Treatment of neurological disorders using modulators of UNC13A gene transcripts

Abstract

Disclosed herein is the UNC13A oligonucleotide with one or more spacers or without spacers.In various embodiments, the UNC13A oligonucleotide with spacer(s) reduces the mis-spliced ​​UNC13A transcript and increases the full-length UNC13A transcript, thereby providing therapeutic efficacy against neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD) or Alzheimer's disease (AD).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 285,786, filed December 3, 2021, U.S. Provisional Patent Application No. 63 / 350,206, filed June 8, 2022, and U.S. Provisional Patent Application No. 63 / 398,987, filed August 18, 2022, each of which is incorporated by reference in its entirety for all purposes.

[0002] This application relates generally to methods of treating neurological disorders with UNC13A splice switching antisense oligonucleotides, particularly UNC13A antisense oligonucleotides having one or more spacers that target UNC13A transcripts. [Background technology]

[0003] Motor neuron disease is a class of neurological disease that causes the degeneration and death of motor neuron function, which is the neuron that coordinates the voluntary movement of muscles by the brain.Motor neuron disease can be sporadic or familial, and can affect upper motor neurons and / or lower motor neurons.Motor neuron disease includes amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.

[0004] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases that affect approximately 15,000 people in the United States. ALS is characterized by the degeneration and death of upper and lower motor neurons, resulting in the loss of voluntary muscle control. The death of motor neurons is accompanied by muscle fasciculations and atrophy. Early symptoms of ALS include cramps, muscle spasticity, muscle weakness (e.g., affecting the arms, legs, neck, or diaphragm), slurred and nasal speech, and difficulty chewing or swallowing. Loss of strength and control over movement, including movements necessary for speech, feeding, and breathing, eventually occurs. Disease progression may be accompanied by weight loss, malnutrition, anxiety, depression, increased risk of pneumonia, cramps, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die from respiratory failure within five years of the first onset of symptoms. Currently, there is no effective treatment for ALS.

[0005] ALS occurs in individuals of all ages, but is most common in individuals between the ages of 55 and 75, with a slightly higher incidence in men. ALS may be characterized as sporadic or familial. Sporadic ALS appears to occur randomly and accounts for greater than 90% of all incidences of ALS. Familial ALS accounts for 5-10% of all incidences of ALS.

[0006] FTD refers to a progressive neurodegenerative disease spectrum caused by loss of neurons in the frontal and temporal lobes of the brain. FTD is the third most common form of dementia (after Alzheimer's disease and Lewy body dementia) and the second most common form of dementia in individuals under age 65. FTD is estimated to affect 50,000-60,000 people in the United States. FTD is characterized by behavioral and personality changes, as well as language dysfunction. Forms of FTD include behavioral FTD (bvFTD), semantic primary progressive aphasia (svPPA), and non-fluent progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD along with symptoms of ALS, such as muscle weakness, atrophy, fasciculations, spasticity, speech impairment (dysarthria), and inability to swallow (dysphagia). Individuals usually die from FTD within 5-10 years, although ALS with FTD often results in death within 2-3 years of the first onset of symptoms.

[0007] As with ALS, there is no known cure for FTD, or ALS with FTD, and no treatments are known to prevent or slow the progression of either disease.

[0008] Thus, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), neurological injury (e.g., brachial plexus injury), neuropathies (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body variants associated with Alzheimer's disease, There is an urgent need to identify compounds and / or compositions that can prevent, ameliorate, and treat neurological disorders such as dementia, Parkinson's disease with or without dementia, and synaptic disorders such as limbic-predominant age-related TDP-43 encephalopathy (LATE), epilepsy, brain aging-related TDP-43 with sclerosis (CARTS), facial onset sensorimotor neuropathy, Guam Parkinson-Dementia Complex, multisystem proteinopathy, CTE, and autism. Summary of the Invention

[0009] Described herein is an oligonucleotide that comprises one or more spacers and comprises a sequence that is at least 85% complementary to the equal length portion of UNC13A transcript.In one aspect, the present disclosure provides an UNC13A oligonucleotide that targets UNC13A transcript (e.g., mis-spliced ​​UNC13A transcript).In various embodiments, the oligonucleotide targets the transcript for treating neurological disease, including motor neuron disease and / or neuropathy.For example, UNC13A oligonucleotide can be used to treat PD, ALS, FTD, ALS with FTD, and AD.

