC populations may be a beneficial therapeutic strategy, however, definitive identification of CSC populations remains a major challenge ( Batlle and Clevers, 2017 ).To target CSCs in cancer therapy, it may be possible to block activation of the Wnt pathway by targeting factors in the tumor microenvironment that signal to CSCs ( Batlle and Clevers, 2017 ; Nusse and Clevers, 2017 ; Zhan et al., 2017 ).

[0004] EpCAM may be one such mediator of Wnt signaling in CSCs, since EpICD is a well-studied factor that promotes cell motility, proliferation, survival and metastasis (Gires et al., 2009; Gires et al., 2020; Liang et al., 2018; Lin et al., 2012; Park et al., 2016). More importantly, it is known that soluble EpICD can form a multi-protein nuclear complex with β-catenin and a scaffolding protein called four and one-half LIM domain protein 2 (FHL2), translocate to the nucleus, and bind with T cell factor (TCF) or lymphoid enhancer factor 1 (LEF-1) to transcribe Wnt target genes (Maetzel et al., 2009; Park et al., 2016; Ralhan et al., 2010). However, it is unclear whether EpEX cooperates with the Wnt pathway in any way.

[0005] In colorectal cancer (CRC) patients, high expression of EpCAM suggests poor prognosis, which is in line with the known critical involvement of EpICD in CRC cell function (Chen et al., 2020; Kim et al., 2016; Liang et al., 2018; Lin et al., 2012; Seeber et al., 2016; Wang et al., 2016). Moreover, EpCAM enhances the tumorigenic potential of CRC stem cells by stimulating the reproductive and phenotypic heterogeneity of parental tumor-forming cells. In mouse models, EpCAM enhances the tumorigenic potential of CRC stem cells by stimulating the reproductive and phenotypic heterogeneity of parental tumor-forming cells. high / CD44 +The cells not only showed high tumorigenicity but also successfully differentiated into several subpopulations exhibiting stemness (Boesch et al., 2018; Dalelba et al., 2007). Indeed, nuclear translocation of EpICD-β-catenin complex is known to upregulate the transcription of reprogramming genes such as Oct4, Sox2 and c-Myc, endowing CRC cells with self-renewal capacity, as well as leading to the activation of EMT-inducing genes such as Snail, Slug and Twist (Lin et al., 2012). Thus, further understanding of the functional repertoire of EpCAM may shed light on ways to target CRC stem cells.

[0006] In cancer, Wnt signaling may be involved in EpCAM activity, as EpICD functions in complex with β-catenin (Liang et al., 2018; Maetzel et al., 2009; Park et al., 2016; Ralhan et al., 2010). Notably, Wnt signaling components are abundant and aberrantly regulated in CRC, and Wnt-related proteins profoundly affect the stemness, self-renewal and heterogeneity of cancer cells (Batlle and Clevers, 2017; de Sousa e Melo et al., 2017; Kozar et al., 2013; Nusse and Clevers, 2017; Schepers et al., 2012). Furthermore, nearly 80% of all colorectal tumors harbor loss-of-function mutations in the adenomatous pigmentosa coli (APC) gene, and approximately 5% of CRC tumors harbor activating mutations in β-catenin (Cancer Genome Atlas, 2012; Morin et al., 1997). Whether CRC cells with such mutations require exogenous Wnt ligands to drive signaling remains controversial, but Voloshanenko et al. reported that Wnt secretion and interaction with its receptor are required to drive and maintain high levels of Wnt activity, regardless of Wnt-activating mutations (Voloshanenko et al., 2013). Similarly, it was also conclusively shown that phosphorylation of β-catenin at S33, S37, and T41 occurs in cells with mutations at S45, a priming phosphorylation site, and can sensitize cells to Wnt ligands (Wang et al., 2003). Therefore, one way to target the Wnt pathway may be to inhibit Wnt activation by inhibiting porcupine, an o-acyl-transferase required for palmitoylation of Wnt proteins (Nusse and Clevers, 2017).In addition, Wnt activity was found to functionally determine stemness of CRC cells independent of APC or β-catenin mutations, as it is governed by extrinsic cues in the tumor microenvironment (Vermeulen et al., 2010). Therefore, to best target CRC tumors, it may be beneficial to inhibit stemness properties by targeting essential intracellular signaling events and extrinsic signals from the microenvironment to CRC stem cells (Batlle and Clevers, 2017; Nusse and Clevers, 2017; Vermeulen et al., 2010). Summary of the Invention

[0007] Summary of the Invention Described herein is a method for the treatment of cancer using a combination of an epithelial cell adhesion molecule (EpCAM) inhibitor and a Wnt signaling inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). The combination therapy is effective in inducing apoptosis of cancer cells, suppressing cancer stemness, inhibiting tumor progression and / or metastasis, and / or prolonging the survival of cancer patients.

[0008] In one aspect, the present invention provides a method for treating cancer, comprising administering to a subject in need thereof: (i) an effective amount of a first inhibitor that inhibits activation of EpCAM signaling; and (ii) an effective amount of a second inhibitor that inhibits activation of Wnt signaling; The method includes administering

[0009] In certain embodiments, the first inhibitor reduces the production (or release) of EpEX and / or inhibits the binding of EpEX to a Wnt receptor.

[0010] In some embodiments, the second inhibitor inhibits binding between a Wnt ligand and a Wnt receptor protein. Specifically, the Wnt ligand is not EpEX.

[0011] In certain embodiments, the first inhibitor is an antibody against EpEX (anti-EpEX antibody) or an antigen-binding fragment thereof.

[0012] In some embodiments, the anti-EpEX antibodies described herein specifically bind to epidermal growth factor (EGF)-like domains I and II. In a particular example, the anti-EpEX antibodies described herein have specific binding affinity to an epitope within the sequence CVCENYKLAVN (aa 27-37) (SEQ ID NO: 20) located in EGF-like domain I, and KPEGALQNNDGLYDPDCD (aa 83-100) (SEQ ID NO: 19) located in EGF-like domain II.

[0013] In some embodiments, the antibody or antigen-binding fragment comprises: (a) a heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1) comprising the amino acid sequence of SEQ ID NO:2, a heavy chain complementarity determining region 2 (HC CDR2) comprising the amino acid sequence of SEQ ID NO:4, and a heavy chain complementarity determining region 3 (HC CDR3) comprising the amino acid sequence of SEQ ID NO:6; and (b) a light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1) comprising the amino acid sequence of SEQ ID NO:9, a light chain complementarity determining region (LC CDR2) comprising the amino acid sequence of SEQ ID NO:11, and a light chain complementarity determining region 3 (LC CDR3) comprising the amino acid sequence of SEQ ID NO:13; Includes.

[0014] In some embodiments, the VH comprises the amino acid sequence of SEQ ID NO:15 and / or the VL comprises the amino acid sequence of SEQ ID NO:16.

[0015] In some embodiments, the compound is effective to inhibit β-catenin signaling.

[0016] In some embodiments, the second inhibitor is a porcupine inhibitor.

[0017] In some embodiments, the methods of the present invention are effective in inducing apoptosis in cancer cells.

[0018] In some embodiments, the methods of the present invention are effective in inhibiting cancer stemness properties, tumor progression and / or metastasis.

[0019] In some embodiments, the methods of the invention are effective in extending the survival time of a subject.

[0020] In some embodiments, the cancer to be treated is selected from the group consisting of lung cancer, brain cancer, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer and testicular cancer.

[0021] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a first inhibitor that inhibits activation of EpCAM signaling; and (ii) a second inhibitor that inhibits activation of Wnt signaling; The present invention provides a kit of pharmaceutical compositions comprising:

[0022] The present invention also provides the use of a combination of (i) a first inhibitor that inhibits activation of EpCAM signaling; and (ii) a second inhibitor that inhibits activation of Wnt signaling, for the manufacture of a pharmaceutical or kit for treating cancer.

[0023] The details of one or more aspects of the invention are set forth in the following description. Other features or advantages of the invention may become apparent from the following detailed description of several aspects, and from the appended claims. [Brief description of the drawings]

