Mixed lineage kinase inhibitors and methods of use

JP2024533121A5Pending Publication Date: 2025-09-03THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY DEPARTMENT OF HEALTH & HUMAN SERVICES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024513749
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-01
Filing Date
2022-08-30
Publication Date
2025-09-03

AI Technical Summary

Technical Problem

Current treatments for head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), and triple-negative breast cancer (TNBC) are limited, with existing therapies showing low response rates and a lack of targeted therapies, while genomic characterization of LSCC has not identified actionable drivers, leading to reliance on chemotherapy and radiotherapy.

Method used

Development of mixed lineage kinase (MLK) inhibitors, particularly targeting LZK, MLK3, and MLK4, to inhibit key signaling pathways in cancer cells, including the c-MYC and PI3K/AKT pathways, through compounds like GNE-3511 and LZK inhibitor 2, which are designed to reduce cancer cell survival and inhibit tumor growth.

Benefits of technology

The MLK inhibitors effectively reduce cancer cell survival and inhibit tumor growth in HNSCC, LSCC, and TNBC by targeting key oncogenic drivers, demonstrating significant cell death and tumor suppression in preclinical models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Mixed lineage kinase (MLK) inhibitors are disclosed. These compounds inhibit kinase activity. These compounds can be used to treat diseases or conditions characterized at least in part by overexpression of one or more MLKs. These compounds have a structure according to Formula I, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt thereof. The present invention relates to mixed lineage kinase inhibitors and methods for using these inhibitors. TIFF2024533121000373.tif1883
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of earlier filing U.S. Provisional Patent Application No. 63 / 239,797, filed September 1, 2021, which is incorporated herein by reference in its entirety.

[0002] Government support acknowledged This invention was made with Government support under Project No. Z01 600.129.15.01.024.001.0021.012 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] Field The present invention relates to mixed lineage kinase inhibitors and methods for using these inhibitors. [Background technology]

[0004] background The worldwide incidence of head and neck squamous cell carcinoma (HNSCC) is approximately 800,000 new cases per year, with 430,000 deaths annually, a statistic that has remained unchanged for decades. Treatment options for HNSCC patients are primarily limited to surgery, radiation therapy, platinum-based chemotherapy, or a combination thereof. Cetuximab, a monoclonal antibody that targets EGFR, is the only approved targeted therapy for HNSCC (Bonner et al., NEJM 2006, 364:567-578; Vermorken et al., NEJM 2008, 359:1116-1127). However, only a subset (13%) of HNSCC patients respond to cetuximab (Vermorken et al., J Clin Oncol 2007, 25:2171-2177); therefore, new therapies are urgently needed.

[0005] Lung squamous cell carcinoma (LSCC) accounts for one-third of all lung cancer cases. Despite extensive genomic sequencing, identification of oncogenic drivers in LSCC remains challenging, and actionable alterations are unknown in the majority of LSCC patients (Gold et al., Clin Cancer Res 2012, 18(11):3002-7; Gandara et al., Clin Cancer Res 2015, 21(10):2236-43). As a result, no targeted therapy has been approved to treat LSCC, and treatment still relies on chemotherapy or radiation therapy. Genomic characterization of LSCC tumors has shown that distal chromosome 3q amplification (3q26-29) is the most predominant genomic alteration in LSCC, occurring in approximately 50% of LSCC patients (Cancer Genome Atlas Research Network, "Comprehensive genomic characterization of squamous cell lung cancers," Nature 2012, 489(7417):519-25). Triple-negative breast cancer (TNBC) accounts for 10-20% of all invasive breast cancers and has a poor prognosis compared to other breast cancers (Mehlich et al., Cell Death and Disease 2021, 12:1111; Marusiak et al., Oncogene 2019, 38:2860-2875). TNBC is characterized by the absence of estrogen and progesterone receptors, as well as the lack of HER2 overexpression. Intrinsic and acquired resistance to chemotherapy leads to high recurrence rates and poor outcomes (Mehlich et al.). Thus, new treatments are needed. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Bonner et al., NEJM 2006, 364:567-578 [Non-Patent Document 2] Vermorken et al., NEJM 2008, 359:1116-1127 [Non-Patent Document 3] Vermorken et al., J Clin Oncol 2007, 25:2171-2177 [Non-Patent Document 4] Gold et al., Clin Cancer Res 2012, 18(11):3002-7 [Non-Patent Document 5] Gandara et al., Clin Cancer Res 2015, 21(10):2236-43 [Non-Patent Document 6] Cancer Genome Atlas Research Network, "Comprehensive genomic characterization of squamous cell lung cancers," Nature 2012, 489(7417):519-25 [Non-Patent Document 7] Mehlich et al., Cell Death and Disease 2021, 12:1111 [Non-Patent Document 8] Marusiak et al., Oncogene 2019, 38:2860-2875 Summary of the Invention [Means for solving the problem]

[0007] overview The present disclosure relates to mixed lineage kinase (MLK) inhibitors and methods for using these inhibitors. In some embodiments, the disclosed inhibitors have the general formula I: [ka] or a stereoisomer, tautomer, or pharma- ceutically acceptable salt thereof, wherein Ring A is [ka] [is].

[0008] With reference to formula I: [ka] Each bond represented by -X is a single bond or a double bond as needed to satisfy valence requirements. 1 (R 5 )-part is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -NC(R 5 )-, or -N(R 5 )-. X 2 is N or C. X 3 is N or CH. X 1 ~X 3 One or two of X contains N. 4 is CH or S. 5 is -N(H)- or absent. 1 is C(R 1 ) or N. Y 2 is C(R 2 ) or N. Y 3 is C(R 3 ) or N. Y 4 is N or C(R 6 ) Y 5 is C(R 7 ) or N. Y 6 is C(R 8 ) or N. Y 1 ~Y 6 One or two of the following are N and Y 1 ~Y 3 or Y 6 At least one of Y is other than C(H). 7 ~Y 10 Two, three, or four of the 9 ), and Y 7 ~Y10 The others are C(R 10 ) R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl; 1 and R 2 R together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R', where R' is alkyl or R 2 and R 3 R together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 4 is aliphatic, azaalkyl, aryl, or amino. 5 is aliphatic, heteroaliphatic, or alkylamino. 6 and R 7 is independently H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano, or R 8 and R 1 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 9 is independently H or alkyl. 10 is independently H, alkyl, or cyano.

[0009] The present disclosure further includes pharmaceutical compositions comprising at least one compound as disclosed herein and at least one pharma- ceutically acceptable carrier.

[0010] Methods of using the disclosed compounds are disclosed. In some embodiments, the method of inhibiting MLK activity comprises contacting a cell expressing MLK with an effective amount of the compounds disclosed herein, thereby inhibiting MLK activity. MLK can be MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof. In some embodiments, inhibiting MLK activity is inhibiting cell cycle progression, decreasing c-MYC expression, inhibiting c-Jun N-terminal kinase (JNK) pathway signaling, inhibiting PI3K / AKT pathway signaling, inhibiting cyclin-dependent kinase 2 (CDK2) activity, or any combination thereof. In any of the above or following embodiments, the cell may be characterized by chromosome 3q amplification, chromosome 11q amplification, overexpression of mitogen-activated protein kinase kinase kinase (MAP3K), overexpression of extracellular signal-regulated kinase (ERK), or any combination thereof. In some examples, the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell, or a breast cancer cell.

[0011] In some embodiments, contacting the cell with the compound comprises administering a therapeutically effective amount of the compound or an amount of a pharmaceutical composition comprising a therapeutically effective amount of the compound to the subject. The subject may have a disease or condition characterized at least in part by MLK overexpression. In some embodiments, the disease or condition is cancer, such as HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, or breast cancer. Administering a therapeutically effective amount of the compound or an amount of the pharmaceutical composition can reduce the survival rate of cancer cells, inhibit tumor growth, or a combination thereof.

[0012] The above and other objects, features, and advantages of the present disclosure will become more apparent from the following detailed description which proceeds with reference to the accompanying drawings.

[0013] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 shows the structure of GNE-3511.

[0015] [Diagram 2] Figures 2A-2C show that GNE-3511 inhibited LZK activity as monitored by downstream JNK phosphorylation at 100 nM to 5 μM at 24 hours (2A) and at 250 nM at 72 hours (2B); Figure 2C is a graphical representation of the data.

[0016] [Diagram 3] FIG. 3 shows RT-PCR analysis of CAL33 TR LZK WT or 240S cell lines with tetracycline-inducible expression of LZK.

[0017] [Figure 4] FIG. 4 shows that GNE-3511 250 nM inhibited LZK activity against JNK within 15 minutes.

[0018] [Diagram 5] FIG. 5 shows that GNE-3511 reduced the in vitro phosphorylation of MKK7, a direct downstream target of LZK.

[0019] [Figure 6]Figures 6A and 6B are a series of images (6A) and a bar graph (6B) showing that GNE-3511 suppressed clonogenic growth in head and neck squamous cell carcinoma (HNSCC) cell lines with amplified MAP3K13 (CAL33 and BICR56) after 14 days, but had only a modest effect on clonogenic growth in a control HNSCC cell line (MSK921) or an immortalized normal human bronchial epithelial cell line (BEAS-2B).

[0020] [Figure 7] Figures 7A and 7B are a bar graph (7A) and an image (7B) showing that LZK inhibition with GNE-3511 at 500 nM reduced clonogenic growth of lung squamous cell carcinoma (LSCC) cell lines (LK2 and NCI-H520) harboring 3q amplification.

[0021] [Figure 8] FIG. 8 is a graph showing that GNE-3511 treatment significantly reduced cell viability in CAL33 and BICR56 cells for 72 hours.

[0022] [Figure 9] FIG. 9 shows that the drug-resistant mutant form of LZK, Q240S, retained catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation.

[0023] [Figure 10] FIG. 10 shows that in 293T cells, GNE-3511 treatment for 1 hour specifically inhibited LZK activity, as observed with rescue of JNK signaling by overexpression of the LZKQ240S drug-resistant mutant.

[0024] [Figure 11] FIG. 11 shows that GNE-3511 suppressed HNSCC viability in a 72-hour MTS assay in CAL33 and BICR56 cell lines with amplified MAP3K13, and viability was rescued by expression of LZKQ240S.

[0025] [Figure 12] Figures 12A-12C show inhibition of tumor growth in mice (n=10) treated with GNE-3511 (50 mg / kg, qd, 5 days on / 2 days off) compared to vehicle control group in an in vivo HNSCC PDX mouse model; Figure 12A is a graph of mean tumor volume ± SEM; Figure 12B is a bar graph showing mean tumor volume at the end of treatment, mean tumor volume ± SEM, Student's t-test, *p<0.05; Figure 12C is a tumor image at the end of the study.

[0026] [Figure 13-1] Figures 13A-13D show that in two in vivo HNSCC PDX mouse models (50 mg / kg, qd, 5 days on / 2 days off) with amplified LZK, tumor growth was significantly suppressed in mice (n=10) treated with GNE-3511 (50 mg / kg, qd, 5 days on / 2 days off) compared to the vehicle control group (Figures 13A, 13B), whereas tumor volume was not reduced in the HNSCC PDX model lacking amplified LZK (Figures 13C, 13D). Mean tumor volume ± SEM is shown. Mean tumor volume at the end of treatment. Mean ± SEM; Student's t-test; *p<0.05. [Figure 13-2] Same as above.

[0027] [Figure 14] FIG. 14 shows that in an in vivo HNSCC CAL33 xenograft mouse model, tumor growth was suppressed in mice treated with 100 mg / kg GNE-3511 (n=10) compared to the vehicle control group.

[0028] [Figure 15]Figures 15A and 15B are images of immunohistochemistry (IHC) staining of the apoptotic marker cleaved caspase-3 in CAL33 xenografts in the instruction treatment group (15A), and quantification of cleaved caspase-3 staining in tumors demonstrating increased apoptotic markers with GNE-3511 treatment compared to controls (15B).

[0029] [Figure 16] FIG. 16 is a graph depicting the percentage of HNSCC PDX models with amplification of each gene on chromosome 3; genes are ordered by gene start along chromosome 3; MAP3K13 is marked with a cross; the line is the Ross regression line.

[0030] [Figure 17] FIG. 17 shows RT-PCR analysis of CAL33, BICR56, and MSK921 cell lines with dox-inducible knockdown of LZK.

[0031] [Figure 18] FIG. 18 shows copy number (CN) profiles of 58 HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR; heatmap colors indicate the log2 ratios of copy numbers.

[0032] [Figure 19] FIG. 19 shows box plots of MAP3K13 gene expression in 58 PDX models with different MAP3K13 copy numbers.

[0033] [Figure 20] FIG. 20 shows the results of an RPPA assay at 48 hours identifying reduced c-MYC levels in LZK-depleted CAL33 and BICR56 cells.

[0034] [Figure 21]FIG. 21 is a series of Western blots of c-MYC abundance in LZK-depleted CAL33 and BICR56 cells at 48 hours. [Figure 22] FIG. 22 is a series of Western blots of cell cycle component abundance in LZK-depleted CAL33 cells at 48 hours.

[0035] [Diagram 23] FIG. 23 is a Western blot showing that 6 hour treatment with MG132 (10 μM) rescued the reduction in c-MYC levels in LZK-depleted CAL33 and BICR56 cells at 48 hours.

[0036] [Figure 24] FIG. 24 is a Western blot showing that treatment of CAL33 cells with GNE-3511 reduced c-MYC abundance by 72 hours.

[0037] [Diagram 25] FIG. 25 is a Western blot showing that LZKQ240S expression rescued the reduction in c-MYC levels in CAL33 cells treated with GNE-3511.

[0038] [Figure 26] FIG. 26 is a graph showing inhibition of LZK activity by several disclosed analogs, as monitored by downstream JNK phosphorylation.

[0039] [Figure 27] FIG. 27 is a Western blot comparison of GNE-3511 and LZK inhibitor 2 showing that LZK inhibitor 2 is a potent LZK inhibitor at 100 nM.

[0040] [Figure 28] FIG. 28 shows that LZK inhibitor 2 maintained JNK pathway inactivation for 72 hours at 250 nM.

[0041] [Figure 29] FIG. 29 shows that LZK signaling activity was suppressed by LZK inhibitor 2 (250 nM) at 5 minutes.

[0042] [Diagram 30] FIG. 30 shows that LZK inhibitor 2 inhibited JNK signaling for 1 hour at lower concentrations than GNE-3511.

[0043] [Diagram 31] Figures 31A and 31B are images (Figure 31A) and quantification revealing a significant reduction in growth in all three cell lines showing that LZK inhibitor 2 suppressed clonogenic growth of HNSCC cells (CAL33, BICR56, and Detroit 562) with amplified MAP3K13. Mean ± SEM; Student's t-test; **p<0.01, *p<0.05 (Figure 31B).

[0044] [Diagram 32] FIG. 32 is an image showing that LZK inhibitor 2 (1 μM) significantly reduced LSCC cell growth in LK2 and NCI-H520 cell lines.

[0045] [Diagram 33] FIG. 33 is a graph showing that LZKQ240S drug resistance mutant expression rescued the loss of viability in CAL33 cells treated with LZK inhibitor 2.

[0046] [Diagram 34] FIG. 34 is a Western blot showing that expression of the LZKQ240S drug resistance mutant during treatment with LZK inhibitor 2 (250 nM) rescued JNK signaling.

[0047] [Diagram 35]Figures 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 μM, 1 hour) reduced phospho-JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to the GNE-3511 control. [Diagram 36] Figures 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 μM, 1 hour) reduced phospho-JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to the GNE-3511 control. [Figure 37] Figures 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 μM, 1 hour) reduced phospho-JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to the GNE-3511 control. [Figure 38] Figures 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 μM, 1 hour) reduced phospho-JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to the GNE-3511 control. [Figure 39] Figures 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 μM, 1 hour) reduced phospho-JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to the GNE-3511 control.

[0048] [Diagram 40]40-42 are graphs showing dose-dependent inhibition of LZK by three disclosed MLK inhibitors. [Diagram 41] 40-42 are graphs showing dose-dependent inhibition of LZK by three disclosed MLK inhibitors. [Diagram 42] 40-42 are graphs showing dose-dependent inhibition of LZK by three disclosed MLK inhibitors.

[0049] [Diagram 43] FIG. 43 is a graph showing that esophageal squamous cell carcinoma (ESCC) cells harboring the 3q amplicon are sensitive to GNE-3511.

[0050] [Diagram 44] FIG. 44 is an image of a soft agar assay confirming that ESCC cells harboring the 3q amplicon are sensitive to GNE-3511.

[0051] [Diagram 45] FIG. 45 is an image of a colony formation assay confirming that ESCC cells harboring the 3q amplicon are sensitive to GNE-3511.

[0052] [Diagram 46] FIG. 46 is an image of a colony formation assay showing that ESCC cells harboring drug-resistant mutant forms of LZK are resistant to GNE-3511.

