Treatment of muscular dystrophy

Abstract

The invention described herein provides codon-optimized polynucleotides encoding micro-dystrophins with reduced CpG islands and their use in the treatment of muscular dystrophies such as DMD / BMD.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of the filing date of U.S. Provisional Patent Application No. 63 / 231,720, filed August 11, 2021, the entire contents of which, including any drawings and sequence listing, are incorporated herein by reference. [Background technology]

[0002] Muscular dystrophies (MD) are a group of diseases that cause progressive weakness and loss of muscle mass. In MD, abnormal (mutated) genes do not produce functional wild-type proteins required to form healthy muscle.

[0003] Muscular dystrophies severely impair the quality of life of affected patients. Duchenne muscular dystrophy (DMD) is one of the most severe muscle diseases affecting 1 in 5,000 newborn boys. It is the best characterized muscular dystrophy resulting from mutations in genes encoding members of the dystrophin-associated protein complex (DAPC). These MDs result from membrane fragility associated with loss of sarcolemma-cytoskeleton linkages by DAPC.

[0004] Specifically, DMD is caused by mutations in the DMD gene, leading to a reduction in DMD mRNA and a lack of dystrophin or functional dystrophin, a 427-kDa sarcolemmal protein associated with the dystrophin-associated protein complex (DAPC) (Hoffman et al., Cell 51(6):919-928, 1987). The DAPC is composed of multiple proteins that form structural associations between the extracellular matrix (ECM) and the cytoskeleton in muscle sarcolemma via the actin-binding protein dystrophin and the laminin-binding protein alpha-dystroglycan. These structural associations act to stabilize the sarcolemma during contraction and prevent contraction-induced damage.

[0005] Loss of dystrophin as a result of DMD gene mutations leads to disruption of the dystrophin glycoprotein complex and increased muscle membrane fragility. A series of events, including calcium influx into the sarcoplasm, activation of proteases and proinflammatory cytokines, and mitochondrial dysfunction, leads to progressive muscle degeneration. In addition, translocation of neuronal nitric oxide synthase (nNOS) contributes to tissue ischemia, increased oxidative stress, and impaired repair. Disease progression is characterized by increased myonecrosis, fibrosis, and fatty tissue replacement, as well as greater degrees of fiber size changes seen in subsequent muscle biopsies.

[0006] There is currently no cure for DMD. Standard treatments include corticosteroids (such as prednisone or deflazacort) to stabilize muscle strength and function, prolong independent ambulation, and slow the progression of scoliosis and cardiomyopathy, bisphosphonates, as well as denosumab and recombinant parathyroid hormone.

[0007] With the advent of gene therapy, research and clinical trials for the treatment of DMD have focused on gene replacement or other gene therapies aimed at at least partially restoring dystrophin function. These include delivery of a functional copy of the dystrophin gene, e.g., a dystrophin minigene, or repair of a defective dystrophin gene product by exon skipping and nonsense suppression.

[0008] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb in length and contains inverted terminal repeats (ITRs) of 145 nucleotides.

[0009] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cultured cells is noncytopathic, and natural infection of humans and other animals is asymptomatic and symptomless. Furthermore, AAV infects many mammalian cells, allowing targeting of many different tissues in vivo. Furthermore, AAV can cause transduction of slow-dividing and non-dividing cells and persist as transcriptionally active nuclear episomes (extrachromosomal elements) essentially for the lifetime of those cells. The proviral genome of AAV is infectious as DNA cloned into a plasmid, allowing the construction of recombinant genomes. Furthermore, signals directing AAV replication, genome encapsidation, and integration are contained within the ITRs of the AAV genome, so that part or all of the internal ∼4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA, for example, a gene cassette containing a promoter, DNA of interest, and a polyadenylation signal. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is a very stable and abundant virus. It easily withstands the conditions used to inactivate adenovirus (56°C to 65°C for several hours), so low-temperature storage of AAV is not as important. AAV may even be lyophilized. Finally, cells infected with AAV are not resistant to superinfection.

[0010] Several studies have demonstrated long-term (>1.5 years) recombinant AAV-mediated protein expression in muscle. See Clark et al., Hum Gene Ther 8:659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA 93:14082-14087 (1996); and Xiao et al., J Virol 70:8098-8108 (1996). See also Chao et al., Mol Ther 2:619-623 (2000); and Chao et al., Mol Ther 4:217-222 (2001). Furthermore, because muscle is highly vascularized, recombinant AAV transduction has resulted in the appearance of the transgene product in the systemic circulation after intramuscular injection, as described by Herzog et al., Proc Natl Acad Sci USA 94:5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA 94:13921-13926 (1997). Furthermore, Lewis et al., J Virol 76:8769-8775 (2002) demonstrated that skeletal muscle fibers possess the cellular factors necessary for correct antibody glycosylation, folding, and secretion, demonstrating that muscle is capable of stable expression of secreted protein therapeutics.

[0011] To optimize the expression level of AAV-delivered micro-dystrophin constructs, micro-dystrophin coding sequences can be optimized for optimal expression in target cells, such as muscle cells.However, many conventional codon optimization processes inadvertently introduce CpG motifs into codon-optimized coding sequences.Methylated CpG motifs or CpG islands tend to suppress gene expression, while unmethylated CpG motifs tend to induce high immunogenicity to viral constructs. Summary of the Invention

[0012] One aspect of the invention provides a polynucleotide encoding microdystrophin of SEQ ID NO:2, comprising the nucleotide sequence of SEQ ID NO:1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto.

[0013] In certain embodiments, a polynucleotide is identical to SEQ ID NO:1 at each capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides.

[0014] In certain embodiments, the polynucleotide is substantially devoid of CpG islands (eg, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

[0015] In certain embodiments, the polynucleotide comprises, consists essentially of, or consists of a nucleotide sequence at least 95% identical to SEQ ID NO:1.

[0016] In certain embodiments, the polynucleotide comprises, consists essentially of, or consists of a nucleotide sequence at least 97% identical to SEQ ID NO:1.

[0017] In certain embodiments, the polynucleotide comprises, consists essentially of, or consists of a nucleotide sequence at least 99% identical to SEQ ID NO:1.

[0018] In certain embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO:1.

[0019] In certain embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO:1.

[0020] Another aspect of the invention provides an adeno-associated virus (AAV) vector genome comprising a polynucleotide of the invention, wherein the AAV vector genome is capable of being packaged within an AAV capsid.

[0021] Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) particle, the rAAV particle comprising an AAV capsid and an AAV vector genome comprising a polynucleotide of the invention, wherein the AAV vector genome is encapsidated within the AAV capsid.

[0022] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the polynucleotide is operably linked to a transcriptional regulatory element.

[0023] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the transcriptional regulatory element comprises a promoter.

[0024] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the promoter is a muscle-specific promoter.

[0025] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the muscle-specific promoter is a CK8 promoter, a cardiac troponin T (cTnT) promoter, a CK7 promoter, a CK9 promoter, a truncated MCK (tMCK), a myosin heavy chain (MHC) promoter, a hybrid alpha-myosin heavy chain enhancer / MCK enhancer-promoter (MHCK7), a muscle-specific creatine kinase (MCK) promoter, a human skeletal actin gene element, a cardiac actin gene element, a myocyte-specific enhancer-binding factor mef, a muscle creatine kinase (MCK), a truncated MCK (tMCK), a myosin heavy chain (MHC), C5-12, a mouse creatine kinase enhancer element, a skeletal fast-twitch troponin c gene element, a slow-twitch cardiac troponin c gene element, a slow-twitch troponin i gene element, a hypoxia-inducible nuclear factor, a steroid-inducible element, or a glucocorticoid responsive element (gre).

[0026] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the muscle-specific promoter is a CK8 promoter, optionally comprising the nucleotide sequence of SEQ ID NO: 3 or 4.

[0027] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the vector genome further comprises a polyadenylation signal sequence, e.g., the polyA signal sequence of SEQ ID NO:8.

[0028] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the polyadenylation signal sequence comprises the SV40 polyadenylation signal sequence (e.g., SEQ ID NO: 9), the bovine growth hormone (bGH) polyadenylation signal sequence (e.g., SEQ ID NO: 10), or the rabbit beta globin (rBG) polyadenylation signal sequence (e.g., SEQ ID NO: 11).

[0029] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the vector genome further comprises a 3'ITR sequence, e.g., an AAV2 3'ITR sequence.

[0030] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the vector genome further comprises a 5' ITR sequence, e.g., an AAV2 5' ITR sequence.

[0031] In certain embodiments, in an AAV vector genome or rAAV viral particle of the invention, the 5'ITR sequence and / or the 3'ITR sequence comprise or are SEQ ID NOs: 12 and 13, respectively.

[0032] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the vector genome further comprises intron and / or exon sequences that enhance expression of micro-dystrophin.

[0033] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the intron comprises SEQ ID NO:14.

[0034] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the vector genome further comprises a 5'UTR sequence and / or a 3'UTR sequence.

[0035] In certain embodiments, in the AAV vector genome or rAAV viral particle of the invention, the AAV vector genome or rAAV viral particle of the invention comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

[0036] In certain embodiments, the capsid of the viral particle is of a serotype: SLB-101, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, AAVhu32, or AAVhu37.

[0037] In certain embodiments, the capsid is of the SLB-101 or AAV9 serotype.

[0038] Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) viral particle comprising an SLB-101 or AAV9 capsid and a vector genome encapsidated therein, the vector genome comprising a polynucleotide sequence encoding MD5 micro-dystrophin of SEQ ID NO:2.

[0039] In certain embodiments, the polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO:1.

[0040] In certain embodiments, the polynucleotide sequence comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:1, and is identical to SEQ ID NO:1 in every capitalized nucleotide.

[0041] In certain embodiments, the vector genome comprises a muscle-specific control element operably linked to the polynucleotide sequence.

[0042] In certain embodiments, the muscle-specific control element comprises a CK8 promoter, such as the CK8 promoter of the nucleotide sequence of SEQ ID NO: 3 or 4.

[0043] In certain embodiments, the vector genome further comprises a polyadenylation signal sequence, such as a polyA signal sequence comprising SEQ ID NO:8.

[0044] In certain embodiments, the polyadenylation signal sequence comprises the SV40 polyadenylation signal sequence (SEQ ID NO:9), the bovine growth hormone (bGH) polyadenylation signal sequence (SEQ ID NO:10), or the rabbit beta globin (rBG) polyadenylation signal sequence (SEQ ID NO:11).

[0045] In certain embodiments, the vector genome further comprises a 3'ITR sequence, such as SEQ ID NO: 3'ITR, and a 5'ITR sequence, such as SEQ ID NO: 5'ITR.

[0046] In certain embodiments, the AAV viral particles of the invention comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

[0047] Another aspect of the invention provides a pharmaceutical composition comprising a polynucleotide of the invention, an rAAV vector genome or an rAAV viral particle of the invention, and a pharma- ceutically acceptable carrier.

[0048] In certain embodiments, the pharmaceutical composition is suitable or formulated for intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, or intrathecal administration.

[0049] Another aspect of the invention provides a method of treating muscular dystrophy in a human in need thereof, comprising administering to the human a therapeutically effective amount of a polynucleotide of the invention, an rAAV vector genome or rAAV viral particle of the invention, or a pharmaceutical composition of the invention.

[0050] In certain embodiments, the muscular dystrophy is characterized by loss of function mutations in the dystrophin gene.

[0051] In certain embodiments, the muscular dystrophy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy.

[0052] In certain embodiments, the rAAV viral particles are about 1×10 12 ~Approx. 1×10 16 vector genomes (vg) / kg, or approximately 1 × 10 13 ~Approx. 1×10 15 The dose is given at vector genome (vg) / kg.

[0053] Another aspect of the invention provides a host cell comprising a polynucleotide of the invention, or a rAAV vector genome or a rAAV viral particle of the invention.

[0054] In certain embodiments, the host cell is a HeLa cell, a Cos7 cell, a HEK293 cell, an A549 cell, a BHK cell, a Vero cell, an RD cell, a HT-1080 cell, an ARPE-19 cell, or an MRC-5 cell.

[0055] In certain embodiments, the host cell is a HeLa cell or a 293 / 293T cell.

