Compositions and methods for treating or preventing autoimmune diseases

JP2024533361A5Pending Publication Date: 2025-09-12ORCHARD THERAPEUTICS (EURO) LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024515336
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-08
Filing Date
2022-09-08
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Current Treg cell therapies for autoimmune diseases face challenges related to durability, stability, viability, manufacturing, and dosage, necessitating improved methods for treating these conditions.

Method used

The use of genetically modified pluripotent hematopoietic cells, such as hematopoietic stem cells, engineered to express autoantigen-binding proteins via nucleic acid cassettes linked to lineage-specific transcriptional regulatory elements, to suppress autoreactive immune cells and induce apoptosis, thereby treating autoimmune diseases.

Benefits of technology

This approach effectively suppresses autoreactive immune cells, reduces inflammation, and protects endogenous tissue from autoimmune responses, providing a more durable and targeted therapeutic strategy for autoimmune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Described herein are compositions and methods for treating subjects with or at risk of developing an autoimmune disease. Using the disclosed compositions and methods, patients can be provided with pluripotent hematopoietic cells that are genetically modified to express an autoantigen-binding moiety (e.g., a chimeric antigen receptor) under the control of a lineage-specific transcriptional regulatory element active in CD4+CD25+ regulatory T (Treg) cells (e.g., the Foxp3 promoter).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy was created on August 24, 2022, is named 51139-032WO2_Sequence_Listing_8_24_22, and is 25,567 bytes in size.

[0002] The present disclosure relates to methods for treating autoimmune diseases with regulatory T cells derived from genetically modified pluripotent hematopoietic cells, and compositions that may be used in such methods. [Background technology]

[0003] Regulatory T (Treg) cells are a subset of T cells that play a key role in suppressing immune responses, thereby maintaining homeostasis and self-tolerance. Treg deficiency or dysfunction is implicated in the pathology of several autoimmune diseases, and Treg cell therapy has been investigated as a potential therapeutic paradigm for these diseases. The development of Treg cell therapy has been hindered by difficulties associated with the durability, stability, viability, manufacturing, and dosage of Treg cells. There remains a need for improved Treg cell therapies for the treatment of autoimmune diseases. Summary of the Invention

[0004] The present disclosure relates to compositions and methods for the treatment of autoimmune disease. In a first aspect, the disclosure provides a method of treating or preventing autoimmune disease in a patient (e.g., a mammalian patient, such as a human patient) in need thereof by administering to the patient a population of pluripotent cells comprising a nucleic acid cassette encoding an autoantigen-binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional control elements that are active in CD4+CD25+ regulatory T (Treg) cells (i.e., that are preferentially active in cells of the Treg lineage compared to other cell types (e.g., other hematopoietic cells)).

[0005] In a further aspect, the present disclosure provides a method of suppressing the activity and / or proliferation of a population of autoreactive effector immune cells in a patient (e.g., a mammalian patient, such as a human patient) diagnosed with an autoimmune disease, comprising administering to the patient a population of pluripotent cells comprising a nucleic acid cassette encoding an autoantigen binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., specifically active in cells of the Treg lineage and not active in other cell types, e.g., other hematopoietic cells).

[0006] In another aspect, the disclosure provides a method of inducing apoptosis of autoreactive effector immune cells in a patient (e.g., a mammalian patient, such as a human patient) diagnosed with an autoimmune disease, comprising administering to the patient a population of pluripotent cells comprising a nucleic acid cassette encoding an autoantigen-binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., specifically active in cells of the Treg lineage and not active in other cell types, e.g., other hematopoietic cells).

[0007] In another aspect, the disclosure provides a method of protecting endogenous tissues from an autoimmune response in a patient (e.g., a mammalian patient, such as a human patient) diagnosed with an autoimmune disease, comprising administering to the patient a population of pluripotent cells comprising a nucleic acid cassette encoding an autoantigen-binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., specifically active in cells of the Treg lineage and not active in other cell types, e.g., other hematopoietic cells).

[0008] In another aspect, the disclosure provides a method of reducing inflammation in a patient (e.g., a mammalian patient, such as a human patient) diagnosed with an autoimmune disease, comprising administering to the patient a population of pluripotent cells comprising a nucleic acid cassette encoding an autoantigen-binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., specifically active in cells of the Treg lineage and not active in other cell types, e.g., other hematopoietic cells).

[0009] In some embodiments of any of the above aspects, the pluripotent cell is a pluripotent hematopoietic cell (e.g., a hematopoietic stem cell (HSC) or a hematopoietic progenitor cell (HPC)). In some embodiments, the pluripotent hematopoietic cell is an embryonic stem cell. In some embodiments, the pluripotent hematopoietic cell is an induced pluripotent stem cell. In some embodiments, the pluripotent hematopoietic cell is a lymphoid progenitor cell. In some embodiments, the pluripotent hematopoietic cell is a CD34+ cell (e.g., an HSC).

[0010] In some embodiments, the population of pluripotent hematopoietic cells is administered to the patient systemically. For example, the population of pluripotent hematopoietic cells may be administered to the patient by intravenous injection. In some embodiments, the population of pluripotent hematopoietic cells is administered to the patient locally.

[0011] In some embodiments, the pluripotent hematopoietic cells are autologous to the patient, hi some embodiments, the pluripotent hematopoietic cells are allogeneic to the patient (e.g., HLA-matched allogeneic cells).

[0012] In some embodiments, pluripotent hematopoietic cells (e.g., HSCs, HPCs, embryonic stem cells, induced pluripotent stem cells, lymphoid progenitor cells, and / or CD34+ cells) are transduced ex vivo with a viral vector comprising a nucleic acid cassette encoding an autoantigen binding protein.

[0013] In some embodiments, the pluripotent hematopoietic cells are transduced with a viral vector selected from the group consisting of a Retroviridae family virus, an adenovirus, a parvovirus, a coronavirus, a rhabdovirus, a paramyxovirus, a picornavirus, an alphavirus, a herpesvirus, and a poxvirus. In some embodiments, the viral vector is a Retroviridae family viral vector. In some embodiments, the Retroviridae family viral vector is a lentiviral vector. In some embodiments, the Retroviridae family viral vector is an alpharetroviral vector or a gammaretroviral vector.

[0014] In some embodiments, the Retroviridae family viral vector comprises a central polypurine tract, a woodchuck hepatitis virus post-transcriptional regulatory element, a 5'-LTR, an HIV signal sequence, an HIV Psi signal 5'-splice site, a delta-GAG element, a 3'-splice site, and a 3'-self-inactivating LTR.

[0015] In some embodiments, the viral vector is a pseudotyped viral vector. In some embodiments, the pseudotyped viral vector is selected from the group consisting of pseudotyped adenovirus, pseudotyped parvovirus, pseudotyped coronavirus, pseudotyped rhabdovirus, pseudotyped paramyxovirus, pseudotyped picornavirus, pseudotyped alphavirus, pseudotyped herpesvirus, pseudotyped poxvirus, and pseudotyped retroviridae family virus. In some embodiments, the pseudotyped viral vector is a pseudotyped lentiviral vector.

[0016] In some embodiments, the pseudotyped viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), RD114 virus, murine leukemia virus (MLV), feline leukemia virus (FeLV), Venezuelan equine encephalitis virus (VEE), human foamy virus (HFV), walleye dermal sarcoma virus (WDSV), Semliki Forest virus (SFV), rabies virus, avian leukosis virus (ALV), bovine immunodeficiency virus (BIV), bovine leukemia virus (BLV), Epstein-Barr virus (EBV), caprine arthritis encephalitis virus (CAP), caprine ... The envelope protein is derived from a virus selected from Avian Virus (AEV), Sin Nombre virus (SNV), Cherry Twisted Leaf virus (ChTLV), Simian T-cell leukemia virus (STLV), Mason-Pfizer monkey virus (MPMV), Squirrel monkey retrovirus (SMRV), Rous-associated virus (RAV), Fujinami sarcoma virus (FuSV), Avian carcinoma virus (MH2), Avian encephalomyelitis virus (AEV), Alpha mosaic virus (AMV), Avian sarcoma virus CT10, and Equine infectious anemia virus (EIAV).

[0017] In some embodiments, the pseudotyped viral vector comprises a VSV-G envelope protein.

[0018] In some embodiments, pluripotent hematopoietic cells (e.g., HSCs, HPCs, embryonic stem cells, induced pluripotent stem cells, lymphoid progenitor cells, and / or CD34+ cells) are transfected ex vivo with a polynucleotide comprising a nucleic acid cassette encoding an autoantigen binding protein.

[0019] In some embodiments, the pluripotent hematopoietic cells are transfected using cationic polymers, diethylaminoethyl dextran, polyethyleneimine, cationic lipids, liposomes, calcium phosphate, activated dendrimers, and / or magnetic beads. In some embodiments, the pluripotent hematopoietic cells are transfected by electroporation, nucleofection, squeeze-poration, sonoporation, optical transfection, magnetofection, and / or impalefection.

[0020] In some embodiments, the nucleic acid cassette is part of a transposable element. In some embodiments, the nucleic acid cassette comprises a transposase recognition and cleavage element for integration into a deoxyribonucleic acid (DNA) molecule of the pluripotent hematopoietic cell. In some embodiments, the DNA molecule is a nuclear DNA molecule or a mitochondrial DNA molecule, and the transposase recognition and cleavage element promotes integration into the nuclear DNA molecule or the mitochondrial DNA molecule.

[0021] In some embodiments, pluripotent hematopoietic cells are obtained by delivering a nuclease that catalyzes single-strand or double-strand breaks at a target position in the genome of a cell to a cell. In some embodiments, the nuclease is delivered to a cell in combination with a guide RNA (gRNA) that hybridizes to the target position in the genome of the cell. In some embodiments, the nuclease is a clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein. For example, in some embodiments, the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9) or CRISPR-associated protein 12a (Cas12a). In some embodiments, the nuclease is a transcription activator-like effector nuclease, a meganuclease, or a zinc finger nuclease.

[0022] In some embodiments, while the cells are contacted with the nuclease, the cells are further contacted with a template polynucleotide comprising a nucleic acid cassette encoding an autoantigen binding protein. In some embodiments, the template polynucleotide comprises a 5' homology arm and a 3' homology arm having nucleic acid sequences sufficiently similar to nucleic acid sequences located 5' and 3' to the target position, respectively, to promote homologous recombination.

[0023] In some embodiments, the nuclease, gRNA, and / or template polynucleotide is delivered to a cell by contacting the cell with a viral vector encoding the nuclease, gRNA, and / or template polynucleotide.

[0024] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an AAV, adenovirus, parvovirus, coronavirus, rhabdovirus, paramyxovirus, picornavirus, alphavirus, herpesvirus, poxvirus, or a virus in the Retroviridae family.

[0025] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is a Retroviridae virus. In some embodiments, the Retroviridae virus is a lentiviral vector, an alpharetroviral vector, or a gammaretroviral vector. In some embodiments, the Retroviridae virus encoding the nuclease, gRNA, and / or template polynucleotide comprises a central polypurine tract, a woodchuck hepatitis virus post-transcriptional regulatory element, a 5'-LTR, an HIV signal sequence, an HIV Psi signal 5'-splice site, a delta-GAG element, a 3'-splice site, and a 3'-self-inactivating LTR.

[0026] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an integration-deficient lentiviral vector. In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAVrh74.

[0027] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter.

[0028] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO: 1.

[0029] SEQ ID NO: 1 TTCCCATCCACACATAGAGCTTCAGATTCTCTTTCTTTCCCCAGAGACCCTCAAATATCCTCTCACTCACAGAATGGTGTCTCTGCCTGCCTCGGGTTGGCCCTGTGATTTATTTTAGTTCTTTTCCCTTGTTTTTTTTTTTTCAAACTCTATACACTTTTGTTTTAAAAACTGTGGTTTCTCATGAGCCCTATTATCTCATTGATACCTCTCACCTCTGTGGTGAGGGGAAGAAATCATATTTTCAGATGACTCGTAAAGGGCAAAGAAAAAAACCCAAAATTTCAAAATTTCCGTTTAAGTCTCATAATCAAGAAAAGGAGAAACACAGAGAGAGAGAAAAAAAAAACTATGAGAACCCCCCCCCACCCCGTGATTATCAGCGCACACACTCATCGAAAAAAATTTGGATTATTAGAAGAGAGAGGTCTGCGGCTTCCACACCGTACAGCGTGGTTTTTCTTCTCGGTATAAAAGCAAAGTTGTTTTTGATACGTGACAGTTTCCCACAAGCCAGGCTGATCCTTTTCTGTCAGTCCACTTCACCAAGGTGAGTGTCCCTGCTCTCCCCTACCAGATGTGGGCCCCATTGGAGGAGATGGCAGGGAGGTAGGCACGGCGGGGGGGTCAGGGGCCCTCTGGTACAGTGGGATGTACCCAGCTACCGTGATTCCAGCCAGGTAAGGTCT

[0030] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:2.

[0031] SEQ ID NO: 2 GCTTCAGATTCTCTTTCTTTCCCCAGAGACCCTCAAATATCCTCTCACTCACAGAATGGTGTCTCTGCCTGCCTCGGGTTGGCCCTGTGATTTATTTTAGTTCTTTTCCCTTGTTTTTTTTTTTTCAAACTCTATACACTTTTTGTTTTAAAAACTGTGGTTTCTCATGAGCCCTATTATCTCATTGATACCTCTCACCTCTGTGGTGAGGGGAAGAAATCATATTTTCAGATGACTCGTAA AGGGCAAAGAAAAAAACCCAAAATTTCAAAATTTCCGTTTAAGTCTCATAATCAAGAAAAGGAGAAACACAGAGAGAGAGAAAAAAAAAACTATGAGAACCCCCCCCACCCCGTGATTATCAGCGCACACACTCATCGAAAAAAATTTGGATTATTAGAAGAGAGAGGTCTGCGGCTTCCACACCGTACAGCGTGGTTTTTCTTCTCGGTATAAAAGCAAAGTTGTTTTTGATACGTGAC

[0032] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:3.

[0033] SEQ ID NO: 3 GCTTCAGATCCCTTCTTCTGTTCAACCCAGCGATCCTCCAACGTCTCACAAACACAATGCTGTCTCTACCTGCCTCGGGATGCCTTTGTGATTTGACTTATTTTCCCTCAGTTTTTTTTTTCTGACTCTACACACTTTTGTTTAAGAAATTGTGGTTTCTCATGAGCCCTGTTATCTCATTGATACCTTTTACCTCTGTGGTGAGGGGAA GAAATCATATTTTCAGATGACTTGTAAAGGGCAAAGAAAAACCCAAAATTTCAAAATTTCCGTTTAAGTCTCATAAGAAAAGAATAAACAAAGTAAGAGAGCAAAGAAAAAAAAAACTACAAGAACCCCCCCCCCCTGCAATTATCAGCACACACACTCATCAAAAAAAAATTGGATTATTAGAAGAGCGAGGTCTGCGGCTTCCAC

[0034] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:4.

[0035] SEQ ID NO:4 GCTTCAGATTCTCTTTCTTTCCCCAGAGACCCTCAAATATCCTCTCACTCACAGAATGGTGTCTCTGCCTGCCTCGGGTTGGCCCTGTGATTTATTTTAGTTCTTTTCCCTTGTTTTTTTTTTCAAACTCTATACACTTTTTGTTTTAAAAACTGTGGTTTCTCATGAGCCCTATTATCTCATTGATACCTCTCACCTCTGTGGTGAGGGG AAGAAATCATATTTTCAGATGACTCGTAAAGGGCAAAGAAAAAAACCCAAAATTTCAAAATTTCCGTTTAAGTCTCATAATCAAGAAAAGGAGAAACACAGAGAGAGAGAAAAAAAAAACTATGAGAACCCCCCCCACCCCGTGATTATCAGCGCACACACTCATCGAAAAAAATTTGGATTATTAGAAGAGAGAGGTCTGCGGCTTCCAC

[0036] In some embodiments, the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo.

[0037] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer.

[0038] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5.

[0039] SEQ ID NO:5 TTTAAGTCTTTTGCACTTGAAAATGAGATAACTGTTCACCCCATGTTGGCTTCCAGTCTCCTTTATGGCTTCATTTTTTCCATTTACTGCAGAGGTCAAAAGTGTGGGTATGGGAGCCAGACTGTCTGGAACAACCTAGCCTCAACTCAA

[0040] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:6.

[0041] SEQ ID NO:6 AAGTCCTTTCCTACTTGAAAATGAGATAAATGTTCACCTATGTTGGCTTCTAGTCTCTTTTATGGCTTCATTTTTTCCATTTACTATAGAGGTTAAGAGTGTGGGTACTGGAGCCAGACTGTCTGGGACAAACCCAGCGTCACCCCAA

[0042] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:7.

[0043] SEQ ID NO:7 TAGATTACTCTTTTCTTGTGGGGCTTCTGTGTATGGTTTTGTGTTTTAAGTCTTTTGCACTTGAAAATGAGATAACTGTTCACCCCATGTTGGCTTCCAGTCTCCTTTATGGCTTCATTTTTTCCATTTACTGCAGAGGTCAAAAGTGTGGGTATGGGAGCCAGACTGTC TGGAACAACCTAGCCTCAACTCAAGTCATCTGTGTGAATTTTACCCAGGCTCTTAACCTCTCTGTACCTCCATTTCCTCGTATGTACTGTGATGATTATAACAGTACCTACCTCAGAGGATCTTTCTGAGGATTATTTTTATTAATGATGGTAGGTGCTCAGCACAAGGCC

[0044] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:8.

[0045] SEQ ID NO:8 TAGGTTAGTCTTTTTTTCTGTGGCTTCTGTCTCTGGTTTTGTGCTTAGAAAGTCCTTTCCTACTTGAAAATGAGATAAATGTTCACCTATGTTGGCTTCTAGTCTCTTTTATGGCTTCATTTTTTCCATTTACTATAGAGGTTAAGAGTGTGGGTACTGGAGCCAGACTGT CTGGGACAAACCCAGCGTCACCCCAAGCCTATGTGTGATTTTTAGCCAGGCACTTAACCTCTCCATACCTCCATTTCCTCATATGTACTGCAATGGTTATAATAGTACCTTCCTCAGGAGTCTTTGTTTAGATTAAAATTTTTAACCACAGTAAATACTTAGCACAAGGCC

[0046] In some embodiments, the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo.

[0047] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer.

[0048] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9.

[0049] SEQ ID NO:9 CAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAAATCTGGCCAAGTTCA GGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTTTCTGAGA

[0050] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:10.

[0051] SEQ ID NO: 10 CAGATGGACATCACCTACCACATCCACCAGCACCCATGTCACCCCACCTGGGCCAAGCCTGCTGCAGGACAGGGCAGCCAGTTCTCGGAACGAAACCTGTGGGGTGGGGTATCTGCCCTCTTCTCTTCCTCCGTGGTGTCGATGAAGCCCGGCGCATCCGGCCGCCATGACGTCAATGGCGGAAAAAATCTG GGCAAGTCGGGGGCTGTGACAACAGGGCCCAGATGCAGACCCCGATATGAAAACATAATCTGTGTCCCAGAAACATCCCCCATTCAGCTTCTGAGAAACCCAGTCAGAAAGGGACGTCCCAACAGACAGTGCAGGAAGCCGGCTGCCCAGCCCGGCCCTCTAGGTCCTCTACCCCCAGACAGATCATCTCCA

[0052] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:11.

[0053] SEQ ID NO: 11 TGGGTTTTGCATGGTAGCCAGATGGACGTCACCTACCACATCCGCTAGCACCCACATCACCCTACCTGGGCCTATCCGGCTACAGGATAGACTAGCCACTTCTCGGAACGAAAACCTGTGGGGTAGATTATCTGCCCCCTTCTCTTCCTCCTTGTTGCCGATGAAGCCCAATGCATCCGGCCGCCATGACGTCAATGGCAGAAAAAATCTGGCCA AGTTCAGGTTGTGACAACAGGGCCCAGATGTAGACCCCGATAGGAAAACATATTCTATGTCCCAGAAAACAACCTCCATACAGCTTCTAAGAAACAGTCAAACAGGAACGCCCCAACAGACAGTGCAGGAAGCTGGCTGGCCAGCCCAGCCCTCCAGGTCCCTAGTACCACTAGACAGACCATATCCAATTCAGGTCCTCTTTCTGAGAATGTA

[0054] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:12.

[0055] SEQ ID NO: 12 GGGCTTGTCATAGTGGCCAGATGGACATCACCTACCACATCCACCAGCACCCATGTCACCCCCCTGGGCCAAGCCTGCTGCAGGACAGGGCAGCCAGTTCTCGGAACGAAACCTGTGGGGTGGGTATCTGCCCTCTTCTCTTCCTCCGTGGTGTCGATGAAGCCCGGCGCATCCGGCCGCCATGACGTCAATGGCGGAAAAATCTGGG CAAGTCGGGGGCTGTGACAACAGGGCCCAGATGCAGACCCCGATATGAAAACATAATCTGTGTCCCAGAAACATCCCCCATTCAGCTTCTGAGAAACCAGTCAGAAAGGGACGTCCCAACAGACAGTGCAGGAAGCCGGCTGCCCAGCCCGGCCCTCTAGGTCCTCTACCCCCAGACAGATCATCTCCATGTCCCTGTCTGAGAATGTA

[0056] In some embodiments, the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel.

[0057] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer.

[0058] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:13.

[0059] SEQ ID NO: 13 CCCGGGGCCCAGAATGGGGTAAGCAGGGTGGGGTACTTGGGCCTATAGGTGTCGACCTTTACTGTGGCATGTGGCGGGGGGGGGGGGGGGCTGGGCACAGGAAGTGGTTTATGGGTCCCAGGCAAGTCTGACTTATGCAGATATTGCAGGGCCAAGAAAATCCCCACTCTCCAGGCTTCAGAGATTCAAGGCTTTCCCCACCCC

[0060] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:14.

[0061] SEQ ID NO: 14 CCCTGGGCCCAGGATGGGGCAGGCAGGGTGGGGTACCTGGACCTACAGGTGCCGACCTTTACTGTGGCACTGGGCGGGAGGGGGGCTGGCTGGGGCACAGGAAGTGGTTTCTGGGTCCCAGGCAAGTCTGTGACTTATGCAGATGTTGCAGGGCCAAGAAAATCCCACCTGCCAGGCCTCAGAGATTGGAGGCTCTCCCC

[0062] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:15.

[0063] SEQ ID NO: 15 GTGAGGCCCGGGGCCCAGAATGGGGTAAGCAGGGTGGGGTACTTGGGCCTATAGGTGTCGACCTTTACTGTGGCATGTGGCGGGGGGGGGGGGGGCTGGGGCACAGGAAGTGGTTTATGGGTCCCAGGCAAGTCTGACTTATGCAGATATTGCAGGGCCAAGAAAATCCCCACTCTCCAGGCTTCAGAGATTCAAGGCTTTCCCCACCCCTCCCAATCCTCATCCCGATAG

[0064] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:16.

[0065] SEQ ID NO: 16 GTGAGGCCCTGGGCCCAGGATGGGGCAGGCAGGGTGGGGTACCTGGACCTACAGGTGCCGACCTTTACTGTGGCACTGGGCGGGAGGGGGGCTGGCTGGGCACAGGAAGTGGTTTCTGGGTCCCAGGCAAGTCCTGACTTATGCAGATGTTGCAGGGCCAAGAAAATCCCCACCTGCCAGGCCTCAGAGATTGGAGGCTCTCCCCGACCTCCCAATCC

[0066] In some embodiments, the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel.

[0067] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer.

[0068] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:17.

[0069] SEQ ID NO: 17 TCCCCTGAGGTCCACCACCATTTCCCCAGAGGGCTGGATCACGGGGGGTAGCTATTCTTCAACAGCACTTCAAATCAGCAGCAGCACACAGGCCTTAAAACAATAATAAGTTGAAATGTATTTGCTAGGAAAGTCACCGACCTACAAAGAAAACCTTATCGCTGATCTAGCAGCGCACACCAGCCTCCCCTTTGCAAGAGCTGAGATCAAAAGATAAAGAAGC TATCAAAAAGCCATCTGCCCACTTAAAATAACATCTCAAGTCACGTTGGGAACCACAAACATGGGGCCAGCTACCAAAACAATTGTCTAAATGAACTACTTCAATTTCTCCTTAAAACCACCCATGTATTTTAAAAGAAAAACACCCTCTCCACCCACCTTGGCACGGCAAGGTTTTGATTTGTCTGTTCCCTTCCTTTCACATTCTTGAAAATGACCAAAACTT

[0070] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:18.

[0071] SEQ ID NO: 18 AGTTTGGTCATTTTAAAGAGTGTGAAAGGCAGAGAACAGAGAAATCAAAACCTTGCAGGGCCAAGGTGGGTGGAGAGGGTGTTTTTCTTTTAACATACATGGGCGGTTTTAAGGAGAAATTGAAGCAGCCTGTTCAGACAATTGTTTTGGTATCTGGCCCCAGGTCTGTGGTTCCTAACATGACTTGTGATATTATTTTAAGTGGGCAGATGGCTTTTTGAT AGCTTCTTTATCTTTCGATCTCAGCTCTTGCAAAGGGGAGGTTGGTGCTCATTGCAAGATCAGCGATAAGGGTTTCTTTGTAGGTCGGTGGCTTTCTTGGTGAGTACATTTCAACATATTATTGTTTTAGAACCTGTGTGCTGCCATGACTTGCAGCACTGTTGAAGACTAGCCACCCTTTGTGACCTAGCCCTCTTGGGAAATGGCGGAGGATCTCAGGG

[0072] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:19.

[0073] SEQ ID NO: 19 CAGTGGGCCTGTGGCCAACGATTCTGAAGCCCTCTACAGCAGGCCTCCCACAGATAAGAAAAGGGATCCCCTGAGGTCCACCACCATTTCCCCAGAGGGCTGGATCACGGGGGGTAGCTATTCTTCAACAGCACTTCAAATCAGCAGCAGCACACAGGCCTTAAAACAATAATAAGTTGAAATGTATTTGCTAGGAAAGTCACCGACCTACAAAGAAAACCTTATCGCTGATCTAGCAGCGCACACCAGCCTCCCCTTTGCAAGAGCTGAGATCAAAAGATAAAGAAGCTATCAAAAAGCCATCTGCCCACTTAAAATAACATCTCAAGTCACGTTGGGAACCACAAACATGGGGCCAGCTACCAAAACAATTGTCTAAATGAACTACTTCAATTTCTCCTTAAAACCACCCATGTATTTTAAAAGAAAAACACCCTCTCCACCCACCTTGGCACGGCAAGGTTTTGATTTGTCTGTTCCCTTCCTTTCACATTCTTGAAAATGACCAAACTTCAGTACTCAACTGTCTTATCTTCCAGAAAGGGCTCCCACAACTGCCGATGGAATAAGAAGTGATTGAAATGCAGGCGATTCTGGGGGC

[0074] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:20.

[0075] SEQ ID NO: 20 CGGCTGTCATGGGAACCCTGTCTGTAAGATGCGACAGTTTGGGTAAAGGAGTTTGGTCATTTTAAAGAGTGTGAAAGGCAGAGAACAGAGAAATCAAAACCTTGCAGGGCCAAGGTGGGTGGAGAGGGTGTT TTTCTTTTAACATACATGGGCGGTTTTAAGGAGAAATTGAAGCAGCCTGTTCAGACAATTGTTTTGGTATCTGGCCCCAGGTCTGTGGTTCCTAACATGACTTGTGATATTATTTTAAGTGGGCAGATGGCTT TTTGATAGCTTCTTTATCTTTCGATCTCAGCTCTTGCAAAGGGGAGGTTGGTGCTCATTGCAAGATCAGCGATAAGGGTTTCTTTGTAGGTCGGTGGCTTTCTTGGTGAGTACATTTCAACATATTATTGTTT TAGAACCTGTGTGCTGCCAGTGACTTGCAGCACTGTTGAAGACTAGCCACCCTTTGTGACCTAGCCCTCTTGGGAAATGGCGGAGGATCTCAGGGTATATCCCTTACCTGTGGGAGCCCTATCAGAGGGCTTC

[0076] In some embodiments, the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5.

[0077] In some embodiments, the nucleic acid cassette is operably linked to a riboswitch. In some embodiments, binding of a ligand to the riboswitch induces expression of the nucleic acid cassette. In some embodiments, binding of the ligand to the riboswitch represses expression of the nucleic acid cassette.