[0024] BRIEF DESCRIPTION OF THE DRAWINGS The summary above, as well as the following detailed description of the invention, may be better understood when read in conjunction with the accompanying drawings. For the purposes of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangement and functionality shown. [Figure 1] Figures 1A to 1D. EpCAM correlates with active β-catenin in CRC patient samples. (Figure 1A) IHC staining of EpCAM and active β-catenin in different stages of CRC (scale bar: 100 μm). (Figure 1B) EpCAM and (Figure 1C) active β-catenin expression were quantified in samples from 120 patients. (Figure 1D) Correlation between EpCAM and active β-catenin in 120 patient samples was shown with Pearson correlation coefficient r. Data were analyzed by one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p <0.05, **p<0.01, ***p<0.001, ****p <0.0001. [Diagram 2]Figures 2A to 2K. EpEX promotes nuclear translocation of β-catenin and associated biological functions. (Figure 2A) IFS showing nuclear β-catenin by the indicated treatments; quantification of nuclear β-catenin from 50 cells of each group is included (scale bar: 10 μm). (Figure 2B) Western blot analysis shows active β-catenin expression in various cell fractions by the indicated treatments, (Figure 2C) corresponding TCF activity (%) as shown in HCT116 cells. The indicated treatments show TCF activity (%) in SW620 cells (Figure 2D), Western blot analysis showing Axin2 expression in HT29 cells (Figure 2E), and corresponding Western blot analysis of mRNA expression in HT29 cells (Figure 2F). (Figure 2G) IFS showing nuclear β-catenin by the indicated treatments. Quantification of nuclear β-catenin from 50 cells of each group (scale bar: 10 μm) and corresponding Western blot confirming nuclear β-catenin levels in HCT116 cells (Figure 2H) (quantification of band intensity from three independent experiments), (Figure 2I) TCF activity (%) in Colo205 cells, (Figure 2J) Western blot analysis showing Axin2 expression, and (Figure 2K) relative mRNA expression in Colo205 cells. Data were analyzed using one-way ANOVA or two-way ANOVA (C) with Bonferroni correction, error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control. [Diagram 3]Figures 3A to 3G. EpEX stimulates nuclear translocation of β-catenin independent of EpICD. (Figure 3A) Western blot analysis showing nuclear β-catenin in EpCAM knockdown HCT116 cells; quantification of band intensity from three independent experiments. (Figure 3B) Immunofluorescence and (Figure 3C) Western blot analysis showing nuclear β-catenin in EpCAM-KO HCT116 cells and EpEX treatment. (Figure 3D) Immunofluorescence and (Figure 3E) Western blot analysis showing nuclear β-catenin in HCT116 cells with indicated treatments. (Figure 3F, Figure 3G) TCF (%) activity corresponding to indicated treatments in HCT116 cells. (All confocal images: scale bar 10 μm, quantification of nuclear β-catenin in 30 cells per group). Statistics were performed by one-way ANOVA followed by Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control, KO: knockout. [Figure 4] Figures 4A to 4E. EpEX and Wnt proteins coordinately regulate the nuclear translocation of β-catenin and its associated biological functions. (Figure 4A) IFS (scale bar 10 μm and quantification of nuclear β-catenin in 30 cells per group), (Figure 4B) Western blot analysis showing nuclear β-catenin, (Figure 4C) corresponding TCF (%) activity, (Figure 4D) Wnt target Axin2 expression, and (Figure 4E) relative Axin2 mRNA expression in HCT116 cells with the indicated treatments. Statistics were performed by one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control. [Diagram 5]Figure 5A to Figure 5C. Combined inhibition of EpCAM and Wnt signals abolishes Wnt-related functions. (Figure 5A) Corresponding TCF activity (%), (Figure 5B) Wnt target Axin2 expression, (Figure 5C) Axin2 mRNA relative expression in HCT116 cells with the indicated treatments. Statistics were performed by one-way ANOVA followed by Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control. [Figure 6] Figures 6A to 6H. hEpAb2-6 inhibits β-catenin nuclear translocation, restricts cancer stemness and induces apoptosis. (Figure 6A) Immunofluorescence shows nuclear β-catenin in HT29 cells with the indicated antibody or inhibitor treatment; quantification of nuclear β-catenin from 30 cells of each group (scale bar: 10 μm). (Figure 6B) Western blot analysis shows nuclear and total β-catenin in HT29 cells after the indicated antibody or inhibitor treatment; (Figure 6C) TCF activity. (Figure 6D) Tumorsphere and colony formation assay, (Figure 6E) sphere number and (Figure 6F) colony density (5 × 103 cells seeded in each case). (GH) Annexin V apoptosis assay with the indicated treatment; quantification of apoptotic cells from three independent trials in HCT116 cells. Statistics were performed by one-way ANOVA with Bonferroni correction; error bars represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001. Ctrl: control. [Figure 7]Figures 7A to 7E. Targeting EpCAM and Wnt signaling suppresses stemness of CRC. (Figures 7A, 7B, and 7C) Western blot and qPCR analysis of EpCAM knockout (KO) or overexpression (OE) in the indicated cell lines. (Figure 7D) Comparison of growth curves in EpCAM-KO HT29 cells. (Figure 7E) Tumorsphere formation by the indicated treatments in HT29 cells. Data were analyzed using one-way ANOVA or two-way ANOVA (D) with Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control. [Figure 8] Figures 8A to 8N. EpEX / EpCAM and Wnt signals cooperatively regulate cancer stemness. (Figure 8A) Comparison of growth curves in indicated HCT116 cells and (Figure 8B) Comparison of growth curves in CT26 cells. (Figures 8C, 8D, 8E, 8F) Comparison of tumor size and progression in vivo; 103 Control and EpCAM-KO HCT116 cells were subcutaneously implanted in NSG mice (n=6 for each cell line). (Figure 8G) In vitro regeneration assay with control and EpCAM-KO HT29 cells. Tumor sphere formation (Figure 8H) and sphere number (Figure 8I) in HCT116 cells. Colony formation (Figure 8J) and density (5x103 cells seeded) by the indicated treatments in HT29 cells (Figure 8K). (Fig. 8L) Sphere and colony formation, (Fig. 8M) colony density, and (Fig. 8N) sphere number by the indicated treatments in SW620 cells (1x103 cells seeded for both assays). Data were analyzed using one-way or two-way ANOVA (Fig. 8A, B, D) followed by Bonferroni correction, and error bars represent the mean ± SD. *p <0.05, **p <0.01, ***p <0.001, ****p <0.0001. Ctrl: control, KO: EpCAM-knockout, OE: EpCAM-forced expression. [Figure 9]Figures 9A to 9I. EpEX interacts with Wnt receptor and induces Wnt signaling. (Figures 9A, 9B) Co-immunoprecipitation (Co-IP) of affinity cross-linked EpEX / Wnt receptor proteins yielded complexes in HCT116 cells. ELISA showing either (Figure 9C) EpEX alone, or (Figure 9D) EpEX, incubated with the indicated antibody complexes binding to purified Wnt receptor-GST fusion proteins coated plates. (Figure 9E) Western blot analysis showing phosphorylation of LRP5 / 6 by the indicated treatments in HCT116 cells, quantified band intensity from three independent experiments. (Figure 9F) HEK293 cells were transfected with EGF domain (I / II) deletion mutant EpCAM-V5 plasmid. IP of affinity cross-linked mutant EpCAM-V5 / Wnt receptor proteins yielded complexes that were blotted with the respective receptor antibodies. HT29 cells were treated with EGF domain (I / II) deleted mutant EpEX protein. (Figure 9G) Western blot showing phosphorylation of LRP5 / 6 and quantified band intensity from at least three independent experiments, and (Figure 9H) IFS showing nuclear translocated β-catenin in mutant EpEX treated HCT116 cells; quantification of nuclear β-catenin in 50 cells per group (scale bar 10 μM). (Figure 9I) Western blot showing inhibition of phosphorylation of LRP5 / 6 and quantified band intensity from three independent experiments with SW620 cells. Data were analyzed using one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p <0.05, **p <0.01, ***p <0.001, ****p <0.0001. Ctrl: control, GST: glutathione S-transferase, pAb: polyclonal antibody. [Figure 10]Figures 10A to 10G. EpEX and Wnt proteins activate TACE and gamma-secretase enzymes. TACE activity in (Figure 10A) HCT116 cells and (Figure 10B) H29 cells, and gamma-secretase activity in (Figure 10C) HCT116 cells and (Figure 10D) H29 cells after the indicated treatments. (Figure 10E) Western blot analysis showing the levels of phosphorylated TACE and PS2 in HCT116 cells after the indicated treatments. The effect of (Figure 10F) BIO and (Figure 10G) PF-670462 treatment on phosphorylated TACE and PS2; band intensities from at least three independent experiments were quantified. Data were analyzed using one-way ANOVA followed by Bonferroni multiple comparisons. Error bars indicate the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl:Contrast. [Figure 11]Figures 11A to 11M. EpICD upregulates transcription of Wnt receptor proteins and stemness factors. (Figure 11A) Wnt receptor protein expression and (Figure 11B) relative mRNA expression in EpCAM knockdown H29 cells. (Figure 11C) Western blot analysis showing Wnt receptor protein expression in EpCAM-KO and EpCAM plasmid transfected HCT116 cells, with band intensities quantified from three independent experiments, and (Figure 11D) corresponding relative mRNA expression. (Figure 11E) Wnt receptor protein expression in overnight DAPT treated HT29 cells, with band intensities quantified from three independent experiments, and corresponding (Figure 11F) relative mRNA expression. (Figure 11G) Wnt receptor promoter activity after EpCAM plasmid transfection and DAPT treatment in HCT116 cells, (Figure 11H) EpCAM-KO HT29 cells, and (Figure 11I) SW620 cells. (Fig. 11J) Western blot analysis showing Wnt receptor expression after indicated treatment in HCT116 cells, and band intensity quantified from three independent experiments. (Fig. 11K) Relative mRNA expression. (Fig. 11L) Western blot analysis showing expression of stemness factors by indicated treatment in HT29 cells, and band intensity quantified from three independent experiments; (Fig. 11M) Relative mRNA expression. Data were analyzed using one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl: control, Trans: transfection. [Figure 12]Figures 12A to 12F. EpICD promotes Wnt receptor transcription. (Figure 12A) Expression of Wnt receptor protein and (Figure 12B) corresponding mRNA expression in EpCAM-KO HCT116 cells. (Figure 12C) Comparison of cell morphology of EpCAM-KO HCT116 cells transfected with and without EpCAM plasmid. (Figure 12D) Western blot analysis showing Wnt receptor protein expression by DAPT treatment in HCT116 cells. (Figure 12E) Wnt receptor promoter plasmid construction with luciferase reporter. (Figure 12F) Wnt receptor promoter activity after EpCAM-KO HCT116 cells transfected with EpCAM plasmid and treated with DAPT overnight. Data were analyzed using one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p <0.05, **p <0.01, ***p <0.001. Ctrl: control; KO: knockout; PM: promoter; LUC: luciferase. [Figure 13] Figures 13A to 13F. EpEX and Wnt proteins cooperate to promote the expression of Wnt receptors and stemness factors. (Figure 13A) Western blot analysis showing Wnt receptor protein expression with the indicated treatments in HCT116 cells, and (Figure 13B) relative mRNA expression. (Figure 13C) Western blot analysis showing the indicated stem cell factor expression in EpCAM knockdown HCT116 cells; (Figure 13D) relative mRNA expression. (Figure 13E) Western blot analysis of HT29 cells showing stem cell factor expression with the indicated treatments, and (Figure 13F) relative mRNA expression. Data were analyzed using one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001. Ctrl: control. [Figure 14]Figures 14A to 14F. EpAb2-6 and LGK974 cooperatively suppress tumor progression. (Figure 14A) Annexin V apoptosis assay with the indicated treatments in SW620 cells, (Figure 14B) quantification of apoptotic cell numbers from three independent studies. (Figure 14C) Kaplan-Meier survival plots show animal survival in the metastatic model after the indicated treatments. (Figure 14D) Bioluminescence showing tumor progression in the orthotopic animal model (day 0 = 72 hours after implantation), (Figure 14E) quantification of luminescence, (Figure 14F) Kaplan-Meier survival plots showing animal survival in the orthotopic model. Data were analyzed using one-way or two-way ANOVA (Figure 14E) followed by Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Ctrl:Contrast. [Figure 15] Figures 15A to 15E. EpCAM and Wnt signals cooperate to participate in tumor progression, so their inhibition induces apoptosis of cancer cells and blocks metastasis. (Figure 15A, Figure 15B) Annexin V apoptosis assay with indicated treatments; quantification of apoptotic cells from three independent experiments in HCT116 cells. (Figure 15C) Treatment schedules for both metastatic and orthotopic CRC model animals (HCT116 cells). (Figure 15D) Comparison of animal weights after indicated treatments in metastatic model. (Figure 15E) Necropsy revealed that the death of mice in metastatic model was due to tumor metastasis to various organs. (F) Comparison of mouse weights in orthotopic animal model. Data were analyzed using one-way ANOVA with Bonferroni correction, and error bars represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001. Ctrl: Control. [Figure 16] Figure 16. In summary, EpCAM induces Wnt signaling to promote stem cell formation in CRC, and combined inhibition by EpAb2-6 and porcupine inhibitors may suppress cancer stem cell formation and improve CRC treatment. [Figure 17]Figures 17A to 17B. Sequence features and domains of human EpCAM. (Figure 17A) Full length of human EpCAM (SEQ ID NO: 17) containing 314 amino acid residues. (Figure 17B) Identification of the domains of EpCAM, where the EpEX domain contains an EGF I domain (aa 27-59) containing VGAQNTVIC (aa 51-59, SEQ ID NO: 18) and an EGF II domain (aa 66-135) containing KPEGALQNNDGLYDPDCD (aa 83-100, SEQ ID NO: 19) which contains a LYD motif (aa 94-96). [Figure 18] Figures 18A to 18G. EpAb2-6 binds to both EGF-like domains I and II of EpCAM. HEK293T cells were transfected with full-length or EGF-like domain deletion mutant EpCAM-V5. Antibody binding was assessed by (Figure 18A) Western blotting, (Figure 18B) flow cytometry, and (Figure 18C) immunofluorescence. (Figure 18D) EpCAM mutants with amino acid substitutions in the EGF-I (Y32A) and EGF-II (L94A, Y95A, or D96A) domains were constructed. EpCAM wild-type and mutant proteins were expressed in HEK293T cells. Binding of MT201, EpAb2-6, and EpAb23-1 to EpCAM wild-type and mutants was assessed by (Figure 18E) immunofluorescence, (Figure 18F) flow cytometry, and (Figure 18G) cell ELISA. All data are shown as mean ± SEM. *, p<0.05; **, p<0.01. [Figure 19] Figure 19. Amino acid sequence of EpAb2-6, where VH (SEQ ID NO:15) comprises HC CDR1 of SEQ ID NO:2, HC CDR2 of SEQ ID NO:4, and HC CDR3 of SEQ ID NO:6; and VL (SEQ ID NO:16) comprises LC CDR1 of SEQ ID NO:9, LC CDR2 of SEQ ID NO:11, and HC CDR3 of SEQ ID NO:13. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Detailed Description of the Invention The following description is merely for the purpose of illustrating various aspects of the present invention. Therefore, the specific aspects or modifications described herein should not be construed as limiting the scope of the present invention. Those skilled in the art will appreciate that various modifications or equivalent aspects may be implemented without departing from the scope of the present invention.

[0026] In order to provide a clear and easy understanding of the present invention, certain terms are first defined. Additional definitions are provided in the detailed description. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0027] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a component" includes a plurality of such components and equivalents thereof known to those skilled in the art.

[0028] The terms "comprise" or "comprising" are generally used in the sense of include / including, meaning permitting the presence of one or more features, components or ingredients. The terms "comprise" or "comprising" encompass the terms "consist" or "consisting of".

[0029] As used herein, the term "polypeptide" refers to a polymer of amino acid residues linked through peptide bonds. The term "protein" generally refers to a relatively large polypeptide. The term "peptide" generally refers to a relatively short polypeptide (e.g., containing up to 100, 90, 70, 50, 30, 20, or 10 amino acid residues).

[0030] The term "approximately" or "about" as used herein means an acceptable degree of deviation that would be understood by one of ordinary skill in the art, and may vary to some extent depending on the context in which it is used. Specifically, "about" may mean a numerical value having a range of ±10%, ±5%, or ±3% of the indicated numerical value.

[0031] As used herein, the term "substantially identical" refers to two sequences that have a homology of 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more.

[0032] As used herein, the term "antibody" (the plural forms are used interchangeably) refers to an immunoglobulin molecule capable of specifically binding to a particular target antigenic molecule. As used herein, the term "antibody" includes intact (i.e., full-length) antibody molecules as well as antigen-binding fragments thereof, e.g., Fab, Fab', F(ab') and the like, which retain antigen-binding ability. 2 and Fv. Such fragments are well known in the art and are routinely used both in vitro and in vivo. The term "antibody" also includes chimeric antibodies, humanized antibodies, human antibodies, diabodies, linear antibodies, single chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and other modified configurations of immunoglobulin molecules which contain an antigen recognition site of the required specificity, including amino acid sequence variants of the antibodies, glycosylation variants of the antibodies, and covalently modified antibodies.

[0033] An intact or whole antibody contains two heavy chains and two light chains. Each heavy chain contains a variable region (V H ) and the first, second and third constant regions (C H 1. C H 2 and C H 3), each light chain contains a variable region (V L ) and the constant region (C L). Antibodies are "Y" shaped, with the stem of the Y consisting of the second and third constant regions of two heavy chains linked via disulfide bonds. Each arm of the Y contains the variable and first constant regions of one heavy chain bound to the variable and constant region of one light chain. The light and heavy chain variable regions are responsible for antigen binding. The variable regions of both chains are generally responsible for antigen binding and each contain three highly variable regions: the heavy (H) chain CDRs, including HC CDR1, HC CDR2, and HC CDR3, and the light (L) chain CDRs, including LC CDR1, LC CDR2, and LC CDR3. The three CDRs are flanked by framework regions (FR1, FR2, FR3, and FR4), which are more highly conserved than the CDRs and form a scaffold supporting the hypervariable regions. The constant regions of the heavy and light chains are not involved in antigen binding but are involved in various effector functions. Depending on the antibody amino acid sequence of the constant domain of the heavy chain, immunoglobulins are classified into different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.

[0034] As used herein, the term "antigen-binding fragment" or "antigen-binding domain" refers to a portion or region of an intact antibody molecule that is responsible for antigen binding. An antigen-binding fragment can bind to the same antigen as the parent antibody binds. Examples of antigen-binding fragments include: (i) V H -C H 1 chain and V L -C L (ii) a Fab fragment, which can be a monovalent fragment consisting of two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a F(ab') fragment, which can be a bivalent fragment consisting of two Fab fragments linked by a disulfide bridge at the hinge region. 2 (iii) a V fragment of an antibody molecule; H Domains and V L (iv) a Fv fragment in which the domains are non-covalently linked; (iv) a V H Domains and VL (v) single-chain Fv (scFv), which can be a single polypeptide chain composed of two V domains linked by a peptide linker; H domain and two V via disulfide bridges H Two Vs bound to the domain L domain (scFv) 2 , but are not limited to these.

[0035] As used herein, the term "chimeric antibody" refers to an antibody that comprises polypeptides from different sources, e.g., different species. In some embodiments, in a chimeric antibody, the variable regions of both the light and heavy chains may mimic the variable regions of an antibody from a certain mammal (e.g., a non-human mammal such as mouse, rabbit, and rat), while the constant regions may be homologous to sequences of an antibody from another mammal, such as a human.

[0036] As used herein, the term "humanized antibody" refers to an antibody containing a framework region derived from a human antibody and one or more CDRs derived from a non-human (usually mouse or rat) immunoglobulin.

