Microtubule-associated protein tau (MAPT) iRNA formulation compositions and methods of use thereof
Patent Information
- Application Number
- JP2024518194
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-02
- Filing Date
- 2022-09-23
- Publication Date
- 2025-10-01
AI Technical Summary
、例えば症状の改善、治癒、疾患の低減、寿命の延長、生活の質の改善、またはMAPT関連障害および関連原因の治療に精通している医師によって肯定的であると通常認識される他の効果が結果的に生じることを示す。
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 248,119, filed September 24, 2021, U.S. Provisional Patent Application No. 63 / 321,573, filed March 18, 2022, and U.S. Provisional Patent Application No. 63 / 403,327, filed September 2, 2022. Each of the foregoing applications is incorporated herein by reference in its entirety.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. The XML copy created on September 19, 2022 is named A108868_1310WO_SL.xml and is 7,900,797 bytes in size. [Background technology]
[0003] The microtubule-associated protein tau (MAPT) gene, which encodes the protein microtubule-associated protein tau (MAPT), a member of the microtubule-associated protein family, is located in chromosome region 17q21.31 (base pairs 45,894,382 to 46,028,334 on chromosome 17). The MAPT gene consists of 16 exons. In the central nervous system (CNS), alternative mRNA splicing generates six MAPT isoforms, which have a total length of 352 to 441 amino acids. In three of the six MAPT isoforms, the microtubule-binding domain of MAPT contains three repeat segments, while the corresponding domain in the other three MAPT isoforms contains four repeat segments.
[0004] MAPT transcripts are differentially expressed throughout the body, primarily in the central and peripheral nervous systems. Wild-type tau is involved in stabilizing microtubules in neuronal axons, maintaining dendritic spines, and regulating axonal transport, microtubule dynamics, and cell division. Pathogenic variants in MAPT are found in approximately 10% of patients with primary tauopathies. These variants are primarily missense mutations located in exons 9–13 (the microtubule-binding domain), with many affecting alternative splicing of exon 10.
[0005] Tauopathies are a heterogeneous group of progressive neurodegenerative disorders pathologically characterized by the presence of tau aggregates in the brain. Phenotypically, tauopathies exhibit variable progression of motor, cognitive, and behavioral impairments. Tauopathies include, but are not limited to, Alzheimer's disease, frontotemporal dementia (FTD), and progressive supranuclear palsy (PSP). Tau is a major component of neurofibrillary tangles in the cytoplasm of neurons and is a hallmark of Alzheimer's disease. Tau aggregation and deposition have also been observed in approximately 50% of brains of Parkinson's disease patients.
[0006] FTD includes, but is not limited to, behavioral variant frontotemporal dementia (bvFTD), nonfluent variant primary progressive aphasia (nfvPPA), and corticobasal syndrome (CBS).
[0007] Currently, there is no curative treatment for tauopathy, and treatments are only aimed at alleviating symptoms and improving the quality of life of patients.Therefore, there is a need for agents that selectively and efficiently inhibit and regulate the expression of the MAPT gene to effectively treat subjects with MAPT-related disorders, such as Alzheimer's disease, FTD, PSP or other tauopathy. Summary of the Invention
[0008] The present disclosure provides RNAi compositions that perform RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the MAPT gene. The MAPT gene may be present in a cell, for example, in a subject, such as a human. The use of these iRNAs allows for targeted degradation of the mRNA of the corresponding gene (MAPT gene) in a mammal.
[0009] The iRNAs of the present invention are designed to target the MAPT gene, for example, a MAPT gene having a missense mutation and / or deletion mutation in an exon of the gene and a combination of nucleotide modifications. The iRNAs of the present invention inhibit the expression of the MAPT gene by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% compared to the control level, and reduce the level of foci, including sense and antisense. Without intending to be bound by theory, it is believed that the combination or subcombination of the above-mentioned features with specific target sites or specific modifications in these iRNAs improves the efficacy, stability, potency, durability, and safety of the iRNAs of the present invention.
[0010] In one embodiment, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the sense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2.
[0011] In one embodiment, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the sense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:3, and the antisense strand comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:4.
[0012] In another aspect, the invention provides a dsRNA agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the antisense strand comprising a region complementary to an mRNA encoding tau, the complementary region comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2.
[0013] In another aspect, the invention provides a dsRNA agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the antisense strand comprising a region complementary to an mRNA encoding tau, the complementary region comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:4.
[0014] In yet another aspect, the present invention provides a dsRNA agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the antisense strand comprising a region complementary to an mRNA encoding tau, the complementary region comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 3-6.
[0015] In one embodiment, the sense strand comprises nucleotides 506 to 526, 507 to 527, 508 to 528, 509 to 529, 510 to 530, 511 to 531, 512 to 532, 513 to 533, 514 to 534, 515 to 535, 516 to 536, 517 to 537, 518 to 538, 519 to 539, 520 to 540, 521 to 541, 522 to 542, 523 to 543, 524 to 544, 525 to 545, 526 to 544, 526 to 546, 527 to 547, 528-548, 529-549, 530-550, 531-551, 532-552, 533-553, 969-989, 970-990, 971-991, 972-992, 973-993, 974-994, 975-995, 976-996, 977-997, 978-997, 978-998, 979-997, 979-999, 980-1000, 981-1001, 982-1002, 983-1003, 984-1004, 985-1003, 985-100 5, 986-1006, 987-1007, 988-1008, 989-1009, 990-1010, 1069-1089, 1070-1090, 1071-1091, 1072-1092, 1073-1093, 1074-1094, 1075-1095, 1076-1096, 1077-1095, 1077-1097, 1078-1098, 1079-1099, 1080-1100, 1081-1101, 5511-5531, 5512-5532, 5513- and the antisense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from any one of the nucleotide sequences of SEQ ID NO: 5533, 5514-5534, 5515-5535, 5516-5536, 5517-5537, 5518-5538, 5519-5539, 5520-5540, 5521-5541, 5522-5542 and 5523-5543, and the antisense strand comprises at least 15 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO: 2.
[0016] In one embodiment, the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences 1072-1092, 1067-1087, and 514-534 of SEQ ID NO: 3, and the antisense strand comprises at least 15 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO: 4. In one embodiment, the antisense strand is selected from the group consisting of AD-1397070, AD-1397072, AD-1397073, AD-1397075, AD-1397081, AD-1397083, AD-1397088, AD-1397249, AD-1397252, AD-1397253, AD-1397258, AD-1397261, AD-1397262, AD-1397263, AD-1397291, AD-1397293, AD-1397294, AD-1397295, AD-1397298, AD-1397299, AD-1637732, AD-1637733, AD-1637734, AD-1637735, AD-1637736, AD-1637737, AD-16 37739, AD-1637744, AD-1637745, AD-1637746, AD-1637747, AD-1637748, AD-1637749, AD-1637750, AD-1637751, AD-1637752, AD-1637753, AD-1637754, AD-1637755, AD-1637756, AD-1637757, AD-1637758, AD-1637759, AD-1637760, AD-1637761, AD-16 37762, AD-1637763, AD-1637764, AD-1637765, AD-1637766, AD-1637767, AD-1637768, AD-1637769, AD-1637770, AD-1637771, AD-1637772, AD-1637773, AD-1637774, AD-1637775, AD-1637776, AD-1637777, AD-1637778, AD-1637779, AD-1637780, AD-16 37781, AD-1637782, AD-1637783, AD-1637784, AD-1637785, AD-1637786, AD-1637787, AD-1637788, AD-1637789, AD-1637790,AD-1637791、AD-1637792、AD-1637793、AD-1637794、AD-1637795、AD-1637796、AD-1637797、AD-1637798、AD-1637799、AD-1637800、AD-1637801、AD-1637802、AD-1637803、AD-1637804、AD-1637805、AD-1637806、AD-1637807、AD-1637808、AD-1637809、AD-1637810、AD-1637811、AD-1637812、AD-1637813、AD-1637814、AD-1637815、AD-1637816、AD-1637817、AD-1637818、AD-1637819、AD-1637820、AD-1637821、AD-1637822、AD-1637823、AD-1637824、AD-1637825、AD-1637826、AD-1637827、AD-1637828、AD-1637829、AD-1637830、AD-1637831、AD-1637832、AD-1637833、AD-1637834、AD-1637835、AD-1637836、AD-1637837、AD-1637838、AD-1637839、AD-1637840、AD-1637841、AD-1637842、AD-1637843、AD-1637844、AD-1637845、AD-1637846、AD-1637847、AD-1637848、AD-1637849、AD-1637850、AD-1637851、AD-1637852、AD-1637853、AD-1637854、AD-1637855、AD-1637856、AD-1637857、AD-1637858、AD-1637859、AD-1637860、AD-1637861、AD-1637862、AD-1637863、AD-1637864、AD-1637865、AD-1637866、AD-1637867、AD-1637868、AD-1637869、AD-1637870、AD-1637871、AD-1637872、AD-1637873、AD-1637874、AD-1637875、AD-1637876、AD-1637877、AD-1637878、AD-1637879、AD-1637880、AD-1637881、AD-1637882、AD-1637883、AD-1637884、AD-1637885、AD-1637886、AD-1637887、AD-1637888、AD-1637889、AD-1637890、AD-1637891、AD-1637892、AD-1637893、AD-1637894、AD-1637895、AD-1637896、AD-1637897、AD-1637898、AD-1637899、AD-1637900、AD-1637901、AD-1637902、AD-1637903、AD-1637904、AD-1637905、AD-1637906、AD-1637907、AD-1637908、AD-1637909、AD-1637910、AD-1637911、AD-1637912、AD-1637913、AD-1637914、AD-1637915、AD-1637916、AD-1637917、AD-1637918、AD-1637919、AD-1637920、AD-1637921、AD-1637922、AD-1637923、AD-1637924、AD-1637925、AD-1637926、AD-1637927、AD-1637928、AD-1637929、AD-1637930、AD-1637931、AD-1637932、AD-1637933、AD-1637934、AD-1637935、AD-1637936、AD-1637937、AD-1637938、AD-1637939、AD-1637940、AD-1637941、AD-1637942、AD-1637943、AD-1637944、AD-1637945、AD-1637946、AD-1637947、AD-1637948、AD-1637949、AD-1637950、AD-1637951、AD-1637952、AD-1637953、AD-1637954、AD-1637955、AD-1637956、AD-1637957、AD-1637958、AD-1637959、AD-1637960、AD-397167、AD-523565、AD-1623140、AD-1637701、and AD-1786708v2. In some embodiments, the duplex comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1786708 and AD-1786708v2. In some embodiments, the duplex is selected from the group consisting of AD-1637922, AD-1637806, AD-1637762, AD-1637777, AD-1637779, AD-1397081, AD-1637793, AD-1637798, AD-1637807, AD-1637829, AD-1637831, AD-1637840, AD-1637841, AD-1637855, AD-1637883, and AD-1637884. In certain embodiments, the duplex is selected from the group consisting of AD-1623140, AD-1786708, and AD-1637701. In certain embodiments, the duplex is AD-1786708.
[0017] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of MAPT, the dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, the antisense strand comprising a region complementary to an mRNA encoding MAPT, the complementary region comprising at least 17 contiguous nucleotides of the antisense sequence UACCAUNCGAGCUUGGGUCACGU (SEQ ID NO: 1268), where N is the only nucleotide that does not match in an mRNA encoding tau. In certain embodiments, N is I, A, C, T, or U. In certain embodiments, the antisense sequence is UACCAUHCGAGCUUGGGUCACGU (SEQ ID NO: 1269), where H is A, C, T, or U. In certain embodiments, the antisense sequence is UACCAUACGAGCUUGGGUCACGU (SEQ ID NO: 1003). In some embodiments, the complementary region comprises at least 18, 19, 20, or 21 contiguous nucleotides of the antisense sequence. In some embodiments, the complementary region consists of the antisense sequence. In some embodiments, the complementary region comprises at least nucleotides 1-17, 1-18, 1-19, 1-20, or 1-21 of the antisense sequence, counting from the 5' end of the antisense sequence. In some embodiments, the complementary region comprises at least nucleotides 2-18, 2-19, 2-20, 2-21, or 2-22 of the antisense sequence, counting from the 5' end of the antisense sequence.
[0018] In some embodiments, the nucleotide sequences of the sense and antisense strands comprise any one of the sense and antisense strand nucleotide sequences in any one of Tables 3-6.
[0019] In one embodiment, the nucleotide sequence of the sense strand comprises at least 15 consecutive nucleotides corresponding to the sense strand sequence of exon 10 of the MAPT gene set forth in SEQ ID NO: 992, and the antisense strand comprises a sequence complementary thereto.
[0020] In one embodiment, the sense strand, the antisense strand, or both the sense and antisense strands described herein are conjugated to one or more lipophilic moieties.
[0021] In one embodiment, the lipophilic moiety is conjugated to one or more interior positions within the double-stranded region of the dsRNA agent.
[0022] In one embodiment, the lipophilic moiety is conjugated via a linker or carrier.
[0023] In one embodiment, the lipophilicity of the lipophilic moiety is greater than 0, as measured by log Kow.
[0024] In one embodiment, the hydrophobicity of the double-stranded RNA agent, as measured by the unbound fraction in a plasma protein binding assay of the double-stranded RNA agent, is greater than 0.2.
[0025] In one embodiment, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.
[0026] In some embodiments, the dsRNA agent includes at least one modified nucleotide.
[0027] In one embodiment, no more than five of the sense strand nucleotides and no more than five of the antisense strand nucleotides of a dsRNA agent of the invention are unmodified nucleotides.
[0028] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.
[0029] In some embodiments, at least one of the modified nucleotides of the dsRNA agent is a deoxy-nucleotide, a 3'-terminal deoxy-thymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxy-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a tetrahydropyran-modified nucleotide, a 1,5-anhydrohexitol-modified nucleotide, a cyclohexenyl-modified nucleotide, The nucleotide is selected from the group consisting of nucleotides containing a 5'-phosphorothioate group, nucleotides containing a 5'-methylphosphonate group, nucleotides containing a 5' phosphate or a 5' phosphate mimic, nucleotides containing vinyl phosphonate, nucleotides containing glycol nucleic acid (GNA) (e.g., adenosine-glycol nucleic acid (GNA)), nucleotides containing S-glycol nucleic acid (S-GNA) (e.g., thymidine-glycol nucleic acid (GNA) S isomer), 2'-5'-linked ribonucleotides (3'-RNA), nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, and terminal nucleotides linked to cholesteryl derivatives, and dodecanoic acid bisdecylamide groups, and combinations thereof.
[0030] In one embodiment, the modified nucleotide of the dsRNA agent is selected from the group consisting of 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, 3'-terminal deoxythymidine nucleotides (dT), locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, and nucleotides containing unnatural bases.
[0031] In one embodiment, the modified nucleotides of the dsRNA agent include a short sequence of 3'-terminal deoxythymidine nucleotides (dT).
[0032] In one embodiment, the modifications on the nucleotides of the dsRNA agent are 2'-O-methyl modifications, GNA modifications, and 2' fluoro modifications.
[0033] In some embodiments, the dsRNA agent further comprises at least one phosphorothioate internucleotide linkage.
[0034] In one embodiment, the dsRNA agent includes 6-8 phosphorothioate internucleotide linkages.
[0035] In one embodiment, each strand of the dsRNA is 30 nucleotides or less in length.
[0036] In one embodiment, at least one strand of the dsRNA agent includes a 3' overhang of at least 1 nucleotide, hi another embodiment, at least one strand of the dsRNA agent includes a 3' overhang of at least 2 nucleotides.
[0037] In some embodiments, the double-stranded region of a dsRNA agent can be 15 to 30 nucleotide pairs in length, 17 to 23 nucleotide pairs in length, 17 to 25 nucleotide pairs in length, 23 to 27 nucleotide pairs in length, 19 to 21 nucleotide pairs in length, or 21 to 23 nucleotide pairs in length.
[0038] In some embodiments, each strand of the dsRNA can have 19-30 nucleotides, 19-23 nucleotides, or 21-23 nucleotides.
[0039] In one embodiment, one or more lipophilic moieties are conjugated, eg, via a linker or carrier, to one or more interior positions on at least one chain.
[0040] In one embodiment, the interior positions include all but the two most distal positions on each end of at least one strand.
[0041] In another embodiment, the interior positions include all but the three most distal positions on each of at least one strand.
[0042] In one embodiment, the internal position excludes the cleavage site region of the sense strand.
[0043] In one embodiment, internal positions include all positions except positions 9 to 12 counting from the 5' end of the sense strand.
[0044] In another embodiment, internal positions include all positions except positions 11-13 counting from the 3' end of the sense strand.
[0045] In one embodiment, the internal position excludes the cleavage site region of the antisense strand.
[0046] In one embodiment, internal positions include all positions except positions 12 to 14 counting from the 5' end of the antisense strand.
[0047] In one embodiment, internal positions include all positions except positions 11 to 13 from the 3' end on the sense strand and positions 12 to 14 from the 5' end on the antisense strand.
[0048] In one embodiment, the one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand.
[0049] In another embodiment, the one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand and positions 15 and 17 on the antisense strand, counting from the 5' end of each strand.
[0050] In one embodiment, the internal positions in the double-stranded region exclude the cleavage site region of the sense strand.
[0051] In one embodiment, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 21, 20, 15, 1, 7, 6, or 2 of the sense strand or position 16 of the antisense strand.
[0052] In one embodiment, the lipophilic moiety is conjugated to position 21, 20, 15, 1, or 7 of the sense strand.
[0053] In another embodiment, the lipophilic moiety is conjugated to position 21, 20, or 15 of the sense strand.
[0054] In yet another embodiment, the lipophilic moiety is conjugated to position 20 or 15 of the sense strand.
[0055] In one embodiment, the lipophilic moiety is conjugated to position 16 of the antisense strand.
[0056] In one embodiment, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound.
[0057] In some embodiments, the lipophilic moiety is selected from the group consisting of a lipid, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
[0058] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.
[0059] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C6 to C18 hydrocarbon chain.
[0060] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain.
[0061] In one embodiment, a saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5' end of one chain.
[0062] In one embodiment, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotides in an internal position or in the double-stranded region.
[0063] In one embodiment, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl, or an acyclic portion of a serinol or diethanolamine backbone system.
[0064] In one embodiment, the lipophilic moiety is conjugated to the double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, the product of a click reaction, or a carbamate.
[0065] In one embodiment, the lipophilic moiety is conjugated to a nucleobase, a sugar moiety, or an internucleoside linkage.
[0066] In one embodiment, the lipophilic moiety or targeting ligand is conjugated via a biolinker selected from the group consisting of DNA, RNA, disulfide, amide, and functionalized mono- or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.
[0067] In one embodiment, the 3' end of the sense strand is protected via an end cap that is an amine-containing cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl.
[0068] In one embodiment, the dsRNA agent further comprises a targeting ligand that targets neurons.
[0069] In one embodiment, the dsRNA agent further comprises a targeting ligand that targets hepatocytes.
[0070] In one embodiment, the targeting ligand is a GalNAc conjugate.
[0071] In one embodiment, the dsRNA agent comprises a terminal chiral modification occurring in a first internucleotide linkage at the 3'-end of the antisense strand having a linking phosphorus atom in the Sp configuration, a terminal chiral modification occurring in a first internucleotide linkage at the 5'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, and It further comprises a terminal chiral modification occurring at the first internucleotide linkage at the 5' end of the sense strand, with the linking phosphorus atom in either the Rp or Sp configuration.
[0072] In another embodiment, the dsRNA agent further includes a terminal chiral modification occurring at the first and second internucleotide linkages at the 3'-end of the antisense strand having a linking phosphorus atom in the Sp configuration, a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, and a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the sense strand having a linking phosphorus atom in either the Rp or Sp configuration.
[0073] In yet another embodiment, the dsRNA agent further includes a terminal chiral modification occurring at the first, second, and third internucleotide linkages at the 3'-end of the antisense strand having a linking phosphorus atom in the Sp configuration, a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, and a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the sense strand having a linking phosphorus atom in either the Rp or Sp configuration.
[0074] In another embodiment, the dsRNA agent further includes a terminal chiral modification occurring at the first and second internucleotide linkages at the 3'-end of the antisense strand having a linking phosphorus atom in the Sp configuration, a terminal chiral modification occurring at the third internucleotide linkage at the 3'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, and a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the sense strand having a linking phosphorus atom in either the Rp or Sp configuration.
[0075] In another embodiment, the dsRNA agent further includes a terminal chiral modification occurring at the first and second internucleotide linkages at the 3'-end of the antisense strand having a linking phosphorus atom in the Sp configuration, a terminal chiral modification occurring at the first and second internucleotide linkages at the 5'-end of the antisense strand having a linking phosphorus atom in the Rp configuration, and a terminal chiral modification occurring at the first internucleotide linkage at the 5'-end of the sense strand having a linking phosphorus atom in either the Rp or Sp configuration.
[0076] In one embodiment, the dsRNA agent further comprises a phosphate or a phosphate mimetic at the 5' end of the antisense strand.
[0077] In one embodiment, the phosphate mimetic is a 5'-vinylphosphonate (VP).
[0078] In one embodiment, the phosphate mimetic is a 5'-cyclopropylphosphonate.
[0079] In one embodiment, the first base pair at the 5'-end of the antisense strand of the duplex is an AU base pair.
[0080] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
[0081] In another embodiment, the dsRNA agent is a pharmaceutically acceptable salt thereof. The "pharmaceutically acceptable salt" of each dsRNA agent herein includes, but is not limited to, sodium, calcium, lithium, potassium, ammonium, magnesium salts, and mixtures thereof. Those skilled in the art will understand that when a dsRNA agent is provided as a polycationic salt, it will have one cation per free acid group of the optionally modified phosophodiester backbone and / or any other acidic modifications (e.g., a phosphonate group at the 5' end). For example, an oligonucleotide "n" nucleotides in length contains n-1 optionally modified phosophodiesters, such that an oligonucleotide 21 nt in length can be provided as a salt with up to 20 cations (e.g., 20 sodium cations). Similarly, a dsRNA agent having a 21 nt sense strand and a 23 nt antisense strand can be provided as a salt with up to 42 cations (e.g., 42 sodium cations). In the foregoing examples, if the dsRNA agent also includes a 5'-terminal phosphate or a 5'-terminal vinylphosphonate group, the dsRNA agent can be provided as a salt with up to 44 cations (eg, 44 sodium cations).
[0082] The invention also provides cells and pharmaceutical compositions comprising the dsRNA agents and lipid formulations of the invention.
[0083] The present invention also provides a pharmaceutical composition for inhibiting the expression of a gene encoding MAPT, comprising a dsRNA agent of the present invention.
[0084] The present invention also provides a pharmaceutical composition for selectively inhibiting exon 10-containing MAPT transcripts, comprising a dsRNA agent of the invention.
[0085] In one embodiment, the dsRNA agent is in an unbuffered solution, such as saline or water.
[0086] In another embodiment, the dsRNA agent is in a buffer containing acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof, or is in a buffer such as phosphate buffered saline (PBS).
[0087] In one aspect, the present invention provides a method for inhibiting expression of the MAPT gene in a cell, the method comprising contacting the cell with a dsRNA agent of the present invention or a pharmaceutical composition of the present invention, thereby inhibiting expression of the MAPT gene in the cell.
[0088] In another aspect, the invention provides a method comprising selectively inhibiting exon 10-containing MAPT transcripts in a cell, the method comprising contacting the cell with a dsRNA agent of the invention or a pharmaceutical composition of the invention, thereby selectively degrading exon 10-containing MAPT transcripts in the cell.
[0089] In one embodiment, the cell is in a subject.
[0090] In one embodiment, the subject is a human.
[0091] In one embodiment, the subject has a MAPT-associated disorder.
[0092] In one embodiment, the subject has a MAPT-associated disorder that is a neurodegenerative disorder.
[0093] In one embodiment, the subject's neurodegenerative disorder is associated with abnormalities in the protein tau, which is encoded by the MAPT gene.
[0094] In one embodiment, abnormalities in the protein tau, encoded by the MAPT gene, result in tau aggregation in the brain of a subject.
[0095] In one embodiment, the neurodegenerative disorder is a familial disorder.
[0096] In one embodiment, the neurodegenerative disorder is a sporadic disorder.
[0097] In one embodiment, the MAPT-related disorder is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic type (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystem with presenile dementia. The present invention is selected from the group consisting of: tauopathy (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS).
[0098] In some embodiments, contacting a cell with a dsRNA agent inhibits expression of MAPT by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% compared to control levels. In one embodiment, the dsRNA agent inhibits expression of MAPT by at least about 25%.
[0099] In some embodiments, inhibiting the expression of MAPT reduces the tau protein level in the subject's serum by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% compared to the control level. In one embodiment, the dsRNA agent reduces the tau protein level in the subject's serum by at least about 25%.
[0100] In one aspect, the invention provides a method of treating a subject having a disorder that would benefit from reduced MAPT expression, comprising administering to the subject a therapeutically effective amount of a dsRNA agent of the invention, or a pharmaceutical composition of the invention, thereby treating the subject having a disorder that would benefit from reduced MAPT expression.
[0101] In another aspect, the invention provides a method for preventing at least one symptom in a subject having a disorder that would benefit from reduced MAPT expression, comprising administering to the subject a prophylactically effective amount of a dsRNA agent of the invention, or a pharmaceutical composition of the invention, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduced MAPT expression.
[0102] In one embodiment, the disorder is a MAPT-associated disorder.
[0103] In one embodiment, the disorder is associated with abnormalities in the protein tau, which is encoded by the MAPT gene.
[0104] In one embodiment, abnormalities in the protein tau, encoded by the MAPT gene, result in tau aggregation in the brain of a subject.
[0105] In one embodiment, the MAPT-related disorder is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic type (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystem with presenile dementia. The present invention is selected from the group consisting of: tauopathy (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS).
[0106] In one embodiment, the subject is a human.
[0107] In one embodiment, administering a dsRNA agent of the invention or a pharmaceutical composition of the invention results in a reduction of tau aggregation in the brain of a subject.
[0108] In one embodiment, administering the agent to a subject results in a reduction in tau accumulation.
[0109] In one embodiment, the dsRNA agent is administered to the subject at a dose of about 0.01 mg / kg to about 50 mg / kg.
[0110] In another embodiment, the dsRNA agent is administered to the subject intrathecally.
[0111] In yet another embodiment, the dsRNA agent is administered to the subject intracisternally. Non-limiting exemplary intracisternal administration includes injection into the cisterna magna (cerebellomedullary cistern) via suboccipital puncture.
[0112] In one embodiment, the method of the present invention further comprises determining the level of MAPT in a sample from the subject.
[0113] In one embodiment, the level of MAPT in a subject's sample is the level of tau protein in a blood, serum, or cerebrospinal fluid sample.
[0114] In one embodiment, the method of the invention further comprises administering to the subject an additional therapeutic agent.
[0115] In one embodiment, the invention provides a kit comprising a dsRNA agent of the invention, or a pharmaceutical composition of the invention.
[0116] In another aspect, the invention provides a vial containing a dsRNA agent of the invention, or a pharmaceutical composition of the invention.
[0117] In yet another aspect, the invention provides a syringe comprising a dsRNA agent of the invention, or a pharmaceutical composition of the invention.
[0118] In another aspect, the invention provides an intrathecal pump comprising a dsRNA agent of the invention, or a pharmaceutical composition of the invention.
[0119] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand differs by no more than 3 bases from the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011), where VP is 5'-vinylphosphonate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, dA is 2'-deoxy A, and Af, Gf, Uf are 2'-deoxy-2'-fluoro (2'-F) A, G, and U. In certain embodiments, the nucleotide sequence of the antisense strand differs from the nucleotide sequence of SEQ ID NO: 1011 by no more than 2 bases. In certain embodiments, the nucleotide sequence of the antisense strand differs by no more than one base from the nucleotide sequence of SEQ ID NO: 1011. In certain embodiments, the sense strand comprises the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007), where (Chd) is 2'-O-hexadecyl-cytidine-3'-phosphate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, and Af, Cf, and Gf are 2'-deoxy-2'-fluoro (2'-F) A, C, and G, respectively. In certain embodiments, the dsRNA agent is a sodium salt.