[0053] [Figure 47] FIG. 47 is an image of a colony formation assay confirming that ESCC cells harboring the 3q amplicon are sensitive to the two disclosed MLK inhibitors.

[0054] [Figure 48] FIG. 48 is a Western blot showing that ESCC cells harboring drug-resistant mutant forms of LZK are resistant to the disclosed MLK inhibitors.

[0055] [Figure 49] FIG. 49 is an image of a colony formation assay showing that ESCC cells harboring drug-resistant mutant forms of LZK are resistant to the disclosed MLK inhibitors.

[0056] [Figure 50] FIG. 50 is an image of a colony formation assay showing that ESCC cells are highly sensitive to the two disclosed MLK inhibitors.

[0057] Sequence Listing A Sequence Listing XML (submitted under 37 CFR § 1.831(a) in accordance with §§ 1.832 through 1.834) has been submitted herewith as “Sequence.xml”, created on August 18, 2022 at 20,480 bytes, which is incorporated herein by reference. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand.

[0058] SEQ ID NO:1 is an exemplary nucleotide sequence of the LZK Q240S forward primer.

[0059] SEQ ID NO:2 is an exemplary nucleotide sequence of the LZK Q240S reverse primer.

[0060] SEQ ID NO:3 is an exemplary nucleotide sequence of the LZK K195M forward primer.

[0061] SEQ ID NO:4 is an exemplary nucleotide sequence of the LZK K195M reverse primer.

[0062] SEQ ID NO:5 is an exemplary nucleotide sequence of an Xbal primer to the start of the LZK forward.

[0063] SEQ ID NO:6 is an exemplary nucleotide sequence of a Notl primer to the end of the LZK reverse.

[0064] SEQ ID NO:7 is an exemplary nucleotide sequence of a T7 promoter primer.

[0065] SEQ ID NO:8 is an exemplary nucleotide sequence of a BGH reverse primer.

[0066] SEQ ID NO:9 is an exemplary nucleotide sequence of an Xbal primer forward to the LZK kinase domain.

[0067] SEQ ID NO:10 is an exemplary nucleotide sequence of an Xbal primer reverse to the LZK terminal kinase domain.

[0068] SEQ ID NO:11 is an exemplary nucleotide sequence of a Notl primer reverse to the LZK terminal zipper domain.

[0069] SEQ ID NO:12 is an exemplary nucleotide sequence of a Notl primer reverse to the LZK termination codon.

[0070] SEQ ID NO:13 is an exemplary nucleotide sequence of a MAP3K13 forward primer.

[0071] SEQ ID NO:14 is an exemplary nucleotide sequence of a MAP3K13 reverse primer.

[0072] SEQ ID NO:15 is an exemplary nucleotide sequence of an ACTB forward primer.

[0073] SEQ ID NO:16 is an exemplary nucleotide sequence of an ACTB reverse primer.

[0074] SEQ ID NO:17 is an exemplary nucleotide sequence of a GAPDH forward primer.

[0075] SEQ ID NO:18 is an exemplary nucleotide sequence of a GAPDH reverse primer.

[0076] SEQ ID NO:19 is an exemplary DNA sequence encoding an shRNA.

[0077] SEQ ID NO:20 is an exemplary DNA sequence encoding an shRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0078] Detailed Description The present disclosure relates to mixed lineage kinase (MLK) inhibitors and methods of making and using these inhibitors. MLK is involved in head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, and breast cancer. For example, LZK is involved in both head and neck squamous cell carcinoma (HNSCC) and lung squamous cell carcinoma (LSCC). LZK has also been shown to regulate c-MYC protein stability in hepatocellular carcinoma and is required to maintain hepatocellular carcinoma cell growth (Zhang et al., Cell Death & Differentiation 2020, 27:420-433). Furthermore, LZK is amplified in 20% of ovarian cancers, 25% of small cell lung cancers, 20% of neuroendocrine prostate cancers, and 20% of esophageal adenocarcinomas, suggesting LZK as a driver in these additional cancers. MLK3 is amplified in 10% of head and neck cancers with 11q amplicons. MLK4 is a driver in 25% of triple-negative breast cancers with MAP3K21 (MLK4) amplification.

[0079] Kinase signaling pathways are essential for cell survival and proliferation, and kinase inhibition is an established approach to treat many forms of cancer. Leucine zipper-containing kinase (LZK, MAPK3K13) is a serine / threonine kinase with high homology to MAPK3K12 (DLK) (Patel et al., J Med Chem 2015, 58:8182-8199). LZK has been shown to be amplified or have copy number gain in the majority of HNSCC tumors, making it an attractive target for therapy. LZK regulates c-MYC (Soth et al., US2018 / 0057507 A1; Soth et al., US10,093,664 B2) and the PI3K / AKT pathway in a kinase-dependent manner. Furthermore, c-MYC and the PI3K / AKT pathway have been implicated in a wide variety of cancers. Preventing the upregulation of these pathways by inhibiting LZK is of broad interest to cancer researchers.

[0080] LZK can directly phosphorylate the MAP2K (MAP kinase kinase) MKK7 and MKK4, leading to JNK (c-Jun N-terminal kinase) pathway activation (Ikeda et al., J Biochem 2001, 130:773-781). Amplified endogenous LZK does not activate the JNK pathway in HNSCC (Edwards et al., Cancer Res 2017, 77:4961-4972; Ikeda et al.). However, overexpressed LZK leads to JNK pathway activation, which can be used as a readout to evaluate catalytic inhibitors of LZK (Edwards et al.). In HNSCC, copy number alterations are frequently observed, with distal amplification of chromosome 3 (3q26-3q29, 3q amplicon) being the most common (TCGA, Nature 2012, 489:519-525), which contains the protein LZK encoded by MAP3K13. This amplification occurs in 20% of HNSCC patients, with another 50% showing gain of chromosome 3q (Edwards et al., Cancer Res 2017, 77:4961-4972).

[0081] MLK4 is a serine-threonine kinase that phosphorylates JNK, p38 MAPK, and extracellular signal-regulated kinase (ERK) signaling pathways (Marusiak et al., Oncogene 2019, 38:2860-2875). MLK4 can directly phosphorylate MEK, leading to activation of the ERK pathway (ibid.). MLK4 also regulates activation of the transcription factor NF-κB (ibid.). MLK4 is overexpressed in 23% of invasive breast cancers, particularly triple-negative breast cancers (TNBCs) (ibid.). MLK4 also promotes TNBC chemoresistance by regulating pro-survival responses to DNA-damaging treatments (Mehlich et al., Cell Death and Disease 2021, 12:1111).

[0082] MLK3 is another serine-threonine kinase that is involved in the NF-κB, ERK, JNK, and p38 MAP kinase pathways (Brancho et al., Mol Cell Biol 2005, 3670-3681). MLK3 signaling has been implicated in several cancers, including head and neck cancers that carry the 11q amplicon.

[0083] Some examples of the disclosed compounds inhibit MLK activity, thereby reducing the viability of cancer cells and / or suppressing tumor growth in vivo. For example, inhibiting LZK activity reduces the viability of cancer cells with amplified MAP3K13 in vivo and / or suppresses tumor growth. The oncogene c-MYC has been identified as a downstream target regulated by the catalytic activity of LZK. Advantageously, some embodiments of the disclosed compounds can suppress LZK kinase-dependent stabilization of MYC and activation of the PI3K / AKT pathway. In addition, some examples of the disclosed compounds promote nearly complete cell death in a cell line-based model of head and neck squamous cell carcinoma (HNSCC) and significant levels of cell death in a lung squamous cell carcinoma (LSCC) model. I. Terms and Abbreviations

[0084] The following explanation of terms and abbreviations is provided to better explain the present disclosure and to guide those skilled in the art in carrying out the present disclosure.As used herein, "comprising" means "including", and the singular form "a" or "an" or "the" includes plural references unless the context clearly dictates otherwise.The term "or" refers to a single element or a combination of two or more elements of the alternative elements described, unless the context clearly dictates otherwise.

[0085] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs.Methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, but suitable methods and materials are described below.The materials, methods, and examples are illustrative only and are not intended to be limiting.Other features of this disclosure will be apparent from the following detailed description and claims.

[0086] The disclosure of a numerical range should be understood to refer to each separate point within the range, including the endpoints, unless otherwise stated. Unless otherwise indicated, all numbers expressing amounts of components, molecular weights, percentages, temperatures, times, etc., should be understood to be modified by the term "about" when used in the specification or claims. Thus, unless otherwise indicated, either implicitly or explicitly, or unless the context would be reasonably understood by one of ordinary skill in the art to have a more restrictive interpretation, the numerical parameters indicated are approximations that may depend on the desired properties sought and / or the detection limits under standard test conditions / methods as known to those of ordinary skill in the art. When the aspect is directly and explicitly identified from the prior art discussed, the aspect number is not an approximation unless the word "about" is recited.

[0087] Although alternatives exist for the various components, parameters, operating conditions, etc., presented herein, that does not mean that the alternatives are necessarily equivalent and / or will perform equally well, nor is it meant that the alternatives are listed in order of preference unless otherwise stated.

[0088] Definitions of common terms in chemistry can be found in Richard J. Lewis, Sr. (ed.), Hawley's Condensed Chemical Dictionary, 2016 (ISBN 978-1-118-13515-0), published by John Wiley & Sons, Inc. In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided:

[0089] Administration: Providing or administering to a subject an agent, such as one or more compounds provided herein, by any effective route. Exemplary administration routes include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intraosseous, intraventricular, intrathecal, and intratumoral), sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes.

[0090] Aliphatic: Substantially hydrocarbon-based compounds, including alkanes, alkenes, and alkynes, including their cyclic (monocyclic, bicyclic, and polycyclic) versions, and further including linear and branched chain configurations, and all stereo- and positional isomers, or radicals thereof (e.g., CH for the hexane radical). 13 ). Unless expressly stated otherwise, an aliphatic group contains 1 to 25 carbon atoms; for example, 1 to 15, 1 to 10, 1 to 6, or 1 to 4 carbon atoms. The aliphatic chain may be substituted or unsubstituted. Unless expressly referred to as "unsubstituted aliphatic", an aliphatic group may be either unsubstituted or substituted. An aliphatic group may be substituted with one or more substituents (up to two substituents at each methylene carbon in the aliphatic chain, or up to one substituent at each carbon of the -C=C- double bond in the aliphatic chain, or up to one substituent at the carbon of the terminal methine group). A substituted aliphatic group contains at least one sp 3 -hybridized carbon or two sp bonded by a double bond 2-hybridized carbon or at least two sp-hybridized carbons linked by a triple bond. Exemplary substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic, heteroaliphatic, heteroaryl, heteroalicyclic, hydroxyl, oxo, sulfonamido, sulfhydryl, thioalkoxy, or other functional groups.

[0091] Alkoxy: A radical (or substituent) having the structure -OR, where R is a substituted or unsubstituted aliphatic group. Methoxy (-OCH3) is an exemplary alkoxy group. In a substituted alkoxy, R is an alkyl substituted with a non-interfering substituent. R may be linear, branched, cyclic, or a combination thereof (e.g., cyclopropylmethoxy).

[0092] Alkyl: A hydrocarbon radical or substituent having a saturated carbon chain. The chain may be cyclic, branched or unbranched. Unless specifically designated as an "unsubstituted alkyl", the alkyl group may be either unsubstituted or substituted. Without limitation, examples of alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl. The term lower alkyl refers to a chain containing 1 to 10 carbon atoms. The terms alkenyl and alkynyl refer to hydrocarbon groups having carbon chains containing one or more double or triple bonds, respectively.

[0093] Alkylamino: An amino group having an alkyl substituent, e.g., -N(H)R or -N(R)R', where R and R' are alkyl groups, and the bond to the remainder of the molecule is through the nitrogen atom. The alkyl portion may be straight-chained, branched, or cyclic.

[0094] Alkylaryl: an alkyl substituted aryl group.

[0095] Amino: The chemical functional group -N(R)R', where R and R' are independently hydrogen, alkyl, heteroalkyl, haloalkyl, aliphatic, heteroaliphatic, aryl (such as optionally substituted phenyl or benzyl), heteroaryl, alkylsulfano, or other functional group. A "primary amino" group is -NH2. "Monosubstituted amino" or "secondary amino" means the radical -N(H)R substituted as above, including, for example, methylamino, (1-methylethyl)amino, phenylamino, and the like. "Disubstituted amino" or "tertiary amino" means the radical -N(R)R substituted as above, including, for example, dimethylamino, methylethylamino, di(1-methylethyl)amino, and the like.

[0096] Amino acid: an organic acid that contains both a basic amino group (-NH2) and an acidic carboxyl group (-COOH). The 25 amino acids that are protein constituents are α-amino acids, that is, the -NH2 group is attached to the carbon atom next to the -COOH group. As used herein, the term amino acid also includes D-amino acids and non-naturally occurring amino acids, such as ornithine and 2,4-diaminobutyric acid.

[0097] Aminoalkyl: An alkyl group containing at least one amino substituent, where the attachment to the remainder of the molecule is through a carbon atom of the alkyl group. The alkyl portion may be straight-chain, branched, or cyclic.

[0098] Aryl: A monovalent aromatic carbocyclic group of 6 to 15 carbon atoms, unless otherwise specified, having a single ring (e.g., phenyl) or multiple condensed rings in which at least one ring is aromatic (e.g., quinoline, indole, benzodioxole, pyridine, pyrimidine, pyrazole, benzopyrazole, thiazole, isoxazole, oxazole, triazole, etc.), provided that the point of attachment is through an atom in the aromatic portion of the aryl group and that the aromatic portion of the attachment point contains only carbon in the aromatic ring. If any aromatic ring portion contains a heteroatom, the group is a heteroaryl and not an aryl. An aryl group may be monocyclic, bicyclic, tricyclic, or tetracyclic. Unless specifically referred to as an "unsubstituted aryl," an aryl group may be either unsubstituted or substituted.

[0099] Arylalkyl: An aryl-substituted alkyl group in which the bond to the rest of the molecule is through a carbon atom in the alkyl group, for example, benzyl.

[0100] Azaalkyl: A heteroalkyl group that contains a nitrogen heteroatom. The heteroalkyl group may be linear, branched, or cyclic. The azaalkyl group is attached to the remainder of the molecule via the nitrogen heteroatom. Unless specifically designated as an "unsubstituted azaalkyl," the azaalkyl group may be either unsubstituted or substituted.

[0101] Derivative: A compound derived from a similar compound, or one that can be imagined to result from another compound, for example, when one atom is replaced by another atom or group of atoms. The latter definition is common in organic chemistry. In biochemistry, the term is used for compounds that can, at least in theory, be formed from a precursor compound.

[0102] Dissociation constant (K D ): a measure of binding affinity. K D is the molar concentration of ligand at which half of the binding sites on the target protein are occupied by the ligand at equilibrium. A smaller Kd indicates increased binding affinity.

[0103] DLK: dual leucine zipper-containing kinase.

[0104] ESCC: Esophageal squamous cell carcinoma.

[0105] Additive: A physiologically inactive substance used as an additive in a pharmaceutical composition. As used herein, an additive may be incorporated into or physically mixed with the particles of a pharmaceutical composition. For example, an additive may be used to dilute the active agent and / or to modify the properties of a pharmaceutical composition. Examples of additives include, but are not limited to, polyvinylpyrrolidone (PVP), tocopheryl polyethylene glycol 1000 succinate (also known as vitamin E TPGS, or TPGS), dipalmitoyl phosphatidylcholine (DPPC), trehalose, sodium bicarbonate, glycine, sodium citrate, and lactose.

[0106] Heteroaliphatic: an aliphatic compound or group having at least one carbon atom and at least one heteroatom in the chain, i.e., one or more carbon atoms are replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Heteroaliphatic compounds or groups can be substituted or unsubstituted, branched or unbranched, cyclic or acyclic, including "heterocycle", "heterocyclyl", "heteroalicyclic", or "heterocyclic" groups. Heteroalkyl has at least one carbon atom in the chain and is not N, O, S, or S(O). n (where n is 1 or 2). Unless specifically designated as "unsubstituted aliphatic," an aliphatic group can be either unsubstituted or substituted.

[0107] Heteroaryl: An aromatic compound or group having at least one heteroatom, i.e., one or more carbon atoms in the ring are replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Unless specifically designated as an "unsubstituted heteroaryl," a heteroaryl group can be either unsubstituted or substituted.

[0108] Heterocyclic: refers to a closed ring compound in which at least one atom in the ring structure is other than carbon, typically oxygen, sulfur, and / or nitrogen, or a radical thereof as a substituent bonded to another group, particularly another organic group. Unless specifically designated "unsubstituted heterocyclic," a heterocyclic group can be either unsubstituted or substituted.

[0109] HNSCC: Head and neck squamous cell carcinoma.

[0110] IAP: Inhibitor of apoptosis proteins. Includes cIAP-cellular IAP 1, and xIAP-X-linked IAP.

[0111] LSCC: Lung squamous cell carcinoma.