[0078] In some embodiments, the autoantigen binding protein is a single-chain polypeptide. In some embodiments, the autoantigen binding protein is a chimeric antigen receptor (CAR).

[0079] In some embodiments, the chimeric antigen receptor comprises an antigen recognition domain, a hinge domain, a transmembrane domain, and one or more intracellular signaling domains.

[0080] In some embodiments, the one or more intracellular signaling domains comprise one or more primary intracellular signaling domains, and optionally one or more costimulatory intracellular signaling domains.

[0081] In some embodiments, the antigen recognition domain is a single chain antibody fragment (eg, a single chain Fv molecule (scFv)).

[0082] In some embodiments, the hinge domain is a CD28, CD8, IgG1 / IgG4, CD4, CD7, or IgD hinge domain.

[0083] In some embodiments, the hinge domain is a CD28 hinge domain.

[0084] In some embodiments, the transmembrane domain comprises a CD28, CD3 zeta, CD8, FcRIγ, CD4, CD7, OX40, or MHC (H2-Kb) transmembrane domain.

[0085] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain.

[0086] In some embodiments, the one or more primary intracellular signaling domains are selected from the group consisting of CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), CD66d, DAP10, and DAP12 intracellular signaling domains.

[0087] In some embodiments, at least one of the one or more primary intracellular signaling domains is a CD3 zeta intracellular signaling domain.

[0088] In some embodiments, the one or more costimulatory intracellular signaling domains are selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, CD83, CDS, ICAM-1, LFA-1 (CD11a / CD18), an MHC class I molecule, BTLA, and a Toll ligand receptor intracellular signaling domain.

[0089] In some embodiments, at least one of the one or more costimulatory intracellular signaling domains is a CD28 intracellular signaling domain.

[0090] In some embodiments, the chimeric antigen receptor comprises an N-terminal leader sequence. In some embodiments, the antigen recognition domain comprises an N-terminal leader sequence. In some embodiments, the N-terminal leader sequence of the antigen recognition domain is cleaved from the antigen recognition domain during cellular processing and localization of the chimeric antigen receptor to the cell membrane.

[0091] In some embodiments, the autoantigen binding protein is a multi-chain protein. In some embodiments, the autoantigen binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, a nanobody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule.

[0092] In some embodiments, the autoimmune disease is type 1 diabetes, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue dermatitis, chronic fatigue immune deficiency syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, juvenile arthritis, lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, or Wegener's granulomatosis.

[0093] In some embodiments, the autoantigen is myelin oligodendrocyte glycoprotein, aquaporin 4, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, Fc portion of immunoglobulin, citrullinated peptide, carbamylated peptide, thyrotropin receptor, or a protein expressed in the thyroid gland.

[0094] In some embodiments, the autoimmune disease is multiple sclerosis and the autoantigen is myelin oligodendrocyte glycoprotein.

[0095] In some embodiments, the autoimmune disease is type I diabetes and the autoantigen is insulin, GAD-65, IA-2, or ZnT8.

[0096] In some embodiments, the autoimmune disease is rheumatoid arthritis and the autoantigen is collagen II, the Fc portion of an immunoglobin, a citrullinated peptide, a carbamylated peptide, or HSP65.

[0097] In some embodiments, the autoimmune disease is myasthenia gravis and the autoantigen is AChR, MuSK, or LRP4.

[0098] In some embodiments, the autoimmune disease is lupus and the autoantigen is histone II A.

[0099] In some embodiments, the autoimmune disease is hypothyroidism and the autoantigen is a protein expressed in the thyroid gland.

[0100] In some embodiments, the autoimmune disease is Graves' disease and the autoantigen is thyrotropin receptor.

[0101] In some embodiments, the autoimmune disease is pemphigus vulgaris and the autoantigen is double-stranded DNA.

[0102] In some embodiments, the autoimmune disease is psoriasis and the autoantigen is double-stranded DNA.

[0103] In some embodiments, the autoimmune disease is neuromyelitis optica and the autoantigen is aquaporin 4.

[0104] In some embodiments, prior to administering the population of multipotent hematopoietic cells to the patient, a population of progenitor cells is isolated from the patient or donor, and the progenitor cells are expanded and genetically modified ex vivo to obtain the population of cells administered to the patient. In some embodiments, the progenitor cells are CD34+ HSCs, and the progenitor cells are expanded without substantial loss of HSC functional potential. In some embodiments, prior to isolating the progenitor cells from the patient or donor, the patient or donor is administered one or more multipotent hematopoietic cell mobilizing agents.

[0105] In some embodiments, prior to administering the population of pluripotent hematopoietic cells to the patient, the population of endogenous pluripotent hematopoietic cells is ablated in the patient by administering one or more conditioning agents to the patient.

[0106] In some embodiments, the method comprises ablating a population of endogenous pluripotent hematopoietic cells in the patient by administering one or more conditioning agents to the patient prior to administering the population of pluripotent hematopoietic cells to the patient.

[0107] In some embodiments, the one or more conditioning agents are non-myeloablative conditioning agents. In some embodiments, the one or more conditioning agents deplete a population of CD34+ cells in the patient. In some embodiments, the depleted CD34+ cells are lymphoid progenitor cells. In some embodiments, the one or more conditioning agents comprise an antibody or antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment thereof binds to CD117, HLA-DR, CD34, CD90, CD45, or CD133. In some embodiments, the antibody or antigen-binding fragment thereof binds to CD117. In some embodiments, the antibody or antigen-binding fragment thereof is conjugated to a cytotoxin.

[0108] In some embodiments, when the population of pluripotent hematopoietic cells is administered to a patient, the administered cells or their progeny differentiate into CD4+CD25+ Treg cells.

[0109] In some embodiments, the patient is a mammal and the cell is a mammalian cell, hi some embodiments, the mammal is a human and the cell is a human cell.

[0110] In another aspect, the disclosure provides a pharmaceutical composition comprising (i) a population of pluripotent cells (e.g., pluripotent hematopoietic cells) comprising a nucleic acid cassette encoding an autoantigen-binding protein, which may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., that are specifically active in cells of the Treg lineage and not in other cell types (e.g., other hematopoietic cells)), and (ii) one or more pharmaceutically acceptable excipients, carriers, or diluents.

[0111] In some embodiments of any of the above aspects, the pluripotent cells are pluripotent hematopoietic cells (e.g., HSCs or HPCs). In some embodiments, the pluripotent hematopoietic cells are embryonic stem cells. In some embodiments, the pluripotent hematopoietic cells are induced pluripotent stem cells. In some embodiments, the pluripotent hematopoietic cells are lymphoid progenitor cells. In some embodiments, the pluripotent hematopoietic cells are CD34+ cells (e.g., HSCs).

[0112] In some embodiments, pluripotent hematopoietic cells are transduced ex vivo with a viral vector comprising a nucleic acid cassette encoding an autoantigen binding protein.

[0113] In some embodiments, the viral vector is selected from the group consisting of a Retroviridae family virus, an adenovirus, a parvovirus, a coronavirus, a rhabdovirus, a paramyxovirus, a picornavirus, an alphavirus, a herpesvirus, and a poxvirus. In some embodiments, the viral vector is a Retroviridae family virus vector. In some embodiments, the Retroviridae family virus vector is a lentiviral vector. In some embodiments, the Retroviridae family virus vector is an alpharetroviral vector or a gammaretroviral vector.

[0114] In some embodiments, the Retroviridae family viral vector comprises a central polypurine tract, a woodchuck hepatitis virus post-transcriptional regulatory element, a 5'-LTR, an HIV signal sequence, an HIV Psi signal 5'-splice site, a delta-GAG element, a 3'-splice site, and a 3'-self-inactivating LTR.

[0115] In some embodiments, the viral vector is a pseudotyped viral vector. In some embodiments, the pseudotyped viral vector is selected from the group consisting of pseudotyped adenovirus, pseudotyped parvovirus, pseudotyped coronavirus, pseudotyped rhabdovirus, pseudotyped paramyxovirus, pseudotyped picornavirus, pseudotyped alphavirus, pseudotyped herpesvirus, pseudotyped poxvirus, and pseudotyped retroviridae family virus. In some embodiments, the pseudotyped viral vector is a pseudotyped lentiviral vector.

[0116] In some embodiments, the pseudotyped viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), RD114 virus, murine leukemia virus (MLV), feline leukemia virus (FeLV), Venezuelan equine encephalitis virus (VEE), human foamy virus (HFV), walleye dermal sarcoma virus (WDSV), Semliki Forest virus (SFV), rabies virus, avian leukosis virus (ALV), bovine immunodeficiency virus (BIV), bovine leukemia virus (BLV), Epstein-Barr virus (EBV), caprine arthritis encephalitis virus (CAP), caprine ... The envelope protein is derived from a virus selected from Avian Virus (AEV), Sin Nombre virus (SNV), Cherry Twisted Leaf virus (ChTLV), Simian T-cell leukemia virus (STLV), Mason-Pfizer monkey virus (MPMV), Squirrel monkey retrovirus (SMRV), Rous-associated virus (RAV), Fujinami sarcoma virus (FuSV), Avian carcinoma virus (MH2), Avian encephalomyelitis virus (AEV), Alpha mosaic virus (AMV), Avian sarcoma virus CT10, and Equine infectious anemia virus (EIAV).

[0117] In some embodiments, the pseudotyped viral vector comprises a VSV-G envelope protein.

[0118] In some embodiments, pluripotent hematopoietic cells are transfected ex vivo with a polynucleotide comprising a nucleic acid cassette encoding an autoantigen binding protein.

[0119] In some embodiments, the pluripotent hematopoietic cells are transfected using cationic polymers, diethylaminoethyl dextran, polyethyleneimine, cationic lipids, liposomes, calcium phosphate, activated dendrimers, and / or magnetic beads, hi some embodiments, the pluripotent hematopoietic cells are transfected by electroporation, nucleofection, squeezeporation, sonoporation, optical transfection, magnetofection, and / or impalefection.

[0120] In some embodiments, the nucleic acid cassette is part of a transposable element. In some embodiments, the nucleic acid cassette comprises a transposase recognition and cleavage element for integration into a deoxyribonucleic acid (DNA) molecule of the pluripotent hematopoietic cell. In some embodiments, the DNA molecule is a nuclear DNA molecule or a mitochondrial DNA molecule, and the transposase recognition and cleavage element promotes integration into the nuclear DNA molecule or the mitochondrial DNA molecule.

[0121] In some embodiments, pluripotent hematopoietic cells are obtained by delivering a nuclease that catalyzes single-strand or double-strand breaks at a target location in the genome of a cell to a cell. In some embodiments, the nuclease is delivered to a cell in combination with a guide RNA (gRNA) that hybridizes to the target location in the genome of the cell. In some embodiments, the nuclease is a clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein. In some embodiments, the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9) or CRISPR-associated protein 12a (Cas12a). In some embodiments, the nuclease is a transcription activator-like effector nuclease, a meganuclease, or a zinc finger nuclease.

[0122] In some embodiments, while the cells are contacted with the nuclease, the cells are further contacted with a template polynucleotide comprising a nucleic acid cassette encoding an autoantigen binding protein. In some embodiments, the template polynucleotide comprises a 5' homology arm and a 3' homology arm having nucleic acid sequences sufficiently similar to nucleic acid sequences located 5' and 3' to the target position, respectively, to promote homologous recombination.

[0123] In some embodiments, the nuclease, gRNA, and / or template polynucleotide is delivered to a cell by contacting the cell with a viral vector encoding the nuclease, gRNA, and / or template polynucleotide.

[0124] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an AAV, adenovirus, parvovirus, coronavirus, rhabdovirus, paramyxovirus, picornavirus, alphavirus, herpesvirus, poxvirus, or a virus in the Retroviridae family.

[0125] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is a Retroviridae virus. In some embodiments, the Retroviridae virus is a lentiviral vector, an alpharetroviral vector, or a gammaretroviral vector. In some embodiments, the Retroviridae virus encoding the nuclease, gRNA, and / or template polynucleotide comprises a central polypurine tract, a woodchuck hepatitis virus post-transcriptional regulatory element, a 5'-LTR, an HIV signal sequence, an HIV Psi signal 5'-splice site, a delta-GAG element, a 3'-splice site, and a 3'-self-inactivating LTR.

[0126] In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an integration-deficient lentiviral vector. In some embodiments, the viral vector encoding the nuclease, gRNA, and / or template polynucleotide is an AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAVrh74.

[0127] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter.

[0128] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO: 1.

[0129] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:2.

[0130] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:3.

[0131] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:4.

[0132] In some embodiments, the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo.

[0133] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer.

[0134] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5.

[0135] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:6.

[0136] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:7.

[0137] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:8.

[0138] In some embodiments, the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo.

[0139] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer.

[0140] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9.

[0141] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:10.

[0142] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:11.

[0143] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:12.

[0144] In some embodiments, the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel.

[0145] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer.

[0146] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:13.

[0147] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:14.

[0148] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:15.

[0149] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:16.

[0150] In some embodiments, the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel.

[0151] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer.

[0152] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:17.

[0153] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:18.

[0154] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:19.

[0155] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:20.

[0156] In some embodiments, the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5.

[0157] In some embodiments, the nucleic acid cassette is operably linked to a riboswitch, hi some embodiments, binding of a ligand to the riboswitch induces expression of the nucleic acid cassette.

[0158] In some embodiments, the autoantigen binding protein is a single chain polypeptide. In some embodiments, the autoantigen binding protein is a chimeric antigen receptor.

[0159] In some embodiments, the chimeric antigen receptor comprises an antigen recognition domain, a hinge domain, a transmembrane domain, and one or more intracellular signaling domains.

[0160] In some embodiments, the one or more intracellular signaling domains comprise one or more primary intracellular signaling domains, and optionally one or more costimulatory intracellular signaling domains.

[0161] In some embodiments, the antigen recognition domain is a single chain antibody fragment (eg, a single chain Fv molecule (scFv)).

[0162] In some embodiments, the hinge domain is a CD28, CD8, IgG1 / IgG4, CD4, CD7, or IgD hinge domain.

[0163] In some embodiments, the hinge domain is a CD28 hinge domain.

[0164] In some embodiments, the transmembrane domain comprises a CD28, CD3 zeta, CD8, FcRIγ, CD4, CD7, OX40, or MHC (H2-Kb) transmembrane domain.

[0165] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain.

[0166] In some embodiments, the one or more primary intracellular signaling domains are selected from the group consisting of CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), CD66d, DAP10, and DAP12 intracellular signaling domains.

[0167] In some embodiments, at least one of the one or more primary intracellular signaling domains is a CD3 zeta intracellular signaling domain.

[0168] In some embodiments, the one or more costimulatory intracellular signaling domains are selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, CD83, CDS, ICAM-1, LFA-1 (CD11a / CD18), an MHC class I molecule, BTLA, and a Toll ligand receptor intracellular signaling domain.

[0169] In some embodiments, at least one of the one or more costimulatory intracellular signaling domains is a CD28 intracellular signaling domain.

[0170] In some embodiments, the chimeric antigen receptor comprises an N-terminal leader sequence. In some embodiments, the antigen recognition domain comprises an N-terminal leader sequence. In some embodiments, the N-terminal leader sequence of the antigen recognition domain is cleaved from the antigen recognition domain during cellular processing and localization of the chimeric antigen receptor to the cell membrane.

[0171] In some embodiments, the autoantigen binding protein is a multi-chain protein. In some embodiments, the autoantigen binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule.

[0172] In some embodiments, the autoantigen is myelin oligodendrocyte glycoprotein, aquaporin 4, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, Fc portion of immunoglobulin, citrullinated peptide, carbamylated peptide, thyrotropin receptor, or a protein expressed in the thyroid gland.

[0173] In another aspect, the present disclosure provides a kit comprising the pharmaceutical composition described herein. The kit may further comprise a package insert instructing a user of the kit to administer the pharmaceutical composition to a human patient with an autoimmune disease. The package insert may instruct a user of the kit to practice a method described herein.

[0174] In another aspect, the present disclosure provides a nucleic acid cassette encoding an autoantigen binding protein, which may be operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells (i.e., that are specifically active in cells of the Treg lineage and not in other cell types (e.g., other hematopoietic cells)).

[0175] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter.

[0176] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO: 1.

[0177] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:2.

[0178] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:3.

[0179] In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:4.

[0180] In some embodiments, the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo.

[0181] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer.

[0182] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5.

[0183] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:6.

[0184] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:7.

[0185] In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:8.

[0186] In some embodiments, the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo.

[0187] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer.

[0188] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9.

[0189] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:10.

[0190] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:11.

[0191] In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:12.

[0192] In some embodiments, the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel.

[0193] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer.

[0194] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:13.

[0195] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:14.

[0196] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 15. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:15.

[0197] In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO:16.

[0198] In some embodiments, the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel.

[0199] In some embodiments, the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer.

[0200] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:17.

[0201] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:18.

[0202] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:19.

[0203] In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 90% identical (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has a nucleic acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO:20.

[0204] In some embodiments, the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5.

[0205] In some embodiments, the nucleic acid cassette is operably linked to a riboswitch, hi some embodiments, binding of a ligand to the riboswitch induces expression of the nucleic acid cassette.

[0206] In some embodiments, the autoantigen binding protein is a single chain polypeptide. In some embodiments, the autoantigen binding protein is a chimeric antigen receptor.

[0207] In some embodiments, the chimeric antigen receptor comprises an antigen recognition domain, a hinge domain, a transmembrane domain, and one or more intracellular signaling domains.

[0208] In some embodiments, the one or more intracellular signaling domains comprise one or more primary intracellular signaling domains, and optionally one or more costimulatory intracellular signaling domains.

[0209] In some embodiments, the antigen recognition domain is a single chain antibody fragment (eg, a single chain Fv molecule (scFv)).

[0210] In some embodiments, the hinge domain is a CD28, CD8, IgG1 / IgG4, CD4, CD7, or IgD hinge domain.

[0211] In some embodiments, the hinge domain is a CD28 hinge domain.

[0212] In some embodiments, the transmembrane domain comprises a CD28, CD3 zeta, CD8, FcRIγ, CD4, CD7, OX40, or MHC (H2-Kb) transmembrane domain.

[0213] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain.

[0214] In some embodiments, the one or more primary intracellular signaling domains are selected from the group consisting of CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), CD66d, DAP10, and DAP12 intracellular signaling domains.

[0215] In some embodiments, at least one of the one or more primary intracellular signaling domains is a CD3 zeta intracellular signaling domain.

[0216] In some embodiments, the one or more costimulatory intracellular signaling domains are selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, CD83, CDS, ICAM-1, LFA-1 (CD11a / CD18), an MHC class I molecule, BTLA, and a Toll ligand receptor intracellular signaling domain.

[0217] In some embodiments, at least one of the one or more costimulatory intracellular signaling domains is a CD28 intracellular signaling domain.

[0218] In some embodiments, the chimeric antigen receptor comprises an N-terminal leader sequence. In some embodiments, the antigen recognition domain comprises an N-terminal leader sequence. In some embodiments, the N-terminal leader sequence of the antigen recognition domain is cleaved from the antigen recognition domain during cellular processing and localization of the chimeric antigen receptor to the cell membrane.

[0219] In some embodiments, the autoantigen binding protein is a multi-chain protein. In some embodiments, the autoantigen binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule.

[0220] In some embodiments, the autoantigen is myelin oligodendrocyte glycoprotein, aquaporin 4, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, Fc portion of immunoglobulin, citrullinated peptide, carbamylated peptide, thyrotropin receptor, or a protein expressed in the thyroid gland.

[0221] In another aspect, the present disclosure provides a viral vector comprising a nucleic acid cassette described herein.

[0222] In some embodiments, the viral vector is selected from the group consisting of a Retroviridae family virus, an adenovirus, a parvovirus, a coronavirus, a rhabdovirus, a paramyxovirus, a picornavirus, an alphavirus, a herpesvirus, and a poxvirus. In some embodiments, the viral vector is a Retroviridae family virus vector. In some embodiments, the Retroviridae family virus vector is a lentiviral vector. In some embodiments, the Retroviridae family virus vector is an alpharetroviral vector or a gammaretroviral vector.

[0223] In some embodiments, the Retroviridae family viral vector comprises a central polypurine tract, a woodchuck hepatitis virus post-transcriptional regulatory element, a 5'-LTR, an HIV signal sequence, an HIV Psi signal 5'-splice site, a delta-GAG element, a 3'-splice site, and a 3'-self-inactivating LTR.

[0224] In some embodiments, the viral vector is a pseudotyped viral vector. In some embodiments, the pseudotyped viral vector is selected from the group consisting of pseudotyped adenovirus, pseudotyped parvovirus, pseudotyped coronavirus, pseudotyped rhabdovirus, pseudotyped paramyxovirus, pseudotyped picornavirus, pseudotyped alphavirus, pseudotyped herpesvirus, pseudotyped poxvirus, and pseudotyped retroviridae family virus. In some embodiments, the pseudotyped viral vector is a pseudotyped lentiviral vector.

[0225] In some embodiments, the pseudotyped viral vector is selected from the group consisting of vesicular stomatitis virus (VSV), RD114 virus, murine leukemia virus (MLV), feline leukemia virus (FeLV), Venezuelan equine encephalitis virus (VEE), human foamy virus (HFV), walleye dermal sarcoma virus (WDSV), Semliki Forest virus (SFV), rabies virus, avian leukosis virus (ALV), bovine immunodeficiency virus (BIV), bovine leukemia virus (BLV), Epstein-Barr virus (EBV), caprine arthritis encephalitis virus (CAP), caprine ... The envelope protein is derived from a virus selected from Avian Virus (AEV), Sin Nombre virus (SNV), Cherry Twisted Leaf virus (ChTLV), Simian T-cell leukemia virus (STLV), Mason-Pfizer monkey virus (MPMV), Squirrel monkey retrovirus (SMRV), Rous-associated virus (RAV), Fujinami sarcoma virus (FuSV), Avian carcinoma virus (MH2), Avian encephalomyelitis virus (AEV), Alpha mosaic virus (AMV), Avian sarcoma virus CT10, and Equine infectious anemia virus (EIAV).

[0226] In some embodiments, the pseudotyped viral vector comprises a VSV-G envelope protein. [Brief explanation of the drawings]

[0227] [Figure 1A](A) and (B) are schematic diagrams of lentiviral vector constructs designed to enable expression of chimeric antigen receptors (CARs) under the control of a constitutive promoter for proof-of-concept studies. (A) Schematic diagram showing the basic components of lentiviral construct design. Single-chain variable fragments (scFvs) were generated by linking heavy and light chain sequences from antibodies with known antigen specificity. A His tag was introduced to facilitate CAR detection. A second-generation CAR signaling domain was selected for its compatibility with regulatory T cell function. For proof-of-concept studies, an scFv (B) with specificity for an unrelated antigen (Ag) was selected to enable in vitro assay optimization and to test the safety and function of CAR biology in vivo. The components are: RRE (Rev response element), cPPT (central polypurine tract), EFS (elongation factor 1a short binding sequence), VL (variable light chain), VH (variable heavy chain), and woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). [Figure 1B] Continued from Figure 1A. [Figure 2A] Figure 1 shows a series of graphs depicting antigen-specific CAR expression in human T cell lines. Jurkat T cells were transduced with a lentiviral vector (MOI 5) to express antigen-specific CAR (aAg-CAR). This series shows CAR expression after 72 hours, assessed by flow cytometry (FC) by incubating cells with 50,000 pg / ml of biotinylated CAR ligand (total protein) before staining with streptavidin-PE conjugate. FC plots are gated on live Jurkat T cells and show untransduced (negative control) and transduced cells. A titration of CAR ligand was used to assess receptor expression, quantified as mean fluorescence intensity (MFI). [Figure 2B]

[0023] Figure 1 is a series of graphs showing the expression of antigen-specific CARs in human T cell lines. Jurkat T cells were transduced with a lentiviral vector (MOI 5) to express antigen-specific CARs (aAg-CARs). Figure 2 is a series of graphs showing the MOI titration used to generate a library of Jurkat T cells expressing different levels of Ag-specific CARs. Transgene vector copy number (VCN) (left graph) was measured by ddPCR, while % CAR+ cells were quantified as outlined in (a). [Figure 2C]