[0120] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011). In certain embodiments, the sense strand comprises the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007). In certain embodiments, the dsRNA agent is a sodium salt.
[0121] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand consists of the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007) and the antisense strand consists of the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011). In certain embodiments, the dsRNA agent is a sodium salt.
[0122] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand differs by no more than 3 bases from the nucleotide sequence 5'-VPusUfsggdTu(Tgn)guagacUfaUfuugcascsa-3' (SEQ ID NO: 1010), wherein VP is 5'-vinylphosphonate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, dT is 2'-deoxy T, Af, Gf, Uf are 2'-deoxy-2'-fluoro (2'-F) A, G, and U, and (Tgn) is a thymidine-glycol nucleic acid (GNA) S-isomer. In certain embodiments, the nucleotide sequence of the antisense strand differs by no more than two bases from the nucleotide sequence of SEQ ID NO: 1010. In certain embodiments, the nucleotide sequence of the antisense strand differs by no more than one base from the nucleotide sequence of SEQ ID NO: 1010. In certain embodiments, the sense strand comprises the nucleotide sequence 5'-usgscaa(Ahd)UfaGfUfCfuacaaaccsasa-3' (SEQ ID NO: 1006), where (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, and Af, Cf, and Gf are 2'-deoxy-2'-fluoro (2'-F) A, C, and G, respectively. In certain embodiments, the dsRNA agent is a sodium salt.
[0123] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises the nucleotide sequence 5'-VPusUfsggdTu(Tgn)guagacUfaUfuugcascsa-3' (SEQ ID NO: 1010). In certain embodiments, the sense strand comprises the nucleotide sequence 5'-usgscaa(Ahd)UfaGfUfCfuacaaaccsasa-3' (SEQ ID NO: 1006). In certain embodiments, the dsRNA agent is a sodium salt.
[0124] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand consists of the nucleotide sequence 5'-usgscaa(Ahd)UfaGfUfCfuacaaaccsasa-3' (SEQ ID NO: 1006) and the antisense strand consists of the nucleotide sequence 5'-VPusUfsggdTu(Tgn)guagacUfaUfuugcascsa-3' (SEQ ID NO: 1010). In certain embodiments, the dsRNA agent is a sodium salt.
[0125] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand differs by no more than 3 bases from the nucleotide sequence 5'-VPusUfscadAc(Tgn)gguuugUfaGfacuaususu-3' (SEQ ID NO: 1009), wherein VP is 5'-vinylphosphonate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, dA is 2'-deoxy A, Af, Gf, Uf are 2'-deoxy-2'-fluoro (2'-F) A, G, and U, and (Tgn) is a thymidine-glycol nucleic acid (GNA) S-isomer. In certain embodiments, the nucleotide sequence of the antisense strand differs by no more than two bases from the nucleotide sequence of SEQ ID NO: 1009. In certain embodiments, the nucleotide sequence of the antisense strand differs by no more than one base from the nucleotide sequence of SEQ ID NO: 1009. In certain embodiments, the sense strand comprises the nucleotide sequence 5'-asusagu(Chd)uaCfAfAfaccaguugsasa-3' (SEQ ID NO: 1005), where (Chd) is 2'-O-hexadecyl-cytidine-3'-phosphate, s is a phosphorothioate linkage, a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively, and Af, Cf, and Gf are 2'-deoxy-2'-fluoro (2'-F) A, C, and G, respectively. In certain embodiments, the dsRNA agent is a sodium salt.
[0126] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises the nucleotide sequence 5'-VPusUfscadAc(Tgn)gguuugUfaGfacuaususu-3' (SEQ ID NO: 1009). In certain embodiments, the sense strand comprises the nucleotide sequence 5'-asusagu(Chd)uaCfAfAfaccaguugsasa-3' (SEQ ID NO: 1005). In certain embodiments, the dsRNA agent is a sodium salt.
[0127] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand consists of the nucleotide sequence 5'-asusagu(Chd)uaCfAfAfaccaguugsasa-3' (SEQ ID NO: 1005) and the antisense strand consists of the nucleotide sequence 5'-VPusUfscadAc(Tgn)gguuugUfaGfacuaususu-3' (SEQ ID NO: 1009). In certain embodiments, the dsRNA agent is a sodium salt.
[0128] The present invention also provides a pharmaceutical composition comprising one of the above-mentioned dsRNA agents of the present invention and pharmaceutically acceptable diluent.In certain embodiments, the pharmaceutical composition can be a sterile aqueous solution.In certain embodiments, the sterile aqueous solution can comprise buffer solution.In certain embodiments, the diluent of the sterile aqueous solution can be physiological saline or water.
[0129] In one aspect, the present invention provides a method for inhibiting expression of the MAPT gene in a cell, the method comprising contacting the cell with any one of the dsRNA agents described above and maintaining the resulting cells for a period of time sufficient to allow degradation of mRNA transcripts of the MAPT gene, thereby inhibiting expression of the MAPT gene in the cell.
[0130] In another aspect, the present invention provides a method of treating a MAPT-associated neurodegenerative disease, the method comprising administering to a patient in need thereof a pharmaceutically effective amount of any one of the aforementioned dsRNA agents. In certain embodiments, the MAPT-associated neurodegenerative disease is selected from the group consisting of tauopathies, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), and multifocal dementia with presenile dementia. The MAPT-associated neurodegenerative disease is selected from the group consisting of multiple systemic tauopathy (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS). In one embodiment, the MAPT-associated neurodegenerative disease is Alzheimer's disease. In another specific embodiment, the MAPT-associated neurodegenerative disease is progressive supranuclear palsy (PSP). In yet another specific embodiment, the MAPT-associated neurodegenerative disease is a tauopathy. [Brief explanation of the drawings]
[0131] [Figure 1] 1 shows AAV screening in the liver to determine the effect of an RNAi composition on MAPT expression. The vertical axis shows human MAPT expression in mice administered the RNAi composition compared to MAPT expression levels in mice administered PBS. [Figure 2A-1]Figures 2A-2B show the off-target effects of selected duplexes. The top panel shows an MA plot of the Log2 fold change in gene expression compared to the average normalized gene expression for genes in control (mock-treated) and duplex-treated cells. Each point represents one gene. Red and blue points represent significant changes in gene expression (p<0.05), while gray points represent no significant changes. Blue and dark gray points represent genes with a standard seed match (8mer or 7mer) in their 3'UTR. The bottom panel shows a cumulative distribution function plot of genes containing a standard seed match against the "true" seed from the antisense strand of the duplex split. Black lines represent "background" genes that do not have a standard seed match for the antisense strand. Red lines represent genes with a mer8 standard seed match for the antisense strand. Blue lines represent genes with a mer7 (m8) standard seed match. Yellow lines represent genes with a mer7 (A1) standard seed match for the antisense strand. Figure 2A shows the off-target effects of AD-1637760, AD-1637761, and AD-1637762. Figure 2B shows the off-target effects of AD-1637763, AD-1637764, and AD-1637765. [Figure 2A-2] Same as above. [Figure 2A-3] Same as above. [Figure 2B-1] Same as above. [Figure 2B-2] Same as above. [Figure 2B-3] Same as above. [Figure 3] Figures 3A-3B show NHP screening in various tissues at 29 days post-treatment compared with treatment with aCSF for the effect on MAPT mRNA expression (Figure 3A is a dot plot, and Figure 3B is a bar graph). [Figure 4] Figures 4A-4B show NHP screening in various tissues at 29 days post-treatment compared with treatment with aCSF for the effect on tau protein expression (Figure 4A is a dot plot, and Figure 4B is a bar graph). [Figure 5]FIG. 5 shows NHP screening in various tissues 113 days after treatment compared with treatment with aCSF for the effect on MAPT mRNA expression. [Figure 6] FIG. 6 shows NHP screening in various tissues 113 days after treatment compared with treatment with aCSF for the effect on tau protein expression. [Figure 7A] Figures 7A-7C show pharmacology data from the NHP screen for all tissues correlated with duplex concentrations measured to the lower limit of quantitation (LLOQ). Figure 7A shows the correlation for MAPT mRNA persistence at 29 days post-treatment, including the IC50 determined for each duplex. Figure 7B shows the correlation for MAPT mRNA persistence at 113 days post-treatment. Figure 7C shows the correlation for tau protein persistence at 113 days post-treatment. [Figure 7B] Same as above. [Figure 7C] Same as above. DETAILED DESCRIPTION OF THE INVENTION
[0132] The present disclosure provides RNAi compositions that perform RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the MAPT gene. The MAPT gene may be present in a cell, for example, in a subject, such as a human. The use of these iRNAs allows for targeted degradation of the mRNA of the corresponding gene (MAPT gene) in a mammal.
[0133] The iRNA of the present invention is designed to target the MAPT gene, for example, the MAPT gene with nucleotide modification or the MAPT gene without nucleotide modification. The iRNA of the present invention inhibits the expression of the MAPT gene by at least about 25% and reduces the level of sense and antisense-containing foci. Without intending to be bound by theory, it is believed that the combination or subcombination of the above-mentioned features with specific target sites or specific modifications in these iRNAs improves the efficacy, stability, potency, durability and safety of the iRNA of the present invention.
[0134] Thus, the present disclosure also provides methods of using the RNAi compositions of the present disclosure for inhibiting expression of the MAPT gene or for treating a subject having a disorder that would benefit from inhibiting or reducing expression of the MAPT gene, such as a MAPT-associated disease, such as Alzheimer's disease, FTD, PSP or other tauopathies.
[0135] RNAi agents of the present disclosure can be about 30 nucleotides in length or less, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23 , 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length (antisense strand), which region is substantially complementary to at least a portion of an mRNA transcript of the MAPT gene, e.g., a MAPT exon. In certain embodiments, the RNAi agent of the present disclosure comprises an RNA strand (antisense strand) having a region that is about 21-23 nucleotides in length, which region is substantially complementary to at least a portion of an mRNA transcript of the MAPT gene.
[0136] In certain embodiments, RNAi agents of the present disclosure include an RNA strand (antisense strand) that is long, e.g., up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, having a region of at least 19 contiguous nucleotides that is substantially complementary to at least a portion of an mRNA transcript of the MAPT gene. These RNAi agents with longer antisense strands preferably include a second RNA strand (sense strand) that is 20-60 nucleotides in length, where the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
[0137] The use of these RNAi agents allows for targeted degradation and / or targeted inhibition of the mRNA of the MAPT gene in mammals. Thus, methods and compositions comprising these RNAi agents are useful for treating subjects who would benefit from reduced tau levels or activity, such as subjects with MAPT-related diseases, such as Alzheimer's disease, FTD, PSP, or other tauopathies.
[0138] The detailed description below discloses methods for making and using compositions containing RNAi agents that inhibit expression of the MAPT gene, as well as compositions and methods for treating subjects with diseases and disorders that would benefit from inhibiting or reducing expression of the gene.
[0139] I. Definition In order that this disclosure may be more readily understood, certain terms are first defined. Additionally, whenever a value or range of values for a parameter is listed, it is intended that values and ranges intermediate to the listed values are also intended to be part of this disclosure.
[0140] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or to more than one element, e.g., a plurality of elements.
[0141] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.
[0142] The term "about" is used herein to mean within a typical tolerance in the art. For example, "about" shall be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is before a series of numbers or ranges, it is understood that "about" modifies each of the consecutive numbers or ranges.
[0143] The term "at least" before a number or a series of numbers, if clear from the context, is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that may be logically included. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the specified property. When "at least" is before a series of numbers or ranges, it is understood that "at least" modifies each of the series of numbers or ranges.
[0144] As used herein, "less than or equal to" or "or less than" refers to the value adjacent to the phrase and, if logical from the context, to zero, any logically smaller value or integer than that value. For example, a duplex with an overhang of "2 nucleotides or less" has an overhang of 2, 1, or 0 nucleotides. When "less than or equal to" is used before a series of numbers or ranges, it is understood that "less than or equal to" modifies each of the series of numbers or ranges.
[0145] As used herein, when referring to a measurable value of a parameter, quantity, etc., the term "at least about" means encompassing a variation of ±20%, preferably ±10%, more preferably ±5%, and even more preferably ±1% from the specified value, so long as such variation is appropriate for practicing the disclosed invention. For example, inhibiting expression of the MAPT gene by "at least about 25%" means that inhibition of expression of the MAPT gene can be measured to be any value within ±20% of the specified 25%, i.e., 20%, 30%, or any intermediate value between 20% and 30%.
[0146] As used herein, "control level" refers to the expression level of a gene, or the expression level of an RNA molecule, or the expression level of one or more proteins or protein subunits in a non-regulated cell, tissue, or system identical to the cell, tissue, or system in which the RNAi agent described herein is expressed. The cell, tissue, or system in which the RNAi agent is expressed has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, or more expression of the above-mentioned gene, RNA, and / or protein observed in the absence of the RNAi agent. The percentage and / or fold difference shall be calculated relative to the control level, for example, as follows:
number
[0147] As used herein, a method of detection includes determining that the amount of analyte present is below the detection level of the method.
[0148] In the event of a conflict between a given target site and the nucleotide sequence for either the sense or antisense strand, the given sequence controls.
[0149] If the chemical structure and chemical name do not match, the chemical structure takes precedence.
[0150] The "MAPT" gene, also known as "DDPAC," "FTDP-17," "MAPTL," "MSTD," "MTBT1," "MTBT2," "PPND," "PPP1R103," "TAU," and "microtubule-associated protein tau," refers to the gene encoding a protein called microtubule-associated protein tau (MAPT).
[0151] MAPT mRNA is expressed throughout the body, primarily in the central nervous system (i.e., brain and spinal cord) and peripheral nervous system. Wild-type tau is involved in stabilizing microtubules in neuronal axons, regulating axonal transport and microtubule dynamics, maintaining dendritic spines, and contributing to genomic DNA integrity.
[0152] Tauopathies are heterogeneous, progressive neurodegenerative disorders pathologically characterized by the presence of tau aggregates in the brain. Intracellular and extracellular tau aggregates lead to microtubule disassembly and axonal degeneration, impair synaptic vesicle release, and induce prion-like interneuronal spread of tau aggregates, termed "seeding."
[0153] Phenotypically, tauopathies show various progressions of motor, cognitive, and behavioral disorders. Tauopathies include, but are not limited to, Alzheimer's disease, the most common type of presenile dementia, which begins with selective memory impairment and is associated with degeneration of the frontal lobe (including the hippocampus) and parietal lobe of the brain; frontotemporal dementia (FTD), the second most common type of presenile dementia, which is associated with neuronal atrophy of the frontal and temporal lobes and presents with a spectrum of behavioral, language, and motor disorders; and progressive supranuclear palsy (PSP), which is a brainstem and basal ganglia disorder that presents with gaze dysfunction, extrapyramidal symptoms (including limb apraxia, akinesia / bradykinesia, rigidity, and dystonia, Parkinson's symptoms) and cognitive dysfunction, affecting approximately 20,000 people in the United States.
[0154] FTDs include, but are not limited to, behavioral frontotemporal dementia (bvFRD), which affects approximately 30,000 people in the United States and is pathologically associated with progressive atrophy of the frontal and anterior temporal lobes and clinically associated with complex thinking, personality, and behavioral changes; primary progressive aphasia-semantic (PPA-S), which is frontal and temporal lobe degeneration associated with difficulty comprehending language and inability to recall names; progressive non-fluent aphasia with left posterior frontal and insular degeneration (nfvPPA), which affects approximately 1,000 people in the United States and is manifested by poor grammar and inability to understand complex sentences; and primary progressive vulgar aphasia, which is left posterior / spur temporal and medial parietal lobe degeneration, which results in difficulty recalling words and frequent silences. These include: phasic-logopenic aphasia-logopenic dementia (PPA-L); frontotemporal dementia with Parkinson's disease (FTDP-17) linked to chromosome 17, which is pathologically associated with frontal and temporal lobe degeneration and clinically associated with speech and movement disorders; Pick's disease (PiD), which involves frontal and temporal lobe degeneration and is associated with language impairment, thinking difficulties, and behavioral changes; FTD with motor neuron disease, which involves cortical and motor neuron degeneration; and corticobasal ganglia syndrome (CBS), which affects approximately 2,000 people in the United States and involves degeneration of the posterior frontal and temporal lobes and basal ganglia (i.e., corticobasal degeneration), presenting with extrapyramidal symptoms (similar to Parkinson's disease and PSP) and cognitive impairment. MAPT mutations have been reported in approximately 10% of patients with bvFTD, nfvPPA, CBS, and PSP, respectively. MAPT is a major component of neurofibrillary tangles in the cytoplasm of neurons and is a hallmark of Alzheimer's disease. MAPT aggregates and deposits have also been observed in approximately 50% of brains of Parkinson's disease patients.Tau has been implicated in the pathology of other diseases, including, but not limited to, argyrophilic grain disease (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with small globular glial inclusions (FTLD with GGL), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), postencephalitic Parkinson's disease, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS).
[0155] The MAPT gene consists of 16 exons (E1-E16). Alternative mRNA splicing of E2, E3, and E10 gives rise to six tau isoforms (352-441 amino acids). E1, E4, E5, E7, E9, E11, E12, and E13 are constitutively spliced exons. E6 and E8 are not transcribed in the human brain. E4a is expressed only in the peripheral nervous system. E0 (part of the promoter) and E14 are non-coding exons.
[0156] Pathogenic variants in MAPT are found in approximately 10% of patients with primary tauopathies. These variants are primarily missense and located in exons 9–13 (microtubule-binding domain), with many affecting alternative splicing of exon 10. Examples of mutations in the coding region include R5H and R5L in E1 of the MAPT gene, K257T, I260V, L266V, G272V, and G273R in E9, and N279K, L284L, ΔN296, N296N, N296H, ΔN298, P301L, P301S, P301T, G303V, G304S, and S305 in E10. These include I, S305N and S305S, L315R, K317M, S320F, P332S at E11, G335S, G335V, Q336R, V337M, E342V, S352L, S356T, V363I, P364S, G366R and K369I at E12, and G389R, R406W and T427M at E13. MAPT(tau) null (- / -) individuals are unlikely to survive. MAPT heterozygous (+ / -) individuals have an unclear or unknown phenotype. MAPT overexpression (+ / + / +) individuals is associated with early-onset dementia, FTD, PSP, and CBD.
[0157] Each of the six isoforms of MAPT (tau) protein contains three or four repeat segments (R1, R2, R3, and R4) within its microtubule-binding domain. Each repeat is 31 or 32 amino acids long. Splicing of E9, E10, E11, and E12 generates the repeat segments R1, R2, R3, and R4, respectively, within the microtubule-binding domain of MAPT. The three MAPT (tau) isoforms in which E10 is spliced in contain four repeat segments (4R), while the other three MAPT isoforms in which E10 is spliced out contain three repeat segments (3R).
[0158] Translation of E2 and E3 produces the N1 and N2 segments, respectively. Alternative splicing of E2 and E3 produces tau isoforms 0N (E2 and E3 are spliced out, resulting in no N segment), 1N (E2 is spliced in and E3 is spliced out, resulting in one N segment), and 2N (E2 and E3 are spliced in, resulting in two N segments). Thus, the six MAPT (tau) isoforms resulting from alternative splicing are 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, and 0N3R.
[0159] In healthy individuals, 3R and 4R MAPT transcript isoforms exist in a 1:1 ratio. The 3R / 4R isoform ratio is distorted in disease states, predicting the type of tau aggregation. The assembly of four-repeat tau into filaments is a hallmark of PSP, CBD, argyrophilic grain disease (AGD), multisystem tauopathy with presenile dementia (MSTD), and white matter tauopathy with small globular glial inclusions (FTD), which belong to the FTD spectrum (4R tauopathy). In contrast, in Pick's disease, three-repeat tau predominates within the neuronal endoplasmic reticulum (3R tauopathy). In Alzheimer's disease and other neurodegenerative diseases with neurofibrillary tangles (NFT dementia), three- and four-repeat tau isoforms constitute the neurofibrillary lesions (3 / 4R tauopathy). FTLD with MAPT mutations can be a 3R, 4R, or 3 / 4R tauopathy.
[0160] FTD with motor neuron disease is associated with FTLD-TDP43 and FTLD-FUS pathology, which is associated with mutations in the C9ORF72, FUS, TARDBP, and VCP genes.
[0161] bvFTD is associated with FTLD-tau(3R) and FTLD-TDP43 pathology. 10% of cases have MAPT mutations, which are associated with mutations in the C9ORF72, GRN, and VCP genes.
[0162] PPA-S can be sporadic and is associated with FTLD-TDP43 pathology.
[0163] nfvPPA is associated with, in order of significance, FTLD-tau(4R), Alzheimer's disease, and FTLD-TDP43 pathology. 10% of cases are associated with MAPT mutations. nfvPPA is further associated with mutations in GRN.
[0164] PPA-L can be sporadic. It is associated, in order of significance, with Alzheimer's disease and FTLD-tau pathology.
[0165] CBS is associated with, in order of significance, FTLD-tau(4R) and Alzheimer's disease pathology. 10% of cases are associated with MAPT mutations. The remaining cases may be sporadic.
[0166] PSP is associated with FTLD-tau(4R) pathology. 10% of cases are associated with MAPT mutations. The remaining cases may be sporadic.
[0167] Tauopathies typically begin between the ages of 60 and 80 and affect the remaining 6–10 years of life. Tauopathies are phenotypically heterogeneous and are associated with a variety of motor, cognitive, and behavioral disorders. In particular, the progression of motor symptoms varies.
[0168] There are currently no approved disease-modifying therapies for tauopathies. Available treatments are aimed only at alleviating symptoms and improving patients' quality of life as the disease progresses. Drugs in preclinical or clinical development include active and passive immunotherapies; inhibitors of O-deglycosylation, aggregation, kinases, acetylation, caspases, or tau expression; phosphatase activators, microtubule stabilizers, and modulators of autophagy or proteosomal degradation. Biomarkers and tests used in clinical trials to assess tauopathies include tau protein phosphorylated at threonine 181 (pTau), total tau protein (tTau), neurofilament light chain (NfL), and volumetric MRI (vMRI).
[0169] Examples of MAPT nucleotide and amino acid sequences are listed, for example, in GenBank Accession No. NM_016841.4 (Homo sapiens MAPT variant 4, SEQ ID NO: 1, reverse complement, SEQ ID NO: 2); GenBank Accession No. NM_005910 (Homo sapiens MAPT variant 2, SEQ ID NO: 3, reverse complement, SEQ ID NO: 4); GenBank Accession No. NM_001038609.2 (Mus musculus MAPT, SEQ ID NO: 5; reverse complement, SEQ ID NO: 6); GenBank Accession No. XM_005584540.1 (Macaca fascicularis MAPT variant X13, SEQ ID NO: 7, reverse complement, SEQ ID NO: 8); GenBank Accession No. XM_008768277.2 (Rattus norvegicus MAPT, variant X7, SEQ ID NO: 9, reverse complement, SEQ ID NO: 10) and GenBank Accession No. XM_005624183.3 (Canis lupus MAPT variant X23, SEQ ID NO:11, reverse complement, SEQ ID NO:12).
[0170] The nucleotide sequence of the genomic region of a human chromosome carrying the MAPT gene can be found, for example, in Genome Reference Consortium Human Build 38 (also referred to as Human Genome build 38 or GRCh38), available at GenBank. The nucleotide sequence of the genomic region of human chromosome 17 carrying the MAPT gene can also be found, for example, in GenBank accession number NC_000017.11, which corresponds to nucleotides 45894382-46028334 of human chromosome 17. The nucleotide sequence of the human MAPT gene can be found, for example, in GenBank accession number NG_007398.2.
[0171] Further examples of MAPT sequences are found in publicly available databases such as GenBank, OMIM, and UniProt.
[0172] Additional information regarding MAPT can be found, for example, at the NCBI website, which references gene 100128977. As used herein, the term MAPT also refers to variations in the MAPT gene, including variants provided in clinical variant databases, for example, the NCBI clinical variant website, which references the term mapt.
[0173] The entire contents of each of the foregoing GenBank Accession Numbers and Gene Database Numbers are incorporated herein by reference as of the filing date of this application.
[0174] As used herein, "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the MAPT gene, such as an mRNA that is a product of RNA processing of a primary transcript (e.g., MAPT mRNA resulting from alternative splicing).In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near a portion of the nucleotide sequence of an mRNA molecule formed during transcription of the MAPT gene.
[0175] The target sequence is about 15-30 nucleotides in length. For example, the target sequence can be about 15-30 nucleotides in length, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19 21-23 nucleotides, or 21-22 nucleotides. In certain embodiments, the target sequence is 19-23 nucleotides in length, optionally 21-23 nucleotides in length. Ranges and lengths between the ranges and lengths listed above are also intended to be part of this disclosure.
[0176] As used herein, the term "strand containing a sequence" refers to an oligonucleotide containing a chain of nucleotides described by a sequence referenced using standard nucleotide nomenclature. "G", "C", "A", "T", and "U" generally refer to nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively, in the context of modified or unmodified nucleotides. However, it will be understood that the term "ribonucleotide" or "nucleotide" also refers to modified nucleotides, as described in more detail below, or alternative replacement moieties (see, for example, Table 2). Those skilled in the art are well aware that guanine, cytosine, adenine, thymidine, and uracil can be substituted with other moieties without substantially changing the base pairing properties of oligonucleotides containing nucleotides with such replacement moieties. For example, but not limited to, a nucleotide containing inosine as its base will base pair with a nucleotide containing adenine, cytosine, or uracil. Therefore, the nucleotide that contains uracil, guanine or adenine can be replaced with the nucleotide that contains inosine in the nucleotide sequence of the dsRNA described in the present disclosure.In another embodiment, the adenine and cytosine at any position in oligonucleotide can also be replaced with guanine and uracil, respectively, to form the GU wobble base that pairs with target mRNA.The sequence that contains such replacement part is suitable for the composition and method described in the present disclosure.
[0177] As used herein interchangeably, the terms "iRNA", "RNAi agent", "iRNA agent", "RNA interference agent" refer to an agent that contains RNA as defined herein and mediates the targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway.RNA interference (RNAi) is the process that controls the sequence-specific degradation of mRNA.RNAi regulates, for example, inhibits, the expression of MAPT in cells, for example, in cells of a subject, such as a mammalian subject.
[0178] In one embodiment, the RNAi agent of the present disclosure comprises a single-stranded RNAi that interacts with a target RNA sequence, e.g., a MAPT target mRNA sequence, to mediate cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNAs introduced into cells are degraded into double-stranded small interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, an RNase III-like enzyme, processes the dsRNA into 19-23 base pair small interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, thereby allowing target recognition to be induced by the complementary antisense strand (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188). That is, in one aspect, the present disclosure relates to a single-stranded RNA (ssRNA) (the antisense strand of the siRNA duplex) that is produced in cells and promotes the formation of a RISC complex to silence the target gene, i.e., the MAPT gene. Therefore, the term "siRNA" is used herein to also refer to the RNAi described above.
[0179] In another embodiment, the RNAi agent can be a single-stranded RNA introduced into a cell or organism to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and chemically modified. The design and testing of single-stranded RNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as the single-stranded siRNA described herein or as the single-stranded siRNA that is chemically modified by the method described in Lima et al., (2012) Cell 150:883-894.