[0056] It is to be understood that any one embodiment of the invention described herein can be combined with any one or more additional embodiments or aspects of the invention, including those embodiments that are described by example only or that are described in one of the sections above or below. [Brief description of the drawings]

[0057] [Figure 1]Figure 1 shows the output from the EMBOSS Cpgplot online tool for the native (non-codon optimized) human microdystrophin coding sequence encoding SEQ ID NO: 2. One CpG island was identified by the online tool. Parameters selected: window size = 100, min length = 100, min observed = 0.6, min percentage = 50. [Diagram 2] FIG. 1 shows the output of the EMBOSS Cpgplot online tool for the first codon-optimized human microdystrophin coding sequence encoding SEQ ID NO:2. Nine CpG islands were identified by the online tool. Codon optimization was performed using Gene Art. Parameters selected: window size=100, min length=100, min observed=0.6, min percentage=50. [Diagram 3] FIG. 1 shows the output from the EMBOSS Cpgplot online tool for SEQ ID NO: 1 resulting from removing 9 identified CpG islands in the first codon-optimized human micro-dystrophin coding sequence encoding SEQ ID NO: 2. No CpG islands were identified by the online tool. Parameters selected: window size=100, min length=100, min observed=0.6, min percentage=50. [Figure 4] FIG. 1 shows the output of the EMBOSS Cpgplot online tool for the second codon-optimized human microdystrophin coding sequence encoding SEQ ID NO:2. Four CpG islands were identified by the online tool. Codon optimization was performed using GenScript. Parameters selected: window size=100, min length=100, min observed=0.6, min percentage=50. [Diagram 5]FIG. 1 shows the output of the EMBOSS Cpgplot online tool for the third codon-optimized human microdystrophin coding sequence encoding SEQ ID NO:2. 11 CpG islands were identified by the online tool. Codon optimization was performed using DNA2.0. Parameters selected: window size=100, min length=100, min observed=0.6, min percentage=50. [Figure 6] Figure 2 shows the output of the EMBOSS Cpgplot online tool for the fourth codon-optimized human microdystrophin coding sequence encoding SEQ ID NO:2. Ten CpG islands were identified by the online tool. Codon optimization was performed using DNA2.0 using the first codon-optimized human microdystrophin coding sequence (codon optimized by Gene Art) as input. Parameters selected: window size = 100, min length = 100, min observed = 0.6, min percentage = 50. Thus, successive codon optimization rounds using different methods did not eliminate CpG islands. [Figure 7] FIG. 1 shows a schematic diagram of the TLR9 assay described in Example 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0058] 1. Overview The invention described herein provides CpG island reduced or substantially eliminated versions of certain codon-optimized micro-dystrophin coding sequences and their uses with minimal risk of eliciting unwanted host immunity and / or expression silencing.

[0059] The present invention is based, in part, on the discovery that certain codon-optimized sequences optimized for optimal expression in mammalian cells inadvertently introduce CpG motifs or CpG islands, and that such CpG motifs can be substantially reduced or eliminated to avoid eliciting undesirable host immune responses while substantially maintaining the enhanced expression that results from codon optimization.

[0060] CpG motifs contain a cytosine triphosphate deoxynucleotide ("C") followed by a guanine triphosphate deoxynucleotide ("G"). The "p" in between refers to a phosphodiester bond between the consecutive nucleotides. When these CpG motifs are methylated, they can suppress expression from the coding sequence that contains or is adjacent to the methylated CpG motif. On the other hand, when CpG motifs are unmethylated, they can act as immune stimulants that can induce undesirable host immune responses.

[0061] CpG motifs are considered pathogen-associated molecular patterns (PAMPs) because they are present in microbial genomes but rare in vertebrate genomes. CpG PAMPs are recognized by the pattern recognition receptor (PRR) Toll-like receptor 9 (TLR9), which is constitutively expressed only in B cells and plasmacytoid dendritic cells (pDCs) of humans and other higher primates. Binding and activation of TLR9 by unmethylated CpG motifs promotes CTL responses to AAV vectors in preclinical models. Polynucleotides containing unmethylated CpGs have been used as adjuvants in vaccine development to stimulate strong cellular immune responses. Meanwhile, many gene therapy trials using different codon modification strategies have resulted in a wide range of CpG content (0-5-fold higher than wild type) in the respective open reading frames (ORFs), and a strong correlation has been found between low CpG content and long-term expression.

[0062] A large number of sequences with variations in the number and position of CpG dimers, as well as precise base sequences adjacent to CpG dimers, have been shown to stimulate TLR 9. As a result, CpG motifs can be divided into approximately five classes or categories based on their sequence, secondary structure, and effect on human peripheral blood mononuclear cells (PBMCs).

[0063] For example, using synthetic oligodeoxynucleotides (ODNs), class A CpG motif containing ODNs have the following structural features: (1) the presence of poly-G sequences at the 5'-end, 3'-end, or both, (2) an internal palindrome, (3) GC dinucleotides contained within the internal palindrome, and (4) a partially PS-modified backbone. This class of ODNs stimulates the production of large amounts of type I interferons (the most important of which is IFNα) and induces the maturation of plasmacytoid dendritic cells. Class A ODNs are also potent activators of NK cells via indirect cytokine signaling.

[0064] In contrast, class B CpG motif containing ODNs have the following structural features: (1) one or more hexameric CpG motifs 5'-Pu Py CG Py Pu-3', (2) a fully phosphorothioated (PS-modified) backbone, and (3) a length of typically 18-28 nucleotides. Class B ODNs (i.e., ODNs 2007) are potent stimulators of human B cell and monocyte maturation. They also stimulate pDC maturation, but to a lesser extent than class A ODNs and very little IFNα.

[0065] There are software or online tools known to those skilled in the art to predict the presence of different classes of CpG motifs that may cause various immune responses in the host. For example, EMBOSS Cpgplot is an online tool at URL ebi.ac.uk / Tools / seqstats / emboss_cpgplot that requires an input nucleotide sequence. Exemplary parameters include a window size of about 100nt, a minimum length of about 200nt (which in some embodiments can be adjusted to, for example, 100), a minimum observed value of about 0.6, and a minimum percentage (%) of about 50. The return includes several results, including predicted CpG islands or lack thereof.

[0066] By inspecting the codon-optimized polynucleotide encoding micro-dystrophin of SEQ ID NO:2, a number of potential CpG motifs were identified and manually eliminated while maintaining the ability of the resulting sequence to encode SEQ ID NO:2.

[0067] One exemplary polynucleotide of the present invention contains a number of such nucleotide sequence changes as "capitalized nucleotides", as described in the following section. Such a collection of capitalized nucleotides constitutes a signature of nucleotide sequence changes in SEQ ID NO:1 to reduce the effect of any CpG motifs. Other polynucleotides of the present invention that contain the same signature changes can still encode SEQ ID NO:2 due to codon degeneracy, even though they differ from SEQ ID NO:1 in a number of other nucleotides, for example, by up to about 70% sequence identity.

[0068] Thus, in one aspect, the present invention provides a polynucleotide encoding micro-dystrophin of SEQ ID NO:2, comprising the nucleotide sequence of SEQ ID NO:1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto.

[0069] In certain embodiments, a polynucleotide of the invention is identical to SEQ ID NO:1 at every capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides.

[0070] In certain embodiments, polynucleotides of the invention are substantially devoid of CpG islands, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands. The presence or absence of CpG motifs or islands can be predicted based on the polynucleotide sequence using art-recognized software such as the EMBOSS Cpgplot online tool.

[0071] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 95% identical to SEQ ID NO:1.

[0072] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 97% identical to SEQ ID NO:1.

[0073] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 99% identical to SEQ ID NO:1.

[0074] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:1.

[0075] Another aspect of the invention provides an adeno-associated virus (AAV) vector genome comprising a polynucleotide of the invention, wherein the AAV vector genome is capable of being packaged within an AAV capsid.

[0076] Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) particle, the rAAV particle comprising an AAV capsid and an AAV vector genome comprising a polynucleotide of the invention, wherein the AAV vector genome is encapsidated within the AAV capsid.

[0077] In certain embodiments, the polynucleotide is operably linked to a transcriptional regulatory element. In certain embodiments, the transcriptional regulatory element comprises a promoter, e.g., a constitutive promoter or a muscle-specific promoter.

[0078] A number of muscle-specific promoters can be used to express the CpG-reduced, codon-optimized polynucleotides of the invention, including, but not limited to, CK8 promoter, cardiac troponin T (cTnT) promoter, CK7 promoter, CK9 promoter, truncated MCK (tMCK), myosin heavy chain (MHC) promoter, hybrid alpha-myosin heavy chain enhancer / MCK enhancer-promoter (MHCK7), muscle-specific creatine kinase (MCK) promoter, human skeletal actin gene element, cardiac actin gene element, myocyte-specific enhancer-binding factor mef, muscle creatine kinase (MCK), truncated MCK (tMCK), myosin heavy chain (MHC), C5-12, mouse creatine kinase enhancer element, skeletal fast-twitch troponin c gene element, slow-twitch cardiac troponin c gene element, slow-twitch troponin i gene element, hypoxia-inducible nuclear factor, steroid-inducible element, or glucocorticoid response element (gre).

[0079] In certain embodiments, the muscle-specific promoter is the CK8 promoter.

[0080] In certain embodiments, the CK8 promoter comprises the nucleotide sequence of SEQ ID NO:3.

[0081] In certain embodiments, the CK8 promoter is a modified CK8 promoter that comprises additional enhancer elements.In certain embodiments, the modified CK8 promoter comprises SEQ ID NO:6 (basal CK8 promoter, 269bp fragment of the CK8 promoter of SEQ ID NO:3) and one additional copy of 130bp enhancer (SEQ ID NO:5) at the 5' end.In certain embodiments, the modified CK8 promoter is a CK8e promoter that comprises the nucleotide sequence of SEQ ID NO:4.

[0082] In certain embodiments, the vector genome further comprises a polyadenylation signal sequence.

[0083] In certain embodiments, the polyA signal sequence comprises SEQ ID NO:8.

[0084] In certain embodiments, the polyA signal sequence comprises the SV40 polyadenylation signal sequence (eg, SEQ ID NO:9).

[0085] In certain embodiments, the polyA signal sequence comprises the bovine growth hormone (bGH) polyadenylation signal sequence (eg, SEQ ID NO:10).

[0086] In certain embodiments, the polyA signal sequence comprises the rabbit beta globin (rBG) polyadenylation signal sequence (eg, SEQ ID NO:11).

[0087] In certain embodiments, the vector genome further comprises a 3' ITR sequence, which can be from any AAV, such as the AAV2 3' ITR sequence.

[0088] In certain embodiments, the vector genome further comprises a 5' ITR sequence, which can be from any AAV, such as the AAV2 5' ITR sequence.

[0089] In certain embodiments, the vector genome further comprises 5' and 3' ITR sequences. The ITR sequences can be from any AAV, such as AAV2 5' and 3' ITR sequences.

[0090] Inverted terminal repeat (ITR) sequences are important for the initiation of viral DNA replication and circularization of the adeno-associated virus genome. Within the ITR sequences, secondary structures (e.g., stems and loops formed by palindromic sequences) are one or more ITR functions that are important in viral replication and / or packaging. Such sequence elements include the RBE sequence (Rep binding element), the RBE' sequence, and the TRS (terminal resolution sequence).

[0091] In certain embodiments, the 5' and / or 3' ITR sequences are wild-type sequences.

[0092] In certain embodiments, the 5' and / or 3' ITR sequences are modified ITR sequences. For example, the most 5' or most 3' end of the wild-type ITR sequence may be deleted. The deletion may be up to 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide.

[0093] In certain embodiments, up to 15 (e.g., exactly 15) nucleotides of the 5'-most nucleotide and / or up to 15 (e.g., exactly 15) nucleotides of the 3'-most nucleotide of the wild-type AAV2 ITR sequence may be deleted.

[0094] Thus, the 5' and / or 3' modified ITR(s) can include up to 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, or 127 nt (such as 130 nucleotides) of the 145 nt wild-type AAV ITR sequence.

[0095] In certain embodiments, the modified ITR sequence comprises the RBE sequence, the RBE' sequence, and / or the TRS of the wt ITR sequence.

[0096] In certain embodiments, the modified ITR sequence includes both an RBE sequence and an RBE' sequence.

[0097] In certain embodiments, the modified ITR sequences confer stability of the plasmids of the invention, including the AAV vector genome (see below), in bacteria, such as stability during plasmid production.

[0098] In certain embodiments, the modified ITRs do not prevent sequencing verification of the plasmids of the invention containing the AAV vector genome.

[0099] In certain embodiments, the modified 5'ITR sequence comprises a 5' heterologous sequence that is not part of the wild-type AAV 5'ITR sequence. In certain embodiments, the modified 3'ITR sequence comprises a 3' heterologous sequence that is not part of the wild-type AAV 3'ITR sequence.