[0112] LZK: Leucine zipper-containing kinase, a regulator of neurodegeneration, for example after neuronal injury and / or in neurodegenerative diseases. MAP3K: Mitogen-activated kinase kinase kinase MDM2: Mouse double minute 2 homologue

[0113] MLK: mixed lineage kinase, a family of serine / threonine protein kinases that regulate signaling through the p38 mitogen-activated protein kinase (MAPK) and c-Jun amino-terminal kinase (JNK) pathways. The MLKs include MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), DLK (MAP3K12), LZK (MAP3K13), and ZAK1 (MAP3K20), among others.

[0114] Pharmaceutically acceptable: A substance that may be administered to a subject without significant adverse toxicological effects to the subject. The term "pharmaceutically acceptable form" refers to any pharmaceutically acceptable derivative or modification, such as stereoisomers, stereoisomeric mixtures, enantiomers, solvates, hydrates, isomorphs, polymorphs, pseudomorphs, neutral forms, salt forms, and prodrug agents.

[0115] Pharmaceutically acceptable carriers: Pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21 st Edition (2005) describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions and additional pharmaceutical agents. In general, the nature of the carrier will depend on the particular mode of administration used. For example, parenteral formulations usually contain an injectable fluid that includes a pharma- ceutical and physiologically acceptable fluid as a vehicle, such as, for example, water, physiological saline, balanced salt solution, aqueous dextrose, glycerol, and the like. In some cases, the pharma- ceutical acceptable carrier can be sterile so as to be suitable for administration to a subject (e.g., by parenteral, intramuscular, or subcutaneous injection). In addition to a biologically neutral carrier, the pharmaceutical composition to be administered can contain small amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, such as, for example, sodium acetate or sorbitan monolaurate. In some cases, the pharma- ceutical acceptable carrier is a non-naturally occurring or synthetic carrier. The carriers can also be formulated in unit dosage forms, such as pills, vials, bottles, or syringes, each containing a preselected therapeutic dosage of the active agent.

[0116] Pharmaceutically acceptable salts: Biologically compatible salts of compounds that can be used as drugs, derived from a variety of organic and inorganic counterions that are well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; where the molecule contains a basic functional group, e.g., salts of organic or inorganic acids such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. Pharmaceutically acceptable acid addition salts are those salts formed with acid partners which are not biologically or otherwise undesirable, such as inorganic acids, e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids, e.g., acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, benzenesulfonic acid (besylate), cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like, while retaining the biological effectiveness of the free base. Pharmaceutically acceptable base addition salts include those derived from inorganic bases, e.g., sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharma- ceutically acceptable organic non-toxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like.Exemplary organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine (see, e.g., SM Berge, et al., "Pharmaceutical Salts," J. Pharm. Sci., 1977; 66:1-19, incorporated herein by reference).

[0117] Stereoisomers: isomers that have the same molecular formula and sequence of bonded atoms, but differ only in the three-dimensional orientation of the atoms in space.

[0118] Subject: An animal (human or non-human) that is subjected to treatment, observation or experiment. Includes both human and veterinary subjects, including human and non-human mammals such as rats, mice, cats, dogs, pigs, horses, cows, and non-human primates. In some embodiments, the subject has cancer, such as head and neck squamous cell carcinoma or lung squamous cell carcinoma.

[0119] Substituent: An atom or group of atoms that replaces another atom in a molecule as a result of a reaction. The term "substituent" typically refers to an atom or group of atoms that replaces one hydrogen atom on a parent hydrocarbon chain or ring, or two hydrogen atoms if the substituent is attached via a double bond. The term "substituent" can also cover a group of atoms that has multiple points of attachment to the molecule, for example, a substituent replaces two or more hydrogen atoms on a parent hydrocarbon chain or ring. In such a situation, the substituent may be attached in any spatial orientation to the parent hydrocarbon chain or ring, unless otherwise specified. Exemplary substituents include, for example, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, arylamino, carbonate, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic (e.g., haloalkyl), haloalkoxy, heteroaliphatic, heteroaryl, heteroalicyclic, hydroxyl, oxo, sulfonamido, sulfhydryl, thio, and thioalkoxy groups. Substituents can be further substituted unless expressly stated otherwise or unless the context dictates otherwise.

[0120] Substituted (substituted): A base compound, such as an aryl or aliphatic compound, or a radical thereof, to which one or more substituents are coupled, each of which typically replaces a hydrogen atom on the base compound. Those skilled in the art will recognize that the compounds disclosed herein may be described in terms of a particular structure and the substituents coupled to such structure, and that such structures and / or substituents may also be further substituted unless expressly stated otherwise or the context dictates otherwise. By way of example only and not limitation, a substituted aryl compound may have an aliphatic group coupled to an aryl-based ring closure, such as toluene. Again by way of example only and not limitation, a long-chain hydrocarbon may have a hydroxyl group attached thereto.

[0121] Tautomers: structural isomers of organic compounds that differ only in the position of protons and electrons and are interconvertible by the shift of a hydrogen atom. Tautomers usually exist together in equilibrium.

[0122] Therapeutically effective amount or dose: An amount sufficient to provide a beneficial or therapeutic effect to a subject, or to a given percentage of subjects.

[0123] Treating or treatment: With respect to a disease, either term includes (1) preventing the disease, e.g., causing clinical symptoms of the disease to not occur, in an animal that may be exposed to or susceptible to the disease, but that has not yet experienced or shown symptoms of the disease; (2) inhibiting the disease, e.g., halting the development of the disease or its clinical symptoms; or (3) relieving the disease, e.g., causing the disease or its clinical symptoms to regress. ZAK: zippersteryl-α motif kinase

[0124] II. Mixed-lineage kinase inhibitors The disclosed mixed lineage kinase (MLK) inhibitors include those having the general formula I: [ka] or a stereoisomer, tautomer, or pharma- ceutically acceptable salt thereof. [In the formula, [ka] Each bond represented by is a single bond or a double bond as required to satisfy valence requirements. Ring A is a monocyclic or bicyclic heteroaryl ring. In some embodiments, Ring A is [ka] and [ka] Each bond represented by -X is a single bond or a double bond as needed to satisfy valence requirements. 1 (R 5 )-part is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -NC(R 5 )-, or -N(R 5 )-. X 2 is N or C. X 3 is N or C(H). X 1 ~X 3 One or two of X contains N. 4 is C(H) or S. X 5 is -N(H)- or absent. 1 is C(R 1 ) or N. Y 2 is C(R 2 ) or N. Y 3 is C(R 3 ) or N. Y 4 is N or C(R 6 ) Y 5 is C(R 7 ) or N. Y 6 is C(R 8 ) or N. Y 1 ~Y 6 One or two of Y are N. 1 ~Y 6 When two of Y are N, the nitrogens do not have to be immediately adjacent to each other. 1 ~Y 3 or Y 6 At least one of Y is other than C(H). 7 ~Y 10 Two, three or four of the 9 ), and Y 7 ~Y 10 The others are C(R 10 ) wherein the nitrogen atoms may be directly adjacent to one another or separated by at least one carbon atom.7 ~Y 10 Two of the are independently N or N(R 9 ), and Y 7 ~Y 10 The other two are C(R 10 ) R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl; 1 and R 2 R together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R', where R' is alkyl or R 2 and R 3 R together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 4 is aliphatic, azaalkyl, aryl, or amino. 5 is aliphatic, heteroaliphatic, or alkylamino. 6 and R 7 is independently H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano, or R 8 and R 1 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. 9 is independently H or alkyl. 10is independently H, alkyl, or cyano. In any of the above or following embodiments, halogen may be fluorine. In any of the above or following embodiments, each substituent may be substituted or unsubstituted unless otherwise specified or unless the context indicates otherwise (e.g., a cyano group is not substituted). In some embodiments, the compound has the general formula IA or IB: [ka] have [In the formula, [ka] Each bond represented by is a single bond or a double bond as required to satisfy valence requirements.

[0125] In any of the above or following aspects, Y 4 may be N. In some embodiments, Y 1 and Y 4 is N. In any of the above or following embodiments, Y 1 ~Y 3 or Y 6 At least one of may be other than C(H).

[0126] R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy. 1 Groups include, but are not limited to, cyano, -H, -OCF, or -CF. In certain embodiments, R 1 is cyano, -H, or -OCF3.

[0127] R 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyanoalkyl, alkyl, cyano, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl; 1 and R 2together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In some embodiments, R 2 The alkyl or alkoxy portion of R is C1-C6 alkyl or alkoxy. For example, R 2 may be methoxy, fluoromethoxy, or trifluoromethoxy. In some embodiments, R 2 At least a portion of the alkyl moieties in R are cycloalkyl, such as cyclopropyl or bicyclo[1.1.1]pentyl. The alkyl or alkoxy moieties may be halogenated. In certain embodiments, R 2 is fluorinated. Exemplary R 2 Groups include, but are not limited to, -CH3, -OCH3, -OCF3, -CF3, -CN, -H, -OCHF2, [ka] In some embodiments, R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In one non-limiting example, ring A is [ka] It is.

[0128] R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R', where R' is alkyl or R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In some embodiments, R 3 is H, -NH2, -N(H)C(O)CH3, methyl, [ka] In some embodiments, R 2 and R 3together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring. In one example, ring A is [ka] It is.

[0129] In some embodiments, Ring A is [ka] and Y 1 is C(H) or N, and Y 2 is C(R 2 ), and Y 3 is C(R 3 ), and Y 4 is N and Y 6 is C(H). In certain embodiments, Y 1 and Y 4 is N. In some embodiments, ring A is [ka] and Y 1 is C(H) or N, and Y 2 is C(R 2 ), and Y 3 is C(R 3 ), and Y 4 is N and Y 5 is C(H). In some embodiments, R 2 is alkyl, H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, or cyanoalkyl; R 3 is H, amino, alkylamino, or aminoalkyl. In a particular example, halogen is fluorine.

[0130] R 6 ~R 8 is independently H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. In some embodiments, R 6 ~R 8is H, methyl, -OCH3, -CF3, -OCF3, or -CN. In certain embodiments, R 6 ~R 8 is H. In some embodiments, Y 4 is N, so R 6 does not exist. Ring A is Y 5 or Y 6 It is connected to the rest of the compound via R 7 or R 8 Either of them will not exist.

[0131] Each R 9 is independently H or alkyl. In some embodiments, each R 9 is independently H or methyl. 10 is independently H, alkyl, or cyano. In some embodiments, R 10 are independently H, methyl, or cyano.

[0132] In any of the above or following embodiments, unless otherwise specified, an aliphatic, heteroaliphatic, or azaalkyl group can be linear, branched, cyclic, or any combination thereof. In some embodiments, Ring A is: [ka] and R 11 and R 12 is H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.

[0133] In one particular example, ring A is: [ka] [ka] and R 2 is -CF3, -OCF3, -OCHF2, -OCH3, -CN, or -H, and R 11 is -CF3, -OCF3, -CN, or -H.

[0134] In some embodiments, the compound has formula IC, ID, IE, or IF: [ka] [ka] It has a structure according to the following:

[0135] In any of the above or following aspects, -X 1 (R 5 )- is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -NC(R 5 )-, or -N(R 5 In some embodiments, -X 1 (R 5 )- is -C(H)-C(R 5 )-.

[0136] In some embodiments, the compound has the formula IC, where R 1 is cyano or perhaloalkyl; R 2 and R 3 is H. R 1 may be cyano or trifluoromethyl. In certain embodiments, R 1 is cyano. In certain embodiments, the compound has the formula IC, where R 1 is H and R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.

[0137] In some embodiments, the compound has the formula ID, 3 is H and R 2 is other than H. In some embodiments, the compound has formula ID, 2 and R 3is other than H. In some embodiments, the compound has formula ID, 2 is H and R 3 is other than H. In certain embodiments, the compound has formula ID, 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.

[0138] In some embodiments, the compound has the formula IE, where R 2 is H, alkyl, alkoxy, amino, or cyano; R 3 is H, amino, or alkyl; R 8 is H or alkyl. In some examples, alkyl or alkoxy is methyl or methoxy, respectively.

[0139] In some embodiments, the compound has the formula IF, where R 2 is haloalkyl, perhaloalkyl, alkoxy, haloalkoxy, perhaloalkoxy, cyano, or H; R 3 is amino, aminoalkyl, or alkylamino; R 7 is H or alkyl. In certain embodiments, R 7 is H and R 3 is -NH2, [ka] and R 2 -CF3, -CN, -H, -OCH3, -OCHF2, OCF3, [ka] It is.

[0140] In any of the above or following embodiments, R 3 may be H, amino, aminoalkyl, or alkylamino; R 2may be alkyl, alkoxy, haloalkoxy, perhaloalkoxy, perhaloalkyl, haloalkyl, or cyano. In certain examples, R 2 is -CH3, R 3 is -H. In some embodiments, R 3 is -NH2, [ka] [ka] and R 2 are -OCH3, -OCF3, -CF3, -CN, -OCHF2, [ka] , or H. In certain instances, R 2 is -OCF3, -CF3, -OCHF2, -OCH3, or -CN. In any of the above or following aspects, [ka] teeth, [ka] R may be 4 is aliphatic, azaalkyl, aryl, or amino. 5 is aliphatic, heteroaliphatic, aminoalkyl, or alkylamino.

[0141] In some embodiments, R 4is C1-C5 alkyl, azacycloalkyl, heterocycloalkyl, or -N(R)R', where R and R' are independently hydrogen, alkyl, or heteroalkyl. In some embodiments, the azacycloalkyl or heterocycloalkyl is a fused or spiro azabicycloalkyl or heterobicycloalkyl. For example, the azabicycloalkyl can be azabicyclo[3.2.0]heptan-3-yl or azabicyclo[3.1.0]hexan-3-yl. In certain embodiments, R 4 is 3,3-difluoro-1-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropylmethyl, or -C(H)(OH)-CH(CH3)2, cyclopropyl, [ka] [ka] It is.

[0142] In some embodiments, R 5 is alkyl, heteroalkyl, alkylamino, or azaalkyl. In certain embodiments, R 5 In some examples, R 5 is a fused or spiro bicycloalkyl, heterobicycloalkyl, or azabicycloalkyl. In some embodiments, R 5 teeth, [ka] and Z is alkoxy, H, aliphatic, or heteroaliphatic. In certain embodiments, Z is -C(O)CH3, H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl, -(CH2)2(OCH2CH2) n OCH3, where n is an integer from 1 to 10, or [ka] In some embodiments, Z is -C(O)CH3. [ka] is the stereochemistry [ka] In one embodiment, R 5 teeth, [ka] and Z is -C(O)CH3. In another embodiment, R 5 teeth, [ka] and Z is -C(O)CH3. In some embodiments, R 5 teeth, [ka] , -(CH2)3N(CH3)2, or -CH2OH.

[0143] In some embodiments, the compound is: [ka] [ka] and R 1 ~R 4 and R 8 is as previously defined, and R 11 and R 12 is H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, or cyano. In some embodiments, R 4 is isopropyl, -C(H)(OH)-C(CH3)2, cyclopropyl, or [ka] In certain embodiments, R 1 is -CN or -CF3; R 2 are -OCH3, -OCF3, -CF3, -CN, -OCHF2, [ka] or H;R 3 is -NH2, [ka] or H;R 8 is -OCF3, -CN, -CH3, or H; R 11 and R 12 are independently -CF3, -CN, -H, -OCH3, or -OCF3.

[0144] In certain embodiments, the compound [ka] teeth, [ka] and R 2 ~R 5 , R 8 and Z is as previously defined. In certain embodiments, the compound is [ka] and Z is aliphatic; R 4 teeth, [ka] and R a and R b form, together with the atoms to which they are attached, a fused alicyclic or heteroalicyclic ring, or R a is alicyclic, and R b is -H or R 4 teeth, [ka] and R a In some embodiments, R 2 is alkyl, such as methyl. Exemplary alicyclic and heteroalicyclic R 4 Groups include, but are not limited to, [ka] and the like.

[0145] In some embodiments, Ring A is [ka] and R 5 but [ka] If (i) X 5 is N(H), or (ii) R 3 is H, aminoalkyl, alkoxy, [ka] or R'C(O)N(H)-, where R' is alkyl; or (iii) R 2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy; or (iv) R 1 and R 7 or (v) X 1 ~X 4 or (vi) only one of X 3 is C(H), or (vii) X 4 is S or (vi)-X 1 (R 5 )- is -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, or -NC(R5 )- or (viii) R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.

[0146] In some embodiments, Ring A is [ka] and R 3 is amino or alkylamino, [ka] but, [ka] If (i) X 5 is N(H), or (ii) R 1 is cyano, perhaloalkyl, or perhaloalkoxy; or (iii) R 2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy; or (iv) R 7 is perhaloalkyl, perhaloalkoxy, or cyano; or (v) R 4 is aryl; or (vi) R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring, or (viii) R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.