[0010] In one aspect, the disclosure provides compounds comprising modified oligonucleotides comprising any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, an equal length portion of the sequence having 90% identity thereto, or a sequence that is at least 85% complementary to a 15-50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are non-natural linkages. In various embodiments, the oligonucleotide comprises a spacer.

[0011] In one aspect, the disclosure provides a compound comprising a modified oligonucleotide comprising any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, an equal length portion of the sequence having 90% identity thereto, or a sequence that is at least 85% complementary to a 15-50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, and the oligonucleotide further comprises a spacer. In various embodiments, the oligonucleotide comprises a segment having up to 11 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment having up to 10, 9, or 8 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment having up to 7 linked nucleosides. In certain embodiments, the oligonucleotide comprises a segment having up to 6, 5, 4, 3, or 2 linked nucleosides. In certain embodiments, every segment of the oligonucleotide comprises up to 7 linked nucleosides.

[0012] In various embodiments, the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that shares 95% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0013] In various embodiments, the oligonucleotide comprises a segment having up to 11 linked nucleosides or up to 7 linked nucleosides, the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In various embodiments, the oligonucleotide comprises a segment having up to 6, 5, 4, 3, or 2 linked nucleosides, the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In various embodiments, the oligonucleotide comprises a segment having up to 6, 5, 4, 3, or 2 linked nucleosides, the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208.

[0014] In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the spacer is a nucleoside replacement group that includes a non-sugar substituent that is not capable of linking to a nucleotide base.

[0015] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and the second spacer is located at position 16 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, and the third spacer is located between positions 21 and 24 of the oligonucleotide.

[0016] In various embodiments, the spacer is located between position 2 and position 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer located between position 8 and position 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer located between position 18 and position 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, and the three spacers are located at positions of the oligonucleotide such that each segment of the oligonucleotide has a maximum of 7 linked nucleosides. In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of at least two of the three spacers is immediately before a guanine nucleobase.

[0017] In various embodiments, each of the first, second, or third spacers is a nucleoside replacement group that includes a non-sugar substituent, where the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

[0018] In certain embodiments, each of the first, second, or third spacers has formula (X):

[0019] [ka] wherein Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl group or a 4-8 membered monocyclic heterocyclyl group, the heterocyclyl group containing 1 or 2 heteroatoms selected from O, S, and N, with the proviso that A is not capable of forming a covalent bond with a nucleobase; and

[0020] [ka] The symbols represent the points of attachment to the internucleoside linkages.

[0021] In various embodiments, each of the first, second, or third spacers independently has the formula (Xa):

[0022] [ka] It is represented by:

[0023] In some embodiments, Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl group selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, and azepanyl.

[0024] In a further embodiment, Ring A is tetrahydrofuranyl.

[0025] In other embodiments, ring A is tetrahydropyranyl.

[0026] In various embodiments, each of the first, second, or third spacers independently has Formula I:

[0027] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0028] In various embodiments, each of the first, second, or third spacers independently has the formula I':

[0029] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0030] In various embodiments, each of the first, second, or third spacers independently has the formula (Ia):

[0031] [ka] wherein n is 0, 1, 2, or 3.

[0032] In various embodiments, each of the first, second, or third spacers independently has the formula (Ia'):

[0033] [ka] wherein n is 0, 1, 2, or 3.

[0034] In certain embodiments, each of the first, second, or third spacers has Formula II:

[0035] [ka] wherein X is selected from -CH2- and -O-.

[0036] In further embodiments, each of the first, second, or third spacers independently has formula II':

[0037] [ka] wherein X is selected from -CH2- and -O-.