[0180] In another embodiment, the "RNAi agent" used in the compositions and methods of the present disclosure is double-stranded RNA, and is also referred to herein as "double-stranded RNAi agent", "double-stranded RNA (dsRNA) molecule", "dsRNA agent" or "dsRNA". The term "dsRNA" refers to a complex of ribonucleic acid molecules with a double-stranded structure, comprising two antiparallel, substantially complementary nucleic acid strands, which are referred to as having "sense" or "antisense" orientation with respect to target RNA, i.e., MAPT gene. In some embodiments of the present disclosure, double-stranded RNA (dsRNA) induces the degradation of target RNA, for example, mRNA, through a post-transcriptional gene silencing mechanism, herein referred to as RNA interference or RNAi.
[0181] Generally, dsRNA molecules contain ribonucleotides, but as described in detail herein, each or both strands contain one or more non-ribonucleotides, such as deoxyribonucleotides, modified nucleotides.In addition, as used herein, "RNAi agent" can include ribonucleotides with chemical modifications, and RNAi agents can contain substantial modifications in multiple nucleotides.As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase.Therefore, the term modified nucleotide encompasses the substitution, addition, or removal of, for example, functional groups or atoms, etc., to the internucleoside linkage, sugar moiety, or nucleobase.The modifications suitable for use in the agent of the present disclosure include all types of modifications disclosed herein or known in the art.Any such modifications used in siRNA-type molecules are encompassed by "RNAi agent" for the purposes of this specification and claims.
[0182] In certain embodiments of the present disclosure, the inclusion of deoxy-nucleotides, if present within an RNAi agent, is considered to constitute a modified nucleotide.
[0183] The double-stranded region can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can range from about 15 to 36 base pairs in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, for example, about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-31, 18-32, 18-33, 18-34, 18-35, 18-36, 18-37, 18-38, 18-39, 18-40, 18-41, 18-42, 18-43, 18-44, 18-45, 18-46, 18-47, 18-48, 18-49, 18-50, 18-51, 18-52, 18-53, 18-54, 18-55, 18-56, 18-57, 18-58, 18-59, 18-60, 18-61, 18-62, 18-63, 18-64, 18-65, 18-66, The length may be about 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 base pairs, or about 21-22 base pairs, etc. In certain embodiments, the double-stranded region is 19-21 base pairs in length, e.g., 21 base pairs in length. Ranges and lengths between the ranges and lengths listed above are also intended to be part of this disclosure.
[0184] The two strands forming the double-stranded structure can be different portions of a larger RNA molecule, or they can be separate RNA molecules. When the two strands are portions of a larger molecule and are therefore connected by an uninterrupted chain of nucleotides between the 3' end of one strand and the corresponding 5' end of the other strand, the connected RNA strands are called "hairpin loops." A hairpin loop contains at least one unpaired nucleotide. In some embodiments, a hairpin loop contains at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23, or more unpaired nucleotides or nucleotides not directed toward the target site of the dsRNA. In some embodiments, a hairpin loop is 10 or fewer nucleotides. In some embodiments, a hairpin is 8 or fewer unpaired nucleotides. In some embodiments, a hairpin loop is 4-10 unpaired nucleotides. In some embodiments, a hairpin loop is 4-8 nucleotides.
[0185] When the two substantially complementary strands of dsRNA are composed of separate RNA molecules, these molecules can, but do not necessarily, be covalently linked. In certain embodiments, when the two strands are covalently linked by means other than an uninterrupted chain of nucleotides between the 3'-end of one strand and the corresponding 5'-end of the other strand that form a double-stranded structure, the connecting structure is called a "linker" (note, however, that other specific structures as defined elsewhere herein are also called "linkers"). The RNA strands can have the same or different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs present in the duplex. In addition to the duplex structure, the RNAi can include one or more nucleotide overhangs. In one embodiment of an RNAi agent, at least one strand includes a 3'-overhang of at least one nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides, for example, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5' overhang of at least 2 nucleotides, for example, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3' end and the 5' end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
[0186] In one embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which independently comprises 19-23 nucleotides that interact with a target RNA sequence, e.g., a MAPT target mRNA sequence, to induce cleavage of the target RNA.
[0187] In some embodiments, the iRNA of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, for example, a MAPT target mRNA sequence, and mediates cleavage of the target RNA.
[0188] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of an RNAi agent, such as dsRNA.For example, when the 3'-end of one strand of dsRNA extends beyond the 5'-end of the other strand, or vice versa, a nucleotide overhang exists.DsRNA comprises at least one nucleotide overhang, or the overhang comprises at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more.The nucleotide overhang comprises or consists of nucleotide / nucleoside analogs, such as deoxynucleotides / nucleosides.The overhang may be on the sense strand, on the antisense strand, or any combination thereof.In addition, some overhanging nucleotides exist on the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand of dsRNA.
[0189] In one embodiment, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3' or 5' end, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3' or 5' end, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In another embodiment, one or more of the nucleotides in the overhang are substituted with a nucleoside thiophosphate.
[0190] In certain embodiments, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3'-end or 5'-end, for example, 0 to 3, 1 to 3, 2 to 4, 2 to 5, 4 to 10, 5 to 10, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3'-end or 5'-end, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In another embodiment, one or more nucleotides in the overhang are substituted with nucleoside thiophosphates.
[0191] In certain embodiments, the overhang on the sense strand or the antisense strand comprises an extended length greater than 10 nucleotides, e.g., a length of 1 to 30 nucleotides, 2 to 30 nucleotides, 10 to 30 nucleotides, or 10 to 15 nucleotides. In certain embodiments, the extended overhang is on the sense strand of the duplex. In certain embodiments, the extended overhang is on the 3'-end of the sense strand of the duplex. In certain embodiments, the extended overhang is on the 5'-end of the sense strand of the duplex. In certain embodiments, the extended overhang is on the antisense strand of the duplex. In certain embodiments, the extended overhang is on the 3'-end of the antisense strand of the duplex. In certain embodiments, the extended overhang is on the 5'-end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang are substituted with a nucleoside thiophosphate. In certain embodiments, the overhang comprises a self-complementary portion that enables the overhang to form a stable hairpin structure under physiological conditions.
[0192] The term "blunt" or "blunt-end" when used herein in relation to dsRNA means that there is no unpaired nucleotide or nucleotide analogue at the predetermined end of dsRNA, that is, there is no nucleotide overhang.One end or both ends of dsRNA are blunt.When both ends of dsRNA are blunt, dsRNA is said to be blunt-ended.For clarity, "blunt-end" dsRNA is the dsRNA that has both ends blunt, that is, there is no nucleotide overhang at either end of the molecule.In most cases, this molecule will be double-stranded throughout its entire length.
[0193] The term "antisense strand" or "guide strand" refers to the strand of an RNAi agent, e.g., dsRNA, that includes a region that is substantially complementary to a target sequence, e.g., MAPT mRNA.
[0194] As used herein, the term "region of complementarity," as defined herein, refers to a region on the antisense strand that is substantially complementary to a sequence, for example, a target sequence, for example, a MAPT nucleotide sequence. If the complementary region is not completely complementary to the target sequence, the mismatch is in the internal or terminal region of the molecule. Generally, the most tolerable mismatch is in the terminal region, for example, within 5, 4, 3, or 2 nucleotides of the 5' or 3' end of the RNAi agent. In some embodiments, the double-stranded RNA agent of the present invention comprises a nucleotide mismatch in the antisense strand. In some embodiments, the antisense strand of the double-stranded RNA agent of the present invention comprises 4 or less mismatches with the target mRNA, for example, the antisense strand comprises 4, 3, 2, 1, or 0 mismatches with the target mRNA. In some embodiments, the antisense strand of the double-stranded RNA agent of the present invention comprises 4 or less mismatches with the sense strand, for example, the antisense strand comprises 4, 3, 2, 1, or 0 mismatches with the sense strand. In some embodiments, the double-stranded RNA agent of the present invention contains a nucleotide mismatch in the sense strand. In some embodiments, the sense strand of the double-stranded RNA agent of the present invention contains four or fewer mismatches with the antisense strand, for example, the sense strand contains 4, 3, 2, 1, or 0 mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, or 3 nucleotides from the 3' end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3' terminal nucleotide of the iRNA agent. In some embodiments, the mismatch is not in the seed region.
[0195] Therefore, the RNAi agent described herein contains one or more mismatches to the target sequence. In one embodiment, the RNAi agent described herein contains three or fewer mismatches (i.e., three, two, one, or zero mismatches). In one embodiment, the RNAi agent described herein contains two or fewer mismatches. In one embodiment, the RNAi agent described herein contains one or fewer mismatches. In one embodiment, the RNAi agent described herein contains zero mismatches. In certain embodiments, when the antisense strand of an RNAi agent contains a mismatch to the target sequence, the mismatch is optionally limited to be within the last five nucleotides from either the 5'-end or the 3'-end of the complementary region. For example, in such an embodiment, for a 23-nucleotide RNAi agent, the strand complementary to a region of the MAPT gene generally does not contain any mismatches within the central 13 nucleotides. By using the methods described herein or known in the art, it is determined whether an RNAi agent containing a mismatch to the target sequence is effective in inhibiting the expression of the MAPT gene. For example, Jackson et al. (Nat. Biotechnol. 2003;21:635-637) described an expression profiling study in which the expression of a small number of genes sharing sequence identity with MAPK14 siRNA in only 12–18 nt of the sense strand was downregulated with kinetics similar to MAPK14. Similarly, using qPCR and reporter assays, Lin et al. (Nucleic Acids Res. 2005;33(14):4527-4535) showed that 7 nt of complementarity between siRNA and target was sufficient to trigger target mRNA degradation. It is important to consider the efficacy of mismatched RNAi agents to inhibit MAPT expression, especially when specific regions of complementarity in the MAPT gene are known to have polymorphic sequence variation within the population.
[0196] As used herein, "substantially all of the nucleotides are modified" refers to extensively, but not entirely, modified nucleotides, including no more than 5, 4, 3, 2, or 1 unmodified nucleotides.
[0197] The term "sense strand" or "passenger strand," as used herein, refers to the strand of an RNAi agent that includes a region that is substantially complementary to a region of the antisense strand, as those terms are defined herein.
[0198] As used herein, the term "cleavage region" refers to the region located immediately adjacent to the cleavage site. The cleavage site is the site on the target where cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of the cleavage site and directly adjacent to the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of the cleavage site and directly adjacent to the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and this cleavage region comprises nucleotides 11, 12, and 13.
[0199] As used herein, unless otherwise specified, the term "complementary," when used to describe a first nucleotide sequence in the context of a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize to a double-stranded structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under specified conditions, as understood by those skilled in the art. Such conditions are "stringent conditions," for example, but are not limited to, 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50°C or 70°C for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual," Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). As used herein, "stringent conditions" or "stringent hybridization conditions" refer to conditions under which an antisense compound will hybridize to its target sequence but will hybridize to a minimal number of other sequences. Stringent conditions are sequence-dependent and vary in different circumstances, and the "stringent conditions" under which antisense compounds hybridize to target sequences are determined by the nature and composition of antisense compounds and the assays they are being investigated.Other conditions, such as physiologically relevant conditions encountered in living organisms, may be applied.Those skilled in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the final use of hybridized nucleotides.
[0200] The complementary sequence in RNAi agent, for example, in the dsRNA described herein, comprises the base pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence with the oligonucleotide or polynucleotide comprising the second nucleotide sequence throughout the length of one or both nucleotide sequences.Such sequences are referred to herein as " completely complementary " to each other.However, when the first sequence is referred to herein as " substantially complementary " to the second sequence, these two sequences are completely complementary, or they form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs when hybridizing for a double strand of up to 30 base pairs. In some embodiments, the "substantially complementary" sequence disclosed herein comprises a contiguous nucleotide sequence that is at least about 80% complementary to the corresponding region of the target MAPT sequence over its entire length, for example, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. However, if two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs shall not be considered as mismatches when determining complementarity. For example, a dsRNA comprising one oligonucleotide that is 21 nucleotides in length and another oligonucleotide that is 23 nucleotides in length, where the longer oligonucleotide comprises a 21-nucleotide sequence that is completely complementary to the shorter oligonucleotide, is still referred to as "completely complementary" for the purposes described herein.
[0201] "Complementary" sequences, as used herein, may also include or be formed entirely of non-Watson-Crick base pairs or base pairs formed from non-naturally occurring modified nucleotides, so long as they satisfy the above requirements regarding their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogsteen base pairing.
[0202] The terms "complementary," "fully complementary," and "substantially complementary" are used herein in reference to base matching between the sense and antisense strands of a dsRNA or between the antisense strand of an RNAi agent and a target sequence, as will be understood from the context of their use.
[0203] As used herein, a polynucleotide that is "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous portion of an mRNA of interest (e.g., an mRNA encoding tau). For example, a polynucleotide is complementary to at least a portion of MAPT mRNA if the sequence is substantially complementary to an uninterrupted portion of an mRNA encoding tau.
[0204] Therefore, in some embodiments, the antisense polynucleotide disclosed herein is completely complementary to the target MAPT sequence. In other embodiments, the antisense polynucleotide disclosed herein is substantially complementary to the target MAPT sequence, and comprises a contiguous nucleotide sequence that is at least 80% complementary, for example, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary to the equivalent region of any one of the nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, or to a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, over its entire length.
[0205] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of the target MAPT sequence and comprise a contiguous nucleotide sequence that is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 1 selected from the group of nucleotides 5522-5542 and 5523-5543 of SEQ ID NO: 1, e.g., about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. 506-526, 507-527, 508-528, 509-529, 510-530, 511-531, 512-532, 513-533, 514-534, 515-535, 516-536, 517-537, 518-538, 519-539, 520-540, 521-541, 522-542, 523-543, 524-544, 525-545, 526-544, 526-546, 527-547 7, 528-548, 529-549, 530-550, 531-551, 532-552, 533-553, 969-989, 970-990, 971-991, 972-992, 973-993, 974-994, 975-995, 976-996, 977-997, 978-997, 978-998, 979-997, 979-999, 980-1000, 981-1001, 982-1002, 98 3~1003, 984~1004, 985~1003, 985~1005, 986~1006, 987~1007, 988~1008, 989~1009, 990~1010, 1069~1089, 1070~1090, 1071~1091, 1072~1092, 1073~1093, 1074~1094, 1075~1095, 1076~1096, 1077~1095, 1077~1097, 1078 ~1098, 1079-1099, 1080-1100, 1081-1101, 5511-5531, 5512-5532, 5513-5533, 5514-5534, 5515-5535, 5516-5536, 5517-5537, 5518-5538, 5519-5539, 5520-5540, 5521-5541, and ranges intermediate to the above-listed ranges are also contemplated as part of this disclosure.
[0206] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target MAPT sequence and comprise a contiguous nucleotide sequence that is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 3 selected from the group consisting of nucleotides 1072-1092, 1067-1087, and 514-534 of SEQ ID NO: 3, e.g., about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. Ranges intermediate to the above-listed ranges are also contemplated as part of the present disclosure.
[0207] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a target MAPT sequence and comprise a contiguous nucleotide sequence that is at least about 80% complementary, e.g., about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary, over its entire length, to any one of the sense strand nucleotide sequences of any one of Tables 3-6, or to a fragment of any one of the sense strand nucleotide sequences of any one of Tables 3-6.
[0208] In one embodiment, the RNAi agent of the present disclosure comprises a sense strand that is substantially complementary to an antisense polynucleotide, and thus the antisense polynucleotide is identical to the target MAPT sequence, and the sense strand polynucleotide comprises a contiguous nucleotide sequence that is at least about 80% complementary, for example, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, or to a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, over its entire length.
[0209] In some embodiments, an iRNA of the invention comprises a sense strand that is substantially complementary to an antisense polynucleotide, and thus the antisense polynucleotide is complementary to a target MAPT sequence, and the sense strand polynucleotide comprises a contiguous nucleotide sequence that is at least about 80% complementary, e.g., about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary over its entire length to any one of the antisense strand nucleotide sequences in any one of Tables 3-6, or to a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 3-6.
[0210] In certain embodiments, the sense and antisense strands are duplexed as follows: AD-1397070, AD-1397072, AD-1397073, AD-1397075, AD-1397081, AD-1397083, AD-1397088, AD-1397249, AD-1397252, AD-1397253, AD-1397258, AD-1397261, AD-1397262, AD-1397263, AD-1397291, AD-1397293, AD-1397294, AD-1397295, AD-1397298, AD-139729 9, AD-1637732, AD-1637733, AD-1637734, AD-1637735, AD-1637736, AD-1637737, AD-1637739, AD-1637744, AD-1637745, AD-1637746, AD-1637747, AD -1637748, AD-1637749, AD-1637750, AD-1637751, AD-1637752, AD-1637753, AD-1637754, AD-1637755, AD-1637756, AD-1637757, AD-1637758, AD-163 7759, AD-1637760, AD-1637761, AD-1637762, AD-1637763, AD-1637764, AD-1637765, AD-1637766, AD-1637767, AD-1637768, AD-1637769, AD-1637770 , AD-1637771, AD-1637772, AD-1637773, AD-1637774, AD-1637775, AD-1637776, AD-1637777, AD-1637778, AD-1637779, AD-1637780, AD-1637781, AD- 1637782, AD-1637783, AD-1637784, AD-1637785, AD-1637786, AD-1637787, AD-1637788, AD-1637789, AD-1637790, AD-1637791, AD-1637792, AD-1637 793, AD-1637794, AD-1637795, AD-1637796, AD-1637797, AD-1637798, AD-1637799, AD-1637800, AD-1637801, AD-1637802, AD-1637803, AD-1637804,AD-1637805、AD-1637806、AD-1637807、AD-1637808、AD-1637809、AD-1637810、AD-1637811、AD-1637812、AD-1637813、AD-1637814、AD-1637815、AD-1637816、AD-1637817、AD-1637818、AD-1637819、AD-1637820、AD-1637821、AD-1637822、AD-1637823、AD-1637824、AD-1637825、AD-1637826、AD-1637827、AD-1637828、AD-1637829、AD-1637830、AD-1637831、AD-1637832、AD-1637833、AD-1637834、AD-1637835、AD-1637836、AD-1637837、AD-1637838、AD-1637839、AD-1637840、AD-1637841、AD-1637842、AD-1637843、AD-1637844、AD-1637845、AD-1637846、AD-1637847、AD-1637848、AD-1637849、AD-1637850、AD-1637851、AD-1637852、AD-1637853、AD-1637854、AD-1637855、AD-1637856、AD-1637857、AD-1637858、AD-1637859、AD-1637860、AD-1637861、AD-1637862、AD-1637863、AD-1637864、AD-1637865、AD-1637866、AD-1637867、AD-1637868、AD-1637869、AD-1637870、AD-1637871、AD-1637872、AD-1637873、AD-1637874、AD-1637875、AD-1637876、AD-1637877、AD-1637878、AD-1637879、AD-1637880、AD-1637881、AD-1637882、AD-1637883、AD-1637884、AD-1637885、AD-1637886、AD-1637887、AD-1637888、AD-1637889、AD-1637890、AD-1637891、AD-1637892、AD-1637893、AD-1637894、AD-1637895、AD-1637896, AD-1637897, AD-1637898, AD-1637899, AD-1637900, AD-1637901, AD-1637902, AD-1637903, AD-1637904, AD-1637905, AD-1637906, AD-1637907, AD-1637908, AD-1637909, AD-1637910, AD-1637911, AD-1637912, AD-1637913, A D-1637914, AD-1637915, AD-1637916, AD-1637917, AD-1637918, AD-1637919, AD-1637920, AD-1637921, AD-1637922, A D-1637923, AD-1637924, AD-1637925, AD-1637926, AD-1637927, AD-1637928, AD-1637929, AD-1637930, AD-1637931, AD -1637932, AD-1637933, AD-1637934, AD-1637935, AD-1637936, AD-1637937, AD-1637938, AD-1637939, AD-1637940, AD -1637941, AD-1637942, AD-1637943, AD-1637944, AD-1637945, AD-1637946, AD-1637947, AD-1637948, AD-1637949, AD- 1637950, AD-1637951, AD-1637952, AD-1637953, AD-1637954, AD-1637955, AD-1637956, AD-1637957, AD-1637958, AD-1637959, AD-1637960, AD-397167, AD-523565, AD-1623140, AD-1637701, AD-1786708 and AD-1786708v2. In certain embodiments, the sense and antisense strands are selected from the group consisting of AD-1637922, AD-1637806, AD-1637762, AD-1637777, AD-1637779, AD-1397081, AD-1637793, AD-1637798, AD-1637807, AD-1637829, AD-1637831, AD-1637840, AD-1637841, AD-1637855,In certain embodiments, the duplex is selected from the group consisting of AD-1623140, AD-1786708, and AD-1637701. In certain embodiments, the duplex is AD-1623140. In certain embodiments, the duplex is AD-1786708. In certain embodiments, the duplex is AD-1786708.
[0211] In one embodiment, at least partial suppression of MAPT gene expression is assessed by a decrease in the amount of MAPT mRNA, e.g., sense mRNA, antisense mRNA, total MAPT mRNA, isolated from or detected in a first cell or group of cells in which the MAPT gene is transcribed and which has been treated to inhibit expression of the MAPT gene, compared to a second cell or group of cells (control cells) that is substantially identical to the first cell or group of cells but has not been treated in the same manner as the first cell or group of cells. The degree of inhibition can be expressed as follows:
number
[0212] As used herein, the phrase " contacting cell with RNAi agent " such as dsRNA includes contacting cell by any possible means.Contacting cell with RNAi agent includes contacting cell with RNAi agent in vitro or contacting cell with RNAi agent in vivo.Contacting can be carried out directly or indirectly.Therefore, for example, RNAi agent can be physically contacted with cell by carrying out a method separately, or RNAi agent can be placed in a situation that can allow or cause it to contact cell afterwards.
[0213] Contacting cells in vitro can be carried out, for example, by incubating cells with an RNAi agent. Contacting cells in vivo can be carried out, for example, by injecting an RNAi agent into or near the tissue where the cells are located, or by injecting the RNAi agent into another region, for example, the CNS, optionally by intrathecal injection, intravitreal injection, intravesical injection, or other injection, or by injecting the RNAi agent into the bloodstream or subcutaneous space, so that the agent then reaches the tissue where the cells to be contacted are located. For example, the RNAi agent can contain or be coupled to a ligand that directs or otherwise stabilizes the RNAi agent to the desired site, for example, in the CNS, for example, a lipophilic moiety, as described below and further detailed in, for example, PCT / US2019 / 031170, which is incorporated herein by reference. A combination of in vitro and in vivo contacting methods is also possible. For example, cells can be contacted with an RNAi agent in vitro and then transferred to a subject.
[0214] In one embodiment, contacting a cell with an RNAi agent includes "introducing" or "delivering an RNAi agent into a cell" by promoting or performing uptake or absorption into the cell. The absorption or uptake of the RNAi agent occurs by spontaneous diffusive or active cellular processes, or by auxiliary agents or devices. The introduction of an RNAi agent into a cell can be in vitro or in vivo. For example, in the case of in vivo introduction, the RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction into a cell can include methods known in the art, such as electroporation and lipofection. Further approaches are described herein below or known in the art.
[0215] The terms "lipid-soluble" or "lipophilic moiety" refer broadly to any compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is the octanol-water partition coefficient, log K ow In this case, K ow is the ratio of the concentration of a chemical in the octanol phase to the concentration of the chemical in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it can also be predicted by using coefficients attributable to the structural components of a chemical calculated using first principles or empirical methods (see, e.g., Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), incorporated herein by reference in its entirety). It provides a thermodynamic measure of a substance's tendency to prefer a non-aqueous or oily environment rather than water (i.e., its hydrophilic / lipophilic balance). In principle, a chemical can be expressed as its logK ow is greater than 0, the molecule is lipophilic in nature. Typically, a lipophilic moiety has a logK ow For example, the log K of 6-aminohexanol ow For example, the log K of cholesteryl N-(hexan-6-ol)carbamate is predicted to be approximately 0.7. ow is predicted to be 10.7.
[0216] The lipophilicity of a molecule varies depending on the functional groups it contains. For example, adding a hydroxyl or amine group to the end of a lipophilic moiety increases the partition coefficient (e.g., logK ow ) may increase or decrease in value.
[0217] Alternatively, the hydrophobicity of the double-stranded RNAi agent that is conjugated with one or more lipophilic moieties is measured by its protein binding property.For example, in certain embodiments, if the unbound fraction of the plasma protein binding assay of double-stranded RNAi agent is determined to be positively correlated with the relative hydrophobicity of double-stranded RNAi agent, then it will be positively correlated with the silencing activity of double-stranded RNAi agent.
[0218] In one embodiment, the plasma protein binding assay to be determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol for this binding assay is described in detail, for example, in PCT / US2019 / 031170. Briefly, the duplex was incubated with human serum albumin, and the unbound fraction was determined. An exemplary assay protocol involves a 10 μM stock concentration of duplex diluted to a final concentration of 0.5 μM (total volume of 20 μL) in 1×PBS containing 0, 20, or 90% serum. The sample is mixed and centrifuged for 30 seconds, followed by incubation at room temperature for 10 minutes. Upon completion of the incubation step, 4 μL of 6×EMSA gel loading solution is added to each sample, centrifuged for 30 seconds, and 12 μL of each sample is loaded into a 26-well BioRad 10% PAGE (polyacrylamide gel electrophoresis) plate. The gel is run at 100 volts for 1 hour. After the run was completed, the gel was removed from the casing and washed with 50 mL of 10% TBE (Tris base, boric acid, and EDTA). Once the wash was complete, 5 μL of SYBR Gold was added to the gel, which was then incubated at room temperature for 10 minutes. The gel was then washed again in 50 mL of 10% TBE. For this exemplary assay, the gel can be read using a Gel Doc XR+ gel documentation system with the following parameters: the imaging application set to SYBR Gold, the size set to Bio-Rad reference gel, the exposure set to auto for intense bands, highlight saturated pixels set to one, and the color set to gray. Detection, molecular weight analysis, and output are all stopped. Once a clean picture of the gel was obtained, the image could be processed using Image Lab 5.2. Lanes and bands were manually configured to measure band intensity. The band intensity for each sample was normalized to PBS to obtain the percentage of unbound siRNA. From this measurement, the relative hydrophobicity was determined.The hydrophobicity of the double-stranded RNAi agent, as measured by the unbound fraction of siRNA in a binding assay, is greater than 0.15, greater than 0.2, greater than 0.25, greater than 0.3, greater than 0.35, greater than 0.4, greater than 0.45, or greater than 0.5 for enhanced in vivo delivery of siRNA.
[0219] Thus, conjugating a lipophilic moiety to an internal position of a double-stranded RNAi agent provides optimal hydrophobicity for enhanced in vivo delivery in siRNA.
[0220] The term "lipid nanoparticle" or "LNP" refers to a vesicle comprising a lipid layer that encapsulates a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid from which an RNAi agent is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.
[0221] As used herein, a "subject" refers to an animal, such as a mammal, including a primate (e.g., a human, a non-human primate, e.g., a monkey and a chimpanzee) or a non-primate (e.g., a rat or a mouse). In a preferred embodiment, the subject is a human, such as a human being treated or evaluated for a disease, disorder, or condition that would benefit from a decrease in MAPT expression, a human being at risk for a disease, disorder, or condition that would benefit from a decrease in MAPT expression, a human being with a disease, disorder, or condition that would benefit from a decrease in MAPT expression, or a human being treated for a disease, disorder, or condition that would benefit from a decrease in MAPT expression as described herein. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In one embodiment, the subject is a pediatric subject. In another embodiment, the subject is a juvenile subject, i.e., a subject under the age of 20.
[0222] As used herein, the terms "treating" or "treatment" refer to a beneficial or desired outcome, for example, but not limited to, alleviating or ameliorating one or more signs or symptoms associated with MAPT gene expression or tau production in a MAPT-related disease, such as Alzheimer's disease, FTD, PSP or other tauopathies. "Treatment" can also mean increasing survival time as compared to expected survival time if not treated.