[0037] As used herein, the term "human antibody" refers to an antibody in which essentially the entire light and heavy chain sequences, including the complementarity determining regions (CDRs), are derived from human genes. In some cases, a human antibody may contain one or more amino acid residues not encoded by human germline immunoglobulin sequences, e.g., by mutating one or more CDRs or one or more FRs to reduce potential immunogenicity, increase affinity, or remove cysteines that may cause undesirable folding.

[0038] As used herein, the term "specific binds" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an epitope of a target antigen. An antibody that "specifically binds" to a target antigen or epitope is a term well understood in the art, and methods for determining such specific binding are also well known in the art. An antibody "specifically binds" to a target antigen when it binds with higher affinity / avidity, more readily, and / or for longer than it binds to other substances. In other words, by reading this definition, it is understood that, for example, an antibody that specifically binds to a first target antigen may or may not specifically or preferentially bind to a second target antigen. Thus, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. In general, the affinity of binding is measured by the dissociation constant (K D Generally, when used with respect to antibodies, specifically binding can be defined as binding to an antibody with a specific binding capacity of about 10 7 Less than M, about 10 8 Less than M, about 10 9 Less than M, about 10 10 Less than M, about 10 11 Less than M, about 10 12 Specifically binds (recognizes) its target with a KD value, such as less than M or less, and has an affinity for binding to a non-specific antigen (such as BSA or casein) that is at least 100-fold lower, e.g., at least 1,000-fold lower, or at least 10,000-fold lower. D It may refer to an antibody that binds to a specific target with an affinity corresponding to

[0039] As used herein, the term "nucleic acid" or "polynucleotide" may refer to a polymer of nucleotide units. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA"), as well as nucleic acid analogs having non-naturally occurring nucleotides. Polynucleotides may be synthesized, for example, using an automated DNA synthesizer. When a nucleotide sequence is represented as a DNA sequence (i.e., A, T, G, C), it will be understood to also include RNA sequences in which "U" is substituted for "T" (i.e., A, U, G, C). The term "cDNA" refers to DNA that is complementary or identical to mRNA, in single- or double-stranded form.

[0040] As used herein, the term "complementary" refers to the topological compatibility or correspondence of interacting surfaces of two polynucleotides. A first polynucleotide is complementary to a second polynucleotide when its nucleotide sequence is identical to the nucleotide sequence of the polynucleotide binding partner of the second polynucleotide. Thus, a polynucleotide whose sequence is 5'-ATATC-3' is complementary to a polynucleotide whose sequence is 5'-GATAT-3'.

[0041] As used herein, the term "encoding" refers to the natural property, and biological properties resulting therefrom, that a particular sequence of nucleotides in a polynucleotide (e.g., gene, cDNA, or mRNA) serves as a template for the synthesis of other polymers and macromolecules in biological processes having either a predetermined sequence of RNA transcripts (i.e., rRNA, tRNA, and mRNA) or a predetermined sequence of amino acids. Thus, a gene encodes a protein when the protein is produced in a cell or other biological system by transcription and translation of the mRNA produced by that gene. It will be understood by those of skill in the art that, as a result of the degeneracy of the genetic code, many different polynucleotides and nucleic acids can encode the same polypeptide. It will also be understood by those of skill in the art that, using routine techniques, nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides described therein may be made to reflect the codon usage of the particular host organism in which the polypeptide is expressed. Thus, unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.

[0042] The term "recombinant nucleic acid" as used herein refers to a polynucleotide or nucleic acid having sequences that are not naturally linked together. A recombinant nucleic acid may be in the form of a vector. A "vector" may comprise a nucleotide sequence of interest and a regulatory sequence. A vector can be used to express a given nucleotide sequence (expression vector) or to maintain a given nucleotide sequence in order to replicate, manipulate or transfer it between different locations (e.g., between different organisms). A vector can be introduced into a suitable host cell for the above purposes. "Recombinant cell" refers to a host cell into which a recombinant nucleic acid has been introduced. "Transformed cell" refers to a cell into which a DNA molecule encoding a protein of interest has been introduced by recombinant DNA techniques.

[0043] Vectors may be of various types, including plasmids, cosmids, episomes, fosmids, artificial chromosomes, phages, viral vectors, and the like. Generally, in a vector, a given nucleotide sequence is operably linked to a regulatory sequence such that when the vector is introduced into a host cell, the given nucleotide sequence can be expressed in the host cell under the control of the regulatory sequence. Regulatory sequences may include, for example, but are not limited to, promoter sequences (e.g., cytomegalovirus (CMV) promoter, simian virus 40 (SV40) early promoter, T7 promoter, and alcohol oxidase gene (AOX1) promoter), initiation codons, origins of replication, enhancers, secretion signal sequences (e.g., α-mating factor signal), stop codons, and other control sequences (e.g., Shine-Dalgarno sequence, termination sequence). Preferably, the vector may further include a marker sequence (e.g., antibiotic resistance marker sequence) for subsequent screening / selection procedures. For the purpose of protein production, in the vector, the desired nucleotide sequence of interest can be linked to other nucleotide sequences than the above mentioned regulatory sequences, so that a fusion polypeptide is produced, which is beneficial for the subsequent purification procedure, said fusion polypeptide containing a tag for purification purposes, for example a His tag.

[0044] As used herein, the term "treatment" refers to the application or administration of one or more active agents to a subject suffering from a disorder, having a symptom or condition of a disorder, a disorder induced by a disorder, or the progression of a disorder, for the purpose of caring for, curing, alleviating, ameliorating, altering, relieving, ameliorating, or affecting said disorder, a symptom or condition of a disorder, or the progression of a disorder.

[0045] The present invention is based, at least in part, on the development of a combination cancer therapy using an EpCAM inhibitor and a Wnt signaling inhibitor.

[0046] EpCAM is known as a CSC marker in many cancer types, since EpEX contributes to the tumor microenvironment and EpICD is a well-studied promoter of cell motility, proliferation, survival and metastasis (Gires et al. 2009; Lin et al., 2012; Park et al., 2016; Yu et al., 2017; Liang et al., 2018; Herreros-Pomares et al., 2018; Gires et al., 2020; Chen et al., 2020). More importantly, soluble EpICD is known to form a multiprotein-nuclear complex with β-catenin and a scaffolding protein named four and one-half LIM domain protein 2 (FHL2). This protein complex translocates into the nucleus, where it binds to T cell factors (TCFs) or lymphoid enhancer factor 1 (LEF-1) and DNA in a manner reminiscent of the canonical Wnt signaling pathway (Maetzel et al., 2009; Ralhan et al., 2010; Park et al.2016; Yu et al., 2017). However, it is unclear whether EpEX cooperates with the Wnt pathway in any way. We therefore investigated whether EpEX is functionally involved in Wnt signaling and anticipated that EpEX could be targeted to regulate the intracellular signaling of EpICD and β-catenin in hematopoietic stem cells.

[0047] In the present invention, it has been surprisingly found that EpEX interacts with Wnt receptors FZD6 / 7 and LRP5 / 6 to promote the nuclear translocation of β-catenin, and that EpICD promotes the transcription of Wnt receptors and stemness factors. It has also been found that Wnt ligands and EpEX activate the EpCAM cleavage enzymes TACE and γ-secretase as a positive feedback, enhancing the production of EpEX and EpICD. These mechanisms induce cancer stemness, and it has been found that using EpCAM inhibitors (e.g., anti-EpCAM neutralizing antibodies, e.g., EpAb2-6) and Wnt inhibitors (e.g., porcupine inhibitors, e.g., LGK974) that target EpEX induces apoptosis of CSCs. This combination provides a potential therapeutic strategy, particularly giving excellent effects in reducing tumor progression and / or metastasis and / or prolonging the survival of cancer patients.

[0048] As used herein, "combination therapy" refers to a treatment in which two or more therapeutic agents or approaches are combined. "Combination" refers to the administration of two or more therapeutic agents or therapeutic approaches to the same subject, either simultaneously or sequentially. Preferably, the combination therapy produces a synergistic effect.

[0049] As used herein, the term "synergy" refers to and includes the combined action of two or more active agents in a combination such that the combined activity of the two or more active agents exceeds the sum of the activities of each active agent alone. The term "synergy" can also mean that two or more active agents, when used together, provide a combined activity such that a lower dose of each agent can be used to achieve equivalent or enhanced activity compared to using a single agent.

[0050] Thus, the present invention provides a combination therapy for treating cancer, comprising administering to a subject in need thereof a combination comprising: (i) an effective amount of a first inhibitor (EpCAM inhibitor) that inhibits activation of EpCAM signaling; and (ii) an effective amount of a second inhibitor (Wnt inhibitor) that inhibits activation of Wnt signaling.

[0051] In some embodiments, the first inhibitor (EpCAM inhibitor) reduces the production (or release) of EpEX and / or blocks the binding of EpEX to the Wnt receptor. In some cases, the first inhibitor is an antibody or antigen-binding fragment thereof against EpEX.

[0052] In some embodiments, the anti-EpEX antibody used herein specifically binds to the EGF-like domain I (aa 27-59 of EpCAM) and the EGF-like domain II (aa 66-135 of EpCAM) of EpCAM. Specifically, the anti-EpEX antibody used herein has specific binding affinity to an epitope within the sequence CVCENYKLAVN (aa 27-37) (SEQ ID NO: 20) located in the EGF-like domain I, and KPEGALQNNDGLYDPDCD (aa 83-100) (SEQ ID NO: 19) located in the EGF-like domain II. More specifically, the anti-EpEX antibody used herein recognizes the NYK motif (aa 31-33) in domain I of EpCAM and the LYD motif (aa 94-96) in domain II. In contrast, many other antibodies (e.g., MT201, M97, 323 / A3 and edrecolomab) target only the well-known EGF I domain of EpCAM. The features of the anti-EpEX antibody of the present invention that distinguish it from other antibodies are described below. TIFF2024527524000002.tif33155

[0053] One of the anti-EpEX antibodies used herein is EpAb2-6, which is shown in the Examples below. H ) and the light chain variable region (V L), and the amino acid sequences of their complementarity determining regions (HC CDR1, HC CDR2 and HC CDR3) (LC CDR1, LC CDR2 and LC CDR3) are shown in Table 1 below. The anti-EpEX antibodies of the present invention include EpAb2-6 and functional variants thereof.

[0054] [Table 1]

[0055] In some embodiments, the anti-EpEX antibody of the invention comprises (a) a V CDR1 comprising an HC CDR1 of SEQ ID NO:2, an HC CDR2 of SEQ ID NO:4, and an HC CDR3 of SEQ ID NO:6. H and (b) a V comprising an LC CDR1 of SEQ ID NO:9, an LC CDR2 of SEQ ID NO:11, and an LC CDR3 of SEQ ID NO:13. L A functional variant of EpAb2-6, or an antigen-binding fragment thereof, characterized in that it comprises:

[0056] In some embodiments, (a) a V CDR1 comprising an HC CDR1 of SEQ ID NO:2, an HC CDR2 of SEQ ID NO:4, and an HC CDR3 of SEQ ID NO:6. H and (b) a V comprising an LC CDR1 of SEQ ID NO:9, an LC CDR2 of SEQ ID NO:11, and an LC CDR3 of SEQ ID NO:13. L The anti-EpEX antibody of the present invention has a V sequence comprising SEQ ID NO: 15 or an amino acid sequence substantially identical thereto. H and V comprising an amino acid sequence of SEQ ID NO: 16 or substantially identical thereto. L Specifically, the anti-EpEX antibody of the present invention may comprise a V that comprises an amino acid sequence having at least 80% (e.g., 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 99%) identity to SEQ ID NO: 15. H and V comprising an amino acid sequence having at least 80% (e.g., 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 99%) identity to SEQ ID NO: 16. LThe anti-EpEX antibodies of the invention include those having the relevant V H or V L Engineered antibodies that are encoded by a polynucleotide sequence that codes for an amino acid sequence are also included.

[0057] The term "substantially identical" refers to the relative amino acid sequence (e.g., FR, CDR, V H , or V LIn some instances, the amino acid residue change is a conservative amino acid substitution, which means that the amino acid residue of the polypeptide has a similar chemical structure to another amino acid residue, and the other biological effects on the function, activity or properties of the polypeptide are small or do not substantially affect the polypeptide. In contrast to the CDR region, the FR region can usually be made with a relatively large number of substitutions, as long as it does not adversely affect the binding function and biological activity of the antibody (e.g., reducing the binding affinity by 50% or more compared to the original antibody). In some embodiments, sequence identity can be about 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, or 99% or more between the reference antibody and the variant. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, for example, as described in references that summarize such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. For example, conservative substitutions of amino acids include substitutions made between amino acids in the following groups: (i) A, G; (ii) S, T; (iii) Q, N; (iv) E, D; (v) M, I, L, V; (vi) F, Y, W; and (vii) K, R, H.

[0058] The antibodies described herein may be animal antibodies (e.g., mouse-derived antibodies), chimeric antibodies (e.g., mouse-human chimeric antibodies), humanized antibodies, or human antibodies. The antibodies described herein may also be antigen-binding fragments, such as Fab fragments, F(ab')2 fragments, Fv fragments, single chain Fvs (scFvs), (scFvs) 2 Antibodies or antigen-binding fragments thereof can be prepared by methods known in the art.

[0059] Details of the anti-EpEX antibodies used herein are as described in U.S. Pat. No. 9,187,558, the relevant disclosures of which are incorporated herein by reference for any purpose or subject matter referred to herein.

[0060] Numerous methods are available for obtaining antibodies or antigen-binding fragments thereof, which are conventional in the art.

[0061] In some embodiments, the antibodies provided herein can be produced by conventional hybridoma technology. In general, a target antigen, such as a tumor antigen, can be optionally conjugated to a carrier protein, such as keyhole limpet hemocyanin (KLH), and / or mixed with an adjuvant, such as complete Freund's adjuvant, and used to immunize a host animal to produce an antibody that binds to the antigen. Lymphocytes secreting monoclonal antibodies are harvested and fused with myeloma cells to produce hybridomas. The hybridoma clones thus formed are screened to identify and select those secreting the desired monoclonal antibody.