[0038] In various embodiments, each of the first, second, or third spacers independently has the formula (Iia):

[0039] [ka] It is represented by:

[0040] In a further embodiment, each of the first, second, or third spacers independently has the formula (Iia'):

[0041] [ka] It is represented by:

[0042] In some embodiments, the spacer has formula (IIi):

[0043] [ka] wherein X is selected from -CH2- and -O-.

[0044] In some embodiments, the spacer has formula (IIi'):

[0045] [ka] wherein X is selected from -CH2- and -O.

[0046] In some embodiments, the spacer has formula (IIib):

[0047] [ka] It is represented by:

[0048] In some embodiments, the spacer has formula (Iiib'):

[0049] [ka] It is represented by:

[0050] In various embodiments, each of the first, second, or third spacers independently has formula III:

[0051] [ka] wherein X is selected from -CH2- and -O-.

[0052] In further embodiments, each of the first, second, or third spacers independently has formula III':

[0053] [ka] wherein X is selected from -CH2- and -O-.

[0054] In some embodiments, each of the first, second, or third spacers independently has the formula (IIIa):

[0055] [ka] It is represented by:

[0056] In a further embodiment, each of the first, second, or third spacers independently has the formula (IIIa'):

[0057] [ka] It is represented by:

[0058] In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 10%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 20%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 25%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 30%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 40%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 50%.

[0059] In various embodiments, the oligonucleotides are between 12 and 40 oligonucleotide units in length.

[0060] In various embodiments, at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of phosphodiester linkage, phosphorothioate linkage, alkylphosphate linkage, phosphorodithioate linkage, phosphotriester linkage, alkylphosphonate linkage, 3-methoxypropylphosphonate linkage, methylphosphonate linkage, aminoalkylphosphotriester linkage, alkylenephosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphoroamidothioate linkage, thiophosphorodiamidate linkage, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkage, aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

[0061] In various embodiments, one or more nucleoside linkages linking the bases at positions 3 or 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one nucleoside linkage linking the bases at positions 3 or 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, the nucleoside linkages linking both the bases at positions 3 and 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, the base immediately preceding the spacer in the oligonucleotide is further linked to the previous base through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, and the base immediately preceding the second spacer is linked to the previous base through a phosphodiester bond.

[0062] In various embodiments, one or more bases immediately following the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, only the base immediately following the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, two bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one or more bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond, and one or more bases immediately following the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one base immediately preceding the spacer and one base immediately following the spacer are linked through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, one or more bases immediately preceding the second spacer in the oligonucleotide are linked through a phosphodiester bond, and one or more bases immediately following the second spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one base immediately preceding the second spacer and one base immediately following the second spacer are linked through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a range of bases linked through phosphodiester bonds, the range of bases comprising at least two bases. In various embodiments, the oligonucleotide comprises a range of bases linked through phosphodiester bonds, the range of bases comprising at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, the range of bases being disposed between at least two spacers.

[0063] Additionally, disclosed herein are compounds comprising oligonucleotides comprising a nucleic acid base sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. Additionally, disclosed herein are oligonucleotides comprising a nucleic acid base sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the nucleobase sequence shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the nucleobase sequence shares at least 100% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the oligonucleotide is any one of a 19-mer, a 21-mer, a 23-mer, or a 25-mer.

[0064] In various embodiments, the internucleoside linkage of the oligonucleotide is a modified internucleoside linkage. In various embodiments, the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. In various embodiments, the phosphorothioate linkage is either an Rp configuration or an Sp configuration. In various embodiments, the oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is one of a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl) (MOE), a 2'-deoxy-2'-fluoronucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid (tcDNA) (e.g., a tricyclic nucleic acid having an ethyl (2'O-CH2-CH2-4'C) as a bridge, or a tricyclic nucleic acid having a methyl substituted methyl (2'O-CH(CH2)-4'C) bridge), a constrained ethyl 2'-4'-bridged nucleic acid (cEt), an S-cEt, a tcDNA, a hexitol nucleic acid (HNA), a tricyclic analog (e.g., a tcDNA), and an unlocked nucleic acid.