[0223] The term "lower" in the context of MAPT levels or disease markers or symptoms in a subject refers to a statistically significant decrease in such levels. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, the decrease is at least 20%. In certain embodiments, the decrease is at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, in the level of a disease marker, e.g., sense- or antisense-containing foci and / or the level of an abnormal dipeptide repeat protein. In some embodiments, the reduction in disease markers is at least about 25%, for example, tau protein and / or gene expression levels are reduced by, for example, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%. In the context of MAPT levels in a subject, "reducing" preferably refers to reducing to a level that is accepted as being within the normal range for individuals without such disorders. In certain embodiments, "reducing" refers to a reduction in the difference between the level of a marker or symptom in a subject suffering from a disease and the level that an individual would accept as being within the normal range, for example, the level of weight reduction between an obese individual and an individual whose weight is accepted as being within the normal range.
[0224] As used herein, "prevention" or "preventing", when used in relation to a disease, disorder, or condition that would benefit from reducing the expression of the MAPT gene or the production of tau, refers to reducing the likelihood that a subject will develop symptoms associated with such disease, disorder, or condition, for example, symptoms of MAPT-related disease.Not developing a disease, disorder, or condition, or reducing the onset of symptoms associated with such disease, disorder, or condition (for example, by at least about 10% reduction, which is clinically acceptable for the disease or disorder), or delaying the onset of symptoms (for example, by a delay of several days, weeks, months, or years) is considered effective prevention.
[0225] As used herein, the term "MAPT-related disease" or "MAPT-related disorder" or "tauopathy" includes any disease or disorder that would benefit from a decrease in MAPT expression and / or activity. Exemplary MAPT-related diseases include Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystem tauopathy with presenile dementia, and the like. These include MSTD, white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS).
[0226] As used herein, a "therapeutically effective amount" is intended to include an amount of an RNAi agent that, when administered to a subject with a MAPT-related disease, is sufficient to treat the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease). A "therapeutically effective amount" may vary depending on the RNAi agent, the method of administration of the agent, the disease and its severity and medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other personal characteristics of the subject to be treated.
[0227] As used herein, a "prophylactically effective amount" is intended to include an amount of an RNAi agent that, when administered to a subject with a MAPT-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the progression of the disease or reducing the severity of any future disease. The "prophylactically effective amount" may vary depending on the RNAi agent, the method of administration of the agent, the degree of risk of the disease, and the patient's medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other personal characteristics of the patient to be treated.
[0228] A "therapeutically effective amount" or a "prophylactically effective amount" also encompasses the amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the methods of the present disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.
[0229] The phrase "pharmaceutically acceptable" is used herein to refer to those compounds (including salts), materials, compositions or dosage forms that are suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio, within the scope of sound medical judgment.
[0230] The phrase "pharmaceutically acceptable carrier," as used herein, refers to a pharmaceutically acceptable material, composition, or vehicle involved in the transport or transfer of the subject compounds from one organ or body part to another, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium talc, calcium or zinc stearate, or stearic acid), or solvent encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject being treated. Some examples of materials that serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; and (7) lubricants, such as magnesium state. state), sodium lauryl sulfate and talc, (8) excipients, such as cocoa butter and suppository wax, (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil, (10) glycols, such as propylene glycol, (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol, (12) esters, such as ethyl oleate and ethyl laurate, (13) agar, (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffer solutions, (21) polyesters, polycarbonates, or polyanhydrides, (22) bulking agents, such as polypeptides and amino acids, (23) serum components, such as serum albumin, HDL, and LDL, and (22) other non-toxic, compatible substances employed in pharmaceutical formulations.
[0231] The term "sample," as used herein, encompasses similar fluids, cells, or tissues isolated from a subject, as well as collections of fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum, and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymphatic fluid, urine, saliva, and the like. Tissue samples can include samples from tissues, organs, or localized regions. For example, samples can be derived from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples can be obtained from the brain (e.g., the whole brain or specific segments of the brain, such as the striatum, or specific types of cells within the brain, such as neurons and glial cells (astrocytes, oligodendrocytes, microglia)). In some embodiments, "a sample obtained from a subject" refers to blood obtained from a subject or plasma or serum obtained therefrom. In further embodiments, "a sample obtained from a subject" refers to brain tissue (or a subcomponent thereof) or retinal tissue (or a subcomponent thereof) obtained from a subject.
[0232] The term "substituted" refers to the replacement of one or more hydrogen radicals in a given structure with the radical of a specified substituent, including, but not limited to, alkyl, alkenyl, alkynyl, aryl, heterocyclyl, halo, thiol, alkylthio, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl, carboxyalkyl, alkoxycarbonylalkyl, aminocarbonylalkyl, acyl, aralkoxycarbonyl, carboxylic acid, sulfonic acid, sulfonyl, phosphonic acid, aryl, heteroaryl, heterocyclic, and aliphatic. It is understood that the substituents can be further substituted.
[0233] The term "alkyl" refers to saturated and unsaturated non-aromatic hydrocarbon chains, which may be straight or branched, containing the indicated number of carbon atoms (including, but not limited to, propyl, allyl, or propargyl), optionally interrupted by N, O, or S. For example, "(C1-C6) alkyl" refers to a radical having 1 to 6 carbon atoms in a straight or branched arrangement. [(C1-C6) alkyl] includes, for example, methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, pentyl, and hexyl. In certain embodiments, lipophilic moieties of the present disclosure comprise a C6-C18 alkyl hydrocarbon chain.
[0234] The term "alkylene" refers to an optionally substituted saturated aliphatic branched or straight-chain divalent hydrocarbon radical having the specified number of carbon atoms. For example, "(C1-C6) alkylene" refers to a linear arrangement, e.g., [(CH2) n
[0033] means a divalent saturated aliphatic radical having 1 to 6 carbon atoms of the formula: [(CH2CH2CH2CH2CH(CH3)], [(CH2CH2CH2CH2C(CH3)2], [(CH2C(CH3)2CH(CH3)))], where n is an integer from 1 to 6. "(C1-C6) alkylene" includes methylene, ethylene, propylene, butylene, pentylene, and hexylene. Alternatively, "(C1-C6) alkylene" means a divalent saturated radical having 1 to 6 carbon atoms in a branched arrangement, such as [(CH2CH2CH2CH2CH(CH3)], [(CH2CH2CH2CH2C(CH3)2], [(CH2C(CH3)2CH(CH3))], and the like. The term "alkylenedioxo" refers to a divalent species of the structure -ORO-, where R represents alkylene.
[0235] The term "mercapto" refers to an -SH radical. The term "thioalkoxy" refers to an -S-alkyl radical.
[0236] The term "halo" refers to any radical of fluorine, chlorine, bromine, or iodine. "Halogen" and "halo" are used interchangeably herein.
[0237] As used herein, unless otherwise specified, the term "cycloalkyl" refers to a saturated or unsaturated non-aromatic hydrocarbon ring group having 3 to 14 carbon atoms. For example, "(C3-C10)cycloalkyl" refers to a hydrocarbon radical of a (3-10)-membered saturated aliphatic cyclic hydrocarbon ring. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl-cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, and the like. Cycloalkyl groups can contain multiple spiro or fused rings. Cycloalkyl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted in any position allowed by normal valences.
[0238] As used herein, unless otherwise specified, the term "alkenyl" refers to a straight- or branched-chain non-aromatic hydrocarbon radical containing at least one carbon-carbon double bond and having 2 to 10 carbon atoms. Up to five carbon-carbon double bonds may be present in such groups. For example, a "C2-C6" alkenyl is defined as an alkenyl radical having 2 to 6 carbon atoms. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, and cyclohexenyl. The straight-chain, branched, or cyclic portions of an alkenyl group may contain double bonds and are optionally mono-, di-, tri-, tetra-, or penta-substituted in any position allowed by normal valences. The term "cycloalkenyl" refers to a monocyclic hydrocarbon group having the specified number of carbon atoms and at least one carbon-carbon double bond.
[0239] As used herein, unless otherwise specified, the term "alkenyl" refers to a straight- or branched-chain hydrocarbon radical having 2 to 10 carbon atoms and containing at least one carbon-carbon double bond. Up to five carbon-carbon triple bonds may be present. Thus, "C2-C6 alkynyl" refers to an alkynyl radical having 2 to 6 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl, 2-propynyl, and 2-butynyl. The straight- or branched-chain portions of alkenyl groups may contain triple bonds permitted by normal valences and may optionally be mono-, di-, tri-, tetra-, or penta-substituted at any position permitted by normal valences.
[0240] As used herein, "alkoxyl" or "alkoxy" refers to an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. For example, "(C-C)alkoxy" includes methoxy, ethoxy, and propoxy. For example, "(C-C)alkoxy" is intended to include C, C, C, C, C, C, C, C, and C alkoxy groups. For example, "(C-C)alkoxy" is intended to include C, C, C, C, C, C, C, C, and C alkoxy groups. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, s-pentoxy, n-heptoxy, and n-octoxy. "Alkylthio" refers to an alkyl radical attached through a sulfur linking atom. The term "alkylamino" or "aminoalkyl" refers to an alkyl radical attached through an N-H bond. "Dialkylamino" refers to two alkyl radicals linked through a nitrogen linking atom. The amino group may be unsubstituted, monosubstituted, or disubstituted. In some embodiments, the two alkyl radicals are the same (e.g., N,N-dimethylamino). In some embodiments, the two alkyl radicals are different (e.g., N-ethyl-N-methylamino).
[0241] As used herein, "aryl" or "aromatic" refers to any stable monocyclic or polycyclic carbon ring of up to seven atoms in each ring, with at least one ring being aromatic. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, anthracenyl, tetrahydronaphthyl, indanyl, and biphenyl. When the aryl substituent is bicyclic and one ring is non-aromatic, it is understood that the bond is via the aromatic ring. The aryl group is optionally mono-, di-, tri-, tetra-, or penta-substituted at any position allowed by normal valences. The term "arylalkyl" or "aralkyl" refers to an alkyl substituted with an aryl. The term "arylalkoxy" refers to an alkoxy substituted with an aryl.
[0242] "Hetero" refers to the replacement of at least one carbon atom in a ring system with at least one heteroatom selected from N, S, and O. "Hetero" also refers to the replacement of at least one carbon atom in an acyclic system. A heterocyclic or heteroacyclic system may have, for example, 1, 2, or 3 carbon atoms replaced by heteroatoms.
[0243] As used herein, the term "heteroaryl" refers to a stable monocyclic or polycyclic ring of up to seven atoms in each ring, wherein at least one ring is aromatic and contains 1 to 4 heteroatoms selected from the group consisting of O, N, and S. Examples of heteroaryl groups include, but are not limited to, acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, benzimidazolonyl, benzoxazolonyl, quinolinyl, isoquinolinyl, dihydroisoindolonyl, imidazopyridinyl, isoindolonyl, indazolyl, oxazolyl, oxadiazolyl, isoxazolyl, indolyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, pyrrolyl, and tetrahydroquinoline. "Heteroaryl" is also understood to include the N-oxide derivative of any nitrogen-containing heteroaryl. When a heteroaryl substituent is bicyclic and one ring is non-aromatic or does not contain a heteroatom, it is understood that attachment is via the aromatic ring or the ring containing the heteroatom. Heteroaryl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted in any position allowed by normal valences.
[0244] As used herein, the terms "heterocycle," "heterocyclic ring," or "heterocyclyl" refer to a 3- to 14-membered aromatic or non-aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from the group consisting of O, N, and S, including polycyclic groups. As used herein, the term "heterocycle" is also considered synonymous with the terms "heterocycle" and "heterocyclyl," and are understood to have the same definitions as described herein. "Heterocyclyl" includes heteroaryls as defined above, as well as dihydro and tetrahydro analogs thereof.Examples of heterocyclyl groups include, but are not limited to, azetidinyl, benzimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxoxo-, oxazolyl ... Sazolidinyl, oxazolyl, oxazoline, oxopiperazinyl, oxopyrrolidinyl, oxomorpholinyl, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridinyl, pyridazinyl, pyridyl, pyridinonyl, pyrimidyl, pyrimidinonyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrahydropyranyl, tetrahydrofuranyl, tetrahydrothiopyranyl, tetrahydroisoquinolinyl (tet tetrahydroisoquinolinyl), tetrazolyl, tetrazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, 1,4-dioxanyl, hexahydroazepinyl, piperazinyl, piperidinyl, pyridin-2-onyl, pyrrolidinyl, morpholinyl, thiomorpholinyl, dihydrobenzimidazolyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisoxazolyl, dihydroisothiazolyl Heterocyclyl groups include azolyl, dihydrooxadiazolyl, dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, dioxidethiomorpholinyl, methylenedioxybenzoyl, tetrahydrofuranyl, and tetrahydrothienyl, and N-oxides thereof. Attachment of a heterocyclyl substituent can occur through a carbon atom or through a heteroatom.Heterocyclyl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted in any position allowed by normal valences.
[0245] "Heterocycloalkyl" refers to a cycloalkyl residue in which one to four of the carbons are replaced by a heteroatom such as oxygen, nitrogen, or sulfur. Examples of heterocycles in which the radical is a heterocyclyl group include tetrahydropyran, morpholine, pyrrolidine, piperidine, thiazolidine, oxazole, oxazoline, isoxazole, dioxane, tetrahydrofuran, and the like.
[0246] The term "heteroaryl" refers to an aromatic 5- to 8-membered monocyclic, 8- to 12-membered bicyclic, or 11- to 14-membered tricyclic ring system having 1 to 3 heteroatoms in the monocyclic ring, 1 to 6 heteroatoms in the bicyclic ring, or 1 to 9 heteroatoms in the tricyclic ring, selected from O, N, or S (e.g., carbon atoms and 1 to 3, 1 to 6, or 1 to 9 heteroatoms of N, O, or S in the monocyclic, bicyclic, or tricyclic ring, respectively), and 0, 1, 2, 3, or 4 atoms in each ring may be substituted by substituents. Examples of heteroaryl groups include pyridyl, furyl, or furanyl, imidazolyl, benzimidazolyl, pyrimidinyl, thiophenyl, or thienyl, quinolinyl, indolyl, thiazolyl, and the like. The term "heteroarylalkyl" or "heteroaralkyl" refers to an alkyl substituted with a heteroaryl. The term "heteroarylalkoxy" refers to an alkoxy substituted with a heteroaryl.
[0247] As used herein, the term "cycloalkyl" includes saturated and partially unsaturated cyclic hydrocarbon groups having 3 to 12 carbons, e.g., 3 to 8 carbons, and e.g., 3 to 6 carbons, and the cycloalkyl groups may further be optionally substituted. Cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
[0248] The term "acyl" refers to an alkylcarbonyl, cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or heteroarylcarbonyl substituent, any of which can be further substituted by substituents.
[0249] As used herein, "keto" refers to any alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, or aryl group as defined herein attached through a carbonyl bridge.
[0250] Examples of keto groups include, but are not limited to, alkanoyl (e.g., acetyl, propionyl, butanoyl, pentanoyl, hexanoyl), alkenoyl (e.g., acryloyl), alkynoyl (e.g., ethinoyl, propynoyl, butynoyl, pentinoyl, hexynoyl), aryloyl (e.g., benzoyl), and heteroaryloyl (e.g., pyrroloyl, imidazoloyl, quinolinoyl, pyridinoyl).
[0251] As used herein, [alkoxycarbonyl] refers to any alkoxy group as defined above via a carbonyl bridge (i.e., -C(O)O-alkyl). Examples of alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, iso-propoxycarbonyl, n-propoxycarbonyl, t-butoxycarbonyl, benzyloxycarbonyl, or n-pentoxycarbonyl.
[0252] As used herein, "aryloxycarbonyl" refers to any aryl group, as defined herein, attached through an oxycarbonyl bridge (i.e., -C(O)O-aryl). Examples of aryloxycarbonyl groups include, but are not limited to, phenoxycarbonyl and naphthyloxycarbonyl.
[0253] As used herein, "heteroaryloxycarbonyl" refers to any heteroaryl group, as defined herein, attached through an oxycarbonyl bridge (i.e., -C(O)O-heteroaryl). Examples of heteroaryloxycarbonyl groups include, but are not limited to, 2-pyridyloxycarbonyl, 2-oxazolyloxycarbonyl, 4-thiazolyloxycarbonyl, or pyrimidinyloxycarbonyl.
[0254] The term "oxo" refers to an oxygen atom which forms a carbonyl when attached to carbon, an N-oxide when attached to nitrogen, and a sulfoxide or sulfone when attached to sulfur.
[0255] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein assume that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure of the present specification is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the pH of the environment, as will be readily understood by those skilled in the art.
[0256] II. RNAi Agents of the Disclosure Described herein are RNAi agents that inhibit expression of the MAPT gene. In one embodiment, the RNAi agent comprises a double-stranded ribonucleic acid (dsRNA) molecule that inhibits expression of the MAPT gene in a cell, e.g., a cell in a mammalian subject, e.g., a human, having a MAPT-related disease, such as Alzheimer's disease, FTD, PSP, or other tauopathy. The dsRNA comprises an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed upon expression of the MAPT gene. The complementary region is approximately 15-30 nucleotides or less in length. Upon contact with a cell expressing the MAPT gene, the RNAi agent inhibits expression of the MAPT gene (e.g., human gene, primate gene, non-primate gene) by at least 25% or more, as described herein, compared to similar cells not contacted with the RNAi agent or compared to an RNAi agent that is not complementary to the MAPT gene. Expression of the MAPT gene can be analyzed, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods, such as immunofluorescence analysis using Western blotting or flow cytometry techniques. In one embodiment, the level of knockdown is analyzed in BE(2)-C cells using the assay method provided in Example 1 below. In some embodiments, the level of knockdown is analyzed in primary mouse hepatocytes. In some embodiments, the level of knockdown is analyzed in Neuro-2a cells.
[0257] dsRNA comprises two RNA strands, which are complementary and hybridize to form a duplex structure under the conditions in which dsRNA is used. One strand of dsRNA (antisense strand) comprises a complementary region that is substantially complementary to the target sequence, and generally completely complementary. The target sequence is obtained from the sequence of the mRNA formed during the expression of the MAPT gene. The other strand (sense strand) comprises a region that is complementary to the antisense strand, so that when the two strands are combined under suitable conditions, they hybridize to form a duplex structure. As described elsewhere herein and known in the art, the complementary sequence of dsRNA can also be contained as a self-complementary region of a single nucleic acid molecule, so that it is opposite on separate oligonucleotides.
[0258] Generally, the duplex structure is 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29 , 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 base pairs, or 21-22 base pairs in length. In certain preferred embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 25, 21 to 24, 21 to 23, 21 to 22, 22 to 25, 22 to 24, 22 to 23, 23 to 25, 23 to 24, or 24 to 25 base pairs in length, e.g., 19 to 21 base pairs in length. Ranges and lengths between the ranges and lengths listed above are also intended to be part of this disclosure.
[0259] Similarly, the region complementary to the target sequence may be 15-30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-30, 19-29, 19-28, 19-30, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 19-66, 19-67, 19-68, 19-70, 19-71, 19-72, 19-73, 19-74, 19-75, 19-76, 19-77, 19-78, 19-80, 19-81, 21-23, 21-24, 21-23, or 21-22 nucleotides in length, e.g., 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths that lie between the ranges and lengths listed above are also intended to be part of this disclosure.
[0260] In some embodiments, the duplex structure is 19-30 base pairs in length. Similarly, the region complementary to the target sequence is 19-30 nucleotides in length.
[0261] In some embodiments, the dsRNA is 15 to 23 nucleotides long, 19 to 23 nucleotides long, or 25 to 30 nucleotides long. Generally, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNA longer than about 21-23 nucleotides serves as a substrate for Dicer. As those skilled in the art will recognize, the region of RNA targeted for cleavage will most often be a portion of a longer RNA molecule, often an mRNA molecule. Where relevant, a "portion" of an mRNA target is a contiguous sequence of the mRNA target long enough to allow it to serve as a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).
[0262] Those skilled in the art will appreciate that the double-stranded region is the primary functional portion of the dsRNA, and may be, for example, about 15-36 base pairs, e.g., 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-23, 18-24, 18-25, 18-26, 18-24, 18-23, 18-22, 18-26 ...6, 18-25, 18-26, 18-24, 18-23, 18-22, 18-26, 18-26, 18-26, 18-25, 18-26, 18-22, It will also be appreciated that the duplex region may be 1, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs, for example 19-21 base pairs. That is, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA, as long as it is processed into a functional duplex of, for example, 15-30 base pairs that targets the desired RNA for cleavage. Thus, those skilled in the art will recognize that, in one embodiment, miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an RNAi agent useful for targeting MAPT expression is not generated in a target cell by cleavage of a larger dsRNA.
[0263] The dsRNA described herein further comprises one or more single-stranded nucleotide overhangs, for example, 1, 2, 3 or 4 nucleotides.The nucleotide overhang comprises or consists of nucleotide / nucleoside analogs, such as deoxynucleotide / nucleoside.The overhang can be on the sense strand, on the antisense strand, or any combination thereof.Furthermore, the nucleotide of some overhangs is present on the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand of dsRNA.
[0264] dsRNA is synthesized by standard methods known in the art.Double-stranded RNAi compounds of the present invention can be prepared using two-step method.First, each strand of double-stranded RNA molecules is prepared separately.Then, the strands of these components are annealed.The individual strands of siRNA compounds are prepared using solution phase or solid phase organic synthesis or both.Organic synthesis has the advantage that the oligonucleotide chains containing unnatural nucleotides or modified nucleotides can be easily prepared.Similarly, single-stranded oligonucleotides of the present invention are prepared using solution phase or solid phase organic synthesis or both.
[0265] In one embodiment, the dsRNA of the present disclosure comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence of MAPT may be selected from the sequences provided in any one of Tables 3-6, and the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the sequences provided in any one of Tables 3-6. In this embodiment, one of the two sequences is complementary to the other of the two sequences, where one of the sequences is substantially complementary to the sequence of mRNA produced upon expression of the MAPT gene. Thus, in this embodiment, the dsRNA comprises two oligonucleotides, one of which is designated in any one of Tables 3-6 as the sense strand (passenger strand) and the second of which is designated in any one of Tables 3-6 as the corresponding antisense strand (guide strand).
[0266] In one embodiment, the sense strand comprises nucleotides 506 to 526, 507 to 527, 508 to 528, 509 to 529, 510 to 530, 511 to 531, 512 to 532, 513 to 533, 514 to 534, 515 to 535, 516 to 536, 517 to 537, 518 to 538, 519 to 539, 520 to 540, 521 to 541, 522 to 542, 523 to 543, 524 to 544, 525 to 545, 526 to 544, 526 to 546, 527 to 547, 528-548, 529-549, 530-550, 531-551, 532-552, 533-553, 969-989, 970-990, 971-991, 972-992, 973-993, 974-994, 975-995, 976-996, 977-997, 978-997, 978-998, 979-997, 979-999, 980-1000, 981-1001, 982-1002, 983-1003, 984-1004, 985-1003, 985-100 5, 986-1006, 987-1007, 988-1008, 989-1009, 990-1010, 1069-1089, 1070-1090, 1071-1091, 1072-1092, 1073-1093, 1074-1094, 1075-1095, 1076-1096, 1077-1095, 1077-1097, 1078-1098, 1079-1099, 1080-1100, 1081-1101, 5511-5531, 5512-5532, 5513- and the antisense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from any one of the nucleotide sequences of SEQ ID NO: 5533, 5514-5534, 5515-5535, 5516-5536, 5517-5537, 5518-5538, 5519-5539, 5520-5540, 5521-5541, 5522-5542 and 5523-5543, and the antisense strand comprises at least 15 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO: 2.
[0267] In one embodiment, the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences 1072-1092, 1067-1087, and 514-534 of SEQ ID NO: 3, and the antisense strand comprises at least 15 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO: 4.
[0268] In one embodiment, the antisense strand is selected from the group consisting of AD-1397070, AD-1397072, AD-1397073, AD-1397075, AD-1397081, AD-1397083, AD-1397088, AD-1397249, AD-1397252, AD-1397253, AD-1397258, AD-1397261, AD-1397262, AD-1397263, AD-1397291, AD-1397293, AD-1397294, AD-1397295, AD-1397298, AD-1397299, AD-16377 32, AD-1637733, AD-1637734, AD-1637735, AD-1637736, AD-1637737, AD-1637739, AD-1637744, AD-1637745, AD-1637746, AD-1637747, AD-1637748, A D-1637749, AD-1637750, AD-1637751, AD-1637752, AD-1637753, AD-1637754, AD-1637755, AD-1637756, AD-1637757, AD-1637758, AD-1637759, AD-16 37760, AD-1637761, AD-1637762, AD-1637763, AD-1637764, AD-1637765, AD-1637766, AD-1637767, AD-1637768, AD-1637769, AD-1637770, AD-163777 1, AD-1637772, AD-1637773, AD-1637774, AD-1637775, AD-1637776, AD-1637777, AD-1637778, AD-1637779, AD-1637780, AD-1637781, AD-1637782, AD -1637783, AD-1637784, AD-1637785, AD-1637786, AD-1637787, AD-1637788, AD-1637789, AD-1637790, AD-1637791, AD-1637792, AD-1637793, AD-163 7794, AD-1637795, AD-1637796, AD-1637797, AD-1637798, AD-1637799, AD-1637800, AD-1637801, AD-1637802, AD-1637803, AD-1637804, AD-1637805,AD-1637806、AD-1637807、AD-1637808、AD-1637809、AD-1637810、AD-1637811、AD-1637812、AD-1637813、AD-1637814、AD-1637815、AD-1637816、AD-1637817、AD-1637818、AD-1637819、AD-1637820、AD-1637821、AD-1637822、AD-1637823、AD-1637824、AD-1637825、AD-1637826、AD-1637827、AD-1637828、AD-1637829、AD-1637830、AD-1637831、AD-1637832、AD-1637833、AD-1637834、AD-1637835、AD-1637836、AD-1637837、AD-1637838、AD-1637839、AD-1637840、AD-1637841、AD-1637842、AD-1637843、AD-1637844、AD-1637845、AD-1637846、AD-1637847、AD-1637848、AD-1637849、AD-1637850、AD-1637851、AD-1637852、AD-1637853、AD-1637854、AD-1637855、AD-1637856、AD-1637857、AD-1637858、AD-1637859、AD-1637860、AD-1637861、AD-1637862、AD-1637863、AD-1637864、AD-1637865、AD-1637866、AD-1637867、AD-1637868、AD-1637869、AD-1637870、AD-1637871、AD-1637872、AD-1637873、AD-1637874、AD-1637875、AD-1637876、AD-1637877、AD-1637878、AD-1637879、AD-1637880、AD-1637881、AD-1637882、AD-1637883、AD-1637884、AD-1637885、AD-1637886、AD-1637887、AD-1637888、AD-1637889、AD-1637890、AD-1637891、AD-1637892、AD-1637893、AD-1637894、AD-1637895、AD-1637896、AD-1637897, AD-1637898, AD-1637899, AD-1637900, AD-1637901, AD-1637902, AD-1637903, AD-1637904, AD-1637905, AD-1637 906, AD-1637907, AD-1637908, AD-1637909, AD-1637910, AD-1637911, AD-1637912, AD-1637913, AD-1637914, AD-1637915, AD- 1637916, AD-1637917, AD-1637918, AD-1637919, AD-1637920, AD-1637921, AD-1637922, AD-1637923, AD-1637924, AD-1637925 , AD-1637926, AD-1637927, AD-1637928, AD-1637929, AD-1637930, AD-1637931, AD-1637932, AD-1637933, AD-1637934, AD-163 7935, AD-1637936, AD-1637937, AD-1637938, AD-1637939, AD-1637940, AD-1637941, AD-1637942, AD-1637943, AD-1637944, AD -1637945, AD-1637946, AD-1637947, AD-1637948, AD-1637949, AD-1637950, AD-1637951, AD-1637952, AD-1637953, AD-163795 4. It contains at least 15 consecutive nucleotides that differ by 3 nucleotides or less from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1637955, AD-1637956, AD-1637957, AD-1637958, AD-1637959, AD-1637960, AD-397167, AD-523565, AD-1623140, AD-1637701, AD-1786708, and AD-1786708v2. In some embodiments, the duplex is selected from the group consisting of AD-1637922, AD-1637806, AD-1637762, AD-1637777, AD-1637779, AD-1397081, AD-1637793, AD-1637798, AD-1637807, AD-1637829, AD-1637831, AD-1637840,In certain embodiments, the duplex is selected from the group consisting of AD-1637841, AD-1637855, AD-1637883, and AD-1637884. In certain embodiments, the duplex is selected from the group consisting of AD-1623140, AD-1786708, and AD-1637701. In certain embodiments, the duplex is AD-1786708.