[0147] In some embodiments, X 5 is N(H), [ka] but, [ka] If so, then R 5 teeth, [ka] In some embodiments, X 5 is N(H), [ka] but, [ka] When the formula is: [ka] or (ii) R 4 is not methyl or azacycloalkyl, or (iii) R 5 teeth, [ka] In some embodiments, X 5 is N(H), [ka] but, [ka] When the formula is: [ka] or (ii) R 5 teeth, [ka] [ka] In some embodiments, X 5 is N(H) and ring A is [ka] If so, then R 5 teeth, [ka] isn't it.

[0148] In some embodiments, X 5 does not exist, [ka] but, [ka] If so, then R 5 teeth, [ka] or ring A is [ka] In some embodiments, X 5 does not exist, [ka] but, [ka] If (i) R 5 teeth, [ka] or (ii) ring A is [ka] isn't it.

[0149] In some embodiments, X 5 is N(H), [ka] but, [ka] If (i) R 5 teeth, [ka] or (ii) Y 4 is not N, or (iii) R 2 is not -H, -CN, or -CF3, or (iv) R 1 is not -H, -CN, or -CF3. 5 is N(H), [ka] but, [ka] If (i) R 4 is not a cycloalkyl or heterocycloalkyl; or (ii) Y 4 is not N or (iii) R 1 is not -CN, or (iv) R 2 , R 3 , and R 8 is other than H, or (v) R 5 is alkyl, [ka] [ka] In some embodiments, ring A is [ka] and X 5 If N(H), then R 5 teeth, [ka] isn't it.

[0150] Exemplary MLK inhibitors include the compounds shown in Tables 1-17, as well as other stereoisomers, tautomers, and pharma- ceutically acceptable salts. [Table 1-1] [Table 1-2] [Table 2] [Table 3-1] [Table 3-2] [Table 4] [Table 5-1] [Table 5-2] [Table 6-1] [Table 6-2] [Table 7] [Table 8] [Table 9-1] [Table 9-2] [Table 10-1]

Table 10-2

Table 10-3

Table 10-4

Table 11

Table 12

Table 13-1

Table 13-2

Table 14-1

Table 14-2

Table 14-3

Table 15-1

Table 15-2

Table 15-3

Table 16-1

Table 16-2

Table 17-1

Table 17-2

[0151] In any of the above or following embodiments, the MLK inhibitor may exhibit membrane permeability and / or water solubility. Permeability and solubility are related to the topological polar surface area (TPSA) and molecular weight of the MLK inhibitor. Desired solubility may be provided by a molecule having a TPSA of 0.1×MW or more (i.e., a TPSA / MW ratio of ≧0.1) (see, e.g., Maple et al., Med Chem Commun 2019, 10:1755-1764). In some embodiments, water solubility is enhanced by forming the MLK inhibitor as a common salt (e.g., acetate, oxalate, methanesulfonate) or from a common acid such as hydrochloric acid or sulfuric acid. Advantageously, since some examples of MLK inhibitors are catalytic in nature, relatively low aqueous solubility may not be an inhibitor. Desired permeability may be provided by a molecule having a TPSA of less than 140 (ibid.). Thus, in some embodiments, the MLK inhibitor has a TPSA of 0.1×MW to 140.

[0152] In any of the above or below embodiments, the MLK inhibitor has an MLK dissociation constant K of less than 200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less than 50 nM, less than 25 nM, less than 10 nM, or even less than 5 nM. D In any of the above or following embodiments, the MLK inhibitor can be an LZK inhibitor that selectively binds to LZK over dual leucine zipper kinase (DLK). For example, the LZK inhibitor can have a dissociation constant K between LZK and DLK of D In some embodiments, the LZK inhibitor exhibits at least 2-fold selectivity for LZK over DLK, at least 3-fold selectivity, at least 5-fold selectivity, at least 10-fold selectivity, at least 25-fold selectivity, at least 50-fold selectivity, at least 100-fold selectivity, or even at least 150-fold selectivity for LZK over DLK, as evidenced by a ratio of about 1 nM LZK K D and shows 180-fold selectivity for LZK over DLK.

[0153] In some aspects, the compound is [ka] [ka] isn't it. III. Pharmaceutical Compositions

[0154] The disclosure also encompasses pharmaceutical compositions comprising one or more of the disclosed MLK inhibitors. The pharmaceutical compositions comprise the compounds as disclosed herein and a pharma- ceutical acceptable excipient.

[0155] The compounds described herein can be used to prepare therapeutic pharmaceutical compositions.The compounds may be added to the composition in the form of salts or solvates.For example, when the compounds are sufficiently basic or acidic to form stable non-toxic acid or base salts, administration of the compounds as salts may be appropriate.Examples of pharmaceutically acceptable salts are organic acid addition salts formed with acids that form physiologically acceptable anions, such as tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, α-ketoglutarate, and b-glycerophosphate.Suitable inorganic salts can also be formed, including hydrochloride, halide, sulfate, nitrate, bicarbonate, and carbonate.

[0156] Pharmaceutically acceptable salts can be obtained using procedures known to those skilled in the art, for example, by reacting a sufficiently basic compound, such as an amine, with a suitable acid to give a physiologically acceptable ionic compound. Alkali metal (e.g., sodium, potassium or lithium) or alkaline earth metal (e.g., calcium) salts of carboxylic acids can also be prepared by similar methods.

[0157] The compounds of the formulas described herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human or veterinary patient, in a variety of forms. The forms can be specifically adapted for a selected route of administration, for example oral, or parenteral administration by intravenous, intramuscular, topical or subcutaneous routes.

[0158] The compounds described herein may be administered systemically in combination with a pharma- ceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier. For oral administration, the compounds may be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or directly incorporated into the food of the patient's diet. The compounds may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations typically contain at least 0.1% of the active compound. The percentage of the compositions and preparations may vary and may conveniently be about 2% to about 60% by weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level can be obtained.

[0159] Tablets, troches, pills, capsules, etc. may contain one or more of the following additives: binders, such as gum tragacanth, gum arabic, corn starch, or gelatin; excipients, such as dicalcium phosphate; disintegrating agents, such as corn starch, potato starch, alginic acid, etc.; and lubricants, such as magnesium stearate. Sweeteners, such as sucrose, fructose, lactose, or aspartame; or flavoring agents, such as peppermint, oil of wintergreen, or cherry flavoring, may be added. When the unit dosage form is a capsule, it may contain, in addition to the above types of materials, a liquid carrier, such as vegetable oil or polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For example, tablets, pills, or capsules may be coated with gelatin, wax, shellac, sugar, and the like. Syrup or elixir may contain active compound, sucrose or fructose as sweetener, methyl and propyl parabens as preservatives, dyes and flavorings such as cherry or orange flavor. Any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts used. In addition, active compound may be incorporated into sustained release preparations and devices.

[0160] The active compound may be administered intravenously or intraperitoneally by infusion or injection.The solution of the active compound or its salt may be prepared in water, and may be mixed with non-toxic surfactant if necessary.Dispersion may be prepared in glycerol, liquid polyethylene glycol, triacetin, or mixture thereof, or in pharmaceutically acceptable oil.Under normal conditions of storage and use, the preparation may contain a preservative to prevent the growth of microorganisms.

[0161] Pharmaceutical dosage forms suitable for injection or infusion may include sterile aqueous solutions, dispersions, or sterile powders containing the active ingredient adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The final dosage form should be sterile, fluid, and stable under the conditions of manufacture and storage. The liquid carrier or vehicle may be, for example, a solvent or liquid dispersion medium, including water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, non-toxic glyceryl esters, and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thiomersal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by agents delaying absorption, for example, aluminum monostearate and / or gelatin.

[0162] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in a suitable solvent with various other ingredients as listed above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method can include vacuum drying and freeze-drying techniques that result in a powder of the active ingredient and any additional desired ingredients present in the previously sterile-filtered solution.

[0163] The useful dosage of the compounds described herein can be determined by comparing their in vitro activity and in vivo activity in animal models.Methods for extrapolating the effective dosage in mice and other animals to humans are known in the art; see, for example, U.S. Patent No. 4,938,949 (Borch et al.).The amount of compound or its active salt or derivative required for use in treatment varies not only with the specific compound or salt selected, but also with the route of administration, the nature of the condition being treated, and the age and condition of the patient, and is ultimately at the discretion of the attending physician or clinician. IV. How to use

[0164] The disclosed compounds are MLK inhibitors. In some aspects, the method of inhibiting MLK activity comprises contacting a cell expressing MLK with an effective amount of a compound as disclosed herein, thereby inhibiting MLK activity. In some embodiments, MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof. In certain embodiments, MLK is LZK, MLK3, or MLK4. In certain examples, MLK is LZK.

[0165] The contacting may be in vivo, in vitro, or ex vivo. In any of the above or following embodiments, inhibiting MLK activity may further inhibit cell cycle progression, reduce c-MYC expression, inhibit c-Jun N-terminal kinase (JNK) pathway signaling, inhibit PI3K / AKT pathway signaling, inhibit cyclin-dependent kinase 2 (CDK2) activity, extracellular signal-regulated kinase (ERK) pathway signaling, NF-κB signaling, or any combination thereof. In some embodiments, the inhibition or reduction is at least 10%, at least 25%, at least 50%, or at least 75% compared to cell cycle progression, c-MYC expression, JNK pathway signaling, PI3K / AKT pathway signaling, CDK2 activity, ERK pathway signaling, or NF-κB signaling in the absence of the MLK inhibitor. In any of the above or following embodiments, the cell may be characterized by chromosome 3q amplification, chromosome 11q amplification, overexpression of mitogen-activated protein kinase kinase kinase (MAP3K), or any combination thereof. In some embodiments, the MAP3K is MAP3K13 or MAP3K21.

[0166] In any of the above or following embodiments, the cell can be a cancer cell. Some cancers are driven by MLK. For example, LZK is involved in head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), esophageal squamous cell carcinoma (ESCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, and neuroendocrine prostate cancer. MLK3 is a driver that is amplified in about 10% of head and neck cancers with 11q amplicon. MLK4 is described as a novel driver in 25% of triple-negative breast cancers with MAP3K21 amplification. In some embodiments, the cell is HNSCC cell, LSCC cell, hepatocellular carcinoma cell, ovarian cancer cell, small cell lung cancer cell, neuroendocrine prostate cancer cell, esophageal cancer cell (e.g., esophageal squamous cell carcinoma (ESCC) cell or esophageal adenocarcinoma cell), or breast cancer cell (e.g., triple-negative breast cancer (TNBC) cell). In certain embodiments, the cell is a HNSCC, LSCC, ESCC, or TNBC cell.

[0167] In any of the above-mentioned aspects, contacting the cell with the compound may include administering to the subject a therapeutically effective amount of the compound or an amount of a pharmaceutical composition comprising a therapeutically effective amount of the compound. The subject may be identified as a subject that may benefit from MLK inhibition. In some aspects, the subject has a disease or condition characterized at least in part by MLK overexpression. In some embodiments, the MLK is LZK, MLK3, or MLK4. In particular examples, the MLK is LZK. In certain aspects, the disease or condition is cancer. In some examples, the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer (e.g., esophageal squamous cell carcinoma or esophageal adenocarcinoma), or breast cancer (e.g., TNBC). In certain aspects, the cancer is HNSCC, LSCC, ESCC, or TNBC. In any of the above-mentioned embodiments, administering to the subject a therapeutically effective amount of the compound or an amount of a pharmaceutical composition may reduce the viability of the cancer cell, inhibit tumor growth, or a combination thereof. In some embodiments, viability is reduced or tumor growth is inhibited by at least 10%, at least 25%, at least 50%, or at least 75% compared to viability or tumor growth in the absence of the MLK inhibitor.

[0168] The compound or pharmaceutical composition can be administered to the subject by any suitable route. In some embodiments, the compound or pharmaceutical composition is administered to the subject by oral route or in a single bolus delivery, via continuous delivery (e.g., continuous transdermal, mucosal or intravenous delivery), over an extended period of time, or in a repeated administration protocol (e.g., hourly, daily or weekly, repeated administration protocol). In some embodiments, the compound or pharmaceutical composition is administered to the subject by injection. The therapeutically effective dosage of the agent can be provided as repeated doses within a long-term prevention or treatment regimen that will provide clinically significant results for alleviating one or more symptoms or detectable conditions associated with the targeted condition as set forth herein. The determination of the effective dosage in this context is typically based on animal model studies, followed by human clinical trials, and guided by an administration protocol that significantly reduces the incidence or severity of the targeted disease symptoms or condition in the subject. Suitable models in this regard include, for example, mice, rats, birds, pigs, cats, non-human primates, and other accepted animal model subjects known in the art. Alternatively, effective dosage can be determined using in vitro models.By using such models, only routine calculations and adjustments are required to determine the appropriate concentration and dose for administering a therapeutically effective amount of compound (e.g., the amount that is effective for inducing desired immune response or alleviating one or more symptoms of targeted disease).In alternative embodiments, the effective amount or effective dose of a drug can simply inhibit or enhance one or more selected biological activities associated with disease or condition as shown herein, either for treatment or diagnosis purposes.

[0169] The actual dosage of the drug varies with factors such as the disease indication and the specific status of the subject (e.g., the subject's age, size, compatibility, degree of symptoms, morbidity factors, etc.), the time and route of administration, other drugs or treatments administered concomitantly, and the specific pharmacological action of the drug to induce the desired activity or biological response in the subject. The dosage regimen can be adjusted to provide an optimal prophylactic or therapeutic response. A therapeutically effective amount is also an amount in which any toxic or adverse side effects of the drug are outweighed by the therapeutically beneficial effects in clinical terms. A non-limiting range of therapeutically effective amounts of a compound according to any one of formulas I-IV within the methods and formulations of the present disclosure is 0.001 mg / kg body weight to 100 mg / kg body weight, for example, 0.01 mg / kg body weight to 20 mg / kg body weight, 0.01 mg / kg body weight to 10 mg / kg body weight, 0.05 mg / kg body weight to 5 mg / kg body weight, or 0.1 mg / kg to 2 mg / kg body weight. Dosage can be varied by the attending clinician to maintain the desired concentration at the target site (e.g., systemic circulation). Higher or lower concentrations can be selected based on the mode of delivery, e.g., transepidermal or oral delivery versus intravenous or subcutaneous delivery. Dosage can also be adjusted based on the release rate of the formulation administered, e.g., sustained release oral versus injected microparticle or transdermal delivery formulations.

[0170] In any of the above or following embodiments, the therapeutically effective amount may be administered at intervals for a period effective to obtain a therapeutic effect, e.g., reduction in cancer cell viability and / or tumor growth inhibition. In some embodiments, the interval is once a day. In other embodiments, the therapeutically effective amount may be divided into two or more doses administered 24 hours apart. In some embodiments, the effective period is from one day to several months, e.g., from one day to 12 months, from three days to six months, from seven days to three months, from seven to thirty days, or from seven to fourteen days. In certain embodiments, the effective period may be even longer than twelve months, e.g., several years. V. Representative Aspects

