Nucleic acid constructs, viral vectors and viral particles

JP2024543001A5Pending Publication Date: 2025-10-31UCB BIOPHARMA SPRL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024525372
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-28
Filing Date
2022-10-26
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

There is a clear unmet medical need for effective treatments that can restore normal STXBP1 functional activity to address STXBP1 genetic disorders associated with neurodevelopmental disorders such as Ohtahara syndrome and Dravet syndrome, as current therapies do not target the underlying disease mechanism.

Method used

The development of nucleic acid constructs and viral vectors that overexpress healthy copies of the STXBP1 gene, using viral particles to deliver these constructs to restore normal STXBP1 functional activity in patients with STXBP1 mutations.

Benefits of technology

The approach effectively increases synaptic function, reduces seizure frequency, and improves cognitive and developmental outcomes in animal models of STXBP1-related disorders, demonstrating potential for therapeutic efficacy in treating these conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000088_0000
    Figure 00000088_0000
  • Figure 00000088_0001
    Figure 00000088_0001
  • Figure 00000088_0002
    Figure 00000088_0002
Patent Text Reader

Abstract

The present invention relates to a nucleic acid construct comprising a transgene encoding syntaxin binding protein 1 (STXBP1, Munc-18), a viral vector for packaging said nucleic acid into viral particles, and the use of such viral particles for treating diseases associated with loss of STXBP1 functional activity.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to nucleic acid constructs, viral vectors and viral particles for use in the treatment and / or prevention of neurodevelopmental disorders associated with epilepsy, such as diseases associated with loss of syntaxin binding protein 1 (STXBP1) functional activity, as identified in, for example, Ohtahara syndrome, West syndrome and Dravet syndrome. [Background technology]

[0002] Many neurodevelopmental disorders are associated with genetic alterations that result in the onset of severe clinical symptoms early in life. Genetic alterations in STXBP1 are associated with severe early-onset epileptic encephalopathies (EOEEs), such as Ohtahara syndrome, West syndrome, and Dravet syndrome (Saitsu et al. 2008, Stamberger et al. 2016). STXBP1 encephalopathy (STXBP1-E) is characterized by a wide range of symptoms, but it is now established that all patients have severe intellectual disability and up to 85% of patients develop seizures (Abramov et al. 2020). STXBP1-E can be caused by dominant heterozygous de novo mutations in the STXBP1 (Munc-18) gene. Multiple genetic variants have been reported, including missense, nonsense, frameshift, deletion, duplication, and splice site variants. Most cases are typically caused by de novo heterozygous loss-of-function (LoF) mutations, but in rare cases are inherited from a heterozygous or mosaic parent. New variants resulting in homozygous mutations in STXBP1 have been described. Genotype-phenotype correlation studies have not led to the identification of a clear association between the variants and the variable expression of STXBP1-E to date.

[0003] STXBP1 (Munc-18; syntaxin-binding protein 1) is an essential component of the molecular machinery that controls SNARE-mediated (N-ethylmaleimide-sensitive factor attachment protein receptor) membrane fusion in neurons and neuroendocrine cells. STXBP1 regulates the formation of the SNARE complex by binding to the closed conformation of syntaxin-1, a process that promotes the fusion of synaptic vesicles and neurotransmitter release at synapses.

[0004] Figure 1 shows a schematic of the effect of STXBP1 on synaptic transmission under normal (A) and disease conditions (B). STXBP1 (Munc18) is a key component of the synaptic machinery, and its interaction with syntaxin-1 at the presynaptic membrane is a critical step for triggering neurotransmitter release. Under normal conditions (A), STXBP1 is abundantly expressed at the presynaptic membrane, and complex formation with syntaxin-1 ensures efficient synaptic vesicle fusion leading to neurotransmitter release and generation of postsynaptic currents. Under disease conditions (B), mutant STXBP1 does not express syntaxin-1 or cannot directly bind to syntaxin-1, and the remaining normal STXBP1 levels are not sufficient to sustain efficient neurotransmitter release, resulting in reduced postsynaptic currents [Patzke et al. 2015].

[0005] STXBP1 knockout (KO) studies demonstrated that the absence of the protein in neurons results in a complete loss of neurotransmitter secretion from synaptic vesicles throughout the course of pathology (Verhage et al. 2000). Characterization of heterozygous KO models (HET) of STXBP1 showed that a reduction of approximately 50% in STXBP1 protein levels results in a strong seizure phenotype characterized by myoclonic seizures and spike-and-wave discharges (Kovacevic et al. 2018, Orock et al. 2018, Chen et al. 2020). Extensive phenotyping of such HET mice also showed impaired cognitive abilities, hyperactivity and anxiety-like behavior. Generation of mice with heterozygous expression only in GABAergic neurons provided further insight into the mechanism of STXBP1 mutations by highlighting differences in synaptic transmission from GABAergic interneurons to glutamatergic pyramidal neurons (Chen et al. 2020).

[0006] Although STXBP1 HET mouse neurons show normal synaptic transmission, more detailed analysis showed that reduced levels of STXBP1 increased synaptic depression during strong stimulation at glutamatergic, GABAergic and neuromuscular synapses (Toonen et al. 2006). Experiments with stem cell-derived human neurons showed that a 20–30% reduction in STXBP1 levels resulted in a dramatic reduction in normal synaptic function (Patzke et al. 2015), further highlighting that the effects of STXBP1 mutations can vary between neuronal subtypes and species backgrounds. In contrast, overexpression of STXBP1 in normal mouse neurons increased synaptic function (Toonen et al. 2006), and phenotypic analysis of a transgenic mouse line overexpressing the protein isoform munc18-1a in the brain showed several schizophrenia-related behaviors (Uriguen et al. 2013). Additional nonsynaptic roles have been described for STXBP1, suggesting that it regulates the mechanism of radial migration in cortical neurons. Thus, STXBP1 may also regulate vesicle fusion at the plasma membrane, distribute various proteins to the cell surface, and distribute vesicle trafficking from the Golgi to the plasma membrane (Hamada et al. 2016).

[0007] Mutations in STXBP1 that result in loss of functional activity have been characterized in vitro and in model systems to establish their impact on neuronal function. Mutations that result in truncation of the STXBP1 protein, generally associated with nonsense, frameshift or deletion, are not detected in neuronal systems and it is hypothesized that such mutant proteins are rapidly downregulated by the nonsense-mediated decay mechanism of their RNA messenger. Approximately 40–50% of mutations in STXBP1 are missense mutations (Abramov et al. 2020), and in vitro experiments have demonstrated that such point mutations result in reduced stability of the STXBP1 protein, leading to reduced expression levels in neuronal systems (Kovacevik et al. 2018, Zhu et al. 2020). Examination of stem cell-derived neurons from Ohtahara patients carrying STXBP1 missense mutations also showed reduced STXBP1 protein levels (Yamashita et al. 2016). More recently, homozygous STXBP1 mutations have been identified and in vitro studies have shown that the homozygous L446F mutation causes a gain-of-function phenotype but with less effect on protein levels than previously reported for heterozygous mutations (Lammertse et al. 2020).

[0008] Overall, STXBP1 genetic disorders are associated with loss of function of the STXBP1 protein, and multiple therapeutic approaches have been proposed, including small molecule chaperones to prevent aggregation of mutant forms, and antisense oligonucleotides to downregulate specific miRNAs that negatively regulate STXBP1 expression (Abramov et al. 2020). The complexity for developing disease-modifying therapies for STXBP1 lies in developing new specific tools that can restore normal STXBP1 functional activity and be translated into the clinic. Approved drug therapies that address the underlying disease mechanisms are not available at this time.

[0009] There is a clear unmet medical need for an effective treatment for STXBP1 genetic disorders. The present disclosure provides a disease-modifying gene therapy that overexpresses STXBP1 to restore normal STXBP1 functional activity and potentially provide a cure. Summary of the Invention

[0010] The present invention provides a healthy copy of the STXBP1 gene that can correct the effects of STXBP1 mutations and restore normal STXBP1 functional activity by gene therapy.

[0011] The present invention provides the following: i. Syntaxin binding protein 1 (STXBP1) comprising isoform a, b, c, d, e, f, g, or h having the sequence set forth in SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, respectively; or ii. a sequence having at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, and retaining function as STXBP1; or iii. Naturally occurring variants comprising one or more of the mutations shown in Table 7, with reference to SEQ ID NO:9. A nucleic acid construct comprising a transgene encoding.

[0012] The present invention further provides: A viral vector comprising the nucleic acid construct. A viral particle containing a viral vector. Medical use of viral particles for treating and / or preventing STXBP1 genetic disorders. A method for treating and / or preventing a disease characterized by a STXBP1 mutation, comprising administering viral particles to a subject in need thereof. [Brief description of the drawings]

[0013] [Figure 1]Schematic diagram of the effect of STXBP1 on synaptic transmission under normal (A) and disease conditions (B). STXBP1 (Munc18) is a key component of the synaptic machinery and its interaction with syntaxin-1 at the presynaptic membrane is a critical step for triggering neurotransmitter release. Under normal conditions (A), STXBP1 is abundantly expressed at the presynaptic membrane and its complex formation with syntaxin-1 ensures efficient synaptic vesicle fusion leading to neurotransmitter release and generation of postsynaptic currents. Under disease conditions (B), mutant STXBP1 does not express or is unable to directly bind to syntaxin-1, and the remaining normal STXBP1 levels are not sufficient to sustain efficient neurotransmitter release and postsynaptic currents are reduced [Patzke et al. 2015]. [Diagram 2] Protein sequence alignment of human, monkey and mouse STXBP1 sequences (human isoform a according to SEQ ID NO: 9). The alignment shows high sequence homology across species. The monkey and mouse amino acid sequences are identical to the human amino acid sequence. [Diagram 3] Schematic diagram of the designed constructs. In the figure, "prom" means promoter, "INT" means intron, "h" means human, SV40 means polyadenylation sequence SV40, and "tag" means HA tag or Myc tag located at either the N- or C-terminus of the construct. [Figure 4] (A) Immunofluorescence imaging of AD-HEK293 cells transfected with hSTXBP1 plasmids driven by various promoters (CAG, MECP2 and MECP2-intron) detected by anti-STXBP1 antibody. (B) Magnified section shows that STXBP1 is localized to the cell membrane. AD=adherent, NC=negative control. [Diagram 5](A) Immunofluorescence imaging of Neuro-2A cells transfected with hSTXBP1 plasmids driven by various promoters (CAG, MECP2 and MECP2-intron) detected by anti-STXBP1 antibody. (B) Magnification shows that STXBP1 is localized to the cell membrane. NC = negative control. [Figure 6] Western blot analysis of Neuro-2A cells transfected with hSTXBP1 driven by various promoters (CAG, MECP2 and MECP2-intron). Two technical replicates of each condition are shown. NC=negative control, 1=MECP2-intron-hSTXBP1, 2=CAG-hSTXBP1, 3=MECP2-hSTXBP1. [Figure 7] Western blot analysis of (A) Myc-tagged hSTXBP1 driven by the CAG promoter in AD-HEK293 cells detected by anti-Myc antibody and (B) HA-tagged hSTXBP1 driven by the hSYN promoter in AD-HEK293, SH-SY5Y and Neuro-2a cells detected by anti-HA antibody. Two technical replicates of each condition are shown. (C) Epitope-tagged proteins were also detected in AD-HEK293 cells using anti-STXBP1 antibody. NC=negative control, 1=CAG-hSTXBP1-Myc, 2=CAG-Myc-hSTXBP1, 3=hSYN-HA-hSTXBP1. The background protein band in the NC lane in (A) is due to the detection of endogenous Myc by anti-Myc antibody. [Figure 8] Lentiviral vector transduction of the SXTBP1 cassette in iPSC-derived glutamatergic neurons. Images show representative pictures of STXBP1 expression under control conditions (non-transduced) and after transduction of the cassette under the control of the hSyn or MECP2 promoter. [Figure 9]AAV9 transduction of STXBP1 in mouse primary neurons. (A) Representative images of STXBP1 staining in primary mouse cortical neurons transduced with AAV9 viral vectors at an MOI of 5.0E+5 GC / cell. Pictures show control conditions (untransduced) and STXBP1 expression under the control of the hSyn, MECP2 or MECP2-intronic promoters. (B) Comparison of HA staining (right) with STXBP1 staining (left) in the same primary mouse cortical neurons. [Figure 10] Colocalization of STXBP1 overexpression in MAP2-positive neurons. Images are representative photographs of anti-HA tag staining (left panel) and anti-MAP2 staining (right panel) in mouse primary neurons after transduction with AAV9 viral vectors. Arrows indicate examples of cells expressing STXBP1 (HA) and a neuronal marker (MAP2). [Figure 11] Viral vector DNA copy analysis. qPCR data for SV40pA (Simian Virus 40 polyA signal) normalized by the number of diploid mouse genomes from the left hippocampus and left frontal cortex of 5-week-old mice after AAV treatment. Data are shown for the vehicle group and four AAV9 transduction groups (control virus, hSyn, MECP2, MECP2-intron). Results are shown as mean ± SD. [Figure 12] STXBP1 mRNA expression analysis. Data are presented as relative expression normalized to two reference genes and scaled to the mean expression (mean ± SD) of all groups. Analysis was performed from left hippocampus and left frontal cortex tissues of 5-week-old mice after AAV treatment. Data are shown for the vehicle group and four AAV9-transduced groups (control virus, hSyn, MECP2, MECP2-intron). [Figure 13] Protein analysis by Western blot. (A) Western blot showing HA tag expression for various cassettes in the cortex (n=5-7 / group). GAPDH was used as a loading control. (B) Quantification of HA tag band intensity, each sample normalized to the GAPDH loading control. Results are shown as mean ± SD. [Figure 14]Distribution of infected cells in mouse brain using GFP reporter derived from AAV9-hSyn-NLS-eGFP-NLS virus. (A) Sagittal section of mouse brain administered AAV9-hSyn1-NLS-GFP-NLS icv, sacrificed 1 month later, and immunostained to label GFP. The distribution of GFP-expressing cells was observed from anterior to posterior throughout the brain. Some of the main brain regions showing GFP+ cells are highlighted by rectangles. (B-G): Higher magnification of brain regions showing GFP+ cells from A (arrows point to GFP+ cells). [Figure 15] Characterization of cells expressing the GFP reporter derived from the AAV9-hSyn-NLS-eGFP-NLS virus. Double immunofluorescence labeling was performed to detect (A–F) GFP and the neuronal marker NeuN, (G–L) GFP and the astroglial marker GFAP. Cells positive for both (A–C) GFP and (D–F) NeuN were observed within all brain regions (arrows point to double-labeled cells), indicating that neurons were transduced and expressed the reporter gene. Conversely, GFP (G–I) signal was not detected in GFAP-positive cells (J–L), suggesting that astrocytes did not express the reporter gene. [Figure 16]Distribution of HA-STXBP1 fusion proteins from various promoters in mouse brain after AAV9 administration. The distribution of HA-tagged STXBP1 overexpressed from various promoters in mouse brain was tested by immunohistochemistry against HA. As negative control conditions, no HA signal was observed in animals that received (A) PBS only or (B) AAV9-hSyn-GFP virus icv. (C) As a negative control (NC) for antibody selectivity, no HA signal was observed in animals that received AAV9-MECP2-intron-HA-STXBP1 virus but omitted the primary HA antibody during the immunohistochemistry procedure. (D-F) HA signal was observed in the brain of all animals injected with various viruses expressing HA-STXBP1 from various promoters. The three promoters resulted in a common pattern of HA distribution throughout the brain, with the main expression observed in the cerebral cortex, hippocampus, striatum, olfactory bulb, substantia nigra, and fiber tracts of the forebrain. Notable differences in HA distribution between promoters are reported in Table 16. [Figure 17] Distribution of HA-STXBP1 fusion proteins derived from different promoters in the hippocampus after AAV9 administration. Double immunofluorescence labeling was performed to detect (A-C) HA and (D-F) the neuronal marker NeuN, which was used to identify different parts of the hippocampus. All three promoters resulted in HA expression throughout the hippocampus, mainly in neuronal projections (Mol, LMol or MF) and occasionally in the cell bodies. (F) The MECP2-intronic promoter resulted in better coverage and higher HA signal intensity than the other two promoters (D, E). LMol: molecular layer of the plexiform (lacunosum) of the hippocampus; MF: mossy fiber; Mol: molecular layer of the dentate gyrus; Or: polymorphonuclear cell layer. [Figure 18] Characterization of cells expressing HA-STXBP1 from various promoters. Double immunofluorescence labeling was performed to detect (A-C) HA and (D-F) the neuronal marker NeuN. Cell bodies positive for HA and occasionally observed in different brain regions were also positive for NeuN, confirming that all three promoters drive transgene expression in neurons. Arrows point to double-labeled cells. [Figure 19] Analysis of STXBP1 mutant mRNA levels in mouse brain by qPCR. mRNA analysis of brain tissue samples from the caudal cortex (right hemisphere) of WT (wild type) littermates and HET (heterozygous) mice (n=11–13 / group). (A) mRNA expression analysis of total endogenous STXBP1 (common probe recognizing any STXBP1 transcript). (B) and (C): mRNA expression analysis of STXBP1 mutants using two different probes that specifically recognize the long isoform (B) or the short protein isoform (C). Data are presented as mRNA expression levels by calculating 2-ΔCt values, where expression was normalized to the average of two reference genes. Results are presented as mean ± SD. [Figure 20] Analysis of STXBP1 protein levels in mouse brain by Western blot. Tissue samples from the right frontal (medial) cortex of WT (wild type) littermates and HET (heterozygous) mice (n = 11–13 / group) were analyzed. (A): Western blots representing total STXBP1 protein expression. (B) Quantitative data of the respective Western blots in (A). For normalization, β-actin was used as a loading control. The "WT" group was used as a scaling group. Results are shown as mean ± SD. [Figure 21] Analysis of STXBP1 mutant protein levels in mouse brain by LC-MS. Tissue samples from the lateral half of the frontal cortex of WT (wild type) littermates and HET (heterozygous) mice (n=11–13 / group) were analyzed. (A) Quantification of total STXBP1 peptides vs. STXBP1 long vs. STXBP1 short isoforms. Results are shown as mean ± SD. (B): Western blots representing STXBP1 short and long isoforms. (C): Combined quantitative data of the respective western blots in (B). β-actin was used as a loading control. Data are shown as the ratio of band intensity of each STXBP1 isoform to the respective β-actin band. Results are shown as mean ± SD. [Figure 22]Analysis of syntaxin-1A (STX1A) protein levels in mouse brain by Western blot. Quantification of STX1A protein expression in mouse brain tissue samples (n=11–13 / group). For normalization, β-actin was used as a loading control. The "WT" group was used as a scaling group. Results are shown as mean ± SD. [Diagram 23] Analysis of AAV transduction efficiency in mouse brain by qPCR (7 weeks after injection). (A) Absolute quantification by qPCR of viral genome copies in WT mice injected with vehicle-PBS (WT), HET mice injected with vehicle-PBS (HET), HET mice injected with STXBP1 long mutant (HET-AAV9(L)), and HET mice injected with STXBP1 short mutant (HET-AAV9(S)). Samples were collected from the posterior cortex (right hemisphere) and quantified using SV40pA normalized to the absolute number of diploid mouse genomes. Results are shown as mean ± SD. n = 14–15 animals per group were analyzed and nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test was applied. No significant differences were observed between transduced groups. (B) mRNA expression analysis of SV40 polyA and (C) human-specific STXBP1. Data are presented as mRNA expression levels by calculating the 2-ΔCt value, where expression was normalized to the average of two reference genes. Results are presented as mean ± SD. n = 14–15 animals per group were analyzed and nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test was applied. No significant differences were observed between transduction groups. [Figure 24] Analysis of STXBP1 mutant expression after AAV treatment in mouse brain by qPCR (7 weeks after injection). Analysis of STXBP1 mutant mRNA expression was performed using probes that specifically measure total (mouse and human) levels of the short mutant (A) or long mutant (B). Data are shown as mRNA expression levels by calculating 2-ΔCt values, where expression was normalized to the average of two reference genes. Results are shown as mean ± SD. n = 14–16 animals per group were analyzed. [Diagram 25] Analysis of STXBP1 mutant expression after AAV treatment in mouse brain by Western blot (7 weeks after injection). Protein analysis by Western blot of samples from the right frontal (medial) cortex in WT mice injected with vehicle-PBS (WT), HET mice injected with vehicle-PBS (HET), HET mice injected with STXBP1 long mutant (HET-AAV9(L)), and HET mice injected with STXBP1 short mutant (HET-AAV9(S)). (A) Quantification of Western blot data for total STXBP1 (long and short mutant) protein expression. (B) Quantification of Western blot data for long STXBP1 mutant protein expression. (C) Quantification of Western blot data for short STXBP1 mutant protein expression. (D) Quantification of Western blot data for syntaxin-1A protein expression. β-actin was used as a loading control for normalization of each STXBP1 and STX1A band intensity. The vehicle WT group (WT) was used as a scaling group. Results are presented as mean ± SD. Data were analyzed using nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test (* <p.0.05;**p<0.01 ***p<0.001;****p<0.0001)。 [Figure 26] Brain distribution of HA-tagged STXBP1 expression after AAV treatment in mouse brain by immunohistochemistry (7 weeks after injection). HA tag staining was performed on sagittal sections from HET mice injected with HA-tagged STXBP1 long mutants and compared to vehicle (PBS) treated mice. Representative examples of brain sections from AAV treated (animal 6023) and vehicle treated (animal 6009) groups are shown. Strong HA staining is observed within key brain regions in animal 6023 (AAV treated), but no HA staining is observed in the PBS treated group (animal 6009). [Figure 27]Analysis of spike-and-wave discharges (SWDs) after AAV treatment in STXBP1 HET mouse brains by EEG 6-7 weeks after injection (A,B) and 24 weeks after injection (C,D). (A) Average number of SWDs in WT mice injected with vehicle-PBS (WT, n=10), HET mice injected with vehicle-PBS (HET, n=19), HET mice injected with STXBP1 long mutant (HET-AAV9(L), n=15), and HET mice injected with STXBP1 short mutant (HET-AAV9(S), n=16). SWDs were analyzed over 24 h for 7 consecutive days 6-7 weeks after injection. (B) Analysis of the number of "seizure-free" animals (no SWDs detected during recording) and "seizure-present" animals (SWDs detected during recording). (C) Mean number of SWDs in WT mice injected with vehicle-PBS (WT, n=5), HET mice injected with vehicle-PBS (HET, n=12), HET mice injected with STXBP1 long mutant (HET-AAV9(L), n=9), and HET mice injected with STXBP1 short mutant (HET-AAV9(S), n=11). SWDs were analyzed for 24 h over 7 consecutive days 24 weeks after injection. (D) Analysis of the number of "seizure-free" animals (no SWDs detected during recording) and "seizure-bearing" animals (SWDs detected during recording) 24 weeks after injection. Differences between groups were analyzed by nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test (****p<0.0001), (***p<0.001), and chi-squared contingency test was used for seizure-free analysis. [Figure 28]Analysis of body weight after AAV treatment in STXBP1 HET mice (1 - 22 weeks after injection) (A) Mean body weight as a function of age in WT (n = 17) and HET mice (n = 16) injected with vehicle - PBS. Inter - group differences were analyzed by two - way repeated - measures ANOVA, followed by uncorrected Fisher's LSD post - hoc multiple - comparison test (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). (B) Mean body weight measured at 22 weeks of age in WT mice injected with vehicle - PBS (WT, n = 17), HET mice injected with vehicle - PBS (HET, n = 16), HET mice injected with STXBP1 long variant (HET - AAV9(L), n = 10), and HET mice injected with STXBP1 short variant (HET - AAV9(S), n = 13). Inter - group differences were analyzed by parametric one - way ANOVA, followed by uncorrected Fisher's LSD post - hoc multiple - comparison test (**p < 0.01; ****p < 0.0001; ns, not significant). Bar graphs represent mean ± SEM. [Figure 29] Analysis of hindlimb clasping after AAV treatment in STXBP1 HET mice (4 - 22 weeks after injection) (A) Mean hindlimb clasping scores as a function of age in WT mice injected with vehicle - PBS (WT, n = 17), HET mice injected with vehicle - PBS (HET, n = 16), HET mice injected with STXBP1 long variant (HET - AAV9(L), n = 10), and HET mice injected with STXBP1 short variant (HET - AAV9(S), n = 13). (B) Mean hindlimb clasping scores recorded at 22 weeks of age in WT mice injected with vehicle - PBS (n = 17), and HET mice injected with vehicle - PBS (n = 16), AAV9 / MECP2 - int - STXBP1 - L (n = 10), and AAV9 / MECP2 - int - STXBP1 - S (n = 13). Inter - group differences were analyzed by non - parametric one - way ANOVA (Kruskal - Wallis test), followed by uncorrected Dunn's post - hoc multiple - comparison test (*p < 0.05; **p < 0.01; ****p < 0.0001; ns, not significant). Bar graphs represent mean ± SEM. [Diagram 30] Analysis of STXBP1 HET mice in the wire hanging test after AAV treatment (8 weeks after injection). Time to fall measured in the four - limb wire hanging test at 8 weeks of age in wild - type (WT) mice injected with vehicle - PBS (WT, n = 17), heterozygous (HET) mice injected with vehicle - PBS (HET, n = 16), HET mice injected with the long STXBP1 variant (HET - AAV9(L), n = 10), and HET mice injected with the short STXBP1 variant (HET - AAV9(S), n = 13). Inter - group differences were analyzed by parametric one - way ANOVA followed by uncorrected Fisher's LSD post - hoc multiple comparison test (****p < 0.0001; ns, not significant). Bar graphs represent mean ± SEM. [Diagram 31] Analysis of STXBP1 HET mice in the fear conditioning test after AAV treatment (10 weeks after injection) (A) Mean freezing behavior during the contextual fear memory test performed at 10 weeks of age, 24 hours after the fear conditioning training phase, in wild - type (WT) mice injected with vehicle - PBS (WT, n = 17), heterozygous (HET) mice injected with vehicle - PBS (HET, n = 16), HET mice injected with the long STXBP1 variant (HET - AAV9(L), n = 10), and HET mice injected with the short STXBP1 variant (HET - AAV9(S), n = 13). Inter - group differences were analyzed by parametric one - way ANOVA followed by uncorrected Fisher's LSD post - hoc multiple comparison test (*p < 0.05; ****p < 0.0001). (B) Mean freezing behavior during the cued fear memory test performed on the same animals as in (A), 1 hour after the contextual fear memory test. Inter - group differences were analyzed by parametric one - way ANOVA followed by uncorrected Fisher's LSD post - hoc multiple comparison test (*p < 0.05; ***p < 0.001; ****p < 0.0001). Bar graphs represent mean ± SEM.