[0269] In one embodiment, the nucleotide sequence of the sense strand comprises at least 15 consecutive nucleotides corresponding to the sense strand sequence of exon 10 of the MAPT gene set forth in SEQ ID NO: 992, and the antisense strand comprises a sequence complementary thereto.
[0270] In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides, hi another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
[0271] Although the sequences in Tables 4 and 6 are described as modified or conjugated sequences, it will be understood that the RNA of an RNAi agent of this disclosure, e.g., a dsRNA of this disclosure, may comprise any one of the sequences specified in Tables 3 or 5, unmodified, unconjugated, or modified or conjugated differently from those described therein. For example, the sense strand of an agent of the invention may be conjugated to a GalNAc ligand, but these agents may also be conjugated to a moiety responsible for delivery to the CNS, e.g., a C16 ligand, as described herein. In one embodiment, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain (e.g., a linear C16 alkyl or alkenyl). The lipophilic ligand is contained at any of the positions provided in this application. In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleoside linkage of a double-stranded iRNA agent. For example, a C16 ligand may be conjugated via the 2'-oxygen of a ribonucleotide, as shown in the following structure: [ka] wherein * represents a bond to an adjacent nucleotide, and B is a nucleobase or nucleobase analog, and optionally B is adenine, guanine, cytosine, thymine, or uracil. The design and synthesis of the ligands and monomers provided herein are described, for example, in PCT Publications WO2019 / 217459, WO2020 / 132227, and WO2020 / 257194, the contents of which are incorporated herein by reference in their entireties.
[0272] In some embodiments, the double-stranded RNA agent further comprises a phosphate or phosphate mimic at the 5'-end of the antisense strand. In one embodiment, the phosphate mimic is 5'-vinylphosphonate (VP). In one embodiment, the phosphate mimic is 5'-cyclopropylphosphonate (VP). In some embodiments, the 5'-end of the antisense strand of the double-stranded iRNA agent does not contain a 5'-vinylphosphonate (VP).
[0273] In other embodiments, each of the duplexes in Table 4 can be specifically modified to provide another double-stranded iRNA agent of the present disclosure. In one example, the 3' end of each sense duplex can be modified by removing the 3'-terminal L96 ligand and replacing the two phosphodiester internucleotide linkages with phosphorothioate internucleotide linkages between the three 3'-terminal nucleotides, i.e., the three 3'-terminal nucleotides (N) of the sense sequence of the following formula: 5'-N1-...-N n-2 N n-1 N n L96 3' can be replaced with: 5'-N1-...-N n-2 s N n-1 s N n 3'.
[0274] For example, the sense sequence AD-1397081: asusagu(Chd)uaCfAfAfaccaguu gaaL96 (SEQ ID NO: 434) can be replaced with: asusagu(Chd)uaCfAfAfaccaguu gsasa (SEQ ID NO: 1005) Alternatively, the antisense sequence may remain unchanged, providing another double-stranded iRNA agent of the present disclosure.
[0275] Those skilled in the art are well aware that dsRNAs having duplex structures of approximately 20-23 base pairs, e.g., 21 base pairs, have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures are also effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above-described embodiments, due to the nature of the oligonucleotide sequences provided herein, the dsRNAs described herein contain at least one strand that is a minimum of 21 nucleotides in length. It is reasonably expected that shorter duplexes, minus only a few nucleotides at one or both ends, may be similarly effective compared to the dsRNAs described above. Therefore, it is contemplated that the dsRNA that has a sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one of the sequences provided herein, and differs in that it can inhibit the expression of MAPT gene by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% compared to the control level from the dsRNA that comprises the entire sequence, for example, using A549 cells and an in vitro assay of 10 nM concentration of RNA agent and PCR assay provided in the examples herein, is within the scope of the present disclosure.In some embodiments, the inhibition from the dsRNA that comprises the entire sequence is measured using an in vitro assay of primary mouse hepatocytes.
[0276] In addition, the RNA described herein identifies the site in MAPT transcript that is susceptible to RISC-mediated cleavage.Therefore, the present disclosure also features the RNAi agent that targets within this site.As used herein, if the RNAi agent promotes the cleavage of the transcript at any of the specific sites, it is said that the RNAi agent targets within the specific site of RNA transcript.This RNAi agent will generally comprise at least about 15 consecutive nucleotides, preferably at least 19 nucleotides, from one of the sequences provided herein, which is combined with additional nucleotide sequences taken from the region adjacent to the selected sequence in MAPT gene.
[0277] III. Modified RNAi Agents of the Present Disclosure In one embodiment, the RNA of the RNAi agent of the present disclosure, e.g., dsRNA, is unmodified and does not contain, for example, chemical modifications or conjugations known in the art and described herein. In a preferred embodiment, the RNA of the RNAi agent of the present disclosure, e.g., dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the present disclosure, substantially all of the nucleotides of the RNAi agent of the present disclosure are modified. In other embodiments of the present disclosure, all of the nucleotides of the RNAi agent of the present disclosure are modified. An RNAi agent of the present disclosure in which "substantially all of the nucleotides are modified" is widely modified but not entirely modified, and contains no more than 5, 4, 3, 2, or unmodified nucleotides. In yet other embodiments of the present disclosure, an RNAi agent of the present disclosure contains no more than 5, 4, 3, 2, or 1 modified nucleotide.
[0278] Nucleic acids featured in this disclosure can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. Lett. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted linkage) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkage, etc.), base modifications, such as substitution with stabilizing bases, destabilizing bases, or bases that base pair with partners in an extended repertoire, base removal (abasic nucleotides) or conjugated bases, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, or backbone modifications, including modification or replacement of phosphodiester linkages. Specific examples of RNAi agents useful in the embodiments described herein include, but are not limited to, the RNA that contains modified backbone or does not contain natural internucleoside linkages.The RNA with modified backbone includes, among others, that does not have phosphorus atom in backbone.For the purpose of this specification and as sometimes referred to in the art, the modified RNA that does not have phosphorus atom in their internucleoside backbone is also considered to be oligonucleoside.In some embodiments, modified RNAi agents will have phosphorus atom in their internucleoside backbone.
[0279] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. In some embodiments of the present invention, the dsRNA agent of the present invention is in free acid form. In other embodiments of the present invention, the dsRNA agent of the present invention is in salt form. In one embodiment, the dsRNA agent of the present invention is in sodium salt form.In certain embodiments, when the dsRNA agent of the present invention is in sodium salt form, sodium ion exists in the agent as counterion to substantially all of the phosphodiester and / or phosphorothioate groups present in the agent.The agent in which substantially all of the phosphodiester and / or phosphorothioate linkages have sodium counterion comprises 5, 4, 3, 2 or 1 or less phosphodiester and / or phosphorothioate linkages that do not have sodium counterion.In some embodiments, when the dsRNA agent of the present invention is in sodium salt form, sodium ion exists in the agent as counterion to all of the phosphodiester and / or phosphorothioate groups present in the agent.
[0280] Representative U.S. patents that teach the preparation of the above-described phosphorus-containing linkages include, but are not limited to, U.S. Patents 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 86,717;5,321,131;5,399,676;5,405,939;5,453,496;5,455,233;5,466,677;5,476,925;5,519,126;5,536,821;5,541,316;5,550,111;5,563,253;5,571,799;5,5 87,361;5,625,050;6,028,188;6,124,445;6,160,109;6,169,170;6,172,209;6,239,265;6,277,603;6,326,199;6,346,614;6,444,423;6,531,590;6,534,639;6,6 Nos. 08,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029 and U.S. Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.
[0281] Modified RNA backbones that do not contain a phosphorus atom in the backbone have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages, including those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH2 constituent moieties.
[0282] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patents 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; ,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437, and 5,677,439, the entire contents of each of which are incorporated herein by reference.
[0283] In another embodiment, RNA mimics suitable for use in RNAi agents are considered, in which both the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide units are replaced with alternative groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic known to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, the entire contents of each of which are incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the present disclosure are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0284] Some embodiments featured in this disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2-- (known as the methylene (methylimino) or MMI backbone), --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2---- (the natural phosphodiester backbone is represented as --O--P--O--CH2--) of the above-referenced U.S. Patent No. 5,489,677, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, RNAs featured herein have the morpholino backbone structure of the above-referenced U.S. Patent No. 5,034,506.
[0285] Modified RNAs also contain one or more substituted sugar moieties. The RNAi agents, e.g., dsRNAs featured herein, contain one of the following at the 2' position: OH, F, O-, S-, or N-alkyl, O-, S-, or N-alkenyl, O-, S-, or N-alkynyl, or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 Alkenyl and alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA includes one of the following at the 2' position: C1 to C 10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, interfering substances, groups for improving the pharmacokinetic properties of RNAi agents or groups for improving the pharmacodynamic properties of RNAi agents, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described herein below in the Examples, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Further exemplary modifications include 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers within these three families), 2'-alkoxyalkyl, and 2'-NMA (N-methylacetamide).
[0286] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-O-hexadecyl, and 2'-fluoro (2'-F). Similar modifications are also made at other positions on the RNA of RNAi agents, particularly the 3'-position of the sugar on the 3'-terminal nucleotide or in 2'-5'-linked dsRNA and the 5'-position of the 5'-terminal nucleotide. RNAi agents also have sugar mimetics, such as cyclobutyl moieties in place of pentofuranosyl sugars. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633 and 5,700,920, portions of which are commonly incorporated herein. The entire contents of each of the foregoing are incorporated herein by reference.
[0287] The RNAi agents of the present disclosure also include modifications or substitutions of nucleobases (often simply referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine. , 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine.Additional nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed.Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, JL, ed.John Wiley&Sons, 1990, those disclosed in Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed in Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993.Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T., and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are exemplary base substitutions, especially when combined with 2'-O-methoxyethyl sugar modifications.
[0288] Representative U.S. patents that teach the preparation of some of the above-described modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patents: 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469 ;5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672 and 7,495,088, the entire contents of each of which are incorporated herein by reference.
[0289] The RNAi agent of the present disclosure can also be modified to include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide with a modified ribose moiety, in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-end structural conformation. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0290] The RNAi agents of the present disclosure may also be modified to include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanose ring modified by bridging two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring. Thus, in some embodiments, the agents of the present disclosure may include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-terminal structural conformation. The addition of a locked nucleic acid to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in polynucleotides of the present disclosure include, but are not limited to, nucleosides containing a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the present disclosure include one or more bicyclic nucleosides containing a 4' to 2' bridge.Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CHOCH3)-O-2' (and analogs, see, e.g., U.S. Pat. No. 7,399,845), 4'-C(CH3)(CH3)-O-2' (and analogs, e.g., No. 8,278,283), 4'-CH2-N(OCH3)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Patent Application Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2', where R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C(=CH2)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are incorporated herein by reference.
[0291] Additional representative U.S. patents and U.S. patent publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patents 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; 2008 / 0039618 and 2009 / 0012281, the entire contents of each of which are incorporated herein by reference.
[0292] Any of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226).
[0293] The RNAi agents of the present disclosure may also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-0-2' bridge. In one embodiment, the constrained ethyl nucleotide is in the S conformation and is referred to herein as an "S-cEt."
[0294] The RNAi agent of the present disclosure may also contain one or more "conformation-restricting nucleotides" ("CRNs"). A CRN is a nucleotide analogue with a linker connecting the C2' and C4' carbons of ribose or the C3 and C5' carbons of ribose. The CRN locks the ribose ring into a stable conformation, increasing hybridization affinity to mRNA. The linker is long enough to position the oxygen at an optimal position for stability and affinity, thereby reducing puckering of the ribose ring.
[0295] Representative publications that teach the preparation of certain of the above CRNs include, but are not limited to, US2013 / 0190383 and WO2013 / 036868, the entire contents of each of which are incorporated herein by reference.
[0296] In some embodiments, the RNAi agent of the present disclosure includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNAs are acyclic unlocked nucleic acids in which any of their sugar linkages have been removed to form an unlocked "sugar" residue. In one example, UNAs also include monomers in which the C1'-C4' bond has been removed (i.e., a covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' bond of the sugar has been removed (i.e., a covalent carbon-carbon bond between the C2' and C3' carbons) (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).
[0297] Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Pat. No. 8,314,227 and U.S. Patent Application Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.
[0298] The RNAi agents of the present disclosure may also include one or more "cyclohexene nucleic acids" or (CeNA). CeNA is a nucleotide analogue that involves replacing the furanose moiety of DNA with a cyclohexene ring. Incorporation of a cyclohexenyl nucleoside into a DNA strand increases the stability of DNA / RNA hybrids. CeNA is stable against degradation in serum, and CeNA / RNA hybrids can activate E. coli RNase H, resulting in cleavage of the RNA strand (see Wang et al., Am. Chem. Soc. 2000, 122, 36, 8595-8602, incorporated herein by reference).
[0299] Potential stabilizing modifications for the ends of RNA molecules include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted 2'-deoxy-modified ribonucleotides such as inverted dT (idT) and inverted dA (idA), and inverted abasic 2'-deoxyribonucleotides (iAb). Disclosure of these modifications can be found in WO 2011 / 005861.
[0300] In one example, the 3' or 5' end of the oligonucleotide is linked to an inverted 2'-deoxy modified ribonucleotide, such as an inverted dT (idT), an inverted dA (idA), or an inverted abasic 2'-deoxyribonucleotide (iAb). In one particular example, the inverted 2'-deoxy-modified ribonucleotide is linked to the 3' end of the oligonucleotide, such as the 3' end of the sense strand described herein, where the linkage is via a 3'-3' phosphodiester linkage or a 3'-3'-phosphorothioate linkage.
[0301] In another embodiment, the 3' end of the sense strand is linked to an inverted abasic ribonucleotide (iAb) via a 3'-3'-phosphorothioate linkage. In another embodiment, the 3' end of the sense strand is linked to an inverted dA (idA) via a 3'-3'-phosphorothioate linkage.
[0302] In one particular example, the inverted 2'-deoxy-modified ribonucleotide is linked to the 3' end of an oligonucleotide, such as the 3' end of the sense strand described herein, wherein the linkage is via a 3'-3' phosphodiester linkage or a 3'-3'-phosphorothioate linkage.
[0303] In another example, the 3'-terminal nucleotide of the sense strand is an inverted dA (idA) and is joined to the preceding nucleotide via a 3'-3'-linkage (eg, a 3'-3'-phosphorothioate linkage).
[0304] Other modifications of the RNAi agent of the present disclosure include 5' phosphate or 5' phosphate mimic, for example, the 5' terminal phosphate or phosphate mimic on the antisense strand of RNAi agent.Suitable phosphate mimic is disclosed, for example, in US2012 / 0157511, the entire content of which is incorporated herein by reference.
[0305] A. Modified RNAi Agents Comprising Motifs of the Disclosure In certain aspects of the present disclosure, the double-stranded RNAi agent of the present disclosure includes an agent having chemical modifications, such as those disclosed in International Publication No. 2013 / 075035, the entire contents of which are incorporated herein by reference. As shown herein and in International Publication No. 2013 / 075035, excellent results can be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense or antisense strand of the RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense and antisense strands of the RNAi agent can be otherwise completely modified. The introduction of these motifs interrupts the modification pattern of the sense or antisense strand, if present. The RNAi agent can optionally be conjugated with a lipophilic ligand, for example, a C16 ligand, for example, on the sense strand. The RNAi agent can optionally be modified with an (S)-glycol nucleic acid (GNA) modification, for example, at one or more residues of the antisense strand. The resulting RNAi agent exhibits excellent gene silencing activity.
[0306] Thus, the present disclosure provides a double-stranded RNAi agent capable of inhibiting expression of a target gene (i.e., the MAPT gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent can be 15 to 30 nucleotides in length. Each strand can be, for example, 16 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotides in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length. In certain embodiments, each strand is 19 to 23 nucleotides in length.
[0307] The sense and antisense strands typically form a duplex, double-stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The duplex region of an RNAi agent can be 15-30 nucleotide pairs in length. For example, the duplex region is 16-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length. In a preferred embodiment, the duplex region is 19 to 21 nucleotide pairs in length.
[0308] In one embodiment, the RNAi agent can contain one or more overhang regions or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs can be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length. In a preferred embodiment, the nucleotide overhang region is 2 nucleotides in length. The overhang can be the result of one strand being longer than the other, or the result of two strands of the same length being twisted. The overhang can form a mismatch with the target mRNA, be complementary to the targeted gene sequence, or be a different sequence. The first and second strands can also be linked by additional bases, for example, to form a hairpin, or by other non-basic linkers.
[0309] In one embodiment, the nucleotides in the overhang region of an RNAi agent can each independently be modified or unmodified nucleotides, including, but not limited to, 2'-sugar modifications, such as 2-F, 2'-O-methyl, thymidine (T), and any combination thereof.
[0310] For example, TT is an overhang sequence for either end on either strand, which may form a mismatch with the target mRNA, or may be complementary to the targeted gene sequence, or may be another sequence.
[0311] The 5'- or 3'-overhang of the sense strand, antisense strand, or both strands of an RNAi agent can be phosphorylated. In some embodiments, the overhang region contains two nucleotides with a phosphorothioate between them, and the two nucleotides are the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 3'-overhang is present in the sense strand.
[0312] RNAi agent can contain only a single overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, the single-stranded overhang can be located at the 3'-end of the sense strand or at the 3'-end of the antisense strand.RNAi can also have a blunt end, which is located at the 5'-end of the antisense strand (or the 3'-end of the sense strand), or vice versa.Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end, and its 5'-end is blunt.Without wishing to be bound by theory, the asymmetry between the blunt end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand is favorable for the insertion of guide strand into RISC process.
[0313] In one embodiment, the RNAi agent is double-blunt ended and 19 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0314] In another embodiment, the RNAi agent is double blunt ended and 20 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0315] In yet another embodiment, the RNAi agent is double-blunt ended and 21 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0316] In one embodiment, the RNAi agent comprises a 21-nucleotide sense strand and a 23-nucleotide antisense strand, wherein the sense strand comprises at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end, and the antisense strand comprises at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, and one end of the RNAi agent is blunt, and the other end comprises a two-nucleotide overhang.Preferably, the two-nucleotide overhang is at the 3' end of the antisense strand.When the two-nucleotide overhang is at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the three terminal nucleotides, two of which are overhanging nucleotides, and the third nucleotide is a paired nucleotide adjacent to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide linkages between the three terminal nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotide that is part of a motif, is a modified nucleotide.In one embodiment, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example, within an alternating motif.Optionally, the RNAi agent further comprises a ligand (for example, a lipophilic ligand, optionally a C16 ligand).
[0317] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length and, starting from the 5'-terminal nucleotide (position 1), comprises at least 8 ribonucleotides at positions 1-23 of the first strand; and the antisense strand is 36-66 nucleotide residues in length and, starting from the 3'-terminal nucleotide, comprises at least 8 ribonucleotides at positions 1-23 of the sense strand to form a duplex; wherein at least the 3'-terminal nucleotide of the antisense strand is unpaired with the sense strand, and up to 6 consecutive 3'-terminal nucleotides are unpaired with the sense strand, thereby forming a 3' single-stranded overhang of 1-6 nucleotides; and wherein the 5'-end of the antisense strand comprises 10-30 consecutive ribonucleotides that are not paired with the sense strand. the sense strand comprises nucleotides corresponding to the 2'-F modification, thereby forming a single-stranded 5' overhang of 10 to 30 nucleotides, at least the 5'- and 3'-terminal nucleotides of the sense strand base-pair with nucleotides of the antisense strand when the sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplex region between the sense and antisense strands, and the antisense strand is sufficiently complementary to the target RNA along at least 19 ribonucleotides of the antisense strand length, such that the double-stranded nucleic acid reduces target gene expression when introduced into a mammalian cell, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides, at least one of the motifs occurring at or near the cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.
[0318] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a length of at least 25 nucleotides and at most 29 nucleotides, and a second strand having a length of at most 30 nucleotides with at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, the 3' end of the first strand and the 5' end of the second strand forming a blunt end, the second strand being 1 to 4 nucleotides longer at its 3' end than the first strand, the duplex region being at least 25 nucleotides in length, the second strand being sufficiently complementary to a target mRNA along at least 19 nucleotides of the length of the second strand, the RNAi agent reducing target gene expression when introduced into a mammalian cell, and Dicer cleavage of the RNAi agent preferentially resulting in an siRNA comprising the 3' end of the second strand, thereby reducing target gene expression in the mammalian cell. Optionally, the RNAi agent further comprises a ligand.
[0319] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, one of which motifs occurs at the cleavage site within the sense strand.
[0320] In one embodiment, the antisense strand of the RNAi agent also contains at least one motif of three identical modifications on three consecutive nucleotides, one of which occurs at or near the cleavage site in the antisense strand.
[0321] For RNAi agents with a duplex region 17-23 nucleotides in length, the cleavage sites of the antisense strand are typically approximately 10, 11, and 12 positions from the 5' end. Thus, three identical modification motifs can occur at positions 9, 10, 11, 10, 11, 12, 11, 12, 13, 12, 13, 14, or 13, 14, 15 of the antisense strand, starting from the first nucleotide from the 5' end of the antisense strand, or starting from the first paired nucleotide within the duplex region from the 5' end of the antisense strand. The cleavage site within the antisense strand can also vary depending on the length of the duplex region of the RNAi from the 5' end.
[0322] The sense strand of RNAi agent can contain at least one motif of three identical modifications on three consecutive nucleotides at the break site of its strand, and antisense strand can have at least one motif of three identical modifications on three consecutive nucleotides at or near the break site of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand are aligned so that one motif of three nucleotides on sense strand and one motif of three nucleotides on antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pairing.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.
[0323] In one embodiment, the sense strand of an RNAi agent may contain multiple motifs of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the site of strand cleavage, and the other motifs may be wing modifications. As used herein, the term "wing modification" refers to a motif that occurs in another portion of the strand separated from a motif at or near the site of cleavage of the same strand. The wing modifications may be adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other, the chemical nature of the motifs is distinct from each other, and when the motifs are separated by one or more nucleotides, the chemical nature may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may occur at one end of the first motif at or near the cleavage site, or on either side of the lead motif.
[0324] Like the sense strand, the antisense strand of an RNAi agent may contain multiple motifs of three identical modifications on three consecutive nucleotides, at least one of which occurs at or near the site of cleavage on that strand. The antisense strand may also contain one or more wing modifications in the same alignment as the wing modifications that may be present on the sense strand.
[0325] In one embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.
[0326] In another embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.
[0327] When the sense and antisense strands of an RNAi agent each contain at least one wing modification, the wing modifications can be at the same end of the duplex region and have an overlap of one, two, or three nucleotides.
[0328] When the sense and antisense strands of an RNAi agent each contain at least two wing modifications, the sense and antisense strands are aligned such that the two modifications from each single strand are at one end of a duplex region with one, two, or three nucleotide overlap, the two modifications from each single strand are at the other end of the duplex region with one, two, or three nucleotide overlap, and the two modifications from the single strand are on either side of a lead motif within the duplex region with one, two, or three nucleotide overlap.
[0329] In one embodiment, the RNAi agent contains mismatches or combinations thereof in the duplex with the target. Mismatches can occur in the overhang region or in the duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (e.g., based on the free energy of association or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but adjacent or similar analysis can also be used). In terms of promoting dissociation, A:U is preferred to G:C, G:U is preferred to G:C, and I:C is preferred to G:C (I=inosine). Mismatches, such as non-standard pairings or non-standard pairings (described elsewhere herein), are preferred to standard pairings (A:T, A:U, G:C), and pairings containing universal bases are preferred to standard pairings.
[0330] In one embodiment, the RNAi agent comprises the first 1, 2, 3, 4, or 5 base pairs within the duplex region from the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and at least one mismatch pair, e.g., a non-canonical pairing or a non-canonical pairing or a pairing containing a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.
[0331] In one embodiment, the nucleotide at position 1 from the 5' end of the antisense strand to the duplex region is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first one, two, or three base pairs from the 5' end of the antisense strand to the duplex region is an AU base pair. For example, the first base pair from the 5' end of the antisense strand to the duplex region is an AU base pair.
[0332] In another embodiment, the nucleotide at the 3' end of the sense strand is deoxythymine (dT). In another embodiment, the nucleotide at the 3' end of the antisense strand is deoxythymine (dT). In one embodiment, there is a short sequence of deoxythymine nucleotides, for example, two dT nucleotides on the 3' end of the sense strand or the antisense strand.
[0333] In one embodiment, the sense strand sequence is represented by formula (I): 5'n p -N a -(XX) i -N b -Y YN b -(Z) j -N a -n q 3'(I) During the ceremony, i and j are each independently 0 or 1; p and q each independently represent 0 to 6; each N a each independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p and n q independently represent an overhanging nucleotide; wherein Nb and Y do not have the same modification, and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably, YYY are all 2'-F modified nucleotides.
[0334] In one embodiment, N a or N b includes alternating pattern modifications.
[0335] In one embodiment, YYY motif occurs at or near the cleavage site of sense strand.For example, when RNAi agent has a double-stranded region of 17-23 nucleotides in length, YYY motif occurs at or near the cleavage site of sense strand (for example, can occur at position 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12, or 11, 12, 13), and this number starts from the first nucleotide from the 5' end, or optionally this number starts from the first paired nucleotide in the double-stranded region from the 5' end.
[0336] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand has the following formula: 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib), 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic), or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id) It can be expressed as:
[0337] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides.
[0338] each N a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0339] When the sense strand is represented by formula (Ic), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0340] When the sense strand is represented by formula (Id), each N b independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6. Each N a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0341] Each of X, Y and Z may be the same or different from one another.
[0342] In other embodiments, i is 0 and j is 0, and the sense strand has the formula 5'n p -N a -YYY-N a -nq 3'(Ia).
[0343] When the sense strand is represented by formula (Ia), each N a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0344] In one embodiment, the antisense strand sequence of the RNAi is represented by formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3'(Ie), It can be expressed as During the ceremony, k and l are each independently 0 or 1; p' and q' each independently represent 0 to 6; each N a ' independently represent an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p ' and n q ' independently represent an overhanging nucleotide; N b ' and Y' do not have the same modification, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0345] In one embodiment, N a ' or N b ' includes alternating pattern modifications.
[0346] Y'Y'Y' motif occurs at or near the cleavage site of antisense strand.For example, when RNAi agent has a double-stranded region of 17-23 nucleotides in length, Y'Y'Y' motif occurs at the 9th, 10th, 11th, 10th, 11th, 12th, 11th, 12th, 13th, 12th, 13th, 14th, or 13th, 14th, 15th positions of antisense strand, this number starting from the first nucleotide from the 5' end, or optionally this number starting from the first paired nucleotide in the double-stranded region from the 5' end.Preferably, Y'Y'Y' motif occurs at the 11th, 12th, 13th positions.
[0347] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.
[0348] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 1.