[0100] In certain embodiments, the modified 5' ITR sequence comprises a 5' heterologous sequence that is not part of the wild-type AAV (e.g., wt AAV2) 5' ITR sequence, and the modified 3' ITR sequence comprises a 3' heterologous sequence that is not part of the wild-type AAV (e.g., wt AAV2) 3' ITR sequence, and the 5' heterologous sequence and the 3' heterologous sequence are complementary to each other.

[0101] In certain embodiments, the 5' heterologous sequence and the 3' heterologous sequence each comprise a type II restriction endonuclease recognition sequence, such as the recognition sequence for Sse8387I (CCTGCAGG), or the recognition sequence for PacI (TTAATTAA).

[0102] In certain embodiments, the 5' heterologous sequence comprises, consists essentially of, or consists of CCTGCAGGCAG (SEQ ID NO:19) and the 3' heterologous sequence comprises, consists essentially of, or consists of the reverse complement of SEQ ID NO:19.

[0103] In certain embodiments, the 5' heterologous sequence comprises, consists essentially of, or consists of TTAATTAAGG (SEQ ID NO:22) and the 3' heterologous sequence comprises, consists essentially of, or consists of the reverse complement of SEQ ID NO:22.

[0104] In certain embodiments, the 5'ITR and the 3'ITR are both flipped ITRs.

[0105] In certain embodiments, the 5'ITR and the 3'ITR are both flop ITRs.

[0106] In certain embodiments, the 5'ITR and the 3'ITR are independently flip or flop ITRs.

[0107] In certain embodiments, the 5' ITR is a flip ITR and the 3' ITR is a flop ITR.

[0108] In certain embodiments, the 5' ITR is a flop ITR and the 3' ITR is a flip ITR.

[0109] In certain embodiments, the 5' ITR is a flipped ITR and the 3' ITR is a flipped ITR.

[0110] In certain embodiments, the 5' ITR is a flop ITR and the 3' ITR is a flop ITR.

[0111] As used herein, a 5' flip ITR is one in which the B:B' segment is closer to the 5' end than the C:C' segment. A 3' flip ITR is one in which the B:B' segment is closer to the 3' end than the C:C' segment. A 5' flop ITR is one in which the C:C' segment is closer to the 5' end than the B:B' segment. A 3' flop ITR is one in which the C:C' segment is closer to the 3' end than the B:B' segment.

[0112] In certain embodiments, the modified 5' ITR and the modified 3' ITR are both flop ITRs, the modified 5' ITR comprises a 5' heterologous sequence that is not part of the wild-type AAV2 5' ITR sequence (such as SEQ ID NO: 19 or 22), the modified 3' ITR sequence comprises a 3' heterologous sequence that is not part of the wild-type AAV2 3' ITR sequence, the 5' heterologous sequence and the 3' heterologous sequence are complementary to each other and each comprises a type II restriction endonuclease recognition sequence, such as the recognition sequence for Sse8387I or PacI, and optionally the modified 5' ITR sequence further comprises a deletion in the C:C' segment, such as the 11 nt deletion AAAGCCCGGGC (SEQ ID NO: 23).

[0113] In certain embodiments, the 5'ITR comprises, consists essentially of, or consists of SEQ ID NO:12. CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 12)

[0114] In certain embodiments, the 5'ITR comprises, consists essentially of, or consists of SEQ ID NO:24. CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 24)

[0115] In certain embodiments, the 5'ITR comprises, consists essentially of, or consists of SEQ ID NO:25. CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 25)

[0116] In certain embodiments, the 5'ITR comprises, consists essentially of, or consists of SEQ ID NO:26. TTAATTAAGGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 26)

[0117] In certain embodiments, the 3'ITR comprises, consists essentially of, or consists of SEQ ID NO:13. AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 13)

[0118] In certain embodiments, the 3'ITR comprises, consists essentially of, or consists of SEQ ID NO:27. AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG (SEQ ID NO: 27)

[0119] In certain embodiments, the 3'ITR comprises, consists essentially of, or consists of SEQ ID NO:28. AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCCTTAATTAA (SEQ ID NO: 28)

[0120] In certain embodiments, the 5'ITR sequence is or comprises SEQ ID NO:12 and the 3'ITR sequence is or comprises SEQ ID NO:13.

[0121] In certain embodiments, the 5'ITR sequence is or comprises SEQ ID NO:24 and the 3'ITR sequence is or comprises SEQ ID NO:27.

[0122] In certain embodiments, the 5'ITR comprises up to 141 nt of the 3'-most nucleotides of the 145 nt wt AAV2 5'ITR (e.g., a deletion of 4 or more of the 5'-most end of the 145 nt wt AAV2 5'ITR).

[0123] In certain embodiments, the 5'ITR comprises up to 130 nt of the 3'-most nucleotides of the 145 nt wt AAV2 5'ITR (eg, a deletion of 15 or more of the 5'-most nucleotides of the 145 nt wt AAV2 5'ITR).

[0124] In certain embodiments, the 3'ITR comprises up to 141 nt of the 5'-most nucleotides of the 145 nt wt AAV2 3'ITR (eg, a deletion of 4 or more of the 3'-most nucleotides of the 145 nt wt AAV2 3'ITR).

[0125] In certain embodiments, the 3'ITR comprises up to 130 nt of the 5'-most nucleotides of the 145 nt wt AAV2 3'ITR (eg, a deletion of 15 or more of the 3'-most nucleotides of the 145 nt wt AAV2 3'ITR).

[0126] In certain embodiments, the 5' and 3' ITR sequences are compatible with AAV production in mammalian cells based on triple transfection.

[0127] In certain embodiments, the 5' and 3' ITR sequences are compatible with AAV production in insect cells (eg, Sf9) based on baculovirus vectors (see below).

[0128] In certain embodiments, the 5' and 3' ITR sequences are compatible with AAV production in mammalian cells based on HSV vectors (see below).

[0129] In certain embodiments, the vector genome further comprises intron and / or exon sequences that enhance expression of micro-dystrophin, hi certain embodiments, the intron / exon increases expression of micro-dystrophin by up to 2-10 fold.

[0130] In certain embodiments, the intron comprises the sequence of a β-globin splice donor / IgG splice acceptor chimeric intron (see, for example, the chimeric intron in the Promega pCMVTnT vector (catalog no. L5620)).

[0131] In certain embodiments, the intron comprises SEQ ID NO:14. gtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 14)

[0132] In certain embodiments, the promoter is the CK8e promoter (below), which contains 48 bp (SEQ ID NO: 7) or 50 bp (SEQ ID NO: 8) of MCK UTR exon sequence that enhances expression.

[0133] In certain embodiments, the vector genome does not contain intron and / or exon sequences that potentially enhance expression of micro-dystrophin. Eliminating intron / exon sequences may improve packaging efficiency and increase packaging capacity of other sequence elements.

[0134] In certain embodiments, the vector genome further comprises 5'UTR and / or 3'UTR sequences.

[0135] In certain embodiments, the AAV vector genome or rAAV viral particle of the invention comprises, from 5' to 3', the following sequence elements: (1) a 5' ITR (such as a wild-type or modified AAV2 5' ITR, e.g., a 145 nt wild-type AAV2 5' ITR, or a 141 nt modified AAV2 5' ITR). (2) a muscle-specific promoter (such as a CK8 promoter (e.g., SEQ ID NO: 3) or a modified CK8 protein such as CK8e described herein (SEQ ID NO: 4)), (3) any one of the CpG-reduced / eliminated codon-optimized polynucleotides of the invention (such as SEQ ID NO: 1 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto), (4) a polyA signal sequence (such as any one of SEQ ID NOs: 8-11), and (5) a 3'ITR (such as a wild-type or modified AAV2 3'ITR, e.g., a 145 nt wild-type AAV2 3'ITR or a 141 nt modified AAV2 3'ITR). 3'ITR (such as SEQ ID NO: 13), or a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical to the AAV vector genome. Optionally, immediately prior to (3) is a KOZAK sequence containing ACC immediately 5' to the ATG start codon.

[0136] In certain embodiments, an AAV vector genome or rAAV viral particle of the invention comprises, consists essentially of, or consists of, from 5' to 3', the following sequence elements: (1) a 5' ITR (such as SEQ ID NO: 12), (2) a CK8 promoter (e.g., SEQ ID NO: 3), (3) any one of the CpG-reduced / eliminated codon-optimized polynucleotides of the invention (such as SEQ ID NO: 1), (4) a polyA signal sequence (such as SEQ ID NO: 8), and (5) a 3' ITR (such as SEQ ID NO: 13), or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical to an AAV vector genome. Optionally, immediately preceding (3) is a KOZAK sequence including ACC immediately 5' to the ATG start codon.

[0137] In certain embodiments, an AAV vector genome or rAAV viral particle of the invention comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

[0138] In certain embodiments, the rAAV viral particles of the invention comprise a capsid of a serotype of SLB-101, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, AAVhu32, or AAVhu37.

[0139] In certain embodiments, the serotype is SLB-101 (e.g., the VP1 capsid sequence is SEQ ID NO:21) or AAV9 (e.g., the VP1 capsid sequence is SEQ ID NO:20).

[0140] Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) viral particle comprising an SLB-101 or AAV9 capsid and a vector genome encapsidated therein, the vector genome comprising a polynucleotide sequence encoding MD5 micro-dystrophin of SEQ ID NO:2.

[0141] In certain embodiments, the polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO:1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto.

[0142] In certain embodiments, the polynucleotide sequence comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:1, is identical to SEQ ID NO:1 at every capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides.

[0143] In certain embodiments, the polynucleotide sequence is substantially devoid of CpG islands (eg, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands).

[0144] In certain embodiments, the vector genome comprises a muscle-specific control element operably linked to the polynucleotide sequence.

[0145] In certain embodiments, the muscle-specific control element comprises a CK8 promoter, such as the CK8 promoter of the nucleotide sequence of SEQ ID NO: 3 or 4.

[0146] In certain embodiments, the vector genome further comprises a polyadenylation signal sequence, such as any one of SEQ ID NOs:8-11.

[0147] In certain embodiments, the vector genome further comprises a 3' ITR sequence, such as SEQ ID NO:13, and a 5' ITR sequence, such as SEQ ID NO:12.

[0148] Another aspect of the invention provides a pharmaceutical composition comprising a polynucleotide of the invention, an rAAV vector genome or an rAAV viral particle of the invention, and a pharma- ceutically acceptable carrier.

[0149] In certain embodiments, the pharmaceutical composition is suitable or formulated for intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, or intrathecal administration.

[0150] Another aspect of the invention provides a method of treating muscular dystrophy in a human in need thereof, comprising administering to the human a therapeutically effective amount of a polynucleotide of the invention, an rAAV vector genome or rAAV viral particle of the invention, or a pharmaceutical composition of the invention.

[0151] In certain embodiments, the muscular dystrophy is characterized by loss of function mutations in the dystrophin gene.

[0152] In certain embodiments, the muscular dystrophy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy.

[0153] In certain embodiments, the rAAV viral particles are about 1×10 12 ~Approx. 1×10 16 vector genomes (vg) / kg, or approximately 1 × 10 13 ~Approx. 1×10 15 The dose is given at vector genome (vg) / kg.

[0154] Another aspect of the invention provides a host cell comprising a polynucleotide of the invention, or a rAAV vector genome or a rAAV viral particle of the invention.

[0155] In certain embodiments, the host cell is a HeLa cell, a Cos7 cell, a HEK293 cell, an A549 cell, a BHK cell, a Vero cell, an RD cell, a HT-1080 cell, an ARPE-19 cell, or an MRC-5 cell.

[0156] In certain embodiments, the host cell is a HeLa cell or a 293 / 293T cell.

[0157] Having generally described the present invention above, the following sections provide more detailed descriptions of certain aspects of the invention. Thus, any one embodiment described herein, including those described only in the examples or claims, can be combined with any one or more additional embodiments of the present invention, unless expressly disclaimed or inappropriate.

[0158] 2. CpG-condon-optimized polynucleotide encoding micro-dystrophin AAV vector genome In one aspect, the invention described herein provides a codon-optimized polynucleotide sequence, such as SEQ ID NO: 1, that encodes the micro-dystrophin protein of SEQ ID NO: 2 and has a reduced number of CpG sites / islands or substantially eliminates CpG islands. The polynucleotide sequence of SEQ ID NO: 1 and the protein sequence of SEQ ID NO: 2 are provided below.

[0159] As used herein, a "codon-optimized" polynucleotide coding sequence refers to a polynucleotide sequence that has been altered / changed in some respect such that the resulting codons are optimal for expression in a particular cell, host, or system, e.g., a particular mammalian (human) cell type, e.g., muscle cells. Codon optimization does not change the amino acid sequence of the encoded protein, i.e., the codon-optimized polynucleotide coding sequence; the native sequence for which the codon optimization has been performed still encodes the same amino acid sequence.