[0014] Brief description of the sequences

Table 1 - 1

[0015] The invention will now be described with respect to certain non-limiting aspects and embodiments thereof and with reference to certain figures and examples.

[0016] Technical terms are used according to their common sense unless otherwise indicated. If a specific meaning is conveyed to a particular term, the definition of the term is given in the context in which the term is used.

[0017] Where an indefinite or definite article is used when referring to a singular noun e.g. "a", "an" or "the", this includes a plural of that noun, unless otherwise stated.

[0018] As used herein, the term "comprising" does not exclude other elements. For the purposes of the present disclosure, the term "consisting of" is considered to be a preferred embodiment of the term "comprising."

[0019] As used herein, the terms "treatment", "treating" and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in that it completely or partially prevents the disease or its symptoms, and / or it may be therapeutic in that it partially or completely cures the disease and / or the adverse symptoms caused by the disease. Thus, treatment encompasses any treatment of a mammalian, particularly a human, disease, including (a) preventing disease symptoms from occurring in a subject who may have a predisposition to the disease but has not yet been diagnosed as having it, i.e., a human; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.

[0020] Syntaxin binding protein 1 Twelve transcript variants of human STXBP1 have been identified, encoding eight protein isoforms. The amino acid sequence is highly conserved between rodents and humans. In the central nervous system, STXBP1 is specifically expressed in neurons and widely distributed across major brain regions, including the cortex, cerebellum, hippocampus and basal ganglia (Kalidas et al. 2000). Two major splice variants, including a short and a long version, have been described: Munc18-1a (aa 568-603): GSTHILTPTKFLMDLRHPDFRESSRVSFEDQAPTME (sequence number 38). Munc18-1b (aa 568-594): GSTHILTPQKLLDTLKKLNKTDEEISS (sequence number 39).

[0021] The longer splice version (M18L, Munc18-1a, 603 amino acids) shows differences in the last 25 C-terminal amino acids and is reported to be expressed at the synaptic level and predominantly in GABAergic neurons in rat brain (Ramos et al. 2015). The smaller splice version (M18S, Munc18-1b, 594 amino acids) is localized in various cellular compartments and is more ubiquitously expressed in GABAergic and glutamatergic neurons. Functional tests showed that STXBP1 splice variants could play different roles in synaptic plasticity (Meijer et al. 2015).

[0022] The STXBP1 gene is located on chromosome 9q34.11 (GRCh38 genomic coordinates: chr9:127,579,370-127,696,029) and the human encoded protein has a high level of identity with both rat and mouse STXBP1 (Swanson et al. 1998). The STXBP1 gene contains 25 exons. Alternative splicing of the final exon in the STXBP1 primary transcript can result in two different C-terminal amino acid sequences of STXBP1, including or skipping a 110 bp sequence containing a stop codon. The STXBP1-202 transcript (ENST00000373302.8) (SEQ ID NO:22) is the longest and encodes a 603 amino acid protein (SEQ ID NO:9). STXBP1-201 (ENST00000373299.5) (SEQ ID NO:23) encodes a 594 amino acid protein (SEQ ID NO:10). Both of these variants are detected in the central nervous system, although their expression patterns can differ between brain tissues and cell types (Ramos-Miguel et al. 2015).

[0023] The 12 transcript variants and 8 protein isoforms of human STXBP1 are summarized in Table 2.

[0024] [Table 2]

[0025] Syntaxin binding protein 1 or STXBP1 is sometimes referred to in the art by alternative names listed in Table 3. The most common is "Munc18-1" and, to a lesser extent, "Sec1." The accepted gene name is STXBP1.

[0026] [Table 3]

[0027] A protein sequence alignment of human, monkey and mouse STXBP1 sequences (human isoform a according to SEQ ID NO: 9) is shown in Figure 2. The alignment shows high sequence homology across species. The monkey and mouse amino acid sequences are identical to the human amino acid sequence.

[0028] Transgene The present invention relates to i. Syntaxin binding protein 1 (STXBP1) comprising isoform a, b, c, d, e, f, g, or h having the sequence set forth in SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, respectively; or ii. a sequence having at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, and retaining function as STXBP1; or iii. Provide a nucleic acid construct comprising a transgene encoding a naturally occurring variant comprising one or more of the mutations shown in Table 7, with reference to SEQ ID NO:9.

[0029] The term "transgene" refers to a nucleic acid molecule ("nucleic acid molecule" and "nucleic acid" are used interchangeably), DNA or cDNA, that encodes a gene product for use as an effective principle in gene therapy. The gene product may be one or more peptides or proteins.

[0030] In one embodiment, the transgene encodes STXBP1 isoform a having a sequence as set forth in SEQ ID NO:9, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:9.

[0031] In one embodiment, the transgene encodes STXBP1 isoform b having a sequence as set forth in SEQ ID NO:10, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:10.

[0032] In one embodiment, the transgene encodes STXBP1 isoform c having a sequence as shown in SEQ ID NO:11, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:11.

[0033] In one embodiment, the transgene encodes STXBP1 isoform d having the sequence shown in SEQ ID NO:12, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:12.

[0034] In one embodiment, the transgene encodes STXBP1 isoform e having the sequence shown in SEQ ID NO:13, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:13.

[0035] In one embodiment, the transgene encodes STXBP1 isoform f having the sequence shown in SEQ ID NO:14, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:14.

[0036] In one embodiment, the transgene encodes STXBP1 isoform g having a sequence as set forth in SEQ ID NO:15, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:15.

[0037] In one embodiment, the transgene encodes STXBP1 isoform h having a sequence as set forth in SEQ ID NO:16, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:16.

[0038] In one embodiment, the transgene encodes: i. STXBP1 transcript variant 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 having the sequence set forth in SEQ ID NO: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33, respectively; or ii. A sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33.

[0039] As is conventional in the art, the mRNA sequences of STXBP1 transcript variants 1-12 are reported as DNA sequences for alignment with the reference genome sequence. (National Center for Biotechnology Information, www.ncbi.nlm.nih.gov). The purpose of this is to make genome alignment more direct and to report fewer mismatches. To express STXBP1 isoforms a, b, or c, for example, one skilled in the art would express cDNA from transcript variants 1, 2, or 3.

[0040] In one embodiment, the transgene encodes STXBP1 isoform a and comprises a cDNA sequence of SEQ ID NO:7, or a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO:7.

[0041] The terms "nucleic acid" and "polynucleotide" or "nucleotide sequence" may be used interchangeably to refer to any molecule composed of or containing monomeric nucleotides. A nucleic acid may be an oligonucleotide or a polynucleotide. A nucleotide sequence may be DNA or RNA. A nucleotide sequence may be chemically modified or artificial. Nucleic acid sequences include peptide nucleic acids (PNAs), morpholinos and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Each of these sequences is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Phosphorothioate nucleotides may be used. Other deoxynucleotide analogs include methyl phosphonates, phosphoramidates, phosphorodithioates, N3'P5'-phosphoramidates and oligoribonucleotide phosphorothioates, as well as their 2'-0-allyl analogs, and 2'-0-methylribonucleotide methylphosphonates.

[0042] The term "nucleic acid construct" refers to a non-naturally occurring nucleic acid resulting from the use of recombinant DNA technology. In particular, a nucleic acid construct is a nucleic acid molecule that has been modified to contain segments of nucleic acid sequences that are combined or juxtaposed in a manner that does not occur in nature.

[0043] In certain embodiments, the nucleic acid construct comprises all or a fragment of a coding nucleic acid sequence having at least 70%, 80%, 90%; 95%, 99% or 100% identity to the coding sequence of a naturally occurring or recombinant functional variant of STXBP1.

[0044] The term "fragment" as used herein refers to a continuous portion of a reference sequence. For example, a fragment of a sequence having a length of 1000 nucleotides can refer to 5, 50, 500 consecutive nucleotides of the sequence.

[0045] As used herein, the term "pathological variant" refers to a nucleic acid sequence or amino acid sequence that is modified compared to a reference sequence and has a functional disorder compared to the reference sequence. Pathological variants and possible pathological variants of STXBP1 are shown in Table 5 and Table 6, respectively.

[0046] As used herein, the term "functional variant" refers to a nucleic acid or amino acid sequence that is modified compared to a reference sequence but retains the function of the reference sequence. Functional variants of STXBP1 are shown in Table 7.

[0047] The term "sequence identity" or "identity" refers to the number of matches (identical nucleic acid or amino acid residues) at positions obtained from the alignment of two polynucleotide or polypeptide sequences. Sequence identity is determined by comparing sequences when aligned to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity can be determined using any of several mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970, J Mol Biol.; 48(3):443-53) that optimally aligns the sequences over their entire length, whereas sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., the Smith and Waterman algorithm (Smith and Waterman, 1981, J Theor Biol.; 91(2):379-80) or the Altschul algorithm (Altschul SF et al., 1997, Nucleic Acids Res.; 25(17):3389-402.; Altschul SF et al., 1998, Nucleic Acids Res.; 25(17):3389-402.; Alignment is performed using the nucleotide sequence alignment software (Stanford University Press, 2005, Bioinformatics.;21(8):1451-6). Alignment for determining nucleic acid sequence identity percentage or amino acid sequence identity percentage can be achieved in various ways within the skill of the art, for example, using publicly available computer software available on Internet websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine the appropriate parameters for measuring alignment, including any algorithm required to achieve maximum alignment over the entire length of the sequences to be compared.For purposes herein, % nucleic acid sequence identity values ​​or % amino acid sequence identity values ​​refer to values ​​generated using the pairwise sequence alignment program EMBOSS Needle, which creates an optimal global alignment of two sequences using the Needleman-Wunsch algorithm with all search parameters set to default values, i.e., Scoring matrix=BLOSUM62, Gap open=10, Gap extend=0.5, End gap penalty=false, End gap open=10, and End gap extend=0.5.

[0048] A nucleic acid construct according to the present disclosure comprises a transgene and at least suitable nucleic acid elements for its expression in a host, e.g., a host cell.

[0049] For example, the nucleic acid construct comprises a transgene encoding STXBP1 and one or more regulatory sequences required for expression of STXBP1 in a relevant host. Generally, the nucleic acid construct comprises a transgene and the regulatory sequences required for expression of STXBP1 before (5' non-coding sequences) and after (3' non-coding sequences) the transgene.

[0050] promoter In one embodiment, the nucleic acid construct comprises a transgene encoding STXBP1 and a promoter operably linked to the transgene. Preferably, the transgene is under the control of the promoter.

[0051] The term "promoter" refers to a regulatory element that directs transcription of a nucleic acid to which it is operably linked. A promoter can regulate both the rate and efficiency of transcription of an operably linked nucleic acid. A promoter can also be operably linked to other regulatory elements that enhance ("enhancers") or suppress ("repressors") promoter-dependent transcription of a nucleic acid. These regulatory elements include, but are not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequence known to those of skill in the art that acts directly or indirectly to regulate the amount of transcription from a promoter, such as attenuators, enhancers and silencers. A promoter is located near the transcription start site of a gene or coding sequence to which it is operably linked, on the same strand, and upstream of the DNA sequence (towards the 5' region of the sense strand). A promoter can be about 100 to 1000 base pairs in length. Positions within a promoter are specified relative to the transcription start site of a particular gene (i.e., upstream positions are negative numbers counting backwards from -1, e.g., -100 is a position 100 base pairs upstream).