[0349] Thus, the antisense strand has the formula: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(If); 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(Ig); or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3'(Ih) It is expressed as:
[0350] When the antisense strand is represented by formula (If), N b ’represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0351] When the antisense strand is represented by formula (Ig), N b ' represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0352] When the antisense strand is represented by formula (Ih), each N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6.
[0353] In other embodiments, k is 0 and l is 0, and the antisense strand has the formula 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia).
[0354] When the antisense strand is represented by formula (Ie), each N a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0355] Each of X', Y' and Z' may be the same as or different from one another.
[0356] Each nucleotide of sense strand and antisense strand can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.Each X, Y, Z, X', Y' and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification.
[0357] In one embodiment, the sense strand of the RNAi agent can contain a YYY motif occurring at positions 9, 10, and 11 of the strand when the duplex region is 21 nt, the numbers starting from the first nucleotide from the 5' end, or optionally, the numbers starting from the 5' end with the first paired nucleotide in the duplex region, and Y represents a 2'-F modification. The sense strand can further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region, and XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.
[0358] In one embodiment, the antisense strand can contain a Y'Y'Y' motif occurring at positions 11, 12, or 13 of the strand, where the numbering starts from the first nucleotide from the 5' end, or optionally, the numbering starts from the 5' end with the first paired nucleotide in the duplex region, and Y' represents a 2'-O-methyl modification. The antisense strand can further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region, and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.
[0359] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with the antisense strand represented by any one of the formulas (Ie), (If), (Ig), and (Ih), respectively.
[0360] Thus, the RNAi agent used in the methods of the present disclosure can include a sense strand and an antisense strand, each strand having 14-30 nucleotides, and the RNAi duplex can have the formula (Ii): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p ’ -N a ’ -(X'X'X') k -N b ’ -Y'Y'Y'-N b ’ -(Z'Z'Z') l -N a ’ -n q ’ 5'(Ii) During the ceremony, i, j, k, and l are each independently 0 or 1; p, p', q and q' each independently represent 0 to 6; each N a and N a ’ independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b and N b ’ independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; During the ceremony, each n p ',n p , n q ' and n q each of which may or may not be present independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0361] In one embodiment, i is 0 and j is 0, or i is 1 and j is 0, or i is 0 and j is 1, or i and j are both 0, or i and j are both 1. In another embodiment, k is 0 and l is 0, or k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 0, or k and l are both 1.
[0362] An exemplary combination of sense and antisense strands that form an RNAi duplex is represented by the formula: 5'n p -N a -YYY-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N a ’ n q ’ 5'(Ij) 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ n q ’ 5'(Ik) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'np ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N a ’ -n q ’ 5'(Il) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a -n q ’ 5'(Im)
[0363] When the RNAi agent is represented by formula (Ij), each N a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0364] When the RNAi agent is represented by formula (Ik), each N b independently represent an oligonucleotide sequence containing 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0365] When the RNAi agent is represented by formula (II), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0366] When the RNAi agent is represented by formula (Im), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a ’ independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b , and N b ’ each independently comprises an alternating pattern of modifications.
[0367] In one embodiment, when the RNAi agent has formula (Im), N a The modification is a 2"-O-methyl modification or a 2"-fluoro modification. In another embodiment, when the RNAi agent has formula (Im), N a The modifications are 2'-O-methyl or 2'-fluoro modifications, and p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (Im), N' is linked to the adjacent nucleotide via a phosphorothioate linkage. a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the RNAi agent has formula (Im), N' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand is conjugated to one or more C16 (or related thereto) moieties attached via a divalent or trivalent branched linker (described below). a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p' are linked to adjacent nucleotides via phosphorothioate linkages, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic moieties, e.g., C16 (or related) moieties, which may optionally be attached via a bivalent or trivalent branched linker.
[0368] In one embodiment, when the RNAi agent has formula (Ij), N a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' are linked to adjacent nucleotides via phosphorothioate linkages, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic moieties, e.g., C16 (or related) moieties, which may be attached via a divalent or trivalent branched linker.
[0369] In one embodiment, the RNAi agent is a multimer comprising at least two double strands represented by formula (Ii), (Ij), (Ik), (II), and (Im), and the double strands are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each double strand can target the same gene or two different genes, or each double strand can target the same gene at two different target sites.
[0370] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more double strands represented by formula (Ii), (Ij), (Ik), (Il), and (Im), and the double strands are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the double strands can target the same gene or two different genes, or each of the double strands can target the same gene at two different target sites.
[0371] In one embodiment, two RNAi agents represented by formula (Ii), (Ij), (Ik), (Il), and (Im) are linked to each other at their 5' ends and optionally conjugated to a ligand at one or both of their 3' ends. The agents can each target the same gene or two different genes, or the agents can each target the same gene at two different target sites.
[0372] Various publications describe the multimeric RNAi agent that can be used in the method of the present disclosure.These publications include International Publication No. 2007 / 091269, International Publication No. 2010 / 141511, International Publication No. 2007 / 117686, International Publication No. 2009 / 014887 and International Publication No. 2011 / 031520 and United States Patent No. 7858769, each of whose entire contents is incorporated herein by reference.
[0373] In certain embodiments, the compositions and methods of the present disclosure include vinyl phosphonate (VP) modifications of RNAi agents as described herein. In exemplary embodiments, the vinyl phosphonates of the present disclosure have the following structure: [ka]
[0374] The vinyl phosphonate of the present disclosure can be attached to either the antisense or sense strand of the dsRNA of the present disclosure. In certain embodiments, the vinyl phosphonate of the present disclosure is attached to the antisense strand of the dsRNA, optionally at the 5' end of the antisense strand of the dsRNA.
[0375] The dsRNAi agent may contain a phosphorus-containing group at the 5'-end of the sense strand or antisense strand. The 5'-terminal phosphorus-containing group may be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MMePhos), or 5'-deoxy-5'-C-malonyl. When the 5'-terminal phosphorus-containing group is 5'-terminal vinylphosphonate (5'-VP), the 5'-VP may be a 5'-E-VP isomer (i.e., trans-vinylphosphonate, [ka] 5'-Z-VP isomer (i.e., cis-vinyl phosphonate, [ka] or a mixture thereof.
[0376] For example, if the phosphate mimetic is a 5'-vinylphosphonate (VP), the 5' terminal nucleotide may have the structure: [ka] wherein X is O or S; R is hydrogen, hydroxy, fluoro, or C 1~20 alkoxy (e.g., methoxy or n-hexadecyloxy); R 5 is =C(H)-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in the E or Z conformation (e.g., E conformation), and B is a nucleobase or modified nucleobase, optionally B is adenine, guanine, cytosine, thymine, or uracil.
[0377] In one embodiment, R 5’ is ═C(H)—P(O)(OH) and the double bond between the C5′ carbon and R5′ is in the E configuration. In another embodiment, R is methoxy and R5’ is ═C(H)—P(O)(OH) and the double bond between the C5′ carbon and R5′ is in the E configuration. In another embodiment, X is S, R is methoxy and R 5’ is =C(H)-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in the E configuration.
[0378] Vinyl phosphate modifications are also contemplated for the compositions and methods of the present disclosure. An exemplary vinyl phosphate structure is as follows: [ka] Substitutions may be made in the phosphonate structure described above.
[0379] i. Thermal destabilization modification In certain embodiments, dsRNA molecules can be optimized for RNA interference by incorporating a thermally destabilizing modification into the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been discovered that dsRNAs having an antisense strand containing at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5' end of the antisense strand have reduced off-target gene silencing activity. Thus, in some embodiments, the antisense strand contains at least one (e.g., one, two, three, four, five, or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand. In some embodiments, the thermally destabilizing modification of one or more duplexes is located between positions 2-9, or preferably between positions 4-8, from the 5' end of the antisense strand. In some further embodiments, the thermally destabilizing modification of the duplex is located at positions 6, 7, or 8 from the 5' end of the antisense strand. In some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5' end of the antisense strand. The term "thermally destabilizing modification" includes modifications that result in a dsRNA having a lower overall melting temperature (Tm), preferably one, two, three or four degrees lower than the melting temperature (Tm) of a dsRNA that does not have such a modification. In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5' end of the antisense strand.
[0380] Thermally destabilizing modifications can include, but are not limited to, abasic modifications; mismatches with opposing nucleotides in the opposing strand; and sugar modifications such as 2'-deoxy modifications or acyclic nucleotides such as unlocked nucleic acids (UNAs), glycol nucleic acids (GNAs); and 2'-5'-linked ribonucleotides ("3'-RNAs").
[0381] Exemplary abasic modifications include, but are not limited to, the following: [ka] wherein R=H, Me, Et or OMe, R'=H, Me, Et or OMe, R"=H, Me, Et or OMe.
[0382] Further exemplary thermodestabilizing modifications include, but are not limited to, the following: [ka] wherein B is a modified or unmodified nucleobase.
[0383] Exemplary sugar modifications include, but are not limited to, the following: [ka] wherein B is a modified or unmodified nucleobase.
[0384] In some embodiments, the thermally destabilizing modifications of the duplex are selected from the group consisting of: [ka] where B is a modified or unmodified nucleobase, and the asterisk on each structure represents either R, S, or racemic.
[0385] In some embodiments, the thermally destabilizing modification of the duplex is selected from the group consisting of: [ka] wherein B is a modified or unmodified nucleobase and the asterisk represents either R, S or racemic (e.g., S).
[0386] The term "acyclic nucleotide" refers to any nucleotide having an acyclic ribose sugar, for example, one in which any of the bonds of the ribose carbon ring (e.g., C1'-C2', C2'-C3', C3'-C4', C4'-O4', or C1'-O4') are absent, or at least one of the ribose carbons or oxygens (e.g., C1', C2', C3', C4', or O4'), independently or in combination, is absent from the nucleotide. In some embodiments, an acyclic nucleotide is [ka] wherein B is a modified or unmodified nucleobase and R 1 and R 2 are independently H, halogen, OR3, or alkyl, and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar. Acyclic derivatives offer greater backbone flexibility without affecting Watson-Crick pairing. Acyclic nucleotides can be linked via 2'-5' or 3'-5' linkages.
[0387] The term "GNA" refers to glycol nucleic acid, which is a polymer similar to DNA or RNA, but differs in the composition of its "backbone" in that it is made up of repeating glycerol units linked by phosphodiester bonds. [ka]
[0388] The thermally destabilizing modification of the duplex can be a mismatch (i.e., non-complementary base pair) between the thermally destabilizing nucleotide and the opposite nucleotide in the opposite strand of the dsRNA duplex.Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof.Other mismatch base pairings known in the art are also contemplated by the present invention.Mismatches can occur between nucleotides that are either naturally occurring or modified nucleotides, i.e., mismatch base pairings can occur between the nucleobases derived from each nucleotide, regardless of the modification on the ribose sugar of the nucleotide.In certain embodiments, the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2'-deoxynucleobase, for example, the 2'-deoxynucleobase is in the sense strand.
[0389] In some embodiments, the thermodestabilizing modifications of the duplex in the seed region of the antisense strand include nucleotides that impair WCH bonding with complementary bases on the target mRNA, such as: [ka]
[0390] Many examples of abasic nucleotides, acyclic nucleotide modifications (including UNA and GNA) and mismatch modifications are described in detail in WO 2011 / 133876, which is incorporated herein by reference in its entirety.
[0391] Thermally destabilizing modifications can also include universal base and phosphate modifications that have reduced or eliminated ability to form hydrogen bonds with opposing bases.
[0392] In some embodiments, the thermal destabilizing modification of duplex comprises the nucleotide with non-standard base, for example but not limited to, the nucleobase modification that the ability to form hydrogen bond with the base in opposite strand is impaired or completely lost.These nucleobase modifications have been evaluated for the destabilization of the central region of dsRNA duplex, as described in International Publication No. 2010 / 0011895, the entire contents of which are incorporated herein by reference.Exemplary nucleobase modifications include: [ka]
[0393] In some embodiments, the thermally destabilizing modifications of the duplex in the seed region of the antisense strand include one or more α-nucleotides that are complementary to bases on the target mRNA, such as: [ka] wherein R is H, OH, OCH3, F, NH2, NHMe, NMe2 or O-alkyl.
[0394] Exemplary phosphate modifications that have been shown to reduce the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages include the following: [ka]
[0395] The alkyl R group can be a C1-C6 alkyl. Specific alkyl R groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, pentyl, and hexyl.
[0396] As those skilled in the art will recognize, considering that the functional role of nucleobase defines the specificity of the RNAi agent of the present disclosure, nucleobase modification can be carried out in various ways as described herein, for example, for the purpose of enhancing on-target effect against off-target effect, for example, introducing destabilizing modification into the RNAi agent of the present disclosure, and generally the range of modifications present on the RNAi agent of the present disclosure tends to be much greater than the non-nucleobase modifications, for example, the modification of the sugar group or phosphate backbone of polyribonucleotide.Such modifications will be described in more detail in other sections of the present disclosure, and are expressly intended for the RNAi agent of the present disclosure that has either natural nucleobase or modified nucleobase as described above or elsewhere herein.
[0397] In addition to the antisense strand containing a thermally destabilizing modification, the dsRNA may also contain one or more stabilizing modifications. For example, the dsRNA may contain at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) stabilizing modifications. Without limitation, all of the stabilizing modifications may be present in one strand. In some embodiments, both the sense and antisense strands contain at least two stabilizing modifications. The stabilizing modifications may occur at any nucleotide in either the sense or antisense strand. For example, the stabilizing modifications may occur at any nucleotide in the sense or antisense strand, and each stabilizing modification may occur in an alternating pattern on the sense or antisense strand, or the sense or antisense strand may contain both stabilizing modifications in an alternating pattern. The alternating pattern of stabilizing modifications on the sense strand may be the same as or different from that of the antisense strand, and the alternating pattern of stabilizing modifications on the sense strand may be shifted relative to the alternating pattern of stabilizing modifications on the antisense strand.
[0398] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) stabilizing modifications. Without limitation, the stabilizing modifications within the antisense strand can be located at any position. In some embodiments, the antisense strand comprises stabilizing modifications at positions 2, 6, 8, 9, 14, and 16 from the 5' end. In some other embodiments, the antisense strand comprises stabilizing modifications at positions 2, 6, 14, and 16 from the 5' end. In yet some other embodiments, the antisense strand comprises stabilizing modifications at positions 2, 14, and 16 from the 5' end.
[0399] In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification.For example, the stabilizing modification can be at the 5'-end or 3'-end of the destabilizing modification, i.e., at the -1 or +1 position from the position of the destabilizing modification, nucleotide.In some embodiments, the antisense strand comprises a stabilizing modification at each of the 5'-end and 3'-end of the destabilizing modification, i.e., at the -1 and +1 positions from the position of the destabilizing modification.
[0400] In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3' end of the destabilizing modification, ie, at positions +1 and +2 from the position of the destabilizing modification.
[0401] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) stabilizing modifications. Without limitation, the stabilizing modifications within the sense strand can be located at any position. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10, and 11 from the 5' end. In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10, and 11 from the 5' end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complementary to positions 11, 12, and 15 of the antisense strand, counting from the 5' end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5' end of the antisense strand. In some embodiments, the sense strand comprises blocks of two, three, or four stabilizing modifications.
[0402] In some embodiments, the sense strand does not contain a stabilizing modification at a position opposite or complementary to a thermally destabilizing modification of the duplex in the antisense strand.
[0403] Exemplary thermally stabilizing modifications include, but are not limited to, 2'-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to, LNA.
[0404] In some embodiments, the dsRNA of the present disclosure contains at least four (e.g., four, five, six, seven, eight, nine, ten, or more) 2'-fluoro nucleotides. Without limitation, all of the 2'-fluoro nucleotides can be present in one strand. In some embodiments, both the sense and antisense strands contain at least two 2'-fluoro nucleotides. The 2'-fluoro modification can occur on either the sense strand or the antisense strand's nucleotide. For example, the 2'-fluoro modification can occur on any nucleotide on the sense strand or the antisense strand, and each 2'-fluoro modification can occur in an alternating pattern on the sense strand or the antisense strand, or both the sense strand and the antisense strand contain 2'-fluoro modifications in an alternating pattern. The alternating pattern of 2'-fluoro modifications on the sense strand can be the same as or different from that of the antisense strand, and the alternating pattern of 2'-fluoro modifications on the sense strand can be shifted relative to the alternating pattern of 2'-fluoro modifications on the antisense strand.
[0405] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2'-fluoro nucleotides. Without limitation, the 2'-fluoro modifications in the antisense strand can be present at any position. In some embodiments, the antisense strand comprises 2'-fluoro nucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5' end. In some other embodiments, the antisense strand comprises 2'-fluoro nucleotides at positions 2, 6, 14, and 16 from the 5' end. In yet some other embodiments, the antisense strand comprises 2'-fluoro nucleotides at positions 2, 14, and 16 from the 5' end.
[0406] In some embodiments, antisense strand comprises at least one 2'-fluoro nucleotide adjacent to destabilizing modification.For example, 2'-fluoro nucleotide can be at the 5'-end or 3'-end of destabilizing modification, that is, at the -1 position or +1 position from the position of destabilizing modification, nucleotide.In some embodiments, antisense strand comprises 2'-fluoro nucleotide at each of the 5'-end and 3'-end of destabilizing modification, that is, at the -1 position and +1 position from the position of destabilizing modification.
[0407] In some embodiments, the antisense strand comprises at least two 2'-fluoro nucleotides at the 3' end of the destabilizing modification, ie, at positions +1 and +2 from the position of the destabilizing modification.
[0408] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2'-fluoro nucleotides. Without limitation, the 2'-fluoro modifications within the sense strand can be present at any position. In some embodiments, the antisense strand comprises 2'-fluoro nucleotides at positions 7, 10, and 11 from the 5'-end. In some other embodiments, the sense strand comprises 2'-fluoro nucleotides at positions 7, 9, 10, and 11 from the 5'-end. In some embodiments, the sense strand comprises 2'-fluoro nucleotides at positions opposite or complementary to positions 11, 12, and 15 of the antisense strand, counting from the 5'-end of the antisense strand. In some other embodiments, the sense strand comprises 2'-fluoro nucleotides at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5'-end of the antisense strand. In some embodiments, the sense strand comprises two, three, or four blocks of 2'-fluoro nucleotides.
[0409] In some embodiments, the sense strand does not contain a 2'-fluoro nucleotide at a position opposite or complementary to a thermally destabilizing modification of the duplex in the antisense strand.
[0410] In some embodiments, a dsRNA molecule of the present disclosure comprises a 21 nucleotide (nt) sense strand and a 23 nucleotide (nt) antisense strand, wherein the antisense strand contains at least one thermolabile nucleotide, wherein the at least one thermolabile nucleotide occurs within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), wherein one end of the dsRNA is blunt while the other end comprises a 2 nt overhang, and the dsRNA optionally comprises at least The antisense strand further comprises at least one (e.g., one, two, three, four, five, six, or all seven) of the following features: (i) the antisense strand comprises two, three, four, five, or six 2'-fluoro modifications, (ii) the antisense strand comprises one, two, three, four, or five phosphorothioate internucleotide linkages, (iii) the sense strand is conjugated to a ligand, (iv) the sense strand comprises two, three, four, or five 2'-fluoro modifications, (v) the sense strand comprises one, two, three, four, or five phosphorothioate internucleotide linkages, (vi) the dsRNA comprises at least four 2'-fluoro modifications, and (vii) the dsRNA comprises a blunt end at the 5' end of the antisense strand. Preferably, a 2-nt overhang is at the 3' end of the antisense strand.
[0411] In some embodiments, a dsRNA molecule of the present disclosure comprises a sense strand and an antisense strand, wherein the sense strand is 25 to 30 nucleotide residues in length and, starting from the 5'-terminal nucleotide (position 1), comprises at least 8 ribonucleotides at positions 1 to 23 of the sense strand; the antisense strand is 36 to 66 nucleotide residues in length and, starting from the 3'-terminal nucleotide, at least 8 ribonucleotides at these positions are paired with positions 1 to 23 of the sense strand to form a duplex; at least the 3'-terminal nucleotide of the antisense strand is not paired with the sense strand, and up to 6 consecutive 3'-terminal nucleotides are not paired with the sense strand, thereby forming a 1-6 nucleotide 3' single-stranded overhang; and the 5'-end of the antisense strand is composed of 10 to 30 consecutive nucleotides that are not paired with the sense strand. the antisense strand is composed of at least one ribonucleotide, thereby forming a single-stranded 5' overhang of 10 to 30 nucleotides, at least the 5'- and 3'-terminal nucleotides of the sense strand base-pair with nucleotides of the antisense strand when the sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially double-stranded region between the sense and antisense strands, and the antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of the length of the antisense strand to reduce target gene expression when the double-stranded nucleic acid is introduced into a mammalian cell, and the antisense strand contains at least one thermally destabilizing nucleotide, the at least one thermally destabilizing nucleotide being within the seed region of the antisense strand (i.e., at positions 2-9 of the 5'-end of the antisense strand).For example, the thermally destabilizing nucleotide occurs between positions 14-17 opposite or complementary to positions 14-17 of the 5' end of the sense strand, and the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, or all seven) of the following features: (i) the antisense strand contains two, three, four, five, or six 2'-fluoro modifications; (ii) the antisense strand contains one, two, three, four, or five phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated to a ligand; (iv) the sense strand contains two, three, four, or five 2'-fluoro modifications; (v) the sense strand contains one, two, three, four, or five phosphorothioate internucleotide linkages; and (vi) the dsRNA contains at least four 2'-fluoro modifications; and (vii) the dsRNA contains a duplex region 12-30 nucleotide pairs in length.
[0412] In some embodiments, a dsRNA molecule of the present disclosure comprises a sense strand and an antisense strand, the dsRNA molecule comprising a sense strand having a length of at least 25 nucleotides and at most 29 nucleotides, and an antisense strand having a length of at most 30 nucleotides, the sense strand comprising a modified nucleotide at position 11 from the 5' end that is susceptible to enzymatic degradation, the 3' end of the sense strand and the 5' end of the antisense strand forming a blunt end, and the antisense strand is 1 to 4 nucleotides longer at its 3' end than the sense strand, the duplex region being at least 25 nucleotides in length, and the antisense strand being sufficiently complementary to a target mRNA along at least 19 nT of the antisense strand, such that the dsRNA molecule reduces target gene expression when introduced into a mammalian cell, and Dicer cleavage of the dsRNA preferentially results in an siRNA comprising the 3' end of the antisense strand, thereby inhibiting target gene expression in mammalian cells. The antisense dsRNA optionally further comprises at least one thermally destabilized nucleotide within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), and the dsRNA optionally further comprises at least one of the following features (e.g., one, two, three, four, five, six, or all seven): (i) the antisense dsRNA comprises two, three, four, five, or six 2'-fluoro modifications; (ii) the antisense dsRNA comprises at least one thermally destabilized nucleotide within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand); (iii) the sense strand is conjugated to a ligand; (iv) the sense strand contains two, three, four, or five 2'-fluoro modifications; (v) the sense strand contains one, two, three, four, or five phosphorothioate internucleotide linkages; and (vi) the dsRNA contains at least four 2'-fluoro modifications; and (vii) the dsRNA has a duplex region 12 to 29 nucleotide pairs in length.
[0413] In some embodiments, any nucleotide in the sense strand and antisense strand of dsRNA molecule can be modified.Each nucleotide can be modified with the same or different modifications, and these modifications can include one or both of non-linked phosphate oxygen or one or more of linked phosphate oxygen, modifying the ribose sugar component, for example, modifying the 2' hydroxyl on the ribose sugar, replacing phosphate moiety with "dephosphorylation" linker in large scale, modifying or replacing naturally occurring base, and replacing or modifying ribose phosphate backbone.
[0414] Because nucleic acids are polymers of subunits, many modifications occur at positions that are repeated within nucleic acids, such as modifications of bases or phosphate moieties, or unlinked Os in phosphate moieties.In some cases, modifications occur at all target positions in nucleic acids, but in many cases, they do not occur.For example, modifications can occur only at the 3'-end or 5'-end positions, or only in terminal regions, such as at the terminal nucleotide position of the chain or at the last 2, 3, 4, 5, or 10 nucleotides of the chain.Modifications can occur in double-stranded regions, single-stranded regions, or both.Modifications can occur only in the double-stranded region of RNA, or only in the single-stranded region of RNA.For example, phosphorothioate modifications at unlinked O positions can occur only at one or both ends, or only in terminal regions, such as at the terminal nucleotide position of the chain or within the last 2, 3, 4, 5, or 10 nucleotides, or in double-stranded and single-stranded regions, especially at the ends. The 5' end can be phosphorylated.
[0415] This may, for example, enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide substitutes in the single-stranded overhang, for example, in the 5' overhang or 3' overhang, or in both overhangs.For example, it may be desirable to include purine nucleotides in the overhang.In some embodiments, all or part of the bases in the 3' overhang or 5' overhang can be modified, for example, with the modifications described herein.Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar with modifications known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl, instead of the ribosugar of the nucleic acid base, and modifications at the phosphate group, for example, phosphorothioate modifications.The overhang does not need to be homologous to the target sequence.
[0416] In some embodiments, each residue of the sense strand and the antisense strand is independently modified with locked nucleic acid (LNA), unlocked nucleic acid (UNA), cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, or 2'-fluoro. These strands may contain two or more modifications. In some embodiments, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. It should be understood that these modifications are in addition to at least one thermally destabilizing modification of the duplex present in the antisense strand.
[0417] At least two different modifications are typically present on the sense strand and the antisense strand. These modifications can be 2'-deoxy, 2'-O-methyl, or 2'-fluoro modifications, acyclic nucleotides, etc. In some embodiments, the sense strand and the antisense strand each contain two differently modified nucleotides selected from 2'-O-methyl or 2'-deoxy. In some embodiments, each residue in the sense strand and the antisense strand is independently modified with a 2'-O-methyl nucleotide, a 2'-deoxy nucleotide, a 2'-deoxy-2'-fluoro nucleotide, a 2'-ON-methylacetamide (2'-O-NMA) nucleotide, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleotide, a 2'-O-aminopropyl (2'-O-AP) nucleotide, or a 2'-ara-F nucleotide. Again, it should be understood that these modifications are in addition to at least one thermostabilizing modification of the duplex present in the antisense strand.
[0418] In some embodiments, the dsRNA molecules of the present disclosure contain an alternating pattern of modifications, particularly in the B1, B2, B3, B1', B2', B3', and B4' regions. The term "alternating motif" or "alternating pattern," as used herein, refers to a motif having one or more modifications, with each modification occurring at alternating nucleotides in a single strand. The alternating nucleotides may refer to one every other nucleotide, one every three nucleotides, or similar patterns. For example, if A, B, and C each represent a type of modification to a nucleotide, the alternating motif may be "ABABABABABAB...," "AABBAABBAABB...," "AABAABAABAAB...," "AAABAAABAAAB...," "AAABBBAAABBB...," or "ABCABCABCABC...," etc.
[0419] The types of modifications contained within an alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications on every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possible modifications within the alternating motif, such as "ABABAB...," "ACACAC...," "BDBDBD...," or "CDCDCD...," etc.
[0420] In some embodiments, dsRNA molecules of the present disclosure include an alternating motif modification pattern on the sense strand that is shifted relative to the alternating motif modification pattern on the antisense strand. The shift can be such that modified groups on nucleotides in the sense strand correspond to differently modified groups on nucleotides in the antisense strand, or vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA duplex, the alternating motif in the sense strand can begin with "ABABAB" from the 5'-3' end of the strand, and the alternating motif in the antisense strand can begin with "BABABA" from the 3'-5' end of the strand in the duplex region. As another example, the alternating motif in the sense strand can begin with "AABBAABB" from the 5'-3' end of the strand, and the alternating motif in the antisense strand can begin with "BBAABBAA" from the 3'-5' end of the strand in the duplex region, resulting in a complete or partial shift in the modification pattern between the sense and antisense strands.