[0171] Certain representative embodiments are illustrated in the following numbered paragraphs: 1. General formula I: [ka] or a stereoisomer, tautomer, or pharma- ceutically acceptable salt thereof: [In the formula, Ring A is [ka] and [ka] Each bond represented by -X may be a single or double bond as needed to satisfy valence requirements; 1 (R 5 )- is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -NC(R 5 )-, or -N(R 5 )- and;X 2 is N or C; X 3 is N or CH, and X 1 ~X 3 One or two of the X 4 is CH or S; X 5 is -N(H)- or absent; Y 1 is C(R 1 ) or N;Y 2 is C(R 2 ) or N;Y 3 is C(R 3 ) or N;Y 4 is N or C(R 6 ) and Y 5 is C(R 7 ) or N;Y 6 is C(R 8 ) or N;Y 1 ~Y 6 One or two of the following are N and Y 1 ~Y 3 or Y 6At least one of Y is other than C(H); 7 ~Y 10 Two, three, or four of the 9 ), and Y 7 ~Y 10 The others are C(R 10 ) and R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy; R 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, or heteroarylalkoxy; or R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or R'C(O)N(H)-, where R' is alkyl or R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; R 4 is a substituted or unsubstituted aliphatic, substituted or unsubstituted azaalkyl, or aryl; R 5 is a substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, or substituted or unsubstituted alkylamine; R 6 and R 7 are independently H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano; R 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano, or R 8 and R 1 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; each R 9 is independently H or alkyl; each R 10are independently H, alkyl, or cyano, with the proviso that: (a) Ring A is [ka] and R 5 but, [ka] If (i) X 5 is N(H), or (ii) R 3 is H, aminoalkyl, alkoxy, [ka] or R'C(O)N(H)-, where R' is alkyl; or (iii) R 2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy; or (iv) R 1 and R 7 or (v) X 1 ~X 4 contains N, or (vi) X 3 is C(H), or (vii) X 4 is S or (vi)-X 1 (R 5 )- is -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, or -NC(R 5 )- or (viii) R 1 and R 2 together with the atom to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; (b) Ring A is [ka] and R 3 is amino or alkylamino, [ka] but, [ka] If (i) X 5 is N(H), or (ii) R 1 is cyano, perhaloalkyl, or perhaloalkoxy; or (iii) R 2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy; or (iv) R 7 is perhaloalkyl, perhaloalkoxy, or cyano; or (v) R 4 is aryl; or (vi) R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring, or (viii) R 2 and R 3 together with the atom to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring; (c)X 5 is N(H), [ka] but, [ka] If so, then R 5 teeth, [ka] Not that, (d)X 5 is N(H), [ka] but, [ka] When the formula is: [ka] or (ii) R 4 is not methyl or substituted or unsubstituted azacycloalkyl, or (iii) R 5 teeth, [ka] That is, (e)X 5 is N(H), [ka] but, [ka] When the formula is: [ka] or (ii) R 5 teeth, [ka] That is, (f)X 5 is N(H) and ring A is [ka] If so, then R 5 teeth, [ka] Not that, (g)X 5 does not exist, [ka] but, [ka] If so, then R 5 teeth, [ka] or ring A is [ka] Not that, (h)X 5 does not exist, [ka] but, [ka] If (i) R 5 teeth, [ka] or (ii) ring A is [ka] Not that, (i)X 5 is N(H), [ka] but [ka] If (i) R 5 teeth, [ka] or (ii) Y 4 is not N, or (iii) R 2 is not -H, -CN, or -CF3, or (iv) R 1 is not -H, -CN, or -CF3, (j)X 5 is N(H), [ka] but, [ka] If (i) R 4 is not a cycloalkyl or heterocycloalkyl; or (ii) Y 4 is not N or (iii) R 1 is not -CN, or (iv) R 2 , R 3 , and R 8 is other than H, or (v) R 5 is a substituted or unsubstituted alkyl, [ka] That is, (k) Ring A is [ka] and X 5 If N(H), then R 5 teeth, [ka] and (l) A compound [ka] [ka] [Provided that the 2. Ring A is [ka] and R 11 and R 12 is H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino. 3. Ring A is [ka] [ka] and R 2 is -CF3, -OCF3, -OCHF2, -OCH3, -CN, or -H, and R 11 is -CF3, -OCF3, -CN, or -H. 4. [ka] but, [ka] The compound according to any one of items 1 to 3, 5. R 4 is 3,3-difluoro-1-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, or -C(H)(OH)-C(CH3)2. 6. R 5 but, [ka] and Z is alkoxy, H, aliphatic, or heteroaliphatic. 7. The compound according to item 6, wherein Z is C1-C3 alkoxy, H, C1-C6 alkyl, or heteroalkyl. 8. Z is -C(O)CH3, H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl, -(CH2)2(OCH2CH2) n OCH3, where n is an integer from 1 to 10, or [ka] 7. The compound according to item 6, wherein 9. The compound is [ka] [ka] and R 11 and R 12 is H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino. 10. R 1 is -CN, -OCF3, or -CF3; R 2 But -OCH3, -OCF3, -CF3, -CN, -OCHF2, [ka] or H;R 3 But -NH2, [ka] or H;R 8 is -OCF3, -CN, -CH3, or H; R 11 and R 12 is independently -CF3, -CN, -H, -OCH3, or -OCF3. 11. A compound: (i) [ka] [In the formula, R 2 is -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, or [ka] and R 4 teeth, [ka] and R2 If is -OCF3, then R 4 teeth, [ka] or (ii) [ka] [In the formula, R 1 is -OCF3 or -CN, and R 4 teeth, [ka] or (iii) [ka] [In the formula, R 4 teeth, [ka] or (iv) [ka] [In the formula, R 4 teeth, [ka] and R 11 is -CF3, -CN, -H, -OCH3, -OCHF2, or -OCF3; or (v) [ka] [In the formula, R 2 -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, [ka] and R 4 teeth, [ka] or (vi) [ka] [In the formula, R 2 are -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, and R 4 teeth, [ka] or (vii) [ka] [In the formula, R 2 are -CF3, -CN, -H, -OCH3, -OCHF2, -OCF3, and R 4 teeth, [ka] or (viii) [ka] [In the formula, R 2 teeth, [ka] and R 4 teeth, [ka] or (ix) [ka] [In the formula, R 4 teeth, [ka] and R 11 is -CF3, -CN, -H, -OCH3, -OCHF2, or -OCF3; or (x) [ka] [In the formula, ring A is [ka] or (xi) [ka] [ka] Item 2. The compound according to item 1, wherein the compound is any one of the following: 12. A pharmaceutical composition comprising a compound according to any one of items 1 to 11 and at least one pharma- ceutically acceptable carrier. 13. A method for inhibiting leucine zipper-containing kinase (LZK) activity, comprising: A method comprising contacting a cell expressing LZK with an effective amount of a compound according to any one of items 1 to 11, thereby inhibiting LZK activity. 14. The method of item 13, wherein inhibiting LZK activity is inhibiting cell cycle progression, reducing c-MYC expression, inhibiting c-Jun N-terminal kinase (JNK) pathway signaling, inhibiting PI3K / AKT pathway signaling, inhibiting cyclin-dependent kinase 2 (CDK2) activity, or any combination thereof. 15. The method of item 13 or item 14, wherein the cells are characterized by amplification of chromosome 3q, overexpression of mitogen-activated protein kinase kinase kinase 13 (MAP3K13), or both. 16. The method according to any one of items 13 to 15, wherein the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, or an esophageal cancer cell. 17. The method of any one of items 13 to 16, wherein contacting the cell with the compound comprises administering to the subject a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition containing a therapeutically effective amount of the compound. 18. The method of item 17, wherein the subject has a disease or condition characterized at least in part by LZK overexpression. 19. The method according to item 18, wherein the disease or condition is cancer. 20. The method according to item 17, wherein the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer. 21. The method according to item 20, wherein the cancer is HNSCC or LSCC. 22. The method of any one of items 19 to 21, wherein administering a therapeutically effective amount of the compound, or that amount of the pharmaceutical composition, reduces cancer cell viability, inhibits tumor growth, or a combination thereof. 23. The method according to any one of items 17 to 22, wherein administering is performed parenterally, orally, or topically. 24. Use of a compound according to any one of items 1 to 11 for inhibiting leucine zipper-containing kinase (LZK) activity, wherein inhibiting LZK activity comprises contacting a cell expressing LZK with an effective amount of the compound, thereby inhibiting LZK activity. 25. Use of a compound according to any one of items 1 to 11 for treating a disease or condition characterized at least in part by leucine zipper-containing kinase (LZK) overexpression, wherein treating comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising a therapeutically effective amount of the compound, to a subject having a disease or condition characterized at least in part by LZK overexpression. 26. Use of a compound according to any one of paragraphs 1 to 11 in the manufacture of a medicament for the treatment of a disease or condition characterized at least in part by leucine zipper-containing kinase (LZK) overexpression. 27. The use according to item 25 or 26, wherein the disease or condition is cancer. 28. The use according to item 27, wherein the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer. EXAMPLES

[0172] VI. Working Examples method Plasmids and transfection LZK cDNA was prepared from RNA extracted from 293T cells, the attB flanking regions were added by PCR, and LZK was inserted into pDONR221 using a BP Clonase reaction. From here, the Invitrogen Gateway system was used for cloning into the destination vector. The FLAG-tagged (pReceiver-M12, GeneCopoeia) destination vector was converted into a Gateway destination vector for use in transient overexpression assays. Stable overexpression was generated using the pLenti6.3 / TO / V5-DEST vector. The drug resistance construct for LZK was the Q240S mutation introduced using the Site-Directed Mutagenesis Kit (Stratagene). The oligonucleotides are listed below in Table 18. 293T cells were transiently transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol with OptiMEM (Gibco). Where required, pcDNA3.1(+) vector (Invitrogen) was used as an empty vector control. The CDK2 sensor vector CSII-pEF1a-DHB(aa994-1087)-mVenus and the nuclear marker vector CSII-pEF1a-H2B-mTurquoise were previously described (Spencer et al., Cell 2013, 155:369-383). [Table 18-1] [Table 18-2]

[0173] cell culture CAL33 (German Collection of Microorganisms and Cell Cultures [DSMZ], obtained October 2012) and 293T (American Type Culture Collection [ATCC], July 2012) cells were maintained in DMEM (Sigma-Aldrich) supplemented with 10% tetracycline-tested fetal bovine serum (FBS) (Atlanta Biologicals), 1% penicillin-streptomycin (Gibco), and 2 mM GlutaMAX (Gibco). BICR56 cells (Public Health England, November 2012 and April 2014) were grown in DMEM containing 10% tetracycline-tested FBS, 1% penicillin-streptomycin, 0.4 μg / mL hydrocortisone (Sigma-Aldrich), and 2 mM GlutaMAX. MSK921 (Memorial Sloan Kettering Cancer Center, July 2014), BEAS-2B (ATCC, October 2012), LK2 (Japanese Collection of Research Bioresources [JCRB] Cell Bank, February 2015), and NCI-H520 (ATCC) cells were maintained in RPMI 1640 (Quality Biological) with 10% tetracycline-tested FBS, 2 mM GlutaMAX, and 1% penicillin-streptomycin. Detroit 562 cells (ATCC, November 2014) were maintained in EMEM (Sigma-Aldrich) with 10% tetracycline-tested FBS, 2 mM GlutaMAX, and 1% penicillin-streptomycin. 293FT cells (Invitrogen, November 2011) were maintained in DMEM containing 10% tetracycline-tested FBS, 4 mM GlutaMAX, 1 mM sodium pyruvate (Gibco), and 0.1 mM NEAA (Gibco). SCC-15 cells (ATCC, 2019) were maintained in DMEM containing bicarbonate buffer (3.7 g / L), 10% FBS, and 1% penicillin-streptomycin (Gibco).All cells were incubated at 37°C and 5% CO2. Cell lines in routine use were subjected to authentication by chronological short tandem repeat (STR) profiling (performed by multiplex PCR assay with Applied Biosystems AmpFLSTR system). STR profiles were compared to ATCC and DSMZ databases. However, no profile was available for MSK921. The 3q status of all HNSCC and immortalized control cell lines was verified in-house. All cell lines were used in experiments at less than 20 passages (10 weeks) after thawing, after which a new vial was taken out of freezing. Cell lines in use were confirmed to be mycoplasma negative using a Visual-PCR Mycoplasma Detection Kit (GM Biosciences). Generation of doxycycline-inducible knockdown cell lines

[0174] CAL33 and BICR56 inducible knockdown cells were generated by SIRION Biotech. MSK921 was generated in-house using lentiviral particles provided by SIRION (generated by transfection of 293TN cells with expression vector and lentiviral packaging plasmids). Transduction occurred with 8 μg / mL polybrene at MOI 5. After 24 hours, the medium was replaced with fresh medium containing puromycin (Invitrogen) to select effectively transduced cells. The shRNA sequences were CGGAATGAACCTGTCTCTGAA (sh1) and GATGTAGATTCTTCAGCCATT (sh2). The lentiviral expression plasmid was pCLVi(3G)-MCS-Puro, which expresses doxycycline-responsive transactivator and shRNA from the same vector. Transactivator expression is constitutive, while shRNA expression is dependent on a doxycycline-inducible promoter. Binding of doxycycline to the transactivator allows it to bind to the doxycycline-inducible promoter and promote shRNA expression. Doxycycline (Sigma-Aldrich) was used at 1 μg / mL to induce LZK knockdown. Generation of tetracycline-inducible expression cell lines

[0175] Cells with tetracycline-inducible expression of LZK were generated using the ViraPower HiPerform T-REx Gateway Expression System (Invitrogen). Briefly, wild-type (WT) or drug-resistant mutant (Q240S) LZK (cloned into pLenti6.3 / TO / V5-DEST vector) and pLenti3.3 / TR (for tetracycline repressor expression) were transfected into 293FT cells using Lipofectamine 2000 to generate lentiviral stocks. Cell lines were generated by antibiotic selection (blasticidin [Gibco] and geneticin [Gibco]). Doxycycline (Sigma-Aldrich) was used at 1 μg / mL to induce LZK expression. RNA preparation

[0176] Forty-eight hours after treatment (tetracycline-induced overexpression or doxycycline-induced knockdown), cells were lysed using Buffer RLT (Qiagen) containing 1% v / v 2-mercaptoethanol (Bio-Rad). Genomic DNA was removed and RNA was prepared using the RNeasy kit (Qiagen) according to the manufacturer's protocol. RNA quantity was determined using a NanoDrop™ One Spectrophotometer (Thermo Scientific). RT-PCR

[0177] RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen). The primers used were: AACTGATTCGAAGGCGCAGA (LZK forward; SEQ ID NO: 13), GGGCGTTTTCCAAGAGAGGA (LZK reverse; SEQ ID NO: 14), GGCACCACACCTTCTACAATG (β-actin forward; SEQ ID NO: 15), GTGGTGGTGAAGCTGTAGCC (β-actin reverse; SEQ ID NO: 16), CCATGGAGAAGGCTGGGG (GAPDH forward; SEQ ID NO: 17), GTCCACCACCCTGTTGCTGTA (GAPDH reverse; SEQ ID NO: 18). Cycling conditions for PCR were as follows: cDNA synthesis and pre-denaturation (55° C. for 30 min, followed by one cycle of 94° C. for 2 min), PCR amplification (25 cycles of denaturation at 94° C. for 15 s, annealing at 55° C. for 30 s, and extension at 68° C. for 60 s), and a final extension at 68° C. for 5 min, using a C1000 TOUCH CYCLER w / 48W FS RM (Bio-Rad). PCR products were resolved on a 2% agarose gel and visualized under ultraviolet light with Nancy-520 (Sigma-Aldrich) DNA gel stain using a ChemiDoc™ MP Imaging System (Bio-Rad). Inhibitor treatment

[0178] GNE-3511 (#19174) was purchased in bulk from Cayman Chemical or Synnovator (#SYNNAA108230) for mouse studies. MG132 (#S2619) was purchased from Selleck Chemicals. Pevonedistat or MLN4924 (#HY-70062) were purchased from MedChemExpress. All compounds were dissolved in DMSO (Fisher) and DMSO was used as a vehicle control in cell-based assays. Protein lysate preparation and immunoblotting

[0179] Generally, cells were plated in 6-well or 35 mm plates for 24 hours, after which doxycycline was added or treatment with specific inhibitors was administered for 48 hours using 5% FBS medium. After the appropriate treatment time, cells were washed with ice-cold phosphate buffered saline without Ca and Mg (Quality Biological) and then lysed on ice using RIPA buffer (50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) (Sigma-Aldrich) supplemented with protease inhibitor tablets (Sigma-Aldrich) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), followed by centrifugation at 15,000 rpm for 10 minutes at 4°C. Protein concentration was determined from cell lysates by using 660 nm protein assay reagent (Pierce). Cell extracts were denatured, subjected to SDS-PAGE, transferred to PVDF membranes (Bio-Rad) and blocked for 2 hours using 5% bovine serum albumin (BSA) and 0.1% Tween® 20 in phosphate-buffered saline (PBS-T). Membranes were incubated with specific antibodies overnight in 5% BSA / PBST at 4° C., followed by incubation with appropriate horseradish peroxidase-conjugated secondary antibodies for 1 hour, and signals were detected by chemiluminescence (Thermo Fisher). Antibodies are listed in Table 19. [Table 19]

[0180] Reverse Phase Protein Arrays Cells were plated in a 10 cm dish at 6 × 10 for CAL33 and BICR56. 5 and 6.25×10 for MSK921. 5Cells were seeded at 1000 x g for 1 h and then doxycycline was added the next day (to induce LZK knockdown). 48 hours after induction with doxycycline, cells were lysed on ice with 1x Triton® X-100 cell lysis buffer (#9803, Cell Signaling Technology) supplemented with protease and phosphatase inhibitors (Roche Applied Science, #05056489001 and 04906837001, respectively) and 1.5 mM MgCl2. Cell lysates were centrifuged and supernatants were collected. Protein concentration was measured using 660 nm protein assay reagent (Pierce) and adjusted to 2 mg / mL. Then, 4x reduced sodium dodecyl sulfate (SDS) sample buffer was added (40% glycerol, 8% SDS, and 0.25 M Tris-HCl, pH 6.8, with 10% β-mercaptoethanol added before use) and the samples were incubated at 80°C for 3 min. Lysates from three independent experiments were sent for RPPA analysis. The Host and Tumour Profiling Unit at Cancer Research UK Edinburgh Centre (MRC Institute of Genetics and Molecular Mechanism, The University of Edinburgh) performed nitrocellulose slide format RPPA with a panel of 60 antibodies following a validated protocol (Sriskandarajah et al., BMC Cancer 2020, 20:269). Results were compared to samples without dox induction of LZK knockdown. MTS cell viability assay