[0160] The polynucleotides of the present invention, such as SEQ ID NO:1, encode a micro-dystrophin protein known as "micro-D5", "MD5", or "μD5" (see SEQ ID NO:2). Micro-dystrophin proteins stabilize muscle membranes during muscle contraction. For example, micro-dystrophin functions as a shock absorber during muscle contraction. MD5 is a specifically engineered 5-repeat micro-dystrophin protein that contains, from N-terminus to C-terminus, an N-terminal actin-binding domain, hinge region 1 (H1), spectrin-like repeats R1, R16, R17, R23, and R24, hinge region 4 (H4), and a C-terminal dystroglycan-binding domain of human full-length dystrophin protein. The protein sequences of this 5-repeat micro-dystrophin and related dystrophin minigenes are described in US10,479,821 and WO2016 / 115543 (incorporated herein by reference).

[0161] In SEQ ID NO:1 shown above, certain nucleotides are marked as uppercase letters, and these nucleotides are collectively referred to herein as "uppercase nucleotides of SEQ ID NO:1." Specifically, the uppercase nucleotides of SEQ ID NO:1 are nucleotides 264, 273, 282, 291, 297, 303, 543, 555, 558, 627, 1110, 1113, 1122, 1656, 1665, 1678, 1681, 1722, 1815, 1830, 1833, 1989, 2031, 2052, 2061, 2053, 2052, 2051, 2052, 2053, 2054, 2055, 2056, 2058, 2061, 2062, 2063, 2064, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2072, 2073, 2074, 2075, 2076, 2077, 2078, 2079, 2080, 2081, 2082, 2083, 2084, 2085, 2086, 2087, 2088, 2089, 2090, 2091, 2092, 2093, 2094, 2095, 2096, 2100, 2101, 2102, 2103, 2104, 210 55, 2079, 2097, 2115, 2157, 2181, 2290, 2316, 2343, 2346, 2356, 2364, 2367, 2406, 2532, 2550, 2559, 2844, 2881, 2889, 2896, 3081, 3099, 3339, 3354, 3363, 3384, 3405, and 3735.

[0162] In certain embodiments, the polynucleotides of the invention not only encode the same protein (i.e., SEQ ID NO:2), but also share the same set of uppercase nucleotides of SEQ ID NO:1, but they differ from SEQ ID NO:1 at nucleotide positions other than the uppercase nucleotides of SEQ ID NO:1.

[0163] In certain embodiments, polynucleotides of the invention are substantially identical to SEQ ID NO:1, not just encoding the same protein (i.e., SEQ ID NO:2) at the capitalized nucleotides of SEQ ID NO:1, albeit with additional sequence changes (e.g., resulting in 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% overall sequence identity) at positions of SEQ ID NO:1 other than the capitalized nucleotides. In certain embodiments, polynucleotides of the invention are identical to SEQ ID NO:1 at each capitalized nucleotide or differ by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides.

[0164] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 95% identical to SEQ ID NO: 1. That is, a polynucleotide of the invention encodes a micro-dystrophin of SEQ ID NO: 2, and further, a polynucleotide of the invention (1) is identical to SEQ ID NO: 1 at every capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides, and / or (2) is substantially devoid of CpG islands (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

[0165] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 97% identical to SEQ ID NO: 1. That is, a polynucleotide of the invention encodes a micro-dystrophin of SEQ ID NO: 2, and further, a polynucleotide of the invention (1) is identical to SEQ ID NO: 1 at every capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides, and / or (2) is substantially devoid of CpG islands (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

[0166] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of a nucleotide sequence at least 99% identical to SEQ ID NO: 1. That is, a polynucleotide of the invention encodes a micro-dystrophin of SEQ ID NO: 2, and further, a polynucleotide of the invention (1) is identical to SEQ ID NO: 1 at every capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides, and / or (2) is substantially devoid of CpG islands (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

[0167] The sequence percentage identity between any two or more related or unrelated polynucleotides or between any two or more related or unrelated protein sequences can be aligned and the percentage of matches between nucleotides or amino acid residues, respectively, can be calculated using any art-recognized method, such as the NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990), which is available from online sources such as the National Center for Biological Information (NCBI) website for use in conjunction with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx, depending on the type of query and database. Similar web-based tools can be found on the EMBL-EBI website.

[0168] In certain embodiments, a polynucleotide of the invention is substantially devoid of CpG islands (eg, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

[0169] In certain embodiments, the polynucleotides of the invention are substantially unable to induce activation of TLR9, such as in the in vitro assay described in Example 2.

[0170] In certain embodiments, a polynucleotide of the invention comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:1.

[0171] Another aspect of the invention provides an adeno-associated virus (AAV) vector genome comprising any of the polynucleotides of the invention, wherein the AAV vector genome is capable of being packaged within an AAV capsid.

[0172] The packaging capacity of a typical AAV is generally about 4.7 kb, including approximately 0.2-0.3 kb of 5' and 3' ITR sequences, at least one of which (and likely both) are structural elements required for packaging the AAV vector genome into a capsid.

[0173] In certain embodiments, the AAV vector genome comprises certain ITR structural elements, such as a Rep binding element (RBE), an internal hairpin within the TR (RBE'), and a terminal resolution site (TRS).

[0174] Another aspect of the invention provides a recombinant adeno-associated virus (rAAV) particle, the rAAV particle comprising an AAV capsid and an AAV vector genome comprising any of the polynucleotides of the invention, wherein the AAV vector genome is encapsidated within the AAV capsid.

[0175] In certain embodiments, the (CpG codon-optimized) polynucleotide is operably linked to a transcriptional regulatory element. In certain embodiments, the transcriptional regulatory element comprises a promoter, such as a constitutive promoter, or a tissue-specific promoter (e.g., a muscle-specific promoter) (below). An exemplary promoter is CK8 or its mutant (below).

[0176] In certain embodiments, the vector genome further comprises a polyadenylation signal sequence, for example a polyA signal sequence, such as any one of SEQ ID NOs: 8-11 (below).

[0177] In certain embodiments, the vector genome further comprises a 3'ITR sequence, e.g., the AAV2 3'ITR sequence. In certain embodiments, the vector genome further comprises a 5'ITR sequence, e.g., the AAV2 5'ITR sequence. In certain embodiments, the 5'ITR sequence and / or the 3'ITR sequence comprise or are SEQ ID NOs: 12 and 13, respectively.

[0178] In certain embodiments, the vector genome further comprises intron and / or exon sequences that enhance expression of micro-dystrophin, hi certain embodiments, the vector genome does not comprise intron and / or exon sequences that would otherwise enhance expression of micro-dystrophin.

[0179] In certain embodiments, the vector genome further comprises 5'UTR and / or 3'UTR sequences.

[0180] In certain embodiments, the AAV vector genome or rAAV viral particle of the invention comprises, from 5' to 3', the following sequence elements: (1) a 5' ITR (such as a wild-type or modified AAV2 5' ITR, e.g., a 145 nt wild-type AAV2 5' ITR, or a 141 nt modified AAV2 5' ITR). 5'ITR), (2) a muscle-specific promoter (such as a CK8 promoter or a modified CK8 protein such as CK8e described herein), (3) any one of the CpG-reduced / eliminated codon optimized polynucleotides of the invention (such as SEQ ID NO:1 or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto), (4) a polyA signal sequence (such as any one of SEQ ID NOs:8-11), and (5) a 3'ITR (such as a wild-type or modified AAV2 3'ITR, e.g., a 145 nt wild-type AAV2 3'ITR, or a 141 nt modified AAV2 3'ITR).

[0181] In certain embodiments, an AAV vector genome or rAAV viral particle of the invention comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

[0182] 3. Promoter In certain embodiments, the codon-optimized micro-dystrophin coding sequence is operably linked to a transcriptional regulatory element comprising a promoter capable of driving the transcription of the micro-dystrophin coding sequence of the present invention. The transcriptional regulatory element may further comprise one or more introns or exons that enhance expression of the micro-dystrophin encoded by the CpG-reduced polynucleotide of the present invention.

[0183] In certain embodiments, the transcriptional regulatory element comprises a constitutive promoter, such as a CMV promoter, a CAG promoter, an EF-1α promoter, a CB promoter, or a derivative thereof.

[0184] In certain embodiments, the transcriptional regulatory element comprises a muscle-specific control element.

[0185] For example, the muscle-specific control element can be a CK8 promoter, a cardiac troponin T (cTnT) promoter, a CK7 promoter, a CK9 promoter, a truncated MCK (tMCK), a myosin heavy chain (MHC) promoter, a hybrid alpha-myosin heavy chain enhancer / MCK enhancer-promoter (MHCK7), a muscle-specific creatine kinase (MCK) promoter, a human skeletal actin gene element, a cardiac actin gene element, a myocyte-specific enhancer-binding factor mef, a muscle creatine kinase (MCK), a truncated MCK (tMCK), a myosin heavy chain (MHC), C5-12, a mouse creatine kinase enhancer element, a skeletal fast-twitch troponin c gene element, a slow-twitch cardiac troponin c gene element, a slow-twitch troponin i gene element, a hypoxia-inducible nuclear factor, a steroid-inducible element, or a glucocorticoid response element (gre).

[0186] In certain embodiments, the muscle-specific regulatory element is 5' of a heterologous intron sequence (which enhances microdystrophin expression) that is 5' of the microdystrophin coding sequence of the invention, which is 5' of the optional 3'-UTR region that includes a translation stop codon (such as TAG), a polyA adenylation signal (such as AATAAA), and an mRNA cleavage site (such as CA).

[0187] In certain embodiments, the muscle-specific control element includes a CK8 promoter, such as one having the following sequence: TAGACTAGCATGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGCATGCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGC CATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCA (CK8 promoter, SEQ ID NO: 3)

[0188] In certain embodiments, the CK8 promoter may include an additional C at the 5' end and / or an additional dinucleotide GC at the 3' end. The CK8 promoter includes a 5' end 130 bp enhancer element followed by 269 bp of the basal CK8 promoter followed by 48 bp or 50 bp of MCK exon 1 UTR sequence at the most 3' end of the CK8 promoter. The 5' end 130 bp enhancer element can be duplicated (e.g., have two tandem copies compared to one copy in CK8) for further enhancer transcription.

[0189] Thus, in certain embodiments, the CK8 promoter is modified as the CK8e promoter (SEQ ID NO: 4) containing two copies of the 130 bp enhancer of SEQ ID NO: 5, a 269 bp fragment of the basal CK8 promoter of SEQ ID NO: 3 (SEQ ID NO: 6), and 48 bp or 50 bp of the MCK exon 1 UTR region sequence (SEQ ID NO: 7 or 16). TAGACTAGCATGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGCATGTAGACTAGCATGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGCATGCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCA(SEQ ID NO:4) tagactagcatgctgcccatgtaaggaggcaaggcctggggacacccgagatgcctggttataattaacccagacatgtggctgcccccccccccccaacacctgctgcctctaaaaataaccctgcatg(SEQ ID NO:5, 130bp enhancer) ccatgttcccggcgaagggccagctgtcccccgccagctagactcagcacttagtttaggaaccagtgagcaagtcagcccttggggcagcccatacaaggccatggggctgggcaagctgcacgcctgggtccggggtgggcacgg tgcccgggcaacgagctgaaagctcatctgctctcaggggcccctccctggggacagcccctcctggctagtcacaccctgtaggctcctctatataacccaggggcacaggggctgccctc (SEQ ID NO: 6, 269bp basal CK8 promoter) attctaccaccacctccacagcacagacagacactcaggagccagcca (MCK exon 1 of UTR 48 bp, SEQ ID NO: 7). attctaccaccacctccacagcacagacagacactcaggagccagccagc (MCK exon 1 of UTR 50 bp, SEQ ID NO: 16)

[0190] In certain embodiments, the muscle-specific control element comprises the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 of WO2017 / 181015.

[0191] SEQ ID NO: 10 of WO2017 / 181015 (SEQ ID NO: 17): [ka]

[0192] SEQ ID NO:11 of WO2017 / 181015 (SEQ ID NO:18): [ka]

[0193] In certain embodiments, the rAAV vectors of the invention can be operably linked to a muscle-specific control element comprising the nucleotide sequence of an MCK enhancer (see SEQ ID NO: 10 of WO2017 / 181015, which is incorporated herein by reference) and / or an MCK promoter sequence (see SEQ ID NO: 11 of WO2017 / 181015, which is incorporated herein by reference).