[0052] The term "operably linked in the 5' to 3' direction" or simply "operably linked" refers to the linkage of two or more nucleotide sequences in a functional relationship that allows each of the sequences to perform their normal function. Typically, the term operably linked is used to refer to the juxtaposition of regulatory elements, such as a promoter and a transgene that encodes a protein of interest. For example, the operably linked between the promoter and the transgene allows the promoter to function to promote the 5' expression of the transgene in a suitable expression system, such as in a cell.

[0053] The promoter can be a tissue- or cell-type-specific promoter, or an organ-specific promoter, or a promoter specific to multiple organs, or a systemic or ubiquitous promoter.

[0054] The term "ubiquitous promoter" more specifically relates to a promoter which is active in a variety of different cells or tissues, such as neurons and astrocytes.

[0055] Examples of promoters suitable for expression of transgenes throughout the central nervous system include the chicken beta actin (CBA) promoter (Miyazaki 1989, Gene 79:269-277), the CAG promoter (Niwa 1991, Gene 108:193-199), the elongation factor 1 alpha promoter (EF1α) (Nakai 1998, Blood 91:4600-4607), the human synapsin 1 gene promoter (hSyn) (Kugler S. et al. Gene Ther. 2003.10(4):337-47) or the phosphoglycerate kinase 1 promoter (PGK1) (Hannan 1993, Gene 130:233-239), the methyl CPG binding protein 2 (MECP2) promoter (Adachi et al. al., Hum. Mol. Genetics. 2005;14(23):3709-3722), human neuron-specific enolase (NSE) promoter (Twyman, RM and EA Jones (1997). J Mol Neurosci 8(1):63-73)), calcium / calmodulin-dependent protein kinase II (CAMKII) promoter (Nathanson, JL, et al. (2009). Neuroscience 161(2):441-450) and human ubiquitin C (UBC) promoter (Schorpp, M., et al. (1996). Nucleic Acids Res 24(9):1787-1788).

[0056] In one embodiment, the promoter is the CAG 1.6 kb promoter of SEQ ID NO:1.

[0057] In one embodiment, the promoter is the hSYN promoter of SEQ ID NO:2.

[0058] In one embodiment, the promoter is the MECP2 promoter of SEQ ID NO:3.

[0059] In one embodiment, the promoter is the hNSE promoter of SEQ ID NO:4.

[0060] In one embodiment, the promoter is the CamKII promoter of SEQ ID NO:5.

[0061] In one embodiment, the promoter is the endogenous hSTXBP1 promoter of SEQ ID NO:6.

[0062] In one embodiment, the promoter is the MECP2 promoter of SEQ ID NO:3 operably linked in a 5' to 3' direction to the MECP2 intron of SEQ ID NO:37.

[0063] In an alternative embodiment, the nucleic acid construct comprises a transgene encoding STXBP1 and a promoter operably linked to the transgene, wherein the promoter is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to: (a) CAG 1.6 kb promoter (SEQ ID NO: 1). (b) hSYN promoter (sequence number 2). (c) MECP2 promoter (sequence number 3). (d) hNSE promoter (SEQ ID NO:4). (e) CamKII promoter (sequence number 5). (f) endogenous hSTXBP1 promoter (sequence number 6). (g) the MECP2 promoter (SEQ ID NO: 3) operably linked in a 5' to 3' direction to the MECP2 intron (SEQ ID NO: 37).

[0064] The promoter may be a functional variant or fragment of the promoter described herein. The functional variant or fragment of the promoter may be functional in the sense that it retains the characteristics of the corresponding non-mutant or full-length promoter. Thus, the functional variant or fragment of the promoter retains the ability to promote the transcription of the transgene to which it is operably linked, thereby promoting the expression of STXBP1 encoded by said transgene. The functional variant or fragment of the promoter may retain specificity for a particular tissue type. For example, the functional variant or fragment of the promoter may be specific to cells of the CNS. The functional variant or fragment of the promoter may specifically promote the expression of STXBP1 in neurons.

[0065] A promoter may comprise a "minimal sequence," which refers to a nucleotide sequence of a promoter that has sufficient length and contains the necessary elements to function as a promoter, i.e., that the promoter is capable of promoting transcription of an operably linked transgene, thereby promoting expression of STXBP1.

[0066] The minimal promoter used in the nucleic acid construct of the present invention may be, for example, a CAG promoter comprising SEQ ID NO:1, or an hSYN promoter comprising SEQ ID NO:2, or an MECP2 promoter comprising SEQ ID NO:3.

[0067] A promoter may contain one or more introns. The term "intron" refers to a non-coding nucleotide sequence within a gene. Typically, introns are transcribed from DNA into messenger RNA (mRNA) during transcription of a gene, but are excised from the mRNA transcript by splicing before its translation.

[0068] The promoter may comprise the functional variant or fragment of the intron described herein. The functional variant or fragment of the intron may be functional in the sense that it retains the characteristics of the corresponding non-mutant or full-length intron. Thus, the functional variant or fragment of the intron described herein is non-coding. The functional variant or fragment of the intron described herein may also retain the ability to be transcribed from DNA into mRNA and / or excised from mRNA by splicing.

[0069] Introns that may be incorporated into the promoters used in the present invention may be derived from natural non-coding regions or may be engineered.

[0070] In one embodiment, the intron is an MECP2 intron comprising or consisting of SEQ ID NO:37, or a functional variant or fragment thereof having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to SEQ ID NO:37.

[0071] The promoter and / or intron may be combined with one or more non-expressed exon sequences that are not capable of generating a transcript, but rather may provide splice sites adjacent to the intron sequence.

[0072] Alternatively, the promoter can be a chemically inducible promoter.A chemically inducible promoter is a promoter that is regulated by in vivo administration of a chemical inducer to a subject that requires it.Examples of suitable chemically inducible promoters include, but are not limited to, tetracycline / minocycline inducible promoter (Chtarto 2003, Neurosci Lett.352:155-158) or rapamycin inducible promoter (Sanftner 2006, Mol Ther.13:167-174).

[0073] Polyadenylation signal sequence The nucleic acid construct may include a 3' untranslated region comprising a polyadenylation signal sequence and / or a transcription terminator.

[0074] The term "polyadenylation signal sequence" (or "polyadenylation site" or "poly(A) signal" both used interchangeably) refers to a specific recognition sequence in the 3' untranslated region (3'UTR) of a gene that is transcribed into precursor mRNA and guides the termination of gene transcription. The polyadenylation signal sequence acts as a signal for endonucleolytic cleavage of the newly formed precursor mRNA at its 3' end and for the addition of a stretch of RNA consisting only of adenine bases to this 3' end (polyadenylation process; poly(A) tail). The polyadenylation signal sequence is important for the nuclear export, translation and stability of mRNA. In the context of the present invention, the polyadenylation signal sequence is a recognition sequence that can direct the polyadenylation of mammalian and / or viral genes in mammalian cells.

[0075] Polyadenylation signal sequences typically consist of (a) the consensus sequence AAUAAA, which has been shown to be necessary for both 3'-end cleavage and polyadenylation of the pre-messenger RNA (pre-mRNA), as well as to promote downstream transcription termination, and (b) additional elements upstream and downstream of AAUAAA that control the efficiency of utilization of AAUAAA as a poly(A) signal. In mammalian genes, there is considerable diversity in these motifs.

[0076] In one embodiment, optionally in combination with one or more features of various embodiments described herein, the polyadenylation signal sequence of the nucleic acid construct of the present invention is a polyadenylation signal sequence of a mammalian gene or a viral gene.Suitable polyadenylation signals include, inter alia, SV40 early polyadenylation signal, SV40 late polyadenylation signal, HSV thymidine kinase polyadenylation signal, protamine gene polyadenylation signal, adenovirus 5 EIb polyadenylation signal, growth hormone polyadenylation signal, PBGD polyadenylation signal or in silico designed synthetic polyadenylation signal.

[0077] In one embodiment, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence comprising SEQ ID NO:8.

[0078] Other Regulatory Elements The nucleic acid construct may include additional regulatory elements, such as enhancer sequences, introns, microRNA targeting sequences, polylinker sequences that facilitate insertion of the DNA fragment into the vector, and / or splicing signal sequences.

[0079] Viral Vectors The present invention further provides a viral vector comprising a nucleic acid construct described herein.

[0080] The term "viral vector" refers to the nucleic acid portion of a viral particle disclosed herein that can be packaged into a capsid.

[0081] A viral vector typically comprises at least (i) a nucleic acid construct containing a transgene and suitable nucleic acid elements for its expression in a host, and (ii) all or a portion of the viral genome, e.g., the inverted terminal repeats of the viral genome.

[0082] The term "inverted terminal repeat" (ITR) refers to nucleotide sequences located at the 5' end (5'ITR) and 3' end (3'ITR) of a virus that contain palindromic sequences and can fold to form a T-shaped hairpin structure that functions as a primer during the initiation of DNA replication. They are also required for viral genome integration into and rescue from the host genome, and for encapsidation of viral nucleic acid into mature virions. ITRs are required in cis for vector genome replication and its packaging into viral particles.

[0083] In one embodiment, the viral vector comprises the viral 5' and 3' ITRs.

[0084] In one embodiment, the viral vector comprises the 5'ITR and 3'ITR of a virus independently selected from the group consisting of parvovirus (particularly adeno-associated virus), adenovirus, alphavirus, retrovirus (particularly gammaretrovirus and lentivirus), herpesvirus and SV40.

[0085] In one embodiment, the virus is an adeno-associated virus (AAV), an adenovirus (Ad) or a lentivirus.

[0086] In one embodiment, the virus is AAV.

[0087] In one embodiment, the viral vector comprises the 5' and 3' ITRs of AAV.

[0088] AAV has attracted considerable interest as a potential vector for human gene therapy. Among the favorable properties of the virus are the lack of association with any human disease, the ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from various tissues that can be infected. The AAV genome is composed of a linear single-stranded DNA molecule containing 4681 bases (Berns and Bohenzky, 1987, Advances in Virus Research (Academic Press, Inc.) 32:243-307). The genome contains inverted terminal repeats (ITRs) at each end that function in cis as origins of DNA replication and as packaging signals for the virus. ITRs are typically about 100-150 bp long.

[0089] The AAV ITRs may have a wild-type nucleotide sequence or may be altered by the insertion, deletion or substitution of one or more nucleotides, typically no more than 5, 4, 3, 2 or 1 nucleotide insertion, deletion or substitution, compared to known AAV ITRs. The serotype of the inverted terminal repeats (ITRs) of the AAV vector may be selected from any known human or non-human AAV serotype.

[0090] In certain embodiments, viral vector can comprise any AAV serotype ITR.Known AAV ITR includes but is not limited to AAV1, AAV2, AAV3 (including type 3A and 3B), AAV-LK03, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 (AAVrh10), AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV.Also includes recombinant serotypes such as Rec2 and Rec3 identified from primate brain.

[0091] Alternatively, the viral vector may contain synthetic 5' and / or 3' ITRs.

[0092] In one embodiment, the nucleic acid construct of the invention is comprised in a viral vector which further comprises the 5' and / or 3' ITR of AAV of serotype AAV2.

[0093] In one embodiment, the viral vector comprises the 3'ITR and / or 5'ITR of AAV of serotype AAV2 having the sequence shown in SEQ ID NO: 18 and / or 19, respectively, or a sequence having at least 80% or at least 90% identity to SEQ ID NO: 18 and / or 19, respectively.

[0094] Virus particles The present invention further provides a viral particle comprising a nucleic acid construct or a viral vector described herein.

[0095] The term "viral particle" refers to an infectious and typically replication-defective viral particle that comprises (i) a viral vector packaged therein (optionally including a nucleic acid construct), and (ii) a capsid.

[0096] In one embodiment, the capsid is formed from adeno-associated virus capsid proteins.

[0097] The proteins of the viral capsid of adeno-associated virus include capsid proteins VP1, VP2 and VP3. Differences between the capsid protein sequences of various AAV serotypes result in the use of different cell surface receptors for cell entry. Combined with alternative intracellular processing pathways, this gives rise to different tissue tropism for each AAV serotype.

[0098] AAV-based gene therapy targeting the CNS is reviewed in Pignataro D, Sucunza D, Rico AJ et al., J Neural Transm 2018;125:575-589. Viral particles can be selected and / or engineered to target at least neural cells in various regions of the brain and CNS.

[0099] AAV viruses are generally referred to in terms of their serotypes. Serotypes correspond to mutant subtypes of AAV with unique reactivity that can be used to distinguish them from other mutant subtypes due to the profile of expression of capsid surface antigens. AAV serotypes include AAV1, AAV2, AAV3 (including A and B), AAV-LK03, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 (AAVrh10) or AAV11 or combinations thereof. AAV can be a recombinant serotype such as Rec2 or Rec3 identified from primate brain, and AAV2-true-type (AAVtt). AAVtt is described in detail in Tordo et al., Brain. 2018;141(7):2014-2031 and WO 2015 / 121501. Reviews of AAV serotypes can be found in Choi et al (Curr Gene Ther. 2005; 5(3); 299-310) and Wu et al (Molecular Therapy. 2006; 14(3), 316-327).

[0100] In the viral particles of the invention, the capsid can be derived from any AAV serotype, or a combination of serotypes (such as VP1 from one AAV serotype and VP2 and / or VP3 from a different serotype).

[0101] In certain embodiments, the capsid protein may be derived from AAV2, AAV5, AAV8, AAV9, AAV2-retro or AAVtt.

[0102] In one embodiment, the viral particle comprises at least a VP1 capsid protein from AAV, the capsid protein being derived from AAV2, AAV5, AAV6, AAV8, AAV9 (e.g., AAV9.hu14 as set forth in SEQ ID NO:21), AAV10, AAV true type (AAVtt as set forth in SEQ ID NO:20), or a combination thereof.

[0103] In one embodiment, the viral particle comprises a capsid protein from AAVtt as set forth in SEQ ID NO: 20. In one embodiment, the capsid protein is at least 98.5%, 99% or 99.5% identical to SEQ ID NO:20.

[0104] In one embodiment, the viral particle comprises a capsid protein from AAV9 as set forth in SEQ ID NO: 21. In one embodiment, the capsid protein is at least 98.5%, 99% or 99.5% identical to SEQ ID NO:21.

[0105] AAV genomes, or elements of the AAV genome, including ITR sequences, rep genes, or cap genes for use in the present invention may be identified by the following accession numbers for AAV complete genome sequences: Adeno-associated virus 1 NC_002077, AF063497; Adeno-associated virus 2 NC_001401; Adeno-associated virus 3 NC_001729; Adeno-associated virus 3B NC_001863; Adeno-associated virus 4 NC_001829; Adeno-associated virus 5 Y18065, 5AF085716; Adeno-associated virus 6 NC_001862; Avian AAV ATCC VR-865 AY186198, AY629583, NC_004828; Avian AAV strain DA-1 NC_006263, AY629583; Bovine AAV Can be derived from NC_005889, AY388617.

[0106] AAV virus can also be referred to in terms of clade or clone.This refers to the phylogenetic relationship of AAV virus of natural origin, and typically refers to a phylogenetic group of AAV viruses that can be traced back to a common ancestor and includes all its descendants.Furthermore, AAV virus can be referred to in terms of specific isolate, i.e., the genetic isolate of a specific AAV virus found in nature.

[0107] The term "genetic isolate" refers to a population of AAV viruses that has undergone limited genetic mixing with other naturally occurring AAV viruses, thereby defining a population that is recognizably distinct at the genetic level. Examples of AAV clades and isolates that can be used in the present invention include the following: ·Clade A: AAV1 NC_002077, AF063497, AAV6 NC_001862, Hu.48 AY530611, Hu 43 AY530606, Hu 44 AY530607, Hu 46 AY530609; ·Clade B: Hu.19 AY530584, Hu.20 AY530586, Hu 23 AY530589, Hu22 AY530588, Hu24 AY530590, Hu21 AY530587, Hu27 AY530592, Hu28 AY530593, Hu 29 AY530594, Hu63 AYS30624, Hu64 AY530625, Hul3 AY530578, Hu56 AY530618, Hu57 AY530619, Hu49 AY530612, Hu58 25 AY530620, Hu34 AY530598, Hu35 AY530599, AAV2 NC_001401, Hu45 AY530608, Hu47 AY530610, Hu51 AY530613, Hu52 AY530614, Hu T41 AY695378, Hu S17 AY695376, Hu T88 AY695375, Hu T71 AY695374, HuT70 AY695373, Hu T40 AY695372, Hu T32 AY695371, Hu T17 AY695370, Hu LG15 AY695377; ·Clade C: Hu9 AY530629, HulO AY530576, Hull AY530577, Hu53 AY530615, Hu55 AY530617, Hu54 AY530616, Hu7 AY530628, Hul8 AY530583, Hul5 AY530580, Hul6 AY530581, Hu25 AY530591, Hu60 AY530622, Ch5 AY243021, Hu3 AY530595, Hul AY530575, Hu4 AY530602 Hu2, AY530585, Hu61 AY530623; · Clade D: Rh62 AY530573, Rh48 AY530561, Rh54 AY530567, Rh55 AY530568, C5 y2 AY243020, AAV7 AF513851, Rh35 AY243000, Rh37 AY242998, Rh36 AY242999, Cy6 AY243016, Cy4 AY243018, Cy3 AY243019, Cy5 AY243017, Rhl3 AY243013; · Clade E: Rh38 AY530558, Hu66 AY530626, Hu42 AY530605, Hu67 AY530627, Hu40 AY530603, Hu41 AY530604, Hu37 AY530600, Rh40 10 AY530559, Rh2 AY243007, Bbl AY243023, Bb2 AY243022, RhlO AY243015, Hul7 AY530582, Hub AY530621, Rh25 AY530557, Pi2 AY530554, Pil AY530553, Pi3 AY530555, Rh57 AY530569, Rh50 AY530563, Rh49 AY530562, Hu39 AY530601, Rh58 AY530570, Rhbl AY530572, Rh52AY530565, Rh53 AY530566, Rh51 AY530564, Rh64 AY530574, Rh43 15 AY530560, AAV8 AF513852, Rh8 AY242997, Rhl AY530556; and · Clade F: Hu 14(AAV9)AY530579, Hu31 AY530596, Hu32 AY530597; Clone isolate AAV5 Y18065, AF085716, AAV 3 NC_001729, AAV 3B NC_001863, AAV4 15 NC_001829, Rh34 AY243001, Rh33 AY243002, Rh32 AY243003.

[0108] The present invention encompasses the use of capsid protein sequences from different serotypes, clades, clones or isolates of AAV within the same vector. The present invention also encompasses packaging of the genome of one serotype into the capsid of another serotype, i.e., pseudotyping. Chimeric, shuffled, or capsid-modified derivatives may be selected to provide one or more desired functions. Thus, these derivatives may exhibit increased efficiency of gene delivery, reduced immunogenicity (humoral or cellular), altered tropism range, and / or improved targeting of specific cell types compared to AAV viral vectors containing naturally occurring AAV capsids. Increased efficiency of gene delivery may be achieved by improved receptor or co-receptor binding at the cell surface, improved internalization, improved transport into cells and the nucleus, improved uncoating of viral particles, or improved conversion of single-stranded genome to double-stranded form. Increased efficiency may also be associated with altered tropism range or targeting of specific cell populations so that the vector dose is not diluted by delivery to tissues where it is not required.