[0023] Figure 1 is a series of graphs showing antigen-specific CAR expression in human T cell lines. Jurkat T cells were transduced with a lentiviral vector (MOI 5) to express an antigen-specific CAR (aAg-CAR). Increased CAR expression with increasing VCN was confirmed by assessing CAR expression by FC, quantified as MFI as a measure of the MOI used. [Figure 3A] Figure 2 shows confirmation of antigen-specific CAR function in vitro in a human T cell line. Transduced Jurkat T cells expressing different levels of aAg-CAR (transduction efficiencies shown in Figures 2A-2C) were treated with increasing amounts of CAR ligand for 24 hours in vitro. Figure 2 shows a series of graphs showing CAR function assessed by FC analysis of expressed T cell activation markers, CD69 (left graph) and CD25 (right graph), quantified as mean fluorescence intensity (MFI). [Figure 3B] Figure 2 shows the confirmation of antigen-specific CAR function in vitro in a human T cell line. Transduced Jurkat T cells expressing different levels of aAg-CAR (transduction efficiencies shown in Figures 2A-2C) were treated with increasing amounts of CAR ligand for 24 hours in vitro. Figure 2 shows the results of an experiment in which supernatants from cultured Jurkat T cells were collected and assessed for IL-2 production by enzyme-linked immunosorbent assay (ELISA). Data points represent the mean + / - SEM (n=3). [Figure 4A]Figure 1 shows that transduced primary mouse T cells express functional antigen-specific CARs. Purified CD4+CD25- naive splenic T cells were activated in vitro using CD3 / CD28 microbeads before adding a lentiviral vector (MOI 10) for expression of aAg-CAR. Figure 2 shows that FC analysis confirmed aAg-CAR expression 72 hours later. Plots are gated on live CD4+ T cells. Non-transduced cells were used as a negative control. [Figure 4B] Figure 1 shows that transduced primary mouse T cells express functional antigen-specific CARs. Purified CD4+CD25- naive splenic T cells were activated in vitro using CD3 / CD28 microbeads before adding lentiviral vectors (MOI 10) for expression of aAg-CARs. % of transduced cells quantified as % of live CD4+ T cells is shown (n=4). [Figure 4C] Figures 1A and 1B show that transduced primary murine T cells express functional antigen-specific CARs. Purified CD4+CD25- naive splenic T cells were activated in vitro using CD3 / CD28 microbeads before adding a lentiviral vector (MOI 10) for expression of aAg-CAR. (C) and (D) show the results of an experiment in which transduced CD4+CD25- T cells were treated with increasing concentrations of CAR ligand for 48 hours in vitro. T cell activation was assessed by measuring CD69 (right graph) and CD25 (left graph) expression by FC quantified as MFI (C). Supernatants from cultured cells were assessed in parallel for IL-2 secretion. Data points represent the mean + / - SEM (n=4) (D). [Figure 4D]Figures 1A and 1B show that transduced primary murine T cells express functional antigen-specific CARs. Purified CD4+CD25- naive splenic T cells were activated in vitro using CD3 / CD28 microbeads before adding a lentiviral vector (MOI 10) for expression of aAg-CAR. (C) and (D) show the results of an experiment in which transduced CD4+CD25- T cells were treated with increasing concentrations of CAR ligand for 48 hours in vitro. T cell activation was assessed by measuring CD69 (right graph) and CD25 (left graph) expression by FC quantified as MFI (C). Supernatants from cultured cells were assessed in parallel for IL-2 secretion. Data points represent the mean + / - SEM (n=4) (D). [Figure 5] (A) and (B) are graphs showing that transduced primary murine regulatory T cells secrete the immunosuppressive cytokine, IL-10, after in vitro CAR activation. Purified CD4+CD25+ Tregs were activated in vitro using CD3 / CD28 microbeads before lentiviral transduction (MOI 10) for expression of aAg-CAR. (A) is a graph showing that expression of aAg-CAR was confirmed by FC analysis after 72 hours. Plots were gated on live CD4+ T cells. (B) is a graph showing the results of an experiment in which transduced CD4+CD25+ Tregs were cultured in medium alone or 10 μg of CAR ligand for 48 hours. Supernatants were collected, and IL-10 secretion was quantified. Bars represent the mean + / - SEM (n=4) with individual data points indicated. Statistical significance assessed by unpaired T-test: **p=0.0019. [Figure 6A]This study demonstrates that transplantation of transduced mouse bone marrow HSCs results in the generation of regulatory T cells with preferential FoxP3 promoter-directed transgene expression within the reconstituted immune compartment. Lineage-BM cells were isolated and transduced with a lentiviral construct designed to express green fluorescent protein (GFP) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, GFP expression was assessed within the reconstituted immune compartment. Figure 1 shows a schematic diagram illustrating the Treg promoter design. Conserved noncoding sequence (CNS) domains 1, 2, and 3, the Foxp3 promoter, and 3'UTR sequence elements within the construct are designed to enhance transgene expression within the Treg compartment while restricting transgene expression within other immune subsets. Promoter activity was assessed by GFP expression. [Figure 6B] We demonstrate that transplantation of transduced mouse bone marrow HSCs results in the generation of regulatory T cells with preferential FoxP3 promoter-directed transgene expression within the reconstituted immune compartment. Lineage-BM cells were isolated and transduced with a lentiviral construct designed to express green fluorescent protein (GFP) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, GFP expression was assessed within the reconstituted immune compartment. Representative FC plots show the GFP expression profile in CD4+CD25+ regulatory T cells derived from the spleens of transplanted animals. [Figure 6C]We demonstrate that transplantation of transduced murine bone marrow HSCs results in the generation of regulatory T cells with preferential FoxP3 promoter-directed transgene expression within the reconstituted immune compartment. Lineage-BM cells were isolated and transduced with a lentiviral construct designed to express green fluorescent protein (GFP) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, GFP expression was assessed within the reconstituted immune compartment. Foxp3 promoter activity is shown in immune cells indicated by FC. GFP expression was quantified as MFI. Individual data points represent biological replicates (n=4), with bars representing the mean + / - SEM. BM (bone marrow), DP (double positive), SP (single positive), MLN (mesenteric lymph node), and pLN (peripheral lymph node). [Figure 7A] We demonstrate that transplantation of transduced mouse bone marrow HSCs results in the generation of CAR-expressing regulatory T cells in vivo. Lineage-BM cells were isolated and transduced with lentiviral constructs to express antigen-specific CARs (CAR+) or an unrelated transgene (CAR-) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, CAR expression was assessed throughout the immune compartment. Changes in Treg development and function were measured ex vivo in bone marrow chimeric mice. Schematic diagram showing the components of the Treg promoter design. Promoter activity was assessed by antigen-specific CAR expression. [Figure 7B] Transplantation of transduced mouse bone marrow HSCs results in the generation of CAR-expressing regulatory T cells in vivo. Lineage-BM cells were isolated and transduced with lentiviral constructs to express antigen-specific CARs (CAR+) or an unrelated transgene (CAR-) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, CAR expression was assessed throughout the immune compartment. Changes in Treg development and function were measured ex vivo in bone marrow chimeric mice. Representative FC plots show the CAR expression profile in CD4+CD25+ regulatory T cells derived from the spleens of transplanted animals. [Figure 7C]Transplantation of transduced mouse bone marrow HSCs results in the generation of CAR-expressing regulatory T cells in vivo. Lineage-BM cells were isolated and transduced with lentiviral constructs to express an antigen-specific CAR (CAR+) or an irrelevant transgene (CAR-) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, CAR expression was assessed throughout the immune compartment. Changes in Treg development and function were measured ex vivo in bone marrow chimeric mice. This set of graphs demonstrates the detection of comparable numbers and phenotypes of splenic regulatory T cells expressing a CAR (CAR+) or an irrelevant transgene (CAR-), as assessed by ex vivo FC analysis. The total number of regulatory cells per spleen was quantified (left graph). Expression levels of key regulatory T cell genes, including the transcription factor Foxp3 and the surface marker CD25, were quantified as MFI (middle and right graphs), respectively. Individual data points represent biological replicates with bars representing the mean + / - SEM (CAR- n = 4, CAR+ n = 6). Statistical differences were assessed by unpaired T cell assay, and no significant differences were detected. [Figure 8A] We demonstrate that transformed mouse bone marrow HSC-derived Tregs expressing a CAR possess immunosuppressive activity comparable to that of Tregs expressing an unrelated transgene. Lineage-BM cells were isolated and transduced with lentiviral constructs to express an antigen-specific CAR (CAR+) or an unrelated transgene (CAR-) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and evaluated in vitro for changes in immune function. Results from experiments in which CAR-expressing Tregs were assessed for their immunosuppressive capacity by culturing them with effector T cells labeled with cell tracer violet are shown. Effector T cells were stimulated with CD3 / CD28 microbeads for 96 hours in the presence of control CAR- or Ag-CAR+ Tregs. Representative histograms show the cell tracer dye profiles for the indicated experimental conditions. [Figure 8B]We demonstrate that transformed mouse bone marrow HSC-derived Tregs expressing a CAR have immunosuppressive activity equivalent to that of Tregs expressing an unrelated transgene. Lineage-BM cells were isolated and transduced with lentiviral constructs to express an antigen-specific CAR (CAR+) or an unrelated transgene (CAR-) under the control of the Treg (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and evaluated in vitro for changes in immune function. Results are shown for experiments in which proliferative responses were quantified by dilution of a cell tracer dye. Data are expressed as the percentage of cells labeled with the cell tracer undergoing division, i.e., "% proliferation." Individual data points represent biological replicates (CAR- n=4, CAR+ n=6), with bars representing the mean + / - SEM. Statistical significance was assessed by paired t-test for each equivalent ratio of cells; no significant differences were detected. [Figure 9A] We demonstrate that transduced murine bone marrow HSC-derived Tregs can be activated by antigen-specific CAR stimulation and exhibit enhanced immunosuppressive potential. Lineage-BM cells were isolated and transduced with lentiviral constructs to express antigen-specific CARs (CAR+) or an unrelated transgene (control CAR-) under the control of a Treg-specific (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and cultured in vitro with CAR ligand for 48 hours to assess activation. Representative histograms showing the change in CD25 expression levels after stimulation with 10 μg of CAR ligand are shown. [Figure 9B] We demonstrate that transduced murine bone marrow HSC-derived Tregs can be activated by antigen-specific CAR stimulation and exhibit enhanced immunosuppressive potential. Lineage-BM cells were isolated and transduced with lentiviral constructs to express antigen-specific CARs (CAR+) or an unrelated transgene (control CAR-) under the control of a Treg-specific (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and cultured in vitro with CAR ligands for 48 hours to assess activation. CD25 levels were quantified as MFI in control CAR- and CAR+-expressing regulatory T cells. [Figure 9C] We show that transduced murine bone marrow HSC-derived Tregs can be activated by antigen-specific CAR stimulation and exhibit enhanced immunosuppressive potential. Lineage-BM cells were isolated and transduced with lentiviral constructs to express an antigen-specific CAR (CAR+) or an irrelevant transgene (control CAR-) under the control of a Treg-specific (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and cultured in vitro with CAR ligand for 48 hours to assess activation. Panels C and D show the results of an experiment in which control (black circles) and CAR-expressing Tregs (white squares) were exposed to 10 μg of CAR ligand for 48 hours in the absence (C) or presence (D) of CD3 / CD28 microbeads. Supernatants were collected, and IL-10 secretion was determined by ELISA. Statistical significance was assessed by paired t-test, and p values ​​are shown. [Figure 9D] We show that transduced murine bone marrow HSC-derived Tregs can be activated by antigen-specific CAR stimulation and exhibit enhanced immunosuppressive potential. Lineage-BM cells were isolated and transduced with lentiviral constructs to express an antigen-specific CAR (CAR+) or an irrelevant transgene (control CAR-) under the control of a Treg-specific (Foxp3) promoter. Ten weeks after transplantation, regulatory T cells were isolated from peripheral immune organs and cultured in vitro with CAR ligand for 48 hours to assess activation. Panels C and D show the results of an experiment in which control (black circles) and CAR-expressing Tregs (white squares) were exposed to 10 μg of CAR ligand for 48 hours in the absence (C) or presence (D) of CD3 / CD28 microbeads. Supernatants were collected, and IL-10 secretion was determined by ELISA. Statistical significance was assessed by paired t-test, and p values ​​are shown.

[0228] definition As used herein, the term "pluripotent cells" refers to cells that possess the ability to develop into two or more differentiated cell types. For example, pluripotent cells can be pluripotent hematopoietic cells that possess the ability to develop into two or more differentiated cell types of the hematopoietic lineage, such as granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells). Examples of pluripotent hematopoietic cells are ESCs, iPSCs, lymphoid progenitor cells, and CD34+ cells.

[0229] As used herein, the terms "stem cell" and "undifferentiated cell" refer to cells in an undifferentiated or partially differentiated state that have the developmental potential to differentiate into multiple cell types. Stem cells can proliferate and give rise to more such stem cells while maintaining their functional potential. Stem cells can divide asymmetrically, known as inevitable asymmetric differentiation, in which some daughter cells retain the functional potential of the parent stem cell while other daughter cells express some other specific function, phenotype, and / or developmental potential that differs from the parent cell. The daughter cells themselves can be induced to proliferate and subsequently produce progeny that differentiate into one or more mature cell types, while also retaining one or more cells with the developmental potential of the parent. Differentiated cells can be derived from pluripotent cells, which themselves are derived from pluripotent cells, etc. Alternatively, some stem cells within a population can divide symmetrically into two stem cells. Thus, the term "stem cell" refers to any subset of cells that, under certain circumstances, have the developmental potential to differentiate into a more specialized or differentiated phenotype and, under certain circumstances, retain the ability to proliferate without substantial differentiation. In some embodiments, the term stem cell generally refers to a naturally occurring parent cell whose descendants (progeny cells) often specialize in different directions upon differentiation, acquiring entirely separate characteristics that occur, for example, in the progressive diversification of embryonic cells and tissues. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be artificially induced upon treatment with various factors. Cells that begin as stem cells can progress to a differentiated phenotype but can then be induced to "reverse" and re-express the stem cell phenotype. This term is often referred to by those skilled in the art as "dedifferentiation," or "reprogramming," or "retrodifferentiation."

[0230] As used herein, the terms "hematopoietic stem cells" and "HSCs" refer to immature blood cells that have the ability to self-renew and differentiate into mature blood cells of diverse lineages, including, but not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells). It is known in the art that such cells may or may not contain CD34+ cells. CD34+ cells are immature cells that express the CD34 cell surface marker. In humans, CD34+ cells are thought to comprise a subpopulation of cells with the stem cell properties defined above, whereas in mice, HSCs are CD34-. In addition, HSCs also refer to long-term repopulating HSCs (LT-HSCs) and short-term repopulating HSCs (ST-HSCs). LT-HSCs and ST-HSCs are differentiated based on functional potential and cell surface marker expression. For example, human HSCs can be CD34+, CD38-, CD45RA-, CD90+, CD49F+, and lin- (negative for mature lineage markers including CO2, CD3, CD4, CD7, CD8, CD10, CD11B, CD19, CD20, CD56, and CD235A). In mice, bone marrow LT-HSCs can be CD34-, SCA-1+, C-kit+, CD135-, Slamf1 / CD150+, CD48-, and lin- (negative for mature lineage markers including Ter119, CD11b, Gr1, CD3, CD4, CD8, B220, and IL-7ra), whereas ST-HSCs can be CD34+, SCA-1+, C-kit+, CD135-, Slamf1 / CD150+, and lin- (negative for mature lineage markers including Ter119, CD11b, Gr1, CD3, CD4, CD8, B220, and IL-7ra). In addition, ST-HSCs are less quiescent (i.e., more active) and more proliferative than LT-HSCs under homeostatic conditions.However, LT-HSCs have greater self-renewal potential (i.e., they survive through adulthood and can be serially transplanted through successive recipients), whereas ST-HSCs have limited self-renewal (i.e., they survive only for a limited period of time and do not possess serial transplantation potential). Either of these HSCs can be used in any of the methods described herein. Optionally, ST-HSCs are useful because they are highly proliferative and therefore can give rise to differentiated progeny more quickly.

[0231] As used herein, the terms "hematopoietic progenitor cell" and "HPC" refer to immature blood cells that have the ability to self-renew and differentiate into mature blood cells of various lineages, including, but not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells). Examples of hematopoietic progenitor cells include lymphoid progenitor cells and myeloid progenitor cells.

[0232] As used herein, the terms "embryonic stem cell" and "ES cell" refer to embryo-derived totipotent or pluripotent stem cells derived from the inner cell mass of a blastocyst that can be maintained in in vitro culture under suitable conditions. ES cells are capable of differentiating into cells of any of the three vertebrate germ layers, e.g., endoderm, ectoderm, or mesoderm. ES cells are also characterized by their ability to proliferate indefinitely under suitable in vitro culture conditions. ES cells are described, for example, in Thomson et al., Science 282:1145 (1998), the disclosure of which is incorporated herein by reference as it relates to the structure and functionality of embryonic stem cells.

[0233] As used herein, the terms "induced pluripotent stem cell," "iPS cell," and "iPSC" refer to multipotent stem cells that can be derived directly from differentiated somatic cells. Human iPS cells can be generated by introducing a specific set of reprogramming factors into non-pluripotent cells, which may include, for example, Oct3 / 4, Sox family transcription factors (e.g., Sox1, Sox2, Sox3, Sox15), Myc family transcription factors (e.g., c-Myc, l-Myc, n-Myc), Kruppel-like family (KLF) transcription factors (e.g., KLF1, KLF2, KLF4, KLF5), and / or related transcription factors such as NANOG, LIN28, and / or Glis1. Human iPS cells can also be generated by the use of, for example, miRNAs, small molecules that mimic the action of transcription factors, or lineage specification factors. Human iPS cells are characterized by their ability to differentiate into cells of any of the three vertebrate germ layers, e.g., endoderm, ectoderm, or mesoderm. Human iPS cells are also characterized by their ability to proliferate indefinitely under suitable in vitro culture conditions. Human iPS cells are described, for example, in Takahashi and Yamanaka, Cell 126:663 (2006), the disclosure of which is incorporated herein by reference as it relates to the structure and functionality of iPS cells.

[0234] As used herein, the term "autologous" refers to cells, tissues, nucleic acid molecules, or other materials obtained or derived from an individual's own cells, tissues, nucleic acid molecules, etc. For example, in the context of a population of cells (e.g., a population of pluripotent cells) that express one or more proteins described herein, autologous cells include cells obtained from a patient undergoing therapy and then transduced or transfected with a vector that directs the expression of one or more proteins of interest.

[0235] As used herein, the term "allogeneic" refers to cells, tissues, nucleic acid molecules, or other materials obtained or derived from a different subject of the same species. For example, in the context of a population of cells (e.g., a population of pluripotent cells) expressing one or more proteins described herein, allogeneic cells include cells (i) obtained from a subject not undergoing therapy and then (ii) transduced or transfected with a vector directing the expression of one or more desired proteins. The phrase "directing expression" refers to the inclusion of one or more polynucleotides encoding one or more proteins to be expressed. The polynucleotides may contain additional sequence motifs that enhance expression of the protein of interest.

[0236] As used herein, the term "HLA-matched" refers to a donor-recipient pair in which none of the HLA antigens are mismatched between the donor and recipient, such as a donor providing a hematopoietic stem cell graft to a recipient in need of multipotent hematopoietic stem cell transplantation therapy. HLA-matched (i.e., all six alleles matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to recognize the incoming graft as foreign and therefore less likely to mount an immune response against the transplanted tissue.

[0237] As used herein, the term "HLA-mismatched" refers to a donor-recipient pair in which at least one HLA antigen is mismatched between the donor and recipient, particularly for HLA-A, HLA-B, HLA-C, and HLA-DR, such as a donor providing a hematopoietic stem cell graft to a recipient in need of multipotent hematopoietic stem cell transplantation therapy. In some embodiments, some haplotypes are matched and others are mismatched. HLA-mismatched donor-recipient pairs may be at increased risk of graft rejection compared to HLA-matched donor-recipient pairs because endogenous T cells and NK cells are more likely to recognize the incoming graft as foreign in HLA-mismatched donor-recipient pairs, and such T cells and NK cells are therefore more likely to mount an immune response against the transplanted tissue.

[0238] As used herein, the term "functional potential," when referring to pluripotent cells such as hematopoietic stem cells, refers to the functional properties of stem cells, including: 1) pluripotency (which refers to the ability to differentiate into multiple different blood lineages, including, but not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells)); 2) self-renewal (which refers to the ability of a stem cell to give rise to daughter cells that have potential equivalent to that of the mother cell and further have the ability to be generated repeatedly throughout the lifespan of an individual without exhaustion); and 3) the ability of the stem cell or its progeny to be reintroduced into a transplant recipient, where they home to a stem cell niche and re-establish productive and sustained cell growth and differentiation.

[0239] As used herein, the terms "ablate," "ablation," "ablation," "regulate," and "conditioning" refer to the depletion of one or more cells in a population of cells in vivo or ex vivo. In some embodiments of the present disclosure, it may be desirable to ablate endogenous cells in a patient (e.g., a patient undergoing treatment for a disease described herein) before administering a therapeutic composition, such as a population of therapeutic cells, to a subject. This can be beneficial, for example, to provide the newly administered cells with an environment in which they can engraft. Ablation of a population of endogenous cells can be performed in a manner that selectively targets a specific cell type, for example, using an antibody or antibody-drug conjugate that binds to an antigen expressed in the target cell, followed by killing of the target cell. Additionally or alternatively, ablation can be performed in a non-specific manner, using a cytotoxin that does not localize to a specific cell type but instead is capable of exerting a cytotoxic effect on a variety of different cells. Examples of ablation include depletion of at least 5% (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more) of cells in a population of cells in vivo or in vitro. Quantifying cell counts within a sample of cells can be performed using a variety of cell counting techniques, for example, by using a counting chamber, a Coulter counter, flow cytometry, or other cell counting methods known in the art.

[0240] Exemplary agents that can be used to "deplete" populations of cells in a patient (i.e., to "condition" the patient for treatment) in accordance with the compositions and methods of the present disclosure include alkylating agents, such as nitrogen mustards (e.g., bendamustine, chlorambucil, cyclophosphamide, ifosfamide, mechlorethamine, or melphalan), nitrosoureas (e.g., carmustine, lomustine, or streptozocin), alkylsulfonates (e.g., busulfan), triazines (e.g., dacarbazine or temozolomide), or ethyleneimines (e.g., altretamine or thiotepa). In some embodiments, the one or more conditioning agents are non-myeloablative conditioning agents that selectively target and ablate specific populations of endogenous pluripotent cells, such as populations of endogenous CD34+ HSCs or HPCs. For example, the one or more conditioning agents can include cytarabine, antithymocyte globulin, fludarabine, or idarubicin.

[0241] As used herein, the terms "conditioning" and "conditioning" refer to a process by which a subject is prepared to receive a transplant containing a population of cells (e.g., a population of pluripotent cells, such as CD34+ cells). Such manipulation promotes cell transplant engraftment, for example, by selectively depleting endogenous cells (e.g., endogenous CD34+ cells, among others), thereby creating a void that is filled by the exogenous cell transplant. According to the methods described herein, a subject can be conditioned for cell transplant manipulation by administering to the subject one or more agents, radiation therapy, or a combination thereof, capable of ablating endogenous cells (e.g., CD34+ cells, among others). Conditioning regimens useful in combination with the compositions and methods of the present disclosure can be myeloablative or non-myeloablative. Other cell ablative agents and methods known in the art (e.g., antibodies and antibody-drug conjugates) can also be used.

[0242] As used herein, the term "myeloablative" or "myeloablation" refers to a conditioning regimen that substantially impairs or destroys the hematopoietic system, typically by exposure to cytotoxic agents or radiation. Myeloablation includes complete bone marrow destruction, brought about by high doses of cytotoxic agents or total body radiation, which destroys the hematopoietic system.

[0243] As used herein, the terms "non-myeloablative" or "myelosuppressive" refer to a conditioning regimen that does not eliminate substantially all hematopoietic cells from the host.

[0244] As used herein in the context of hematopoietic stem and / or progenitor cells, the term "mobilization" refers to the release of such cells from the stem cell niche (e.g., bone marrow) in which they typically reside, into the peripheral circulation. A "mobilizing agent" is an agent capable of inducing the release of hematopoietic stem and / or progenitor cells from the stem cell niche into the peripheral circulation.

[0245] As used herein, the term "expansion agent" refers to a substance capable of promoting the ex vivo expansion of a given cell type. Accordingly, "hematopoietic stem cell expansion agent" or "HSC expansion agent" refers to a substance capable of promoting the expansion of a population of hematopoietic stem cells ex vivo. Hematopoietic stem cell expansion agents include those that cause the expansion of a population of hematopoietic stem cells such that the cells retain their functional potential as hematopoietic stem cells. Exemplary hematopoietic stem cell expansion agents that may be used in combination with the compositions and methods of the present disclosure include, but are not limited to, aryl hydrocarbon receptor antagonists such as those described in U.S. Pat. Nos. 8,927,281 and 9,580,426, and in particular, the compound SR1, the disclosures of each of which are incorporated herein by reference in their entireties. Additional hematopoietic stem cell expansion agents that may be used in combination with the compositions and methods of the present disclosure include the compound UM-171 and other compounds described in U.S. Pat. No. 9,409,906, the disclosures of which are incorporated herein by reference in their entireties. Hematopoietic stem cell expansion agents further include structural and / or stereoisomeric variants of the compound UM-171, such as those described in US 2017 / 0037047, the disclosure of which is incorporated herein by reference in its entirety. Additional hematopoietic stem cell expansion agents suitable for use in the present disclosure include, among others, histone deacetylase (HDAC) inhibitors, such as trichostatin A, trapoxin, trapoxin A, chlamydocin, sodium butyrate, dimethyl sulfoxide, suberanilohydroxamic acid, m-carboxycinnamic acid bishydroxamide, HC-toxin, Cyl-2, WF-3161, depudecin, and radicicol, as described in WO 2000 / 023567, the disclosure of which is incorporated herein by reference.

[0246] As used herein, the term "T cell" refers to a type of lymphocyte that plays a central role in cell-mediated immunity. T cells can be distinguished from other lymphocytes, such as B cells and NK cells, by the presence of a T cell receptor (TCR) on the cell surface. T cell receptors confer antigen specificity to T cells by recognizing antigens associated with self-molecules encoded by genes within the major histocompatibility complex (MHC). Antigens can be displayed along with MHC molecules on the surface of antigen-presenting cells (APCs), virus-infected cells, and the like. There are several subsets of T cells, each with different functions (e.g., effector T cells, regulatory T cells, T helper cells, cytotoxic T cells, memory T cells, natural killer T (NKT) cells, mucosal-associated invariant T cells (MAIT), and gamma delta T cells (γδ T cells)).

[0247] As used herein, the term "regulatory T cells" or "Treg cells" refers to a subpopulation of immunosuppressive T cells that regulate the immune system, maintain tolerance to self-antigens, and prevent autoimmune diseases. For example, Treg cells have the ability to suppress the proliferation and / or effector function of other T cell populations. Treg cells can be distinguished based on their unique surface protein presentation. For example, Treg cells can be T cells that express CD4, CD25, FOXP3, and / or CD17 biomarkers. Treg cells exert their immunosuppressive effects, for example, via IL-2 / IL-2 receptor-dependent mechanisms and by the production of inhibitory cytokines (e.g., IL-10, IL-35, and TGF-β).

[0248] As used herein, the term "autoreactive effector cell" or "autoreactive effector immune cell" refers to a cell that is involved in promoting an immune effector response (e.g., promoting an immune response against a target) and recognizes an autoantigen. Examples of autoreactive effector immune cells include B cells, T cells, and natural killer (NK) cells.

[0249] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of a common cell type can include cells isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or cells isolated from a common organ, tissue system, blood vessel, or other structure and / or region in an organism.

[0250] As used herein, the term "autoantigen-binding protein" refers to a protein (e.g., a single-chain protein or a protein composed of multiple polypeptide subunits) that specifically binds to an antigen endogenously expressed in a subject (e.g., a mammalian subject such as a human subject). Examples of autoantigen-binding proteins are single-chain proteins, such as chimeric antigen receptors and single-chain antibody fragments, that specifically bind to an antigen endogenously expressed in a subject with an autoimmune disease. Additional examples of autoantigen-binding proteins are multi-chain proteins, such as T-cell receptors and full-length antibodies, that specifically bind to an antigen endogenously expressed in a subject with an autoimmune disease.

[0251] As used herein, the term "antibody" (Ab) refers to an immunoglobulin molecule that specifically binds to or is immunologically reactive with a particular antigen, and includes polyclonal, monoclonal, genetically engineered, and otherwise modified forms of antibodies, including, but not limited to, chimeric antibodies, humanized antibodies, primatized antibodies, heteroconjugate antibodies (e.g., bi-, tri-, and tetra-specific antibodies, diabodies, triabodies, and tetrabodies), and antigen-binding fragments of antibodies, including, for example, Fab', F(ab')2, Fab, Fv, rgG, and scFv fragments. Furthermore, unless otherwise indicated, the term "monoclonal antibody" (mAb) is meant to include both intact molecules and antibody fragments (e.g., Fab and F(ab')2 fragments) that are capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of an intact antibody, clear more rapidly from the circulation of an animal, and may have less non-specific tissue binding than an intact antibody (see Wahl et al., J. Nucl. Med. 24:316 (1983), incorporated herein by reference).

[0252] The term "antigen-binding fragment," as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to a target antigen. The antigen-binding function of an antibody can be performed by a fragment of a full-length antibody. An antibody fragment can be a Fab, F(ab')2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include, but are not limited to: (i) Fab fragments, V L , V H , C L , and C H (ii) a F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a V H and C H (iv) a single-arm V of an antibody; L and VH Fv fragment consisting of domains, (v) V H and V L (vi) V domain-containing dAbs H (vii) a dAb fragment consisting of the V domain (Ward et al., Nature 341:544-546, 1989); H or V L (viii) an isolated complementarity-determining region (CDR), and (ix) a combination of two or more isolated CDRs, which may optionally be linked by a synthetic linker. Additionally, the two domains of an Fv fragment, V L and V H are encoded by separate genes, they can be synthesized using recombinant methods L Area and V H The domains may be joined by a linker that allows them to be produced as a single protein chain that pairs to form a monovalent molecule (known as a single-chain Fv (scFv)—see, e.g., Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)). These antibody fragments can be obtained using conventional techniques known to those of skill in the art, and the fragments can be screened for utility in the same manner as intact antibodies. Antigen-binding fragments can be produced by recombinant DNA techniques, enzymatic or chemical cleavage of intact immunoglobulins, or, in some embodiments, chemical peptide synthetic procedures known in the art.

[0253] As used herein, the term "VH" refers to the variable region of an immunoglobulin heavy chain of an antibody, including the heavy chain of an Fv, scFv, or Fab. Reference to "VL" refers to the variable region of an immunoglobulin light chain, including the light chain of an Fv, scFv, dsFv, or Fab. Antibodies (Ab) and immunoglobulins (Ig) are glycoproteins with the same structural characteristics. While antibodies exhibit binding specificity to a specific target, immunoglobulins include both antibodies and other antibody-like molecules that lack target specificity. Natural antibodies and immunoglobulins are typically heterotetrameric glycoproteins of approximately 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each heavy chain of a natural antibody has a variable domain (VH) at its amino terminus, followed by multiple constant domains. Each light chain of a natural antibody has a variable domain at its amino terminus (VL) and a constant domain at its carboxy terminus.

[0254] As used herein, the term "complementarity-determining region" (CDR) refers to the hypervariable regions found in both light- and heavy-chain variable domains. The more highly conserved portions of variable domains are called framework regions (FRs). As understood in the art, the amino acid positions representing hypervariable regions of an antibody can vary depending on the context and various definitions known in the art. Some positions within a variable domain can be considered hybrid hypervariable positions, in that these positions can be considered within a hypervariable region under one set of criteria, while being considered outside a hypervariable region under a different set of criteria. One or more of these positions can also be found in extended hypervariable regions. The antibodies described herein can contain modifications at these hybrid hypervariable positions. Native heavy- and light-chain variable domains each contain four framework regions, which primarily adopt a β-sheet configuration and are connected by three CDRs, which form loops that connect, and in some cases form part of, the β-sheet structure. The CDRs in each chain are held together in close proximity by the FR region in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and together with the CDRs from other antibody chains, contribute to the formation of the antibody's target binding site (see Kabat et al., Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda, Md. 1987), which is incorporated herein by reference). As used herein, immunoglobulin amino acid residue numbering is performed according to the immunoglobulin amino acid residue numbering system of Kabat et al., unless otherwise indicated.