[0194] 4. PolyA signal sequences, introns, exons, and UTRs In certain embodiments, the rAAV further comprises a polyadenylation (polyA) signal sequence for inserting a polyA sequence into the transcribed mRNA.

[0195] In one particular embodiment, the poly A signal sequence is SEQ ID NO:8, with the AATAAA sequence in upper case and double underlined. [ka]

[0196] In one particular embodiment, the polyA sequence is the 197 bp SV40 polyA signal sequence. [ka]

[0197] In one particular embodiment, the polyA sequence is the 230 bp bGH polyA signal sequence. [ka]

[0198] In one particular embodiment, the polyA sequence is the 127 bp rBG polyA signal sequence. [ka]

[0199] 5. AAV and Capsid As used herein, the term "AAV" is the standard abbreviation for adeno-associated virus, a single-stranded DNA parvovirus that grows only in cells in which certain functions are provided by a coinfecting helper virus.

[0200] Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the ITRs. Three AAV promoters (designated p5, p19, and p40 from their relative map positions) drive expression of two AAV internal open reading frames encoding the rep and cap genes.

[0201] These two rep promoters (p5 and p19), along with alternative splicing of a single AAV intron (e.g., at AAV2 nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins have multiple enzymatic properties that are ultimately involved in the replication of the viral genome.

[0202] The cap gene is expressed from the p40 promoter and encodes three in-frame translated capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-consensus translation start sites are involved in the production of three related capsid proteins.

[0203] A single consensus polyadenylation site is located in the AAV genome at map position 95. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology 158:97-129 (1992).

[0204] There are at least 13 serotypes of AAV that have been characterized. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York) (incorporated herein by reference). However, it is well known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level, so it is fully expected that these same principles will be applied to additional AAV serotypes. See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, JR Pattison, ed., and Rose, Comprehensive Virology 3:1-61 (1974). For example, all AAV serotypes clearly display very similar replication properties mediated by homologous rep genes, and all have the three related capsid proteins as expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis revealing extensive cross-hybridization between serotypes along the length of the genome, and the presence of similar self-annealing segments at the ends corresponding to the "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions of each serotype are under similar regulatory control.

[0205] "AAV vector" or "(AAV) vector genome," as used interchangeably herein, refers to a vector that contains one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged into infectious AAV viral particles when present in a host cell transfected with a vector encoding and expressing the rep and cap gene products.

[0206] A recombinant AAV vector genome of the invention comprises a nucleic acid molecule of the invention and one or more AAV ITRs flanking the nucleic acid molecule of the invention.

[0207] "AAV virion" or "AAV virus particle" or "recombinant AAV (rAAV) virus particle" refers to a virus particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. When the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as the subject CpG-reduced codon-optimized micro-dystrophin coding sequence for delivery to mammalian (muscle) cells), it is typically referred to as an "AAV vector / virus particle". Thus, since such vectors are contained within the AAV virus particle, the production of the AAV virus particle necessarily includes the production of the AAV vector.

[0208] There are several serotypes of AAV, and the nucleotide sequence of the genome of the serotype of AAV is known.For example, the nucleotide sequence of the genome of AAV serotype 2 (AAV2) is shown in Srivastava et al., J Virol 45:555-564 (1983), and revised by Ruffing et al., J Gen Virol 75:3385-3392 (1994).Both are incorporated herein by reference. As other examples, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077 (incorporated herein by reference), the complete genome of AAV-3 is provided in GenBank Accession No. NC_001829 (incorporated herein by reference), the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829 (incorporated herein by reference), the genome of AAV-5 is provided in GenBank Accession No. AF085716 (incorporated herein by reference), and the complete genome of AAV-6 is provided in GenBank Accession No. AF085716 (incorporated herein by reference). The entire genome of AAV-6 is provided in GenBank Accession No. NC_001862, which is incorporated herein by reference; at least portions of the genomes of AAV-7 and AAV-8 are provided in GenBank Accession Nos. AX753246, which is incorporated herein by reference, and AX753249, which is incorporated herein by reference, respectively (see also U.S. Pat. Nos. 7,282,199 and 7,790,449 regarding AAV-8); and the genome of AAV-9 is provided in GenBank Accession No. NC_001862, which is incorporated herein by reference; The genome of AAV-10 is provided in Mol. Ther. 13(1):67-76 (2006), which is incorporated herein by reference, and the genome of AAV-11 is provided in Virology 330(2):375-383 (2004), which is incorporated herein by reference. The AAVrh74 serotype is described in Rodino-Klapac et al., J. Trans. Med. 5:45 (2007), which is incorporated herein by reference.

[0209] The AAV DNA in the rAAV genome can be from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, AAVrh74, AAVrh32, AAVrh34, and AAV-2i8.

[0210] In certain embodiments, AAV1, AAV6, AAV8, or AAVrh.74 may be used to promote skeletal muscle-specific expression.

[0211] In certain embodiments, the AAV has an AAV9 serotype, or the capsid has the polypeptide of SEQ ID NO:20 (AAV9 VP1). (SEQ ID NO:20)

[0212] Pseudotyped rAAV and the production thereof are also suitable for the present invention and are disclosed, for example, in WO 01 / 83692, which is incorporated herein by reference in its entirety.

[0213] Other types of rAAV variants are also contemplated, such as rAAVs with capsid mutations.See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014).The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0214] In certain embodiments, the capsid is an SLB-101 capsid and the VP1 capsid has the sequence of SEQ ID NO:21. (SEQ ID NO:21)

[0215] 6. Production of rAAV and Host Cells rAAV viral particles and vector genomes containing the subject CpG-depleted, codon-optimized micro-dystrophin coding sequences can be produced by any standard rAAV production method, typically using a producer cell line.

[0216] The general principles of rAAV production have been reviewed, for example, in Carter, Current Opinions in Biotechnology 1533-1539, 1992 and Muzyczka, Curr. Topics in Microbial. and Immunol. 158:97-129, 1992. Various approaches have been described in Ratschin et al., Mol. Cell. Biol. 4:2072, 1984; Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466, 1984; Tratschin et al., Mol. Cell. Biol. 5:3251, 1985; McLaughlin et al., J. Virol. 62:1963, 1988; and Lebkowski et al., Mol. Cell. Biol. 7:349, 1988; Samulski et al., Mol. Cell. Biol. 7:349, 1988. al., J. Virol. 63: 3822-3828, 1989, U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al., Vaccine 13: 1244-1250, 1995, Paul et al., Human Gene Therapy 4:609-615, 1993, Clark et al., Gene Therapy 3:1124-1132, 1996, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are incorporated by reference in their entireties, with particular emphasis on the sections of the documents related to rAAV production.

[0217] Overall, several strategies differing in principle have been used for rAAV production, all of which can be used to produce the subject rAAV.

[0218] In certain embodiments, the subject rAAV is produced based on a helper virus-free transient transfection method using all cis and trans components (vector plasmid and packaging plasmid together with helper genes isolated from adenovirus) in a suitable host cell such as 293 cells. The transient transfection method is simple to construct vector plasmid and produces high titer AAV vectors that are adenovirus-free. The VP1 capsid protein can be encoded by one of the plasmids used for transient transfection of the production cell line.

[0219] Thus, in certain embodiments, the polynucleotide of the present invention comprises a DNA plasmid comprising the rAAV vector genome of the present invention. Such DNA plasmids can be used in standard triple transfection methods to produce rAAV. Specifically, the DNA plasmid of the present invention is transferred into a cell that is permissive for infection with a helper virus of AAV (e.g., adenovirus, El-deleted adenovirus, or herpesvirus) to assemble the rAAV vector genome into an infectious viral particle. Techniques for producing rAAV particles in which the packaged AAV genome, rep and cap genes, and helper virus functions are provided to the cell are standard in the art. The production of rAAV requires the presence of the following components: the rAAV genome, the AAV rep and cap genes separated from the rAAV genome (i.e., not included in the rAAV genome), and the helper virus functions in a single cell (referred to herein as a packaging cell). The AAV rep and cap genes can be from any AAV serotype from which the recombinant virus can be derived, and can be from an AAV serotype different from the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh.32, AAVrh34, or AAVrh.74. In certain embodiments, the capsid is a modified capsid, such as SLB-101.

[0220] Transient transfection of packaging cell line (HEK293) In particular, in certain embodiments, the AAV vector is produced by using transient transfection of packaging cell line, such as HEK293 cell.This is the most established AAV production method, which involves plasmid transfection into human embryonic HEK293 cell.Typically, HEK293 cell is simultaneously transfected with vector plasmid (comprising the subject polynucleotide that codes both gene of interest, such as dystrophin minigene and one or more additional coding sequences) and one or two helper plasmids, using calcium phosphate or cationic polymer polyethyleneimine (PEI).

[0221] The helper plasmid(s) allow expression of the four Rep proteins, the three structural proteins VP1, VP2, and VP3 of AAV, AAP, and the adenoviral accessory functions E2A, E4, and VARNA. The additional adenoviral E1A / E1B cofactors required for rAAV replication are expressed in HEK293 producer cells. Both three-plasmid and two-plasmid systems for transfection are possible, since the Rep-cap and adenoviral helper sequences are either cloned into two separate plasmids or combined into one plasmid. The three-plasmid protocol offers versatility with the cap gene easily switchable from one serotype to another.

[0222] Plasmids are usually produced by conventional techniques in E. coli, using antibiotic resistance genes of bacterial origin or by the minicircle technique.

[0223] Transient transfection in adherent HEK293 cells has been used for large-scale production of rAAV vectors, and more recently, HEK293 cells have also been adapted to suspension conditions, which are economically viable for long-term production.

[0224] HEK293 lines are typically grown in DMEM completed with L-glutamine, 5%-10% fetal bovine serum (FBS), and 1% penicillin-streptomycin, except for suspension HEK293 cells, which are maintained in serum-free F17, Expi293, or other manufacturer's specialized media. For adherent cells, the percentage of FBS can be reduced during AAV production to limit contamination with animal-derived components.

[0225] Typically, rAAV vectors are harvested from cell pellets and / or supernatants 48-72 hours after plasmid transfection, depending on the serotype.

[0226] Infection of mammalian cells with rHSV vectors HSV is a helper virus for AAV replication in permissive cells, and therefore can act both as a helper and as a shuttle to deliver essential AAV functions that support replication and packaging of the AAV genome into producer cells.

[0227] AAV production based on co-infection with rHSV can efficiently generate large amounts of rAAV with high total yields (up to 1.5 × 10 5 In addition to the high titer (1000 μg / cell), the method has the further advantage of generating rAAV stocks of demonstrably improved quality as measured by improved viral titers.

[0228] In this method, cells, usually the hamster BHK21 cell line or HEK293 and derivatives, are infected with two rHSVs, one carrying the gene of interest surrounded by the AAV ITRs (rHSV-AAV) and the second carrying the rep and cap ORFs of an AAV of the desired serotype (rHSVrepcap). After 2-3 days, the cells and / or medium are harvested and the rAAV is purified through multiple purification steps to remove cellular impurities, HSV-derived contaminants, and unpackaged AAV DNA.

[0229] Thus, in some embodiments, HSV serves as a helper virus for AAV infection. In some embodiments, AAV growth is achieved using a non-replicating mutant of HSV that is deleted for ICP27.

[0230] Certain methods for producing recombinant AAV viral particles in mammalian cells are known in the art and have been improved in the past decade. For example, US Patent Publication No. 20070202587 describes recombinant AAV production in mammalian cells based on co-infection of cells with two or more replication-defective recombinant HSV vectors. US Patent Publication No. 20110229971 and Thomas et al. (Hum. Gene Ther. 20(8):861-870, 2009) describe a scalable recombinant AAV production method using recombinant HSV type 1 co-infection of suspension-adapted mammalian cells. Adamson-Small et al. (Hum. Gene Ther. Methods 28(1):1-14, 2017) describe an improved AAV production method in a serum-free suspension manufacturing platform using the HSV system.

[0231] In certain other embodiments, a subject rAAV is produced using a recombinant herpes simplex virus (rHSV) vector-based AAV production system, which utilizes a rHSV vector that delivers the AAV vector and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention) to a producer cell. The modified cap gene can be present within the rHSV vector, which can carry the rAAV genome.