[0062] In certain embodiments, the antibodies provided herein can be prepared by recombinant techniques. In related aspects, isolated nucleic acids encoding the disclosed amino acid sequences are also provided, along with vectors containing such nucleic acids and host cells transformed or transfected with the nucleic acids.

[0063] For example, nucleic acids comprising nucleotide sequences encoding heavy and light chain variable regions of such antibodies can be cloned into expression vectors (e.g., bacterial vectors such as E. coli vectors, yeast vectors, viral vectors, or mammalian vectors) by conventional techniques, and either vector can be introduced into appropriate cells (e.g., bacterial cells, yeast cells, plant cells, mammalian cells) for expression of the antibody. Examples of nucleotide sequences encoding the heavy and light chain variable regions of the antibodies described herein are shown in Table 1. Examples of mammalian host cell lines include human embryonic kidney lines (293 cells), baby hamster kidney cells (BHK cells), Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (VERO cells), and human liver cells (Hep G2 cells). Recombinant vectors for expressing the antibodies described herein usually contain a nucleic acid encoding the antibody amino acid sequence operably linked to either a constitutive or inducible promoter. Common vectors contain transcription and translation terminators, initiation sequences, and promoters useful for controlling expression of the nucleic acid encoding the antibody. The vectors may contain both prokaryotic and eukaryotic selectable markers, if desired. In some instances, coding sequences for both the heavy and light chains are contained in the same expression vector. In other instances, each of the heavy and light chains of an antibody may be cloned into a separate vector, produced separately, and then incubated under conditions suitable for antibody assembly.

[0064] Recombinant vectors for expressing the antibodies described herein typically contain a nucleic acid encoding an antibody amino acid sequence operably linked to either a constitutive or inducible promoter. Recombinant antibodies can be produced in prokaryotic or eukaryotic expression systems, such as bacteria, yeast, insect, or mammalian cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for controlling expression of the nucleic acid encoding the antibody. Vectors can contain selectable markers for both prokaryotic and eukaryotic systems, if desired. The produced antibody protein can be further isolated or purified to obtain a substantially homogenous preparation for further assays and applications. Suitable purification procedures include, for example, immunoaffinity or ion exchange column fractionation, ethanol precipitation, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), high performance liquid chromatography (HPLC), ammonium sulfate precipitation, and gel filtration.

[0065] When full-length antibodies are desired, the V H Chain and V L The coding sequence for either chain can be linked to the coding sequence for the Fc region of an immunoglobulin, and the resulting genes encoding full-length antibody heavy and light chains can be expressed and assembled in a suitable host cell, such as a plant cell, a mammalian cell, a yeast cell, or an insect cell.

[0066] Antigen-binding fragments can be prepared by conventional methods. For example, F(ab') 2 Fragments can be generated by pepsin digestion of full-length antibody molecules, with Fab fragments being F(ab') 2The fragments can be generated by reducing the disulfide bonds of the fragments. Alternatively, such fragments can be prepared by recombinant techniques by expressing heavy and light chain fragments in a suitable host cell and assembling them to form the desired antigen-binding fragment either in vivo or in vitro. Single-chain antibodies can be prepared by recombinant techniques by linking a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region. Preferably, a flexible linker is incorporated between the two variable regions.

[0067] An antibody can be further modified to conjugate one or more additional elements, such as another protein and / or a drug or carrier, to the N-terminus and / or C-terminus of the antibody. Preferably, the antibody with the additional elements attached retains the desired binding specificity and therapeutic effect while providing additional properties due to the additional elements that aid in, for example, solubility, storage or other handling properties, cell permeability, half-life, reduction of hypersensitivity, delivery and / or distribution control. Other embodiments include conjugation of labels, such as dyes or fluorescent dyes, for assay, detection, tracking, etc. In some embodiments, the antibody can be conjugated to additional elements, such as peptides, dyes, fluorophores, carbohydrates, anticancer drugs, lipids, etc. Additionally, the antibody can be directly conjugated to the surface of a liposome via the Fc region, for example, to form an immunoliposome.

[0068] In some embodiments, the second inhibitor (Wnt inhibitor) blocks the binding of a Wnt ligand to a Wnt receptor protein. Specifically, the Wnt ligand is not EpEX.

[0069] In some embodiments, the second inhibitor (Wnt inhibitor) is a porcupine inhibitor. Porcupine (PORCN) is a membrane-bound O-acyltransferase that mediates palmitoylation of Wnt family proteins, which is required for Wnt secretion and biological activity. Thus, porcupine inhibitors can inhibit Wnt signal transduction. Small molecule PORCN inhibitory compounds include, for example, LGK-974, ETC-159 and Wnt-C59. Table 2 shows some examples of small molecule PORCN inhibitory compounds.

[0070] [Table 2]

[0071] As used herein, the term "small molecule porcupine (PORCN) inhibitor compound" or "small molecule PORCN inhibitor" includes small molecule compounds that inhibit or bind to porcupine. Unless otherwise specified, references herein to small molecule PORCN inhibitors include references to pharmaceutically acceptable salts, solvates, hydrates and complexes thereof, and solvates, hydrates and complexes of pharmaceutically acceptable salts thereof, including polymorphs, stereoisomers, and isotopically labeled forms thereof.

[0072] As used herein, the term "pharmaceutically acceptable salts" includes acid addition salts. "Pharmaceutically acceptable acid addition salts" refers to salts that retain the biological effectiveness and properties of the free bases formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and organic acids such as acetic acid, propionic acid, pyruvic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, trifluoroacetic acid, and the like. The term "pharmaceutically acceptable salts" also includes base salts. Suitable base salts are formed from bases that form non-toxic salts. For example, aluminum salts, arginine salts, benzathine salts, calcium salts, choline salts, diethylamine salts, diolamine salts, glycine salts, lysine salts, magnesium salts, meglumine salts, olamine salts, potassium salts, sodium salts, tromethamine salts, zinc salts, and the like.

[0073] The term "effective amount" as used herein means the amount of an active ingredient to give a desired biological effect to a treated subject or cell. The effective amount may vary for various reasons, such as the route of administration and frequency of administration, the weight and type of the individual to whom the drug is administered, and the purpose of administration. Those skilled in the art can determine the dosage for each case based on the description herein, established methods, and their own experience.

[0074] The subject to be treated by the treatment methods described herein may be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, mice, rats, etc.

[0075] As used herein, "a pharma- ceutically acceptable carrier" means that the carrier is compatible with the active ingredient in the composition, preferably capable of stabilizing the active ingredient, and is safe for the recipient individual. The carrier may be a diluent, vehicle, excipient, or matrix for the active ingredient. In general, the composition containing the EpCAM inhibitor, the Wnt inhibitor, or a combination thereof may be formulated in the form of a solution, such as an aqueous solution, for example, a saline solution, or may be provided in the form of a powder. Suitable excipients include lactose, sucrose, dextrose, sorbose, mannose, starch, gum arabic, calcium phosphate, alginate, gum tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose. The composition may further include pharma-ceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusting agents and buffers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The composition may be in the form of tablets, pills, powders, lozenges, sachets, troches, elixirs, suspensions, lotions, solutions, syrups, soft and hard gelatin capsules, suppositories, sterile injections, and packaged powders.The composition of the present invention can be delivered by any physiologically acceptable route, including oral, enteral (intramuscular, intravenous, subcutaneous and intraperitoneal, etc.), transdermal, suppository, and nasal.In certain embodiments, the composition of the present invention is administered as a liquid injection dosage form that can be provided as a ready-to-use dosage form or as a stable powder that can be reconstituted.

[0076] In some embodiments, the two active components of the present invention, EpCAM inhibitor and Wnt inhibitor, can be formulated in the form of a kit, either as a mixture or separately, for simultaneous administration, separate administration or sequential administration to subject.Each component can be formulated with suitable pharma-ceutically acceptable carrier for suitable administration route.In some embodiments, EpCAM inhibitor and Wnt inhibitor can be provided in suitable packaging unit, where EpCAM inhibitor or the composition comprising it and Wnt inhibitor or the composition comprising it are in separate packaging unit.

[0077] According to the present invention, the combination of an EpCAM inhibitor and a Wnt inhibitor provides synergistic effects in the treatment of cancer, particularly in inducing apoptosis of cancer cells, reducing or inhibiting tumor progression, reducing or inhibiting cancer hepatocellularity and / or metastasis, and / or extending the survival time of cancer patients, compared with the EpCAM inhibitor or the Wnt inhibitor alone. In particular, as shown in the examples (e.g., Example 2.7), in a metastatic model, treatment with either an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor or a combination of an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor and an EpCAM inhibitor (LGK974) can extend survival time, while most animals in the control IgG or EpCAM inhibitor (LGK974) treated group showed clear metastasis and reduced overall survival time, and similarly, in an orthotopic model, treatment with either an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor or a combination of an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor and an EpCAM inhibitor (LGK974) treated group showed clear metastasis and reduced overall survival time, while treatment with either an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor or a combination of an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor can extend survival time, while most animals in the control IgG or EpCAM inhibitor (LGK974) treated group showed clear metastasis and reduced overall survival time, and similarly, in an orthotopic model, treatment with either an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor or a combination of an EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor can extend survival time, while most animals in the control IgG or EpCAM inhibitor (LGK974) treated group showed clear metastasis and reduced overall survival time, and While animals in the EpCAM neutralizing antibody (EpAb2-6) treated group developed significant tumors and showed a lower median survival time, the EpCAM neutralizing antibody (EpAb2-6) treated group showed slower tumor progression and higher median survival time, and surprisingly, combination therapy with EpCAM neutralizing antibody (EpAb2-6) and EpCAM inhibitor (LGK974) produced a synergistically significant effect in reducing tumor progression (about 60% (4 / 6) of the animals were found to be completely tumor-free) and prolonging overall survival time.

[0078] In some embodiments, the EpCAM inhibitor and the Wnt inhibitor are administered simultaneously, separately or sequentially to provide a synergistic anti-cancer or anti-metastatic effect, particularly where the cancer is susceptible to a synergistic combination.

[0079] In some embodiments, the cancer is selected from the group consisting of lung cancer, brain cancer, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer and testicular cancer.

[0080] The present invention is further illustrated by the following examples, which are provided for purposes of illustration and not limitation. Those skilled in the art should, in light of the description herein, appreciate that many changes can be made to the specific embodiments described and still obtain like or similar results without departing from the spirit and scope of the invention. EXAMPLES

[0081] Working Example Epithelial cell adhesion molecule (EpCAM) is a pleiotropic type 1 transmembrane glycoprotein and a known cancer stem cell marker, but its mechanism of involvement in cancer stemness remains unclear. In this study, we used a colorectal cancer (CRC) model system to reveal and define the interaction between EpCAM and Wnt signaling that promotes cancer stemness. We demonstrate that the extracellular domain of EpCAM (EpEX) functions as a ligand for the Wnt receptor proteins frizzled6 / 7 and LRP5 / 6, which induce signaling. Furthermore, the intracellular domain (EpICD) upregulates the transcription of genes encoding such Wnt receptors and key stemness factors. Interestingly, EpEX-induced Wnt signaling activates TACE and γ-secretase enzymes, which enhance the shedding of EpEX and EpICD, establishing a positive feedback loop. In line with this mechanism, our EpCAM neutralizing antibody (EpAb2-6) and porcupine inhibitor (LGK974) can each partially attenuate cancer stemness, but their combination abolishes this phenomenon and induces apoptosis in CRC cells. This combination therapy also significantly inhibits tumor progression in metastatic and orthotopic animal models of human CRC and substantially prolongs survival. We conclude that EpCAM activation stimulates Wnt signaling to promote cancer stemness. Thus, the combination of EpAb2-6 and porcupine inhibitor can effectively suppress cancer stemness, overcome drug resistance, and improve CRC treatment.

[0082] 1. Materials and Methods 1.1 Cell culture Tests were performed using HCT116, HT29, CT26, SW620, HEK293T and HeLa cell lines. HCT116, HT29 and HEK293T were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco), while CT26 and SW620 cells were cultured in RPMI1640 (Gibco) and L-15 (Gibco) media, respectively. The media was supplemented with 10% fetal bovine serum (FBS, Gibco), 1% L-glutamine (Gibco) and 1% penicillin and streptomycin (P / S) (Gibco). All cells except SW620 were incubated in 5% CO 2 SW620 cells were grown at 37°C in 0% CO 2 The cells were grown at 37°C in a broth.

[0083] For the growth curve, 10 wells were cultured in 6-well plates for each cell line. 4 Cells were seeded in triplets. Each triplet was counted using a hemocytometer and the counts were averaged daily from day 1 to day 8. After the entire data set was collected, the points were plotted to analyze the growth curves and calculate the cell doubling time.

[0084] 1.2 Cell fractionation cells (1×10 6 ) were seeded overnight and further grown under serum-free conditions. Cells were then further treated with 20 μg / mL mEpAb2-6 or hEpAb2-6 or MT201 for 6 h, or 400 ng / mL LGK974 (MedChemExpress) for 9 h, or the indicated combinations. Samples were fractionated into cytosolic and nuclear extracts using a Nuclear / Cytosolic Fractionation Kit (Biovision) according to the manufacturer's protocol. Fractions were then subjected to Western blot analysis.