[0255] As used herein, the term "variable region CDR" includes amino acids within a CDR or complementarity determining region identified using sequence- or structure-based methods. As used herein, the term "CDR" or "complementarity determining region" refers to the noncontiguous antigen-binding sites found within the variable regions of both heavy and light chain polypeptides. These particular regions are described by Kabat et al., J. Biol. Chem. 252:6609-6616, 1977, and Kabat, et al., Sequences of Proteins of Immunological Interest, Fifth Edition, USDapartment of Health and Human Services, NIH Publication No. 91-3242, 1991, Chothia et al., (J. Mol. Biol. 196:901-917, 1987), and MacCallum et al., (J. Mol. Biol. 262:732-745, 1996), and the definitions include overlapping or subsets of amino acid residues when compared with each other. The term "CDR" may be, for example, the CDR defined by Kabat based on sequence comparison.

[0256] As used herein, the term "framework region" or "FW region" includes the amino acid residues flanking the CDRs. FW region residues may be present in, for example, human antibodies, rodent-derived antibodies (e.g., murine antibodies), humanized antibodies, primatized antibodies, chimeric antibodies, antibody fragments (e.g., Fab fragments), single-chain antibody fragments (e.g., scFv fragments), antibody domains, and bispecific antibodies, among others.

[0257] As used herein, the term "hinge region," in the context of an antibody or antigen-binding fragment thereof, refers to the domain of an antibody or antigen-binding fragment thereof (e.g., an IgG2 antibody or antigen-binding fragment thereof) located between the antigen-binding portion(s) of the antibody or antigen-binding fragment thereof, such as the Fab region of the antibody or antigen-binding fragment thereof, and the portion of the antibody or antigen-binding fragment thereof that designates the isotype of the antibody or antigen-binding fragment thereof, such as the Fc region of the antibody or antigen-binding fragment thereof. For example, in the context of a monoclonal antibody, the hinge region is a polypeptide located approximately in the center of each heavy chain that connects the CH1 domain to the CH2 and CH3 domains. The hinge region of an antibody or antigen-binding fragment thereof may provide a chemical link between the chains of the antibody or antigen-binding fragment thereof. For example, in monoclonal antibodies, cysteine ​​residues in the hinge region form interchain disulfide bonds, thereby providing explicit covalent bonds between the heavy chains. As used herein, antibody hinge regions are numbered according to the numbering system of Kabat et al., Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda, Md. 1987), the disclosure of which is incorporated herein by reference.

[0258] As used herein, the term "bispecific antibody" refers to an antibody (e.g., a monoclonal antibody, often a humanized or humanized antibody) that has binding specificities for at least two different antigens. For example, one of the binding specificities can be directed against an autoantigen (e.g., myelin oligodendrocyte glycoprotein), and the other can be directed against any other antigen, such as a cell surface protein, receptor, receptor subunit, tissue-specific antigen, virus-derived protein, virus-encoded envelope protein, bacterial-derived protein, or bacterial surface protein.

[0259] As used herein, the term "chimeric" antibody refers to an antibody having variable domain sequences (e.g., CDR sequences) derived from the immunoglobulin of one source organism, such as a rat or mouse, and constant regions derived from the immunoglobulin of a different organism (e.g., a human, another primate, pig, goat, rabbit, hamster, cat, dog, guinea pig, a member of the bovine family (such as cow, bison, buffalo, elk, and yak, among others), cow, sheep, horse, or bison, among others). Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, Science. 229(4719):1202-7 (1985); Oi et al. BioTechniques. 4:214-221 (1986); Gillies et al. J. Immunol. Methods. 125:191-202 (1985); U.S. Patent Nos. 5,807,715, 4,816,567, and 4,816,397, which are incorporated herein by reference.

[0260] As used herein, the term "diabody" means a bivalent antibody comprising two polypeptide chains, each of which is connected to a V on the same peptide chain. H and V L V linked by a linker that is too short to allow intramolecular association of the domains (e.g., a linker consisting of five amino acids) H and V L This configuration forces each domain to pair with a complementary domain on another polypeptide chain to form a homodimeric structure. Thus, the term "triabody" refers to a trivalent antibody containing three peptide chains, each of which is connected to a V domain within the same peptide chain. H and V L A single V connected by a very short linker (e.g., a linker consisting of 1–2 amino acids) to allow intramolecular association of the domains H Domain and one V LIn order to fold into its native structure, a peptide constructed in this way typically requires V domains of adjacent peptide chains to allow proper folding. H and V L The domains trimerize to bring them into close spatial proximity to one another (see Holliger et al., Proc. Natl. Acad. Sci. USA 90:6444-48, 1993, incorporated herein by reference).

[0261] As used herein, a "dual variable domain immunoglobulin" ("DVD-Ig") refers to an antibody that combines the target-binding variable domains of two monoclonal antibodies via a linker to create a tetravalent, dual-targeting single agent. (Gu et al., Meth. Enzymol., 502:25-41, 2012, incorporated herein by reference). Suitable linkers for use in the light chains of the DVDs described herein include those identified in Table 2.1 on page 30 of Gu et al.

[0262] As used herein, the term "human antibody" refers to an antibody that contains substantially all of the protein (e.g., CDRs, framework, C L , C H Domain (e.g., C H 1. C H 2. C H 3), Hinge, (V L , V H) refers to antibodies that are substantially non-immunogenic in humans and possess only minor sequence changes or mutations. Human antibodies can be produced in human cells (e.g., by recombinant expression) or by non-human animals or prokaryotic or eukaryotic cells capable of expressing functionally rearranged human immunoglobulin (e.g., heavy and / or light chain) genes. Furthermore, when a human antibody is a single-chain antibody, it may contain a linker peptide not found in native human antibodies. For example, an Fv may contain a linker peptide, such as two to about eight glycine or other amino acid residues, connecting the variable region of the heavy chain and the variable region of the light chain. Such a linker peptide is considered to be of human origin. Human antibodies can be produced by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences. See U.S. Patent Nos. 4,444,887 and 4,716,111, and PCT publications WO1998 / 46645, WO1998 / 50433, WO1998 / 24893, WO1998 / 16654, WO1996 / 34096, WO1996 / 33735, and WO1991 / 10741, which are incorporated herein by reference. Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. See, e.g., PCT Publications WO98 / 24893, WO92 / 01047, WO96 / 34096, WO96 / 33735, U.S. Patent Nos. 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, 5,885,793, 5,916,771, and 5,939,598, which are incorporated herein by reference.

[0263] As used herein, the term "humanized" antibody refers to forms of non-human (e.g., murine) antibodies that are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other target-binding subdomains of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Generally, humanized antibodies will contain substantially all of at least one, and typically two, variable domains, with all or substantially all of the CDR regions corresponding to those of a non-human immunoglobulin. All or substantially all of the FR regions may be those of a human immunoglobulin sequence. A humanized antibody may also contain at least a portion of an immunoglobulin constant region (Fc), typically at least a portion of a human immunoglobulin consensus sequence. Methods for antibody humanization are known in the art. See, e.g., Riechmann et al., Nature 332:323-7, 1988; Queen et al., U.S. Patent Nos. 5,530,101, 5,585,089, 5,693,761, 5,693,762, and 6,180,370; EP 239400; PCT Publication WO 91 / 09967; U.S. Patent No. 5,225,539; EP 592106; and EP 519596, which are incorporated herein by reference.

[0264] As used herein, the term "primatized antibody" refers to an antibody that contains framework regions from a primate-derived antibody and other regions, e.g., CDRs and / or constant regions, from an antibody of non-primate origin. Methods for producing primatized antibodies are known in the art. See, e.g., U.S. Patent Nos. 5,658,570, 5,681,722, and 5,693,780, which are incorporated herein by reference. For example, a primatized antibody or antigen-binding fragment thereof described herein can be produced by inserting the CDRs of a non-primate antibody or antigen-binding fragment thereof into an antibody or antigen-binding fragment thereof containing one or more primate framework regions.

[0265] As used herein, the term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

[0266] As used herein, the term "scFv" refers to a single-chain Fv antibody in which the variable domains of the heavy and light chains from an antibody are joined to form one chain. An scFv fragment contains a single polypeptide chain comprising the variable region of the antibody light chain (VL) (e.g., CDR-L1, CDR-L2, and / or CDR-L3) and the variable region of the antibody heavy chain (VH) (e.g., CDR-H1, CDR-H2, and / or CDR-H3), separated by a linker. The linker connecting the VL and VH regions of the scFv fragment can be a peptide linker composed of proteinogenic amino acids. Alternative linkers may be used to increase the resistance of the scFv fragment to proteolysis (e.g., linkers containing D-amino acids), to improve the solubility of the scFv fragment (e.g., hydrophilic linkers such as polyethylene glycol-containing linkers or polypeptides containing repeating glycine and serine residues), to improve the biophysical stability of the molecule (e.g., linkers containing cysteine ​​residues that form intramolecular or intermolecular disulfide bonds), or to reduce the immunogenicity of the scFv fragment (e.g., linkers containing glycosylation sites). scFv molecules are known in the art and are described, for example, in U.S. Patent No. 5,892,019; Flo et al. (Gene 77:51, 1989); Bird et al. (Science 242:423, 1988); Pantoliano et al. (Biochemistry 30:10117, 1991); Milenic et al. (Cancer Research 51:6363, 1991); and Takkinen et al. (Protein Engineering 4:837, 1991). The VL and VH domains of scFv molecules can be derived from one or more antibody molecules. Those skilled in the art will also understand that the variable regions of the scFv molecules described herein can be modified such that they differ in amino acid sequence from the antibody molecule from which they are derived. For example, in one embodiment, nucleotide or amino acid substitutions resulting in conservative substitutions or changes in amino acid residues can be made (e.g., in CDR and / or framework residues).Alternatively or additionally, mutations are made to CDR amino acid residues to optimize antigen binding using art-recognized techniques. scFv fragments are described, for example, in WO2011 / 084714, which is incorporated herein by reference.

[0267] As used herein, the term "chimeric antigen receptor" ("CAR") refers to a recombinant polypeptide containing one or more antigen recognition regions (e.g., one or more CDRs) that recognize and specifically bind to a given antigen (e.g., an autoantigen). CARs described herein generally contain at least an extracellular antigen recognition domain, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule as defined herein. The stimulatory molecule may be the zeta chain associated with the T cell receptor complex. In some embodiments, the intracellular signaling domain further contains one or more functional signaling domains derived from at least one costimulatory molecule, as described below. The costimulatory molecule may comprise, for example, 4-1BB (i.e., CD137), CD27, and / or CD28. In some embodiments, a CAR contains a chimeric fusion protein having an extracellular antigen recognition domain, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain comprising a functional signaling domain derived from a stimulatory molecule. A CAR may contain, for example, a chimeric fusion protein having an extracellular antigen recognition domain, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain comprising a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In some embodiments, a CAR contains a chimeric fusion protein having an extracellular antigen recognition domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain comprising two functional signaling domains derived from one or more costimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In some embodiments, a CAR contains a chimeric fusion protein having an extracellular antigen recognition domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more costimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. A CAR may contain a leader sequence at the amino terminus of the CAR fusion protein.In some embodiments, the CAR further contains a leader sequence at the N-terminus of the extracellular antigen-recognition domain, which can be cleaved from the antigen-recognition domain, e.g., (scFv), during cellular processing and localization of the CAR to the cell membrane. For the avoidance of doubt, as used herein, the terms "intracellular domain" and "cytoplasmic domain" are used interchangeably.

[0268] The term "signaling domain" refers to a functional portion of a protein that acts by transmitting information intracellularly to control cellular activity through a defined signaling pathway, either by generating second messengers or by functioning as an effector by responding to such messengers. The CARs described herein can contain antibodies or antibody fragments thereof, which can exist in various forms. For example, antigen recognition domains can be expressed as part of a contiguous polypeptide chain, including, for example, single-domain antibody fragments (sdAbs), single-chain antibodies (e.g., scFvs), and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0269] As used herein, the term "hinge domain," in the context of a CAR, refers to the extracellular portion of the CAR that serves to position the antigen recognition domain away from the T cell surface to allow for proper cell-cell contact, antigen binding, and activation. CARs generally contain one or more hinge domains between the antigen recognition domain and the transmembrane domain. Examples of hinge domains include those derived from CD28, CD8 (e.g., CD8α), IgG1 / IgG4 (hinge-Fc portion), CD4, CD7, and IgD.

[0270] As used herein, the term "transmembrane domain" refers to the portion of a CAR that fuses the extracellular antigen recognition domain and the intracellular signaling domain and anchors the CAR to the plasma membrane of a T cell. Examples of transmembrane domains include those derived from CD28, CD3 zeta, CD8 (e.g., CD8α), FcRIγ, CD4, CD7, OX40, and MHC (H2-Kb).

[0271] As used herein, the term "stimulatory molecule" refers to a molecule expressed by a T cell that provides the primary cytoplasmic signaling sequence(s) that regulate primary activation of the TCR complex in a stimulatory manner for at least some aspects of the T cell signaling pathway. In one aspect, the primary signal is initiated, for example, by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, which results in mediation of a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. Primary cytoplasmic signaling sequences (also referred to as "primary signaling domains") that act in a stimulatory manner can contain signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs. Examples of ITAM-containing primary cytoplasmic signaling sequences that can be used in conjunction with the compositions and methods of the present disclosure include, but are not limited to, those derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), and CD66d. In exemplary CAR molecules of the present disclosure, the intracellular signaling domain in any one or more CAR molecules of the present disclosure comprises an intracellular signaling sequence, e.g., the primary signaling sequence of CD3 zeta. In certain CARs of the present disclosure, the primary signaling sequence of CD3 zeta is a human sequence or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc.

[0272] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. The intracellular signaling domain can generate a signal that promotes the immunosuppressive function of a CAR-containing cell, e.g., a CAR Treg cell. For example, an example of the immunosuppressive function in Treg cells includes suppressing the activity and / or proliferation of autoreactive effector immune cells.

[0273] In some embodiments, the intracellular signaling domain may comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules involved in primary stimulation or antigen-dependent stimulation. In embodiments, the intracellular signaling domain may comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules involved in costimulatory signals or antigen-independent stimulation. For example, in the case of CAR Tregs, the primary intracellular signaling domain may comprise the cytoplasmic sequence of a T cell receptor, and the costimulatory intracellular signaling domain may comprise the cytoplasmic sequence from a co-receptor or costimulatory molecule.

[0274] The primary intracellular signaling domain can contain a signaling motif known as an immunoreceptor tyrosine-based activation motif, or ITAM. Examples of ITAM-containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.

[0275] As used herein, "zeta," or alternatively "zeta chain," "CD3 zeta," or "TCR zeta," is defined as the protein provided as GenBank Acc. No. BAG36664.1, or equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape, etc., and "zeta stimulatory domain," or alternatively "CD3 zeta stimulatory domain" or "TCR zeta stimulatory domain," is defined as amino acid residues from the cytoplasmic domain of the zeta chain that are sufficient to functionally transmit the initial signal required for T cell activation. In one embodiment, the zeta cytoplasmic domain comprises residues 52-164 of GenBank Acc. No. BAG36664.1, or equivalent residues from a non-human species that is a functional ortholog, e.g., mouse, rodent, monkey, ape, etc.

[0276] "Costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB (CD137).

[0277] The costimulatory intracellular signaling domain can be derived from the intracellular portion of a costimulatory molecule. Costimulatory molecules can be represented in the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), and activating NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and ligands that specifically bind to CD83. The intracellular signaling domain can comprise the entire intracellular portion of the molecule from which it is derived, or the entire native intracellular signaling domain, or a functional fragment thereof.

[0278] As used herein, the term "autoimmune disease" refers to a group of diseases caused by the immune system mistakenly attacking one's own tissues. Non-limiting examples of autoimmune disorders include type 1 diabetes, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behçet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue dermatitis, chronic fatigue immune deficiency syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis, and idiopathic thrombocytopenic purpura (ITP). P), IgA nephropathy, juvenile arthritis, lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, and Wegener's granulomatosis.

[0279] As used herein, the term "inflammation" refers to a signal-mediated response to cellular injury caused by infectious agents (e.g., pathogens), toxins, tumor cells, irritants, and stress. Acute inflammation is important for defending and protecting the body from harmful stimuli (e.g., pathogens, damaged cells, cancer / tumor cells, stress, or irritants), whereas chronic and inappropriately high inflammation can cause tissue destruction (e.g., in autoimmune, inflammatory, neurodegenerative, or cardiovascular diseases). Inflammation results in capillary dilation accompanied by fluid accumulation (edema) and recruitment of leukocytes. For purposes as used herein, increased or decreased inflammation refers to increased or decreased leukocyte recruitment, and / or increased or decreased immune cell activity (e.g., T cell polarization, T cell activation, dendritic cell activation, neutrophil activation, eosinophil activation, basophil activation, T cell proliferation, B cell proliferation, monocyte proliferation, macrophage proliferation, dendritic cell proliferation, NK cell proliferation, ILC proliferation, mast cell proliferation, neutrophil proliferation, eosinophil proliferation, basophil proliferation, cytotoxic T cell activation, circulating monocytes, peripheral blood hematopoietic stem cells, macrophage polarization, macrophage phagocytosis, macrophages, etc.). phagocytosis, neutrophil ADCP, monocyte phagocytosis, mast cell phagocytosis, B cell phagocytosis, eosinophil phagocytosis, dendritic cell phagocytosis, macrophage activation, antigen presentation (e.g., antigen presentation by dendritic cells, macrophages, and B cells), migration of antigen-presenting cells (e.g., migration of dendritic cells, macrophages, and B cells), lymph node immune cell homing and egress (e.g., lymph node homing and egress of T cells, B cells, dendritic cells, or macrophages), NK cell activation, NK cell ADCC, mast cell degranulation, NK cell degranulation, ILC activation, ILC The autoimmune disease may be assessed by one or more of ADCC, ILC degranulation, cytotoxic T cell degranulation, neutrophil degranulation, eosinophil degranulation, basophil degranulation, neutrophil recruitment, eosinophil recruitment, NKT cell activation, B cell activation, regulatory T cell differentiation, dendritic cell maturation, HEV development, or ectopic or tertiary lymphoid organ (TLO) development. The compositions and methods of the present disclosure may be administered to reduce inflammation in subjects diagnosed with or not afflicted with an autoimmune disease.

[0280] As used herein, the term "leukocyte recruitment" refers to the movement or migration of leukocytes from the circulatory system to sites of tissue damage, infection, injury, or stress. Leukocyte recruitment from the bloodstream to inflammatory foci within tissues is fundamental to mounting a successful inflammatory response and forms an essential part of the innate immune response, as evidenced by the recurrent infections and poor survival rates of patients suffering from leukocyte adhesion deficiency, a class of conditions in which neutrophil trafficking is impaired. Monocytes also use this process in the absence of infection or tissue injury during their development into macrophages. Leukocyte recruitment primarily occurs in postcapillary venules, where molecules controlling leukocyte trafficking are preferentially expressed. During the process of leukocyte recruitment, leukocytes adhere to the vascular endothelium and then leave the circulation by transendothelial migration driven by chemoattractants (e.g., chemokines). This process is known as extravasation.

[0281] As used herein, the term "express" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end processing), (3) translation of the RNA into a polypeptide or protein, and (4) post-translational modification of the polypeptide or protein. In the context of a gene encoding a protein product, the terms "gene expression" and the like are used interchangeably with the terms "protein expression" and the like. Expression of a gene or protein of interest in a subject can be determined, for example, by detecting, in a sample obtained from the subject, an increase in the amount or concentration of mRNA encoding the corresponding protein (e.g., as assessed using RNA detection procedures described herein or known in the art, such as quantitative polymerase chain reaction (qPCR) and RNA-seq techniques), an increase in the amount or concentration of the corresponding protein (e.g., as assessed using protein detection methods described herein or known in the art, such as enzyme-linked immunosorbent assay (ELISA), among others), and / or an increase in the activity of the corresponding protein (e.g., in the case of an enzyme, as assessed using an enzyme activity assay described herein or known in the art). As used herein, a cell is considered to "express" a gene or protein of interest if one or more, or all, of the above events can be detected within the cell or in the medium in which the cell resides.For example, a gene or protein of interest is considered to be "expressed" by a cell or population of cells if it is possible to detect (i) the production of a corresponding RNA transcript, such as an mRNA template, by the cell or population of cells (e.g., using the RNA detection procedures described herein), (ii) processing of the RNA transcript (e.g., splicing, editing, 5' cap formation, and / or 3' end processing, e.g., using the RNA detection procedures described herein), (iii) translation of the RNA template into a protein product (e.g., using the protein detection procedures described herein), and / or (iv) post-translational modification of the protein product (e.g., using the protein detection procedures described herein).

[0282] As used herein, the term "nucleic acid cassette" refers to a recombinant nucleic acid (e.g., DNA or cDNA) that encodes a gene product (e.g., a gene product described herein). The gene product can be RNA, a peptide, or a protein. In addition to the coding region for the gene product, the nucleic acid cassette can include or be operably linked to one or more elements to facilitate or enhance expression, such as a promoter, enhancer(s), destabilization domain(s), response element(s), reporter element(s), insulator element(s), polyadenylation signal(s), and / or other functional elements. Embodiments of the present disclosure can utilize any known suitable promoter(s), enhancer(s), destabilization domain(s), response element(s), reporter element(s), insulator element(s), polyadenylation signal(s), and / or other functional elements.

[0283] As used herein, the term "operably linked" refers to a first molecule attached to a second molecule, the molecules being positioned so that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single, uninterrupted molecule, and may or may not be adjacent. For example, if the promoter controls the transcription of a transcribable polynucleotide molecule of interest in a cell, the promoter is operably linked to the transcribable polynucleotide molecule. Furthermore, two portions of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operably linked to each other by a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without any intervening nucleotides.

[0284] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene of interest. Transcriptional regulatory elements can include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals) that control or help control gene transcription. Examples of transcriptional regulatory elements are described, for example, in Mantel et al., J. Immunol. 176(6):3593-602(2006), Lee et al., Exp. Mol. Med. 50(3):e456(2018), Kim et al., J. Exp. Med. 204(7):1543-51(2007), Zheng et al., Nature. 463(7282):808-12(2010), Tone et al., Nat. Immunol. 9(2):194-202(2008), Dikiy et al., Immunity. 54(5):931-946(2021), Kawakami et al., Immunity. 54(5):947-961(2021), and Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990), the disclosures of which are incorporated by reference in their entireties.

[0285] As used herein, the term "lineage-specific" refers to a nucleic acid that selectively targets a particular cell type over another cell type. For example, the term "lineage-specific transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene found in a particular cell type. Examples of lineage-specific transcriptional regulatory elements include the Foxp3 promoter, CNS1 enhancer, CNS2 enhancer, CNS3 enhancer, and CNS0 enhancer, which control the transcription of the Foxp3 gene, a defining characteristic of Treg cells.

[0286] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase drives transcription of the nucleic acid cassette. Exemplary promoters suitable for use with the compositions and methods described herein are described, for example, in Mantel et al., J. Immunol. 176(6):3593-602 (2006), Lee et al., Exp. Mol. Med. 50(3):e456 (2018), Kim et al., J. Exp. Med. 204(7):1543-51 (2007), and Zheng et al., Nature. 463(7282):808-12 (2010). Additionally, the term "promoter" can refer to a synthetic promoter, which is a regulatory DNA sequence that does not naturally occur in biological systems. Synthetic promoters contain portions of naturally occurring promoters combined with non-naturally occurring polynucleotide sequences and can be optimized to express recombinant DNA using a variety of nucleic acid cassettes, vectors, and target cell types.

[0287] As used herein, the term "enhancer" refers to a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the transcription start site. Thus, enhancers can be located upstream or downstream of the transcription start site, or at a considerable distance from the promoter. Enhancers can also physically and functionally overlap with promoters. Many polynucleotides containing promoter sequences (e.g., Foxp3 promoter sequences) also contain enhancer sequences (e.g., CNS1 enhancer sequences).

[0288] As used herein, the term "Foxp3 promoter" refers to a promoter that turns on the transcription of the Foxp3 gene in Treg cells. An exemplary human Foxp3 promoter includes, for example, the nucleic acid set forth in SEQ ID NO: 1, which is described in Mantel et al., J. Immunol. 176(6):3593-602(2006). Another example of a human Foxp3 promoter includes, for example, the nucleic acid set forth in SEQ ID NO: 2, which is described in Kim et al., J. Exp. Med. 204(7):1543-51(2007). An exemplary mouse Foxp3 promoter includes, for example, the nucleic acid set forth in SEQ ID NO: 3, which is described in Zheng et al., Nature. 463(7282):808-12(2010). As an alignment of SEQ ID NO: 3 to the human genome, a further example of a human Foxp3 promoter includes the nucleic acid set forth in SEQ ID NO: 4. Additional examples of Foxp3 promoter nucleic acids include nucleic acids having at least 70% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above nucleic acid sequences.

[0289] As used herein, the term "CNS0 enhancer" refers to an enhancer that increases the transcription efficiency of the Foxp3 gene in Treg cells. For example, CNS0 enhancers that can be used in combination with the compositions and methods of the present disclosure include those that recruit the transcription factors Satb1 and / or Stat5. Exemplary mouse CNS0 enhancers include, for example, the nucleic acid set forth in SEQ ID NO: 17, which is described in Kawakami et al., Immunity. 54(5):947-961 (2021). Aligning SEQ ID NO: 17 to the human genome, exemplary human CNS0 enhancers include, for example, the nucleic acid set forth in SEQ ID NO: 18. Another example of a mouse CNS0 enhancer includes the nucleic acid set forth in SEQ ID NO: 19, which is described in Dikiy et al., Immunity. 54(5):931-946 (2021). Aligning SEQ ID NO: 19 to the human genome, a further example of a human CNS0 enhancer includes the nucleic acid set forth in SEQ ID NO: 20. Additional examples of CNS0 enhancer nucleic acids include nucleic acids having at least 70% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above nucleic acid sequences.

[0290] As used herein, the term "CNS1 enhancer" refers to an enhancer that increases the transcriptional efficiency of the Foxp3 gene in Treg cells. For example, CNS1 enhancers that can be used in combination with the compositions and methods of the present disclosure include those that recruit transcription factors AP-1, NFAT, Smad3, and / or Foxo (e.g., Foxo1 and Foxo3). CNS1 enhancers are thought to contribute to the peripheral induction of Treg cells and mucosal immune tolerance. An exemplary human CNS1 enhancer contains nucleic acids -500 to +100 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). Exemplary mouse CNS1 enhancers include, for example, the nucleic acid set forth in SEQ ID NO:5, which is described in Tone et al., Nat. Immunol. 9(2):194-202 (2008). Aligning SEQ ID NO:5 to the human genome, additional examples of human CNS1 enhancers include the nucleic acid set forth in SEQ ID NO:6. Another example of a mouse CNS1 enhancer includes the nucleic acid set forth in SEQ ID NO:7, which is described in Zheng et al., Nature. 463(7282):808-12 (2010). Aligning SEQ ID NO:7 to the human genome, a further example of a human CNS1 enhancer includes the nucleic acid set forth in SEQ ID NO:8. Additional examples of CNS1 enhancer nucleic acids include nucleic acids having at least 70% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) with the above nucleic acid sequences.

[0291] As used herein, the term "CNS2 enhancer" refers to an enhancer that increases the transcriptional efficiency of the Foxp3 gene in Treg cells. For example, CNS2 enhancers that can be used in combination with the compositions and methods of the present disclosure include those that recruit the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel. The CNS2 enhancer is highly demethylated in functional Treg cells and is thought to be involved in the stability of Foxp3 expression in response to T cell receptor stimulation and during Treg cell proliferation. An exemplary human CNS2 enhancer contains nucleic acids +2,022 to +2,721 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). Exemplary mouse CNS2 enhancers include, for example, the nucleic acid set forth in SEQ ID NO: 9, which is described in Kawakami et al., Immunity. 54(5):947-961 (2021). Aligning SEQ ID NO: 9 to the human genome, additional examples of human CNS2 enhancers include the nucleic acid set forth in SEQ ID NO: 10. Another example of a mouse CNS2 enhancer includes the nucleic acid set forth in SEQ ID NO: 11, which is described in Zheng et al., Nature. 463(7282):808-12 (2010). Aligning SEQ ID NO: 11 to the human genome, a further example of a human CNS2 enhancer includes the nucleic acid set forth in SEQ ID NO: 12. Additional examples of CNS2 enhancer nucleic acids include nucleic acids having at least 70% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) with the above nucleic acid sequences.