[0109] Chimeric capsid proteins include those that are produced by recombination between two or more capsid coding sequences of naturally occurring AAV serotypes.This can be done, for example, by marker rescue techniques, in which a non-infectious capsid sequence of one serotype is co-transfected with a capsid sequence of a different serotype, and directional selection is used to select the capsid sequence with desired properties.The capsid sequence of a different serotype can be changed by homologous recombination in cells to produce novel chimeric capsid proteins.

[0110] Chimeric capsid proteins include those that are generated by engineering capsid protein sequences to transfer specific capsid protein domains, surface loops, or specific amino acid residues between two or more capsid proteins, for example, between two or more capsid proteins of different serotypes. Shuffled or chimeric capsid proteins can be generated by DNA shuffling or error-prone PCR. Hybrid AAV capsid genes can be generated by randomly fragmenting the sequences of related AAV genes, for example those that code for capsid proteins of multiple different serotypes, and then reassembling the fragments in a self-priming polymerase reaction, which may also cause crossover within the region of sequence homology. The library of hybrid AAV genes thus generated by shuffling the capsid genes of several serotypes can be screened to identify viral clones with desired functions. Similarly, error-prone PCR can be used to randomly mutate AAV capsid genes to generate a diverse library of mutants that can then be selected for desired properties.

[0111] The sequence of the capsid gene can be genetically modified to introduce specific deletions, substitutions or insertions with respect to the native wild-type sequence. For example, the capsid gene can be modified by inserting the sequence of an unrelated protein or peptide within the open reading frame of the capsid coding sequence or at the N-terminus and / or C-terminus of the capsid coding sequence. The unrelated protein or peptide can advantageously act as a ligand for a specific cell type, thereby conferring improved binding to the target cell or improving the specificity of targeting of the viral particle to a specific cell population. The unrelated protein can be an epitope or affinity tag that aids in the purification of the viral particle as part of the production process. The insertion site is typically selected so as not to interfere with other functions of the viral particle, such as internalization or transport of the viral particle. Suitable insertion sites are disclosed in Choi et al (Curr Gene Ther. 2005;5(3);299-310).

[0112] In one embodiment, viral particles can be prepared by encapsulating an AAV viral vector derived from a particular AAV serotype into a viral particle formed by the native Cap protein corresponding to an AAV of the same serotype.

[0113] Nevertheless, several techniques have been developed to modify and improve the structural and functional properties of naturally occurring virus particles (Bunning H et al. J Gene Med 2008;10:717-733).

[0114] Thus, in another embodiment, a viral particle may comprise a nucleic acid construct comprising a transgene encoding STXBP1 flanked by the ITRs of a given AAV serotype and packaged into: (a) a viral particle comprising capsid proteins from different AAV serotypes, e.g., AAV2 ITR and AAV9 capsid proteins, or AAV2 ITR and AAVtt capsid proteins, or (b) a mosaic virus particle that contains a mixture of capsid proteins from different AAV serotypes or variants, e.g., AAV2 ITRs with capsids formed by proteins of more than one AAV serotype; or (c) a capsid protein truncated by domain swapping between different AAV serotypes or variants, e.g., a chimeric virus particle comprising an AAV2 ITR with an AAV5 capsid protein containing an AAV3 domain, or (d) Viral particles engineered to display selective binding domains and enable stringent interactions with target cell-specific receptors.

[0115] The AAVtt capsid, also referred to as the AAV2 true type capsid, is described in WO 2015 / 121501. In one embodiment, the AAVtt VP1 capsid protein contains at least one amino acid substitution relative to the wild type VP1 capsid protein at a position corresponding to one or more of the following positions of the AAV2 protein sequence (NCBI Reference Sequence: YP_680426.1): 125, 151, 162, 205, 312, 457, 492, 499, 533, 546, 548, 585, 588, and / or 593.

[0116] In one embodiment, the AAVtt comprises one or more of the following amino acid substitutions relative to the wild-type AAV2 VP1 capsid protein (NCBI Reference Sequence: YP_680426.1): V125I, V151A, A162S, T205S, N312S, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T and / or A593S.

[0117] In one embodiment, AAVtt contains four or more mutations at positions 457, 492, 499 and 533 relative to the wild-type AAV2 VP1 capsid protein.

[0118] The construction of recombinant AAV viral particles is generally known in the art and is described, for example, in U.S. Pat. No. 5,173,414; U.S. Pat. No. 5,139,941; WO 92 / 01070; WO 93 / 03769; Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, BJ (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, RM (1994) Human Gene Therapy 5:793-801.

[0119] Generation of viral particles The production of viral particles carrying the viral vectors and nucleic acid constructs described herein can be carried out by conventional methods and protocols, selected having regard to the structural characteristics of the viral particle to be generated.

[0120] In summary, viral particles can be produced within a host cell, more specifically within specific virus-producing cells (packaging cells) that are transfected with a nucleic acid construct or viral vector in the presence of a helper vector or virus or other DNA construct.

[0121] The term "packaging cell" refers to a cell or cell line that can be transfected with a nucleic acid construct or viral vector and provides in trans any missing functions necessary for complete replication and packaging of the viral vector. Packaging cells can express such missing viral functions constitutively or inducibly. Packaging cells can be adherent or suspension cells.

[0122] Typically, the process of producing viral particles involves the following steps: (a) culturing in a culture medium packaging cells containing a nucleic acid construct or a viral vector; and (b) harvesting the viral particles from the cell culture supernatant and / or intracellularly.

[0123] Viral particles can be produced using conventional methods involving transient cell co-transfection with a nucleic acid construct or expression vector (e.g., a plasmid) carrying a transgene encoding STXBP1, a second nucleic acid construct (e.g., an AAV helper plasmid) encoding the rep and cap genes but lacking ITR sequences, and a third nucleic acid construct (e.g., a plasmid) that provides adenoviral functions required for AAV replication.

[0124] The viral gene required for AAV replication is called viral helper gene.Typically, the gene required for AAV replication is adenovirus helper gene, such as E1A, E1B, E2a, E4 or VA RNA.In one embodiment, the adenovirus helper gene is of Ad5 or Ad2 serotype.

[0125] Alternatively, AAV particle production may be performed by infection of insect cells with a combination of recombinant baculoviruses (Urabe et al. Hum. Gene Ther. 2002;13:1935-1943). SF9 cells are co-infected with two or three baculovirus vectors, each expressing AAV rep, AAV cap and the AAV vector to be packaged. The recombinant baculovirus vector provides viral helper gene functions required for viral replication and / or packaging. Smith et al 2009 (Molecular Therapy, vol.17, no.11, pp 1888-1896) describes a dual baculovirus expression system for large-scale production of AAV particles in insect cells.

[0126] Suitable culture media are known to those skilled in the art. The components that make up the culture medium may vary depending on the type of cells being cultured. In addition to the nutrient composition, osmolality and pH are considered important parameters of the culture medium. Cell growth media contain several components well known to those skilled in the art, including amino acids, vitamins, organic and inorganic salts, carbohydrate sources, lipids, trace elements (CuS04, FeS04, Fe(N03)3, ZnS04, to name a few), each component being present in an amount that supports the in vitro culture of cells (i.e., cell survival and growth). The components may also include auxiliary substances, such as buffer substances (e.g., sodium bicarbonate, Hepes, Tris, or similarly acting buffers), oxidative stabilizers, stabilizers against mechanical stress, protease inhibitors, animal growth factors, plant hydrolysates, anti-aggregating agents, anti-foaming agents. The characteristics and composition of cell growth media vary depending on the specific cell requirements. Examples of commercially available cell growth media include MEM (Minimum Essential Medium), BME (Bass Medium Eagle), DMEM (Dulbecco's Modified Eagle's Medium), Iscoves DMEM (Iscoves' Modified Dulbecco's Medium), GMEM, RPMI 1640, Leibovitz L-15, McCoy's Medium 199, Ham's F10 and derivatives, Ham F12, DMEM / F12.

[0127] Further guidance in the construction and generation of viral vectors for use in accordance with the present disclosure can be found in: Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology, Vol. 737. Merten and Al-Rubeai (Eds.); 2011 Humana Press (Springer); Gene Therapy. M. Giacca. 2010 Springer-Verlag; Heilbronn R. and Weger S. Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics. In: Drug Delivery, Handbook of Experimental Pharmacology 197; M. Schafer-Korting (Ed.). 2010 Springer-Verlag; pp. 143-170; Adeno-Associated Virus: Methods and Protocols. ROSnyder and P. Moulllier (Eds). 2011 Humana Press (Springer); Bunning H. et al. Recent developments in Adeno-associated virus technology. J. Gene Med. 2008;10:717-733; Adenovirus: Methods and Protocols. M. Chillon and A. Bosch (Eds.); Third Edition. 2014 Humana Press (Springer).

[0128] host cell The present disclosure further provides a host cell comprising the nucleic acid construct or viral vector encoding STXBP1 described herein.The host cell according to the present disclosure is a virus-producing cell, also called packaging cell, which is transfected by nucleic acid construct or viral vector in the presence of helper vector or virus or other DNA construct, and provides all missing functions required for complete replication and packaging of viral particles in trans.The packaging cell can be an adherent cell or a suspension cell.

[0129] The packaging cell may be a eukaryotic cell, such as a mammalian cell, including monkey cells, human cells, dog cells and rodent cells. Examples of human cells include PER.C6 cells (WO 01 / 38362), MRC-5 (ATCC CCL-171), WI-38 (ATCC CCL-75), HEK-293 cells (ATCC CRL-1573), HeLa cells (ATCC CCL2) and fetal rhesus lung cells (ATCC CL-160). Examples of non-human primate cells include Vero cells (ATCC CCL81), COS-1 cells (ATCC CRL-1650) or COS-7 cells (ATCC CRL-1651). Examples of dog cells include MDCK cells (ATCC CCL-34). Examples of rodent cells include hamster cells, such as BHK21-F, HKCC cells or CHO cells.

[0130] As an alternative to mammalian sources, packaging cells for producing viral particles can be derived from avian sources such as chicken, duck, goose, quail or pheasant.Examples of avian cell lines include avian embryonic stem cells (WO 01 / 85938; WO 03 / 076601), immortalized duck retina cells (WO 2005 / 042728), and avian embryonic stem cell-derived cells, including chicken cells (WO 2006 / 108846) or duck cells, such as EB66 cell lines (WO 2008 / 129058; WO 2008 / 142124).

[0131] In another embodiment, the host cell can be any packaging cell that allows baculovirus infection and replication.In one example, the cell is an insect cell, such as SF9 cell (ATCC CRL-1711), Sf21 cell (IPLB-Sf21), MG1 cell (BTI-TN-MG1) or High Five™ cell (BTI-TN-5B1-4).

[0132] In one embodiment, the host cell comprises: (a) a first nucleic acid construct or viral vector comprising a transgene encoding human STXBP1; (b) a second nucleic acid construct, e.g., a plasmid, encoding an AAV rep and / or cap gene, wherein the second nucleic acid construct does not have ITR sequences, and, optionally, (c) a third nucleic acid construct, e.g., a plasmid or virus, comprising viral helper genes.

[0133] The present disclosure further provides a host cell transduced with a viral particle of the present disclosure, where the term "host cell" as used herein refers to any cell line that is susceptible to infection by the virus of interest and suitable for culture in vitro.

[0134] Pharmaceutical Compositions The present disclosure further provides pharmaceutical compositions comprising the nucleic acid constructs, viral vectors, viral particles of the present disclosure in combination with a pharma- ceutically acceptable excipient, diluent or carrier.

[0135] The term "pharmaceutical acceptable" means approved by a regulatory agency or a recognized pharmacopoeia, e.g., the European Pharmacopoeia, for use in animals and / or humans. The term "excipient" refers to a diluent, adjuvant, carrier, or vehicle with which the therapeutic is administered.

[0136] Any suitable pharma- ceutically acceptable carrier, diluent or excipient can be used for the preparation of pharmaceutical compositions (see, for example, Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (Editor) Mack Publishing Company, April 1997). Pharmaceutical compositions are typically sterile and stable under the conditions of manufacture and storage. Pharmaceutical compositions can be formulated as a solution (e.g., saline, dextrose solution or buffer solution or other pharma- ceutically acceptable sterile fluid), microemulsion, liposome, or other ordered structure (e.g., microparticles or nanoparticles) suitable for accommodating high product concentration. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, or salts, such as sodium chloride, in the composition.

[0137] In one embodiment, the pharmaceutical composition is formulated as a solution, for example, a buffered saline solution.

[0138] Supplementary active compounds may be incorporated into the pharmaceutical compositions of the present disclosure. Guidance regarding the co-administration of additional therapeutic agents may be found in the Compendium of Pharmaceutical and Specialties (CPS) of the Canadian Pharmacists Association.

[0139] In one embodiment, the pharmaceutical composition is suitable for intraparenchymal, intracerebral, intravenous or intrathecal administration. These pharmaceutical compositions are merely exemplary and are not intended to be limiting of pharmaceutical compositions suitable for other parenteral and non-parenteral administration routes. The pharmaceutical compositions described herein may be packaged in single unit dosage form or in multiple dosage form.

[0140] medical use The pharmaceutical compositions, nucleic acid constructs, viral vectors and viral particles of the present disclosure may be used to treat or prevent any condition associated with loss of STXBP1 functional activity, for example, any condition associated with an STXBP1 mutation.

[0141] Such conditions include Dravet syndrome, Lennox-Gastaut syndrome, infantile spasms, myoclonic epilepsy, epileptic encephalopathy, early myoclonic encephalopathy, nonsyndromic epilepsy, Ohtahara syndrome, early-onset epileptic encephalopathy, West syndrome, developmental delay, autism spectrum disorder, ataxia-tremor-retardation syndrome, Rett syndrome, and intellectual disability without epilepsy.

[0142] The pharmaceutical compositions, nucleic acid constructs, viral vectors and viral particles of the present disclosure may be particularly useful for treating or preventing neurodevelopmental and / or epilepsy disorders associated with genetic mutations in the STXBP1 gene, e.g., mutations that contribute to the development of syndromes such as Ohtahara syndrome, Dravet syndrome and West syndrome.

[0143] Thus, in one embodiment a pharmaceutical composition, a nucleic acid construct, a viral vector or a viral particle is provided for use in therapy.

[0144] In one embodiment, a pharmaceutical composition, a nucleic acid construct, a viral vector or a viral particle is provided for use in treating an STXBP1 genetic disorder.

[0145] In one embodiment, the STXBP1 genetic disorder is Dravet syndrome, Lennox-Gastaut syndrome, infantile spasms, myoclonic epilepsy, epileptic encephalopathy, early myoclonic encephalopathy, nonsyndromic epilepsy, Ohtahara syndrome, early onset epileptic encephalopathy, West syndrome, developmental delay, autism spectrum disorder, ataxia-tremor delay syndrome, Rett syndrome, or intellectual disability without epilepsy.

[0146] In one embodiment, the STXBP1 genetic disorder is Dravet syndrome, Ohtahara syndrome, or West syndrome.

[0147] In one embodiment, a use of the nucleic acid construct, viral vector or viral particle is provided for the manufacture of a medicament for treating a STXBP1 genetic disorder.

[0148] In one embodiment, the disclosure provides a method of treating an STXBP1 genetic disorder, comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition or viral particle.

[0149] The term "therapeutically effective amount" refers to an amount of a number of viral particles, or a pharmaceutical formulation containing such viral particles, that achieves a desired therapeutic outcome when administered to a patient or subject. Desired therapeutic outcomes include: A significant reduction in the frequency or duration of various seizure types, e.g. atonic seizures (drop attacks), myoclonic seizures, generalized seizures, partial seizures, febrile seizures, infantile spasms, -Remarkable achievement of freedom from persistent seizures, Significant impact on the progression of neurodevelopmental symptoms such as developmental delay, intellectual disability, speech and language disorders, cognitive impairment, involuntary movements, gait disorders and autistic features.

[0150] The terms "patient" or "subject", used interchangeably, refer to a mammal. Any mammalian species can benefit from the therapeutic method. Typically, the patient is a human. The patient may be a neonate, infant, child, or adolescent.

[0151] STXBP1 genetic disorders can be identified by known genetic mutations.

[0152] In one embodiment, the STXBP1 genetic disorder is associated with a pathological STXBP1 variant comprising a mutation or a combination of mutations.

[0153] The term "pathological STXBP1 variant" refers to a variant of STXBP1 found in a patient sample, identified through clinical trials or research, and reported to be associated with a pathological phenotype. Pathological STXBP1 variants and possible pathological STXBP1 variants are described in Example 3 and shown in Tables 5 and 6, respectively.

[0154] In one embodiment, the pathological STXBP1 mutant comprises one or more mutations selected from the group listed in Table 5.

[0155] In one embodiment, the pathological STXBP1 mutant comprises one or more mutations selected from the group listed in Table 6.

[0156] The STXBP1 gene therapy described herein can be administered in combination with anti-epileptic drugs or other neuromodulatory therapies.

[0157] The pharmaceutical composition, nucleic acid construct, viral vector or viral particle can be administered to the brain and / or cerebrospinal fluid (CSF) of a patient. For example, they can be administered by injection or by using a purpose-specific administration device. Delivery to the brain can be selected from intracerebral delivery, intraparenchymal delivery, intracortical delivery, intrahippocampal delivery, intraputaminal delivery, intracerebellar delivery and combinations thereof. Delivery to the CSF can be selected from intracisternal delivery, intrathecal delivery, intracerebroventricular (ICV) delivery and combinations thereof.

[0158] Treatment may be provided as a single dose, although repeat doses may be considered, for example, if the treatment may not be targeting the correct area or in the future and / or with a different AAV serotype.

[0159] array The sequences encompassed by the present invention are shown in Table 4.

[0160] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11] [Table 4-12] [Table 4-13] [Table 4-14] [Table 4-15] [Table 4-16] [Table 4-17] [Table 4-18] [Table 4-19] [Table 4-20] [Table 4-21] [Table 4-22] [Table 4-23] EXAMPLES

[0161] example The following examples illustrate the invention.

[0162] Example 1: Construct design, generation and cloning The plasmids used in this study were constructed by recombinant DNA technology. The AAV Cis backbone plasmid was synthesized de novo and contained two AAV inverted terminal repeats (ITRs), a kanamycin resistance cassette, a prokaryotic origin of replication, and an SV40 polyadenylation sequence. A DNA sequence encoding the isoform variant X1 of human STXBP1 (including SEQ ID NO: 7) was synthesized de novo with convenient cloning restriction sites. Individual promoters were synthesized de novo with convenient restriction sites. Human influenza hemagglutinin (HA) or Myc tags (according to SEQ ID NOs: 33 and 32, respectively) were synthesized as oligonucleotides from Integrated DNA Technologies™ (Coralville, IA, USA) and inserted at the amino or carboxy terminus. Seven different promoters (MECP2-intron, MECP2, hNSE, CamKII, hSyn, hSTXBP1p, CAG) were tested for the human STXBP1 gene.