[0085] 1.3 Western blotting For Western blotting, cells were extracted using radioimmunoprecipitation assay (RIPA) buffer [(0.01 M sodium phosphate, pH 7.2), 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 1% Nonidet P-40, 1% sodium deoxycholate, and 0.1% SDS)] containing phosphatase inhibitor (Roche) and protease inhibitor (Roche) cocktails. Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 3% BSA in TBST (blocking solution) and incubated with the required primary antibodies in blocking solution overnight at 4 °C. The membranes were then incubated with HRP-conjugated secondary antibodies in blocking solution for 1 h at room temperature to detect protein expression. Antibodies used were: anti-α-tubulin (Sigma), anti-EpCAM (abcam), anti-active β-catenin (Millipore), anti-total β-catenin (abcam), anti-Frizzled 6 (CST), anti-Frizzled 7 (Santa Cruz Biotech), anti-LRP5 (abcam), anti-phospho-LRP5 (abcam), anti-phospho-LRP 6 (CST), anti-LRP6 (CST) and anti-EpEX antibody EpAb3-5 (produced in-house), anti-ADAM17 (abcam), anti-phospho-ADAM17 (abcam), anti-presenilin 2 (abcam), anti-phospho-presenilin 2 (S327) (abcam), anti-phospho-presenilin 2 (S330) (abcam) and anti-Axin2 (CST).

[0086] 1.4 TCF activity 5 x 10 cells 3Cells / well were seeded and grown overnight in 12-well plates. Cells were then transiently transfected with TOP-Flash TCF reporter plasmid (Millipore) using polyjet transfection agent (SignaGen). 48 hours after transfection, cells were treated with 20 μg / mL anti-EpCAM EpAb2-6 (in-house manufactured) or MT201 (in-house manufactured) for 6 hours, or with 400 ng / mL LGK974 (MedChemExpress) for 9 hours, or with the indicated combination. Additionally, cells were treated with EpEX (in-house manufactured by Expi293 expression system) or recombinant Wnt3A (R&D systems) or their combination for 8 hours. Finally, cells were lysed and luciferase assays were performed.

[0087] 1.5 Immunohistochemical staining Human colon cancer tissue arrays were purchased from Biomax. Sections were dewaxed in xylene and rehydrated in a series of decreasing alcohol concentrations. Antigen retrieval was performed simultaneously in Trilogy TM (Cell Marque). For peroxidase blocking, sections were washed with H 2 O 2The sections were incubated in methanol containing 0.1% Tween 20 (PBST0.1) (Thermo) for 20 min at room temperature (RT). The sections were further washed with PBS and incubated with 1% bovine serum albumin (BSA) in PBS for 30 min at room temperature to block non-specific binding. Following the primary antibody, anti-active β-catenin (Millipore) and anti-EpEX antibody EpAb3-5 (in-house manufactured) were applied and the samples were incubated overnight at 4°C. The sections were then washed with PBS containing 0.1% Tween 20 (PBST0.1) (Thermo) and treated with Super Sensitive Super Enhancer reagent for 20 min at room temperature. The samples were then rinsed three times with PBST0.1. Afterwards, the sections were treated with polymer-HRP reagent for 30 min at room temperature and then rinsed three times with PBST0.1. 3,3'-diaminobenzidine (DAB) was then used as a chromogen to visualize peroxidase activity. Quantification of protein intensities was performed using Fiji-Image J software.

[0088] 1.6 Immunofluorescence staining The slide glass was used in a 24-well plate and coated with 0.1% gelatin. 4 Cells were seeded overnight in serum-free medium. Cells were treated with 20 μg / mL EpAb2-6 for 6 h, or 400 ng / mL LGK974 (MedChemExpress) for 9 h, or a combination. Cells were washed with ice-cold PBS, fixed with 4% paraformaldehyde for 15 min at room temperature, and washed with ice-cold PBS. Cells were further permeabilized with 0.1% Triton-X in PBS for 20 min, then washed with PBS. Cells were blocked with 3% BSA in PBS for 1 h at room temperature. Next, cells were treated with primary antibody anti-active β-catenin (Millipore) overnight. Cells were then washed and treated with secondary antibody in PBS and 3% BSA with DAPI for 1 h at room temperature. Samples were then washed 5 times with PBS and mounted for microscopy. Nuclear β-catenin intensity was calculated using IMARIS (Oxford Instruments) software.

[0089] 1.7 Quantitative real-time PCR (qPCR) Total RNA was extracted using TRI Reagent, and 5 μg of total RNA was further reverse transcribed with oligo(dT) primers using reverse transcriptase. Quantitative real-time RT-PCR (qPCR) was performed on the cDNA using the Light Cycler 480 SYBR Green-I Master kit and the LightCycler480 System. Gene expression levels of each sample were normalized to the expression levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin. The primers used in qPCR are listed in Table 3.

[0090] [Table 3]

[0091] 1.8 Luciferase reporter assay HEK293T packaging cells were co-transfected with the packaging plasmid (pCMV-ΔR8.91) and the envelope (pMDG) and shRNA (shEpCAM#1 and shEpCAM#2) containing plasmids using the Poly JET transfection kit. 48 hours after transfection, virus-containing supernatants were collected, mixed with fresh medium containing polybrene (8 μg / mL) and incubated with target cells for another 48 hours. Transduced cells were selected with the required antibiotics, and single clones were selected and expanded into stable clones.

[0092] For EpCAM knockout using CRISPR / Cas9, EPCAM CRISPR guide RNA (target sequence: GTGCACCAACTGAAGTACAC (SEQ ID NO: 41), vector: pLentiCRISPR v2) was purchased from GenScript, and lentivirus production and clonal selection were performed according to the procedure described above.

[0093] 1.9 Tumorsphere Assay Cells were plated in ultra-low attachment 6-well plates (5 × 10 4 cells / well) or 24-well plates (1 × 10 3 The cells were seeded at 1000 x 1000 cells / well and maintained in DMEM / F-12 supplemented with B27. Additionally, the cells were treated with 20 μg / mL mEpAb2-6, hEpAb2-6 or MT201 (in-house produced), or 400 ng / mL LGK974 (MedChemExpress), or a combination thereof, by direct addition to the culture medium. The entire culture medium containing the treatment components was changed every other day. The cells were cultured for 10 days, and on the 10th day, the spheres were counted and photographed under a microscope.

[0094] 1.10 Colony formation assay Cells were seeded in 12-well plates (5 × 10 3 Cells were treated with 20 μg / mL mEpAb2-6, hEpAb2-6 or MT201 (in-house produced), 400 ng / mL LGK974 (MedChemExpress), or the indicated combinations, where each component was added directly to the medium. The medium with the treatment components was replaced every other day, and the cells were grown for 10 days. On day 10, the cells were washed, fixed with 4% paraformaldehyde, and further stained with 1% crystal violet for 30 min. The colonies were washed three times with PBS and images were taken. Furthermore, to measure the colony density, the wells were incubated with 0.5% SDS at room temperature for 2 h with shaking. The supernatant was collected, and the absorbance of the solution was measured at 570 nm using a microplate reader.

[0095] 1.11 In vitro regeneration assay Control and EpCAM knockout cells (5 × 10 3 Both the 5×10 cells / well were subjected to tumorsphere assay in 12-well plates according to the protocol described above. On day 7 after seeding, the plates were imaged and the spheres were counted. Furthermore, the spheres were trypsinized into single cells, passed through a cell strainer (BD Falcon) to avoid cell clumps, counted and subjected to tumorsphere assay (5×10 cells / well). 3The plates were then subjected to 100 µg / well incubation at 37 °C for 24 h and grown for an additional 7 days. This procedure was repeated three times. After the final regeneration, the plates were imaged and the spheres were counted.

[0096] 1.12 Interaction of EpEX with Wnt receptors Cells were seeded overnight and harvested with 10 mM EDTA in PBS, then incubated with 2 mM DTSSP (Thermo) crosslinker to stabilize the interaction between EpEX and Wnt receptor proteins. Tris (pH 7.5) was then added to a final concentration of 20 mM to stop the crosslinking reaction. Cells were then lysed using NP40 buffer (1% by volume NP-40, 150 mM NaCl, 50 mM Tris, pH 8.0) supplemented with a protease inhibitor cocktail. Protein G Dynabeads were used to precipitate the EpEX-Wnt receptor complex, and co-immunoprecipitation by Western blotting was performed.

[0097] 1.13 Co-immunoprecipitation (Co-IP) and subsequent Western blotting Co-immunoprecipitation was performed using Pierce Magnetic Protein G Dynabeads (Thermo) according to the manufacturer's instructions. Briefly, cells were lysed using NP40 buffer supplemented with protease cocktail inhibitors. Cell lysates containing 500 μg–1 mg protein were incubated with antibodies for immunoprecipitation at 4°C overnight. The products were then incubated with Protein G Dynabeads at 4°C for 4 h. The beads were precipitated using a magnet and washed three times, after which sample buffer was added to the protein-bound beads and heated at 100°C for 10 min. The final products were subjected to Western blot analysis as described above. Antibodies used for precipitation and Western blot analysis included Frizzled 6 (CST), Frizzled 7 (Santa Cruz Biotech), LRP5 (abcam), LRP6 (CST) and EpEX (EpAb3-5) (produced in-house).

[0098] 1.14 Enzyme-linked immunosorbent assay (ELISA) For ELISA, wells (at least 6 wells per protein) were coated with recombinant FZD6 (Proteintech), recombinant FZD7 (Proteintech), recombinant LRP5 (Proteintech), or recombinant LRP6 (Proteintech) overnight at 4°C. The wells were then blocked with 1% BSA and treated with EpEX-his (Expi293 Expression System) for 2 hours. Alternatively, EpEX-his was incubated with EpAb 2-6 overnight and this complex was used to treat the protein-coated plates for 2 hours. Further analysis was performed with anti-His antibody (abcam) and the optical density was recorded at 450 nm using TMB.

[0099] 1.15 Apoptosis assay Cells were cultured in 24-well plates (5 × 10 4 Cells (1000 x 1000 cells / well) were seeded overnight and then treated with 20 μg / mL mEpAb2-6, hEpAb2-6 or MT201, or 2 μg / mL LGK974 (MedChemExpress) or their combination for 24 h. Cell pellets were collected and apoptosis assays were performed using Annexin-V / PI Apoptosis Kit (BD Biosciences). Results were read by flow cytometry analysis and the percentage of apoptotic cells was calculated.

[0100] 1.16 Luciferase reporter assay Cells were seeded in 24-well plates (1 × 10 4Cells were incubated at 37°C for 24 h after incubation in 100% CO for 1 h. The medium was replaced with fresh medium and cells were transfected with the respective reporter plasmid (TCF reporter or Wnt receptor promoter reporter) by PolyJET (SignaGen). Transfection efficiency was normalized by co-transfecting pRL-TK (20 ng) as an internal control. Additional treatments were performed as indicated. Firefly luciferase and Renilla luminescence were measured 48 h after transfection using the Dual-Glo Luciferase Assay System (Promega) according to the manufacturer's recommendations.

[0101] 1.17 Tumorigenicity in vivo NSG mice were divided into two groups of equal numbers. EpCAM control or EpCAM knockout HCT116 cells were subcutaneously implanted into the right flank of each animal (n=6 per group) (10 3 Tumors were allowed to grow and tumor size was measured twice weekly using slide calipers. 3 Upon reaching the end of gestation period (as defined by IACUC, Academia Sinica), all animals were sacrificed and tumor weights and volumes were measured. No data were excluded.

[0102] 1.18 TACE activity assay Cells were seeded overnight in 24-well plates (1 × 10 5 After further treatment with 250 ng / mL EpEX-His or 100 ng / mL Wnt3A (R&D Systems) for 8 h, TACE activity was measured using the InnoZyme TACE activity kit (Merck). Briefly, cell lysates were prepared in RIPA buffer, added to the TACE antibody-coated plate, and incubated for 1 h at RT with slight shaking. Further, the lysates were removed and the plate was washed three times. Substrate was added to each well and incubated for 5 h at 37 °C. Finally, the fluorescent signal of the reaction product was detected using a microplate reader at an excitation of 324 nm and an emission of 405 nm.

[0103] 1.19 γ-secretase activity γ-Secretase activity was measured using the protocol described by Liao et al. (2004) (Liao et al., 2004). Briefly, cells were transiently transfected with a control plasmid and a tetracycline-inducible γ-secretase plasmid carrying luciferase (Liao et al., 2004) (plasmids were a generous gift from Dr. Yung-Feng, Liao, ICOB, Academia Sinica). Cells were treated with 250 ng / mL EpEX-His or 100 ng / mL Wnt3A (R&D Systems) for 8 h. Furthermore, cells were lysed using passive lysis buffer and subjected to luciferase assay.

[0104] 1.20 Wnt receptor promoter reporter plasmid construction The putative promoter regions of LRP5 (-1187 to +200), LRP6 (-1543 to +55), FZD6 (-1385 to +205) and FZD7 (-1285 to +116) were cloned from HeLa genomic DNA and fused into pGL4.18 plasmid (Promega, USA). Genomic DNA was extracted using a Genomic DNA Isolation kit (NovelGene, TW) according to the manufacturer's recommendations. The primers used to generate PCR fragments of Wnt receptor promoters are listed in Table 4.

[0105] [Table 4]

[0106] 1.21 Activity of GSK3 and CK1 on phosphorylation of ADAM17 and presenilin 2 To examine the kinase activity of GSK3 and CK1, 6The cells were seeded overnight and treated with GSK3 inhibitor BIO (Sigma) or CK1 inhibitor PF-670462 (selleckchem) for 8 hours. The cells were then lysed with RIPA buffer and subjected to Western blot analysis to examine the phosphorylation of ADAM17 and presenilin 2. Additionally, the cells were treated with EpEX (in-house manufactured) or recombinant Wnt3A (R&D systems) or their combination for 8 hours to examine the phosphorylation of ADAM17 and presenilin 2.

[0107] 1.22 Plasmid transfection and protein (EpICD) delivery All plasmid transfection procedures were performed using Polyjet DNA transfection agent (SignaGen Lab) as directed. Protocols were performed according to the manufacturer's instructions. Delivery of EpICD protein (produced in-house using the Expi293 expression system) was performed using the Pierce Protein Transfection Reagent Kit (Thermo Scientific). Protocols were performed according to the kit's instructions.