[0232] In certain embodiments, the AAV vectors of the invention are produced by the method described in Adamson-Small et al. (Molecular Therapy-Methods & Clinical Development (2016) 3, 16031; doi:10.1038 / mtm.2016.31, incorporated herein by reference), which is a scalable method for the production of high titer and high quality adeno-associated type 9 vectors using the HSV platform. This is an entirely herpes simplex virus (HSV)-based production and purification process, with 1x106 vectors per 10 layers of CellSTACK HEK293 producer cells. 14 More than 1 x 10 rAAV9 vector genomes per cell in the final fully purified product. 5 It is possible to generate more than 1000 vector genomes. This represents a 5-10-fold increase over transfection-based methods. Furthermore, rAAV vectors produced by this method demonstrated improved biological characteristics compared to transfection-based production, including increased infectivity indicated by a high transducing unit-to-vector genome ratio and reduced total capsid protein amounts indicated by a low empty-to-solid ratio. The method can also be readily adapted for large-scale Good Laboratory Practice (GLP) and Good Manufacturing Practice (GMP) production of rAAV9 vectors to enable preclinical and clinical studies and provide a platform to build towards later stage and commercial production.

[0233] Infection of insect cells with recombinant baculoviruses In certain further embodiments, the subject rAAV is produced using a baculovirus system, which requires co-infection of insect cells with several baculovirus vectors to deliver the AAV vector cassette and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention).

[0234] The baculovirus-Sf9 platform has been established as an alternative, GMP-compliant, scalable AAV production method in mammalian cells, with crude yields of up to 2 × 10 per cell. 5 A vector genome (vg) can be generated.

[0235] The current protocol involves the infection of Sf9 insect cells with two recombinant baculoviruses, namely, a baculovirus expression vector (BEV) that allows the synthesis of Rep78 / 52 and Cap, and a recombinant baculovirus carrying a gene of interest flanked by the ITRs of AAV, and several serum-free media adapted for the growth of Sf9 cells in suspension.

[0236] The dual baculovirus-Sf9 production system has many advantages over other production platforms with regard to these safety issues: (1) the use of serum-free medium, (2) despite the discovery of foreign viral transcripts in Sf cell lines, most viruses that infect insects do not actively replicate in mammalian cells, and (3) other than baculovirus, no helper virus is required for rAAV production in insect cells.

[0237] In certain embodiments, a stable Sf9 insect cell line expressing Rep and Cap proteins is used such that infection with only one recombinant baculovirus is required to produce high yields of infectious rAAV vector.

[0238] Mammalian stable cell line. rAAV vectors can also be efficiently and scalably produced using stable mammalian producer cells that stably express the rep and cap genes. Such cells can be infected with wild-type Ad5 helper virus, which is genetically stable and can be easily produced at high titers, to induce high levels of rep and cap expression. Infectious rAAV vectors can be generated by infecting these packaging cell lines with wild-type Ad5 and providing the rAAV genome either by transfection of a plasmid or following infection with a recombinant Ad / AAV hybrid virus.

[0239] Alternatively, Ad can be replaced with HSV-1 as the helper virus.

[0240] Suitable stable mammalian production cells may include HeLa-derived production cell lines, A549 cells, or HEK293 cells. A preferred HeLa cell line is HeLaS3 cells, a suspension-adapted HeLa subclone.

[0241] The methods described herein can be used to produce the subject AAV vectors in animal component-free medium, preferably at the 250-L scale, or at a 2,000-L commercial scale.

[0242] Regardless of how the rAAV viral particles of the invention are produced, the resulting rAAV can be purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, those disclosed in Clark et al., Hum. Gene Ther. 10(6):1031-1039, 1999; Schenpp and Clark, Methods Mol. Med. 69:427-443, 2002; U.S. Patent No. 6,566,118; and WO 98 / 09657.

[0243] Thus, the present invention provides packaging / producing cells that produce infectious rAAV. In one embodiment, the packaging cells can be stably transformed cancer cells, such as HeLa cells, 293 cells, and PerC.6 cells (synonymous 293 lines). In another embodiment, the packaging cells are non-transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with adenovirus El), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (fetal rhesus lung cells).

[0244] In certain embodiments, the subject rAAV is produced based on certain AAV-producing cell lines, such as those derived from HeLa or A549 or HEK293 cells, that stably carry the AAV Rep / cap genes. The AAV vector cassette can either be stably integrated into the host genome or can be introduced by an adenovirus containing the cassette.

[0245] In certain embodiments, such producer cell lines for rAAV production contain a rAAV provirus encoding micro-dystrophin flanked by AAV ITR sequences, and the rAAV provirus is integrated into the genome of the producer cell line for rAAV production.

[0246] The method for generating packaging cells is to create a cell line that stably expresses all the components required for AAV particle production. For example, a plasmid (or multiple plasmids) containing a rAAV vector genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selectable marker such as a neomycin resistance gene is integrated into the genome of the cell. The AAV genome has been introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., Proc. Natl. Acad. Sci. USA 79:2077-2081, 1982), addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., Gene 23:65-73, 1983), or direct blunt-end ligation (Senapathy & Carter, J. Biol. Chem. 259:4661-4666, 1984). The packaging cell line is then infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and are suitable for large-scale production of rAAV.

[0247] In another example of a suitable method, the rAAV genome and / or the rep and cap genes are introduced into the packaging cells using adenovirus or baculovirus, rather than plasmids.

[0248] Thus, any packaging cell is within the scope of the host cells of the invention that contain a polynucleotide, AAV vector genome, or AAV viral particle of the invention.

[0249] 7. Treating muscular dystrophy using rAAV Another aspect of the invention provides a method of treating muscular dystrophy in a human in need thereof, comprising administering to the human a therapeutically effective amount of a polynucleotide of the invention, an rAAV vector genome or rAAV viral particle of the invention, or a pharmaceutical composition of the invention.

[0250] In certain embodiments, the muscular dystrophy is characterized by loss of function mutations in the dystrophin gene.

[0251] In certain embodiments, the muscular dystrophy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy.

[0252] Accordingly, a related aspect of the invention provides a method of treating muscular dystrophies (such as DMD and BMD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a recombinant AAV (rAAV) vector (such as encapsidated in an AAV9 or SLB-101 capsid) encoding a functional version of a gene deficient in muscular dystrophy, such as the microdystrophin gene, wherein the rAAV vector genome comprises any of the CpG-reduced, codon-optimized polynucleotides of the invention (such as SEQ ID NO:1).

[0253] In certain embodiments, the microdystrophin gene comprises the coding sequence for the R1, R16, R17, R23, and R24 spectrin-like repeats of a full-length dystrophin protein (such as those described in PCT / US2016 / 013733).

[0254] In certain embodiments, the microdystrophin gene comprises a coding sequence for the microdystrophin protein of SEQ ID NO:2, wherein the coding sequence comprises the nucleotide sequence of SEQ ID NO:1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto. Optionally, the coding sequence is identical to SEQ ID NO:1 at each capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides, and further optionally, the coding sequence is substantially devoid of CpG islands (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands).

[0255] In certain embodiments, the methods further include producing the subject rAAV prior to administering the rAAV so produced to a subject.

[0256] In any of the methods of the invention, the rAAV vector can be administered by intramuscular or intravenous injection.

[0257] In any of the methods of the invention, the rAAV vector or composition can be administered systemically, for example, the rAAV vector or composition is administered parenterally by injection, infusion, or implantation.

[0258] 8. Pharmaceutical Compositions and Uses Thereof Another aspect of the invention provides compositions, such as pharmaceutical compositions, comprising any of the rAAV vectors, viral particles, and vector genomes that comprise the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the invention.

[0259] In certain embodiments, the composition is a pharmaceutical composition that may further comprise a therapeutically compatible carrier, excipient, diluent, and / or adjuvant. Acceptable carriers, diluents, and adjuvants are non-toxic to recipients and are preferably inert at the dosages and concentrations used, and include buffers such as phosphate, citric acid, or other organic acids, antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates (including glucose, mannose, or dextrins), chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or non-ionic surfactants such as Tween, pluronic, or polyethylene glycol (PEG).

[0260] In another embodiment, the invention provides compositions comprising any of the rAAV vectors, viral particles, and vector genomes comprising the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the invention for use in treating a subject suffering from a dystrophinopathy or muscular dystrophy, e.g., DMD or Becker muscular dystrophy.

[0261] The compositions (e.g., pharmaceutical compositions) of the present invention can be formulated for intramuscular or intravenous injection.The compositions of the present invention can also be formulated for systemic administration, such as parenteral administration by injection, infusion, or implantation.Furthermore, any of the compositions is formulated for administration to a subject suffering from a dystrophinopathy or muscular dystrophy, such as DMD, Becker muscular dystrophy, or any other dystrophin-related muscular dystrophy.

[0262] In a further embodiment, the invention provides the use of any of the rAAV vectors, viral particles, and vector genomes comprising the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the invention for the preparation of a medicament for reducing a subject suffering from a dystrophinopathy or muscular dystrophy, such as DMD, Becker muscular dystrophy, or any other dystrophin-associated muscular dystrophy.

[0263] The present invention contemplates the use of any of the rAAV vectors, viral particles, and vector genomes comprising the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the present invention for the preparation of a medicament for administration to a patient diagnosed with DMD.

[0264] The present invention also contemplates the use of any of the rAAV vectors, viral particles, and vector genomes comprising the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the present invention for the preparation of a medicament for administering any of the rAAV, viral particles, and vector genomes comprising the CpG-reduced, codon-optimized micro-dystrophin coding sequences of the present invention to a subject suffering from muscular dystrophy.

[0265] In any of the uses of the present invention, the medicament can be formulated for intramuscular injection.Furthermore, any of the medicaments can be prepared for administration to a subject suffering from a muscular dystrophy, such as DMD or any other dystrophin-related muscular dystrophy.

[0266] 9. Medication and Administration The titer of the rAAV administered in the methods of the invention will vary depending on, for example, the particular rAAV, the method of administration, the therapeutic goal, the individual, and the cell type(s) being targeted, and can be determined by standard methods in the art. The titer of the rAAV is approximately 1 x 10 per mL. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12, about 1×10 13 , about 1×10 14 Doses may range from 1000 to 15000 DNase resistant particles (DRP) or more. Doses may also be expressed in units of viral genomes (vg).

[0267] Methods of transducing target cells with rAAV in vivo or in vitro are contemplated by the present invention. In vivo methods include administering an effective dose or effective multiple doses of a composition comprising the rAAV of the present invention to an animal (including a human) in need thereof. If the dose is administered before the onset of the disorder / disease, the administration is prophylactic. If the dose is administered after the onset of the disorder / disease, the administration is therapeutic. In an embodiment of the present invention, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, delays or prevents progression to the disorder / disease state, delays or prevents progression of the disorder / disease state, reduces the extent of the disease, causes remission (partial or complete) of the disease, and / or extends survival.

[0268] For administration, effective amounts and therapeutically effective amounts (also referred to herein as doses) can be estimated initially based on the results of in vitro assays and / or animal model studies. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined in cell culture. Such information can be used to more accurately determine useful doses in subjects of interest.

[0269] Administration of an effective dose of the composition may be by routes standard in the art, including, but not limited to, intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal. The route(s) of administration and serotype(s) of the AAV components (particularly the AAV ITRs and capsid proteins) of the rAAV of the present invention can be selected and / or matched by one of skill in the art taking into consideration the infection and / or disease state to be treated and the target cell / tissue(s) expressing one or more coding sequences and / or microdystrophin.

[0270] Specifically, the formulations described herein may be administered by, but are not limited to, injection, infusion, perfusion, inhalation, lavage, and / or ingestion. Routes of administration may include, but are not limited to, intravenous, intradermal, intraarterial, intraperitoneal, intralesional, intracranial, intraarticular, intraprostatic, intrapleural, intratracheal, intranasal, intravitreal, intravaginal, intrarectal, topical, intratumoral, intramuscular, intravesicular, intrapericardial, intraumbilical, intraocular, mucosal, oral, subcutaneous, and / or subconjunctival.

[0271] The present invention provides for local or systemic administration of an effective dose of the rAAV and compositions of the present invention, including the combination therapy of the present invention. For example, systemic administration is administration into the circulatory system, thereby affecting the entire body. Systemic administration includes enteral administration, e.g., absorption from the digestive tract, and parenteral administration by injection, infusion, or implantation.

[0272] In particular, the actual administration of the rAAV of the present invention can be achieved by using any physical method that delivers the rAAV recombinant vector to the target tissue of an animal, such as skeletal muscle. Administration according to the present invention includes, but is not limited to, injection into muscle, bloodstream, and / or directly into the liver. It has been demonstrated that resuspension of rAAV in phosphate buffered saline is sufficient to provide a vehicle useful for expression in muscle tissue, and there are no known limitations on carriers or other components that can be co-administered with rAAV (although compositions that degrade DNA should generally be avoided with rAAV). The capsid protein of rAAV can be modified to target rAAV to a specific target tissue of interest, such as muscle. See, for example, WO02 / 053703, the disclosure of which is incorporated herein by reference.