[0181] Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega) was used for MTS assay according to the manufacturer's protocol. Briefly, 5,000 cells were plated in triplicate in 96-well plates and treated with drug compounds after 24 hours using 5% FBS medium. When appropriate, doxycycline was added and cells were incubated for 72 hours. MTS was added, cells were incubated for 2 hours, and absorbance was measured at 490 nm using an iMark™ Microplate Absorbance Reader (Bio-Rad). Graph displays percent cell viability compared to DMSO-treated control samples. EC 50 Values ​​were determined using GraphPad Prism 8. Colony formation assay

[0182] Crystal violet assay was used to evaluate relative cell growth and survival after treatment with specific compounds. Generally, cells were plated in triplicate in 12-well plates for 24 hours, and then drug treatment was added using 10% FBS medium. Plates were incubated for 14 days with medium and drug replaced every 48 hours. Cells were then washed with phosphate-buffered saline, fixed in ice-cold methanol, and then stained with 0.5% crystal violet (Sigma-Aldrich) in 25% methanol. Images were taken using a ChemiDoc MP Imaging System (Bio Rad), and for quantification, crystal violet stain was dissolved in 33% acetic acid, incubated for 20 minutes with shaking, and read at 595 nm using an iMark™ Microplate Absorbance Reader (Bio-Rad). Graphs display the percent colony formation compared to DMSO-treated control samples. In vitro kinase assay

[0183] One hundred nanograms of glutathione S-transferase (GST)-tagged human LZK pure protein (Carna Biosciences, #09-114) was incubated with 100 ng of GST-tagged human inactive MKK7 pure protein (Carna Biosciences, #07-147-10) in kinase buffer (Cell Signaling Technology, #9802). Assays were performed with 100 μM ATP for 30 min at 37° C. After addition of 4× reducing SDS sample buffer, proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis was performed as previously described. ELISA assay

[0184] PathScan® Phospho-SAPK / JNK(Thr183 / Tyr185) Sandwich ELISA Assay (Cell Signaling Technology) was used for ELISA assay according to the manufacturer's protocol. Typically, 500,000 cells were plated, treated with doxycycline the next day if appropriate, and incubated at 37°C for 48 hours. Cells were treated with drug compounds or controls for 1 hour in 5% FBS medium. After the appropriate treatment time, cells were lysed on ice using 1× Cell Lysis Buffer (Cell Signaling Technology) supplemented with phosphatase and protease inhibitors (Sigma). Each diluted cell lysate was added in triplicate to Phospho-SAPK / JNK(Thr183 / Tyr185) Rabbit mAb-coated microwells and incubated overnight at 4°C. Samples were treated with the following antibodies and incubated at 37° C. for 1 hour and 30 minutes, respectively: detection antibody and HRP-linked secondary antibody. Samples were washed between treatments using 1× Wash Buffer according to the manufacturer's protocol. TMB substrate was added to each well and incubated at 37° C. for 10 minutes. After this, stop solution was added to each well and absorbance was measured at 450 nm using an iMark™ Microplate Absorbance Reader (Bio-Rad). The graph displays the relative phospho-JNK levels. Quantitative and statistical analysis

[0185] All samples represent biological replicates. Data are presented as mean values, and error bars shown on graphs represent ±SEM unless otherwise stated. A two-tailed Student's t-test was used to assess the significance of differences between groups in the assays and to measure the significance of mouse tumor volumes on the last day of treatment. Values ​​of p<0.05 were considered significantly different. Human samples

[0186] Tumor fragments from HNSCC patients containing amplified MAP3K13 were obtained from the NIH PDMR, #391396-364-R, or from Crown Biosciences San Diego, #HN5120. PDX Mouse Models

[0187] Approximately 2 × 2 × 2 mm tissue from a HNSCC patient containing amplified MAP3K13 was prepared according to the SOP50101 Implantation and Cryopreservation of Tissue for PDX Generation protocol from the NIH Patient-Derived Models Repository (PDMR). 3 Tumor fragments were subcutaneously implanted into mice with Matrigel (Corning). Five NSG mice were used for the initial implantation of cryopreserved tumor fragments. Body weight and tumor size were measured twice weekly. Approximately 1,000 mm 3 When tumors reached 150-200 mm , tumors were harvested and used to generate PDX mouse models for testing GNE-3511. For efficacy studies, fresh PDX tumor fragments at passage 1 were implanted into NSG mice using a previously described protocol. Twenty NSG mice were used (10 for vehicle control and 10 for GNE-3511 treatment). ... 3 Body weight and tumor size were measured twice weekly until tumor size reached 1.0 cm in diameter, at which point mice were randomly assigned to control or GNE-3511 treatment cohorts for approximately 4-8 weeks. Study endpoints were >20% weight loss, tumor size >2.0 cm in diameter, and tumor size >2.0 cm in diameter. 3 The tumor volume was greater than 100 mg / kg, or significant (>80%) tumor regression observed with treatment. GNE-3511 was dissolved in 60% PEG 300MW, 3 equivalents of 0.1M HCl, saline (vehicle) and administered daily at 50mg / kg by intratumoral injection. Body weight and tumor size were measured twice weekly. At the end of each study, tumors were harvested, cleaned, weighed, and photographed for analysis. Bioinformatics analysis of HNSCC PDX mouse models of NCI PDMR

[0188] For nucleic acid extraction, library preparation, whole exome sequencing, and whole transcriptome sequencing, please refer to the notes from the NIH PDMR SOP. An in-house bioinformatics pipeline was used to process the WES and RNA-seq data. FASTQ data was generated using the bcl2fastq tool (Illumina, v2.18) and then run through FASTQC for quality check. For WES, reads were mapped to the human hg19 reference genome by the Burrows-Wheeler Alignmenttool. The resulting bam files were processed using the GATK best practice workflow (32). Copy number data was inferred from the WES data by using the CNVKit algorithm using a pool of normal HapMap cell line samples as a reference (30). An RSEM pipeline using the STAR aligner was implemented to process the RNA-seq data to obtain gene expression data (Li et al., BMC Bioinformatics 2011, 12(1):323). In the current cohort, 58 PDX head and neck models were subjected to WES and RNA-seq bioinformatics analysis. For each PDX model, this included multiple (≥4 PDX) samples. For copy number data, a majority vote was used among multiple PDX samples from the same model to call a consensus copy number status (2=diploid, >2 and <5=gained, and ≥5=amplified). For gene expression data, the average of fragments per kilobase million (FPKM) was taken to obtain gene expression at the model level. Example 1 Chemical synthesis and characterization A general synthetic scheme for 3,3-fluoropyrrolidin-1-yl analogues is shown below: [ka]

[0189] Method A. 4-Substituted 2,6-dichloropyridine (3 mmol) is combined with 5.25 mmol (1.75 eq.) of 3,3-difluoropyrrolidine hydrochloride in dioxane (e.g., 8 mL) in a microwave vial. Diisopropylethylamine (9 mmol, 3 eq.) is added and the sealed vial is heated at 130° C. for 16 h with stirring. The cooled reaction is then diluted with 50 mL of water and extracted with 3×35 mL of ethyl acetate. The combined organic layers are dried over Na2SO4 and concentrated under reduced pressure. The resulting residue is purified by flash chromatography eluting with a gradient of ethyl acetate in dichloromethane.

[0190] Method B. 4-Substituted 2-(difluoropyrrolidin-1-yl)-6-chloropyridine (e.g., 145 μmol) is combined with the desired 2-aminoheterocycle (1.77 μmol, 1.22 equiv.), 2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenylpalladium(II) phenethylamine chloride (8.5 mg, 11.6 μmol, 0.08 equiv.), and potassium tert-butoxide (24.5 mg, 218 μmol, 1.5 equiv.). The reaction vial is sealed and then evacuated and backfilled with argon three times. Dioxane (2 mL) is added and the reaction is heated at 145° C. for 45 min. The cooled reaction is adsorbed directly onto Celite and the desired material is obtained by flash chromatography eluting with a gradient of methanol in dichloromethane. [ka]

[0191] 2-Chloro-6-(3,3-difluoropyrrolidin-1-yl)piperidin-4-yl)pyridine trifluoroacetate. tert-Butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-1-yl)pyridin-4-yl)piperidine-1-carboxylate (550 mg, 1.37 mmol) was dissolved in 3 mL of dichloromethane and the solution was stirred in an ice bath. Trifluoroacetic acid (3.0 mL) was added and stirring was continued for 20 minutes. Volatiles were then removed under reduced pressure and the resulting residue was used without further purification. [ka]

[0192] 2-Chloro-6-(3,3-difluoropyrrolidin-1-yl)piperidin-4-yl)pyridine trifluoroacetate (1 mmol) is dissolved in 25 mL of dichloromethane and washed with 50 mL of saturated NaHCO3. The organic layer is dried over Na2SO4 and concentrated under reduced pressure. The resulting residue is dissolved in 5 mL of tetrahydrofuran and treated successively with a ketone or aldehyde (2 mmol, 2 equiv.) and sodium triacetoxyborohydride (371 mg, 1.75 mmol, 1.75 equiv.). The reaction is monitored by chromatography. Upon completion, the reaction is diluted with 25 mL of ethyl acetate and washed with 40 mL of NH4Cl. The aqueous layer is extracted with 2×25 mL of ethyl acetate; the combined organic layers are dried over Na2SO4 and concentrated under reduced pressure. The desired material is purified by flash chromatography eluting with a gradient of methanol in dichloromethane and used in Method B.

[0193] Exemplary R groups include, but are not limited to, 1-acetylpiperidin-4-yl, piperidin-4-yl, 1-ethylpiperidin-4-yl, 1-oxetan-3-ylpiperidin-4-yl, 1-(polyethylene glycol) piperidin-4-yl, 1-isopropylpiperidin-4-yl, 1-cyclopentylpiperidin-4-yl, 4-(1-cyclopropylmethyl)piperidin-4-yl, azetidin-3-yl, 1-acetylazetidin-3-yl, 1-ethylazetidin-3-yl, N-oxetan-3-yl-3-azetidinyl, 1-(polyethylene glycol-azetidin-3-yl, 1-isopropylazetidin-3-yl, 1-cyclopentylazetidin-3-yl, 1-(cyclopropylmethyl)azetidin- 3-yl, (6-azabicyclo[3.1.0]-hexan-3-yl), (6-acetyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-ethyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-oxetan-3-yl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-polyethylene glycol)-6-azabicyclo[3.1.0]-hexan-3-yl), (6-isopropyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-cyclopentyl-6-azabicyclo[3.1.0]-hexan-3-yl), (6-(cyclopropylmethyl)-6-azabicyclo[3.1.0]-hexan-3-yl), 4-(tetrahydro-2H-pyran-4-yl): [ka]

[0194] Exemplary heterocycles (Het) include, but are not limited to, pyridin-2-amine, pyrimidin-2-amine, pyrimidin-4-amine, pyrazin-2-amine, quinoxaline-2-amine, 1H-pyrrolo-[3,2-c]pyridin-6-amine, 5-methoxypyrazin-2-amine, 5-methylpyrazin-2-amine, 6-methylpyrazin-2-amine, 3-methylpyrazin-2-amine, 5-cyanopyrazin-2-amine, 1-methyl-1H-imidazole-4-carbonitrile 1-methyl-1H-pyrazol-3-yl, 1H-pyrazol-3-yl, and 1-methyl-1H-imidazol-5-yl: [ka]

[0195] 1-(4-(2-chloro-6-(3,3-difluoropyrrolidin-1-yl)pyridin-4-yl)piperidin-1-yl)ethan-1-one. tert-Butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-1-yl)pyridin-4-yl)piperidine-1-carboxylate (0.55 g, 1.37 mmol) was dissolved in 3 mL of DCM, the solution was cooled in an ice bath and treated with 3 mL of TFA. After 20 min, the reaction was concentrated under reduced pressure. The resulting residue was dissolved in 15 mL of DCM, treated with N-methylmorpholine (754 μL, 693 mg, 5 eq.) and acetic anhydride (136 μL, 147 mg, 1.05 eq.) and stirred at room temperature for 1 h. The reaction was then diluted with DCM and washed with 50 mL of H2O. The aqueous layer was extracted with 2×40 mL of DCM and the combined organic layers were dried over Na 2 SO 4 and evaporated to give the desired material which was used in Method B.

[0196] [ka] [ka] [ka] [ka] [ka] Example 2 LZK inhibition in 3q amplicon-harboring squamous cell carcinoma

[0197] GNE-3511, a dual leucine zipper kinase (DLK) inhibitor, was evaluated for inhibition of LZK catalytic activity. LZK and DLK share over 90% homology within their kinase domains, and it was reported that GNE-3511 also inhibits the catalytic activity of LZK (Patel et al., J Med Chem 2015, 58:401-418). To verify that GNE-3511 (Figure 1) would inhibit LZK catalytic activity in cells, doxycycline (dox)-inducible expression of LZK was induced in 3q amplicon-positive CAL33 HNSCC cell lines. GNE-3511 is a potent LZK inhibitor in cells, as measured by inhibition of downstream JNK pathway activation (Figures 2A-C, 3, 4). Similar results were observed in vitro (Figure 5).

[0198] Treatment of HNSCC cells (CAL33 and BICR56) with amplified MAP3K13 with 200 nM GNE-3511 resulted in an 80% or greater reduction in colony formation, a result that phenocopied that observed when LZK was depleted from these cells (Edwards et al., Cancer Res 2017, 77:4961-4972), whereas cells lacking amplified MAP3K13 (BEAS-2B and MSK921) only showed a small reduction in colony formation (Figures 6A and 6B). Quantification reveals a significant reduction in growth in the CAL33 and BICR56 cell lines. * p<0.05, Student's t-test.

[0199] To determine whether other squamous cell carcinomas harboring the 3q amplicon are sensitive to LZK inhibition, LK2 and NCI-H520 lung squamous cell carcinoma (LSCC) cells were treated with 500 nM GNE-3511. A 45% and 55% reduction in colony formation, respectively, was observed, indicating that additional squamous cell carcinomas are dependent on LZK to maintain viability (Figure 7). A significant reduction in viability of CAL33 and BICR56 cells in short-term MTS assays was also observed, with IC of 687.7 ± 114.1 nM and 410.5 ± 59.6 nM, respectively. 50 (Figure 8). IC 50 Values ​​were calculated using GraphPad Prism 8.

[0200] Kinase inhibitors are often promiscuous compounds that target additional kinases, and GNE-3511 was initially developed as a DLK inhibitor. To confirm that drug-induced toxicity was specifically due to LZK inhibition, a drug-resistant mutant form of LZK (Q240S) was generated that maintains catalytic activity in the presence of drugs, as assessed by JNK pathway activation (Figures 9, 10). As shown in Figure 9, Q240S maintains catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation. Figure 10 shows the inhibition of LZK in 293T cells. Q240S We show that 1-hour GNE-3511 treatment specifically inhibits LZK, as observed by rescue of JNK signaling by overexpression of a drug-resistant mutant. Q240S Expression of LZK resulted in a near-complete rescue of GNE-3511-induced toxicity, indicating that GNE-3511 suppresses HNSCC cell viability specifically through LZK inhibition and validating LZK as a drug target in HNSCC ( Fig. 11 ; *** p<0.001, ** p<0.01, Student's t test).

[0201] Evaluation of GNE-3511 in a patient-derived xenograft mouse model of 3q-amplified HNSCC demonstrated that 50 mg / kg GNE-3511 could significantly suppress HNSCC tumor growth in vivo in three mice, with near-complete tumor regression and no detectable tumors ( Figures 12A-12C ; **** p<0.0001, two-way ANOVA.). Figures 13A-13D show that tumor growth was significantly suppressed in mice (n=10) treated with GNE-3511 (50 mg / kg, qd, 5 days on / 2 days off) compared to the vehicle control group in two in vivo HNSCC PDX mouse models (50 mg / kg, qd, 5 days on / 2 days off) with amplified LZK (Figures 13A, 13B), whereas there was no reduction in tumor volume in the HNSCC PDX model lacking amplified LZK (Figures 13C, 13D). Mean tumor volume ± SEM is shown. Mean tumor volume at the end of treatment. Mean ± SEM; Student's t-test; * p<0.05. Similar results were observed with 100 mg / kg GNE-3511 treatment in a CAL33-based xenograft mouse model of HNSCC (Figure 14; mean ± SEM, **** p<0.0001, two-way ANOVA).

[0202] Immunohistochemistry (IHC) staining revealed increased cleaved caspase-3 expression in GNE-3511-treated tumors compared to controls (Figures 15A and 15B; mean ± SEM, Student's t test, *p<0.001). The study was stopped early due to toxicity at this concentration and dosing regimen (100 mg / kg, bid, 5 days on / 2 days off) and a decrease in body weight was observed in inhibitor-treated mice. GNE-3511 was further evaluated in vivo utilizing a lower dose of daily dosing (50 mg / kg, qb) in a patient-derived xenograft mouse model of 3q-amplified HNSCC (PDX model: 391396-364-R). GNE-3511 significantly inhibited HNSCC PDX tumor growth in vivo with near complete tumor regression and no detectable tumors in three mice (Figures 12A-12C) and had no effect on mouse body weight.