[0108] 1.23 Tumor implantation and treatment studies in mice All animal experiments were approved and performed in accordance with the IACUC regulations of Academia Sinica. HCT116 cells (1 × 10 6 ) was injected via the tail vein. In addition, 2 × 10 5HCT116 cells were surgically implanted into the cecal wall in the orthotopic model. Male NOD / SCID mice, approximately 6-8 weeks old, were used for the animal experiments (n=5 and n=6 for each treatment group in the metastatic and orthotopic models, respectively). 72 hours after injection / implantation, the mice were randomly divided into four different treatment groups. For treatment, animals were injected with 20 mg / kg IgG or EpAb2-6 via the tail vein twice a week for 4 weeks, or were gavaged with 5 mg / kg LGK974 (MedChemExpress) formulated with vehicle [0.5% methylcellulose (Sigma-Aldrich) and 0.5% Tween 80 (Sigma-Aldrich)] or vehicle every other day for 4 weeks, or animals were treated with a combination of both inhibitors and antibodies. In the metastatic model, survival was the primary endpoint. In the orthotopic model, tumor progression was monitored using bioluminescence imaging. To image the tumors, an intraperitoneal injection of D-luciferin (GOLD BIO) was performed and images were taken 10 min after injection.

[0109] 1.24 Statistical analysis Statistical analysis was performed using GraphPad Prism (GraphPad Software). Data were analyzed using one-way or two-way ANOVA, as appropriate, followed by Bonferroni multiple correction as described in the figure legends. P values ​​less than 0.05 were considered significant, and stars assigned to each significant value are indicated in the figure legends. Error bars for all included data sets represent the mean + SD. All experiments were performed at least in triplicate. None of the data from this study were excluded.

[0110] 2.Results 2.1 EpCAM expression is associated with β-catenin activity To begin the study, we investigated whether EpCAM expression correlated with active β-catenin in CRC tissue samples. We performed immunohistochemistry (IHC) on 120 patient tissue samples and found that the levels of EpCAM and β-catenin were elevated in diseased samples compared to healthy tissue samples. Furthermore, the levels of both proteins were also found to increase with increasing grade of CRC (Figure 1A, Figure 1C). Indeed, correlation analysis showed that the expression of EpCAM was strongly correlated with the expression of active β-catenin (Pearson's correlation coefficient r = 0.76, p < 0.0001) (Figure 1D). Therefore, we next decided to investigate whether and how EpCAM is involved in canonical Wnt signaling.

[0111] 2.2 EpEX is involved in the nuclear translocation of β-catenin We next tested whether EpCAM promotes the nuclear localization of β-catenin, which is a standard readout for classical Wnt signaling. EpCAM knockdown (shEpCAM) or EpCAM knockout (KO-EpCAM) colon cancer cells were immunostained for active β-catenin. We found that knockdown or knockout of EpCAM significantly reduced the nuclear accumulation of β-catenin (Figure 2A, Figure 2B, Figure 3A, Figure 3B, Figure 3C). Notably, the complex of EpICD and β-catenin, together with its binding partner FHL2, is known to translocate to the nucleus and regulate the transcription of EpCAM target genes with the help of transcription factors such as TCF or LEF (Lin et al., 2012; Maetzel et al., 2009; Park et al., 2016). However, β-catenin without EpICD can still translocate to the nucleus and bind such factors to transcribe Wnt target genes (Maetzel et al., 2009; Nusse and Clevers, 2017). Therefore, to examine whether EpEX can regulate protein nuclear translocation independently of EpICD, we treated shEpCAM or KO-EpCAM cells with exogenous EpEX. This treatment stimulated a significant increase in the nuclear accumulation of β-catenin (Figure 2A, Figure 2B, Figure 3A, Figure 3B, Figure 3C). Furthermore, treatment of wild-type cells with DAPT, a γ-secretase inhibitor, reduced the nuclear translocation of β-catenin, whereas treatment of cells with both EpEX and DAPT restored the nuclear accumulation of the protein (Figure 3D, Figure 3E). Furthermore, we monitored TCF activity using a luciferase reporter in EpEX-treated EpCAM knockdown and knockout cells (Figure 2C and Figure 3F). Similar to the IFS and Western results, EpCAM knockdown or knockout cells showed reduced TCF activity compared to control cells, and this phenomenon was significantly restored when the cells were treated with EpEX. In addition, DAPT treatment of wild-type cells slightly reduced TCF activity, but this phenomenon was significantly increased by combined treatment with EpEX and DAPT (Figure 3G).Taken together, these observations suggest a potential role of EpEX in stimulating β-catenin nuclear translocation independent of EpICD. Next, we investigated the individual and combined effects of EpEX and Wnt proteins (with recombinant Wnt3A) on β-catenin nuclear translocation and TCF activity in wild-type cells (Figure 2D, Figure 4A, Figure 4B, Figure 4C). We found that either EpEX or Wnt3A could increase β-catenin nuclear translocation and TCF activity, while a combination of both further increased the signal. Furthermore, we wanted to test whether these treatments also regulated direct target genes of the Wnt pathway, such as Axin2 (Figure 2E, Figure 2F, Figure 4D, Figure 4E). Indeed, we found that, similar to the results of TCF activity, either EpEX or Wnt3A increased Axin2 expression, but the combined treatment enhanced such activity. Taken together, these results suggested that EpEX could activate the Wnt pathway, while EpICD was involved in further downstream signaling.

[0112] We next examined whether inhibition of Wnt or EpCAM signaling in wild-type cells would prevent β-catenin nuclear translocation. Because we wanted to maintain the ability of EpEX to activate Wnt-related signaling, we avoided inhibiting Wnt signaling by inhibiting the β-catenin destruction complex. Instead, we used LGK974, a porcupine inhibitor that limits Wnt ligand activation and inhibits receptor binding (Liu et al., 2013). To inhibit EpCAM signaling, we used EpAb2-6, an anti-EpCAM monoclonal antibody that works by neutralizing EpEX and inhibiting downstream signaling (Liao et al., 2015). Treatment with LGK974 reduced nuclear β-catenin but did not completely remove the protein from the nucleus. Similarly, treatment with EpAb2-6 also significantly reduced nuclear β-catenin signaling. Interestingly, the combined use of LGK974 and EpAb2-6 almost abolished the nuclear accumulation of the protein (Figure 2G, Figure 2H). These results are consistent with the nuclear TCF activity and Axin2 expression data (Figure 2I, Figure 2J, Figure 2K, and Figure 5), suggesting that EpEX initiates Wnt signaling and causes β-catenin translocation to the nucleus. Furthermore, since the EpAb2-6 antibody (mEpAb2-6) was produced in mice by hybridoma technology, we decided to further test its humanized version (hEpAb2-6) (Liao et al., 2015). We also compared the effects of hEpAb2-6 with those of adecatumumab (MT201), a human anti-EpCAM antibody undergoing clinical trials. In this study, hEpAb2-6 was found to retain β-catenin inhibitory activity and correlated with TCF activity, whereas MT201 had no significant effect compared to control-treated cells (Figures 6A, 6B, and 6C).

[0113] 2.3 EpCAM promotes cancer stemness and tumorigenesis Although EpCAM is known to be abundantly expressed in CSCs, we found that EpEX and EpICD may be involved in Wnt-related signaling, which is primarily involved in cancer stemness in many cancer types (Batlle and Clevers, 2017; Gires et al., 2020). Therefore, we next tested the functional role of EpCAM in promoting cancer cell proliferation and cancer stemness. To do so, we used CRISPR / Cas9 to generate EpCAM knockout cells and forced expression of EpCAM in CT26 cells that do not normally express EpCAM (Figure 7A, Figure 7B, Figure 7C). Comparing the growth curves of control and EpCAM knockout cells, knockout of EpCAM significantly slowed cell proliferation, increasing the doubling time from 18 ± 2 hours in control cells to 51 ± 2 hours in knockout HCT116 cells (Figure 8A). Similarly, the doubling time increased from 23 ± 2 h in control cells to 48 ± 2 h in knockout HT29 cells (Figure 7D). Furthermore, forced expression of EpCAM in CT26 cells decreased the doubling time from 30 ± 2 h in control cells to 21 ± 2 h in EpCAM-expressing cells (Figure 8B). To evaluate the tumorigenic potential of EpCAM in vivo, we used only 10 3Control or EpCAM knockout cells were subcutaneously implanted into NSG mice. EpCAM knockout cells showed reduced tumor progression and produced smaller tumors (Figure 8C, Figure 8D, Figure 8E, Figure 8F). Such tumorigenicity may be the result of cancer stemness exhibited by EpCAM. Therefore, we performed in vitro regeneration assays with control and EpCAM knockout cells. After several passages, EpCAM knockout cells lost tumorigenicity and produced smaller tumor sphere size and number (Figure 8G). Since Wnt signaling also largely governs cancer stemness, we sought to clarify whether EpCAM crosses with the Wnt pathway to achieve such properties in cancer cells. Therefore, we performed tumor sphere and colony formation assays while blocking either signaling or blocking them together. Treatment with either LGK974 or EpAb2-6 reduced tumorsphere and colony formation, whereas the combination almost completely eliminated tumorspheres and colonies (Figure 8H, Figure 8I, Figure 8J, Figure 8K, and Figure 7E). On the other hand, EpCAM knockout cells with reduced tumorsphere or colony formation ability were restored to wild-type levels when treated with exogenous EpEX, suggesting that EpEX may be able to promote stemness via Wnt signaling. Interestingly, treatment of EpCAM knockout cells with LGK974 completely lost the ability to form spheres or colonies, whereas addition of EpEX together with LGK974 could partially restore sphere and colony formation (Figure 8H, Figure 8I, Figure 8J, Figure 8K, and Figure 7E). Thus, even in the absence of Wnt ligands, EpEX can promote some degree of cancer stemness, which may be due to its involvement in Wnt signaling. Furthermore, exogenous Wnt3A or EpEX treatment enhanced sphere and colony formation, and the combination further amplified such potential (Figure 8L, 8M, 8N). Next, the present inventors compared EpAb2-6 and MT201 in terms of their ability to inhibit colony and sphere formation, and found that MT201 did not show any activity to regulate cancer stemness (Figure 6D, 6E, 6F).Taken together, these data support the idea that EpCAM and Wnt proteins coordinately stimulate β-catenin signaling to promote cancer stemness in CRC.

[0114] 2.4 EpEX interacts with Wnt receptors to promote β-catenin signaling Since the present inventors have revealed that EpEX can activate Wnt signaling, the binding of EpEX to Wnt receptors was further investigated. The present inventors co-immunoprecipitated EpEX or Wnt receptor molecules FZD6 / 7 and LRP5 / 6, and subjected the precipitated products to Western blot analysis. The results showed that EpEX formed a complex with Wnt receptor proteins (Figure 9A, Figure 9B). To confirm the binding of EpEX to Wnt receptor proteins, ELISA plates were coated with purified FZD6 / 7 or LRP5 / 6 fusion proteins (with GST tag) to test whether EpEX could bind to the proteins (Figure 9C). EpEX was found to bind to all receptor proteins, but such binding was significantly reduced when EpEX was pre-incubated with anti-EpCAM polyclonal antibody (which blocks almost all epitopes). Furthermore, pre-incubation of EpEX with EpAb2-6 significantly reduced the binding to only FZD7 and LRP5 proteins, suggesting that the EpAb2-6 epitope on EpEX may be involved in binding to FZD7 and LRP5 (Figure 9C, Figure 9D). In this context, in the Wnt pathway, receptor-ligand interaction initiates signaling by recruiting the β-catenin destruction complex, which is activated and allows translocation to the nucleus. During this process, LRP5 / 6 is phosphorylated by glycogen synthase kinase 3β (GSK3β) or casein kinase 1 (CK1) at the plasma membrane, which are present in the destruction complex (Nusse and Clevers, 2017). Therefore, we tested whether the interaction of EpEX with Wnt receptors could initiate such phosphorylation. Indeed, treatment with exogenous EpEX or Wnt3A increased LRP5 / 6 phosphorylation, and this combination led to an enhancing effect (Figure 9E).

[0115] These results further encouraged us to evaluate which specific domain of EpEX interacts with Wnt receptor. To answer this question, we transfected HEK293 cells with plasmids expressing deletion mutants of EpEX lacking either EGF-like domain I or domain II, and performed immunoprecipitation of EpEX (Figure 9F). The results revealed that EGF-like domain I of EpEX directly interacts with Wnt receptor. Furthermore, since we previously observed that EpEX can induce phosphorylation of LRP5 / 6 (Figure 9C) and nuclear translocation of β-catenin (Figure 2A, Figure 2B, Figure 3B, Figure 3C, Figure 3E, and Figure 4A, Figure 4B), we tested whether domain I of EpEX can induce the same effect by binding to Wnt receptor. Therefore, we treated cells with EGF-like domain (I / II)-deleted mutant EpEX protein and observed its activity (Figure 9G, Figure 9H). Indeed, we found that EpEX domain I mutant protein treatment induced phosphorylation of LRP5 / 6 and nuclear translocation of β-catenin, but EpEX domain II mutant protein treatment did not have the same effect. As previously observed, EpAb2-6 and LGK974 could attenuate the nuclear translocation of β-catenin (Figure 2G, Figure 2H), so we next tested whether such treatment could inhibit phosphorylation of LRP5 / 6 to block Wnt signaling. We found that either LGK974 or EpAb2-6 treatment could reduce LRP5 / 6 phosphorylation, and combined treatment absolutely inhibited such phosphorylation (Figure 9I). These results confirmed that the EGF-like domain I of EpEX directly interacts with the Wnt receptor to activate β-catenin signaling.

[0116] 2.5 EpEX and Wnt activate TACE and γ-secretase Since we found that EpEX interacts with Wnt receptors, we further investigated factors that may affect the production of EpEX and even EpICD. Therefore, we investigated whether EpEX-induced Wnt signaling can activate TACE and γ-secretase, which cleave EpEX and EpICD, respectively. Interestingly, we found that treatment with exogenous EpEX or Wnt3A enhanced TACE and γ-secretase activity, and this combination further enhanced such activation (Figure 10A, Figure 10B, Figure 10C, Figure 10D). Regarding the mechanism of upregulated activity, we found that Wnt3A and EpEX treatment increased the phosphorylation of presenilin-2 (PS2), the activating subunit of TACE and γ-secretase (Figure 10E). To identify the kinase involved in this process, we blocked GSK3 or CK1 of the β-catenin destruction complex with small molecule inhibitors and observed a decrease in the phosphorylation of TACE and PS2. This suggests that GSK3 and CK1 are involved in this process (Figure 10F, Figure 10G). These observations require further testing to identify the detailed mechanism of TACE and γ-secretase activation by the activation of the Wnt pathway.