[0421] In one particular embodiment, the alternating motif in the sense strand is "ABABAB" from 5'-3' of the strand, where each A is an unmodified ribonucleotide and each B is a 2'-O methyl modified nucleotide.
[0422] In one particular embodiment, the alternating motif in the sense strand is "ABABAB" from 5'-3' of the strand, where each A is a 2'-deoxy-2'-fluoro modified nucleotide and each B is a 2'-O methyl modified nucleotide.
[0423] In another specific embodiment, the alternating motif in the antisense strand is "BABABA" from 3'-5' of the strand, where each A is a 2'-deoxy-2'-fluoro modified nucleotide and each B is a 2'-O methyl modified nucleotide.
[0424] In one particular embodiment, the alternating motif in the sense strand is "ABABAB" from 5'-3' of that strand and the alternating motif in the antisense strand is "BABABA" from 3'-5' of that strand, where each A is an unmodified ribonucleotide and each B is a 2'-O methyl modified nucleotide.
[0425] In one particular example, the alternating motif in the sense strand is "ABABAB" from 5'-3' of that strand, and the alternating motif in the antisense strand is "BABABA" from 3'-5' of that strand, where each A is a 2'-deoxy-2'-fluoro modified nucleotide and each B is a 2'-O methyl modified nucleotide. dsRNA molecules of the present disclosure may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on nucleotides in either the sense strand or the antisense strand, or on both strands, at any position along the strand. For example, the internucleotide linkage modification may occur at any nucleotide on the sense strand or the antisense strand, each internucleotide linkage modification may occur in an alternating pattern on the sense strand or the antisense strand, or the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide linkage modifications on the sense strand can be the same as or different from that on the antisense strand, and the alternating pattern of internucleotide linkage modifications on the sense strand can be displaced relative to the alternating pattern of internucleotide linkage modifications on the antisense strand.
[0426] In some embodiments, the dsRNA molecule comprises phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.For example, the overhang region comprises two nucleotides, and the two nucleotides comprise phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.Internucleotide linkage modification can also be made to link the overhang nucleotide to the terminal paired nucleotide in the double-stranded region.For example, at least 2, 3, 4 or all of the overhang nucleotides can be linked by phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there can be an additional phosphorothioate or methylphosphonate internucleotide linkage connecting the overhang nucleotide to the paired nucleotide adjacent to the overhang nucleotide.For example, there can be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, such that two of the three nucleotides are overhang nucleotides and the third is the paired nucleotide adjacent to the overhang nucleotide.Preferably, these terminal three nucleotides can be at the 3'-end of the antisense strand.
[0427] In some embodiments, the sense strand of the dsRNA molecule comprises 1 to 10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0428] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0429] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, one of the phosphorothioate or methylphosphonate internucleotide linkages being positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0430] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0431] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0432] In some embodiments, the antisense strand of the dsRNA molecule contains two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand containing any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand containing either phosphorothioate or methylphosphonate or phosphate linkages.
[0433] In some embodiments, the antisense strand of the dsRNA molecule contains two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, or 8 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand containing any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand containing either phosphorothioate or methylphosphonate or phosphate linkages.
[0434] In some embodiments, the antisense strand of a dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, or 6 phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or with an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkages.
[0435] In some embodiments, the antisense strand of a dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by one, two, three, or four phosphate internucleotide linkages, one of which is positioned at any position within the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or with an antisense strand comprising either phosphorothioate, methylphosphonate, or phosphate linkages.
[0436] In some embodiments, dsRNA molecules of this disclosure further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 1 to 10 of the termini of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides can be linked via phosphorothioate or methylphosphonate internucleotide linkages at one or both termini of the sense or antisense strand.
[0437] In some embodiments, the dsRNA molecules of the present disclosure further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modifications within 1-10 of the internal region of the duplex of each of the sense or antisense strands. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides can be linked via phosphorothioate methylphosphonate internucleotide linkage modifications at positions 8-16 of the duplex region, counting from the 5' end of the sense strand, and the dsRNA molecule can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 1-10 of that end.
[0438] In some embodiments, dsRNA molecules of the disclosure comprise one to five phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18-23 of the sense strand, and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) of the antisense strand and one to five within positions 18-23 of the antisense strand.
[0439] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification within the range of positions 1-5 (counting from the 5' end) and one phosphorothioate or methylphosphonate internucleotide linkage modification within the range of positions 18-23 of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 (counting from the 5' end) and two phosphorothioate or methylphosphonate internucleotide linkage modifications within the range of positions 18-23 of the antisense strand.
[0440] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1-5 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the antisense strand.
[0441] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1-5 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the antisense strand.
[0442] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1-5 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the antisense strand.
[0443] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification within the range of positions 1-5 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the antisense strand (counting from the 5' end).
[0444] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification within the range of positions 1-5 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the antisense strand.
[0445] In some embodiments, dsRNA molecules of the present disclosure further comprise one phosphorothioate internucleotide linkage modification within the range of positions 1 to 5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within the range of positions 18 to 23 (counting from the 5' end) of the antisense strand.
[0446] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1 to 5 (counting from the 5' end) of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 and two phosphorothioate internucleotide linkage modifications within the range of positions 18 to 23 (counting from the 5' end) of the antisense strand.
[0447] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1 to 5 (counting from the 5' end) and one within the range of positions 18 to 23 of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18 to 23 of the antisense strand.
[0448] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1 to 5 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18 to 23 of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within the range of positions 18 to 23 of the antisense strand (counting from the 5' end).
[0449] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications within the range of positions 1-5 (counting from the 5' end) and one phosphorothioate internucleotide linkage modification within the range of positions 18-23 of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 or 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications within the range of positions 18-23 of the antisense strand.
[0450] In some embodiments, the dsRNA molecules of this disclosure further comprise two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 of the sense strand, and one phosphorothioate internucleotide linkage modification at position 1 and one at position 21 (counting from the 5' end) of the antisense strand.
[0451] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 (counting from the 5' end) of the antisense strand.
[0452] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 of the sense strand, and one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 (counting from the 5' end) of the antisense strand.
[0453] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 (counting from the 5' end) of the antisense strand.
[0454] In some embodiments, dsRNA molecules of the disclosure further comprise two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) and two phosphorothioate internucleotide linkage modifications at positions 22 and 23 of the sense strand, and one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 (counting from the 5' end) of the antisense strand.
[0455] In some embodiments, dsRNA molecules of the disclosure further comprise one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 (counting from the 5' end) of the antisense strand.
[0456] In some embodiments, the compounds of the present disclosure comprise a pattern of backbone chiral centers. In some embodiments, the regular pattern of backbone chiral centers comprises at least 5 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 6 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 7 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 8 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 9 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 10 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 11 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 12 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 13 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 14 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 15 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 16 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 17 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 18 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises at least 19 internucleotide linkages in the Sp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 8 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 7 or fewer internucleotide linkages in the Rp configuration.In some embodiments, the regular pattern of backbone chiral centers comprises 6 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 5 or fewer internucleotide linkages in the Rp configuration.
[0457] In some embodiments, the regular pattern of backbone chiral centers comprises 4 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 3 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 2 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 1 or fewer internucleotide linkages in the Rp configuration. In some embodiments, the regular pattern of backbone chiral centers comprises 8 or fewer non-chiral internucleotide linkages (phosphodiesters as a non-limiting example). In some embodiments, the regular pattern of backbone chiral centers comprises 7 or fewer non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises 6 or fewer non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises 5 or fewer non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises 4 or fewer non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises 3 or fewer non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises no more than two non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises no more than one non-chiral internucleotide linkage. In some embodiments, the regular pattern of backbone chiral centers comprises at least 10 internucleotide linkages in the Sp configuration and no more than eight non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises at least 11 internucleotide linkages in the Sp configuration and no more than seven non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises at least 12 internucleotide linkages in the Sp configuration and no more than six non-chiral internucleotide linkages. In some embodiments, the regular pattern of backbone chiral centers comprises at least 13 internucleotide linkages in the Sp configuration and no more than six non-chiral internucleotide linkages.In some embodiments, the regular pattern of backbone chiral centers comprises at least 14 internucleotide linkages in the Sp configuration and no more than 5 internucleotide linkages that are non-chiral. In some embodiments, the regular pattern of backbone chiral centers comprises at least 15 internucleotide linkages in the Sp configuration and no more than 4 internucleotide linkages that are non-chiral. In some embodiments, the internucleotide linkages in the Sp configuration may be contiguous or non-contiguous. In some embodiments, the internucleotide linkages in the Rp configuration may be contiguous or non-contiguous. In some embodiments, the non-chiral internucleotide linkages may be contiguous or non-contiguous.
[0458] In some embodiments, compounds of the present disclosure include blocks that are stereochemical blocks. In some embodiments, the blocks are Rp blocks, in that each internucleotide linkage of the block is Rp. In some embodiments, the 5'-block is an Rp block. In some embodiments, the 3'-block is an Rp block. In some embodiments, the blocks are Sp blocks, in that each internucleotide linkage of the block is Sp. In some embodiments, the 5'-block is an Sp block. In some embodiments, the 3'-block is an Sp block. In some embodiments, provided oligonucleotides include both Rp and Sp blocks. In some embodiments, provided oligonucleotides include one or more Rp blocks but no Sp blocks. In some embodiments, provided oligonucleotides include one or more Sp blocks but no Rp blocks. In some embodiments, provided oligonucleotides include one or more PO blocks, where each internucleotide linkage is a natural phosphate linkage.
[0459] In some embodiments, compounds of the present disclosure include a 5'-block that is an Sp block in which each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp block in which each internucleotide linkage is a modified internucleotide linkage and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp block in which each internucleotide linkage is a phosphorothioate linkage and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block comprises four or more nucleoside units. In some embodiments, the 5'-block comprises five or more nucleoside units. In some embodiments, the 5'-block comprises six or more nucleoside units. In some embodiments, the 5'-block comprises seven or more nucleoside units. In some embodiments, the 3'-block is an Sp block in which each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp block in which each internucleotide linkage is a modified internucleotide linkage and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp block, in which each of the internucleotide linkages is a phosphorothioate linkage and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block comprises 4 or more nucleoside units. In some embodiments, the 3'-block comprises 5 or more nucleoside units. In some embodiments, the 3'-block comprises 6 or more nucleoside units. In some embodiments, the 3'-block comprises 7 or more nucleoside units.
[0460] In some embodiments, compounds of the present disclosure comprise a type of nucleoside in a region or oligonucleotide followed by a particular type of internucleotide linkage, such as a natural phosphate linkage, a modified internucleotide linkage, an Rp chiral internucleotide linkage, an Sp chiral internucleotide linkage, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by a natural phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by a natural phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by a natural phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by a natural phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by a natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.
[0461] In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotides 21 and 22 and between nucleotides 22 and 23, the antisense strand contains at least one thermodestabilizing modification of the duplex located within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), and the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven, or all eight) of the following features: (i) the antisense strand contains two, three, four, five, or six 2'-fluoro modifications; (ii) the antisense strand comprises 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated to a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2'-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2'-fluoro modifications; (vii) the dsRNA comprises a duplex region 12 to 40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at the 5' end of the antisense strand.
[0462] In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, the antisense strand contains at least one thermodestabilizing modification of the duplex located within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), and the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven, or all eight) of the following features: (i) the antisense strand comprises two, three, (ii) the sense strand is conjugated to a ligand; (iii) the sense strand contains two, three, four, or five 2'-fluoro modifications; (iv) the sense strand contains one, two, three, four, or five phosphorothioate internucleotide linkages; (v) the dsRNA contains at least four 2'-fluoro modifications; (vi) the dsRNA contains a duplex region 12 to 40 nucleotide pairs in length; (vii) the dsRNA contains a duplex region 12 to 40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at the 5' end of the antisense strand.
[0463] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3, and the antisense strand contains at least one thermodestabilizing modification of the duplex located within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), and the dsRNA optionally further comprises at least one (e.g., one, two, three, four, five, six, seven, or all eight) of the following features: (i) the antisense strand comprises two, three, four, five, or six 2'-fluoro modifications; (i) the antisense strand comprises one, two, three, four, or five phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated to a ligand; (iv) the sense strand comprises two, three, four, or five 2'-fluoro modifications; (v) the sense strand comprises three, four, or five phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2'-fluoro modifications; (vii) the dsRNA comprises a duplex region 12 to 40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at the 5' end of the antisense strand.
[0464] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3, and the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, the antisense strand contains at least one thermodestabilizing modification of the duplex located within the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand), and the dsRNA optionally has at least one of the following features: (e.g., one, two, three, four, five, six, or all seven): (i) the antisense strand comprises two, three, four, five, or six 2'-fluoro modifications; (ii) the sense strand is conjugated to a ligand; (iii) the sense strand comprises two, three, four, or five 2'-fluoro modifications; (iv) the sense strand comprises three, four, or five phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least two 2'-fluoro modifications; (vi) the dsRNA comprises a duplex region 12 to 40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at the 5' end of the antisense strand.
[0465] In some embodiments, the dsRNA molecule of the present disclosure comprises mismatches in the duplex with the target, or a combination thereof. Mismatches can occur in the overhang region or the duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (for example, based on the free energy of association or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but then adjacent or similar analysis can also be used). In terms of promoting dissociation, A:U is more preferable than G:C, G:U is more preferable than G:C, and I:C is more preferable than G:C (I=inosine). Mismatches, such as non-standard pairings or non-standard pairings (described elsewhere herein), are more preferable than standard pairings (A:T, A:U, G:C), and pairings that include universal bases are more preferable than standard pairings.
[0466] In some embodiments, the dsRNA molecules of the present disclosure comprise at least one mismatch pair within the duplex region from the 5' end of the antisense strand, which may be independently selected from the group of A:U, G:U, I:C, and a non-canonical or non-standard or universal base pair, to promote dissociation of the antisense strand at the 5' end of the duplex.
[0467] In some embodiments, the nucleotide at position 1 from the 5' end of the antisense strand to the duplex region is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first one, two, or three base pairs from the 5' end of the antisense strand to the duplex region is an AU base pair. For example, the first base pair from the 5' end of the antisense strand to the duplex region is an AU base pair.
[0468] It has been found that the introduction of a 4'- or 5'-modified nucleotide at the 3'-end of a dinucleotide phosphodiester (PO), phosphorothioate (PS), or phosphorodithioate (PS2) linkage at any position in a single- or double-stranded oligonucleotide can exert a steric effect on the internucleotide linkage, thereby protecting or stabilizing it against nucleases. In some embodiments, the introduction of a 4'- or 5'-modified nucleotide at the 3'-end of a dinucleotide PO, PS, or PS2 linkage modifies the second nucleotide in the dinucleotide pair. In other embodiments, the introduction of a 4'- or 5'-modified nucleotide at the 3'-end of a dinucleotide PO, PS, or PS2 linkage modifies the 3'-terminal nucleotide in the dinucleotide pair.
[0469] In some embodiments, 5'-modified nucleotide is introduced at the 3' end of dinucleotide at any position in single-stranded or double-stranded siRNA.For example, 5'-alkylated nucleoside can be introduced at the 3' end of dinucleotide at any position in single-stranded or double-stranded siRNA.The alkyl group at the 5' position of ribose sugar can be racemic or chiral pure R or S isomer.An exemplary 5'-alkylated nucleotide is 5'-methyl nucleoside.5'-methyl can be racemic or chiral pure R or S isomer.
[0470] In some embodiments, 4'-modified nucleotides are introduced at the 3' end of dinucleotides at any position in single-stranded or double-stranded siRNA.For example, 4'-alkylated nucleosides can be introduced at the 3' end of dinucleotides at any position in single-stranded or double-stranded siRNA.The alkyl group at the 4' position of ribose sugar can be racemic or chirally pure R or S isomer.Exemplary 4'-alkylated nucleotides include 4'-methyl nucleosides.4'-methyl can be racemic or chirally pure R or S isomer.Alternatively, 4'-O-alkylated nucleosides can be introduced at the 3' end of dinucleotides at any position in single-stranded or double-stranded siRNA.The 4'-O-alkyl of ribose sugar can be racemic or chirally pure R or S isomer. Exemplary 4'-O-alkylated nucleotides include 4'-O-methyl nucleosides, which can be either racemic or chirally pure R or S isomers.
[0471] In some embodiments, 5'-alkylated nucleotide is introduced at any position of the sense strand or antisense strand of dsRNA, and this modification maintains or improves the efficacy of dsRNA.5'-alkyl can be either racemic or chiral pure R or S isomer.Exemplary 5'-alkylated nucleotide is 5'-methyl nucleoside.5'-methyl can be either racemic or chiral pure R or S isomer.
[0472] In some embodiments, 4'-alkylated nucleotide is introduced at any position of the sense strand or antisense strand of dsRNA, and this modification maintains or improves the efficacy of dsRNA.4'-alkyl can be either racemic or chiral pure R or S isomer.Exemplary 4'-alkylated nucleotide includes 4'-methyl nucleoside.4'-methyl can be either racemic or chiral pure R or S isomer.
[0473] In some embodiments, 4'-O-alkylated nucleotide can be introduced at any position of the sense strand or antisense strand of dsRNA, and this modification can maintain or improve the efficacy of dsRNA.5'-Alkyl can be either racemic or chiral pure R or S isomer.Exemplary 4'-O-alkylated nucleotide includes 4'-O-methyl nucleoside.4'-O-methyl can be either racemic or chiral pure R or S isomer.
[0474] In some embodiments, the dsRNA molecules of the present disclosure can comprise 2'-5' linkages (having 2'-H, 2'-OH and 2'-OMe, and also having P=O or P=S). For example, 2'-5' linkage modifications can be used to promote nuclease resistance, or to inhibit the binding of the sense strand to the antisense strand, or can be used at the 5' end of the sense strand to prevent the activation of the sense strand by RISC.
[0475] In another embodiment, the dsRNA molecule of the present disclosure can comprise L sugar (for example, L-ribose, L-arabinose, with 2'-H, 2'-OH and 2'-OMe).For example, these L sugar modifications can be used to promote nuclease resistance, or to inhibit the binding of sense strand to antisense strand, or can be used at the 5' end of sense strand to prevent the activation of sense strand by RISC.
[0476] Multimeric siRNA has been described in various publications, and all of them can be used with the dsRNA of the present disclosure.These publications include WO2007 / 091269, US Patent No. 7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887 and WO2011 / 031520, and each of them is incorporated herein by reference in its entirety.
[0477] As described in more detail below, RNAi agents containing one or more carbohydrate moieties conjugated to them can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose-replacement modified subunit (PRMS). The cyclic carrier can be a carbon-cyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, e.g., fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.
[0478] The ligand can be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone attachment point," preferably two "backbone attachment points," and (ii) at least one "tethering attachment point." As used herein, "backbone attachment point" refers to a functional group, e.g., a hydroxyl group, or generally a bond, available and suitable for incorporating the carrier into the backbone of a ribonucleic acid, e.g., a phosphate or a modified phosphate backbone, e.g., sulfur-containing. In some embodiments, a "tethering attachment point" (TAP) refers to a ring atom, e.g., a carbon atom or heteroatom (other than the atom providing the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety can be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier by an intervening tether. Thus, cyclic carriers often contain a functional group, e.g., an amino group, or generally a bond, that provides a linkage suitable for the incorporation or tethering of another chemical entity, e.g., a ligand, to the constituent ring.
[0479] The RNAi agent may be conjugated to the ligand via a carrier, which may be a cyclic or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; preferably, the acyclic group is selected from a serinol backbone or a diethanolamine backbone.
[0480] In certain embodiments, the RNAi agent used in the methods of the present disclosure is an agent selected from the group of agents listed in any one of Tables 3 to 6. These agents may further comprise a ligand.
[0481] IV. Ligand-Conjugated iRNA Another modification of the iRNA of the invention involves chemically linking the iRNA to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake, for example, of the iRNA. Such moieties include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al., Proc. Natl. Acids Sci. USA, 1989, 86:6553-6556), cholic acid (Manoharan et al., Bior. Med. Chem. Let., 1994, 4:1053-1060), thioethers such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309, Manoharan et al., Bior. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), fatty chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118, Kabanov et al., FEBS Lett., 1990, 259:327-330, Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654, Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0482] In certain embodiments, ligand changes the distribution, targeting or life span of the iRNA agent into which it is incorporated.In some embodiments, ligand brings about enhanced affinity to selected target, for example, molecule, cell or cell type, compartment, tissue, organ or region of body, for example, cell or organ compartment, when compared with the species without such ligand.Normal ligand does not participate in double-stranded pairing in double-stranded nucleic acid.
[0483] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryl acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.
[0484] The ligand can also include a targeting group, such as a cell or tissue targeting agent, such as a lectin, a glycoprotein, lipid, or protein, such as an antibody, that binds to a specific cell type, such as a kidney cell.The targeting group can be thyroid stimulating hormone, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, biotin, or RGD peptide or RGD peptide mimic.In certain embodiments, the ligand is a polyvalent galactose, such as N-acetyl-galactosamine.
[0485] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules, such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutanoic acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithophosphate, and the like. Examples of suitable cleavage inhibitors include oleic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0486] Ligands can be proteins, such as glycoproteins or peptides, e.g., molecules with specific affinity for a co-ligand, or antibodies, e.g., antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-κB.
[0487] The ligand can be a substance, e.g., a drug, that can increase the uptake of an iRNA agent into a cell, for example, by disrupting the cytoskeleton of the cell, e.g., by disrupting the cell's microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0488] In some embodiments, the ligands binding to the iRNAs described herein act as pharmacokinetic modulators (PK modulators). PK modulators include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing several phosphorothioate linkages have also been shown to bind to serum proteins, and therefore short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g., oligonucleotides of about 5, 10, 15, or 20 bases, are also suitable as ligands (e.g., as PK-modulating ligands) for the present invention. Furthermore, aptamers that bind serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.
[0489] The ligand-conjugated iRNAs of the invention can be synthesized by using oligonucleotides bearing reactive functional pendant side chains, such as those derived from the attachment of a linking molecule onto the oligonucleotide (described below). The reactive oligonucleotides can be reacted directly with commercially available ligands, synthesized ligands bearing any of a variety of protecting groups, or ligands bearing a linking moiety attached thereto.
[0490] The oligonucleotides used in the conjugates of the present invention can be conveniently and routinely prepared by the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems® (Foster City, California). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.
[0491] In the ligand-conjugated oligonucleotides and sequence-specific linked nucleosides bearing ligand molecules of the present invention, the oligonucleotides and oligonucleosides can be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors already bearing a linking moiety, ligand-nucleotide or ligand-nucleoside conjugate precursors already bearing a ligand molecule, or non-nucleoside ligand-bearing building blocks.
[0492] When using a nucleotide-conjugate precursor that already possesses a linking moiety, typically, synthesis of the sequence-specifically linked nucleoside is completed, and then a ligand molecule is reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the invention are synthesized by automated synthesizers using phosphoramidites derived from ligand-nucleoside conjugates, in addition to commercially available standard and non-standard phosphoramidites routinely used in oligonucleotide synthesis.
[0493] A. Lipid Conjugates In certain embodiments, the ligand or conjugate is lipid or lipid-based molecule.This lipid or lipid-based molecule can usually bind serum protein, for example, human serum albumin (HSA).HSA-binding ligand allows the distribution of conjugate to target tissue in the body, for example, to target tissue other than the kidney.For example, the target tissue can be the liver, including the liver parenchymal cells.Other molecules that can bind HSA can also be used as ligand.For example, naproxen or aspirin can be used.Lipid or lipid-based ligand can (a) increase the resistance of conjugate to degradation, (b) increase targeting or transport into target cell or cell membrane, or (c) be used to adjust the binding to serum protein, for example, HSA.
[0494] Lipid-based ligands can be used to regulate, for example, control (for example, inhibit) the binding of conjugate to target tissue.For example, lipid or lipid-based ligands that bind more strongly to HSA are less likely to target the kidney, and therefore less likely to be eliminated from the body.A lipid or lipid-based ligand that binds less strongly to HSA can be used so that the conjugate targets the kidney.
[0495] In certain embodiments, the lipid-based ligand binds HSA. For example, the ligand can bind to HSA with sufficient affinity, thereby enhancing the distribution of the conjugate to non-renal tissues. However, this affinity is usually not so strong that the HSA-ligand binding is irreversible.
[0496] In certain embodiments, the lipid-based ligand binds weakly or not at all to HSA, thereby enhancing distribution of the conjugate to the kidney. Other moieties that target kidney cells can be used instead of or in addition to the lipid-based ligand.
[0497] In another aspect, the ligand is a moiety, for example, a vitamin, that is taken up by target cells, for example, proliferating cells.These are particularly useful for treating disorders characterized by unwanted cell proliferation, for example, malignant or non-malignant, for example, cancer cells.Exemplary vitamins include vitamins A, E and K.Other exemplary vitamins include vitamin B, for example, folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients that are taken up by cancer cells.Also included are HSA and low-density lipoprotein (LDL).
[0498] BB cell penetrating agents In another aspect, the ligand is a cell-penetrating agent, such as a helical cell-penetrating agent. In certain embodiments, the cell-penetrating agent is amphipathic. Exemplary cell-penetrating agents include peptides such as tat or antennapedia. When the cell-penetrating agent is a peptide, it can be modified, including peptidyl mimics, invertomers, non-peptide or pseudopeptide linkages, and the use of D-amino acids. Helical agents are usually α-helical agents, and can have lipophilic and lipophobic phases.
[0499] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules that can fold into de...
Claims
1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of MAPT, comprising a sense strand and an antisense strand forming a double-stranded region; The antisense strand comprises a region complementary to an mRNA encoding tau, the complementary region being SEQ ID NO: 1003, 1004, 1001, 1002, 1011, 1009 or 1010, or any of the sequences listed in the table below. 【Table 1】 【Table 2】 【Table 3】 【Table 4】 【Table 5】 【Table 6】 【Table 7】 【Table 8】 【Table 9】 【Table 10】 【Table 11】 【Table 12】 【Table 13】 【Table 14】 【Table 15】 Table 16 Table 17 dsRNA agent comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense nucleotide sequences of any one of
2. 2. The dsRNA agent of claim 1, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 514-534, 1072-1092, and 1067-1087 of SEQ ID NO:3, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:
4.