[0273] The pharmaceutical composition can be prepared as an injection formulation or a local formulation that is delivered to muscle by transdermal delivery. Numerous formulations for both intramuscular injection and transdermal delivery have been previously developed and can be used in the practice of the present invention. rAAV can be used with any pharma- ceutically acceptable carrier to facilitate administration and handling.

[0274] The dose of rAAV administered in the methods disclosed herein will vary depending on, for example, the particular rAAV, the method of administration, the therapeutic goal, the individual, and the cell type(s) being targeted, and can be determined using standard methods in the art.

[0275] The actual dosage administered to a particular subject may be determined by a physician, veterinarian, or researcher, taking into consideration parameters such as physical and physiological factors, including, but not limited to, body weight, severity of the condition, type of disease, previous or concomitant therapeutic interventions, idiopathic diseases of the subject, and / or route of administration.

[0276] The titer of each rAAV administered was approximately 1 × 10 per mL. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 , about 1×10 14 , or approximately 1 × 10 15 Dosages can range from 1×10 to 1×10 DNase resistant particles (DRP) or more. Dosages can also range from 1×10 to 1×10 DNase resistant particles (DRP) or more. 7 vg, 1×10 8 vg, 1×10 9 vg, 1×10 10 vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg, 1×10 14 vg, 1×10 15 Dosages may also be expressed in units of viral genomes (vg) per kilogram (kg) of body weight (i.e., 1×10 10 vg / kg, 1×10 11 vg / kg, 1×10 12 vg / kg, 1×10 13 vg / kg, 1×10 14 vg / kg, 1×10 15AAV may be expressed in units of vg / kg. Methods for titrating AAV are described in Clark et al., Hum. Gene Ther. 10:1031-1039, 1999.

[0277] An exemplary dose is about 1×10 10 ~Approx. 1×10 15 In some embodiments, the dose may range from 1×10 to 1×10 vector genomes (vg) / kilogram body weight. 10 vg / kg body weight, 1×10 11 vg / kg body weight, 1×10 12 vg / kg body weight, 1×10 13 vg / kg body weight, 1×10 14 vg / kg body weight, or 1 × 10 15 vg / kg body weight. The dose may be 1×10 10 vg / kg / day, 1×10 11 vg / kg / day, 1×10 12 vg / kg / day, 1×10 13 vg / kg / day, 1×10 14 vg / kg / day, or 1 × 10 15 vg / kg / day. The dose can range from 0.1 mg / kg / day to 5 mg / kg / day or 0.5 mg / kg / day to 1 mg / kg / day or 0.1 mg / kg / day to 5 μg / kg / day or 0.5 mg / kg / day to 1 μg / kg / day. In other non-limiting examples, the dose can include 1 μg / kg / day, 5 μg / kg / day, 10 μg / kg / day, 50 μg / kg / day, 100 μg / kg / day, 200 μg / kg / day, 350 μg / kg / day, 500 μg / kg / day, 1 mg / kg / day, 5 mg / kg / day, 10 mg / kg / day, 50 mg / kg / day, 100 mg / kg / day, 200 mg / kg / day, 350 mg / kg / day, 500 mg / kg / day, or 1000 mg / kg / day. A therapeutically effective amount can be achieved by a single administration or multiple administrations over the course of a treatment regimen (ie, days, weeks, months, etc.).

[0278] In some embodiments, the pharmaceutical composition comprises at least 1.6×10 13In some embodiments, the dosage is in the form of a 10 mL aqueous solution having at least 2×10 vector genomes per milliliter. 12 In some embodiments, the dosage comprises a sterile aqueous solution containing 10 mM L-histidine at pH 6.0, 150 mM sodium chloride, and 1 mM magnesium chloride. In some embodiments, the pharmaceutical composition is in the form of a 10 mL sterile aqueous solution containing 10 mM L-histidine at pH 6.0, 150 mM sodium chloride, and 1 mM magnesium chloride, and contains at least 1.6×10 13 The vector genome is

[0279] In some embodiments, the pharmaceutical composition comprises 1×10 10 ~1×10 15 A 10 mL solution containing 1 x 10 vector genomes 11 ~1×10 14 A 10 mL solution containing 1 x 10 vector genomes 12 ~2×10 13 of vector genome, or approximately 1.6 × 10 13 The dosage form may comprise 10 mL of an aqueous solution containing the vector genome or more. In some embodiments, the aqueous solution is a sterile aqueous solution containing 10 mM L-histidine at pH 6.0, 150 mM sodium chloride, and 1 mM magnesium chloride. In some embodiments, the dosage is about 1 x 10 per milliliter. 11 Vector genome (vg / mL), approximately 1 x 10 12 More than vg / mL, approximately 2×10 12 More than vg / mL, approximately 3×10 12 >4 × 10 vg / mL or approximately 12 It has a potency of > vg / mL.

[0280] In some embodiments, at least one AAV vector is provided as part of a pharmaceutical composition. The pharmaceutical composition may, for example, comprise at least 0.1% w / v of the AAV vector. In some other embodiments, the pharmaceutical composition may comprise 2%-75% of the compound by weight of the pharmaceutical composition, or 25%-60% of the compound by weight of the pharmaceutical composition.

[0281] In some embodiments, the dosage form is included in a kit. The kit may further include dosage instructions.

[0282] For the purpose of intramuscular injection, not only sterile aqueous solutions but also solutions in an adjuvant such as sesame or peanut oil or aqueous propylene glycol solutions can be used. Such aqueous solutions can be buffered if necessary, and the diluent is first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions of rAAV can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtained by standard techniques well known to those skilled in the art.

[0283] In some embodiments, for injection, the formulation may be prepared as an aqueous solution, for example, but not limited to, Hank's solution, Ringer's solution, and / or buffered saline solution. The solution may contain formulating agents such as suspending agents, stabilizing agents, and / or dispersing agents. Alternatively, the formulation may be in lyophilized and / or powder form for constitution with a suitable vehicle control (e.g., pyrogen-free sterile water) prior to use.

[0284] Any formulation disclosed herein may advantageously include any other pharma- ceutically acceptable carrier(s), including those that do not produce significant side, allergic, or other adverse reactions that may outweigh the benefits of administration, whether for research, prophylactic, and / or therapeutic treatment. Exemplary pharma-ceutically acceptable carriers and formulations are disclosed in Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990, which is incorporated herein by reference for its relevant teachings. Furthermore, formulations may be prepared to meet the standards of sterility, pyrogenicity, general safety, and purity required by the Division of Biological Standards and Quality Control of the U.S. FDA and / or other relevant U.S. and foreign regulatory agencies.

[0285] Exemplary commonly used pharma- ceutically acceptable carriers may include, but are not limited to, bulking agents or fillers, solvents or cosolvents, dispersion media, coatings, surfactants, antioxidants (e.g., ascorbic acid, methionine, and vitamin E), preservatives, isotonicity agents, absorption delaying agents, salts, stabilizers, buffers, chelating agents (e.g., EDTA), gels, binders, disintegration agents, and / or lubricants.

[0286] Exemplary buffers may include, but are not limited to, citrate buffers, succinate buffers, tartrate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers, and / or trimethylamine salts.

[0287] Exemplary preservatives may include, but are not limited to, phenol, benzyl alcohol, meta-cresol, methylparaben, propylparaben, octadecyldimethylbenzylammonium chloride, benzalkonium halides, hexamethonium chloride, alkylparabens (such as methyl or propylparaben), catechol, resorcinol, cyclohexanol, and / or 3-pentanol.

[0288] Exemplary isotonicity agents can include polyhydric sugar alcohols, including, but not limited to, trihydric or higher sugar alcohols (eg, glycerin, erythritol, arabitol, xylitol, sorbitol, and / or mannitol).

[0289] Exemplary stabilizers may include, but are not limited to, organic sugars, polyhydric sugar alcohols, polyethylene glycols, sulfur-containing reducing agents, amino acids, low molecular weight polypeptides, proteins, immunoglobulins, hydrophilic polymers, and / or polysaccharides.

[0290] The preparation may also be a depot preparation.In some embodiments, such long-acting preparations can be administered by, but not limited to, implantation (e.g., subcutaneous or intramuscular) or intramuscular injection.Thus, for example, the compound can be formulated with suitable polymeric and / or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as a poorly soluble derivative (e.g., as a poorly soluble salt).

[0291] Furthermore, in various embodiments, the AAV vector can be delivered using a sustained release system, such as a semipermeable matrix of solid polymers containing the AAV vector. Various sustained-release materials have been established and are well known to those skilled in the art. Sustained-release capsules can release vectors for several weeks up to 100 days or more after administration, depending on their chemical nature.

[0292] Suitable pharmaceutical carriers, diluents, or excipients for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that it passes easily through a syringe. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be a solvent or dispersion medium, including, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is preferable to include an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0293] Sterile injectable solution is prepared by incorporating the required amount of rAAV into a suitable solvent with various other ingredients as listed above as necessary, and then sterilizing by filtration.Generally, dispersion is prepared by incorporating sterile active ingredient into a sterile vehicle that contains a basic dispersion medium and other necessary ingredients from those listed above.For the preparation of sterile powder for the preparation of sterile injectable solution, the preferred preparation method is vacuum drying and freeze-drying technology, which allows the powder of active ingredient plus any other desired ingredients to be obtained from its solution that has been previously sterile-filtered.

[0294] Transduction with rAAV may also be performed in vitro. In one embodiment, the desired target muscle cells are removed from the subject, transduced with rAAV, and reintroduced into the subject. Alternatively, syngeneic or xenogeneic muscle cells can be used, which do not generate an inappropriate immune response in the subject.

[0295] Suitable methods for transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells can be transduced in vitro by combining rAAV with muscle cells, for example, in a suitable medium, and screening those cells that carry the DNA of interest using conventional techniques such as Southern blot and / or PCR, or using a selectable marker. The transduced cells can then be formulated into a pharmaceutical composition, and the composition can be introduced into a subject by various techniques, for example, intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or injection into smooth muscle and cardiac muscle, for example, using a catheter.

[0296] The transduction of cells with the rAAV of the present invention results in the sustained co-expression of the one or more additional coding sequences and micro-dystrophin. The present invention therefore provides methods for administering / delivering rAAVs that co-express the one or more additional coding sequences and micro-dystrophin to animals, preferably humans. These methods include transducing tissues (including but not limited to tissues such as muscle, organs such as liver and brain, and glands such as salivary glands) with one or more rAAV of the present invention. Transduction can be performed using gene cassettes that contain tissue-specific control elements. For example, one embodiment of the present invention provides a method of transducing muscle cells and muscle tissues that are directed by muscle-specific control elements, including, but not limited to, those from the actin and myosin gene families, such as those from the myoD gene family (see Weintraub et al., Science 251:761-766, 1991), muscle cell-specific enhancer binding factor MEF-2 (Cserjesi and Olson, Mol Cell Biol 11:4854-4862, 1991), the human skeletal actin gene (Muscat et al., Mol Cell Biol 7:4089-4099, 1987), the cardiac actin gene, muscle creatine kinase sequence elements (Johnson et al., Mol Cell Biol 11:4091-4092, 1992), and the myosin gene family (see Weintraub et al., Science 251:761-766, 1991). 9:3393-3399, 1989), and the mouse creatine kinase enhancer (mCK) element, control elements derived from the skeletal fast-twitch troponin C gene, the slow-twitch cardiac troponin C gene, and the slow-twitch troponin I gene, hypoxia-inducible nuclear factor (Semenza et al., Proc Natl Acad Sci USA 88:5680-5684, 1991), promoters containing steroid-inducible elements and glucocorticoid response elements (GREs) (see Mader and White, Proc. Natl. Acad. Sci. USA 90:5603-5607, 1993), as well as other control elements.

[0297] Muscle tissue is an attractive target for DNA delivery in vivo because it is a non-vital organ and is easily accessible. The present invention contemplates sustained co-expression of miRNA and micro-dystrophin from transduced muscle fibers.

[0298] As used herein, "muscle cell" or "muscle tissue" refers to a cell or group of cells derived from any type of muscle (e.g., skeletal muscle and smooth muscle, e.g., gastrointestinal, bladder, blood vessel or heart tissue). Such muscle cells can be differentiated or undifferentiated, e.g., myoblasts, myocytes, myotubes, cardiomyocytes, and cardiomyoblasts.

[0299] The term "transduction" is used to refer to the administration / delivery of the one or more additional coding sequences and the microdystrophin coding region to a recipient cell via a replication-deficient rAAV of the present invention resulting in co-expression of the one or more additional coding sequences and microdystrophin by the recipient cell, either in vivo or in vitro.