[0117] 2.6 EpICD upregulates Wnt receptor protein expression High levels of Wnt receptor protein increase Wnt activity (MacDonald and He, 2012), which may affect cancer stemness. Therefore, we investigated whether the levels of Wnt receptor protein are affected by EpCAM signaling. Interestingly, we found that EpCAM knockout or knockdown significantly reduced Wnt receptor protein levels (Figure 11A, Figure 11B, and Figure 12A, Figure 12B). Furthermore, transfecting knockout cells with wild-type EpCAM plasmid restored Wnt receptor and changed the cell morphology to wild-type-like (Figure 11C, Figure 11D, and Figure 12C). Furthermore, when EpICD shedding was blocked with DAPT, a γ-secretase inhibitor, reduced expression of Wnt receptor was observed (Figure 11E, Figure 11F, and Figure 12D). Based on these results, we hypothesized that EpICD may function as a transcription factor that promotes the expression of Wnt receptor. To test this hypothesis, we constructed a luciferase reporter under the control of the Wnt receptor promoter (Figure 12E). As expected, transfection of cells with EpCAM enhanced promoter activity, while DAPT treatment almost completely blocked the effect (Figure 11G, Figure 11H, Figure 11I, and Figure 12F). These data suggest that EpICD upregulates the expression level of Wnt receptor protein through direct interaction with the promoter. In this context, overproduction of EpEX (as in cancer cells) can activate γ-secretase, which phosphorylates presenilin-2 and cleaves EpICD through the EpEX-EGFR-ERK system (Chen et al., 2020; Liang et al., 2018). In this study, we also noted that both Wnt and EpEX can activate γ-secretase to produce more EpICD (Figure 10). Therefore, we investigated whether EpEX can upregulate Wnt receptors. Indeed, EpEX and Wnt3A treatment upregulated the expression of Wnt receptors, and this combination further enhanced the phenomenon at both the protein and mRNA levels (FIGS. 13A, B).Thus, EpAb2-6 and LGK974 each partially reduced, and their combination almost nullified, the expression of Wnt receptors (Figure 11J, 11K). In addition, pluripotency factors such as Oct4, Sox2 and c-Myc are thought to be important for cancer stemness, and it has been well studied that the transcription of these genes is activated by EpICD (Lin et al., 2012). Thus, in this study, knocking down EpCAM reduced the protein and relative mRNA expression levels of stemness factors (Figure 13C, 13D). As stemness factors are direct targets of the Wnt pathway, treating cells with either EpEX or Wnt3A induced the expression of pluripotency factors, but the combination treatment further enhanced the effect (Figure 13E, 13F). Indeed, treating cells with LGK974 or EpAb2-6 reduced the expression of pluripotency factors, and the combination treatment completely abolished such activity (Figure 11L, 11M). These results are consistent with a previous study by Lin et al. (Lin et al., 2012), which revealed that EpICD functions as a transcriptional regulator of stemness proteins. Thus, EpEX binds to Wnt receptors to initiate signaling, while EpICD functions as a transcription factor to promote the production of Wnt receptor proteins and stemness factors to achieve cancer stemness.

[0118] 2.7 LGK974 and EpAb2-6 cooperatively induce apoptosis and inhibit tumor progression Our data suggested that EpCAM and Wnt proteins cooperatively stimulate Wnt signaling to promote stemness, which could be inhibited by simultaneously blocking both signals using EpAb2-6 and LGK974, so we tested the cellular effects of this combination. We found that treatment with EpAb2-6 alone, but not LGK974, was able to induce apoptosis in colon cancer cells. However, induction of apoptosis was amplified in cells that received combination treatment (Figure 14A, Figure 14B, Figure 15A, Figure 15B). Furthermore, we evaluated whether such effects could be reproduced with MT201, which showed no such activity, whereas hEpAb2-6 showed similar activity to mEpAb2-6 (Figure 6G, Figure 6H). These results encouraged us to test the antitumor effects of EpAb2-6 using animal models. In this context, EpCAM has previously been reported to enhance EMT gene expression, which promotes colon cancer metastasis (Lin et al., 2012). Therefore, we decided to evaluate the effect of the combination of EpAb2-6 and LGK974 in both human metastatic and orthotopic animal models. In the metastatic animal model, HCT116 cells were injected via the tail vein, whereas in the orthotopic model, cells were surgically implanted into the cecal wall. Treatment was started 72 hours after implantation in both models (Figure 15C). In the metastatic model, treatment with either EpAb2-6 or the combination was found to prolong survival. Only 2 out of 5 animals in the EpAb2-6 group died by the end of the study, whereas 0 out of 5 animals in the combination group died. However, most animals in the control IgG or LGK974 groups developed distant metastases, which were associated with a shorter overall survival (Figure 14C, Figure 15D, Figure 15E). Similarly, in the orthotopic model, all animals in the control IgG and LGK974 groups developed significant tumors and showed a lower median survival (Figure 14D, Figure 14E, Figure 14F). Tumor progression was much slower in the EpAb2-6 treated group, with a relatively higher median survival time than the control IgG or LGK974 treated groups (Figures 14D, 14E, 14F). The reduction in tumor progression was even more pronounced in the combination therapy group, with complete disappearance of tumors in 4 out of 6 animals and an increase in the overall survival time of the animals (Figures 14D, 14E, 14F).Of note, previous studies have reported that LGK974 is non-toxic at a dose of 5 mg / kg body weight (Liu et al., 2013). We found that the body weight of both LGK974-treated and combination-treated animals decreased during the treatment period (Figure 15F). However, after treatment was discontinued, the combination group regained weight, whereas LGK974-treated mice continued to lose weight, likely due to tumor burden. Taken together, these data lead us to conclude that EpCAM actively orchestrates the Wnt machinery via EpEX and EpICD to establish cancer stemness in CRC, and thus combination therapy with EpAb2-6 and porcupine inhibitors may fully suppress cancer stemness to maximize therapeutic efficacy (Figure 16).

[0119] 2.8 EpAb2-6 binds to the EGF-like domains I and II of EpCAM In the present invention, we investigated whether EpEX binds to EpCAM at both EGF-like domains (Figure 18A, Figure 18B, Figure 18C). To confirm that EpAb2-6 recognizes the LYD motif of EpCAM, we constructed cDNA sequences encoding the first EGF-like repeat (aa 27-59; EGF-I domain) and the second EGF-like repeat (aa 66-135; EGF-II / TY domain) of EpCAM. Then, PCR-based site-directed mutagenesis was used to introduce mutations into each domain (Figure 18D). The reactivity of EpAb2-6 antibody against these EpCAM mutants was evaluated by immunofluorescence (Figure 18E), flow cytometry (Figure 18F), and cell ELISA (Figure 18G). Amino acid mutations at EpCAM positions Y32 (EGF-I domain) or Y95 (EGF-II domain) caused a significant decrease in EpAb2-6 binding but did not affect MT201 binding. Therefore, we conclude that EpAb2-6 binds to the EGF-I and EGF-II domains of EpEX targeting amino acid residues Y32 and Y95, respectively.

[0120] 3. Discussion EpCAM is known to be a potent CSC surface antigen, and its high expression has been reported as a common feature of CRC (Boesch et al., 2018;Dalerba et al., 2007;Gires et al., 2009;Gires et al., 2020;Lin et al., 2012). In addition to the intracellular effects of EpICD, EpCAM signals through EpEX in the extracellular tumor microenvironment. In this regard, the phenotype of cancer cells is attributed to abnormal and heterogeneous cell signaling networks that may confer self-renewal and high tumorigenicity. Furthermore, certain subpopulations of cancer cells exhibit stemness properties that are believed to have strong tumorigenic potential, and even a single CSC in melanoma can form a complete heterogeneous tumor (Quintana et al., 2008). Due to this malignant potential, eliminating CSCs may be highly beneficial in treating cancer patients. However, this goal remains challenging due to the high plasticity of cancer cells, i.e., non-CSCs can dedifferentiate and become CSCs when appropriately stimulated by the microenvironment. Thus, elimination of CSCs may require not only direct targeting of CSC populations but also simultaneous blockade of specific signals from the microenvironment (Batlle and Clevers, 2017). In particular, CRC microenvironments are often enriched in Wnt ligands that have been shown to confer stemness via β-catenin signaling (Batlle and Clevers, 2017; Vermeulen et al., 2010; Voloshanenko et al., 2013). Indeed, CRCs have been modeled to support context-specific functions of CSCs (Batlle and Clevers, 2017). Thus, the intestinal stem cell (ISC) crypt niche is enriched with Wnt ligands that help maintain the undifferentiated state of stem cells. Genetic alterations that aberrantly affect Wnt signaling can convert the crypt precursor phenotype into CRC, suggesting that ISCs are the origin of the major cell type in CRC ( Barker et al., 2009 ; van de Wetering et al., 2002 ).These studies suggest that Wnt signaling is centrally involved in the function of the CRC niche as a factor imposing stemness.

[0121] Nuclear accumulation of β-catenin, a hallmark of the classical Wnt pathway, occurs upon binding of Wnt ligands to their receptors, recruiting a destruction complex to the cell membrane and dephosphorylating β-catenin, termed active β-catenin (Nusse and Clevers, 2017). Here, we further show that EpEX can also induce nuclear accumulation of β-catenin through its interaction with Wnt receptors, which activates signaling. Thus, interaction of Wnt proteins or EpEX with Wnt receptors releases β-catenin to form a complex with EpICD, which translocates to the nucleus, where it transcribes EpCAM target genes, such as Wnt receptor proteins and stemness factors (Lin et al., 2012). Under the influence of Wnt or EpEX, β-catenin can translocate to the nucleus independently of EpICD, allowing TCF / LEF to function as a transcription factor for EpCAM itself and Wnt target genes such as Axin2 (Gires et al., 2020;Maetzel et al., 2009;Nusse and Clevers., 2017). In particular, overproduction of EpEX and EpICD leads to enhanced EpCAM signaling. We previously reported that stimulation of ERK1 / 2 signaling via the EpEX-EGFR axis can cause phosphorylation of TACE and presenilin-2, activating enzymes that enhance EpEX and EpICD cleavage in CRC and lung cancer (Chen et al., 2020;Liang et al., 2018). We further found that Wnt and EpEX proteins also activate TACE and presenilin-2 through Wnt signaling, requiring GSK3 and CK1 to establish a positive feedback loop. Thus, the function of EpEX as a ligand for Wnt receptors is indicated as an exogenous cue in the tumor microenvironment that mediates the transcription of key Wnt receptor proteins, through which EpICD achieves cancer stemness potential.

[0122] Currently, cancer therapeutic strategies are mostly designed to target cancer by eliminating cancer cells through standard anti-proliferative therapy. However, such strategies often suffer from limited positive results. Upon cessation of treatment, some remaining cell populations (called anticancer drug resistant cells) that can cause cancer to recur are enriched in CSCs. Cancer recurrence is often attributed to CSCs that have acquired drug resistance through multiple independent mechanisms (Borst, 2012; Holohan et al., 2013). Thus, the intrinsic ability of CSCs to exhibit plasticity and quiescence is believed to be a strong promoter of drug resistance (Borst, 2012). Interestingly, CSCs acquire such properties from extrinsic cues in the microenvironment, including the extracellular Wnt machinery (Batlle and Clevers, 2017; Nusse and Clevers, 2017). Indeed, attempts have been made to target the Wnt pathway (porcupines, inhibitors of FZD proteins and anti-RSPO3) with the aim of suppressing CSC signaling, but these strategies are thwarted by drug resistance and regeneration of the CSC pool (Batlle and Clevers, 2017; Kahn, 2014). Furthermore, several cancer types, including CRC, express EpCAM abundantly (Gires et al., 2020), so EpEX is enriched to function as an extrinsic cue in the tumor microenvironment. To target the CSC population and the CSC-inducing cues, it is necessary to simultaneously target both EpCAM and Wnt signaling, which may overcome drug resistance. Here, we show that our anti-EpCAM antibody, EpAb2-6, in combination with LGK974, can attenuate mechanisms associated with cancer stemness to induce apoptosis in cancer cells and prevent tumor progression in mouse models. Notably, no significant effect of LGK974 alone was observed in inducing apoptosis or inhibiting cancer progression in animal models, which is consistent with previous studies (Cho et al., 2020). However, the inhibitor in combination with EpAb2-6 showed promising therapeutic effects.Therefore, these findings may be beneficial for designing better strategies for CSC treatment and help overcome drug resistance.

[0123] Both Wnt and EpCAM promote the transcription of important genes in cancer progression, proliferation, EMT, metastasis and stemness (Gires et al., 2020; Lin et al., 2012). In addition, both signaling components contribute to the CSC phenotype and CSC-microenvironment communication in CRC. Interestingly, we found that EpEX maintained β-catenin signaling and cancer stemness in the absence of functional Wnt ligands (when cells were treated with LGK974). Only combined inhibition of Wnt ligands and EpEX could completely inhibit Wnt pathway activity and abolish cancer stemness. Therefore, combination therapy of EpAb2-6 and porcupine inhibitors may be an effective way to target CSCs. It is a common feature of many cancer types (especially solid tumors) that show high expression of both EpCAM and Wnt machinery, and EpCAM may further stimulate Wnt signaling. Therefore, blocking Wnt ligands may not completely stop signaling, as EpCAM further activates the pathway, maintaining CSCs and promoting cancer proliferation. In such cases, blocking both EpEX and Wnt ligands may be necessary to suppress cancer progression. This blockade of cancer progression may be due to the lack of pro-survival intracellular signaling that contributes to the CSC phenotype, as well as the inhibition of communication between the microenvironment and tumor cells. The mechanistic insights gained from our study may be useful for improving existing treatments and developing new anti-cancer therapies.