[0163] A schematic diagram of the designed constructs is shown in Figure 3. In the figure, "prom" means promoter, "INT" means intron, "h" means human, SV40 means polyadenylation sequence SV40, and "tag" means HA tag or Myc tag located at either the N- or C-terminus of the construct.

[0164] Example 2: Evaluation of STXBP1 expression under different promoters cell culture Human-derived AD-HEK293 (Agilent Technologies™, Santa Clara, CA, USA) and mouse-derived Neuro-2A (ATCC™, Manassas, VA) cell lines were passaged in DMEM + 10% FBS + 1% penicillin / streptomycin (both from Thermo Fisher Scientific™, Waltham, MA, USA). Neuro-2A cells were differentiated by supplementing the growth medium with 10 μM retinoic acid (MilliporeSigma™, Burlington, MA, USA) for 72 h as previously described (Tremblay, R. et al. 2010). Cells were transfected using X-tremeGene 360 ​​Transfection reagent (Roche, Mannheim, Germany) according to the manufacturer's protocol. A control transfection with a control plasmid was also included.

[0165] Immunofluorescence and microscopy Imaging experiments were performed using a Zeiss Axio Observer 7 epifluorescence microscope (Carl Zeiss AG™, Oberkochen, Germany) equipped with a 40x objective and a Hamamatsu Orca 4 flash-cooled monochrome camera (Hamamatsu Photonics KK™, Hamamatsu City, Japan). Transfected AD-HEK293 and Neuro-2A cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, 19440) and stained with rabbit polyclonal anti-STXBP1 (MilliporeSigma™, Burlington, MA, USA) at 1:500. Cells were then stained with donkey anti-rabbit secondary antibody conjugated to Alexa Fluor 488 at 1:1,000 before imaging.

[0166] Figure 4: (A) Immunofluorescence imaging of AD-HEK293 cells transfected with hSTXBP1 plasmids driven by various promoters (CAG, MECP2 and MECP2-intron) detected by anti-STXBP1 antibody. (B) Magnified section shows that STXBP1 is localized to the cell membrane. AD=adherent, NC=negative control.

[0167] As shown in Figure 4, the transfected cells exhibited different levels of expression of the human STXBP1 transgene under the driving of the ubiquitous CAG promoter or the neural-specific promoters (MECP2 and MECP2-intron).

[0168] As shown in Figure 5, Neuro-2A transfected cells transfected with STXBP1 plasmids driven by the ubiquitous CAG promoter and neuronal-specific promoters (MECP2 and MECP2-intron) were also analyzed.

[0169] Figure 5: (A) Immunofluorescence imaging of Neuro-2A cells transfected with hSTXBP1 plasmids driven by various promoters (CAG, MECP2 and MECP2-intron) detected by anti-STXBP1 antibody. (B) Magnification shows that STXBP1 is localized to the cell membrane. NC = negative control.

[0170] STXBP1 is a cytosolic protein that interacts with a series of membrane-associated proteins. Zoomed images of transfected AD-HEK293 and Neuro-2A cells show that STXBP1 expressed from these plasmids is localized to the plasma membrane, as expected (Figure 4(B)), or to both neuronal processes and the plasma membrane (Figure 5(B)).

[0171] Western blot analysis Transfected AD-HEK 293 cells were harvested in 1X Cell Lysis Buffer (Cell Signaling Technology™, Danvers, MA, USA) containing 1X Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific™, Waltham, MA, USA) according to the manufacturer's instructions. Lithium dodecyl sulfate (LDS) Sample Buffer supplemented with 10% reducing agent (both Thermo Fisher Scientific™, Waltham, MA, US) was added to the protein lysate to a final concentration of 1X. Samples were separated by 1D SDS-PAGE gel electrophoresis. For each sample, 30 μg of protein was loaded per lane. Proteins were transferred to nitrocellulose membranes (Li-Cor Biosciences™, Lincoln, NE, USA) using a semi-dry transfer apparatus (Bio-Rad Laboratories™, Hercules CA). After transfer, the membrane was incubated in blocking solution (Li-Cor Biosciences™, Lincoln, NE, USA) for 1 hour at room temperature. The membrane was then incubated overnight at 4°C with blocking solution containing primary antibodies. The following primary antibodies were used in this analysis: rabbit polyclonal anti-STXBP1 (MilliporeSigma™, Burlington, MA, USA) at 1:1,000, goat polyclonal anti-STXBP1 (Abnova, Taoyuan, Taiwan) at 1:1,000, rabbit polyclonal anti-c-myc (MilliporeSigma™, Burlington, MA, USA) at 1,1000, rabbit monoclonal anti-HA (Cell Signalling Technology™, Danvers, MA, USA) at 1:1,000, mouse monoclonal anti-GAPDH (MilliporeSigma™, Burlington, MA, USA) at 1:1,000.The membrane was washed three times with PBST solution and placed in blocking solution containing IRDye 680RD donkey anti-goat or IRDye 680RD donkey anti-rabbit secondary antibodies or 800CW donkey anti-mouse (1:15,000; Li-Cor Biosciences™, Lincoln, NE, USA) suitable for detection in the near-infrared spectrum for 1 h at room temperature. Proteins were visualized using a Li-Cor Odyssey CLx near-infrared imager (Li-Cor Biosciences™, Lincoln, NE, USA).

[0172] The molecular weight of STXBP1 monomer under reducing conditions is predicted to be about 70 kDa, and the protein was detected as a monomer by Western blot. Detection of GAPDH was used as a loading control. These results show that robust expression was achieved by various promoters in differentiated Neuro-2A (Figure 6).

[0173] Figure 6: Western blot analysis of Neuro-2A cells transfected with hSTXBP1 driven by various promoters (CAG, MECP2 and MECP2-intron). Two technical replicates of each condition are shown. NC = negative control, 1 = MECP2-intron-hSTXBP1, 2 = CAG-hSTXBP1, 3 = MECP2-hSTXBP1.

[0174] These results also show that robust expression was achieved by both N- and C-terminally tagged constructs driven by the CAG promoter (Figure 7).

[0175] Figure 7: Western blot analysis of (A) Myc-tagged hSTXBP1 driven by the CAG promoter in AD-HEK293 cells, detected by anti-Myc antibody, and (B) HA-tagged hSTXBP1 driven by the hSYN promoter in AD-HEK293, SH-SY5Y and Neuro-2a cells, detected by anti-HA antibody. Two technical replicates of each condition are shown. (C) Epitope-tagged proteins were also detected in AD-HEK293 cells using anti-STXBP1 antibody. NC=negative control, 1=CAG-hSTXBP1-Myc, 2=CAG-Myc-hSTXBP1, 3=hSYN-HA-hSTXBP1. The background protein band in the NC lane in (A) is due to the detection of endogenous Myc by anti-Myc antibody.

[0176] Example 3: Identification and analysis of natural and pathological variants We searched the ClinVar database (https: / / www.ncbi.nlm.nih.gov / clinvar / ), a freely accessible public archive of reports of associations between human variants and phenotypes with supporting evidence, to identify STXBP1 gene variants using the search terms "STXBP1" and "pathogenic" or "probably pathogenic". The list of pathogenic variants was supplemented by variants published in the literature reviewed by scientific experts and manually curated from a PubMed (https: / / pubmed.ncbi.nlm.nih.gov / ) search using the search terms "STXBP1, Munc18, variant, mutation" and defined as pathogenic by the authors to identify additional STXBP1 pathogenic variants not reported in ClinVar.

[0177] Pathological and potentially pathological variants that result in alterations in the STXBP1 protein were then identified (Tables 5 and 6, respectively).

[0178] [Table 5-1] [Table 5-2]

[0179] [Table 6]

[0180] The STXBP1 gene variant may contain a missense mutation resulting in an amino acid substitution. For example, R190Q in Table 5 means that the arginine at position 190 is replaced by glutamine with reference to SEQ ID NO:9.

[0181] Other mutations may occur. One type of mutation identified is a mutation involving the insertion or deletion of nucleotides where the number of changed base pairs is not divisible by 3, which results in the generation of a new amino acid sequence, a frameshift, denoted as "fs". If the mutation disrupts the correct reading frame, the entire DNA sequence following the mutation will be read incorrectly. For example, E12fs in Table 5 means that the glutamic acid at position 12 with reference to SEQ ID NO:9 is changed by a nucleotide frameshift, resulting in an abnormal protein with an incorrect amino acid sequence.

[0182] Another type of mutation found in the mutants was a mutation at the DNA level that removes one or more amino acid residues in the protein. This type of mutation is shown in the table as a deletion (del). For example, I539del in Table 5 means that the isoleucine at position 539 has been removed with reference to SEQ ID NO:9.

[0183] Other mutations include the introduction of a stop codon, indicated by an asterisk (*), which means that translation of the protein stops at this position, resulting in a shortened or truncated protein. For example, Y531* in Table 5 means that a stop mutation is made in the codon that normally codes for tyrosine 531, with reference to SEQ ID NO:9, resulting in protein translation terminating at this position.

[0184] The query term "STXBP1" was used to obtain natural variants in healthy populations from gnomAD (Genome Aggregation Database-https: / / gnomad.broadinstitute.org / v2.1.1), a publicly available control dataset containing genetic information from 60.146 samples from unrelated individuals. The variants extracted from the control dataset include missense, start lost, and stop gained variants resulting in amino acid changes. Natural variants resulting in amino acid changes are reported in Table 7.

[0185] [Table 7]

[0186] Example 4: Production of virus particles AAV generation Transplasmids containing AAV2 Rep sequences followed by AAV9.hu14 (hereafter AAV9) or AAV true type (hereafter AAVtt) capsid sequences (according to SEQ ID NOs: 17 and 34, respectively) were synthesized de novo by ATUM™ (Newark, CA, USA). AAV helper plasmid pALD-X80 was purchased from Aldevron, LLC™ (Fargo, ND, USA).

[0187] Non-replicating AAV vectors were generated by a triple transfection method. Expi293 cells (Thermo Fisher™, Waltham, MA, USA) were passaged every 3–4 days using Expi293 Expression Media (Thermo Fisher™, Waltham, MA, USA) in shake flasks at a seeding density of 3.0E+05-5.5E+05 cells / mL. Expi293 cells were cultured on an orbital shaker at 125 rpm in an Eppendorf incubator set at 37°C with 5% CO2. To set up production flasks, 125 mL shake flasks were inoculated the day before transfection at 1.5E+05 cells / mL in a total volume of 30–66 mL per virus preparation. Viable cell density was calculated using Vi-Cell Blu (Beckman Coulter™, Pasadena, CA, USA).

[0188] For production flasks with a working volume of 30 mL, transfection complexes were made for each flask as follows: 180 μL of Polyethylenimine (PEI) MAX at 1 mg / mL (Polysciences Inc™, Warrington, PA, USA) was diluted into 1.5 mL of OptiPRO serum-free medium (Thermo Fisher™, Waltham, MA, USA), vortexed 4 times at setting 8, and incubated at room temperature for 5 minutes. Separately, 20 μg of Cis plasmid (shown in Table 10), 30 μg of Rep / Cap plasmid (AAV9 or AAVtt), and 40 μg of helper plasmid (pALD-X80) were diluted into 1.5 mL of OptiPRO serum-free medium, vortexed 4 times at setting 8, and incubated at room temperature for 5 minutes. These two mixtures were then combined, vortexed 4 times at setting 8, and incubated at room temperature for 15 minutes. The transfection complex was then added to the shake flask containing the cells. The cells were incubated with the transfection mixture at 37° C. with constant agitation at 125 rpm.

[0189] After 96 hours, concentrated AAV lysis buffer was added to the flask to a final concentration of 1X (150 mM NaCl, 120 mM Tris-HCl [pH=8.0], 2 mM MgCl2, 0.1% Triton X-100) and Benzonase (MilliporeSigma™, Burlington, MA, USA) to a final concentration of 50 U / mL. The mixture was incubated at 37°C for 1 hour with constant stirring at 125 rpm. The mixture was clarified by centrifugation at 2,880×g for 10 minutes at 23°C. Samples were stored at −80°C until further analysis.

[0190] AAV titer determination Each sample was removed from -80°C and thawed at room temperature for 15 minutes. After thawing, the samples were vortexed briefly and centrifuged for 1 minute. After this, 10 μL of sample was added to individual wells of a 96-well PCR plate in combination with 10X DNase Buffer, 50 U DNase, and DNase-free water (all from Promega™, Madison, WI, USA) for a total volume of 100 μL in each well.

[0191] The plate was then transferred to a Bio-Rad™ (Hercules, Calif., USA) thermal cycler and heated at 37° C. for 30 min and then cooled to 4° C. Samples were then serially diluted as described in Table 8.

[0192] [Table 8]

[0193] 5 μL of dilutions D2, D3, D4 and D5 were mixed with 20 μL of ddPCR master mix consisting of Supermix for Probes (no dUTP; Bio-Rad™, Hercules, CA, USA), forward primer GATCCAGACATGATAAGATACATTG (SEQ ID NO: 40), reverse primer GCAATAGCATCACAAATTTCAC (SEQ ID NO: 41), probe 6-Fam / Zen / 3′IB FQ:TGGACAAACCACAACTAGAATGCA (SEQ ID NO: 42) and DNase-free water to a final concentration of 1×. This primer set targets the SV40 polyA region of the transgene. Each sample was run in duplicate in a 96-well PCR plate.

[0194] The plate was heat sealed with a foil cover, pulse vortexed, and centrifuged at 1,000×g for 5 min. The plate was placed in a Bio-Rad™ QX-200 droplet generator and droplets were generated according to the manufacturer's instructions.

[0195] After droplet generation, the plate was heat sealed with a foil cover and placed in a BioRad™ thermocycler programmed to run the cycles described in Table 9.

[0196] [Table 9]

[0197] Once complete, the plate was placed into a Bio-Rad™ QX200 dropper and the drop was read according to the manufacturer's instructions. The concentration of vector genomes (VG / mL) was quantified using the following formula: VG / ML:X=[(aY)(1000 / b)]D, where: X is VG / mL a is the volume of the ddPCR reaction (25 μl); Y is the ddPCR readout in copies per microliter, b is the volume of diluent vector in ddPCR (5 μL); D is the total dilution applied to the test material.

[0198] Assay acceptance criteria were defined as follows: The %CV between replicates must be ≤15%. If >15%, one outlier may be omitted. If an outlier is omitted and the %CV remains >15%, the assay must be repeated. The %CV between dilutions must be ≤20% and the dilutions reported must be at least two serial dilutions. If the %CV is >20%, a dilution may be omitted as long as the dilutions reported are at least two serial dilutions. If the average dilution is still >20%, the assay must be repeated. Each reaction well must have ≥1,000 accepted droplets. If <10,000 droplets, the well is excluded from analysis.

[0199] Viral particle quantification by AAV capsid ELISA Viral particle titers were determined by ELISA kit (PROGEN™ Biotechnik GmbH, Heidelberg, Germany) according to the manufacturer's instructions. For AAV9, mouse monoclonal ADK9 antibody was used for both capture and detection steps. For AAVtt, A20R monoclonal antibody was used for both capture and detection steps. Washing in the provided 1X Assay Buffer (ASSB) was performed between each step using a Molecular Devices™ (San Jose, CA, USA) AquaMax 4000 microplate washer. Samples were detected using a Molecular Devices™ SpectraMax M5e plate reader. Capsid titers were interpolated from the standard curve. Capsid titers are reported in Table 10.

[0200] [Table 10]

[0201] Viral genome titers obtained by ddPCR and capsid titers obtained by ELISA indicated that both AAV9 and AAVtt viral particles could be successfully generated that contained viral vectors carrying nucleic acids containing the indicated promoters operably linked to the human STXBP1 transgene.

[0202] Example 5: Lentiviral expression of STXBP1 cassette in NGN2 differentiated glutamatergic neurons A gene-edited iPSC line (EBiSC, ref. BIONi010-C-13) carrying a DOX-inducible NGN2 expression cassette was used to generate iPSC-derived glutamatergic neurons. In this protocol, NGN2 transcription factor was induced by doxycycline for 9 days to prime neuronal differentiation. At division in vitro (DIV) 21, iPSC-derived NGN2 neurons were transduced with serial dilutions of lentiviral vectors expressing human STXBP1 (SEQ ID NO: 9) under the control of the hSyn or MECP2 promoter. To improve safety, lentiviral vectors were generated in HEK 293 cells using a third generation system. At DIV28, immunocytochemistry (ICC) analysis was performed as follows: cells were fixed by 2% paraformaldehyde and stained by primary rabbit polyclonal anti-STXBP1 antibody (Sigma, ref. HPA008209) at a dilution of 1:250. Cells were then stained at 1:1000 dilution with a goat anti-rabbit secondary antibody conjugated to Alexa Fluor 568. Imaging was performed with an InCell Analyzer 6000 instrument using empirical parameters.

[0203] Representative ICC images from cells transduced with lentiviral vectors with a multiplicity of infection (MOI) of 2 are shown in Figure 8.

[0204] Figure 8: Lentiviral vector transduction of the SXTBP1 cassette in iPSC-derived glutamatergic neurons. The images show representative pictures of STXBP1 expression under control conditions (non-transduced) and after transduction of the cassette under the control of the hSyn or MECP2 promoter.

[0205] Pictures were taken using the same acquisition settings for both conditions. Comparison of the signal with non-transduced cells allowed visualization of overexpression of STXBP1 in human iPSC-derived NGN2 neurons. STXBP1 under the control of the hSyn promoter resulted in higher expression than the MECP2 promoter (summarized in Table 11).

[0206] [Table 11]

[0207] Example 6: AAV-9 transduction of STXBP1 cassette in primary mouse neurons AAV9 vectors were generated as described in Example 4. Capsid characteristics are listed in Table 12. The transgene expressed STXBP1 protein (SEQ ID NO: 9) fused to an HA tag at the N-terminus, and expression was driven by the following promoters: hSyn, MECP2, or MECP2-intron. HA-tagged protein was used to distinguish transgene expression from endogenous STXBP1 levels. AAV9 capsid carrying a CAG-eGFP-NLS cassette was used as a control vector for transduction efficiency. STXBP1 expression was investigated in vitro by transducing mouse primary cortical neurons. Non-transduced cells were used as a control for endogenous STXBP1 expression.

[0208] [Table 12]

[0209] Mouse primary cortical neurons were prepared from cortical tissue of E17 mouse embryos. Cortical tissue was dissociated using papain for 30 min at 37°C and maintained in culture in Neurobasal™ Medium supplemented with B27 supplement 2%, GlutaMAX-I 1 mM, and penicillin-streptomycin 50 units / ml. Half medium changes were performed once a week.