3. (a) The antisense strand is AD-1786708, AD-1786708v2, AD-1623140, AD-1637701, AD-1397070, AD-1397072, AD-1397073, AD-1397075, AD-1397081, AD-1397083, AD-1397088, AD-1397249, AD-1397252, AD-1397253, AD-1397258, AD-1397261, AD-1397262, AD-1397263, AD-1397291, AD-1397293, AD-1397294, AD-1397295, AD-1397298, AD-1397299, AD-1637732, AD-1637733, AD-1637734, AD-1637735, AD-1637736, AD-1637737, AD-1637739, AD-1637744, AD-1637745, AD-1637746, AD-1637747, AD-1637748, AD-1637749, AD-1637750, AD-1637751, AD-1637752, AD-1637753, AD-1637754, AD-1637755, AD-1637756, AD-1637757, AD-1637758, AD-1637759, AD-1637760, AD-1637761, AD-1637762, AD-1637763, AD-1637764, AD-1637765, AD-1637766, AD-1637767, AD-1637768, AD-1637769, AD-1637770, AD-1637771, AD-1637772, AD-1637773, AD-1637774, AD-1637775, AD-1637776, AD-1637777, AD-1637778, AD-1637779, AD-1637780, AD-1637781, AD-1637782, AD-1637783, AD-1637784, AD-1637785, AD-1637786, AD-1637787, AD-1637788, AD-1637789, AD-1637790, AD-1637791, AD-1637792, AD-1637793, AD-1637794, AD-1637795, AD-1637796, AD-1637797, AD-1637798, AD-1637799, AD-1637800,AD-1637801、AD-1637802、AD-1637803、AD-1637804、AD-1637805、AD-1637806、AD-1637807、AD-1637808、AD-1637809、AD-1637810、AD-1637811、AD-1637812、AD-1637813、AD-1637814、AD-1637815、AD-1637816、AD-1637817、AD-1637818、AD-1637819、AD-1637820、AD-1637821、AD-1637822、AD-1637823、AD-1637824、AD-1637825、AD-1637826、AD-1637827、AD-1637828、AD-1637829、AD-1637830、AD-1637831、AD-1637832、AD-1637833、AD-1637834、AD-1637835、AD-1637836、AD-1637837、AD-1637838、AD-1637839、AD-1637840、AD-1637841、AD-1637842、AD-1637843、AD-1637844、AD-1637845、AD-1637846、AD-1637847、AD-1637848、AD-1637849、AD-1637850、AD-1637851、AD-1637852、AD-1637853、AD-1637854、AD-1637855、AD-1637856、AD-1637857、AD-1637858、AD-1637859、AD-1637860、AD-1637861、AD-1637862、AD-1637863、AD-1637864、AD-1637865、AD-1637866、AD-1637867、AD-1637868、AD-1637869、AD-1637870、AD-1637871、AD-1637872、AD-1637873、AD-1637874、AD-1637875、AD-1637876、AD-1637877、AD-1637878、AD-1637879、AD-1637880、AD-1637881、AD-1637882、AD-1637883、AD-1637884、AD-1637885、AD-1637886、AD-1637887、AD-1637888、AD-1637889、AD-1637890、AD-1637891、AD-1637892, AD-1637893, AD-1637894, AD-1637895, AD-1637896, AD-1637897, AD-1637898, AD-1637899, AD-1637900, AD-163790 1, AD-1637902, AD-1637903, AD-1637904, AD-1637905, AD-1637906, AD-1637907, AD-1637908, AD-1637909, AD-1637910, AD-1637 911, AD-1637912, AD-1637913, AD-1637914, AD-1637915, AD-1637916, AD-1637917, AD-1637918, AD-1637919, AD-1637920, AD-16 37921, AD-1637922, AD-1637923, AD-1637924, AD-1637925, AD-1637926, AD-1637927, AD-1637928, AD-1637929, AD-1637930, AD- 1637931, AD-1637932, AD-1637933, AD-1637934, AD-1637935, AD-1637936, AD-1637937, AD-1637938, AD-1637939, AD-1637940, A D-1637941, AD-1637942, AD-1637943, AD-1637944, AD-1637945, AD-1637946, AD-1637947, AD-1637948, AD-1637949, AD-1637950 , AD-1637951, AD-1637952, AD-1637953, AD-1637954, AD-1637955, AD-1637956, AD-1637957, AD-1637958, AD-1637959, AD-1637960, AD-397167, and AD-523565; and / or (b) the nucleotide sequences of the sense strand and the antisense strand are selected from the group consisting of: 【Table 18】 【Table 19】 Table 20 Table 21 Table 22 Table 23 Table 24 Table 25 Table 26 Table 27 Table 28 Table 29 【Table 30】 Table 31 Table 32 【Table 33】 Table 34 and any one of the sense strand nucleotide sequences and the antisense strand nucleotide sequence The dsRNA agent of claim 1.
4. 4. The dsRNA agent of claim 3, wherein the duplex is selected from the group consisting of AD-1623140, AD-1637701, and AD-1786708.
5. The dsRNA agent of claim 4, wherein the duplex is AD-1786708.
6. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of MAPT, comprising a sense strand and an antisense strand forming a double-stranded region; The antisense strand comprises a region complementary to an mRNA encoding tau, the complementary region comprising: UACCA UNCGA GCUUG GGUCA CGU (SEQ ID NO: 1268), A dsRNA agent wherein N is the only nucleotide that is a mismatch relative to an mRNA encoding tau.
7. 7. The dsRNA agent of claim 6, wherein N is I, A, C, T, or U.
8. The antisense sequence is UACCA UHCGA GCUUG GGUCA CGU (SEQ ID NO: 1269); 7. The dsRNA agent of claim 6, wherein H is A, C, T, or U.
9. The antisense sequence is 7. The dsRNA agent of claim 6, which is UACCA UACGA GCUUG GGUCA CGU (SEQ ID NO: 1003). (a) the complementary region comprises at least 18, 19, 20, or 21 consecutive nucleotides of the antisense sequence; (b) the complementary region consists of the antisense sequence; (c) the complementary region comprises at least nucleotides 1-17, 1-18, 1-19, 1-20, or 1-21 of the antisense sequence, counting from the 5' end of the antisense sequence; and / or (d) the complementary region comprises at least nucleotides 2 to 18, 2 to 19, 2 to 20, 2 to 21, or 2 to 22 of the antisense sequence, counting from the 5' end of the antisense sequence; The dsRNA agent of claim 6.
11. 10. The dsRNA agent of claim 1, wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties.
12. (a) the one or more lipophilic moieties are conjugated to one or more interior positions on at least one of the chains. (b) the one or more lipophilic moieties are conjugated to one or more interior positions in the double-stranded region of the dsRNA agent; (c) the one or more lipophilic moieties are conjugated via a linker or carrier; (d) the lipophilicity of the one or more lipophilic moieties, as measured by log Kow, is greater than 0; (e) the hydrophobicity of the double-stranded RNA agent is greater than 0.2 as measured by the unbound fraction in a plasma protein binding assay of said double-stranded RNA agent; and / or (f) the hydrophobicity of the double-stranded RNA agent is greater than 0.2 as measured by the unbound fraction in a plasma protein binding assay of said double-stranded RNA agent, wherein said plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein; 12. The dsRNA agent of claim 11.
13. 10. The dsRNA agent of claim 1, wherein the dsRNA agent comprises at least one modified nucleotide. (a) no more than five nucleotides of the sense strand and no more than five nucleotides of the antisense strand are unmodified nucleotides. (b) all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides; (c) the at least one modified nucleotide is a deoxy-nucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxy-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural nucleotide base, a tetrahydropyran-modified nucleotide, a 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing a 5'-methylphosphonate group, nucleotides containing a 5' phosphate or a 5' phosphate mimic, nucleotides containing vinyl phosphonate, glycol nucleic acids (GNA), glycol nucleic acid S isomers (S-GNA), 2'-5'-linked ribonucleotides (3'-RNA), nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, and terminal nucleotides linked to cholesteryl derivatives, and dodecanoic acid bisdecylamide groups, and combinations thereof; (d) the at least one modified nucleotide is selected from the group consisting of 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, 3'-terminal deoxythymidine nucleotides (dT), locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and nucleotides containing unnatural bases; (e) the at least one modified nucleotide comprises a short sequence of 3'-terminal deoxythymidine nucleotides (dT); and / or (f) the at least one modified nucleotide is independently selected from the group consisting of a 2'-deoxy modification, a 2'-O-methyl modification, a 3'-RNA modification, a GNA modification, an S-GNA modification, and a 2'-deoxy-2'-fluoro modification; 14. The dsRNA agent of claim 13.
15. (a) the dsRNA agent comprises at least one phosphorothioate internucleotide linkage. (b) the dsRNA agent comprises 6 to 8 phosphorothioate internucleotide linkages; (c) each strand is 30 nucleotides or less in length; (d) at least one strand comprises a 3' overhang of at least one nucleotide; (e) at least one strand comprises a 3' overhang of at least 2 nucleotides; (f) the double-stranded region is 15-30, 16-20, 10-18, 10-16, 12-14, or 14-16 nucleotide pairs in length; and / or (g) each strand has 12 to 23, 12 to 16, or 14 to 16 nucleotides; The dsRNA agent of claim 1.
16. 12. The dsRNA agent of claim 11, wherein the one or more lipophilic moieties are conjugated to one or more interior positions on at least one strand via a linker or carrier.
17. (a) the interior positions include all positions from each end of the at least one chain except for the two positions at that end. (b) the interior positions include all positions from each end of the at least one strand except for the three positions closest to that end; (c) the internal position excludes the cleavage site region of the sense strand; (d) the internal positions include all positions except positions 9 to 12 counting from the 5' end of the sense strand; (e) the internal positions include all positions except positions 11 to 13 counting from the 3' end of the sense strand; (f) the internal position excludes the cleavage site region of the antisense strand; (g) the internal positions include all positions except positions 12 to 14 counting from the 5' end of the antisense strand; and / or (h) the internal positions include all positions except positions 11 to 13 from the 3' end on the sense strand and positions 12 to 14 from the 5' end on the antisense strand; 17. The dsRNA agent of claim 16. (a) the one or more lipophilic moieties are conjugated to one or more of the interior positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand. (b) the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5' end of each strand; (c) the one or more lipophilic moieties are conjugated to one or more interior positions on at least one strand, the interior positions in the double-stranded region excluding the cleavage site region of the sense strand; (d) the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, and the one or more lipophilic moieties are conjugated to positions 21, 20, 15, 1, 7, 6, or 2 of the sense strand or position 16 of the antisense strand. (e) the one or more lipophilic moieties are conjugated to position 21, 20, 15, 1, or 7 of the sense strand; (f) the one or more lipophilic moieties are conjugated to position 21, 20, or 15 of the sense strand; (g) the one or more lipophilic moieties are conjugated to position 20 or 15 of the sense strand; (h) the one or more lipophilic moieties are conjugated to position 16 of the antisense strand; (i) the one or more lipophilic moieties are aliphatic, alicyclic, or polycyclic alicyclic compounds; (j) the one or more lipophilic moieties are selected from the group consisting of lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl groups, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, and phenoxazine; (k) the one or more lipophilic moieties contain a saturated or unsaturated C4-C30 hydrocarbon chain and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne; (l) the one or more lipophilic moieties contain a saturated or unsaturated C6 to C18 hydrocarbon chain; (m) the one or more lipophilic moieties contain a saturated or unsaturated C16 hydrocarbon chain; (n) the one or more lipophilic moieties contain a saturated or unsaturated C16 hydrocarbon chain, and the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6 or 7 of the sense strand, counting from the 5' end of the sense strand; (o) the one or more lipophilic moieties are conjugated via a carrier that replaces one or more nucleotides at an internal position or in the double-stranded region; (p) the one or more lipophilic moieties are conjugated via a carrier that replaces one or more nucleotides at an internal position or in the double-stranded region, and the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl, or an acyclic moiety of a serinol or diethanolamine backbone system; (q) the one or more lipophilic moieties are conjugated to the double-stranded iRNA agent via a linker containing an ether, a thioether, a urea, a carbonate, an amine, an amide, a maleimide-thioether, a disulfide, a phosphodiester, a sulfonamide linkage, a product of a Click reaction, or a carbamate; (r) the one or more lipophilic moieties are conjugated to a nucleobase, a sugar moiety, or an internucleoside linkage; (s) the one or more lipophilic moieties are conjugated via a biocleavable linker selected from the group consisting of DNA, RNA, disulfides, amides, and functionalized mono- or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof; and / or (t) the 3′-end of the sense strand is protected via an end-cap that is a cyclic group having an amine, and the cyclic group is selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; 12. The dsRNA agent of claim 11.
19. (a) the dsRNA agent comprises a targeting ligand that targets a neuronal cell. (b) the dsRNA agent comprises a targeting ligand that targets a hepatocyte; or (c) the dsRNA agent comprises a targeting ligand that targets a hepatocyte, wherein said targeting ligand is a GalNAc conjugate.
14. The dsRNA agent of claim 13.
20. (a) the dsRNA agent comprises a phosphate or a phosphate mimetic at the 5' end of the antisense strand. (b) the dsRNA agent comprises a 5'-vinylphosphonate (VP); (c) the base pair at position 1 of the 5'-end of the antisense strand of the duplex is an AU base pair, and / or (d) the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides; The dsRNA agent of claim 1.
21. The dsRNA agent of claim 6, wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties.
22. (a) the one or more lipophilic moieties are conjugated to one or more interior positions on at least one of the chains. (b) the one or more lipophilic moieties are conjugated to one or more interior positions in the double-stranded region of the dsRNA agent; (c) the one or more lipophilic moieties are conjugated via a linker or carrier; (d) the lipophilicity of the one or more lipophilic moieties, as measured by log Kow, is greater than 0; (e) the hydrophobicity of the double-stranded RNA agent is greater than 0.2 as measured by the unbound fraction in a plasma protein binding assay of said double-stranded RNA agent; and / or (f) the hydrophobicity of the double-stranded RNA agent is greater than 0.2 as measured by the unbound fraction in a plasma protein binding assay of said double-stranded RNA agent, wherein said plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein; 22. The dsRNA agent of claim 21.
23. The dsRNA agent of claim 6, wherein the dsRNA agent comprises at least one modified nucleotide. (a) no more than five nucleotides of the sense strand and no more than five nucleotides of the antisense strand are unmodified nucleotides. (b) all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides; (c) the at least one modified nucleotide is a deoxy-nucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxy-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural nucleotide base, a tetrahydropyran-modified nucleotide, a 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing a 5'-methylphosphonate group, nucleotides containing a 5' phosphate or a 5' phosphate mimic, nucleotides containing vinyl phosphonate, glycol nucleic acids (GNA), glycol nucleic acid S isomers (S-GNA), 2'-5'-linked ribonucleotides (3'-RNA), nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, and terminal nucleotides linked to cholesteryl derivatives, and dodecanoic acid bisdecylamide groups, and combinations thereof; (d) the at least one modified nucleotide is selected from the group consisting of 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, 3'-terminal deoxythymidine nucleotides (dT), locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and nucleotides containing unnatural bases; (e) the at least one modified nucleotide comprises a short sequence of 3'-terminal deoxythymidine nucleotides (dT); and / or (f) the at least one modified nucleotide is independently selected from the group consisting of a 2'-deoxy modification, a 2'-O-methyl modification, a 3'-RNA modification, a GNA modification, an S-GNA modification, and a 2'-deoxy-2'-fluoro modification; 24. The dsRNA agent of claim 23.
25. (a) the dsRNA agent comprises at least one phosphorothioate internucleotide linkage. (b) the dsRNA agent comprises 6 to 8 phosphorothioate internucleotide linkages; (c) each strand is 30 nucleotides or less in length; (d) at least one strand comprises a 3' overhang of at least one nucleotide; (e) at least one strand comprises a 3' overhang of at least 2 nucleotides; (f) the double-stranded region is 15-30, 16-20, 10-18, 10-16, 12-14, or 14-16 nucleotide pairs in length; and / or (g) each strand has 12 to 23, 12 to 16, or 14 to 16 nucleotides; The dsRNA agent of claim 6.
26. 22. The dsRNA agent of claim 21, wherein the one or more lipophilic moieties are conjugated to one or more interior positions on at least one strand via a linker or carrier.
27. (a) the interior positions include all positions from each end of the at least one chain except for the two positions at that end. (b) the interior positions include all positions from each end of the at least one strand except for the three positions closest to that end; (c) the internal position excludes the cleavage site region of the sense strand; (d) the internal positions include all positions except positions 9 to 12 counting from the 5' end of the sense strand; (e) the internal positions include all positions except positions 11 to 13 counting from the 3' end of the sense strand; (f) the internal position excludes the cleavage site region of the antisense strand; (g) the internal positions include all positions except positions 12 to 14 counting from the 5' end of the antisense strand; and / or (h) the internal positions include all positions except positions 11 to 13 from the 3' end on the sense strand and positions 12 to 14 from the 5' end on the antisense strand; 27. The dsRNA agent of claim 26.
28. (a) the one or more lipophilic moieties are conjugated to one or more of the interior positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand. (b) the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5' end of each strand; (c) the one or more lipophilic moieties are conjugated to one or more interior positions on at least one strand, the interior positions in the double-stranded region excluding the cleavage site region of the sense strand; (d) the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, and the one or more lipophilic moieties are conjugated to positions 21, 20, 15, 1, 7, 6, or 2 of the sense strand or position 16 of the antisense strand. (e) the one or more lipophilic moieties are conjugated to position 21, 20, 15, 1, or 7 of the sense strand; (f) the one or more lipophilic moieties are conjugated to position 21, 20, or 15 of the sense strand; (g) the one or more lipophilic moieties are conjugated to position 20 or 15 of the sense strand; (h) the one or more lipophilic moieties are conjugated to position 16 of the antisense strand; (i) the one or more lipophilic moieties are aliphatic, alicyclic, or polycyclic alicyclic compounds; (j) the one or more lipophilic moieties are selected from the group consisting of lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl groups, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, and phenoxazine; (k) the one or more lipophilic moieties contain a saturated or unsaturated C4-C30 hydrocarbon chain and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne; (l) the one or more lipophilic moieties contain a saturated or unsaturated C6 to C18 hydrocarbon chain; (m) the one or more lipophilic moieties contain a saturated or unsaturated C16 hydrocarbon chain; (n) the one or more lipophilic moieties contain a saturated or unsaturated C16 hydrocarbon chain, and the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6 or 7 of the sense strand, counting from the 5' end of the sense strand; (o) the one or more lipophilic moieties are conjugated via a carrier that replaces one or more nucleotides at an internal position or in the double-stranded region; (p) the one or more lipophilic moieties are conjugated via a carrier that replaces one or more nucleotides at an internal position or in the double-stranded region, and the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl, or an acyclic moiety of a serinol or diethanolamine backbone system; (q) the one or more lipophilic moieties are conjugated to the double-stranded iRNA agent via a linker containing an ether, a thioether, a urea, a carbonate, an amine, an amide, a maleimide-thioether, a disulfide, a phosphodiester, a sulfonamide linkage, a product of a Click reaction, or a carbamate; (r) the one or more lipophilic moieties are conjugated to a nucleobase, a sugar moiety, or an internucleoside linkage; (s) the one or more lipophilic moieties are conjugated via a biocleavable linker selected from the group consisting of DNA, RNA, disulfides, amides, and functionalized mono- or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof; and / or (t) the 3′-end of the sense strand is protected via an end-cap that is a cyclic group having an amine, and the cyclic group is selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; 22. The dsRNA agent of claim 21.
29. (a) the dsRNA agent comprises a targeting ligand that targets a neuronal cell. (b) the dsRNA agent comprises a targeting ligand that targets a hepatocyte; or (c) the dsRNA agent comprises a targeting ligand that targets a hepatocyte, wherein said targeting ligand is a GalNAc conjugate.
24. The dsRNA agent of claim 23.
30. (a) the dsRNA agent comprises a phosphate or phosphate mimetic at the 5' end of the antisense strand. (b) the dsRNA agent comprises a 5'-vinylphosphonate (VP); (c) the base pair at position 1 of the 5'-end of the antisense strand of the duplex is an AU base pair, and / or (d) the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides; The dsRNA agent of claim 6. (a) a dsRNA agent according to any one of claims 1 to 30 for inhibiting expression of a gene encoding MAPT, and / or (b) a dsRNA agent according to any one of claims 1 to 30, and a pharmaceutically acceptable diluent; Pharmaceutical compositions.
32. 31. A pharmaceutical composition comprising the dsRNA agent of any one of claims 1-30 for use in inhibiting expression of the MAPT gene in a cell, wherein inhibiting comprises introducing the dsRNA agent into said cell, thereby inhibiting expression of the MAPT gene in said cell.
33. (a) the cell is in a subject. (b) the cell is in a human subject; (c) the cell is in a subject, and the subject has a MAPT-associated disorder. (d) the cell is in a subject having a MAPT-associated disorder, and the MAPT-associated disorder is a neurodegenerative disorder. (e) the cell is in a subject having a neurodegenerative disorder, the neurodegenerative disorder being associated with an abnormality in the protein tau encoded by the MAPT gene; (f) the cell is in a subject having a neurodegenerative disorder associated with an abnormality in the protein tau encoded by the MAPT gene, and the abnormality in the protein tau encoded by the MAPT gene causes tau aggregation in the brain of the subject; (g) the cell is in a subject having a neurodegenerative disorder, and the neurodegenerative disorder is a familial or sporadic disorder, and / or (h) the cell is in a subject having a MAPT-related disorder, the MAPT-related disorder being selected from the group consisting of tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), and pre-senile dementia. the patient is selected from the group consisting of multisystem tauopathy with progressive dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down's syndrome (DS); 33. The pharmaceutical composition of claim 32.
34. 31. A pharmaceutical composition comprising the dsRNA agent of any one of claims 1-30 for use in treating a subject having a disorder that would benefit from reduced MAPT gene expression, wherein treating comprises administering to the subject a therapeutically effective amount of the dsRNA agent, thereby treating the subject having a disorder that would benefit from reduced MAPT expression.
35. (a) The disorder is associated with an abnormality in the protein tau encoded by the MAPT gene. (b) the disorder is associated with an abnormality in the protein tau encoded by the MAPT gene, and the abnormality in the protein tau encoded by the MAPT gene causes tau aggregation in the brain of the subject; (c) the disorder is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystem tauopathy with presenile dementia. (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, Down's syndrome (DS), (d) the subject is a human. (e) administration of the dsRNA agent or the pharmaceutical composition results in a reduction of tau aggregation in the brain of the subject. (f) the dsRNA agent is administered to the subject intrathecally. (g) the use further comprises determining the level of MAPT in a sample from the subject. (h) the use further comprises determining the level of MAPT in a sample from the subject, wherein the level of MAPT in the subject's sample is the level of tau protein in a cerebrospinal fluid sample; and / or (i) the dsRNA agent is administered to the subject in combination with an additional therapeutic agent; 35. The pharmaceutical composition of claim 34.
36. 31. A pharmaceutical composition comprising the dsRNA agent of any one of claims 1-30 for use in preventing at least one symptom of a subject having a disorder that would benefit from decreased MAPT expression, wherein preventing comprises administering to the subject a prophylactically effective amount of the dsRNA agent, thereby preventing at least one symptom of the subject having a disorder that would benefit from decreased MAPT expression.
37. (a) The disorder is associated with an abnormality in the protein tau encoded by the MAPT gene. (b) the disorder is associated with an abnormality in the protein tau encoded by the MAPT gene, and the abnormality in the protein tau encoded by the MAPT gene causes tau aggregation in the brain of the subject; (c) the disorder is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystem tauopathy with presenile dementia. (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, Down's syndrome (DS), (d) the subject is a human. (e) administration of the dsRNA agent or the pharmaceutical composition results in a reduction of tau aggregation in the brain of the subject. (f) the dsRNA agent is administered to the subject intrathecally. (g) the use further comprises determining the level of MAPT in a sample from the subject. (h) the use further comprises determining the level of MAPT in a sample from the subject, wherein the level of MAPT in the subject's sample is the level of tau protein in a cerebrospinal fluid sample; and / or (i) the dsRNA agent is administered to the subject in combination with an additional therapeutic agent; 37. The pharmaceutical composition of claim 36.
38. 31. A kit, vial, syringe, or intrathecal pump comprising the dsRNA agent of any one of claims 1-30.
39. The double-stranded region comprises a sense strand and an antisense strand, and the nucleotide sequence of the antisense strand is 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011) differs by 3 bases or less, During the ceremony, VP is 5'-vinylphosphonate; s is a phosphorothioate linkage; a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; dA is 2'-deoxy A, and A double-stranded ribonucleic acid (dsRNA) agent or a pharmaceutically acceptable salt thereof, wherein Af, Gf, and Uf are 2'-deoxy-2'-fluoro (2'-F) A, G, and U, respectively.
40. The dsRNA agent of claim 39, which is a sodium salt.
41. The nucleotide sequence of the antisense strand is the nucleotide sequence 40. The dsRNA agent of claim 39, or a pharmaceutically acceptable salt thereof, which differs from 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011) by no more than 2 bases.
42. The dsRNA agent described in claim 41, which is a sodium salt.
43. The nucleotide sequence of the antisense strand is the nucleotide sequence 40. The dsRNA agent of claim 39, or a pharmaceutically acceptable salt thereof, which differs from 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011) by no more than 1 base.
44. The dsRNA agent described in claim 43, which is a sodium salt.
45. the sense strand comprises the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007), During the ceremony, (Chd) is 2'-O-hexadecyl-cytidine-3'-phosphate; s is a phosphorothioate linkage; a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; and 40. The dsRNA agent of claim 39, or a pharmaceutically acceptable salt thereof, wherein Af, Cf, and Gf are 2'-deoxy-2'-fluoro(2'-F)A, C, and G, respectively.
46. The dsRNA agent described in claim 45, which is a sodium salt.
47. a sense strand and an antisense strand forming a double-stranded region, the antisense strand having the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011), During the ceremony, VP is 5'-vinylphosphonate; s is a phosphorothioate linkage; a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; dA is 2'-deoxy A, and A double-stranded ribonucleic acid (dsRNA) agent or a pharmaceutically acceptable salt thereof, wherein Af, Gf, and Uf are 2'-deoxy-2'-fluoro (2'-F) A, G, and U, respectively.
48. The dsRNA agent described in claim 47, which is a sodium salt.
49. the sense strand having the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007), During the ceremony, (Chd) is 2'-O-hexadecyl-cytidine-3'-phosphate; s is a phosphorothioate linkage; a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; and 48. The dsRNA agent of claim 47, or a pharmaceutically acceptable salt thereof, wherein Af, Cf, and Gf are 2'-deoxy-2'-fluoro(2'-F)A, C, and G, respectively.
50. The dsRNA agent described in claim 49, which is a sodium salt.
51. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand having the nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID NO: 1007), The antisense strand has the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID NO: 1011), During the ceremony, VP is 5'-vinylphosphonate; s is a phosphorothioate linkage; a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; dA is 2'-deoxy A, Af, Cf, Gf and Uf are 2'-deoxy-2'-fluoro(2'-F) A, C, G and U, respectively; and (Chd) is a double-stranded ribonucleic acid (dsRNA) agent which is 2'-O-hexadecyl-cytidine-3'-phosphate, or a pharmaceutically acceptable salt thereof.
52. The dsRNA agent described in claim 51, which is a sodium salt.
53. 53. A pharmaceutical composition comprising the dsRNA agent of any one of claims 39-52 and a pharmaceutically acceptable diluent.
54. 53. A pharmaceutical composition comprising the dsRNA agent of any one of claims 39 to 52 for use in inhibiting expression of the MAPT gene in a cell, wherein the inhibiting comprises: (a) introducing into said cell said dsRNA agent; and (b) maintaining the cells produced in step (a) for a time sufficient to allow mRNA transcripts of the MAPT gene to be degraded, thereby inhibiting expression of the MAPT gene in the cells; Pharmaceutical compositions.
55. (a) The MAPT-related neurodegenerative disease is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystemic tachycardia with presenile dementia. tauopathy (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, Down's syndrome (DS), (b) the MAPT-associated neurodegenerative disease is Alzheimer's disease; (c) the MAPT-associated neurodegenerative disease is progressive supranuclear palsy (PSP), or (d) the MAPT-associated neurodegenerative disease is a tauopathy; 55. The pharmaceutical composition of claim 54.
56. 53. A pharmaceutical composition comprising the dsRNA agent of any one of claims 39-52 for use in treating a MAPT-associated neurodegenerative disease, wherein treating comprises administering to a patient in need thereof a pharmaceutically effective amount of said dsRNA agent.
57. (a) The MAPT-related neurodegenerative disease is a tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant frontotemporal dementia (bvFTD), non-fluent variant primary progressive aphasia (nfvPPA), primary progressive aphasia-semantic (PPA-S), primary progressive aphasia-logopenic (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), multisystemic dementia with presenile dementia. tauopathy (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), small corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, Down's syndrome (DS), (b) the MAPT-associated neurodegenerative disease is Alzheimer's disease; (c) the MAPT-associated neurodegenerative disease is progressive supranuclear palsy (PSP), or (d) the MAPT-associated neurodegenerative disease is a tauopathy; 57. The pharmaceutical composition of claim 56.