[0124] literature Barker, N., Ridgway, R.A., van Es, J.H., van de Wetering, M., Begthel, H., van den Born, M., Danenberg, E., Clarke, A.R., Sansom, O.J., and Clevers, H. (2009). Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 457, 608-611. Batlle, E., and Clevers, H. (2017). Cancer stem cells revisited. Nat Med 23, 1124-1134. Boesch, M., Spizzo, G., and Seeber, A. (2018). Concise Review: Aggressive Colorectal Cancer: Role of Epithelial Cell Adhesion Molecule in Cancer Stem Cells and Epithelial-to-Mesenchymal Transition. Stem Cells Transl Med 7, 495-501. Borst, P. (2012). Cancer drug pan-resistance: pumps, cancer stem cells, quiescence, epithelial to mesenchymal transition, blocked cell death pathways, persisters or what? Open Biol 2, 120066. Cancer Genome Atlas, N. (2012). Comprehensive molecular characterization of human colon and rectal cancer. Nature 487, 330-337. Chen, H.N., Liang, K.H., Lai, J.K., Lan, C.H., Liao, M.Y., Hung, S.H., Chuang, Y.T., Chen, K.C., Tsuei, W.W., and Wu, H.C. (2020). EpCAM Signaling Promotes Tumor Progression and Protein Stability of PD-L1 through the EGFR Pathway. Cancer Res 80, 5035-5050. Cho, Y.H., Ro, E.J., Yoon, J.S., Mizutani, T., Kang, D.W., Park, J.C., Il Kim, T., Clevers, H., and Choi, K.Y. (2020). 5-FU promotes stemness of colorectal cancer via p53-mediated WNT / beta-catenin pathway activation. Nat Commun 11, 5321. Dalerba, P., Dylla, S.J., Park, I.K., Liu, R., Wang, X., Cho, R.W., Hoey, T., Gurney, A., Huang, E.H., Simeone, D.M., et al. (2007). Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A 104, 10158-10163. de Sousa e Melo, F., Kurtova, A.V., Harnoss, J.M., Kljavin, N., Hoeck, J.D., Hung, J., Anderson, J.E., Storm, E.E., Modrusan, Z., Koeppen, H., et al. (2017). A distinct role for Lgr5(+) stem cells in primary and metastatic colon cancer. Nature 543, 676-680. Gires, O., Klein, C.A., and Baeuerle, P.A. (2009). On the abundance of EpCAM on cancer stem cells. Nat Rev Cancer 9, 143; author reply 143. Gires, O., Pan, M., Schinke, H., Canis, M., and Baeuerle, P.A. (2020). Expression and function of epithelial cell adhesion molecule EpCAM: where are we after 40 years? Cancer Metastasis Rev 39, 969-987. Holohan, C., Van Schaeybroeck, S., Longley, D.B., and Johnston, P.G. (2013). Cancer drug resistance: an evolving paradigm. Nat Rev Cancer 13, 714-726. Kahn, M. (2014). Can we safely target the WNT pathway? Nat Rev Drug Discov 13, 513-532. Kim, J.H., Bae, J.M., Song, Y.S., Cho, N.Y., Lee, H.S., and Kang, G.H. (2016). Clinicopathologic, molecular, and prognostic implications of the loss of EPCAM expression in colorectal carcinoma. Oncotarget 7, 13372-13387. Kozar, S., Morrissey, E., Nicholson, A.M., van der Heijden, M., Zecchini, H.I., Kemp, R., Tavare, S., Vermeulen, L., and Winton, D.J. (2013). Continuous clonal labeling reveals small numbers of functional stem cells in intestinal crypts and adenomas. Cell Stem Cell 13, 626-633. Liang, K.H., Tso, H.C., Hung, S.H., Kuan, II, Lai, J.K., Ke, F.Y., Chuang, Y.T., Liu, I.J., Wang, Y.P., Chen, R.H., et al. (2018). Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer cells. Cancer Lett 433, 165-175. Liao, M.Y., Lai, J.K., Kuo, M.Y., Lu, R.M., Lin, C.W., Cheng, P.C., Liang, K.H., and Wu, H.C. (2015). An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 6, 24947-24968. Liao, Y.F., Wang, B.J., Cheng, H.T., Kuo, L.H., and Wolfe, M.S. (2004). Tumor necrosis factor-alpha, interleukin-1beta, and interferon-gamma stimulate gamma-secretase-mediated cleavage of amyloid precursor protein through a JNK-dependent MAPK pathway. J Biol Chem 279, 49523-49532. Lin, C.W., Liao, M.Y., Lin, W.W., Wang, Y.P., Lu, T.Y., and Wu, H.C. (2012). Epithelial cell adhesion molecule regulates tumor initiation and tumorigenesis via activating reprogramming factors and epithelial-mesenchymal transition gene expression in colon cancer. J Biol Chem 287, 39449-39459. Liu, J., Pan, S., Hsieh, M.H., Ng, N., Sun, F., Wang, T., Kasibhatla, S., Schuller, A.G., Li, A.G., Cheng, D., et al. (2013). Targeting Wnt-driven cancer through the inhibition of Porcupine by LGK974. Proc Natl Acad Sci U S A 110, 20224-20229. MacDonald, B.T., and He, X. (2012). Frizzled and LRP5 / 6 receptors for Wnt / beta-catenin signaling. Cold Spring Harb Perspect Biol 4. Maetzel, D., Denzel, S., Mack, B., Canis, M., Went, P., Benk, M., Kieu, C., Papior, P., Baeuerle, P.A., Munz, M., et al. (2009). Nuclear signalling by tumour-associated antigen EpCAM. Nat Cell Biol 11, 162-171. Morin, P.J., Sparks, A.B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K.W. (1997). Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275, 1787-1790. Nusse, R., and Clevers, H. (2017). Wnt / beta-Catenin Signaling, Disease, and Emerging Therapeutic Modalities. Cell 169, 985-999. Pan, M., Schinke, H., Luxenburger, E., Kranz, G., Shakhtour, J., Libl, D., Huang, Y., Gaber, A., Pavsic, M., Lenarcic, B., et al. (2018). EpCAM ectodomain EpEX is a ligand of EGFR that counteracts EGF-mediated epithelial-mesenchymal transition through modulation of phospho-ERK1 / 2 in head and neck cancers. PLoS Biol 16, e2006624. Park, S.Y., Bae, J.S., Cha, E.J., Chu, H.H., Sohn, J.S., and Moon, W.S. (2016). Nuclear EpICD expression and its role in hepatocellular carcinoma. Oncol Rep 36, 197-204. Quintana, E., Shackleton, M., Sabel, M.S., Fullen, D.R., Johnson, T.M., and Morrison, S.J. (2008). Efficient tumour formation by single human melanoma cells. Nature 456, 593-598. Ralhan, R., He, H.C., So, A.K., Tripathi, S.C., Kumar, M., Hasan, M.R., Kaur, J., Kashat, L., MacMillan, C., Chauhan, S.S., et al. (2010). Nuclear and cytoplasmic accumulation of Ep-ICD is frequently detected in human epithelial cancers. PLoS One 5, e14130. Sankpal, N.V., Fleming, T.P., Sharma, P.K., Wiedner, H.J., and Gillanders, W.E. (2017). A double-negative feedback loop between EpCAM and ERK contributes to the regulation of epithelial-mesenchymal transition in cancer. Oncogene 36, 3706-3717. Schepers, A.G., Snippert, H.J., Stange, D.E., van den Born, M., van Es, J.H., van de Wetering, M., and Clevers, H. (2012). Lineage tracing reveals Lgr5+ stem cell activity in mouse intestinal adenomas. Science 337, 730-735. Seeber, A., Untergasser, G., Spizzo, G., Terracciano, L., Lugli, A., Kasal, A., Kocher, F., Steiner, N., Mazzoleni, G., Gastl, G., et al. (2016). Predominant expression of truncated EpCAM is associated with a more aggressive phenotype and predicts poor overall survival in colorectal cancer. Int J Cancer 139, 657-663. van de Wetering, M., Sancho, E., Verweij, C., de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A.P., et al. (2002). The beta-catenin / TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111, 241-250. Vermeulen, L., De Sousa, E.M.F., van der Heijden, M., Cameron, K., de Jong, J.H., Borovski, T., Tuynman, J.B., Todaro, M., Merz, C., Rodermond, H., et al. (2010). Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat Cell Biol 12, 468-476. Voloshanenko, O., Erdmann, G., Dubash, T.D., Augustin, I., Metzig, M., Moffa, G., Hundsrucker, C., Kerr, G., Sandmann, T., Anchang, B., et al. (2013). Wnt secretion is required to maintain high levels of Wnt activity in colon cancer cells. Nat Commun 4, 2610. Wang, A., Ramjeesingh, R., Chen, C.H., Hurlbut, D., Hammad, N., Mulligan, L.M., Nicol, C., Feilotter, H.E., and Davey, S. (2016). Reduction in membranous immunohistochemical staining for the intracellular domain of epithelial cell adhesion molecule correlates with poor patient outcome in primary colorectal adenocarcinoma. Curr Oncol 23, e171-178. Wang, Z., Vogelstein, B., and Kinzler, K.W. (2003). Phosphorylation of beta-catenin at S33, S37, or T41 can occur in the absence of phosphorylation at T45 in colon cancer cells. Cancer Res 63, 5234-5235. Zhan, T., Rindtorff, N., and Boutros, M. (2017). Wnt signaling in cancer. Oncogene 36, 1461-1473.

Claims

1. For treating cancer, (i) a first inhibitor in an effective amount that inhibits the activation of epithelial cell adhesion molecule (EpCAM) signaling; and (ii) a second inhibitor in an effective amount that inhibits the activation of Wnt signaling comprising, or comprising a first inhibitor in an effective amount that inhibits the activation of EpCAM signaling and administered in combination with a second inhibitor in an effective amount that inhibits the activation of Wnt signaling, or comprising a second inhibitor in an effective amount that inhibits the activation of Wnt signaling and administered in combination with a first inhibitor in an effective amount that inhibits the activation of EpCAM signaling, a pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the first inhibitor reduces the production (or release) of the extracellular domain (EpEX) of EpCAM and / or blocks the binding of EpEX to the Wnt receptor.

3. The pharmaceutical composition according to claim 1, wherein the second inhibitor blocks the binding of the Wnt ligand to the Wnt receptor protein.

4. The pharmaceutical composition according to claim 3, wherein the Wnt ligand is not EpEX.

5. The pharmaceutical composition according to claim 1, wherein the first inhibitor is an antibody against EpEX or an antigen-binding fragment thereof.

6. The pharmaceutical composition according to claim 5, wherein the antibody specifically binds to epidermal growth factor (EGF)-like domains I and II.

7. The pharmaceutical composition according to claim 6, having specific binding affinity for epitopes within the sequences CVCE NYKLA VN (aa 27-37) (SEQ ID NO: 20) located in EGF-like domain I and KPEG ALQNN DGLYD PDC D (aa 83-100) (SEQ ID NO: 19) located in EGF-like domain II.

8. The antibody or antigen-binding fragment is (a) A heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1) containing the amino acid sequence of SEQ ID NO: 2, a heavy chain complementarity determining region 2 (HC CDR2) containing the amino acid sequence of SEQ ID NO: 4, and a heavy chain complementarity determining region 3 (HC CDR3) containing the amino acid sequence of SEQ ID NO: 6; and (b) A light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1) containing the amino acid sequence of SEQ ID NO: 9, a light chain complementarity determining region 2 (LC CDR2) containing the amino acid sequence of SEQ ID NO: 11, and a light chain complementarity determining region 3 (LC CDR3) containing the amino acid sequence of SEQ ID NO: 13, The pharmaceutical composition according to claim 5, comprising.

9. The pharmaceutical composition according to claim 1, wherein the first inhibitor is effective for inhibiting β-catenin signaling.

10. The pharmaceutical composition according to claim 1, wherein the second inhibitor is a porcupine inhibitor.

11. The pharmaceutical composition according to claim 1, which is effective for inducing apoptosis of cancer cells.

12. The pharmaceutical composition according to claim 1, which is effective for inhibiting cancer stem cell properties, tumor progression and / or metastasis.

13. The pharmaceutical composition according to claim 1, which is effective for prolonging the survival of a subject.

14. The pharmaceutical composition according to any one of claims 1 to 13, wherein the cancer is selected from the group consisting of lung cancer, brain tumor, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer and testicular cancer.

15. (i) A first inhibitor that inhibits the activation of EpCAM signaling; and (ii) A second inhibitor that inhibits the activation of Wnt signaling A kit comprising the same as a mixture or separately.

16. The kit according to claim 15, wherein the first inhibitor is as described in any one of claims 1, 2, and 5 to 9, and / or the second inhibitor is as described in claim 3, 4, or 10.

17. Use of a combination of (i) a first inhibitor that inhibits the activation of EpCAM signaling and (ii) a second inhibitor that inhibits the activation of Wnt signaling for the manufacture of a medicament or kit for treating cancer.

18. The use according to claim 17, wherein the first inhibitor is as described in any one of claims 1, 2, and 5 to 9, and / or the second inhibitor is as described in claim 3, 4, or 10.

19. The use according to claim 17, wherein the medicament or kit is effective in inducing apoptosis of cancer cells.

20. The use according to claim 17, wherein the medicament or kit is effective in inhibiting cancer stemness, tumor progression, and / or metastasis.

21. The use according to claim 17, wherein the medicament or kit is effective in prolonging the survival of a subject.

22. The use according to claim 17, wherein the cancer is selected from the group consisting of lung cancer, brain tumor, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, and testicular cancer.

23. The pharmaceutical composition for treating cancer according to claim 1, wherein the first inhibitor and the second inhibitor are administered simultaneously, individually, or sequentially.

Images