[0300] Thus, the invention provides methods of administering an effective dose (or multiple doses, administered essentially simultaneously or at intervals) of a rAAV encoding the one or more additional coding sequences and micro-dystrophin to a patient in need thereof. EXAMPLES

[0301] Example 1: Conventional codon-optimized CpG islands There are a variety of conventional codon optimization approaches, all aimed at improving the expression levels of a codon-optimized coding sequence in a particular host cell, however, these approaches introduce CpG islands in the process.

[0302] Using the online tool at the EBI website, EMBOSS Cpgplot, it is possible to predict the number and location of CpG islands in a particular input nucleotide sequence. The results of this analysis showed that all commonly used codon optimization approaches introduced many CpG islands into their respective output sequences (i.e., codon-optimized polynucleotides), but SEQ ID NO: 1, which was edited based on one of the codon-optimized polynucleotides to remove CpG islands, no longer had CpG islands predicted by the online tool.

[0303] Specifically, the native, non-codon-optimized microdystrophin coding sequence encoding the microdystrophin of SEQ ID NO:2 was analyzed using EMBOSS Cpgplot with the following parameters: window size=100, min length=100, min observed=0.6, min percentage=50. The output of this analysis is shown in Figure 1. It is clear that the native human sequence has only one CpG island between nucleotides 2400-2500.

[0304] This native human MD5 coding sequence was then codon-optimized using Gene Art to generate the first codon-optimized coding sequence for the same micro-dystrophin protein of SEQ ID NO: 2. EMBOSS Cpgplot identified nine CpG islands in this codon-optimized sequence. See Figure 2.

[0305] This initial codon-optimized coding sequence was modified by applicant at the capitalized nucleotides of SEQ ID NO: 1 to arrive at SEQ ID NO: 1. EMBOSS Cpgplot did not identify any CpG islands in this codon-optimized sequence. See FIG. 3.

[0306] The same native human MD5 was then codon-optimized using GenScript to generate a second codon-optimized coding sequence of SEQ ID NO: 2. EMBOSS Cpgplot identified four CpG islands in this codon-optimized sequence. See Figure 4.

[0307] The same process was repeated for yet another codon-optimized approach, DNA2.0. EMBOSS Cpgplot identified 11 CpG islands in this codon-optimized sequence. Figure 5.

[0308] Interestingly, the Gene Art codon-optimized coding sequence of Figure 2 (with 9 CpG islands) was used as input for a second round of codon optimization using DNA2.0 to obtain a coding sequence with 10 CpG islands, similar to other DNA2.0-produced codon-optimized sequences, see Figure 6.

[0309] These data showed that all conventional codon optimization approaches tend to create CpG islands in the resulting codon-optimized coding sequences. Multiple rounds of codon optimization using different approaches did not eliminate CpG islands.

[0310] Example 2 TLR9 Activation Assay CpG PAMPs are recognized by the pattern recognition receptor (PRR) Toll-like receptor 9 (TLR9), which is constitutively expressed only in B cells and plasmacytoid dendritic cells (pDCs) of humans and other higher primates. Binding and activation of TLR9 by unmethylated CpG motifs promotes CTL responses to AAV vectors in preclinical models.

[0311] This assay (a schematic diagram is provided in FIG. 7) can be used to assess the potential and extent to which a given polynucleotide coding sequence may elicit an unwanted host immune response due to the presence of CpG islands.

[0312] Briefly, human plasmacytoid dendritic cells (pDCs) isolated from blood samples of healthy donors scheduled to receive test polynucleotides with potential CpG islands were purchased from STEMCELL Technologies. Cells were plated at 5 × 10 4(5E4) cells / well / 100 μL cell culture medium were seeded. Anti-AAV capsid (e.g., anti-AAV9) IgG3 antibody was added, followed by the addition of test article or vehicle control. The tissue culture plate was incubated at 37° C. for approximately 22 hours. Cell culture supernatants were then collected and the presence and amount of IFN-α was measured by ELISA as a readout for TLR9 activation.

[0313] Using this assay, it was shown that AAV9 viral particles encapsidating vector genomes containing green fluorescent protein (GFP) increased TLR9-dependent IFN-α production (data not shown). Furthermore, empty AAV9 capsids without encapsidated vector genomes did not induce TLR9 activation. Therefore, this assay can be utilized to examine the innate immune response to AAV9 viral particles encapsidating vector genomes containing modified CpG islands.

Claims

1. A polynucleotide encoding the micro-dystrophin of SEQ ID NO:2, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO:1, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical thereto.

2. 2. The polynucleotide of claim 1, which is identical to SEQ ID NO: 1 at each capitalized nucleotide or differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 capitalized nucleotides.

3. 2. The polynucleotide of claim 1, which is substantially devoid of CpG islands (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 CpG islands based on EMBOSS Cpgplot analysis).

4. 4. The polynucleotide of any one of claims 1 to 3, comprising, consisting essentially of, or consisting of a nucleotide sequence at least 95% identical to SEQ ID NO:

1.

5. 4. The polynucleotide of any one of claims 1 to 3, comprising, consisting essentially of, or consisting of a nucleotide sequence at least 97% identical to SEQ ID NO:

1.

6. 4. The polynucleotide of any one of claims 1 to 3, comprising, consisting essentially of, or consisting of a nucleotide sequence at least 99% identical to SEQ ID NO:

1.

7. The polynucleotide of claim 1 comprising the nucleotide sequence of SEQ ID NO:

1.

8. The polynucleotide of claim 1, consisting of the nucleotide sequence set forth in SEQ ID NO:

1.

9. 10. An adeno-associated virus (AAV) vector genome comprising the polynucleotide of claim 1, wherein the AAV vector genome is capable of being packaged within an AAV capsid.

10. 1. A recombinant adeno-associated virus (rAAV) particle comprising an AAV capsid and an AAV vector genome comprising the polynucleotide of claim 1, wherein the AAV vector genome is encapsidated within the AAV capsid.

11. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the polynucleotide is operably linked to a transcriptional regulatory element.

12. The AAV vector genome or rAAV viral particle of claim 11 , wherein the transcriptional regulatory element comprises a promoter.

13. The AAV vector genome or rAAV viral particle of claim 12, wherein the promoter is a muscle-specific promoter.

14. The muscle-specific promoter is a CK8 promoter, a cardiac troponin T (cTnT) promoter, a CK7 promoter, a CK9 promoter, a truncated MCK (tMCK), a myosin heavy chain (MHC) promoter, a hybrid α-myosin heavy chain enhancer / MC 14. The AAV vector genome or rAAV viral particle of claim 13, wherein the enhancer-binding element is a human skeletal actin gene element, cardiac actin gene element, myocyte-specific enhancer-binding factor mef, muscle creatine kinase (MCK), truncated MCK (tMCK), myosin heavy chain (MHC), C5-12, mouse creatine kinase enhancer element, skeletal fast-twitch troponin c gene element, slow-twitch cardiac troponin c gene element, slow-twitch troponin i gene element, hypoxia-inducible nuclear factor, steroid-inducible element, or glucocorticoid response element (gre).

15. 14. The AAV vector genome or rAAV viral particle of claim 13, wherein the muscle-specific promoter is a CK8 promoter, and optionally the CK8 promoter comprises the nucleotide sequence of SEQ ID NO: 3 or 4.

16. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the vector genome further comprises a polyadenylation signal sequence, such as the polyA signal sequence of SEQ ID NO:

8.

17. 17. The AAV vector genome or rAAV viral particle of claim 16, wherein the polyadenylation signal sequence comprises an SV40 polyadenylation signal sequence (e.g., SEQ ID NO: 9), a bovine growth hormone (bGH) polyadenylation signal sequence (e.g., SEQ ID NO: 10), or a rabbit beta globin (rBG) polyadenylation signal sequence (e.g., SEQ ID NO: 11).

18. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the vector genome further comprises a 3' ITR sequence, such as an AAV2 3' ITR sequence.

19. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the vector genome further comprises a 5' ITR sequence, such as an AAV2 5' ITR sequence.

20. The vector genome further comprises a 3' ITR sequence, such as an AAV2 3' ITR sequence, and / or a 5' ITR sequence, such as an AAV2 5' ITR sequence; wherein the 5' ITR sequence and / or the 3' ITR sequence (1) comprises or is SEQ ID NO: 12 and 13, respectively, or (2) comprises or is SEQ ID NO: 24 and 27, respectively; 11. An AAV vector genome according to claim 9 or an rAAV viral particle according to claim 10.

21. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the vector genome further comprises intron and / or exon sequences that enhance expression of the micro-dystrophin.

22. 22. The AAV vector genome or rAAV viral particle of claim 21, wherein the intron comprises SEQ ID NO:

14.

23. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, wherein the vector genome further comprises a 5'UTR sequence and / or a 3'UTR sequence.

24. 11. The AAV vector genome of claim 9 or the rAAV viral particle of claim 10, comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO: 15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

25. 11. The rAAV viral particle of claim 10, wherein the capsid is of the SLB-101, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, AAVrh74, AAVhu32, or AAVhu37 serotype.

26. The rAAV virus particle of claim 10, wherein the capsid is of the SLB-101 or AAV9 serotype.

27. 1. A recombinant adeno-associated virus (rAAV) viral particle comprising an SLB-101 or AAV9 capsid and a vector genome encapsidated therein, wherein the vector genome comprises a polynucleotide sequence encoding MD5 micro-dystrophin of SEQ ID NO:

2.

28. 28. The rAAV viral particle of claim 27, wherein the polynucleotide sequence comprises the nucleotide sequence of SEQ ID NO:

1.

29. 28. The rAAV viral particle of claim 27, wherein the polynucleotide sequence comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:1, and is identical to SEQ ID NO:1 in each capitalized nucleotide.

30. The rAAV viral particle of any one of claims 27 to 29, wherein the vector genome comprises a muscle-specific regulatory element operably linked to the polynucleotide sequence.

31. 31. The rAAV viral particle of claim 30, wherein the muscle-specific regulatory element comprises a CK8 promoter, such as the CK8 promoter of the nucleotide sequence of SEQ ID NO: 3 or 4.

32. The AAV virus particle of any one of claims 27 to 29, wherein the vector genome further comprises a polyadenylation signal sequence, such as a polyA signal sequence comprising SEQ ID NO:

8.

33. 33. The AAV viral particle of claim 32, wherein the polyadenylation signal sequence comprises an SV40 polyadenylation signal sequence (SEQ ID NO: 9), a bovine growth hormone (bGH) polyadenylation signal sequence (SEQ ID NO: 10), or a rabbit beta globin (rBG) polyadenylation signal sequence (SEQ ID NO: 11).

34. 30. The AAV virus particle according to any one of claims 27 to 29, wherein the vector genome further comprises a 3' ITR sequence, such as SEQ ID NO: 3' ITR, and a 5' ITR sequence, such as SEQ ID NO: 5' ITR.

35. 30. The AAV viral particle of claims 27 to 29, comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO: 15, or a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% identical thereto.

36. A pharmaceutical composition comprising the polynucleotide described in claim 1, the rAAV vector genome described in claim 9 or the rAAV virus particle described in claim 10, and a pharmaceutically acceptable carrier.

37. Suitable for intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, or intrathecal administration 37. The pharmaceutical composition of claim 36, wherein the pharmaceutical composition is or is formulated for use in a pharmaceutical composition comprising:

38. 37. The pharmaceutical composition of claim 36 for the treatment of muscular dystrophy.

39. 39. The pharmaceutical composition of claim 38, wherein the muscular dystrophy is characterized by a loss of function mutation in the dystrophin gene.

40. 39. The pharmaceutical composition of claim 38, wherein the muscular dystrophy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy.

41. The rAAV viral particles in the pharmaceutical composition are about 1 x 10 １２ ~Approx. 1×10 １６ vector genomes (vg) / kg, or approximately 1 x 10 １３ ~Approx. 1×10 １５ 39. The pharmaceutical composition of claim 38, administered at a dose of vector genomes (vg) / kg.

42. A host cell comprising the polynucleotide described in claim 1, or the rAAV vector genome described in claim 9, or the rAAV virus particle described in claim 10.

43. 43. The host cell of claim 42, which is a HeLa cell, a Cos7 cell, a HEK293 cell, an A549 cell, a BHK cell, a Vero cell, an RD cell, an HT-1080 cell, an ARPE-19 cell, or an MRC-5 cell.

44. 44. The host cell of claim 43, wherein the host cell is a HeLa cell or a 293 / 293T cell.

Images