[0210] At division (DIV) 7, cells were transduced with different AAV9 constructs at two different MOIs (2.5E+6 GC / cell and 5.0E+5 GC / cell). The level of transduction was confirmed by including the hSyn-eGFP-NLS construct, which was high in both MOI conditions. At DIV13, cells were fixed with 2% paraformaldehyde and stained with primary rabbit polyclonal anti-STXBP1 antibody (1:250; Sigma, ref. HPA008209) and anti-HA tag stain (1:100; ref. 2367S, Cell Signaling Technology). Imaging was performed using an InCell Analyzer 6000 instrument using empirical parameters.

[0211] Figure 9: AAV9 transduction of STXBP1 in mouse primary neurons. (A) Representative images of STXBP1 staining in primary mouse cortical neurons transduced with AAV9 viral vectors at an MOI of 5.0E+5 GC / cell. Pictures show control conditions (untransduced) and STXBP1 expression under the control of the hSyn, MECP2 or MECP2-intronic promoters. (B) Comparison of HA staining (right) with STXBP1 staining (left) in the same primary mouse cortical neurons.

[0212] Using similar acquisition parameters, increased STXBP1 expression levels were confirmed for all three promoters when compared to non-transduced cells (Figure 9A), suggesting that AAV9 transduction can achieve STXBP1 expression above baseline levels. MECP2 with an intronic promoter showed the highest expression level, followed by hSyn and MECP2 (Table 13). Furthermore, colocalization of anti-HA with STXBP1 staining was observed for all viral vectors tested. Representative images are shown in Figure 9B (see arrows).

[0213] [Table 13]

[0214] To demonstrate that STXBP1 transduction is specific to neural cells, mouse primary cultures were counterstained with an antibody against the pan-neuronal marker MAP2 (1:5000; ref: ab5392; Abcam™, Cambridge, MA, USA).

[0215] Figure 10: Colocalization of STXBP1 overexpression in MAP2-positive neurons. Images are representative photographs of anti-HA tag staining (left panel) and anti-MAP2 staining (right panel) in mouse primary neurons after transduction with AAV9 viral vectors. Arrows indicate examples of cells expressing STXBP1 (HA) and a neuronal marker (MAP2).

[0216] Figure 10 shows colocalization of a neuronal marker (MAP2) with anti-HA staining in transduced mouse primary cortical neurons (see arrows). The data confirmed neuronal expression of HA-tagged STXBP1 transgene products under the control of different neuronal promoters. The intensity of the HA tag signal (Table 14) correlated with STXBP1 levels (Table 13), suggesting that promoter strength can be ranked as follows: MECP2-intron>hSyn>MECP2.

[0217] [Table 14]

[0218] Example 7: In vivo expression of STXBP1 following AAV-9 mediated transduction in mouse brain AAV9-mediated transduction of STXBP1 in mouse brain was investigated in vivo. Viral vectors were administered by bilateral intracerebroventricular (ICV) injection into the brains of postnatal day 1 (PND1) neonatal mice. Methods for ICV neonatal injections have been described previously (Bertrand-Mathon, et al. 2015; Kim, et al. 2014; Hamodi, et al. 2020). Injected animals were monitored over a 5-week period, and STXBP1 expression and distribution were analyzed by biochemical readout on brain tissue.

[0219] The experiment included five groups: control (vehicle injection), control virus (AAV9 / hSyn_eGFP), AAV9 / hSyn-HA-STXBP1, AAV9 / MECP2-HA-STXBP1, and AAV9 / MECP2-intron-HA-STXBP1. The AAV9 vectors were the same as those listed in Table 12. A summary of the in vivo experimental conditions is shown in Table 15.

[0220] [Table 15]

[0221] To assess the overall health of the mice, weight differences were monitored over the course of the study (5 weeks after injection). At the final evaluation, there was no significant difference in the weights of the different cassette groups. None of the groups showed clinical signs of toxicity. Furthermore, there were no obvious signs of morbidity or developmental delay in adult wild-type mice treated with AAV9 / hSyn-HA-STXBP1, AAV9 / MECP2-HA-STXBP1, or AAV9 / MECP2-intron-HA-STXBP1. The results of this experiment demonstrated that the viral vector cassettes exhibited long-term tolerability and low toxicity and therefore could be safely used in a preclinical setting.

[0222] Five weeks after injection, brain tissues were collected, dissected, and subjected to biochemical analysis. DNA / RNA was extracted from the left frontal cortex and hippocampus, and protein was extracted from the corresponding right frontal cortex. DNA / RNA extraction was performed using the AllPrep Mini Kit (Qiagen, 80204) according to the manufacturer's instructions, including DNAse treatment for RNA extraction. Tissues were lysed in RLT Plus buffer (supplemented with β-mercaptoethanol) using a Precellys 24 instrument (Bertin Technologies). DNA concentration was measured and adjusted to 20ng / μl for all samples. 40ng was then subjected to qPCR using primers / probes specific for the SV40 polyA signal (present in all AAV cassettes). The amount of mouse genome was analyzed using the ValidPrime® kit (tataabiocenter, A106P25). The ValidPrime® sequence is specific for a non-transcribed locus in gDNA that is present in exactly one copy per normal haploid genome. For both qPCRs, copy numbers were determined using the standard curve method. RNA concentration was measured and 500ng of RNA was subjected to RT using the kit High Capacity cDNA RT Kit + RNase Inhibitor (Applied Biosystems Cat. No. 4374966). The obtained cDNA was subjected to human STXBP1 signal qPCR and two reference genes for normalization of the obtained results. Relative expression was determined and scaled to the mean value of all groups. For protein extraction, tissues were lysed in RIPA buffer (Pierce, 89900) containing 2x concentrated protease and phosphatase inhibitor cocktail (Cell Signaling Technology, #5872) using a Precellys 24 instrument (Bertin Technologies) and cooling system. Samples were left on ice for 30 min, centrifuged and the supernatant was collected as the final protein extract. Protein concentration was determined using a BCA Protein Assay Kit (Pierce, 23227), and 7.5 μg of protein was mixed with Laemli buffer and β-mercaptoethanol and incubated at 90°C for 10 min before SDS-Page.The gels were transferred to nitrocellulose membranes and analyzed by Western blot. The membranes were incubated in blocking solution (ref: 927-50000; Li-Cor) for 1 h at 4°C and subsequently incubated with the primary antibodies mouse monoclonal anti-HA (1:2000; ref: 2367S, Cell Signaling Technology) and mouse monoclonal anti-GAPDH (1:10000; ref: G8795, Sigma). The secondary antibodies used were IRDye® 680RD Donkey anti-Mouse IgG Secondary Antibody (1:20000; ref: 926-68072, Li-Cor) and IRDye® 800CW Donkey anti-Rabbit IgG Secondary Antibody (1:20000; ref: 926-32213, Li-Cor).

[0223] Figure 11: Viral vector DNA copy analysis. qPCR data of SV40pA (polyA signal of Simian Virus 40) normalized by the number of diploid mouse genomes from the left hippocampus and left frontal cortex of 5-week-old mice after AAV treatment. Data are shown for the vehicle group and four AAV9 transduction groups (control virus, hSyn, MECP2, MECP2-intron). Results are shown as mean ± SD.

[0224] Figure 12: STXBP1 mRNA expression analysis. Data are presented as relative expression normalized to two reference genes and scaled to the average expression (mean ± SD) of all groups. Analysis was performed from left hippocampus and left frontal cortex tissues of 5-week-old mice after AAV treatment. Data are shown for the vehicle group and four AAV9-transduced groups (control virus, hSyn, MECP2, MECP2-intron).

[0225] Figure 13: Protein analysis by Western blot. (A) Western blot showing HA tag expression for various cassettes in the cortex (n=5-7 / group). GAPDH was used as a loading control. (B) Quantification of HA tag band intensity, each sample normalized to the GAPDH loading control. Results are shown as mean ± SD.

[0226] As shown in Figure 11, significant vector DNA copies per diploid mouse genome were detected in DNA extracts, demonstrating efficient AAV9 transduction between the different viral vectors in the hippocampus and cortex (N = 5–7 mice). Human STXBP1 transgene expression (mRNA) was observed for all three cassettes, with much stronger expression observed for the MECP2-intron cassette compared to hSyn and MECP2 (Figure 12). Western blot analysis of HA-tagged STXBP1 protein confirmed specific transgene product expression in vivo within the prefrontal cortex for all three cassettes tested (Figure 13A and B). Overall, the data allowed a general ranking of promoter strength among the viral vectors. MECP2-intron showed the highest HA-tagged STXBP1 expression, followed by hSyn and MECP2. This data was consistent with in vitro data in mouse primary cortical neurons, where a similar relative ranking was observed.

[0227] Example 8: In vivo distribution of STXBP1 following AAV-9-mediated transduction in mouse brain The distribution of STXBP1 expression in mouse brain after PND1 injection of AAV9 vectors was investigated by immunohistochemistry (IHC). Mouse brain tissue was collected from the same animals as described in Example 7.

[0228] Fixed frozen sections (12 μm thick; sagittal sections) were generated using a cryostat-microtome and stored at -80°C. All of the following incubation steps were performed at room temperature. Frozen sections were rinsed in PBS 1X for 10 min and then incubated with the following primary antibodies, either alone or in combination for double immunofluorescence: GFP (1:2,000; #1020, Aves), HA (hemagglutinin tag; 1:5,000; #3724, Cell Signaling), NeuN (1:2,000; ab177487, Abcam), GFAP (1:2,000; #173006, Synaptic Systems), parvalbumin (1:500; PV235, Swant), diluted in PBS containing 0.3% Triton X-100 overnight in a humidified chamber. After incubation, sections were washed three times with PBS and then incubated with the appropriate Alexa-conjugated secondary antibody (anti-mouse, anti-rabbit, anti-chicken conjugated to Alexa 488 or 647) for 1 h. They were then counterstained with DAPI (diluted at 300 nM) to label cell nuclei and washed three times with PBS. Finally, sections were mounted with Prolong Gold antifade mounting medium (Life Technologies) and coverslips were applied. Digital images of stained sections were obtained using an AxioScan Z1 slide scanner with a 20x objective (Zeiss) and analyzed using Zen 3 software (Zeiss).

[0229] To test the distribution of transduced cells in the brain expressing transgenes driven by neuronal promoters, mouse pups were injected icv with AAV9 / hSyn_eGFP at PND 1. Animals were sacrificed 1 month after virus administration and brains were dissected and processed for immunohistochemistry to label GFP.

[0230] Figure 14: Distribution of infected cells in mouse brain using GFP reporter derived from AAV9-hSyn-NLS-eGFP-NLS virus. (A) Sagittal section of mouse brain administered AAV9-hSyn1-NLS-GFP-NLS icv, sacrificed 1 month later, and immunostained to label GFP. The distribution of cells expressing GFP was observed from anterior to posterior throughout the brain. Some of the main brain regions showing GFP+ cells are highlighted by rectangles. (B-G): Higher magnification of brain regions showing GFP+ cells from A (arrows point to GFP+ cells).

[0231] Figure 15: Characterization of cells expressing the GFP reporter derived from the AAV9-hSyn-NLS-eGFP-NLS virus. Double immunofluorescence labeling was performed to detect (A-F) GFP and the neuronal marker NeuN, (G-L) GFP and the astroglial marker GFAP. Cells positive for both (A-C) GFP and (D-F) NeuN were observed within all brain regions (arrows point to double-labeled cells), indicating that neurons were transduced and expressed the reporter gene. Conversely, GFP (G-I) signal was not detected in GFAP-positive cells (J-L), suggesting that astrocytes did not express the reporter gene.

[0232] Figure 16: Distribution of HA-STXBP1 fusion proteins from various promoters in mouse brain after AAV9 administration. The distribution of HA-tagged STXBP1 overexpressed from various promoters in mouse brain was tested by immunohistochemistry for HA. As negative control conditions, no HA signal was observed in animals administered (A) PBS only or (B) AAV9-hSyn-GFP virus icv. (C) As a negative control (NC) for antibody selectivity, no HA signal was observed in animals administered AAV9-MECP2-intron-HA-STXBP1 virus but omitting the primary HA antibody during the immunohistochemistry procedure. (D-F) HA signal was observed in the brain of all animals injected with various viruses expressing HA-STXBP1 from various promoters. The three promoters resulted in a common pattern of HA distribution throughout the brain, with the main expression observed in the cerebral cortex, hippocampus, striatum, olfactory bulb, substantia nigra, and fiber tracts of the forebrain. Notable differences in HA distribution between promoters are reported in Table 16.

[0233] Figure 17: Distribution of HA-STXBP1 fusion proteins from various promoters in the hippocampus after AAV9 administration. Double immunofluorescence labeling was performed to detect (A-C) HA, and (D-F) the neuronal marker NeuN, which was used to identify different parts of the hippocampus. All three promoters resulted in HA expression throughout the hippocampus, mainly in neuronal projections (Mol, LMol or MF), and occasionally in the cell bodies. (F) The MECP2-intron promoter resulted in better coverage and higher HA signal intensity than the other two promoters (D, E). LMol: molecular layer of the plexiform (lacunosum) of the hippocampus; MF: mossy fiber; Mol: molecular layer of the dentate gyrus; Or: polymorphonuclear cell layer.

[0234] Figure 18: Characterization of cells expressing HA-STXBP1 from various promoters. Double immunofluorescence labeling was performed to detect (A-C) HA and (D-F) the neuronal marker NeuN. Cell bodies positive for HA and occasionally observed in different brain regions were also positive for NeuN, confirming that all three promoters drive transgene expression in neurons. Arrows point to double-labeled cells.

[0235] Overall, GFP+ cells were observed throughout the brain, from the olfactory bulb to the cerebellum and brainstem (Figure S14A-G). Large numbers of infected cells were prominently observed in the striatum (Figure S14D), cerebral cortex (Figure S14B), hippocampus (Figure S14C) and olfactory bulb. Double immunolabeling confirmed that GFP was exclusively expressed by neurons, as evidenced by colocalization of GFP with the neuronal marker NeuN (Figure S15A-F), and the absence of colocalization of GFP with the astroglial marker GFAP (Figure S15G-L).

[0236] We analyzed the tissue distribution of HA-tagged STXBP1 overexpressed from three different neuronal promoters, hSyn, MECP2 or MECP2-intron, by performing immunohistochemistry for HA (Figure 16). The three promoters resulted in a common pattern of HA expression throughout the brain (Figure 16D-F). The main areas where HA staining was observed were the cerebral cortex, hippocampus, striatum, olfactory bulb, substantia nigra, and fiber tracts of the forebrain. HA signals were detected within the cerebellum only in animals injected with AAV containing the MECP2-intron promoter (Figure 16F). The MECP2-intron promoter resulted in the best HA signal coverage and signal intensity throughout the brain compared to the two other promoters (Figure 16D-F). A summary of the brain distribution of HA from the three promoters is provided in Table 16. Importantly for the purpose of developing therapeutic approaches to treat epilepsy, HA expression was observed in the hippocampus and cortex, which are key areas involved in epileptogenesis and seizure generation. All promoters conferred HA expression throughout the hippocampus (Figure 17), primarily in neuronal projections (mossy fibers, molecular layer of the dentate gyrus, plexiform molecular layer and polymorphonuclear cell layer of the hippocampus). The highest HA signal intensity was observed with the MECP2-intronic promoter. The hSyn promoter conferred intermediate levels of expression, whereas the MECP2 promoter conferred the weakest signal intensity (Figure 17A-C). At the cellular level, HA expression was observed primarily in the neuropil and occasionally in cell bodies (Figure 18A-C) that colocalized with the neuronal marker NeuN (Figure 18D-F), suggesting that all three promoters drive expression within neurons.

[0237] [Table 16]

[0238] Example 9: Characterization of STXBP1 mutant expression in WT and heterozygous STXBP1 (HET) mouse brain To evaluate the expression of STXBP1 protein variants in normal and disease conditions, we generated a transgenic mouse model recapitulating human STXBP1 haploinsufficiency-mediated epilepsy and described by Kovacevic et al. (2018). This mouse model was obtained under license from the University of Amsterdam. A heterozygous model was generated using Stxbp1 floxed (Stxbp1fl / fl) mice, which carry loxP sites on both sides of exon 2 of the Stxbp1 gene. Stxbp1fl / fl were crossed with EIIa-Cre (Jax:003724) to delete Stxbp1 exon 2 in the germline, obtaining Stxbp1fl / - null mutant mice. The floxed allele is outbred to C57BL / 6J generating the Stxbp1+ / -KO HET mouse line. The deletion of exon 2 in one allele results in a premature stop codon, resulting in the expression of a truncated and non-functional STXBP1 protein. All in vivo experiments were performed in accordance with the guidelines issued by the Committee on the Ethics of Animal Experiments in accordance with Belgian law. Experiments were performed in accordance with the European Commission Directive (2010 / 63 / EU). Every effort was made to minimize animal suffering.

[0239] To evaluate the expression of endogenous STXBP1 variants, heterozygous KO (STXBP1+ / -) and wild-type (WT) littermates (STXBP1+ / +) male mice were sacrificed 5-7 weeks after birth and brain tissue was collected, dissected, and analyzed by biochemical readout. RNA was extracted from the posterior cortex (right hemisphere) and protein was extracted from the corresponding right frontal (medial) cortex for Western blot (WB) analysis and from the lateral half of the frontal cortex for liquid chromatography-mass spectrometry (LC-MS) analysis.

[0240] RNA analysis For RNA extraction, samples were transferred to Precellys tubes containing RLT Plus lysis buffer (with 10 μl / ml β-mercaptoethanol) (Precellys Lysing Kit CK14-2ml (VWR, 432-3751)). RNA was subjected to DNAse treatment. RNA extraction was performed using KingFisher Flex (ThermoFisher) using Mag-Bind Total RNA 96 Kit (Omega, M6731). RNA concentration was measured using Nanodrop and 500 ng of RNA was subjected to reverse transcription using the kit High Capacity cDNA RT Kit + RNase Inhibitor (cat. no. 4374966, ThermoFisher). The resulting cDNA was subsequently analyzed in triplicate by qPCR using commercially available and custom-made primers and probes, mouse STXBP1, and mouse and human STXBP1-long and mouse and human STXBP1-short isoforms, and two reference genes. Expression of each gene was normalized to the average of two reference genes. -ΔCt The mRNA expression levels were obtained by calculating the values.

[0241] Western blot analysis For protein extraction, tissues were lysed in RIPA buffer (Sigma R0278) containing 2x protease and phosphatase inhibitor cocktail (Cell Signaling Technology #5872) using a Precellys 24 instrument (Bertin Technologies) and cooling system. Samples were left on ice for 30 min, centrifuged, and the supernatant was collected as the final protein extract. Protein concentration was determined using BCA Protein Assay (Thermo Scientific™), and 10 μg of protein was mixed with Laemmli buffer and β-mercaptoethanol and incubated at 90 °C for 10 min before SDS-Page. Gels were transferred to nitrocellulose membranes and then subjected to standard Western blot procedures. First, the membrane was incubated in blocking solution (ref: 927-50000; Li-Cor) for 1 h at room temperature. The following primary antibodies were incubated overnight at 4 °C: goat polyclonal anti-STXBP1 (1:1000, ref. no.: PAB6504, Abnova) rabbit polyclonal anti-STXBP1 (1:1000, ref. no.: 116002, SySy), rabbit polyclonal anti-STXBP1 (1:1000, ref. no.: HPA008209, Sigma), mouse monoclonal anti-syntaxin-1A (1:2500, ref. no.: 110111, SySy), mouse monoclonal anti-β-actin (1:10000, A2228, Sigma) and rabbit monoclonal anti-β-actin (1:10000, 8457P, Cell Signaling Technology). Secondary antibodies were incubated for 1 h at RT and the following were used: IRDye® 680RD donkey anti-mouse IgG secondary antibody (1:20000; ref. 926-68072, Li-Cor), IRDye® 800CW donkey anti-rabbit IgG secondary antibody (1:20000; ref.: 926-32213, Li-Cor) and IRDye® 800CW donkey anti-goat IgG secondary antibody (1:20000; ref.: 926-32214, Li-Cor).