[0292] As used herein, the term "CNS3 enhancer" refers to an enhancer that increases the transcriptional efficiency of the Foxp3 gene in Treg cells. For example, CNS3 enhancers that can be used in combination with the compositions and methods of the present disclosure include those that recruit the transcription factors Foxo (e.g., Foxo1 and Foxo3) and / or c-Rel. The CNS3 enhancer is thought to play a role in thresholding the TCR stimulation required for Foxp3 expression and is important for the generation of peripheral and thymic Treg cells. An exemplary human CNS3 enhancer contains nucleic acids +4,301 to +4,500 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). Exemplary mouse CNS3 enhancers include, for example, the nucleic acid set forth in SEQ ID NO: 13, which is described in Kawakami et al., Immunity. 54(5):947-961 (2021). Aligning SEQ ID NO: 13 to the human genome, additional examples of human CNS3 enhancers include the nucleic acid set forth in SEQ ID NO: 14. Another example of a mouse CNS3 enhancer includes the nucleic acid set forth in SEQ ID NO: 15, which is described in Zheng et al., Nature. 463(7282):808-12 (2010). Aligning SEQ ID NO: 15 to the human genome, further examples of human CNS3 enhancers include the nucleic acid set forth in SEQ ID NO: 16. Additional examples of CNS3 enhancer nucleic acids include nucleic acids having at least 70% identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above nucleic acid sequences.

[0293] As used herein, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of a gene or genes. Such regulatory sequences are described, for example, in Perdew et al., Regulation of Gene Expression (Humana Press, New York, NY, (2014)), which is incorporated herein by reference.

[0294] "Percent sequence identity" to a reference polynucleotide sequence or a reference polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide sequence or the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of determining percent nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences being compared. For example, percent sequence identity values ​​can be generated using the sequence comparison computer program BLAST. As an example, the percent sequence identity of a given nucleic acid or amino acid sequence A to, with, or relative to a given nucleic acid or amino acid sequence B (which can alternatively be said as a given nucleic acid or amino acid sequence A having a certain percent sequence identity to, with, or relative to a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in a programmatic alignment of A and B, and Y is the total number of nucleic acids in B. It is understood that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0295] As used herein, the term "inhibitor" refers to an agent (e.g., a small molecule, peptide fragment, protein, antibody, or antigen-binding fragment thereof) that binds to and / or otherwise suppresses the activity of a target molecule.

[0296] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell).

[0297] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell). Exogenous materials include those provided from a source external to the organism or culture materials extracted therefrom.

[0298] As used herein, the terms "transduction" and "transducing" refer to the method of introducing a viral vector construct or a portion thereof into a cell, followed by expression in the cell of a nucleic acid cassette encoded by the vector construct or portion thereof.

[0299] As used herein, the term "poloxamer" refers to a nonionic triblock copolymer composed of a central hydrophobic chain of polyoxypropylene flanked by two hydrophilic chains of polyoxyethylene. Poloxamers are also known under the trade names "Pluronics" or "Symperonics" (BASF). The block copolymers can be represented by the following formula: HO(CHO) x (C3H6O) y (C2H4O) z H. The length of the polymer block can be customized. Consequently, many different poloxamers exist. Poloxamers suitable for use in combination with the compositions and methods of the present disclosure include those having an average molecular weight of at least about 10,000 g / mol, at least about 11,400 g / mol, at least about 12,600 g / mol, at least about 13,000 g / mol, at least about 14,600 g / mol, or at least about 15,000 g / mol. Because the synthesis of block copolymers is associated with natural variability from batch to batch, the numerical values ​​cited above (and those used herein to characterize a given poloxamer) may not be precisely achievable during synthesis, and average values ​​will vary to a certain extent. Therefore, as used herein, the term "poloxamer" can be used interchangeably with the term "poloxamer" (representing several poloxamer entities, also referred to as poloxamer mixtures), unless otherwise specified. As used herein, the term "average" in relation to the number of monomer units or molecular weight of a poloxamer(s) is a result of the technical inability to produce poloxamers that all have the same composition and, therefore, the same molecular weight. Poloxamers produced according to state-of-the-art methods exist as a mixture of poloxamers, each exhibiting variability with respect to their molecular weight, but the mixture as a whole averages out to the molecular weight specified herein. BASF and Sigma Aldrich are suitable sources of poloxamers for use in conjunction with the compositions and methods of the present disclosure.

[0300] As used herein, for example, in the context of protein kinase C (PKC) inhibitors such as staurosporine, the term "variant" refers to an agent that contains one or more modifications compared to a reference agent, and (i) retains the functional properties of the reference agent (e.g., the ability to inhibit PKC activity), and / or (ii) is converted to the reference agent in cells (e.g., cells of the type described herein, such as CD34+ cells). In the context of small molecule PKC inhibitors such as staurosporine, structural variants of the reference compound include variants that differ from the reference compound due to the inclusion and / or position of one or more substituents, as well as variants that are isomers of the reference compound, such as structural isomers (e.g., positional isomers) or stereoisomers (e.g., enantiomers or diastereomers), and prodrugs of the reference compound. In the context of interfering RNA molecules, variants may contain one or more nucleic acid substitutions compared to the parent interfering RNA molecule.

[0301] As used herein, an agent that inhibits histone deacetylation refers to a substance or composition (e.g., a small molecule, protein, interfering RNA, messenger RNA, or other natural or synthetic compound, or a composition such as a virus or other material composed of multiple substances) that can attenuate or prevent the activity of histone deacetylase, more specifically, its enzymatic activity, either through direct interaction or indirect means, such as by causing a reduction in the amount of histone deacetylase produced in cells or by inhibiting the interaction between histone deacetylase and an acetylated histone substrate. Inhibiting the enzymatic activity of histone deacetylase means reducing the ability of histone deacetylase to catalyze the removal of acetyl groups from histone residues (e.g., mono-, di-, or tri-methylated lysine residues, mono-methylated arginine residues, or symmetrical / asymmetrical dimethylated arginine residues in histone proteins). Preferably, such inhibition is specific, such that an agent that inhibits histone deacetylation reduces the ability of a histone deacetylase to remove an acetyl group from a histone residue at a concentration of the inhibitor that is lower than the concentration of the inhibitor required to produce an otherwise unrelated biological effect.

[0302] As used herein, the terms "histone deacetylase" and "HDAC" refer to any member of a family of enzymes that catalyze the removal of acetyl groups from the epsilon-amino groups of lysine residues at the N-terminus of histones. Unless otherwise indicated by context, the term "histone" is intended to refer to any histone protein, including H1, H2A, H2B, H3, H4, and H5, from any species. Human HDAC proteins or gene products include, but are not limited to, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, and HDAC-11.

[0303] As used herein, a compound that "activates prostaglandin E receptor signal transduction" refers to a compound that has the ability to increase the signal transduction activity of prostaglandin E receptor in prostaglandin E receptor-expressing cells that have been contacted with the specified compound, compared to the prostaglandin E receptor signal transduction activity in prostaglandin E receptor-expressing cells that have not been contacted with the specified compound. Assays that can be used to measure prostaglandin E receptor signal transduction are described, for example, in WO2010 / 108028, the disclosure of which relates to methods for evaluating prostaglandin E receptor signal transduction, and is incorporated herein by reference.

[0304] As used herein, the term "transfection" refers to any of a wide variety of techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, nucleofection, squeezeporation, sonoporation, optical transfection, magnetofection, impalefection, and the like.

[0305] As used herein, the term "vector" includes nucleic acid vectors (e.g., DNA vectors such as plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). Various vectors have been developed for delivering polynucleotides encoding exogenous proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are described, for example, in WO 1994 / 011026, the disclosure of which is incorporated herein by reference as it relates to vectors suitable for expressing genes of interest. Expression vectors suitable for use with the compositions and methods described herein contain polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Vectors that can be used for expression of the protein(s) described herein include plasmids containing regulatory sequences, such as promoter and enhancer regions, that direct gene transcription. In addition, vectors useful for expressing the protein(s) described herein may contain polynucleotide sequences that increase the translation rate of the corresponding gene(s) or improve the stability or nuclear export of mRNA resulting from gene transcription. Examples of such sequence elements are 5' and 3' untranslated regions, IRES, and polyadenylation signal sites for directing efficient transcription of the gene or genes carried by the expression vector. Expression vectors suitable for use with the compositions and methods described herein can also contain a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers are genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, nourseothricin, or zeocin, among others.

[0306] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Certain plasmids are capable of directing the expression of genes to which they are operably linked.

[0307] As used herein, the terms "subject" and "patient" are used interchangeably and refer to a living organism (e.g., a mammal, e.g., a human) at risk of developing or diagnosed as having and / or undergoing treatment for a disease, such as an autoimmune disease described herein.

[0308] As used herein, the terms "administering," "administration," and the like refer to providing a therapeutic agent (e.g., a population of cells, such as a population of pluripotent cells (e.g., embryonic stem cells, induced pluripotent stem cells, or CD34+ cells)) directly to a patient by any effective route. Exemplary routes of administration are described herein and include, among others, systemic routes such as intravenous injection.

[0309] As used herein, "treatment" and "treating" refer to an approach for obtaining a beneficial or desired result, e.g., a clinical result. Beneficial or desired results can include, but are not limited to, the reduction or amelioration of one or more signs or symptoms, whether detectable or undetectable; a reduction in the extent of the disease or condition; a stabilization of the state of the disease, disorder, or condition (i.e., not worsening); prevention of the spread of the disease or condition; a delay or slowing of the progression of the disease or condition; remission or alleviation of the disease or condition; and remission (partial or complete). "Ameliorating" or "alleviating" a disease or condition means that the severity and / or undesirable clinical signs of the disease, disorder, or condition are reduced and / or the time course of progression is slowed or prolonged compared to the severity or time course in the absence of treatment. "Treatment" can also mean prolonging survival compared to expected survival in the absence of treatment. Those in need of treatment include those already with the condition or disorder, those prone to or at risk of developing the condition or disorder, and those in whom the condition or disorder is to be prevented.

[0310] As used herein, the term "pharmaceutical composition" means a composition containing a therapeutic agent (e.g., a population of cells, such as a population of pluripotent hematopoietic cells (e.g., embryonic stem cells, induced pluripotent stem cells, lymphoid progenitor cells, or CD34+ cells)) that can be administered to a subject, such as a mammal, e.g., a human, to prevent, treat, or control a particular disease or condition affecting the mammal, such as an autoimmune disease described herein.

[0311] As used herein, the term "pharmaceutically acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without excessive toxicity, irritation, allergic response, and other problematic adverse effects, and with a reasonable benefit / risk ratio.

[0312] As used herein, the term "sample" refers to a specimen isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or dermis), pancreatic juice, chorionic membrane samples, and cells). The term sample can also relate to prepared or processed samples, such as mRNA- or cDNA-containing samples.

[0313] As used herein, the term "about" refers to an amount that varies by as much as 30% (e.g., 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%) relative to a reference amount.

[0314] As used herein, the term "alkyl" refers to monovalent, optionally branched alkyl groups, such as those having 1 to 6 or more carbon atoms. This term is exemplified by groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-hexyl, and the like.

[0315] As used herein, the term "lower alkyl" refers to an alkyl group having 1 to 6 carbon atoms.

[0316] As used herein, the term "aryl" refers to an unsaturated aromatic carbocyclic group of 6 to 14 carbon atoms having a single ring (e.g., phenyl) or multiple condensed rings (e.g., naphthyl). Preferred aryls include phenyl, naphthyl, phenanthrenyl, and the like.

[0317] As used herein, the terms "aralkyl" and "arylalkyl" are used interchangeably and refer to alkyl groups containing an aryl moiety. Similarly, the term "aryl lower alkyl" and the like refer to lower alkyl groups containing an aryl moiety.

[0318] As used herein, the term "alkylaryl" refers to an alkyl group having an aryl substituent, including benzyl, phenethyl and the like.

[0319] As used herein, the term "heteroaryl" refers to a monocyclic heteroaromatic group or a bicyclic or tricyclic fused-ring heteroaromatic group.Specific examples of heteroaromatic groups include optionally substituted pyridyl, pyrrolyl, furyl, thienyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, 1,3,4-triazinyl, 1,2,3-triazinyl, benzofuryl, 2,3-dihydrodibenzofuryl, isobenzofuryl, benzothienyl, benzotriazolyl, isobenzothienyl, Examples include indolyl, isoindolyl, 3H-indolyl, benzimidazolyl, imidazo[1,2-a]pyridyl, benzothiazolyl, benzoxazolyl, quinolidinyl, quinazolinyl, phthalazinyl, quinoxalinyl, cinnolinyl, naphthyridinyl, pyrido[3,4-b]pyridyl, pyrido[3,2-b]pyridyl, pyrido[4,3-b]pyridyl, quinolyl, isoquinolyl, tetrazolyl, 5,6,7,8-tetrahydroquinolyl, 5,6,7,8-tetrahydroisoquinolyl, purinyl, pteridinyl, carbazolyl, xanthenyl, and benzoquinolyl.

[0320] As used herein, the term "alkylheteroaryl" refers to an alkyl group having a heteroaryl substituent, including 2-furylmethyl, 2-thienylmethyl, 2-(1H-indol-3-yl)ethyl, and the like.

[0321] As used herein, the term "lower alkenyl" refers to an alkenyl group preferably having from 2 to 6 carbon atoms and having at least 1 or 2 sites of alkenyl unsaturation. Exemplary alkenyl groups are ethenyl (-CH=CH), n-2-propenyl (allyl, -CHCH=CH), and the like.

[0322] As used herein, the term "alkenylaryl" refers to alkenyl groups having an aryl substituent, including 2-phenylvinyl and the like.

[0323] As used herein, the term "alkenylheteroaryl" refers to an alkenyl group having a heteroaryl substituent, including 2-(3-pyridinyl)vinyl and the like.

[0324] As used herein, the term "lower alkynyl" refers to alkynyl groups preferably having from 2 to 6 carbon atoms and having at least 1 or 2 sites of alkynyl unsaturation; preferred alkynyl groups include ethynyl (-C≡CH), propargyl (-CHC≡CH), and the like.

[0325] As used herein, the term "alkynylaryl" refers to an alkynyl group having an aryl substituent, including phenylethynyl and the like.

[0326] As used herein, the term "alkynylheteroaryl" refers to an alkynyl group having a heteroaryl substituent, including 2-thienylethynyl and the like.

[0327] As used herein, the term "cycloalkyl" refers to a monocyclic cycloalkyl group having from 3 to 8 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like.

[0328] As used herein, the term "lower cycloalkyl" refers to a saturated carbocyclic group of 3 to 8 carbon atoms having a single ring (e.g., cyclohexyl) or multiple condensed rings (e.g., norbornyl). Preferred cycloalkyls include cyclopentyl, cyclohexyl, norbornyl, and the like.

[0329] As used herein, the term "heterocycloalkyl" refers to a cycloalkyl group in which one or more ring carbon atoms is replaced with a heteroatom, such as, for example, a nitrogen atom, an oxygen atom, a sulfur atom, etc. Exemplary heterocycloalkyl groups are pyrrolidinyl, piperidinyl, oxopiperidinyl, morpholinyl, piperazinyl, oxopiperazinyl, thiomorpholinyl, azepanyl, diazepanyl, oxazepanyl, thiazepanyl, dioxothiazepinyl, azocanyl, tetrahydrofuranyl, tetrahydropyranyl, and the like.

[0330] As used herein, the term "alkylcycloalkyl" refers to an alkyl group having a cycloalkyl substituent, including cyclohexylmethyl, cyclopentylpropyl, and the like.

[0331] As used herein, the term "alkylheterocycloalkyl" refers to a C1-C6 alkyl group having a heterocycloalkyl substituent, including 2-(1-pyrrolidinyl)ethyl, 4-morpholinylmethyl, (1-methyl-4-piperidinyl)methyl, and the like.

[0332] As used herein, the term "carboxy" refers to the group --C(O)OH.

[0333] As used herein, the term "alkylcarboxy" refers to C1-C5 alkyl groups having a carboxy substituent, including 2-carboxyethyl and the like.

[0334] As used herein, the term "acyl" refers to the group -C(O)R, where R can be, for example, C-C alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other substituents.

[0335] As used herein, the term "acyloxy" refers to the group -OC(O)R, where R can be, for example, C-C alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other substituents.

[0336] As used herein, the term "alkoxy" refers to the group -OR, where R is an optionally substituted alkyl group such as, for example, an optionally substituted C-C alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other substituents. Exemplary alkoxy groups include, for example, methoxy, ethoxy, phenoxy, and the like.

[0337] As used herein, the term "alkoxycarbonyl" refers to the group -C(O)OR, where R is, for example, hydrogen, C-C alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other possible substituents.

[0338] As used herein, the term "alkylalkoxycarbonyl" refers to alkyl groups having an alkoxycarbonyl substituent, including 2-(benzyloxycarbonyl)ethyl and the like.

[0339] As used herein, the term "aminocarbonyl" refers to the group -C(O)NRR', where each of R and R' can independently be, for example, hydrogen, C1-C6 alkyl, aryl, heteroaryl, C1-C6 alkylaryl, or C1-C6 alkylheteroaryl, among other substituents.

[0340] As used herein, the term "alkylaminocarbonyl" refers to alkyl groups having an aminocarbonyl substituent, including 2-(dimethylaminocarbonyl)ethyl and the like.

[0341] As used herein, the term "acylamino" refers to the group -NRC(O)R', where each of R and R' can independently be, for example, hydrogen, C1-C6 alkyl, aryl, heteroaryl, C1-C6 alkylaryl, or C1-C6 alkylheteroaryl, among other substituents.

[0342] As used herein, the term "alkylacylamino" refers to alkyl groups having an acylamino substituent, including 2-(propionylamino)ethyl and the like.

[0343] As used herein, the term "ureido" refers to the group -NRC(O)NR'R", where each of R, R', and R" independently can be, for example, hydrogen, C1-C6 alkyl, aryl, heteroaryl, C1-C6 alkylaryl, C1-C6 alkylheteroaryl, cycloalkyl, or heterocycloalkyl, among other substituents. Exemplary ureido groups further include moieties in which R' and R" together with the nitrogen atom to which they are attached form a 3- to 8-membered heterocycloalkyl ring.

[0344] As used herein, the term "alkylureido" refers to an alkyl group having a ureido substituent, including 2-(N'-methylureido)ethyl and the like.

[0345] As used herein, the term "amino" refers to the group -NRR', where each of R and R' can independently be, for example, hydrogen, C-C alkyl, aryl, heteroaryl, C-C alkylaryl, C-C alkylheteroaryl, cycloalkyl, or heterocycloalkyl, among other substituents. Exemplary amino groups further include moieties where R and R', together with the nitrogen atom to which they are attached, can form a 3- to 8-membered heterocycloalkyl ring.

[0346] As used herein, the term "alkylamino" refers to an alkyl group having an amino substituent, including 2-(1-pyrrolidinyl)ethyl and the like.

[0347] As used herein, the term "ammonium" refers to a positively charged group -N + RR'R" wherein each of R, R', and R" independently may be, for example, C1-C6 alkyl, C1-C6 alkylaryl, C1-C6 alkylheteroaryl, cycloalkyl, or heterocycloalkyl, among other substituents. Exemplary ammonium groups further include moieties in which R and R', together with the nitrogen atom to which they are attached, form a 3-8 membered heterocycloalkyl ring.

[0348] As used herein, the term "halogen" refers to fluorine, chlorine, bromine, and iodine atoms.

[0349] As used herein, the term "sulfonyloxy" refers to the group -OSO2-R, where R is hydrogen, C1-C6 alkyl, C1-C6 alkyl substituted with halogen (e.g., -OSO2-CF3 group), aryl, heteroaryl, C1-C6 alkylaryl, and C1-C6 alkylheteroaryl.

[0350] As used herein, the term "alkylsulfonyloxy" refers to alkyl groups having a sulfonyloxy substituent, including 2-(methylsulfonyl)ethyl and the like.

[0351] As used herein, the term "sulfonyl" refers to the group "-SO2-R," where R is hydrogen, aryl, heteroaryl, C1-C6 alkyl, C1-C6 alkyl substituted with halogen (e.g., a -SO2-CF3 group), C1-C6 alkylaryl, or C1-C6 alkylheteroaryl.

[0352] As used herein, the term "alkylsulfonyl" refers to alkyl groups having a sulfonyl substituent, including 2-(methylsulfonyl)ethyl and the like.

[0353] As used herein, the term "sulfinyl" refers to the group "-S(O)-R," where R is hydrogen, C-C alkyl, C-C alkyl substituted with halogen (e.g., a -SO-CF group), aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl.

[0354] As used herein, the term "alkylsulfinyl" refers to C1-C5 alkyl groups having a sulfinyl substituent, including 2-(methylsulfinyl)ethyl and the like.

[0355] As used herein, the term "sulfanyl" refers to the group -SR, where R is, for example, alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other substituents. Exemplary sulfanyl groups are methylsulfanyl, ethylsulfanyl, and the like.

[0356] As used herein, the term "alkylsulfanyl" refers to alkyl groups having a sulfanyl substituent, including 2-(methylsulfanyl)ethyl and the like.

[0357] As used herein, the term "sulfonylamino" refers to the group -NRSO-R', where each of R and R' can independently be hydrogen, C-C alkyl, aryl, heteroaryl, C-C alkylaryl, or C-C alkylheteroaryl, among other substituents.

[0358] As used herein, the term "alkylsulfonylamino" refers to alkyl groups having a sulfonylamino substituent, including 2-(ethylsulfonylamino)ethyl and the like.

[0359] Unless otherwise constrained by the definition of the individual substituent, the groups described above, such as "alkyl," "alkenyl," "alkynyl," "aryl," and "heteroaryl" groups, can be optionally substituted with one or more substituents, such as, for example, if valence allows, a substituent selected from alkyl (e.g., C-C alkyl), alkenyl (e.g., C-C alkenyl), alkynyl (e.g., C-C alkynyl), cycloalkyl, heterocycloalkyl, alkylaryl (e.g., C-C alkylaryl), alkylheteroaryl (e.g., C-C alkylheteroaryl), alkylcycloalkyl (e.g., C-C alkylcycloalkyl), alkylheterocycloalkyl (e.g., C-C alkylheterocycloalkyl), amino, ammonium, acyl, acyloxy, acylamino, aminocarbonyl, alkoxycarbonyl, ureido, aryl, heteroaryl, sulfinyl, sulfonyl, alkoxy, sulfanyl, halogen, carboxy, trihalomethyl, cyano, hydroxy, mercapto, nitro, and the like. In some embodiments, the substitution involves vicinal functional substituents, and thus is one in which adjacent substituents undergo ring closure, such as, for example, situations in which lactams, lactones, cyclic anhydrides, acetals, thioacetals, and aminals, among others, are formed.

[0360] As used herein, the term "optionally fused" refers to a cyclic chemical group, such as a cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, that can be fused to a ring system. Exemplary ring systems that can be optionally fused to a fused chemical group include, for example, indolyl, isoindolyl, benzofuranyl, isobenzofuranyl, benzothiophenyl, benzoxazolyl, benzothiazolyl, benzisoxazolyl, benzisothiazolyl, indazolyl, benzimidazolyl, quinolinyl, isoquinolinyl, phthalazinyl, quinoxalinyl, quinazolinyl, cinnolinyl, indolizinyl, naphthyridinyl, pteridinyl, indanyl, naphthyl, 1,2,3,4-tetrahydronaphthyl, indolinyl, isoindolinyl, 2,3,4,5-tetrahydrobenzo[b]oxepinyl, 6,7,8,9-tetrahydro-5H-benzocycloheptenyl, chromanyl, and the like.

[0361] As used herein, the term "pharmaceutically acceptable salt" refers to a salt, such as a salt of a compound described herein, that retains the desired biological activity of the non-ionized parent compound from which the salt is formed. Examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.) and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, fumaric acid, maleic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, and polygalacturonic acid. Compounds also have the formula -NR,R',R" + Z -wherein each of R, R', and R" can independently be, for example, hydrogen, alkyl, benzyl, C-C alkyl, C-C alkenyl, C-C alkynyl, C-C alkylaryl, C-C alkylheteroaryl, cycloalkyl, heterocycloalkyl, etc., and Z is a counterion such as, for example, chloride, bromide, iodide, -O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphate, carboxylate (e.g., benzoate, succinate, acetate, glycolate, maleate, malate, fumarate, citrate, tartrate, ascorbate, cinnamoate, mandeloate, and diphenylacetate).

[0362] The structural compositions described herein include tautomers, geometric isomers (e.g., E / Z and cis / trans isomers), enantiomers, diastereomers, and racemates, as well as pharmaceutically acceptable salts thereof, including, for example, acid addition salts formed with pharmaceutically acceptable acids such as hydrochloride, hydrobromide, sulfate or bisulfate, phosphate or hydrogenphosphate, acetate, benzoate, succinate, fumarate, maleate, lactate, citrate, tartrate, gluconate, methanesulfonate, benzenesulfonate, and paratoluenesulfonate.

[0363] As used herein, a chemical structural formula that does not depict the stereochemical configuration of a compound having one or more stereocenters is intended to encompass any one stereoisomer of the depicted compound, or a mixture of one or more such stereoisomers (e.g., any one enantiomer or diastereomer of the depicted compound, or a mixture of enantiomers (e.g., a racemic mixture) or diastereomers). As used herein, a chemical structural formula that does not specifically depict the stereochemical configuration of a compound having one or more stereocenters is intended to refer to a substantially pure form of the particular stereoisomer depicted. By "substantially pure" form is meant a compound having greater than 85% purity, e.g., 85% to 99%, 85% to 99.9%, 85% to 99.99%, or 85% to 100% purity, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, or 100% purity, as assessed, for example, using chromatography and nuclear magnetic resonance techniques known in the art. DETAILED DESCRIPTION OF THE INVENTION

[0364] The present disclosure is directed to, among other conditions, type 1 diabetes, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue dermatitis, chronic fatigue immune deficiency syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, and juvenile arthritis. The present invention provides compositions and methods for treating autoimmune diseases such as psoriasis, lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, and Wegener's granulomatosis. In accordance with the compositions and methods of the present disclosure, a patient (e.g., a human patient) may be administered a population of pluripotent cells (e.g., pluripotent hematopoietic cells) comprising a nucleic acid cassette encoding an autoantigen-binding protein. The nucleic acid cassette may be operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ regulatory T (Treg) cells to treat or prevent an autoimmune disease, such as one or more of the aforementioned conditions. In the context of therapeutic treatment, the pluripotent hematopoietic cells may be administered to a patient to alleviate one or more symptoms of the disease and / or treat the underlying molecular pathology associated with the disease, for example, to suppress the activity and / or proliferation of a population of autoreactive effector immune cells, induce apoptosis of autoreactive effector immune cells, protect endogenous tissues from an autoimmune response, or reduce inflammation.

[0365] The compositions and methods of the present disclosure offer significant advantages over current methods of treating autoimmune diseases using Treg cell therapy. To date, human polyclonal Treg cells have been used in clinical trials to treat autoimmune diseases. However, polyclonal Treg cell therapy has proven ineffective due to the lack of in vivo expansion and persistence of Treg cells and the lack of specificity of Treg cells for target tissues. To overcome the lack of specificity of polyclonal Treg cells, Treg cells have been genetically engineered to express receptors, including chimeric antigen receptors or antigen-specific T cell receptors, that can recognize specific antigens. Despite these advances, one of the obstacles associated with the current use of Treg cell therapy to treat autoimmune diseases is the durability of Treg cells administered directly to patients. Current research suggests that the cells may persist in vivo for only 3 to 5 years, which is particularly concerning in the context of chronic autoimmune diseases. The compositions and methods of the present disclosure improve upon the existing paradigm for using genetically engineered antigen-specific Treg cells to treat autoimmune diseases by combining the specific suppressive potential of Treg cells with the proven durability of hematopoietic stem cell gene therapy. In particular, the compositions and methods of the present disclosure provide pluripotent hematopoietic cells that have been genetically engineered to contain an antigen-binding protein that is preferentially expressed in Treg cells during hematopoietic cell differentiation in vivo. While the pluripotent hematopoietic cells can differentiate into mature blood cells of various lineages, the antigen-binding protein is specifically expressed in Treg cells due to the expression of lineage-specific transcriptional regulatory elements (e.g., Foxp3 promoter) that are preferentially active in CD4+CD25+ regulatory Treg cells.