[0203] We further explored the expression and amplification of LZK in additional HNSCC PDX models from the NCI Patient-Derived Models Repository (PDMR). Utilizing next-generation sequencing (NGS) and RNA sequencing data from 58 HNSCC PDX mouse models, we revealed amplification of MAP3K13 in five samples, including PDX391396-364-R, and an additional 31 contained gains in LZK. MAP3K13 was identified as one of the top genes amplified within chromosome 3 in these patient samples. Finally, elevated copy numbers of MAP3K13 were highly associated with elevated mRNA expression levels (Figure 16).

[0204] Reverse phase protein array (RPPA) was performed to identify downstream targets of amplified MAP3K13. Dox-induced depletion of LZK in CAL33, BICR56, and MSK921 cell lines with two unique LZK shRNAs (as described in Edwards et al. and in Figure 17) reduced c-MYC abundance in 3q amplicon-positive HNSCC cells (CAL33 and BICR56) but not in control cells (MSK921); this was confirmed by Western blot analysis. Figure 18 shows the copy number (CN) profile of 58 HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR. Each column shows the copy number profile of one PDX model. Models were ordered by MAP3K13 copy number data (highlighted as yellow lines). Heatmap colors indicate the log2 ratio of copy numbers. Figure 19 shows box plots of MAP3K13 gene expression in 58 PDX models with different MAP3K13 copy numbers. The X-axis shows MAP3K13 copy number status, where 2=diploid, >2 and <5=increased, and ≧5=amplified. The Y-axis shows MAP3K13 gene expression in mean fragments per kilobase million (FPKM). Each black dot represents one PDX model. MAP3K13 copy number is highly correlated with gene expression (ANOVA, p=1.34e -6). Figure 20 is the result of RPAA assay at 48 hours identifying the reduction of c-MYC levels in LZK-depleted CAL33 and BICR56 cells. Figure 21 is a Western blot of c-MYC abundance in LZK-depleted cells at 48 hours. Figure 22 is a Western blot showing the expression levels of several cell cycle components (Myc, CKD4, CDK6, cyclin D1, CDK2, cyclin E1, cyclin A2, cyclin B1, CDK1, p27, and GAPDH) in LZK-depleted CAL33 cells at 48 hours. These results validate a recent high-throughput siRNA screen that identifies MAP3K13 as a gene required for cell survival specifically with c-MYC overexpression (Toyoshima et al., PNAS USA 2012, 109:9545-9550). The decrease in c-MYC expression was dependent on proteasome-mediated degradation, as the addition of the proteasome inhibitor MG132 (10 μM for 6 hours) prevented the decrease in c-MYC expression and rescued the decrease in c-MYC levels (Figure 23). This observation is consistent with a previous report that LZK phosphorylates and stabilizes expression of the E3 ubiquitin ligase TRIM25, which ubiquitinates FBXW7, a subunit of the SKP1-Cullin-F-Box (SCF) complex that directly regulates c-MYC stability (Zhang et al., Cell Death Differ 2020, 27:420-433). Decreased TRIM25 phosphorylation by depletion or catalytic inhibition of LZK leads to degradation of the ligase, increased stability of FBXW7, and degradation of c-MYC (ibid.).

[0205] To determine whether LZK catalytic inhibition suppresses c-MYC expression, CAL33 cells were treated with GNE-3511 500 nM and c-MYC expression was monitored over time. Within the first hour, the LZK inhibitor led to a decrease in c-MYC levels that was subsequently maintained for 72 hours (Figure 24). Importantly, LZK Q240SExpression of a drug-resistant mutant rescues the loss of c-MYC expression, indicating that LZK catalytic activity is essential for maintaining c-MYC stability in HNSCC cells with amplified MAP3K13 (Figure 25). Thus, LZK has both kinase-dependent and kinase-independent functions that promote cancer. Example 3 MLK Inhibition in HNSCC and LSCC A set of eight inhibitors was prepared and evaluated for efficacy. The compounds have the general structure: [ka] wherein the heterocycle is [ka] [ka] Another inhibitor is the heterocyclic [ka] and contained -N(CH3)- instead of the -N(H)- group of the parent structure. Inhibition of downstream JNK pathway activation by analogs 1-8 was assessed by ELISA assay as described. Results (Figure 26) showed that there was narrow tolerance for substitutions on the aminopyridine ring, with only compound 99 (analog 5) resulting in successful inhibition. Methylation of the connecting amine was not tolerated.

[0206] A subsequent set of inhibitors was prepared to evaluate the effect of an additional nitrogen in the heterocycle. [ka] Only compound 100 was an effective inhibitor. [ka]

[0207] Comparison of GNE-3511 and LZK inhibitor 1 indicates that LZK inhibitor 1 is a poor LZK inhibitor in cells. However, LZK inhibitor 2 was a potent LZK inhibitor that suppressed LZK activity at 100 nM, similar to treatment with GNE-3511, for up to 72 hours (Figures 27-30). In addition, LZK inhibitor 2 suppressed colony formation in 3q amplicon-positive HNSCC cells-CAL33, BICR56, and Detroit 562 cells (Figures 31A, 31B), as well as LSCC cells-LK2 and NCI-H520 cells (Figure 32). Drug-induced decline in CAL33 cell viability was associated with LZK Q240S Rescued by expression of drug-resistant mutants (Figure 33; *** p<0.001, ** p<0.01, Student's t-test). Figure 34 shows the effect of LZK inhibitor 2 (250 nM) on LZK expression during treatment. Q240S We show that expression of drug-resistant mutants also rescued JNK signaling.

[0208] Heterocycle [ka] Several additional LZK inhibitors were prepared that were phospho-JNK levels were determined after incubating doxycycline-induced CAL33 cells with 1 μM LZK inhibitor for 1 hour. The results are shown in Figures 35-37. Compound 107 was particularly effective.

[0209] The following formula [ka] Additional analogs were prepared according to the formula: 5 teeth, [ka] It was. Three additional analogs were also evaluated: [ka]

[0210] Phospho-JNK levels were determined after incubating doxycycline-induced CAL33 cells with 1 μM LZK inhibitor for 1 hour. The results are shown in Figures 38 and 39. Compound 164 was more effective than GNE-3511, while compounds 161, 162, and 159 had similar activity. The Kd values ​​were as follows: 44 - 94nM, 45 - 440nM, and 46 - >10,000nM, 159 - 7.7nM (+4.5 from GNE-3511), 160 - 9.6nM, 161 - 3.3nM (+0.1 from GNE-3511), 162 - 5.8nM (+2.6 from GNE 35-11), 163 - 19nM, 164 - 2.3nM (-0.9 from GNE-3511). Figures 40-42 show the dose-dependent inhibition of LZK by compound 164, compound 161, and compound 162, respectively.

[0211] Several of the compounds were evaluated for LZK activity as well as specificity for LZK over DLK. The results are summarized in Table 20. The results show that compound 164 has the highest affinity for LZK, with an IC of approximately 100 nM. 50 These results show that the inhibitor has relatively strong inhibition of LZK. [Table 20]

[0212] PAMPA (Parallel Artificial Membrane Permeability Assay) results for several LZK inhibitors (see Tables 1-10 for structures) are shown in Table 21. The structures of known compounds DLK-IN2 and DLK-IN3 (Patel et al., J Med. Chem. 2015, 58:8182-8199; US2018 / 0057507 A1; US10,093,664 B2) are shown below. [ka] [Table 21]

[0213] Example 4 Synthesis of additional compounds

[0214] Reagents were purchased from commercial suppliers and used without further purification. Various intermediates were prepared as previously (Patel et al., J Med. Chem. 2015, 58:8182-8199). Microwave reactions were performed on a Biotage Initiator+. Compound purity was >95% by LCMS unless otherwise specified. NMR spectra were obtained on a 400MHz Varian NMR and processed using MestReNova software. LCMS data was acquired on an Agilent Technologies 1290 Infinity HPLC system using an Agilent InfinityLab LC / MS detector and a Poroshell 120 SB-C18 2.7um column (4.6×50mm). Preparative HPLC was performed using an Agilent 1200 series system and a 30 mm x 150 mm Xbridge C18 column (Waters) eluted with a gradient of 20 - 80% solvent B (MeCN, 0.05% TFA) in solvent A (water, 0.05% TFA). Flash chromatography was performed on a Teledyne Isco Combiflash® Rf+. HRMS data was acquired on a Waters XEVO G2-XS QTOF running MassLynx version 4.1. [ka]

[0215] tert-Butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-1-yl)pyridin-4-yl)piperidine-1-carboxylate (704 mg, 1.75 mmol) was combined with 2-amino-5-methylpyrazine (233 mg, 2.14 mmol, 1.22 equiv), Pd-RuPHOS (51 mg, 70 μmol, 0.04 equiv) and potassium t-butoxide (590 mg, 5.25 mmol, 3 equiv) in a 20 mL microwave vial. The vial was sealed, evacuated and backfilled with Ar three times, then 10 mL of dioxane was added. The reaction was heated in a microwave for 45 min at 140° C., then cooled to room temperature and filtered through Celite. The pad was washed three times with ethyl acetate; the combined filtrates were concentrated under reduced pressure and the product was isolated by flash chromatography (gradient of 0 to 15% MeOH in DCM): yellow solid, 734 mg, 1.55 μmol, 88.3% yield.

[0216] [ka] 1 H NMR (400 MHz, cdcl3) δ 9.29 (d, J = 1.5 Hz, 1H), 8.06 - 8.01 (m, 1H), 6.96 (s, 1H), 6.28 (s, 1H), 5.80 (s, 1H), 3.86 (t, J = 13.2 Hz, 2H), 3.71 (t, J = 7.2 Hz, 2H), 3.31 (d, J = 12.0 Hz, 2H), 2.80 (td, J = 12.1, 2.9 Hz, 2H), 2.61 - 2.40 (m, 6H), 1.93 - 1.69 (m, 4H).TFA deprotection: Extract 734 mg → 530 mg of product (free amine). [ka]

[0217] To an ice-cold solution of tert-butyl 4-(2-chloro-6-(3,3-difluoropyrrolidin-1-yl)pyridin-4-yl)piperidine-1-carboxylate (502 mg, 1.25 mmol) was added 2 mL of TFA. LCMS analysis suggested the reaction was complete after 20 min, and the volatiles were removed under reduced pressure. The resulting residue was dissolved in 50 mL of DCM and washed with 100 mL of saturated NaHCO3. The layers were separated; the aqueous layer was extracted with an additional 2 x 50 mL of DCM, and the combined organic layers were dried over Na2SO4 and concentrated under reduced pressure. The residue thus obtained was dissolved in 10 mL of DCM and treated with N-methylmorpholine (206 μL, 1.87 mmol, 1.5 eq) and acetic anhydride (130 μL, 1.37 mmol, 1.1 eq) at room temperature. After 30 min, the reaction was concentrated under reduced pressure and then dissolved in 50 mL of DCM. The solution was washed with 1×50 mL water, 1×50 mL saturated NH4Cl, then 1×50 mL saturated NaHCO3, then dried over Na2SO4 and concentrated under reduced pressure to give the product (413 mg, 1.20 mmol, 96%) as an off-white foam. The crude material was used without further purification. HRMS: C 16 H 21 Calculated value for ClF2N3O+: 344.1341; measured value: 344.1339. [ka]

[0218] 313 mg, 1.14 mmol, 78.9% yield. 1H NMR (400 MHz, cdcl3) δ 8.67 (d, J = 1.4 Hz, 1H), 8.09 (dd, J = 1.5, 0.7 Hz, 1H), 7.54 - 7.49 (m, 1H), 6.77 (d, J = 1.1 Hz, 1H), 4.82 (dq, J = 13.4, 2.2 Hz, 1H), 4.01 - 3.92 (m, 1H), 3.18 (td, J = 13.1, 2.6 Hz, 1H), 2.75 (tt, J = 12.1, 3.6 Hz, 1H), 2.63 (td, J = 12.9, 2.7 Hz, 1H), 2.51 (s, 3H), 2.15 (s, 3H), 2.01 - 1.87 (m, 2H), 1.63 (qt, J = 12.6, 4.1 Hz, 2H). [ka]

[0219] In general, 4-acetylpiperidine-substituted dichloropyridines were subjected to SnAr reaction with 3,3'-difluoropyrrolidines followed by palladium-catalyzed cross-coupling with selected amino-substituted heterocycles (pathway A). Although this route was effective, it was less efficient for exploring modifications to difluoropyrrolidines, especially with volatile amines. Therefore, an alternative route was used in which the heterocyclic amine substituent was first introduced, followed by the aliphatic amine (pathway B). Initial work was performed with an acetylated piperidine substituent, which was introduced first in the sequence. Alkylation of the piperidine nitrogen was subsequently achieved by reductive amination with NaBH3CN, which could be performed at any step of the process after first removing the Boc protecting group. Manipulation with azetidine substituents followed a similar route. Alternative substituents at the 4-position of the central pyridine were typically purchased or pre-introduced prior to the SnAr / RuPHOS coupling or Xantphos / RuPHOS route. Route A [ka]

[0220] 1. SnAr general procedure: 4-substituted 2,6-dichloropyridine (0.366 mmol) was combined with the amine hydrochloride (0.65 mmol, 1.75 equiv.) and DIPEA (1.10 mmol, 3 equiv.) in 1 mL of DMA in a microwave vial. The stirred reaction was heated at 130° C. for 16 h, then cooled and partitioned between 50 mL of ethyl acetate and 100 mL of saturated aqueous NH4Cl. The aqueous layer was extracted with 2×50 mL of additional ethyl acetate, and the combined organic layers were dried over Na2SO4 and concentrated under reduced pressure. The resulting residue was subjected to flash chromatography (hexane:ethyl acetate gradient) to give the desired adduct.

[0221] 2. RuPHOS general procedure: 4,6-substituted 2-chloropyridine (72.7 μmol) was combined with 2-amino-substituted heterocycle (80 μmol, 1.1 equiv.), chloro{[RuPhos][2-(2-aminoethylphenyl]-palladium(II)} / [RuPhos] mixture (PdP / P molar concentration = 1:1) (2.9 μmol, 0.04 equiv.) and potassium t-butoxide (109 μmol, 1.5 equiv.) in a microwave vial equipped with a stir bar. The vial was sealed, evacuated and backfilled with Ar three times. 1 mL of dry dioxane was added and the reaction was heated in a microwave for 30 min at 140° C. After cooling, the reaction was filtered through Celite. The residue was rinsed with 3×5 mL of ethyl acetate and the combined filtrates were concentrated under reduced pressure. The desired product was isolated by preparative HPLC (20→80% MeCN, 0.05% TFA) or flash chromatography (gradient of DCM:MeOH). Route B [ka]

[0222] 1. Xantphos. 1-(4-(2,6-dichloropyridin-4-yl)piperidin-1-yl)ethan-1-one (350 mg, 1.28 mmol) was combined with 2-amino-5-methylpyrazine (143 mg, 1.31 mmol, 1.02 equiv.), Xantphos (47.5 mg, 82 μmol, 0.06 equiv.), tris(dibenzylideneacetone)dipalladium(0) (Pd2dba3, 27 mg, 29.5 μmol) and Cs2CO3 (585 mg, 1.79 mmol, 1.4 equiv.) in a microwave vial equipped with a stir bar. The vial was sealed and then evacuated and backfilled with Ar three times. Dioxane (4 mL) was added and the reaction was heated at 80° C. in a microwave for 20 h. The cooled reaction was filtered through Celite, rinsed with 3×5 mL of DCM, and the combined filtrates were concentrated under reduced pressure. The residue was subjected to flash chromatography eluting with a gradient of 0 to 10% MeOH in DCM to give 319 mg (92.5 μmol, 72.2% yield) of the product 1-(4-(2-chloro-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-1-yl)ethan-1-one as an off-white solid.

[0223] 2. RuPHOS. 1-(4-(2-chloro-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-1-yl)ethan-1-one (25 mg, 72.3 μmol) was added to a microwave vial equipped with a stir bar in the presence of chloro{[RuPhos][2-(2-aminoethylphenyl]-palladium(II)} / [RuPhos] mixture (PdP / P molar concentration=1:1) (5.3 mg, 7.2 μmol, 0.10 equiv.), 3,3'-difluoroazetidine hydrochloride (28.1 mg, 217 μmol, 3 equiv.) and potassium t-butoxide (48.7 mg, 434 μmol, 6 equiv.). The vial was sealed, then evacuated and backfilled with Ar three times. Dry dioxane (1.5 mL) was added and the reaction was heated in a microwave for 20 h at 90° C. The reaction was filtered through Celite, the residue rinsed with 3×2 mL ethyl acetate and the filtrate concentrated under reduced pressure. Preparative HPLC afforded 35.5 mg of the desired product 1-(4-(2-(3,3-difluoroazetidin-1-yl)-6-((5-methylpyrazin-2-yl)amino)pyridin-4-yl)piperidin-1-yl)ethan-1-one as the TFA salt (68.7 μmol, 95% yield). [ka]

[0224] Example of reductive amination: N-(6-(3,3-difluoropyrrolidin-1-yl)-4-(piperidin-4-yl)pyridin-2-yl)-5-methylpyrazin-2-amine (25 mg, 66.8 μmol) was dissolved in 1 mL MeOH and stirred with 7.8 mg (134 μmol, 2 eq.) acetone at room temperature for 3 h. NaBH3CN (8.4 mg, 134 μmol, 2 eq.) was added and the reaction was monitored by LCMS. Upon completion, the reaction was concentrated under reduced pressure and the residue was treated with 10 mL saturated NaHCO3 and extracted with 3×5 mL DCM. The combined organics were dried over Na2SO4, concentrated and the product was isolated by flash chromatography eluting with 0→40% MeOH in DCM to give 13.2 mg (31.7 μmol, 47.5% yield) of a yellowish residue.