[0242] LC-MS analysis For LC-MS analysis, tissue samples were homogenized in 5% SDS / 50 mM TEAB / 1x protease inhibitors using a Precellys tissue homogenizer (Bertin-Instruments). Protein concentrations were then determined by BCA (Pierce, A53227) and 100 μg of each sample was reduced and alkylated. Sample cleanup and digestion were performed using trypsin / Lys-C (Promega, V5072) on a 96-well plate S-Trap according to the manufacturer's instructions (Protifi Llc, Huntington, NY). Digested samples were eluted from the plate and dried under vacuum before being resuspended for LC-MS analysis. The resuspension buffer contained 50 fmol / μl of heavy-labeled AQUA peptides (Thermo, Paisley, UK) in 0.1% aqueous formic acid. STXBP1 peptides were measured on whole lysate samples using a Waters Acquity UPLC M-Class with an IonKey source connected to a Waters Xevo TQ-XS. Peptides were captured on a Waters nanoEase M / Z Sym100 C18 column (5 μm, 300 μm×25 mm) and separated using a Waters Peptide BEH C18 iKey (150 μm×100 mm, 130 Å 1.7 μm). A 17-minute gradient was applied with mobile phase A (0.1% formic acid / 100% H2O) and mobile phase B (0.1% formic acid / 100% acetonitrile) at a flow rate of 3 μl / min. The gradient used was 1.0% B over 0-1 min, 1.0-25% B over 1-3 min, 25-40% B over 3-6 min, 40-99% B over 6-9 min, 99-1% B over 12-13 min. The column temperature was set at 50°C. A scheduled Multiple Reaction Monitoring (MRM) method was used with the following source parameters: capillary voltage - 3.8 kV, source temperature - 150°C, cone gas - 150 L / h, nebulizer gas - 5.3 bar. NanoFlow gas - 0.3 bar.For all analyses, the peptides monitored were DNALLAQLIQDK (SEQ ID NO: 43), YETSGIGEAR (SEQ ID NO: 44), ISEQTYQLSR (SEQ ID NO: 45), WEVLIGSTHILTPTK (SEQ ID NO: 46) (long isoform specific), and WEVLIGSTHILTPQK (SEQ ID NO: 47) (short isoform specific). Three transitions were monitored per peptide. Data analysis was performed in Skyline (MacLean et al., 2010). Each analysis included an 8-point standard curve and QC samples (low, medium, high, n=2). These consisted of blank pooled mouse liver homogenates spiked with purified HA-tagged STXBP1 protein prepared from recombinant expression in E. coli. Endogenous QC samples consisting of pooled mouse brain membrane homogenates (blank, and spiked with additional STXBP1) were also included. Quantification of total protein and short isoforms was performed against this standard curve. Relative quantification of isoform-specific peptides was performed against their respective internal standards.

[0243] Figure 19: Analysis of STXBP1 mutant mRNA levels in mouse brain by qPCR. mRNA analysis of brain tissue samples from the caudal cortex (right hemisphere) of WT (wild type) littermate and HET (heterozygous) mice (n=11-13 / group). (A) mRNA expression analysis of total endogenous STXBP1 (common probe recognizing any STXBP1 transcript). (B) and (C): mRNA expression analysis of STXBP1 mutants using two different probes that specifically recognize the long isoform (B) or the short protein isoform (C). Data are presented as a 2-fold increase in the mRNA expression of STXBP1 mutants. -ΔCt Values ​​are presented as mRNA expression levels by calculation, where expression was normalized to the average of two reference genes, and results are presented as mean ± SD.

[0244] Figure 20: Analysis of STXBP1 protein levels in mouse brain by Western blot. Tissue samples from the right frontal (medial) cortex of WT (wild type) littermates and HET (heterozygous) mice (n = 11–13 / group) were analyzed. (A): Western blots representing total STXBP1 protein expression. (B) Quantitative data of the respective Western blots in (A). For normalization, β-actin was used as a loading control. The "WT" group was used as a scaling group. Results are shown as mean ± SD.

[0245] Figure 21: Analysis of STXBP1 mutant protein levels in mouse brain by LC-MS. Tissue samples from the lateral half of the frontal cortex of WT (wild type) littermate and HET (heterozygous) mice (n=11-13 / group) were analyzed. (A) Quantification of total STXBP1 peptides vs. STXBP1 long vs. STXBP1 short isoforms. Results are shown as mean ± SD. (B): Western blots representing STXBP1 short and long isoforms. (C): Combined quantitative data of the respective western blots in (B). β-actin was used as a loading control. Data are shown as the ratio of band intensity of each STXBP1 isoform to the respective β-actin band. Results are shown as mean ± SD.

[0246] Figure 22: Analysis of syntaxin-1A (STX1A) protein levels in mouse brain by Western blot. Quantification of STX1A protein expression in mouse brain tissue samples (n = 11–13 / group). For normalization, β-actin was used as a loading control. The "WT" group was used as a scaling group. Results are shown as mean ± SD.

[0247] The results of RNA transcript analysis in WT and heterozygous (+ / -) KO mice (referred to as HET in the figures) are shown in Figure 19 (A-C). Endogenous mouse mRNA transcript levels of total STXBP1 are reduced in HET mice (Figure 19 (A)). We also observed that the short and long isoforms of STXBP1 are reduced (37-43%) in HET mice when compared to WT littermates (Figure 19 (B, C)). Western blot analysis of total STXBP1 confirmed a 60-70% protein reduction in HET mice when compared to WT animals (Figure 20).

[0248] Quantification of STXBP1 protein isoforms by LC-MS (Figure 21) showed that the short STXBP1 variant was most abundant in mouse brains of WT and HET animals when compared to the overall levels of the long isoform (Figure 21(A)). Quantification of STXBP1 peptides in HET animals showed that total STXBP1, the short and long variants of STXBP1 were reduced by approximately 60% when compared to WT littermates. Western blot data also confirmed the same overall reduction of the short and long isoforms of STXBP1 in HET animals when compared to WT animals (Figure 21, panels B and C).

[0249] It has been reported that STXBP1 acts as a chaperone for syntaxin-1A protein (STX1A) to ensure the transport, docking and release of synaptic vesicles (Dulubova I. et al. 2007, Saitsu H. et al. 2008). As shown in Figure 22, haploinsufficiency of STXBP1 reduces STX1A protein levels by 50-60% in HET mice when compared to WT littermates.

[0250] Overall, the data provide for the first time an extensive characterization of STXBP1 isoform expression levels in mouse brain and validation of reduced endogenous STXBP1 mutant mRNA and protein levels in a transgenic mouse model recapitulating human STXBP1 haploinsufficiency.

[0251] Example 10: AAV-mediated overexpression of STXBP1 mutants in a haploinsufficient mouse model Viral vectors were administered by bilateral intracerebroventricular (ICV) injection into the brains of postnatal day 1 (PND1) neonatal mice as described in Example 7. Methods for ICV neonatal injections have been previously described (Bertrand-Mathon, et al. 2015; Kim, et al. 2014; Hamodi, et al. 2020). Injected animals were monitored over a 7-week period and STXBP1 expression and distribution was analyzed by biochemical readout on brain tissue. The experiment included the following groups: Heterozygous KO (STXBP1+ / -) (called HET) Wild-type littermate (STXBP1+ / +) male mice (referred to as WT) HET mice injected bilaterally with one of the two viral vectors listed in Table 17

[0252] [Table 17]

[0253] One additional group of WT and HET mice was injected with vehicle-PBS to serve as a control. A summary of the in vivo experimental conditions is shown in Table 18.

[0254] Seven weeks after injection, brain tissues were collected, dissected, and subjected to biochemical analysis. DNA / RNA was extracted from the posterior cortex (right hemisphere), and protein was extracted from the corresponding right frontal (medial) cortex. Both DNA and RNA were extracted by the same lysis buffer composition, as described in Example 7. Proteinase K and RNase treatments were performed on DNA. DNA was extracted using Mag-Bind™ HDQ Blood DNA&Tissue 96 Kit (Omega, M6399). DNA concentration was measured using a Qubit™ Flex Fluorometer (ThermoFisher) with a Qubit™ dsDNA BR Assay Kit (ThermoFisher, Q32853), the same total DNA amount was adjusted for all samples, and 40ng was used for qPCR with primers / probes specific for the SV40 20 polyA signal (present in all AAV cassettes). Mouse genome amount was analyzed using the ValidPrime™ kit (tataabiocenter, A106P25). The ValidPrime® sequence is specific for a non-transcribed locus of gDNA that is present at exactly one copy per normal haploid genome. Absolute copy numbers were determined for both SV40p and ValidPrime® using the standard curve method.

[0255] The RNA extraction process and conversion to cDNA are described in Example 7. The resulting cDNA was analyzed in triplicate by qPCR using commercially available and custom primers and probes, such as SV40 polyA, human STXBP1, mouse STXBP1, mouse STX1A, mouse and human STXBP1-long isoforms, and mouse and human STXBP1-short isoforms, and two reference genes. Expression of each gene was normalized to the average of the two reference genes. -ΔCt The mRNA expression level was obtained by calculating the value. Protein extraction and Western blot analysis were performed as described in Example 7.

[0256] Figure 23: Analysis of AAV transduction efficiency in mouse brain by qPCR (7 weeks after injection). (A) Absolute quantification by qPCR of viral genome copies in WT mice injected with vehicle-PBS (WT), HET mice injected with vehicle-PBS (HET), HET mice injected with STXBP1 long mutant (HET-AAV9(L)), and HET mice injected with STXBP1 short mutant (HET-AAV9(S)). Samples were collected from the posterior cortex (right hemisphere) and quantified using SV40pA normalized to the absolute number of diploid mouse genomes. Results are shown as mean ± SD. n = 14–15 animals per group were analyzed and nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test was applied. No significant differences were observed between the transduced groups. (B) mRNA expression analysis of SV40 polyA and (C) human-specific STXBP1. The data is 2 -ΔCt Values ​​are presented as mRNA expression levels by calculating the mean, where expression was normalized to the average of two reference genes. Results are presented as mean ± SD. n = 14–15 animals per group were analyzed and nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test was applied. No significant differences were observed between transduction groups.

[0257] Figure 24: Analysis of STXBP1 mutant expression after AAV treatment in mouse brain by qPCR (7 weeks after injection). Analysis of STXBP1 mutant mRNA expression was performed using probes that specifically measure total (mouse and human) levels of the short mutant (A) or long mutant (B). Data are presented in Table 2. -ΔCt Values ​​are presented as mRNA expression levels by calculation, where expression was normalized to the average of two reference genes. Results are presented as mean ± SD. n = 14-16 animals per group were analyzed.

[0258] Figure 25: Analysis of STXBP1 mutant expression after AAV treatment in mouse brain by Western blot (7 weeks after injection). Protein analysis by Western blot of samples from the right frontal (medial) cortex in WT mice injected with vehicle-PBS (WT), HET mice injected with vehicle-PBS (HET), HET mice injected with STXBP1 long mutant (HET-AAV9(L)), and HET mice injected with STXBP1 short mutant (HET-AAV9(S)). (A) Quantification of Western blot data for total STXBP1 (long and short mutant) protein expression. (B) Quantification of Western blot data for long STXBP1 mutant protein expression. (C) Quantification of Western blot data for short STXBP1 mutant protein expression. (D) Quantification of Western blot data for syntaxin-1A protein expression. β-actin was used as a loading control for normalization of each STXBP1 and STX1A band intensity. Vehicle WT group (WT) was used as the scaling group. Results are shown as mean ± SD. Data were analyzed using nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test (* <p.0.05;**p<0.01 ***p<0.001;****p<0.0001)。

[0259] Figure 26: Brain distribution of HA-tagged STXBP1 expression after AAV treatment in mouse brain by immunohistochemistry (7 weeks after injection). HA tag staining was performed on sagittal sections from HET mice injected with HA-tagged STXBP1 long mutants and compared to vehicle (PBS) treated mice. Representative examples of brain sections from AAV treated group (animal 6023) and vehicle treated group (animal 6009) are shown. Strong HA staining is observed within key brain regions in animal 6023 (AAV treated), but no HA staining is observed in the PBS treated group (animal 6009).

[0260] As shown in Figure 23(A), significant viral genome copies per diploid mouse genome were detected in mouse brains obtained from the AAV-treated group, demonstrating efficient viral transduction with two cassettes encoding the long and short mutants of STXBP1. Both human STXBP1 transgene (Figure 23(B)) and SV40pA expression (mRNA) (Figure 23(C)) were only detected in the group transduced by the viral vector, and showed similar expression trends depending on the amount of viral DNA injected.

[0261] AAV9 transduction of HET animals resulted in robust and selective overexpression of short and long STXBP1 mutants without affecting endogenous mouse mutant expression levels (Figure 24).

[0262] Western blot analysis confirmed significant overexpression of total STXBP1 levels in both AAV-treated groups when compared to vehicle-PBS-injected HET mice, as shown in Figure 25(A). Western blot quantification using an antibody that specifically recognizes the STXBP1 long isoform showed significant and specific overexpression of the long variant only in the AAV-treated group with the STXBP1 long cassette (Figure 25(B)). Similarly, using a specific antibody against the STXBP1 short isoform, significant and specific protein overexpression was observed only in the group transduced with the STXBP1 short cassette compared to HET-PBS-injected animals (Figure 25(C)). Furthermore, AAV treatment with either the short or long variant partially rescued syntaxin-1A (STX1A) protein levels, which were significantly increased when compared to vehicle-PBS-injected HET mice, as shown in Figure 25(D). The increased levels of STX1A in the AAV-treated group further confirms the functional impact of expression of the human STXBP1 transgene product.

[0263] Overall, HET animals treated with either the short or long mutant showed efficient overexpression of the human STXBP1 transgene product, resulting in a similar rescue of STXBP1 haploinsufficiency for this mouse model.

[0264] An additional group of animals injected with a viral cassette encoding an HA-tagged fusion with the STXBP1 long mutant was used to investigate the distribution of STXBP1 transgene product expression in the mouse brain after PND1 injection of AAV9 vectors by immunohistochemistry (IHC) (described in Example 7). Fixed frozen sections (12 μm thick; sagittal sections) were generated using a cryostat-microtome and stored at -80°C. Staining procedures and detection methods were as described in Example 8.

[0265] As shown in Figure 26, AAV-mediated transgene STXBP1 protein expression was detected through HA tag labeling in sagittal sections, mainly in the striatum, hippocampus, cerebral cortex, hypothalamus, globus pallidus and septum, throughout the entire brain (animal 6023) after 7 weeks. No major HA signal was observed throughout these brain regions in HET animals administered PBS only (animal 6009). The IHC data confirm that AAV-mediated transduction of Mecp2_intron_STXBP1(long) cassette results in widespread brain expression of STXBP1 protein.

[0266] Example 11: AAV gene therapy to rescue the seizure phenotype in an STXBP1 heterozygous disease model To evaluate the efficacy of AAV vectors in normal and disease conditions, we generated a transgenic mouse model recapitulating human STXBP1 haploinsufficiency-mediated epilepsy and described by Kovacevic et al. (2018). This mouse model was obtained under license from the University of Amsterdam. A heterozygous model was generated using Stxbp1 floxed (Stxbp1fl / fl) mice, which carry loxP sites on both sides of exon 2 of the Stxbp1 gene. Stxbp1fl / fl were crossed with EIIa-Cre (Jax:003724) to delete Stxbp1 exon 2 in the germline, resulting in Stxbp1fl / - null mutant mice. The floxed allele is outbred to C57BL / 6J generating the Stxbp1+ / -KO HET mouse line. The deletion of exon 2 in one allele results in a premature stop codon, resulting in the expression of a truncated and non-functional STXBP1 protein. All in vivo experiments were performed in accordance with the guidelines issued by the Committee on the Ethics of Animal Experiments in accordance with Belgian law. Experiments were performed in accordance with the European Commission Directive (2010 / 63 / EU). Every effort was made to minimize animal suffering.

[0267] Heterozygous (HET)KO and wild-type littermate (WT) male mice were injected bilaterally into the lateral ventricles on postnatal day 1 with one of two viral vectors (see Table 17) encoding either the long or short STXBP1 mutants. Experimental conditions are summarized in Table 18. One additional group of mice from each genotype was injected with vehicle-PBS to serve as a control. To assess the overall health of the mice, clinical signs were monitored weekly for 3 weeks post-injection and daily for 3-7 weeks post-injection. Limited mortality was observed across groups related to methodological procedures and aggressive behavior, but not related to treatment or genotype.

[0268] [Table 18]

[0269] Six weeks after injection, in vivo wireless EEG (electroencephalogram) video telemetry recordings were performed for one week to evaluate the occurrence of seizures. Five weeks after injection, STXBP1+ / - mice were surgically implanted with subcutaneous telemetry transmitters and cortical EEG electrodes. Surgery was performed under sterile / aseptic conditions. Anesthetized mice (isoflurane during oxygen induction: 5% at 2 l / min, maintained at 2.5–1.5% at 1.5 l / min) were placed in a stereotaxic frame with a heating pad, and holes were drilled on the skull surface of the prefrontal cortex (above the bregma suture) for the recording electrodes and on the skull surface of the cerebellum (behind the anatomical suture) for the reference electrodes. An Open Source Instruments (OSI) A3028S2 ECoG transmitter was then implanted subcutaneously on the dorsal side, the attached wires were extended subcutaneously to the skull, and the recording and reference electrodes were placed through each hole approximately 0.5 mm into the brain parenchyma. Each electrode was fixed in place by a screw (Plastics One). The entire assembly was held in place with cyanoacrylate and dental cement to form a small circular headpiece, and the dorsal side was closed by nylon absorbable suture material. Postoperative medication and pain management included a second dose of carprofen (10 mg / kg) 24 hours after the preoperative dose. After surgery, mice were allowed to recover in a warming chamber for 2–3 hours. For in vivo wireless EEG video telemetry recordings, mice were group-housed (2–3 mice / cage). To facilitate recordings, mouse cages were placed in a Faraday enclosure. Welfare monitoring of the implanted mice was performed once a day for 2 weeks. Mice were weighed daily for 4 consecutive days and then once a week. All recordings were performed in a purposefully designed recording chamber with temperature and humidity control to reduce ambient interference and improve reception of the transmitted signal. Signals were wirelessly transmitted from the implanted transmitter to an antenna placed inside the Faraday enclosure. EEG signals from one recording channel were digitized at 256 Hz (band-pass filter: 0.3–80 Hz). Spike-and-wave discharges (SWD), typical of absence seizures, were analyzed using in-house automated seizure detection software. The SWD detection algorithm was based on event duration analysis (>2 s), band frequency analysis (5–9 Hz), and identification of specific fundamental harmonic frequencies.Each SWD detected by the algorithm was confirmed in a blinded fashion by at least one experienced observer. As a result, EEG analysis was performed during this period for the different cassette vector and vehicle groups. In the vector-treated groups, a total of four animals were excluded from the analysis due to the occurrence of technical artifacts in the EEG signal: (AAV9-MECP2+intron-hSTXBP1(long mutant) (2 out of 17 animals), and (AAV9-MECP2+intron-hSTXBP1(short mutant) (2 out of 18 animals).