[0366] The compositions and methods of the present disclosure can also confer improved stability to Treg cells by providing tissue-specific regulation of autoantigen-binding protein expression. Thus, the expression of autoantigen-binding proteins is responsive to the Treg cell phenotype. In contrast, antigen-specific Treg cells administered directly to patients may lose the lineage-specific transcriptional regulatory elements that activate Treg cells and allow them to become effector T cells. Therefore, direct administration of Treg cells to patients suffering from autoimmune diseases is associated with the risk of further activating the immune response rather than suppressing it.

[0367] The compositions and methods of the present disclosure may also offer advantages in terms of manufacturing and feasibility. Direct Treg cell therapy requires multiparameter cell sorting on large quantities of cells, posing significant manufacturing challenges, as there is currently no single marker for Treg cells. Furthermore, patients with autoimmune diseases have low and poorly functioning Treg cells, posing significant manufacturing challenges for autologous Treg cell therapy. As provided by the compositions and methods of the present disclosure, hematopoietic stem cells have well-defined manufacturing procedures and good manufacturing practices.

[0368] Furthermore, while hematopoietic stem cell dosages are well established, effective Treg cell dosages remain unknown and are likely to vary for each disease. Long-term efficacy of Treg cells administered directly to patients may also require multiple doses and, consequently, multiple conditioning regimens.

[0369] Methods for Treating Autoimmune Diseases Autoimmune diseases are the result of inappropriate attacks by the immune system against one's own tissues. These diseases are mediated by T and B lymphocytes that misreact with self-antigens. Regulatory T (Treg) cells have evolved to inhibit the activity of immune cells that cross-react with "self" major histocompatibility complex (MHC) proteins and other benign antigens, thereby regulating the immune system, maintaining tolerance to self-antigens, and preventing autoimmune diseases. Treg cells represent a heterogeneous class of T cells that can be distinguished based on their unique surface protein presentation. The best-understood populations of Treg cells include CD4+, CD25+, FoxP3+, and CD17+ Treg cells. The precise mechanisms by which Treg cells mediate the suppression of autoreactive effector immune cells (e.g., effector T cells, B cells, and NK cells) are the subject of ongoing investigation, but Treg suppressive function is thought to occur through contact-dependent cell-cell crosstalk mechanisms and through the secretion of inhibitory cytokines such as IL-10, IL-35, and TGF-β. It has also been shown that a specific class of Treg cells inhibits the production of the proliferation-inducing cytokine IL-2 in target T cells and can sequester IL-2 from autoreactive cells due to the affinity of CD25 (a subdomain of the IL-2 receptor) for IL-2. Furthermore, CD4+, CD25+, FoxP3+ Treg cells also reside in B cell-rich areas and are involved in the proliferation of T cells. H Independently of its ability to attenuate 2-cell activity, it has been shown that it is possible to directly suppress immunoglobulin production.

[0370] Treg cell therapy has been investigated as a potential treatment paradigm for autoimmune diseases, but one problem with Treg cell therapy is that Treg cells tend to lose their phenotype (e.g., CD25+ phenotype). Thus, Treg cells lose their suppressive function and may convert into autoreactive effector immune cells (e.g., effector T cells), potentially leading to an activated immune response and exacerbation of autoimmune diseases.

[0371] The compositions and methods of the present disclosure provide a solution to this problem by providing multipotent cells, such as multipotent hematopoietic cells (e.g., HSCs), that can differentiate into various cells of the hematopoietic lineage for the treatment of autoimmune diseases. For example, multipotent hematopoietic cells can differentiate into granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells). The multipotent hematopoietic cells described herein contain a nucleic acid cassette encoding an autoantigen-binding protein that provides localization to target tissues. While multipotent hematopoietic cells can differentiate into multiple cell types of the hematopoietic lineage, expression of the autoantigen-binding protein is restricted to cells that differentiate into Treg cells. Treg-specific expression of an autoantigen-binding protein is achieved by placing a nucleic acid cassette encoding the autoantigen-binding protein under the control of a transcriptional regulatory element that is preferentially active in CD4+CD25+ Treg cells. The autoantigen-binding protein can direct Treg cells to autoantigens present at sites of autoimmunity, thereby focusing Treg suppressor function at these sites to treat autoimmune disease.

[0372] An advantage of delivering pluripotent hematopoietic cells (e.g., HSCs) upstream of differentiated Treg cells to a patient (e.g., a human patient suffering from an autoimmune disease) is that, due to CD4+CD25+ Treg-specific transcriptional regulatory elements that control the expression of autoantigen-binding proteins, HSC-derived Treg cells cease expressing autoantigen-binding proteins when the Treg cells are converted into autoreactive effector immune cells (e.g., effector T cells). In contrast, Treg cells that express autoantigen-binding proteins and are delivered directly to a patient (e.g., a human patient suffering from an autoimmune disease) may lose their phenotype and convert into autoreactive effector immune cells that continue to express the autoantigen-binding protein. Autoreactive effector immune cells (e.g., effector T cells) that express the autoantigen-binding protein are directed to the site of autoimmunity, leading to the activation of the immune response and the exacerbation of the autoimmune disease. Thus, the compositions and methods of the present disclosure provide significant advantages for the treatment of autoimmune diseases.

[0373] Exemplary autoimmune diseases that may be treated using the compositions and methods of the present disclosure include, among others, type 1 diabetes, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue dermatitis, chronic fatigue immune deficiency syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis ... These include thrombocytopenic purpura (ITP), IgA nephropathy, juvenile arthritis, lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, and Wegener's granulomatosis.

[0374] How to Treat Multiple Sclerosis Multiple sclerosis (MS) is an autoimmune demyelinating disease in which the insulating covering of nerve cells in the brain and spinal cord is damaged. This damage disrupts the ability of parts of the nervous system to communicate, resulting in lasting neurological damage. Patients with MS can exhibit a wide range of symptoms, including, for example, numbness or tingling, weakness, dizziness, tremors, lack of coordination, an unsteady gait, vision problems, pain, and fatigue.

[0375] Using the compositions and methods of the present disclosure, a patient, e.g., a human patient suffering from MS, can be administered a population of pluripotent cells, such as pluripotent hematopoietic cells (e.g., HSCs), comprising a nucleic acid cassette encoding a protein that binds to myelin oligodendrocyte glycoprotein (e.g., a chimeric antigen receptor), operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells. The pluripotent hematopoietic cells can ameliorate one or more symptoms of the disease, slow or halt disease progression, and / or treat one or more underlying physiological causes of the disease.

[0376] How to Treat Type 1 Diabetes Diabetes mellitus (Diabetes mellitus) is a severe autoimmune disease characterized by insulin deficiency, which disrupts normal blood glucose regulation. Insulin is a peptide hormone produced by β cells in the pancreatic islets of Langerhans (β-islet cells). It promotes glucose utilization, protein synthesis, and neutral lipid formation and storage, and is the primary source of energy for the brain and muscle tissue. Type 1 diabetes is caused by an autoimmune response that eliminates or reduces insulin production, ultimately resulting in the destruction of pancreatic β-islet cells, leading to hyperglycemia and ketoacidosis. Symptoms of type 1 diabetes include increased thirst, frequent urination, extreme hunger, weight loss, fatigue, and blurred vision. The chronic hyperglycemia of type 1 diabetes is also associated with significant and often devastating long-term complications in the eyes, kidneys, nerves, and blood vessels.

[0377] Using the compositions and methods of the present disclosure, a patient, e.g., a human patient suffering from type 1 diabetes, can be administered a population of pluripotent cells, such as pluripotent hematopoietic cells (e.g., HSCs), comprising a nucleic acid cassette encoding a protein (e.g., a chimeric antigen receptor) that binds to insulin, GAD-65, IA-2, or ZnT8, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells. The pluripotent hematopoietic cells can ameliorate one or more symptoms of the disease, slow or halt the progression of the disease, and / or treat one or more underlying physiological causes of the disease.

[0378] How to Treat Rheumatoid Arthritis Rheumatoid arthritis is an autoimmune disease in which the synovial membrane lining the joints becomes inflamed. Over time, the inflammation can destroy joint tissue and lead to disability. Examples of symptoms of rheumatoid arthritis include inflammation, fatigue, weakness, and joint pain, swelling, and / or tenderness.

[0379] Using the compositions and methods of the present disclosure, a patient, e.g., a human patient suffering from rheumatoid arthritis, can be administered a population of pluripotent cells, such as pluripotent hematopoietic cells (e.g., HSCs), comprising a nucleic acid cassette encoding collagen II, the Fc portion of an immunoglobulin, a citrullinated peptide, a carbamylated peptide, or a protein (e.g., a chimeric antigen receptor) that binds to HSP65, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells. The pluripotent hematopoietic cells can ameliorate one or more symptoms of the disease, slow or halt disease progression, and / or treat one or more underlying physiological causes of the disease.

[0380] Cells for lineage-specific expression of autoantigen-binding proteins Cells that can be used in combination with the compositions and methods described herein include cells that can undergo further differentiation. For example, one type of cell that can be used in combination with the compositions and methods described herein is a pluripotent cell, which retains the ability to develop into two or more differentiated cell types. Examples of pluripotent cells include pluripotent hematopoietic cells that have the ability to develop into two or more differentiated cell types of the hematopoietic lineage. Pluripotent hematopoietic cells that can be used in combination with the compositions and methods described herein include, for example, HSCs, HPCs, ESCs, iPSCs, lymphoid progenitor cells, and CD34+ cells. HSCs are immature blood cells that have the ability to self-renew and differentiate into mature blood cells comprising diverse lineages, including, but not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, red blood cells), thrombocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), monocytes (e.g., monocytes, macrophages), dendritic cells, microglia, osteoclasts, and lymphocytes (e.g., NK cells, B cells, and T cells).

[0381] One advantage of using pluripotent hematopoietic cells (e.g., HSCs) in combination with the compositions and methods described herein is that these cells have the ability to differentiate into Treg cells. While pluripotent hematopoietic cells can also differentiate into blood cells of lineages different from Treg cells, using the compositions and methods described herein, autoantigen binding proteins can be preferentially expressed in cells that differentiate into Treg cells. The compositions and methods of the present disclosure can achieve excellent specificity of autoantigen binding proteins in Treg cells by controlling the expression of autoantigen binding proteins with lineage-specific regulatory elements that are preferentially active in CD4+CD25+ Treg cells.

[0382] Lineage-specific transcriptional regulatory elements Expression of the Foxp3 transcription factor is a distinctive feature of Treg cells and is responsible for much of the immunosuppressive phenotype displayed by these cells. Regulation of Foxp3 expression by transcriptional regulatory elements (e.g., the Foxp3 promoter, CNS1 enhancer, CNS2 enhancer, CNS3 enhancer, and / or CNS0 enhancer) is important for maintaining homeostasis of Treg cell-mediated immune responses. The compositions and methods of the present disclosure utilize Treg-specific transcriptional regulatory elements, such as the Foxp3 transcriptional regulatory element, to drive expression of nucleic acid cassettes encoding autoantigen-binding proteins, particularly in Treg cells, as described herein.

[0383] Transcriptional regulatory elements that can be used in combination with the compositions and methods described herein can contain various portions operably linked to each other. For example, the transcriptional regulatory elements described herein can contain a Foxp3 promoter, or a functional portion thereof. The Foxp3 promoter turns on transcription of the Foxp3 gene in Treg cells. Transcription factors can bind to the Foxp3 promoter region and transactivate the Foxp3 gene, as described herein. Examples of transcription factors that bind to the Foxp3 promoter region include Foxo transcription factor family members (e.g., Foxo1 and Foxo3) and Nr4a nuclear receptor family members (e.g., Nr4a1 (Nur77), Nr4a2, and Nr4a3), as described in Lee et al., Exp. Mol. Med. 50(3):e456 (2018). An exemplary regulatory element containing the human Foxp3 promoter region is set forth, for example, in SEQ ID NO: 1, which contains nucleic acids −511 to +176 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described in Mantel et al., J. Immunol. 176(6):3593-602 (2006). Another example of a regulatory element containing the human Foxp3 promoter region is set forth in SEQ ID NO: 2, as described in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). An exemplary regulatory element containing the mouse Foxp3 promoter region is set forth in SEQ ID NO: 3, as described in Zheng et al., Nature. 463(7282):808-12 (2010). Aligning SEQ ID NO: 3 to the human genome, a further example of a regulatory element containing the human Foxp3 promoter region is set forth in SEQ ID NO: 4.Additional nucleic acid regulatory elements useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.

[0384] The mechanism underlying the Treg-specific expression of Foxp3 may involve other cis-regulatory elements, such as conserved non-coding sequences (CNS).

[0385] Additionally or alternatively, the transcriptional regulatory elements described herein may contain the CNS1 enhancer, or a functional portion thereof. CNS1 contains a transforming growth factor-β (TGF-β) response element, which contributes to peripheral induction of Treg cells and mucosal immune tolerance. Deletion of CNS1 has been shown to significantly reduce the Treg cell population in gut-associated lymphoid tissue. Transcription factors can bind to the CNS1 enhancer region and transactivate the Foxp3 gene, as described herein. Examples of transcription factors that bind to the CNS1 enhancer region include AP-1, NFAT, Smad3, and Foxo (e.g., Foxo1 and Foxo3) transcription factors, as described in Lee et al., Exp. Mol. Med. 50(3):e456 (2018). An exemplary regulatory element containing the human CNS1 enhancer region contains nucleic acids -500 to +100 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). An exemplary regulatory element containing the mouse CNS1 enhancer region is set forth in SEQ ID NO: 5, as described, for example, in Tone et al., Nat. Immunol. 9(2):194-202 (2008). Aligning SEQ ID NO: 5 to the human genome, an additional example of a regulatory element containing the human CNS1 enhancer region is set forth in SEQ ID NO: 6. Another example of a regulatory element containing the mouse CNS1 enhancer region is set forth in SEQ ID NO: 7, as described in Zheng et al., Nature. 463(7282):808-12 (2010). Alignment of SEQ ID NO:7 to the human genome provides a further example of a regulatory element containing the human CNS1 enhancer region as set forth in SEQ ID NO:8.Additional nucleic acid regulatory elements useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.

[0386] Additionally or alternatively, the transcriptional regulatory elements described herein may contain a CNS2 enhancer, or a functional portion thereof. CNS2 contains a CpG island that is highly demethylated only in functional Treg cells. CNS2 demethylation is considered the most definitive marker of Treg lineage commitment. CNS2 is involved in the stability of Foxp3 expression in response to T cell receptor stimulation and during Treg cell proliferation. Transcription factors can bind to the CNS2 enhancer region and transactivate the Foxp3 gene, as described herein. Examples of transcription factors that bind to the CNS2 enhancer region include Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and c-Rel, as described in Lee et al., Exp. Mol. Med. 50(3):e456 (2018). An exemplary regulatory element containing the human CNS2 enhancer region contains nucleic acids +2,022 to +2,721 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). An exemplary regulatory element containing the mouse CNS2 enhancer region is set forth in SEQ ID NO:9, as described, for example, in Kawakami et al., Immunity. 54(5):947-961 (2021). Aligning SEQ ID NO:9 to the human genome, an additional example of a regulatory element containing the human CNS2 enhancer region is set forth in SEQ ID NO:10. Another example of a regulatory element containing the mouse CNS2 enhancer region is set forth in SEQ ID NO:11, as described in Zheng et al., Nature. 463(7282):808-12 (2010). Alignment of SEQ ID NO:11 to the human genome provides a further example of a regulatory element containing the human CNS2 enhancer region as set forth in SEQ ID NO:12.Additional nucleic acid regulatory elements useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.

[0387] Additionally or alternatively, the transcriptional regulatory elements described herein may contain the CNS3 enhancer region, or a functional portion thereof. CNS3 plays a role in thresholding the TCR stimulation required for Foxp3 expression and is important for the generation of peripheral and thymic Treg cells. Transcription factors can bind to the CNS3 enhancer region and transactivate the Foxp3 gene, as described herein. Examples of transcription factors that bind to the CNS3 enhancer region include Foxo (e.g., Foxo1 and Foxo3) and c-Rel, as described in Lee et al., Exp. Mol. Med. 50(3):e456 (2018). An exemplary regulatory element containing the human CNS3 enhancer region contains nucleic acids +4,301 to +4,500 relative to the Foxp3 transcription start site of the human Foxp3 locus, as described, for example, in Kim et al., J. Exp. Med. 204(7):1543-51 (2007). An exemplary regulatory element containing the mouse CNS3 enhancer region is set forth in SEQ ID NO: 13, as described, for example, in Kawakami et al., Immunity. 54(5):947-961 (2021). An additional example of a regulatory element containing the human CNS3 enhancer region, as aligned with the human genome, is set forth in SEQ ID NO: 14. Another example of a regulatory element containing the mouse CNS3 enhancer region is set forth in SEQ ID NO: 15, as described in Zheng et al., Nature. 463(7282):808-12 (2010). An additional example of a regulatory element containing the human CNS3 enhancer region, as aligned with the human genome, is set forth in SEQ ID NO: 16.Additional nucleic acid regulatory elements useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.

[0388] Additionally or alternatively, the transcriptional regulatory elements described herein may contain a CNS0 enhancer or a functional portion thereof. CNS0 is a Treg cell-specific enhancer. Transcription factors can bind to the CNS0 enhancer region and transactivate the Foxp3 gene. Examples of transcription factors that bind to the CNS0 enhancer region include Satb1 and Stat5, as described in Lee et al., Exp. Mol. Med. 50(3):e456 (2018) and Kawakami et al., Immunity. 54(5):947-961 (2021). Satb1, a chromatin organizer, has been found to bind to CNS0 and function as a pioneer factor to activate Treg cell-specific enhancers of the Foxp3 gene and other Treg cell-associated genes, such as Ctla4 and Il2ra, at an early stage of thymic Treg cell differentiation. Satb1 binds to closed chromatin and alters the epigenetic state of the Foxp3 locus to a balanced state, allowing other transcription factors to bind to the regulatory element. An exemplary regulatory element containing the mouse CNS0 enhancer region is set forth in SEQ ID NO: 17, as described, for example, in Kawakami et al., Immunity. 54(5):947-961 (2021). Aligning SEQ ID NO: 17 to the human genome, an exemplary regulatory element containing the human CNS0 enhancer region is set forth in SEQ ID NO: 18. Another example of a regulatory element containing the mouse CNS0 enhancer region is set forth in SEQ ID NO: 19, as described in Dikiy et al., Immunity. 54(5):931-946 (2021). Aligning SEQ ID NO: 19 to the human genome, a further example of a regulatory element containing the human CNS0 enhancer region is set forth in SEQ ID NO: 20.Additional nucleic acid regulatory elements useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or more sequence identity) to the above-described nucleic acid sequences.

[0389] Additional methods of transcriptional regulation Additional transcriptional regulatory elements can be used in combination with the compositions and methods of the present disclosure to regulate expression of a nucleic acid cassette encoding an autoantigen-binding protein, as described herein. For example, expression of the nucleic acid cassette can be controlled at the transcriptional level by an operably linked regulatory sequence element, such as a DNA-binding domain, that promotes or prevents expression of the nucleic acid cassette upon binding of a chimeric transcription factor containing a DNA-binding domain and a drug-binding domain in the presence of a small molecule activator or drug inducer. An example of a drug-inducible system is described in Tristan-Manzano et al., Front. Immunol. 11:2044 (2020), incorporated herein by reference.

[0390] Engineered riboswitches can also be used in combination with the compositions and methods of the present disclosure to control transcription of the nucleic acid cassettes described herein. These regulatory elements can control mRNA expression by binding metabolites or metal ions as ligands and forming alternative structures in response to ligand binding. Using the compositions and methods of the present disclosure, an exogenous agent, such as a ligand, can induce transcription of a nucleic acid cassette operably linked to a riboswitch. Exemplary riboswitches are described in Strobel et al. ACS Synth. Biol. 9(6):1292-1305 (2020), which is incorporated herein by reference. Examples of inducer ligands include tetracycline, tetracycline derivatives, rapamycin, theophylline, and guanine. Additional examples of inducer ligands are described in Tickner et al. Pharmaceuticals. 14(6):554 (2021), which is incorporated herein by reference.

[0391] Suicide gene safety switches can be used in combination with the compositions and methods of the present disclosure to control the persistence and survival of genetically modified cells, such as pluripotent hematopoietic cells, containing the nucleic acid cassettes described herein. For example, the nucleic acid cassettes can be operably linked to suicide gene safety switches, such as the inducible caspase 9 system (iCasp9) or herpes simplex thymidine kinase (HSV-TK), for selective clearance of transduced genetically modified cells (e.g., pluripotent hematopoietic cells transduced with a lentiviral vector containing the nucleic acid cassette). Induction of iCasp9 depends on the administration of a small molecule, such as the dimeric drug AP1903. Dimerization results in rapid induction of apoptosis in transduced cells, and chimeric proteins composed of a drug-binding domain linked in-frame to a component of the apoptotic pathway can enable conditional dimerization and apoptosis of transduced cells after administration of a non-therapeutic small molecule dimer. Nucleoside analogs, such as ganciclovir, in combination with HSV-TK can also be used to induce apoptosis. An exemplary suicide gene safety switch is described in Jones et al. Front. Pharmacol. 5:254 (2014), the disclosure of which is incorporated by reference.

[0392] Additionally, inhibitory RNA (RNAi) sequences can be used in combination with the disclosed compositions and methods to control transcription of nucleic acid cassettes in Treg cells. For example, RNAi can be used to target microRNAs, such as microRNA-17 (miR-17). miR-17 has been shown to reduce Treg cell suppressive activity by targeting Foxp3 coregulators, such as Eos, as described in Yang et al., Immunity. 45(1):83-93. (2016), incorporated herein by reference. Targeting miR-17 optimizes the suppressive function of genetically modified Treg cells and limits potential pro-inflammatory or pathogenic cellular activity.

[0393] Autoantigen-binding proteins Treg cells derived from pluripotent cells (e.g., pluripotent hematopoietic cells) can express autoantigen-binding proteins that enable the cells to bind to tissue-specific autoantigens and be trafficked to sites of autoimmunity, specifically focusing Treg suppressor function at disease sites, as described herein. Examples of autoantigen-binding proteins useful in combination with the compositions and methods of the present disclosure include single-chain proteins (e.g., chimeric antigen receptors and single-chain antibody fragments) and multi-chain proteins (e.g., T cell receptors, full-length antibodies, dual variable immunoglobulin domains, diabodies, triabodies, antibody-like protein scaffolds, Fab fragments, and F(ab')2 molecules) that specifically bind to antigens endogenously expressed in a subject.

[0394] Autoantigen-binding proteins, as described herein, include myelin oligodendrocyte glycoprotein, aquaporin 4, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, and histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, the Fc portion of immunoglobulins, citrullinated peptides, carbamylated peptides, thyrotropin receptors, and proteins expressed in the thyroid gland. Additional examples of autoantigens are described in Quintana et al., J. Autoimmun. 17(3):191-7 (2001) and Riedhammer et al., Front Immunol. 6:322 (2015), the disclosures of which are incorporated herein by reference in their entireties.

[0395] antibody Antibodies that may be used in conjunction with the compositions and methods of the present disclosure include any protein- or peptide-containing molecule comprising at least a portion of an immunoglobulin molecule, such as, but not limited to, at least one complementarity-determining region (CDR) or ligand-binding portion thereof of a heavy or light chain, a heavy or light chain variable region, a heavy or light chain constant region, or any portion thereof, that is capable of specifically binding to an antigen endogenously expressed in a subject (e.g., a human subject). For example, two or more portions of an immunoglobulin molecule may be covalently linked to one another, for example, via an amide bond, a thioether bond, a carbon-carbon bond, a disulfide bridge, or by a linker, such as those described herein or known in the art.

[0396] Exemplary antibodies that may be used in combination with the compositions and methods of the present disclosure include polyclonal, monoclonal, genetically engineered, and otherwise modified forms of antibodies, such as chimeric, human, humanized, primatized, and heteroconjugate antibodies (e.g., bi-, tri-, and tetra-specific antibodies, diabodies, triabodies, and tetrabodies), as well as antigen-binding fragments of antibodies.

[0397] Chimeric antibodies that can be used in conjunction with the compositions and methods described herein can have variable domain sequences (e.g., CDR sequences) derived from the immunoglobulin of one source organism, such as a rat or mouse, and constant regions derived from the immunoglobulin of a different organism (e.g., a human, another primate, pig, goat, rabbit, hamster, cat, dog, guinea pig, a member of the bovine family (such as cow, bison, buffalo, elk, and yak, among others), cow, sheep, horse, or bison, among others). Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, Science. 229(4719):1202-7 (1985), Oi et al. BioTechniques. 4:214-221 (1986), Gillies et al. J. Immunol. Methods. 125:191-202 (1985), U.S. Patent Nos. 5,807,715, 4,816,567, and 4,816,397.

[0398] Human antibodies that can be used in conjunction with the compositions and methods described herein include antibodies that contain proteins (e.g., CDRs, frameworks, C L , C H Domain (e.g., C H 1. C H 2. C H 3), Hinge, (V L , V H)) are substantially non-immunogenic in humans and have only minor sequence changes or mutations. Human antibodies can be produced in human cells (e.g., by recombinant expression) or in non-human animals or prokaryotic or eukaryotic cells capable of expressing functionally rearranged human immunoglobulin (e.g., heavy and / or light chain) genes. Furthermore, when a human antibody is a single-chain antibody, it may contain a linker peptide not found in native human antibodies. For example, an Fv may contain a linker peptide, such as two to about eight glycine or other amino acid residues, connecting the heavy chain variable region and the light chain variable region. Such a linker peptide is considered to be of human origin. Human antibodies can be produced by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences. See U.S. Patent Nos. 4,444,887 and 4,716,111, and PCT publications WO1998 / 46645, WO1998 / 50433, WO1998 / 24893, WO1998 / 16654, WO1996 / 34096, WO1996 / 33735, and WO1991 / 10741. Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. See, e.g., PCT Publications WO98 / 24893, WO92 / 01047, WO96 / 34096, WO96 / 33735, U.S. Patent Nos. 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, 5,885,793, 5,916,771, and 5,939,598.

[0399] Humanized antibodies that can be used in conjunction with the compositions and methods described herein include forms of non-human (e.g., murine) antibodies that are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other target-binding subdomains of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Generally, humanized antibodies will contain substantially all of at least one, and typically two, variable domains, with all or substantially all of the CDR regions corresponding to those of a non-human immunoglobulin. All or substantially all of the FR regions may be those of a human immunoglobulin sequence. A humanized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc), typically at least a portion of a human immunoglobulin consensus sequence. Methods for antibody humanization are known in the art. See, e.g., Riechmann et al., Nature 332:323-7, 1988; Queen et al., U.S. Patent Nos. 5,530,101, 5,585,089, 5,693,761, 5,693,762, and 6,180,370; EP 239400; PCT Publication WO 91 / 09967; U.S. Patent No. 5,225,539; EP 592106; and EP 519596, which are incorporated herein by reference.

[0400] Exemplary antigen-binding fragments of antibodies that can be used in conjunction with the compositions and methods of the present disclosure include, for example, Fab', F(ab')2, Fab, Fv, rlgG, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. These antibody fragments can be obtained using conventional techniques known to those of skill in the art, and the fragments can be screened for utility in the same manner as intact antibodies. Antigen-binding fragments can be produced by recombinant DNA techniques, enzymatic or chemical cleavage of intact immunoglobulins, or, in some embodiments, chemical peptide synthesis procedures known in the art.

[0401] Single-chain Fv (scFv) molecules that can be used in conjunction with the compositions and methods described herein include antibodies in which the heavy and light chain variable domains from an antibody are joined to form a single chain. scFv fragments contain a single polypeptide chain comprising the variable region of the antibody light chain (VL) (e.g., CDR-L1, CDR-L2, and / or CDR-L3) and the variable region of the antibody heavy chain (VH) (e.g., CDR-H1, CDR-H2, and / or CDR-H3), separated by a linker. The linker connecting the VL and VH regions of the scFv fragment can be a peptide linker composed of proteinogenic amino acids. Alternative linkers may be used to increase the resistance of the scFv fragment to proteolysis (e.g., linkers containing D-amino acids), to improve the solubility of the scFv fragment (e.g., hydrophilic linkers such as polyethylene glycol-containing linkers or polypeptides containing repeating glycine and serine residues), to improve the biophysical stability of the molecule (e.g., linkers containing cysteine ​​residues that form intramolecular or intermolecular disulfide bonds), or to reduce the immunogenicity of the scFv fragment (e.g., linkers containing glycosylation sites). scFv molecules are known in the art and are described, for example, in U.S. Patent No. 5,892,019; Flo et al. (Gene 77:51, 1989); Bird et al. (Science 242:423, 1988); Pantoliano et al. (Biochemistry 30:10117, 1991); Milenic et al. (Cancer Research 51:6363, 1991); and Takkinen et al. (Protein Engineering 4:837, 1991). The VL and VH domains of scFv molecules can be derived from one or more antibody molecules. Those skilled in the art will also understand that the variable regions of the scFv molecules described herein can be modified such that they differ in amino acid sequence from the antibody molecule from which they are derived. For example, in one embodiment, nucleotide or amino acid substitutions resulting in conservative substitutions or changes in amino acid residues can be made (e.g., in CDR and / or framework residues).Alternatively or additionally, mutations are made to CDR amino acid residues to optimize antigen binding using art-recognized techniques. scFv fragments are described, for example, in WO2011 / 084714, which is incorporated herein by reference.