[0225]

change

[0226]

change

[0227]

change

[0228]

change

[0229]

change

[0230]

change

[0231]

change

[0232]

change

[0233]

change

[0234]

change

[0235]

change

[0236] [ka]

[0237] [ka]

[0238] Reductive amination route. 22.7 mg, 65.1 μmol (SM) was stirred with cyclopropanecarboxaldehyde (9.1 mg, 9.7 μL, 2 equiv.) in 1 mL MeOH overnight. Sodium cyanoborohydride (8.2 mg, 2 equiv.) was added and stirring was continued at room temperature. After 20 h, the reaction was diluted with DCM (30 mL), washed with saturated NaHCO3, dried over Na2SO4, and concentrated under reduced pressure. Preparative HPLC followed by lyophilization afforded the product as a fluffy yellow solid (TFA salt, 12.7 mg, 23.3 μmol, 35.8% yield). C 24 H 31 N6 + . Exact mass: 403.2610 Measured value: 403.2606.

[0239] [ka]

[0240] [ka]

[0241] Starting material, 26.3 mg (69.9 μmol), was dissolved in 3 mL DCM and treated with acetic anhydride (7.3 μL, 7.8 mg, 1.1 eq.) and N-methylmorpholine (14.1 mg, 3 eq.). After 20 min at room temperature, the reaction was judged complete by LCMS. The reaction was diluted with 15 mL DCM and washed successively with water (30 mL) and saturated NaHCO3 (30 mL). The organic layer was dried over Na2SO4, concentrated under reduced pressure, and subjected to flash chromatography (gradient 0→20% MeOH in DCM) to give a yellow residue (19.9 mg, 47.5 μmol, 68% yield). 1 H NMR (400 MHz, cdcl3) δ 9.25 - 9.20 (m, 1H), 8.04 (d, J = 1.5 Hz, 1H), 6.90 (s, 1H), 6.14 (s, 1H), 5.72 (s, 1H), 4.79 (d, J = 13.6 Hz, 1H), 3.93 (d, J = 13.5 Hz, 1H), 3.72 (d, J = 9.8 Hz, 2H), 3.45 (d, J = 10.0 Hz, 2H), 3.20 - 3.07 (m, 1H), 2.66 - 2.55 (m, 2H), 2.14 (s, 4H), 2.05 - 1.97 (m, 1H), 1.88 (t, J = 13.7 Hz, 3H), 1.62 (tdd, J = 16.8, 10.6, 4.5 Hz, 3H), 1.05 - 0.95 (m, 5H), 0.75 (q, J = 7.8 Hz, 1H), 0.29 (q, J = 4.2 Hz, 1H).C 24 H 31 NO + The calculated value was 419.2559 and the measured value was 419.2557.

[0242] [ka]

[0243] [ka]

[0244]

change

[0245]

change

[0246]

change

[0247]

change

[0248]

change

[0249]

change

[0250]

change

[0251]

change

[0252]

change

[0253]

change

[0254]

change

[0255] [ka]

[0256] [ka]

[0257] [ka]

[0258] Example 5 Effect of Substituents

[0259] The substituents were varied to improve the binding affinity to LZK and selectivity over DLK. D Values ​​were measured by Eurofins DiscoveRx using the Kd-Elect system. Parallel Artificial Membrane Permeability Assay (PAMPA) values ​​were measured by Cyprotex.

[0260] K D For evaluation, 11-point 3-fold serial dilutions of each test compound were prepared in 100% DMSO at 100x the final test concentration and subsequently diluted to 1x in the assay (final DMSO concentration = 1%). D was determined using a concentration of 30,000 nM. D If the K was less than 0.5 nM, the measurements were repeated with serial dilutions starting with a lower top concentration. D is K D >30,000nM. D Values ​​were calculated using a standard dose-response curve with the Hill equation:

number

[0261] The Hill slope was set to -1. Curves were fitted using a nonlinear least-squares fit with the Levenberg-Marquardt algorithm.

[0262] First, the tolerance of LZK to structural changes in the 4-aminocyanopyridine of GNE-3511 was evaluated. As shown in Table 22, neither ring contraction to a 5-membered heterocycle nor ring expansion to a fused system provided any benefit. In contrast, these modifications were generally detrimental. The feasibility of incorporating an additional nitrogen into the ring, back to the original 6-membered heterocycle, was explored. Attractively, the results showed a clear path forward: the pyrazine substituent (2-pyrazine 100) was significantly better than either the pyrimidines (2-,4-pyrimidines 116, 117) or the unsubstituted parent pyridine (2-pyridine 118). In addition, PAMPA membrane permeability evaluation showed much higher permeability values ​​for (100) than either the parent GNE-3511 or the intermediate acetylated form (98). [Table 22-1] [Table 22-2]

[0263] Next, the tolerance of LZK to substitutions on the pyrazine was investigated (Table 23), starting with a simple methyl scan. Again, the path was clear: 3- or 6-substitutions (108, 109) were not tolerated, but the 5-methylpyrazine (107) was roughly twice as potent as the unsubstituted (100). Again, this pattern was seen with amine substituents, as the 6-amino (110) was 10-fold less potent than the 5-amino (111). With the substitution positions established, the effect of various substituents at the 5-position of the pyrazine was investigated. Of the various substituents investigated, only the cyclopropyl (150) showed a significant increase in potency, with the added benefit of nearly equal affinity for LZK and DLK, whereas almost all of the preceding compounds showed at least mild selectivity for DLK. [Table 23-1] [Table 23-2]

[0264] Next, modifications to the acetyl piperidine ring were explored (Table 24). Initially, the acetyl group was replaced with various small alkyl substituents via reductive amination. These modifications resulted in a 2- to 10-fold increase in potency over the parent (107). A ring-contracted acetyl azetidine substituent on (165) was also explored, which had a neutral effect on LZK binding but significantly increased the Kd for DLK to 6-fold over the parent (107). The alkyl azetidine substituents (166, 167, 168, 169) maintained nearly 3-fold selectivity for LZK over DLK, although the affinity was slightly less than the corresponding piperidine derivative. Shortening of the piperidine to methyl (170) or trifluoromethyl (171) was not favorable, but the addition of a morpholino substituent to methyl (210) rescued binding to some extent. [Table 24-1] [Table 24-2]

[0265] With these results at hand, alternatives to the 3,3'-difluoropyrrolidine substituent were screened (Table 25). In general, fused or contracted ring systems, especially those connected via a pyrrolidine ring, were found to be preferred over open chains, with azetidine or piperidine systems tending to be less potent than the corresponding pyrrolidines. Polar groups or secondary rather than tertiary connected amines were generally less potent. Interestingly, fusion of the pyrrolidine ring to a bicyclic system significantly favored both LZK affinity and selectivity over DLK. Specifically, the 3.1.0 compound (198) was not nearly twice as potent as the parent (107) for LZK; however, (198) also demonstrated twice the selectivity for LZK over DLK, a four-fold increase in selectivity over (107). The dimethyl analog (199) did not show particularly enhanced potency, but was more than 10-fold more selective for LZK than DLK. [Table 25-1] [Table 25-2] [Table 25-3]

[0266] At this point, the effect of combining some of the preferred substituents was explored (Table 26). The presence of a 5-cyclopropyl substituent in place of methyl on the aminopyrazine had previously enhanced LZK affinity and selectivity, but this was not well tolerated by the 3.1.0 dimethyl compound (215) and did not significantly affect binding of the parent 3.1.0 core (217). However, replacement of the acetyl group on the piperidine ring with an alkyl substituent resulted in a significant improvement in potency and an overall 10-fold selectivity for LZK over DLK (216). [Table 26-1] [Table 26-2]

[0267] Continuing the search for alternatives to the difluoropyrrolidine on the same core provided a small number of attractive candidates for further study. In particular, replacement of two fluorines with spiro-cyclopropyl substituents provided compound 201, a compound with good binding affinity and 3-fold selectivity, while the 3.1.1 bicyclic system of compound 204 had similar affinity and 5-fold selectivity. Most excitingly, compound 207 had a Kd measured at just under 1 nM and 180-fold selectivity over DLK for LZK. This 3.2.0 bicyclic substituent was explored in combination with a variety of other modifications (222, 223, 224, 225, 226, 227, 228), but failed to improve on the combination of selectivity and affinity demonstrated by compound 207. Surprisingly, despite previously observed and confirmed trends in the modification of 220 and 221 to 201 and 204, even replacement of the acylpiperidine with an N-alkylpiperidine did not enhance either binding or selectivity.

[0268] Conclusions: Starting with a known DLK inhibitor with nearly twice the specificity for DLK over LZK, substituents were systematically varied to develop novel inhibitors for LZK with subnanomolar potency and excellent selectivity. Not all modifications were synergistic, and combinations of modifications were somewhat unpredictable. A 2-pyrazine substituent confers unexpectedly high membrane permeability, while an N-alkylated piperidine substituent at the 4-position of the central pyridine frequently enhances both LZK binding and selectivity over DLK. The 2-position of the central pyridine is preferentially substituted with pyrrolidines, especially with fused bicyclo or spiro ring systems. A 3.2.0 bicyclic substituent at this position conferred excellent potency and 180-fold selectivity over DLK. Example 6 MLK inhibition in ESCC

[0269] MTS assays (Figure 43) showed that ESCCs containing the 3q amplicon (OVCAR5, KYSE30, and KYSE70 cells) were sensitive to the known LZK inhibitor GNE-3511 compared to control ESCC cells lacking amplified LZK (KYSE410 and OE19 cells). The results were confirmed by soft agar assays (Figure 44) and colony formation assays (Figure 45). Drug-resistant mutant forms of LZK (LZK Q240S )-expressing ESCC cells were resistant to GNE-3511, as shown in colony formation assays (FIG. 46).

[0270] Some of the disclosed MLK inhibitors were also evaluated for their ability to inhibit ESCC. ESCC cells (OVCAR5) were sensitive to compounds 161 and 164 as shown in colony formation assays (Figure 47). Drug-resistant mutant LZK was also sensitive to compounds 161 and 164 as shown in Western blot and colony formation assays in Figures 48 and 49. Q240S ESCC cells expressing 161 were resistant to compound 161. Colony formation assays with compounds 207, 216, and 219 showed that ESCC cells (OVCAR5 and KYSE70) were highly sensitive to treatment with compounds 216 and 219 (Figure 50). Example 7 therapeutic use

[0271] A subject identified as having a disease or condition characterized at least in part by overexpression of LZK is administered a pharmaceutical composition comprising a therapeutically effective amount of an LZK inhibitor as disclosed herein. In some examples, the subject is identified as having cancer, such as HNSCC, LSCC, ESCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer cells (e.g., esophageal adenocarcinoma). In one example, the subject is identified as having cancer and having an upregulated level of LZK expression. In any of the above examples, the subject may be administered a therapeutically effective amount of the pharmaceutical composition at regular intervals for a period of time effective to alleviate at least one sign or symptom of the disease or condition. For example, the subject may be administered a therapeutically effective amount of the pharmaceutical composition once a day or in divided doses throughout the day, such as in divided doses 2-3 times a day. The pharmaceutical composition is administered by any suitable route, including, but not limited to, parenterally (e.g., intravenously, intramuscularly, subcutaneously), orally, or topically.

[0272] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are merely preferred examples of the invention and should not be construed as limiting the scope of the invention, which is rather defined by the following claims, and we therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. General formula: 【Hua330】 or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof. [In the formula, R 2 is alkyl, H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl; R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or R'C(O)N(H)-, where R' is alkyl, or R 2 and R 3 together with the atoms to which they are attached form a phenyl or 5- or 6-membered heteroaryl ring; R 4 is azacycloalkyl, cycloaliphatic, or phenyl; R 5 is heteroaliphatic, aliphatic, or alkylamino; R 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano.

2. R 4 but, 【Chemical 268】 , 3,3-difluoro-1-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, —C(H)(OH)—CH(CH 3 ) 2 , -N(H)(CH 2 ) 4 OH, -N(CH 2 CH 3 ) 2 , 【Chemical 269】 2. The compound of claim 1, wherein:

3. R 5 but, 【Chemistry 270】 - (CH 2 ) 3 N (CH 3 ) 2 , or -CH 2 OH and Z is aliphatic, alkoxy, H, or heteroaliphatic; preferably Z is -C(O)CH 3 , H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl, -(CH 2 ) 2 (OCH 2 CH 2 ) n OCH 3 , where n is an integer from 1 to 10, or 【Chemical 271】 2. The compound of claim 1, wherein:

4. R 2 But -CH 3 , -OCH 3 , -OCF 3 , -CF 3 , -CN, -OCHF 2 , 【Chemical 274】 or —H; R 3 が、-NH 2 、 【Chemistry 275】 2. The compound of claim 1, wherein: 【Request 5】 【Chemical 276】 but, 【Chemical 277】 5. The compound of claim 4, wherein:

6. The compound is 【Chemical 278】 and Z is aliphatic; R 4 but, 【Chemical 279】 and R a and R b together with the atoms to which they are attached form a fused alicyclic or heteroalicyclic ring, or R a is alicyclic, and R b is —H or R 4 but, 【Chemistry 280】 and R a The compound of claim 5 , wherein is alicyclic.

7. The compound is (i) 【Chemical 281】 [In the formula, R 4 teeth, 【Chemistry 331】 is]; or (xiv) 【Chemistry 311】 [In the formula, R 5 teeth, 【Chemical 332】 【Hua 313】 is]; or (xv) 【Chemical 314】 [In the formula, R 2 is -CH 3 or 【Chemistry 315】 and R 4 teeth, 【Hua 316】 and R 5 teeth, 【Hua 317】 is] 2. The compound of claim 1, wherein:

8. The compound 【Chemical 333】 2. The compound of claim 1 selected from:

9. 9. A pharmaceutical composition comprising a compound according to any one of claims 1 to 8 and at least one pharmaceutically acceptable carrier.

10. 10. A composition comprising a compound according to any one of claims 1 to 8 for use in a method of inhibiting mixed lineage kinase (MLK) activity, said method comprising: A composition comprising contacting a cell expressing MLK with said compound or said composition.

11. The composition for use according to claim 10, wherein the MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof.

12. The composition for use according to claim 11, wherein the MLK is LZK, MLK3, or MLK4.

13. 11. The composition for use of claim 10, wherein inhibiting MLK activity is inhibiting cell cycle progression, reducing c-MYC expression, inhibiting c-Jun N-terminal kinase (JNK) pathway signaling, inhibiting PI3K / AKT pathway signaling, inhibiting cyclin-dependent kinase 2 (CDK2) activity, inhibiting extracellular signal-regulated kinase (ERK) pathway signaling, inhibiting NF-κB signaling, or any combination thereof.

14. The composition for use of claim 13, wherein the cells are characterized by amplification of chromosome 3q, amplification of chromosome 11q, overexpression of mitogen-activated protein kinase kinase kinase (MAP3K), or any combination thereof.

15. 11. The composition for use of claim 10, wherein the cells are head and neck squamous cell carcinoma (HNSCC) cells, lung squamous cell carcinoma (LSCC) cells, esophageal cancer cells, hepatocellular carcinoma cells, ovarian cancer cells, small cell lung cancer cells, neuroendocrine prostate cancer cells, or breast cancer cells.

16. The composition for use of claim 10, wherein contacting the cell with the compound comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition containing the therapeutically effective amount of the compound, to a subject having a disease or condition characterized at least in part by MLK overexpression.

17. 17. The composition for use according to claim 16, wherein the disease or condition is cancer.

18. 18. The composition for use of claim 17, wherein the cancer is HNSCC, LSCC, esophageal squamous cell carcinoma (ESCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal adenocarcinoma, or breast cancer.

19. 19. The composition for use of claim 18, wherein the cancer is HNSCC, LSCC, ESCC, or triple-negative breast cancer.

20. 17. The composition for use of claim 16, wherein administering the therapeutically effective amount of the compound or the amount of the pharmaceutical composition reduces the viability of the cancer cells, inhibits tumor growth, or a combination thereof.