[0270] Figure 27: Analysis of spike-wave discharges (SWDs) after AAV treatment in STXBP1 HET mouse brain by EEG 6-7 weeks after injection (A,B) and 24 weeks after injection (C,D). (A) Average number of SWDs in WT mice injected with vehicle-PBS (WT, n=10), HET mice injected with vehicle-PBS (HET, n=19), HET mice injected with STXBP1 long mutant (HET-AAV9(L), n=15), and HET mice injected with STXBP1 short mutant (HET-AAV9(S), n=16). SWDs were analyzed for 7 consecutive days over 24 hours 6-7 weeks after injection. (B) Analysis of the number of "seizure-free" animals (no SWDs were detected during recording) and "seizure-present" animals (SWDs were detected during recording). (C) Mean number of SWDs in WT mice injected with vehicle-PBS (WT, n=5), HET mice injected with vehicle-PBS (HET, n=12), HET mice injected with STXBP1 long mutant (HET-AAV9(L), n=9), and HET mice injected with STXBP1 short mutant (HET-AAV9(S), n=11). SWDs were analyzed for 24 h over 7 consecutive days 24 weeks after injection. (D) Analysis of the number of "seizure-free" animals (no SWDs detected during recording) and "seizure-bearing" animals (SWDs detected during recording) 24 weeks after injection. Differences between groups were analyzed by nonparametric one-way ANOVA (Kruskal-Wallis test) followed by Dunn's post hoc multiple comparison test (****p<0.0001), (***p<0.001), and chi-squared contingency test was used for seizure-free analysis.

[0271] As shown in Figure 27(A), the average number of SWDs per day recorded over 24 hours for 7 consecutive days was significantly reduced by 70% and 65% in HET mice treated with either the long variant (HET-AAV9(L)) and the short variant (HET-AAV9(S)) compared to the vehicle group. HET mice treated with the long variant showed 26% seizure-free animals (Figure 27(B), significant difference compared to the short variant). Detailed EEG analysis did not detect the occurrence of convulsive seizures in treated animals during recording (24 / 7 for 1 week).

[0272] Between-group differences regarding SWD frequency were analyzed by nonparametric one-way ANOVA followed by post-hoc multiple comparison tests (****p<0.0001), and chi-squared contingency tests were used for seizure-free analyses.

[0273] In addition, biochemical and histopathological analyses were performed on brain and organ tissues of injected animals using various groups. For transgene expression evaluation, mice were sacrificed 7 weeks after injection according to the same method described in Example 7. The posterior cortex was collected and subjected to DNA / RNA extraction, and the corresponding hemimedial frontal cortex was used for protein extraction using the same method described in Example 7.

[0274] To measure the durability of the effect of SXTBP1 gene therapy treatment using the same experimental design, a 6-month long-term study was performed on a separate group of animals. 24 weeks after injection, in vivo wireless EEG (electroencephalogram) video telemetry recordings were performed for 1 week to evaluate the occurrence of seizures. As shown in Figure 27(C), the average number of SWDs per day recorded over 24 hours for 7 consecutive days was significantly reduced by 95% and 92% in HET mice treated with either the long variant (HET-AAV9(L)) or the short variant (HET-AAV9(S)), respectively, compared to the vehicle group. HET mice treated with the long variant or the short variant showed 78% and 64% seizure-free animals, respectively (Figure 27(D)). Detailed EEG analysis did not detect the occurrence of convulsive seizures in treated animals during recording (1 week 24 / 7).

[0275] Example 12: AAV gene therapy to rescue behavioral phenotypes in STXBP1 heterozygous disease models To evaluate the efficacy of AAV-mediated gene therapy against different behavioral disease phenotypes in heterozygous STXBP1 KO (HET) male mice and their sex- and age-matched wild-type (WT) littermates, viral vectors encoding human STXBP1 long or short mutants (see Table 17) under the control of the Mecp2_intron promoter were injected bilaterally into the lateral ventricles. These animal groups were separate from those used in Example 11.

[0276] Treated animals were subjected to a battery of behavioral tests from 4 to 22 weeks of age. One additional group of mice from each genotype was injected with vehicle-PBS to serve as a control. All behavioral experiments were performed in accordance with the guidelines issued by the Committee on the Ethics of Animal Experiments in accordance with Belgian law. Experiments were performed in accordance with the European Commission Directive (2010 / 63 / EU). All efforts were made to minimize animal suffering.

[0277] Figure 28: Analysis of body weight after AAV treatment in STXBP1 HET mice (1 - 22 weeks after injection) (A) Mean body weight as a function of age in WT (n = 17) and HET mice (n = 16) injected with vehicle - PBS. Inter - group differences were analyzed by two - way repeated - measures ANOVA followed by uncorrected Fisher's LSD post - hoc multiple - comparison test (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). (B) Mean body weight measured at 22 weeks of age in WT mice injected with vehicle - PBS (WT, n = 17), HET mice injected with vehicle - PBS (HET, n = 16), HET mice injected with the STXBP1 long variant (HET - AAV9(L), n = 10), and HET mice injected with the STXBP1 short variant (HET - AAV9(S), n = 13). Inter - group differences were analyzed by parametric one - way ANOVA followed by uncorrected Fisher's LSD post - hoc multiple - comparison test (**p < 0.01; ****p < 0.0001; ns, not significant). Bar graphs are mean ± SEM.

[0278] Figure 29: Analysis of hindlimb clasping after AAV treatment in STXBP1 HET mice (4 - 22 weeks after injection) (A) Mean hindlimb clasping scores as a function of age in wild-type mice injected with vehicle - PBS (WT, n = 17), heterozygous mice injected with vehicle - PBS (HET, n = 16), heterozygous mice injected with the STXBP1 long variant (HET - AAV9(L), n = 10), and heterozygous mice injected with the STXBP1 short variant (HET - AAV9(S), n = 13). (B) Mean hindlimb clasping scores recorded at 22 weeks of age in wild-type mice injected with vehicle - PBS (n = 17), and heterozygous mice injected with vehicle - PBS (n = 16), AAV9 / MECP2 - int - STXBP1 - L (n = 10), and AAV9 / MECP2 - int - STXBP1 - S (n = 13). Differences between groups were analyzed by non - parametric one - way ANOVA (Kruskal - Wallis test), followed by uncorrected Dunn's post - hoc multiple comparison test (*p < 0.05; **p < 0.01; ****p < 0.0001; ns, not significant). Bar graphs are mean ± SEM.

[0279] Figure 30: Analysis of STXBP1 HET mice in the wire - hanging test after AAV treatment (8 weeks after injection). Time to fall measured in the four - limb wire - hanging test at 8 weeks of age in wild - type mice injected with vehicle - PBS (WT, n = 17), heterozygous mice injected with vehicle - PBS (HET, n = 16), heterozygous mice injected with the STXBP1 long variant (HET - AAV9(L), n = 10), and heterozygous mice injected with the STXBP1 short variant (HET - AAV9(S), n = 13). Differences between groups were analyzed by parametric one - way ANOVA, followed by uncorrected Fisher's LSD post - hoc multiple comparison test (****p < 0.0001; ns, not significant). Bar graphs are mean ± SEM.

[0280] Figure 31: Analysis of STXBP1 HET mice in the fear conditioning test after AAV treatment (10 weeks after injection) (A) Contextual fear memory test performed at 10 weeks of age, 24 hours after the fear conditioning training phase, in wild-type mice injected with vehicle-PBS (WT, n = 17), as well as in HET mice injected with vehicle-PBS (HET, n = 16), HET mice injected with the STXBP1 long variant (HET-AAV9(L), n = 10), and HET mice injected with the STXBP1 short variant (HET-AAV9(S), n = 13). Analysis of differences between groups by parametric one-way ANOVA followed by uncorrected Fisher's LSD post hoc multiple comparison test (*p < 0.05; ****p < 0.0001). (B) Average freezing behavior during the cued fear memory test performed on the same animals as in (A), 1 hour after the contextual fear memory test. Analysis of differences between groups by parametric one-way ANOVA followed by uncorrected Fisher's LSD post hoc multiple comparison test (*p < 0.05; ***p < 0.001; ****p < 0.0001). Bar graphs represent mean ± SEM.

[0281] Body weight The body weight of the animals was tracked once a week from 1 to 22 weeks after injection. As shown in Figure 28(A), HET mice injected with vehicle-PBS showed a consistent and significant weight loss up to 1 - 22 weeks of age compared to their WT littermates injected with vehicle-PBS. This weight deficit could be rescued by AAV treatment with the STXBP1 long variant (HET-AAV9(L)), which showed a significant difference from the HET vehicle-PBS group at week 22 (Figure 28(B)). The STXBP1 short variant group showed a tendency towards weight gain at 22 weeks of age.

[0282] Hindlimb embrace Hindlimb hugging (Guyenet et al., 2010) was recorded once a week from 4 to 10 weeks of age, and once every 3 weeks from 10 to 22 weeks of age. Mice were suspended by the tail and the position of the hindlimbs was observed for 10 s. A score of 0 was assigned if the hindlimbs were constantly spread outward away from the abdomen. A score of 1 was assigned if one hindlimb was retracted towards the abdomen for more than 50% of the time suspended. A score of 2 was assigned if both hindlimbs were partially retracted towards the abdomen for more than 50% of the time suspended. A score of 3 was assigned if both hindlimbs were fully retracted and touching the abdomen for more than 50% of the time suspended. Each mouse was observed three times, and the mean score values ​​were used for statistical analysis.

[0283] Figure 29(A) shows the progression of hindlimb hugging scores in the four animal groups from 4 to 22 weeks. When compared to control WT littermates (WT-veh), vehicle-treated HET mice (HET-veh) started to show hindlimb hugging at 5 weeks of age, which stabilized at 7 weeks of age, indicating the onset of dystonia in the STXBP1 haploinsufficiency model. AAV treatment with either the long or short STXBP1 mutant on HET mice attenuated the progression of hindlimb hugging compared to the HET vehicle group over a period of 5 to 22 weeks. At 22 weeks of age, the degree of hindlimb hugging recorded in HET mice treated with the STXBP1 long mutant was similar to the WT control group (not significant, ns), indicating rescue of the dystonia phenotype (Figure 29(B)). The STXBP1 short mutant significantly reduced the hindlimb hugging severity score in 22-week-old HET mice, but did not restore the dystonia phenotype to WT levels (Figure 29(B)).

[0284] Wire hanging test Eight weeks after AAV treatment, mice were subjected to a four-limb wire hanging test (Klein et al., 2012) to assess muscle strength. Mice were placed on a wire mesh, which was then inverted and gently swung to allow the mouse to grasp the wire. The latency to fall was recorded, with a cutoff time of 90 seconds. As shown in FIG. 30, HET mice injected with vehicle-PBS showed a significant increase in latency to fall at 8 weeks of age when compared to WT littermates treated with vehicle-PBS. The increase in latency to fall was abolished in HET mice treated with AAV encoding either the long or short human STXBP1 mutant, suggesting a complete rescue of the phenotype in the haploinsufficiency model (FIG. 30).

[0285] Fear conditioning test Ten weeks after AVV treatment, associative learning and memory were assessed using a Pavlovian fear conditioning paradigm (Curzon et al., 2009). In associative learning and memory, mice learn to associate a particular environment (i.e., context) and sound (i.e., cue) with an electric foot shock. Fear memory is manifested by the freezing of the mouse, after which the mouse is exposed to this particular context or cue without the electric shock. Fear conditioning tests were performed in a chamber (Ugo Basile) with a grid floor to deliver the electric shock. Mice were monitored using a camera above the chamber. During the 6-min training phase, mice were placed in the chamber (114-116 lux light intensity, one grey wall, grid floor visible) for a 2-min acclimation period to assess baseline freezing, then the sound (78-80 dB, 4 kHz) was turned on for 30 s and immediately delivered a mild foot shock (2 s, 0.5 mA). The same sound-footshock association was repeated two more times with an interval time of 1 min after the first one. After the training phase, the mice were returned to their home cage. After 24 h, the mice were tested for contextual fear memory. To do so, they were placed in the same training chamber and their freezing behavior was monitored for 5 min without sound or footshock stimuli. They were then returned to their home cage. After 1 h, the mice were transferred to a chamber modified by three checkered walls (no visible metal grid, white ground floor) and 14-16 lux light intensity to create a new context for cued fear memory testing. To measure baseline freezing, after a 2 min acclimation period in the chamber, the same sound cue used in the training phase was turned on four times for 30 s, but without footshock, and freezing behavior was monitored during a 7.5 min test period. Freezing times were determined using an automated video-based system using Ethovision software (Noldus).

[0286] Figure 31 shows the results of the contextual test (Figure 31(A)) and the cue test (Figure 31(B)) for the four animal groups. STXBP1 HET mice treated with vehicle-PBS showed a significant decrease in context- and cue-induced freezing behavior when compared to WT littermates, indicating impaired associative learning and memory in the STXBP1 haploinsufficiency model (Figure 31(A,B)). AAV treatment with long and short STXBP1 mutants resulted in an increase in freezing behavior in the contextual and cue tests (Figure 31(A,B)). The effect of long mutant treatment was significantly different from the HET vehicle treatment group, indicating rescue of context- and cue-induced freezing behavior. Short STXBP1 mutant treatment resulted in a significant increase in the cue test (Figure 31(B)) and showed a trend to increase freezing in the contextual test when compared to HET vehicle-treated animals (Figure 31(A)). Overall, AAV treatment with STXBP1 mutants had the potential to rescue the observed impairments in associative learning and memory in an STXBP1 haploinsufficient mouse model.

[0287] Table 19: Summary of behavioral disease symptoms in STXBP1 haploinsufficient mouse models Observations in HET STXBP1 mice were categorized as decreased (↓) or increased (↑) compared to WT littermates. Effects of AAV treatment, including either long or short mutant overexpression of STXBP1, were labeled as "recovery" (statistically significant change relative to HET vehicle-treated mice) or "trend" (observed but not statistically significant change). [Table 19]

[0288] References JPEG2024543001000044.jpg144153 JPEG2024543001000045.jpg225153 JPEG2024543001000046.jpg175153

Claims

1. i. Syntaxin binding protein 1 (STXBP1) comprising isoforms a, b, c, d, e, f, g, or h, having the sequence set forth in SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, respectively; or ii. a sequence having at least 95% sequence identity to SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, or 16, which retains neurotransmitter releasing function as STXBP1, or iii. Naturally occurring variants identified in Table 7 A nucleic acid construct comprising a transgene encoding The nucleic acid construct further comprises a promoter operably linked to the introduced gene, wherein the promoter comprises the MECP2 promoter of SEQ ID NO: 3 operably linked in the 5' to 3' direction to the MECP2 intron of SEQ ID NO:

37.

2. The transgene is i. STXBP1 transcript variants 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 having the sequences set forth in SEQ ID NOs: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33, respectively; or ii. a sequence having at least 95%, or 96%, or 97%, or 98%, or 99%, or 99.5% sequence identity to SEQ ID NO: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33; The nucleic acid construct of claim 1 , encoding

3. The nucleic acid construct of claim 1, wherein the transgene encodes STXBP1 isoform a and comprises the cDNA sequence of SEQ ID NO: 7 or a sequence having at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:

7.

4. The nucleic acid construct of claim 1, comprising the SV40 polyadenylation signal sequence of SEQ ID NO:

8.

5. 5. A viral vector comprising the nucleic acid construct of any one of claims 1 to 4, wherein the viral vector further comprises inverted terminal repeats (ITRs) on the 5' and / or 3' flanks of the nucleic acid construct, and the viral vector is an AAV viral vector or a lentiviral viral vector.

6. The viral vector of claim 5 , wherein the 5′ ITR and / or the 3′ ITR comprises an ITR of a naturally occurring adeno-associated virus (AAV).

7. The viral vector of claim 5 , wherein the 3′ ITR comprises SEQ ID NO: 18 and / or the 5′ ITR comprises SEQ ID NO:

19.

8. A viral particle comprising the nucleic acid construct according to any one of claims 1 to 4 or the viral vector according to any one of claims 5 to 7.

9. 9. The viral particle of claim 8, comprising a VP1 capsid protein from an AAV selected from the group consisting of AAV2, AAV5, AAV6, AAV8, AAV9, AAV10, AAVtt, or a combination thereof.

10. 10. The viral particle of claim 9, wherein the capsid protein is derived from AAVtt or AAV9 and comprises SEQ ID NO: 20 or 21, respectively, or a sequence having at least 98.5%, 99%, or 99.5% sequence identity to SEQ ID NO: 20 or 21.

11. A pharmaceutical composition comprising a nucleic acid construct described in any one of claims 1 to 4, a viral vector described in any one of claims 5 to 7, or a viral particle described in any one of claims 8 to 10, in combination with a pharmaceutically acceptable excipient, diluent or carrier.

12. A pharmaceutical composition according to claim 11, a nucleic acid construct according to any one of claims 1 to 4, a viral vector according to any one of claims 5 to 7, or a viral particle according to any one of claims 8 to 10 for use in therapy.

13. The pharmaceutical composition, nucleic acid construct, viral vector, or viral particle of claim 12 for use in the treatment and / or prevention of an STXBP1 genetic disorder, wherein the STXBP1 genetic disorder is Dravet syndrome, Lennox-Gastaut syndrome, infantile spasms, myoclonic epilepsy, epileptic encephalopathy, early myoclonic encephalopathy, non-syndromic epilepsy, Ohtahara syndrome, early-onset epileptic encephalopathy, West syndrome, developmental delay, autism spectrum disorder, ataxia-tremor delayed syndrome, Rett syndrome, or intellectual disability without epilepsy.

14. A pharmaceutical composition, nucleic acid construct, viral vector, or viral particle described in claim 12 or 13 in the treatment of Ohtahara syndrome, West syndrome, or Dravet syndrome.

15. Use of a viral particle according to any one of claims 8 to 10 in the manufacture of a medicament for the treatment and / or prevention of a disease characterized by loss of STXBP1 functional activity.

16. The use described in claim 15, wherein the disease is associated with at least one mutation in the patient that results in a pathological STXBP1 mutant, and the pathological STXBP1 mutant comprises a mutation or combination of mutations shown in Table 5 and / or Table 6 with reference to SEQ ID NO: 9.