[0402] The tenth fibronectin type III domain ( ) contains the BC, DE, and FG structural loops, which are similar in structure and solvent accessibility to antibody CDRs. 10 Antibody-like protein scaffolds, such as Fn3, may also be used in conjunction with the compositions and methods of the present disclosure.

[0403] Chimeric Antigen Receptor CAR Treg cells can be produced by manipulating precursor cells such as pluripotent cells (e.g., pluripotent hematopoietic cells). As described herein, the manipulated pluripotent hematopoietic cells can differentiate into cells that express a CAR specific to a target antigen, such as an autoantigen, when the differentiated cells are Treg cells. Control of CAR expression by lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells (e.g., Foxp3 promoter) allows Treg-specific expression of the CAR.

[0404] Structurally, a CAR may contain an extracellular antigen-recognition domain, a hinge domain, a transmembrane domain, and an intracellular signaling domain. The antigen-recognition domain may contain an antibody or antibody fragment that recognizes and specifically binds to a given antigen (e.g., an autoantigen), thereby conferring specificity to the target cell. Examples of antigen-recognition domains that can be used in combination with the methods described herein include single-domain antibody fragments (sdAbs), single-chain antibodies (e.g., scFvs), and humanized antibodies. The hinge domain positions the antigen-recognition domain away from the T cell surface to enable proper cell-cell contact, antigen binding, and activation. Exemplary hinge domains for use in combination with the methods described herein include those derived from CD8 (e.g., CD8α), CD28, IgG1 / IgG4 (hinge-Fc portion), CD4, CD7, and IgD. The transmembrane domain fuses the extracellular antigen-recognition domain and the intracellular signaling domain and anchors the CAR to the plasma membrane of the T cell. Exemplary transmembrane domains for use in combination with the methods described herein include those derived from CD3 alpha, CD3 beta, CD3 epsilon, CD3 zeta, CD4, CD5, CD8 (e.g., CD8α), CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154, PD-1, CD4, FcRIγ, CD7, OX40, and MHC (H2-Kb). The intracellular signaling domain generates a signal that promotes the immunosuppressive function of the CAR-containing Treg cell and may contain a primary intracellular signaling domain and, optionally, one or more costimulatory intracellular signaling domains. Exemplary primary intracellular signaling domains include those derived from molecules involved in primary stimulation or antigen-dependent simulation. For example, the primary intracellular signaling domain can be derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (ICOS), CD66d, DAP10, and DAP12.Exemplary costimulatory intracellular signaling domains include those derived from molecules involved in costimulatory signal or antigen-independent stimulation.For example, costimulatory intracellular signaling domains can be derived from CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, CD83, CDS, ICAM-1, LFA-1 (CD11a / CD18), MHC class I molecule, BTLA or Toll ligand receptor.

[0405] Pluripotent hematopoietic cells can be genetically modified to express an antigen receptor on Treg cells that specifically binds to a particular self-antigen by any of a variety of genome editing techniques described herein or known in the art. Exemplary techniques for modifying the genome of pluripotent hematopoietic cells to incorporate a gene encoding a chimeric antigen receptor include CRISPR / Cas, zinc finger nucleases, TALEN, and the ARCUS™ platform.

[0406] Viral transduction methods Poloxamer-based transduction Poloxamers can be used in combination with the compositions and methods of the present disclosure to improve transduction efficiency. Poloxamers that can be used include those with an average molar mass of polyoxypropylene subunits greater than 2,050 g / mol (e.g., about 2,055 g / mol, 2,060 g / mol, 2,075 g / mol, 2,080 g / mol, 2,085 g / mol, 2,090 g / mol, 2,095 g / mol, 2,100 g / mol, 2,200 g / mol, 2,300 g / mol, 2,400 g / mol, 2,500 g / mol, 2,600 g / mol, 2,700 g / mol, 2,800 g / mol, 2,900 g / mol, 3,000 g / mol, 3,100 g / mol, and the like). mol, 3,200 g / mol, 3,300 g / mol, 3,400 g / mol, 3,500 g / mol, 3,600 g / mol, 3,700 g / mol, 3,800 g / mol, 3,900 g / mol, 4,000 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,900 g / mol, or 5,000 g / mol).

[0407] In some embodiments, the poloxamer has an average molar mass of polyoxypropylene subunits greater than 2,250 g / mol (e.g., about 2,300 g / mol, 2,400 g / mol, 2,500 g / mol, 2,600 g / mol, 2,700 g / mol, 2,800 g / mol, 2,900 g / mol, 3,000 g / mol, 3,100 g / mol, 3,200 g / mol, 3,300 g / mol, 3,400 g / mol, 3,500 g / mol). mol, 3,600 g / mol, 3,700 g / mol, 3,800 g / mol, 3,900 g / mol, 4,000 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,900 g / mol, or 5,000 g / mol).

[0408] In some embodiments, the poloxamer has an average molar mass of polyoxypropylene subunits greater than 2,750 g / mol (e.g., about 2,800 g / mol, 2,900 g / mol, 3,000 g / mol, 3,100 g / mol, 3,200 g / mol, 3,300 g / mol, 3,400 g / mol, 3,500 g / mol, 3,600 g / mol, 3,700 g / mol, 3,800 g / mol, 3,900 g / mol, 4,100 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,9 and having an average molar mass of polyoxypropylene subunits of 800 g / mol, 3,900 g / mol, 4,000 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,900 g / mol, or 5,000 g / mol).

[0409] In some embodiments, the poloxamer has an average molar mass of polyoxypropylene subunits greater than 3,250 g / mol (e.g., an average molar mass of polyoxypropylene subunits of about 3,300 g / mol, 3,400 g / mol, 3,500 g / mol, 3,600 g / mol, 3,700 g / mol, 3,800 g / mol, 3,900 g / mol, 4,000 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,900 g / mol, or 5,000 g / mol).

[0410] In some embodiments, the poloxamer has an average molar mass of polyoxypropylene subunits greater than 3,625 g / mol (e.g., an average molar mass of polyoxypropylene subunits of about 3,700 g / mol, 3,800 g / mol, 3,900 g / mol, 4,000 g / mol, 4,100 g / mol, 4,200 g / mol, 4,300 g / mol, 4,400 g / mol, 4,500 g / mol, 4,600 g / mol, 4,700 g / mol, 4,800 g / mol, 4,900 g / mol, or 5,000 g / mol).

[0411] In some embodiments, the poloxamer has a molecular weight of from about 2,050 g / mol to about 4,000 g / mol (e.g., about 2,050 g / mol, 2,055 g / mol, 2,060 g / mol, 2,065 g / mol, 2,070 g / mol, 2,075 g / mol, 2,080 g / mol, 2,085 g / mol, 2,090 g / mol, 2,095 g / mol, 2,100 g / mol, 2,105 g / mol, 2,110 g / mol, 2,115 g / mol, 2,120 g / mol, 2,125 g / mol, 2,130 g / mol, 2,135 g / mol, 2,140 g / mol, 2,145 g / mol, 2,150 g / mol, 2,155 g / mol, 2,160 g / mol, 2,165 g / mol, 2,170 g / mol, 2,175 g / mol, 2,180 g / mol, 2,185 g / mol, 2,190 g / mol, 2,195 g / mol, 2,200 g / mol, 2,205 g / mol, 2,210 g / mol, 2,215 g / mol, 2,220 g / mol, 2,225 g / mol, 2,230 g / mol, 2,235 g / mol, 2,240 g / mol, 2,245 g / mol, 2,250 g / mol, 2,255 g / mol, 2,260 g / mol, 2,265 g / mol, 2,270 g / mol, 2,275 g / mol, 2,280 g / mol, 2,285 g / mol, 2,290 g / mol, 2,295 g / mol, 2,300 g / mol, 2,305 g / mol, 2,310 g / mol, 2,315 g / mol, 2,320 g / mol, 2,325 g / mol, 2,330 g / mol, 2,335 g / mol, 2,340 g / mol, 2,345 g / mol, 2,350 g / mol, 2,355 g / mol, 2,360 g / mol, 2,365 g / mol, 2,370 g / mol, 2,375 g / mol, 2,380 g / mol, 2,385 g / mol, 2,390 g / mol, 2,395 g / mol, 2,400 g / mol, 2,480g / mol、2,485g / mol、2,490g / mol、2,495g / mol、2,500g / mol、2,505g / mol、2,510g / mol、2,515g / mol、2,520g / mol、2,525g / mol、2,530g / mol、2,535g / mol、2,540g / mol、2,545g / mol、2,550g / mol、2,555g / mol、2,560g / mol、2,565g / mol、2,570g / mol、2,575g / mol、2,580g / mol、2,585g / mol、2,590g / mol、2,595g / mol、2,600g / mol、2,605g / mol、2,610g / mol、2,615g / mol、2,620g / mol、2,625g / mol、2,630g / mol、2,635g / mol、2,640g / mol、2,645g / mol、2,650g / mol、2,655g / mol、2,660g / mol、2,665g / mol、2,670g / mol、2,675g / mol、2,680g / mol、2,685g / mol、2,690g / mol、2,695g / mol、2,700g / mol、2,705g / mol、2,710g / mol、2,715g / mol、2,720g / mol、2,725g / mol、2,730g / mol、2,735g / mol、2,740g / mol、2,745g / mol、2,750g / mol、2,755g / mol、2,760g / mol、2,765g / mol、2,770g / mol、2,775g / mol、2,780g / mol、2,785g / mol、2,790g / mol、2,795g / mol、2,800g / mol、2,805g / mol、2,810g / mol、2,815g / mol、2,820g / mol、2,825g / mol、2,830g / mol、2,835g / mol、2,840g / mol、2,845g / mol、2,850g / mol、2,855g / mol、2,860g / mol、2,865g / mol、2,870g / mol、2,875g / mol、2,880g / mol、2,885g / mol、2,890g / mol、2,895g / mol、2,900g / mol、2,905g / mol、2,910g / mol、2,915g / mol、2,920g / mol、2,925g / mol、2,930g / mol、2,935g / mol、2,940g / mol、2,945g / mol、2,950g / mol、2,955g / mol、2,960g / mol、2,965g / mol、2,970g / mol、2,975g / mol、2,980g / mol、2,985g / mol、2,990g / mol、2,995g / mol、3,000g / mol、3,005g / mol、3,010g / mol、3,015g / mol、3,020g / mol、3,025g / mol、3,030g / mol、3,035g / mol、3,040g / mol、3,045g / mol、3,050g / mol、3,055g / mol、3,060g / mol、3,065g / mol、3,070g / mol、3,075g / mol、3,080g / mol、3,085g / mol、3,090g / mol、3,095g / mol、3,100g / mol、3,105g / mol、3,110g / mol、3,115g / mol、3,120g / mol、3,125g / mol、3,130g / mol、3,135g / mol、3,140g / mol、3,145g / mol、3,150g / mol、3,155g / mol、3,160g / mol、3,165g / mol、3,170g / mol、3,175g / mol、3,180g / mol、3,185g / mol、3,190g / mol、3,195g / mol、3,200g / mol、3,205g / mol、3,210g / mol、3,215g / mol、3,220g / mol、3,225g / mol、3,230g / mol、3,235g / mol、3,240g / mol、3,245g / mol、3,250g / mol、3,255g / mol、3,260g / mol、3,265g / mol、3,270g / mol、3,275g / mol、3,280g / mol、3,285g / mol、3,290g / mol、3,295g / mol、3,300g / mol、3,305g / mol、3,310g / mol、3,315g / mol、3,320g / mol、3,325g / mol、3,330g / mol、3,335g / mol、3,340g / mol、3,345g / mol、3,350g / mol、3,355g / mol、3,360g / mol、3,365g / mol、3,370g / mol、3,375g / mol、3,380g / mol、3,385g / mol、3,390g / mol、3,395g / mol、3,400g / mol、3,405g / mol、3,410g / mol、3,415g / mol、3,420g / mol、3,425g / mol、3,430g / mol、3,435g / mol、3,440g / mol、3,445g / mol、3,450g / mol、3,455g / mol、3,460g / mol、3,465g / mol、3,470g / mol、3,475g / mol、3,480g / mol、3,485g / mol、3,490g / mol、3,495g / mol、3,500g / mol、3,505g / mol、3,510g / mol、3,515g / mol、3,520g / mol、3,525g / mol、3,530g / mol、3,535g / mol、3,540g / mol、3,545g / mol、3,550g / mol、3,555g / mol、3,560g / mol、3,565g / mol、3,570g / mol、3,575g / mol、3,580g / mol、3,585g / mol、3,590g / mol、3,595g / mol、3,600g / mol、3,605g / mol、3,610g / mol、3,615g / mol、3,620g / mol、3,625g / mol、3,630g / mol、3,635g / mol、3,640g / mol、3,645g / mol、3,650g / mol、3,655g / mol、3,660g / mol、3,665g / mol、3,670g / mol、3,675g / mol、3,680g / mol、3,685g / mol、3,690g / mol、3,695g / mol、3,700g / mol、3,705g / mol、3,710g / mol、3,715g / mol、3,720g / mol、3,725g / mol、3,730g / mol、3,735g / mol、3,740g / mol、3,745g / mol、3,750g / mol、3,755g / mol、3,760g / mol、3,765g / mol、3,770g / mol、3,775g / mol、3,780g / mol、3,785g / mol、3,790g / mol、3,795g / mol、3,800g / mol、3,805g / mol、3,810g / mol、3,815g / mol、3,820g / mol、3,825g / mol、3,830g / mol、3,835g / mol、3,840g / mol、3,845g / mol, 3,850g / mol, 3,855g / mol, 3,860g / mol, 3,865g / mol, 3,870g / mol, 3,875g / mol, 3,880g / mol, 3,885g / mol l, 3,890g / mol, 3,895g / mol, 3,900g / mol, 3,905g / mol, 3,910g / mol, 3,915g / mol, 3,920g / mol, 3,925g / mol, 3,930g / mol, 3,935 g / mol, 3,940 g / mol, 3,945 g / mol, 3,950 g / mol, 3,955 g / mol, 3,960 g / mol, 3,965 g / mol, 3,970 g / mol, 3,975 g / mol, 3,980 g / mol, 3,985 g / mol, 3,990 g / mol, 3,995 g / mol, or 4,000 g / mol).

[0412] In some embodiments, the poloxamer has a molecular weight of from about 2,750 g / mol to about 4,000 g / mol (e.g., about 2,750 g / mol, 2,755 g / mol, 2,760 g / mol, 2,765 g / mol, 2,770 g / mol, 2,775 g / mol, 2,780 g / mol, 2,785 g / mol, 2,790 g / mol, 2,795 g / mol, 2,800 g / mol, 2,805 g / mol, 2,810 g / mol, 2,815 g / mol, 2,820 g / mol, 2,825 g / mol, 2,830 g / mol, 2,835 g / mol, 2,840 g / mol, 2,845 g / mol, 2,850 g / mol, 2,855 g / mol, 2,860 g / mol, 2,865 g / mol, 2,870 g / mol, 2,875 g / mol, 2,880 g / mol, 2,885 g / mol, 2,890 g / mol, 2,895 g / mol, 2,900 g / mol, 2,905 g / mol, 2,910 g / mol, 2,915 g / mol, 2,920 g / mol, 2,925 g / mol, 2,930 g / mol, 2,935 g / mol, 2,940 g / mol, 2,945 g / mol, 2,950 g / mol, 2,955 g / mol, 2,960 g / mol, 2,965 g / mol, 2,970 g / mol, 2,975 g / mol, 2,980 g / mol, 2,985 g / mol, 2,990 g / mol, 2,995 g / mol, 3,000 g / mol, 3,005 g / mol, 3,010 g / mol, 3,015 g / mol, 3,020 g / mol, 3,025 g / mol, 3,030 g / mol, 3,035 g / mol, 3,040 g / mol, 3,045 g / mol, 3,050 g / mol, 3,055 g / mol, 3,060 g / mol, 3,065 g / mol, 3,070 g / mol, 3,075 g / mol, 3,080 g / mol, 3,085 g / mol, 3,090 g / mol, 3,095 g / mol, 3,100 g / mol, 3,105 g / mol, 3,110 g / mol, 3,115 g / mol, 3,120 g / mol, 3,125 g / mol, 3,130 g / mol, 3,135 g / mol, 3,140 g / mol, 3,145 g / mol, 3,150 g / mol, 3,155 g / mol, 3,160 g / mol, 3,165 g / mol, 3,170 g / mol, 3,175 g / mol, 3,180g / mol、3,185g / mol、3,190g / mol、3,195g / mol、3,200g / mol、3,205g / mol、3,210g / mol、3,215g / mol、3,220g / mol、3,225g / mol、3,230g / mol、3,235g / mol、3,240g / mol、3,245g / mol、3,250g / mol、3,255g / mol、3,260g / mol、3,265g / mol、3,270g / mol、3,275g / mol、3,280g / mol、3,285g / mol、3,290g / mol、3,295g / mol、3,300g / mol、3,305g / mol、3,310g / mol、3,315g / mol、3,320g / mol、3,325g / mol、3,330g / mol、3,335g / mol、3,340g / mol、3,345g / mol、3,350g / mol、3,355g / mol、3,360g / mol、3,365g / mol、3,370g / mol、3,375g / mol、3,380g / mol、3,385g / mol、3,390g / mol、3,395g / mol、3,400g / mol、3,405g / mol、3,410g / mol、3,415g / mol、3,420g / mol、3,425g / mol、3,430g / mol、3,435g / mol、3,440g / mol、3,445g / mol、3,450g / mol、3,455g / mol、3,460g / mol、3,465g / mol、3,470g / mol、3,475g / mol、3,480g / mol、3,485g / mol、3,490g / mol、3,495g / mol、3,500g / mol、3,505g / mol、3,510g / mol、3,515g / mol、3,520g / mol、3,525g / mol、3,530g / mol、3,535g / mol、3,540g / mol、3,545g / mol、3,550g / mol、3,555g / mol、3,560g / mol、3,565g / mol、3,570g / mol、3,575g / mol、3,580g / mol、3,585g / mol、3,590g / mol、3,595g / mol、3,600g / mol、3,605g / mol、3,610g / mol、3,615g / mol、3,620g / mol、3,625g / mol、3,630g / mol、3,635g / mol, 3,640g / mol, 3,645g / mol, 3,650g / mol, 3,655g / mol, 3,660g / mol, 3,665g / mol, 3,670g / mol, 3,675g / mol, 3,680g / m ol, 3,685g / mol, 3,690g / mol, 3,695g / mol, 3,700g / mol, 3,705g / mol, 3,710g / mol, 3,715g / mol, 3,720g / mol, 3,725g / mol, 3,73 0g / mol, 3,735g / mol, 3,740g / mol, 3,745g / mol, 3,750g / mol, 3,755g / mol, 3,760g / mol, 3,765g / mol, 3,770g / mol, 3,775g / mol , 3,780g / mol, 3,785g / mol, 3,790g / mol, 3,795g / mol, 3,800g / mol, 3,805g / mol, 3,810g / mol, 3,815g / mol, 3,820g / mol, 3,825g / mol, 3,830g / mol, 3,835g / mol, 3,840g / mol, 3,845g / mol, 3,850g / mol, 3,855g / mol, 3,860g / mol, 3,865g / mol, 3,870g / mol, 3 ,875g / mol, 3,880g / mol, 3,885g / mol, 3,890g / mol, 3,895g / mol, 3,900g / mol, 3,905g / mol, 3,910g / mol, 3,915g / mol, 3,920g / m ol, 3,925 g / mol, 3,930 g / mol, 3,935 g / mol, 3,940 g / mol, 3,945 g / mol, 3,950 g / mol, 3,955 g / mol, 3,960 g / mol, 3,965 g / mol, 3,970 g / mol, 3,975 g / mol, 3,980 g / mol, 3,985 g / mol, 3,990 g / mol, 3,995 g / mol, or 4,000 g / mol).

[0413] In some embodiments, the poloxamer has a molecular weight of about 3,250 g / mol to about 4,000 g / mol (e.g., about 3,250 g / mol, 3,255 g / mol, 3,260 g / mol, 3,265 g / mol, 3,270 g / mol, 3,275 g / mol, 3,280 g / mol, 3,285 g / mol, 3,290 g / mol, 3,295 g / mol, 3,300 g / mol, 3,305 g / mol, 3,310 g / mol, 3,315 g / mol, 3,320 g / mol, 3,325 g / mol, 3,330 g / mol, 3,335 g / mol, 3,340 g / mol, 3,345 g / mol, 3,350 g / mol, 3,355 g / mol, 3,360 g / mol, 3,365 g / mol, 3,370 g / mol, 3,375 g / mol, 3,380 g / mol, 3,385 g / mol, 3,390 g / mol, 3,395 g / mol, 3,400 g / mol, 3,405 g / mol, 3,410 g / mol, 3,415 g / mol, 3,420 g / mol, 3,425 g / mol, 3,430 g / mol, 3,435 g / mol, 3,440 g / mol, 3,445 g / mol, 3,450 g / mol, 3,455 g / mol, 3,460 g / mol, 3,465 g / mol, 3,470 g / mol, 3,475 g / mol, 3,480 g / mol, 3,485 g / mol, 3,490 g / mol, 3,495 g / mol, 3,500 g / mol, 3,505 g / mol, 3,510 g / mol, 3,515 g / mol, 3,520 g / mol, 3,525 g / mol, 3,530 g / mol, 3,535 g / mol, 3,540 g / mol, 3,545 g / mol, 3,550 g / mol, 3,555 g / mol, 3,560 g / mol, 3,565 g / mol, 3,570 g / mol, 3,575 g / mol, 3,580 g / mol, 3,585 g / mol, 3,590 g / mol, 3,595 g / mol, 3,600 g / mol, 3,605 g / mol, 3,610 g / mol, 3,615 g / mol, 3,620 g / mol, 3,625 g / mol, 3,630 g / mol, 3,635 g / mol, 3,640 g / mol, 3,645 g / mol, 3,650 g / mol, 3,655 g / mol, 3,660 g / mol, 3,665 g / mol, 3,670 g / mol, 3,675 g / mol, 3,680g / mol, 3,685g / mol, 3,690g / mol, 3,695g / mol, 3,700g / mol, 3,705g / mol, 3,710g / mol, 3,715g / mol, 3,720g / mol, 3,725g / mol, 3,730g / mol, 3,735g / mol, 3,740g / mol, 3,745g / mol, 3,750g / mol, 3,755g / mol, 3,760g / mol, 3 ,765g / mol, 3,770g / mol, 3,775g / mol, 3,780g / mol, 3,785g / mol, 3,790g / mol, 3,795g / mol, 3,800g / mol, 3,805g / mol, 3,810g / mol, 3,815g / mol, 3,820g / mol, 3,825g / mol, 3,830g / mol, 3,835g / mol, 3,840g / mol, 3,845g / mol, 3,850g / mol, 3,855g / mol, 3,860g / mol, 3,865g / mol, 3,870g / mol, 3,875g / mol, 3,880g / mol, 3,885g / mol, 3,890 g / mol, 3,895g / mol, 3,900g / mol, 3,905g / mol, 3,910g / mol, 3,915g / mol, 3,920g / mol, 3,925g / mol, 3,930g / mol , 3,935 g / mol, 3,940 g / mol, 3,945 g / mol, 3,950 g / mol, 3,955 g / mol, 3,960 g / mol, 3,965 g / mol, 3,970 g / mol, 3,975 g / mol, 3,980 g / mol, 3,985 g / mol, 3,990 g / mol, 3,995 g / mol, or 4,000 g / mol).

[0414] In some embodiments, the poloxamer has a molecular weight of about 3,625 g / mol to about 4,000 g / mol (e.g., about 3,625 g / mol, 3,630 g / mol, 3,635 g / mol, 3,640 g / mol, 3,645 g / mol, 3,650 g / mol, 3,655 g / mol, 3,660 g / mol, 3,665 g / mol, 3,670 g / mol, 3,675 g / mol, 3,680 g / mol, 3,685 g / mol, 3,690 g / mol, 3,695 g / mol, 3,70 ... 5g / mol, 3,710g / mol, 3,715g / mol, 3,720g / mol, 3,725g / mol, 3,730g / mol, 3,735g / mol, 3,740g / mol, 3,745g / mol, 3,750g / mol, 3,755g / m ol, 3,760g / mol, 3,765g / mol, 3,770g / mol, 3,775g / mol, 3,780g / mol, 3,785g / mol, 3,790g / mol, 3,795g / mol, 3,800g / mol, 3,805g / mol, 3, 810g / mol, 3,815g / mol, 3,820g / mol, 3,825g / mol, 3,830g / mol, 3,835g / mol, 3,840g / mol, 3,845g / mol, 3,850g / mol, 3,855g / mol, 3,860g / mol, 3,865g / mol, 3,870g / mol, 3,875g / mol, 3,880g / mol, 3,885g / mol, 3,890g / mol, 3,895g / mol, 3,900g / mol, 3,905g / mol, 3,910g / mol, and having an average molar mass of the polyoxypropylene subunits of 3,915 g / mol, 3,920 g / mol, 3,925 g / mol, 3,930 g / mol, 3,935 g / mol, 3,940 g / mol, 3,945 g / mol, 3,950 g / mol, 3,955 g / mol, 3,960 g / mol, 3,965 g / mol, 3,970 g / mol, 3,975 g / mol, 3,980 g / mol, 3,985 g / mol, 3,990 g / mol, 3,995 g / mol, or 4,000 g / mol).

[0415] In some embodiments, the poloxamer is greater than 40% by weight (e.g., about 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149 , 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or more).

[0416] In some embodiments, the poloxamer has an average ethylene oxide content of greater than 50% by weight (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or more).

[0417] In some embodiments, the poloxamer has an average ethylene oxide content of greater than 60% by weight (e.g., about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or more).

[0418] In some embodiments, the poloxamer has an average ethylene oxide content of greater than 70% by weight (e.g., about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or more).

[0419] In some embodiments, the poloxamer has an average ethylene oxide content of about 40% to about 90% (e.g., about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%).

[0420] In some embodiments, the poloxamer has an average ethylene oxide content of about 50% to about 85% (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, or 85%).

[0421] In some embodiments, the poloxamer has an average ethylene oxide content of about 60% to about 80% (e.g., about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%).

[0422] In some embodiments, the poloxamer has a molecular weight of more than 10,000 g / mol (e.g., about 10,100 g / mol, 10,200 g / mol, 10,300 g / mol, 10,400 g / mol, 10,500 g / mol, 10,600 g / mol, 10,700 g / mol, 10,800 g / mol, 10,900 g / mol, 11,000 g / mol, 11,10 0g / mol, 11,200g / mol, 11,300g / mol, 11,400g / mol, 11,500g / mol, 11,600g / mol, 11,700g / mol, 11 ,800g / mol, 11,900g / mol, 12,000g / mol, 12,100g / mol, 12,200g / mol, 12,300g / mol, 12,400g / mol, 12,500g / mol, 12,600g / mol, 12,700g / mol, 12,800g / mol, 12,900g / mol, 13,000g / mol, 13,100g / m ol, 13,200g / mol, 13,300g / mol, 13,400g / mol, 13,500g / mol, 13,600g / mol, 13,700g / mol, 13,800g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0423] In some embodiments, the poloxamer has a molecular weight of more than 11,000 g / mol (e.g., about 11,100 g / mol, 11,200 g / mol, 11,300 g / mol, 11,400 g / mol, 11,500 g / mol, 11,600 g / mol, 11,700 g / mol, 11,800 g / mol, 11,900 g / mol, 12,000 g / mol, 12,100 g / mol, 12,200 g / mol, 12,300 g / mol, 12,400 g / mol, 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, and having an average molar mass of 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0424] In some embodiments, the poloxamer has a molecular weight of more than 12,000 g / mol (e.g., about 12,100 g / mol, 12,200 g / mol, 12,300 g / mol, 12,400 g / mol, 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, and having an average molar mass of 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0425] In some embodiments, the poloxamer is greater than 12,500 g / mol (e.g., about 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, and having an average molar mass of 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0426] In some embodiments, the poloxamer has a viscosity of about 10,000 g / mol to about 15,000 g / mol (e.g., about 10,000 g / mol, 10,100 g / mol, 10,200 g / mol, 10,300 g / mol, 10,400 g / mol, 10,500 g / mol, 10,600 g / mol, 10,700 g / mol, 10,800 g / mol, 10,900 g / mol). l, 11,000g / mol, 11,100g / mol, 11,200g / mol, 11,300g / mol, 11,400g / mol, 11,500g / mol, 11,600g / mol , 11,700g / mol, 11,800g / mol, 11,900g / mol, 12,000g / mol, 12,100g / mol, 12,200g / mol, 12,300g / mol, 12,400g / mol, 12,500g / mol, 12,600g / mol, 12,700g / mol, 12,800g / mol, 12,900g / mol, 13,000g / mol, 13,100g / mol, 13,200g / mol, 13,300g / mol, 13,400g / mol, 13,500g / mol, 13,600g / mol, 13,700g / mol, 1 and having an average molar mass of 3,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0427] In some embodiments, the poloxamer has a molecular weight of about 11,000 g / mol to about 15,000 g / mol (e.g., about 11,000 g / mol, 11,100 g / mol, 11,200 g / mol, 11,300 g / mol, 11,400 g / mol, 11,500 g / mol, 11,600 g / mol, 11,700 g / mol, 11,800 g / mol, 11,900 g / mol, 12,000 g / mol, 12,100 g / mol, 12,200 g / mol, 12,300 g / mol, 12,400 g / mol, 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, and having an average molar mass of 12,900 g / mol, 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0428] In some embodiments, the poloxamer has a poloxamer strength of about 11,500 g / mol to about 15,000 g / mol (e.g., about 11,500 g / mol, 11,600 g / mol, 11,700 g / mol, 11,800 g / mol, 11,900 g / mol, 12,000 g / mol, 12,100 g / mol, 12,200 g / mol, 12,300 g / mol, 12,400 g / mol, 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, 13,000 g / mol, 13,100 g / mol). and having an average molar mass of 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0429] In some embodiments, the poloxamer has a molecular weight of about 12,000 g / mol to about 15,000 g / mol (e.g., about 12,000 g / mol, 12,100 g / mol, 12,200 g / mol, 12,300 g / mol, 12,400 g / mol, 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, and having an average molar mass of 13,400 g / mol, 13,500 g / mol, 13,600 g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0430] In some embodiments, the poloxamer has a viscosity of about 12,500 g / mol to about 15,000 g / mol (e.g., about 12,500 g / mol, 12,600 g / mol, 12,700 g / mol, 12,800 g / mol, 12,900 g / mol, 13,000 g / mol, 13,100 g / mol, 13,200 g / mol, 13,300 g / mol, 13,400 g / mol, 13,500 g / mol, 13,600 g / mol). g / mol, 13,700 g / mol, 13,800 g / mol, 13,900 g / mol, 14,000 g / mol, 14,100 g / mol, 14,200 g / mol, 14,300 g / mol, 14,400 g / mol, 14,500 g / mol, 14,600 g / mol, 14,700 g / mol, 14,800 g / mol, 14,900 g / mol, or 15,000 g / mol).

[0431] Poloxamers P288, P335, P338, and P407 Poloxamers that may be used in conjunction with the compositions and methods of the present disclosure include those having the appropriate chemical formula HO(CHO) x (C3H6O) y (C2H4O) z H, where the sum of x and y is about 236.36, and z is about 44.83. The average molecular weight of P288 is about 13,000 g / mol.

[0432] In some embodiments, the poloxamer has the formula HO(CHO) x (C3H6O) y (C2H4O) z H, wherein the sum of x and y is about 220 to about 250, and z is about 40 to about 50. In some embodiments, the poloxamer has an average molecular weight of about 12,000 g / mol to about 14,000 g / mol.

[0433] Poloxamers that may be used in conjunction with the compositions and methods of the present disclosure include those having the appropriate chemical formula HO(CHO) x (C3H6O) y (C2H4O) z Further included is "Poloxamer 335" (also referred to in the art as "P335" and poloxamer "P105"), having the formula: H, where the sum of x and y is about 73.86 and z is about 56.03. The average molecular weight of P335 is about 6,500 g / mol.

[0434] In some embodiments, the poloxamer has the formula HO(CHO) x (C3H6O) y (C2H4O) z H, wherein the sum of x and y is about 60 to about 80, and z is about 50 to about 60. In some embodiments, the average molecular weight of the poloxamer is about 6,000 g / mol to about 7,000 g / mol.

[0435] Poloxamers that may be used in conjunction with the compositions and methods of the present disclosure include those having the appropriate chemical formula HO(CHO) x (C3H6O) y (C2H4O) z Further included is "Poloxamer 338" (also referred to in the art as "P338" and poloxamer "F108"), having the formula: H, where the sum of x and y is about 265.45 and z is about 50.34. The average molecular weight of P335 is about 14,600 g / mol.

[0436] In some embodiments, the poloxamer has the formula HO(CHO) x (C3H6O) y (C2H4O) z H, wherein the sum of x and y is about 260 to about 270, and z is about 45 to about 55. In some embodiments, the poloxamer has an average molecular weight of about 14,000 g / mol to about 15,000 g / mol.

[0437] Poloxamers that may be used in conjunction with the compositions and methods of the present disclosure include those having the appropriate chemical formula HO(CHO) x (C3H6O) y (C2H4O) z Further included is "Poloxamer 407" (also referred to in the art as "P407" and poloxamer "F127"), having the formula: H, where the sum of x and y is about 200.45 and z is about 65.17. The average molecular weight of P335 is about 12,600 g / mol.

[0438] In some embodiments, the poloxamer has the formula HO(CHO) x (C3H6O) y (C2H4O) z H, wherein the sum of x and y is about 190 to about 210, and z is about 60 to about 70. In some embodiments, the average molecular weight of the poloxamer is about 12,000 g / mol to about 13,000 g / mol.

[0439] For clarity, the terms "average molar mass" and "average molecular weight" are used interchangeably herein and refer to the same quantity. The average molar mass, ethylene oxide content, and propylene oxide content of the poloxamers described herein can be determined using the methods disclosed in Alexandridis and Hatton, Colloids and Surfaces A: Physicochemical and Engineering Aspects 96:1-46 (1995), the disclosure of which is incorporated herein by reference in its entirety.

[0440] Transduction using protein kinase C modulators Various agents can be used to reduce PKC activity and / or expression. Without being limited by mechanism, such agents can enhance viral transduction by stimulating Akt signaling and / or maintaining cofilin in a dephosphorylated state, thereby promoting actin depolymerization. This actin depolymerization event may serve to remove a physical barrier that inhibits viral vector entry into the nucleus of target cells.

[0441] Staurosporine and its variants In some embodiments, the substance that reduces the activity and / or expression of PKC is a PKC inhibitor. The PKC inhibitor may be staurosporine or a variant thereof. For example, the PKC inhibitor may be a compound represented by formula (I): [ka] wherein R1 is H, OH, optionally substituted alkoxy, optionally substituted acyloxy, optionally substituted amino, optionally substituted alkylamino, optionally substituted amido, halogen, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 alkynyl, optionally substituted acyl, optionally substituted alkoxycarbonyl, oxo, thiocarbonyl, optionally substituted carboxy, or ureido; R2 is H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 alkynyl, or optionally substituted acyl; R a and R b each independently represents H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl or optionally substituted C 2-6alkynyl, optionally substituted and optionally fused aryl, optionally substituted and optionally fused heteroaryl, optionally substituted and optionally fused cycloalkyl, or optionally substituted and optionally fused heterocycloalkyl, or R a and R b are joined together with the atoms to which they are attached to form an optionally substituted and optionally fused heterocycloalkyl ring; R c , O, NR d , or S, R d is H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 alkenyl, or optionally substituted C 2-6 is alkynyl, Each X is independently halogen, optionally substituted haloalkyl, cyano, optionally substituted amino, hydroxyl, thiol, optionally substituted alkoxy, optionally substituted alkylthio, optionally substituted acyloxy, optionally substituted alkoxycarbonyl, optionally substituted carboxy, ureido, optionally substituted alkylsulfonyl, optionally substituted arylsulfonyl, optionally substituted heteroarylsulfonyl, optionally substituted cycloalkylsulfonyl, optionally substituted heterocycloalkylsulfonyl, optionally substituted alkylsulfanyl, optionally substituted arylsulfanyl, optionally substituted heteroarylsulfonyl, optionally substituted cycloalkylsulfanyl, optionally substituted heterocycloalkylsulfanyl, optionally substituted alkylsulfinyl, optionally substituted arylsulfinyl, optionally substituted heteroarylsulfinyl, optionally substituted cycloalkylsulfinyl, optionally substituted heterocycloalkylsulfinyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted optionally fused aryl, optionally substituted optionally fused heteroaryl, optionally substituted optionally fused cycloalkyl, or optionally substituted optionally fused heterocycloalkyl; Each Y is independently halogen, optionally substituted haloalkyl, cyano, optionally substituted amino, hydroxyl, thiol, optionally substituted alkoxy, optionally substituted alkylthio, optionally substituted acyloxy, optionally substituted alkoxycarbonyl, optionally substituted carboxy, ureido, optionally substituted alkylsulfonyl, optionally substituted arylsulfonyl, optionally substituted heteroarylsulfonyl, optionally substituted cycloalkylsulfonyl, optionally substituted heterocycloalkylsulfonyl, optionally substituted alkylsulfanyl, optionally substituted arylsulfanyl, optionally substituted heteroarylsulfonyl, optionally substituted cycloalkylsulfanyl, optionally substituted heterocycloalkylsulfanyl, optionally substituted alkylsulfinyl, optionally substituted arylsulfinyl, optionally substituted heteroarylsulfinyl, optionally substituted cycloalkylsulfinyl, optionally substituted heterocycloalkylsulfinyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted optionally fused aryl, optionally substituted optionally fused heteroaryl, optionally substituted optionally fused cycloalkyl, or optionally substituted optionally fused heterocycloalkyl; [ka] represents an optionally present bond, n is an integer from 0 to 4, m is an integer from 0 to 4. or a salt thereof.

[0442] Interfering RNA The exemplary PKC regulator that can be used in combination with the compositions and methods of the present disclosure includes interfering RNA molecules, such as short interfering RNA (siRNA), short hairpin RNA (shRNA) and / or microRNA (miRNA), that reduce PKC gene expression.The method for producing interfering RNA molecules is known in the art, and is described in detail in, for example, WO2004 / 044136 and US Patent No. 9,150,605, the disclosures of each of which are incorporated herein by reference in their entirety.

[0443] Transduction using HDAC inhibitors Various drugs can be used to inhibit histone deacetylase to increase expression of the nucleic acid cassette during viral transduction. Without wishing to be bound by theory, reduced nucleic acid cassette expression from viral vectors may be caused by epigenetic silencing of the vector genome via histone deacetylation. Hydroxamic acids represent a particularly robust class of HDAC inhibitors that inhibit these enzymes through a hydroxamate functionality that binds to cationic zinc within the active site of these enzymes. Exemplary inhibitors include trichostatin A and vorinostat (N-hydroxy-N'-phenyl-octanediamide, described in Marks et al., Nature Biotechnology 25, 84-90 (2007) and Stenger, Community Oncology 4, 384-386 (2007) (the disclosures of which are incorporated herein by reference). Other HDAC inhibitors include panobinostat, which is described in Drugs of the Future 32(4):315-322 (2007), the disclosure of which is incorporated herein by reference.

[0444] Additional examples of hydroxamic acid inhibitors of histone deacetylase include the compounds shown below, which are described in Bertrand, European Journal of Medicinal Chemistry 45:2095-2116 (2010), the disclosure of which is incorporated herein by reference.

[0445] Other HDAC inhibitors that do not contain hydroxamate substituents have also been developed, including valproic acid (Gottlicher, et al., EMBOJ. 20(24):6969-6978 (2001) and mocetinostat (N-(2-aminophenyl)-4-[[(4-pyridin-3-ylpyrimidin-2-yl)amino]methyl]benzamide), described in Balasubramanian et al., Cancer Letters 280:211-221 (2009), the disclosures of each of which are incorporated herein by reference. Other small molecule inhibitors that utilize chemical functionality different from hydroxamate include those described in Bertrand, European Journal of Medicinal Chemistry 45:2095-2116 (2010), the disclosures of which are incorporated herein by reference.

[0446] Additional examples of chemical modulators of histone acetylation useful with the compositions and methods of the present invention include modulators of HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, Sirt1, Sirt2, and / or HATs, such as butyrylhydroxamic acid, M344, LAQ824 (dacinostat), AR-42, belinostat (PXD101), CUDC-101, scriptaid, sodium phenylbutyrate, tasquinimod, xinostat (JNJ-26481585), pracinostat (SB939), CUDC-907, entinostat (MS-275), mocetinostat (MGCD0103), tubastatin A HCl, PCI-34051, droxinostat, PCI-24781 (abexinostat), RGFP966, rosirinostat (ACY-1215), CI994 (tacedinaline), Tubacin, RG2833 (RGFP109), resminostat, tubastatin A, BRD73954, BG45, 4SC-202, CAY10603, LMK-235, nextulastat A, TMP269, HPOB, cambinol, and anacardic acid.

[0447] In some particular embodiments, the HDAC inhibitor is scriptaid.

[0448] Transduction using cyclosporine In some embodiments, therapeutic cells of the present disclosure are produced by transducing cells in the presence of a cyclosporin, such as cyclosporin A (CsA) or cyclosporin H (CsH).

[0449] In some embodiments, the concentration of cyclosporine when contacted with cells is about 1 μM to about 10 μM (e.g., about 1 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2 μM, 2.1 μM, 2.2 μM, 2.3 μM, 2.4 μM, 2.5 μM, 2.6 μM, M, 2.7 μM, 2.8 μM, 2.9 μM, 3 μM, 3.1 μM, 3.2 μM, 3.3 μM, 3.4 μM, 3.5 μM, 3.6 μM, 3.7 μM, 3.8 μM, 3 .9μM, 4μM, 4.1μM, 4.2μM, 4.3μM, 4.4μM, 4.5μM, 4.6μM, 4.7μM, 4.8μM, 4.9μM, 5μM, 5.1μM, 5.2μM, 5.3μM, 5.4μM, 5.5μM, 5.6μM, 5.7μM, 5.8μM, 5.9μM, 6μM, 6.1μM, 6.2μM, 6.3μM, 6.4 μM, 6.5 μM, 6.6 μM, 6.7 μM, 6.8 μM, 6.9 μM, 7 μM, 7.1 μM, 7.2 μM, 7.3 μM, 7.4 μM, 7.5 μM, 7.6 μM, 7.7 μM, 7.8 μM, 7.9 μM, 8 μM, 8.1 μM, 8.2 μM, 8.3 μM, 8.4 μM, 8.5 μM, 8.6 μM, 8.7 μM, 8.8 μM, 8.9 μM, 9 μM, 9.1 μM, 9.2 μM, 9.3 μM, 9.4 μM, 9.5 μM, 9.6 μM, 9.7 μM, 9.8 μM, 9.9 μM, or 10 μM).

[0450] Transduction using activators of prostaglandin E receptor signaling In some embodiments, therapeutic cells of the present disclosure are produced by transducing cells in the presence of an activator of prostaglandin E receptor signaling.

[0451] In some embodiments, the activator of prostaglandin E receptor signaling is a small molecule, such as a compound described in WO2007 / 112084 or WO2010 / 108028, the disclosures of each of which are incorporated herein by reference as they relate to prostaglandin E receptor signaling activators.

[0452] In some embodiments, the activator of prostaglandin E receptor signaling is selected from the group consisting of small org...

Claims

1. 1. A population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, the nucleic acid cassette being operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ regulatory T (Treg) cells, for use in a method of treating or preventing an autoimmune disease in a patient in need thereof.

2. 1. A population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells, for use in a method of suppressing the activity and / or proliferation of a population of autoreactive effector immune cells in a patient diagnosed with an autoimmune disease.

3. 1. A population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells, for use in a method of inducing apoptosis of autoreactive effector immune cells in a patient diagnosed with an autoimmune disease.

4. 1. A population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements active in CD4+CD25+ Treg cells, for use in a method of protecting endogenous tissues from an autoimmune response in a patient diagnosed with an autoimmune disease.

5. 1. A population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells, for use in a method of reducing inflammation in a patient diagnosed with an autoimmune disease. (i) the pluripotent hematopoietic cells are hematopoietic stem cells (HSCs) or hematopoietic progenitor cells (HPCs); (ii) the pluripotent hematopoietic cells are embryonic stem cells; (iii) the pluripotent hematopoietic cells are induced pluripotent stem cells; (iv) the multipotent hematopoietic cells are lymphoid progenitor cells; (v) the pluripotent hematopoietic cells are CD34+ cells; (vi) the population of pluripotent hematopoietic cells is administered systemically to the patient; (vii) the pluripotent hematopoietic cells are autologous to the patient; (viii) the pluripotent hematopoietic cells are allogeneic to the patient. (ix) the pluripotent hematopoietic cells are transduced ex vivo with a viral vector comprising the nucleic acid cassette encoding the autoantigen binding protein; (x) the pluripotent hematopoietic cells are transfected ex vivo with a polynucleotide comprising the nucleic acid cassette encoding the autoantigen binding protein; or (xi) the pluripotent hematopoietic cells are obtained by delivering to the cells a nuclease that catalyzes a single-strand or double-strand break at a target location in the genome of the cells; A population of pluripotent hematopoietic cells according to any one of claims 1 to 5. (i) the population of pluripotent hematopoietic cells is administered to the patient by intravenous injection; (ii) the pluripotent hematopoietic cells are HLA-matched to the patient; (iii) the nuclease is delivered to the cell in combination with a guide RNA (gRNA) that hybridizes to the target location within the genome of the cell; (iv) the nuclease is a clustered regularly interspaced short palindromic repeats (CRISPR) associated protein, or (v) while the cells are contacted with the nuclease, the cells are further contacted with a template polynucleotide comprising the nucleic acid cassette encoding the autoantigen binding protein. The population of pluripotent hematopoietic cells according to claim 6. (i) the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9) or CRISPR-associated protein 12a (Cas12a); (ii) the template polynucleotide comprises 5′ and 3′ homology arms having nucleic acid sequences sufficiently similar to nucleic acid sequences located 5′ and 3′ to the target location, respectively, to promote homologous recombination; or (iii) the nuclease, the gRNA, and / or the template polynucleotide are delivered to the cell by contacting the cell with a viral vector encoding the nuclease, the gRNA, and / or the template polynucleotide; The population of pluripotent hematopoietic cells according to claim 7. (i) the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter; (ii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer; (iii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer; (iv) the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer; (v) the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer; (vi) the autoantigen-binding protein is a single-chain polypeptide. (vii) the autoantigen-binding protein is a chimeric antigen receptor (CAR). (viii) the autoantigen-binding protein is a multi-chain protein. (ix) administering the population of pluripotent hematopoietic cells to the patient causes the administered cells, or their progeny, to differentiate into CD4+CD25+ Treg cells; or (x) the patient is a mammal and the cell is a mammalian cell; A population of pluripotent hematopoietic cells according to any one of claims 1 to 5. (i) the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or a nucleic acid sequence at least 85% identical thereto. (ii) the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo; (iii) the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or a nucleic acid sequence at least 85% identical thereto; (iv) the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo; (v) the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a nucleic acid sequence at least 85% identical thereto; (vi) the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel; (vii) the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a nucleic acid sequence at least 85% identical thereto; (viii) the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel; (ix) the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20, or a nucleic acid sequence at least 85% identical thereto; (x) the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5; (xi) the autoantigen binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule; or (xii) the mammal is a human and the cell is a human cell; The population of pluripotent hematopoietic cells according to claim 9.

11. The autoimmune disease may be type I diabetes, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue dermatitis, chronic fatigue and immune deficiency syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, juvenile arthritis, The population of multipotent hematopoietic cells according to any one of claims 1 to 5, wherein the population is lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, or Wegener's granulomatosis.

12. The autoantigen is myelin oligodendrocyte glycoprotein, aquaporin 4, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, or histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, Fc portion of immunoglobulin, citrullinated peptide, carbamylated peptide, thyrotropin receptor, or a protein expressed in the thyroid gland.

13. (i) The autoimmune disease is multiple sclerosis, and the autoantigen is myelin oligodendrocyte glycoprotein. (ii) the autoimmune disease is type I diabetes and the autoantigen is insulin, GAD-65, IA-2, or ZnT8; (iii) the autoimmune disease is rheumatoid arthritis, and the autoantigen is collagen II, the Fc portion of an immunoglobin, a citrullinated peptide, a carbamylated peptide, or HSP65; (iv) the autoimmune disease is myasthenia gravis and the autoantigen is AChR, MuSK, or LRP4; (v) the autoimmune disease is lupus and the autoantigen is histone IIA; (vi) the autoimmune disease is hypothyroidism, and the autoantigen is a protein expressed in the thyroid gland; (vii) the autoimmune disease is Graves' disease and the autoantigen is the thyrotropin receptor; (viii) the autoimmune disease is pemphigus vulgaris and the autoantigen is double-stranded DNA; (ix) the autoimmune disease is psoriasis and the autoantigen is double-stranded DNA; or (x) the autoimmune disease is neuromyelitis optica, and the autoantigen is aquaporin 4; The population of pluripotent hematopoietic cells of claim 11.

14. 1. A pharmaceutical composition comprising: (i) a population of pluripotent hematopoietic cells comprising a nucleic acid cassette encoding an autoantigen binding protein, wherein the nucleic acid cassette is operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells; and (ii) one or more pharmaceutically acceptable excipients, carriers, or diluents. (i) the pluripotent hematopoietic cells are HSCs or HPCs; (ii) the pluripotent hematopoietic cells are embryonic stem cells; (iii) the pluripotent hematopoietic cells are induced pluripotent stem cells; (iv) the multipotent hematopoietic cells are lymphoid progenitor cells; (v) the pluripotent hematopoietic cells are CD34+ cells; (vi) the pluripotent hematopoietic cells are transduced ex vivo with a viral vector comprising the nucleic acid cassette encoding the autoantigen-binding protein; (vii) the pluripotent hematopoietic cells are transfected ex vivo with a polynucleotide comprising the nucleic acid cassette encoding the autoantigen binding protein; (viii) the pluripotent hematopoietic cells are obtained by delivering to the cells a nuclease that catalyzes a single-strand or double-strand break at a target location in the genome of the cells; (ix) the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter; (x) the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer; (xi) the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer; (xii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer; (xiii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer; (xiv) the autoantigen-binding protein is a single-chain polypeptide. (xv) the autoantigen-binding protein is a CAR. (xvi) the autoantigen-binding protein is a multi-chain protein, or (xvii) The autoantigen is myelin oligodendrocyte glycoprotein, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, or histone II. A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, the Fc portion of an immunoglobin, a citrullinated peptide, a carbamylated peptide, a thyrotropin receptor, or a protein expressed in the thyroid gland. The pharmaceutical composition of claim 14.

16. (i) the nuclease is delivered to the cell in combination with a gRNA that hybridizes to the target location within the genome of the cell. (ii) the nuclease is a CRISPR-associated protein; (iii) while the cell is contacted with the nuclease, the cell is further contacted with a template polynucleotide comprising the nucleic acid cassette encoding the autoantigen binding protein. (iv) the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or a nucleic acid sequence at least 85% identical thereto; (v) the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo; (vi) the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or a nucleic acid sequence at least 85% identical thereto; (vii) the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo; (viii) the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a nucleic acid sequence at least 85% identical thereto; (ix) the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel; (x) the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a nucleic acid sequence at least 85% identical thereto; (xi) the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel; (xii) the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20, or a nucleic acid sequence at least 85% identical thereto; (xiii) the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5; (xiv) the autoantigen-binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule; 16. The pharmaceutical composition of claim 15. (i) the CRISPR-associated protein is Cas9 or Cas12a; (ii) the template polynucleotide comprises a 5′ homology arm and a 3′ homology arm having nucleic acid sequences sufficiently similar to a nucleic acid sequence located 5′ to the target location and a nucleic acid sequence located 3′ to the target location, respectively, to promote homologous recombination; (iii) the nuclease, the gRNA, and / or the template polynucleotide are delivered to the cell by contacting the cell with a viral vector encoding the nuclease, the gRNA, and / or the template polynucleotide; 17. The pharmaceutical composition of claim 16.

18. 18. A kit comprising the pharmaceutical composition of any one of claims 14 to 17, the kit further comprising a package insert instructing a user of the kit to administer the pharmaceutical composition to a human patient with an autoimmune disease.

19. 1. A nucleic acid cassette encoding an autoantigen binding protein, said nucleic acid cassette being operably linked to one or more lineage-specific transcriptional regulatory elements that are active in CD4+CD25+ Treg cells.

20. (i) the one or more lineage-specific transcriptional regulatory elements comprise a Foxp3 promoter. (ii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS1 enhancer; (iii) the one or more lineage-specific transcriptional regulatory elements comprise a CNS2 enhancer; (iv) the one or more lineage-specific transcriptional regulatory elements comprise a CNS3 enhancer; (v) the one or more lineage-specific transcriptional regulatory elements comprise a CNS0 enhancer; (vi) the autoantigen-binding protein is a single-chain polypeptide. (vii) the autoantigen-binding protein is a CAR. (viii) the autoantigen-binding protein is a multi-chain protein, or (ix) the autoantigen is myelin oligodendrocyte glycoprotein, actin, tubulin, myosin, tropomyosin, vimentin, fibronectin, collagen I, collagen II, collagen III, collagen IV, collagen V, heparin, laminin, collagenase, cardiolipin, glucocerebroside, phosphatidylethanolamine, cholesterol, enolase, aldolase, acid phosphatase, annexin 33 kDa, annexin 67 kDa, cytochrome P450C, catalase, peroxidase, tyrosinase, ribonuclease, or histone II A, double-stranded DNA, single-stranded DNA, transferrin, fetuin, factor II, factor VII, fibrin, fibrinogen, C1, C1q, interleukin 2, interleukin 10, interleukin 4, interferon gamma, TNFαR, HSP60, HSP65, GAD, insulin, IA-2, ZnT8, MBP, AchR, myoglobulin, thyroglobulin, hemoglobin A, spectrin, TB PPD, LPS, MuSK, LRP4, the Fc portion of an immunoglobin, a citrullinated peptide, a carbamylated peptide, a thyrotropin receptor, or a protein expressed in the thyroid gland. The nucleic acid cassette of claim 19.

21. (i) the Foxp3 promoter has the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or a nucleic acid sequence at least 85% identical thereto. (ii) the Foxp3 promoter specifically binds to the transcription factors Nr4a and / or Foxo; (iii) the CNS1 enhancer has the nucleic acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or a nucleic acid sequence at least 85% identical thereto; (iv) the CNS1 enhancer specifically binds to the transcription factors AP-1, NFAT, Smad3, and / or Foxo; (v) the CNS2 enhancer has the nucleic acid sequence of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12, or a nucleic acid sequence at least 85% identical thereto; (vi) the CNS2 enhancer specifically binds to the transcription factors Runx, Foxp3, Ets-1, CREB, Stat5, NFAT, and / or c-Rel; (vii) the CNS3 enhancer has the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a nucleic acid sequence at least 85% identical thereto; (viii) the CNS3 enhancer specifically binds to the transcription factors Foxo and / or c-Rel; (ix) the CNS0 enhancer has the nucleic acid sequence of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20, or a nucleic acid sequence at least 85% identical thereto; (x) the CNS0 enhancer specifically binds to the transcription factors Satb1 and / or Stat5; or (xi) the autoantigen-binding protein is a full-length antibody, a dual variable immunoglobulin domain, a diabody, a triabody, an antibody-like protein scaffold, a Fab fragment, or a F(ab')2 molecule; The nucleic acid cassette of claim 20.

22. A viral vector comprising the nucleic acid cassette of any one of claims 19 to 21.