[0065] In various embodiments, the oligonucleotides show at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase in full-length UNC13A protein. In various embodiments, the oligonucleotides show at least 100% increase in full-length UNC13A protein. In various embodiments, the oligonucleotides show at least 200% increase in full-length UNC13A protein. In various embodiments, the oligonucleotides show at least 300% increase in full-length UNC13A protein. In various embodiments, the oligonucleotides show at least 400% increase in full-length UNC13A protein. In various embodiments, the increase in full-length UNC13A protein is measured relative to the reduction in full-length UNC13A protein levels achieved using TDP43 antisense oligonucleotides. In various embodiments, the oligonucleotides show at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length UNC13A protein. In various embodiments, the oligonucleotides exhibit at least a 50%, 60%, 70%, 80%, or 90% reduction in mis-spliced ​​UNC13A transcripts.

[0066] Additionally, a method of treating a neurological disease and / or disorder in a patient in need thereof is disclosed comprising administering to the patient an oligonucleotide of any of the above-described oligonucleotides. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, dementia with Lewy bodies associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial onset sensorimotor neuropathy, Guam Parkinson-Dementia Complex, multisystem proteinopathy, CTE, and synaptic diseases such as autism. In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neurological disorder is chemotherapy-induced neuropathy.

[0067] In addition, disclosed herein is a method for restoring neuronal axonal growth and / or regeneration, comprising exposing motor neurons to any of the oligonucleotides disclosed above.In addition, disclosed herein is a method for increasing, promoting, stabilizing or maintaining the expression and / or function of UNC13A in neurons, comprising exposing cells to any of the oligonucleotides disclosed above.

[0068] In various embodiments, the neuron is a neuron of a patient in need of treatment for a neurological disease and / or neurological disorder. In various embodiments, the neurological disorder is chemotherapy-induced neuropathy. In various embodiments, the exposing is performed in vivo or ex vivo. In various embodiments, the exposing comprises administering an oligonucleotide to a patient in need thereof. In various embodiments, the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamic, intracisternally, orally, rectally, bucally, sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, or intraduodenal. In various embodiments, the oligonucleotide is administered orally. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamic, or intracisternally. In various embodiments, the patient is a human.

[0069] In addition, this specification discloses pharmaceutical compositions comprising any one of the oligonucleotides disclosed above, or its pharmaceutically acceptable salt, and pharmaceutically acceptable excipient.In various embodiments, pharmaceutical compositions are suitable for topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal or intraduodenal administration.

[0070] Additionally, disclosed herein is a method of treating a neurological disease or disorder in a patient in need thereof, comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition disclosed above. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Parkinson's disease with dementia, dementia with Lewy bodies, synucleinopathy, Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis, Pick's disease, tauopathy, primary age-related tauopathy, Down's syndrome, epilepsy / seizure disorder, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorder (HAND), multisystem. Neurological disorders such as atrophy, amnesic mild cognitive impairment, corticobasal degeneration (CBD) and / or chemotherapy-induced neuropathy, spinocerebellar ataxia (SCA), SCA type 2, spinal muscular atrophy (SMA), parkinsonism, Niemann-Pick disease type C (NPC), Charcot-Marie-Tooth disease (CMT), mucopolysaccharidosis type II (MPSIIA), mucolipidosis type IV, GM1 gangliosidosis, inclusion body myositis (sIBM), Henoch-Schönlein purpura (HSP), limbic predominant age-related TDP-43 encephalopathy (LATE), brain aging-related TDP-43 with sclerosis (Cerebral The neurological disorder is selected from the group consisting of Age-Related TDP-43 With Sclerosis (CARTS), Gaucher's disease, and synaptic diseases such as facial onset sensorimotor neuropathy, Guam Parkinson-Dementia Complex, multisystem proteinopathy, Perry's disease, and autism. In various embodiments, the neurological disorder is ALS. In various embodiments, the neurological disorder is FTD. In various embodiments, the neurological disorder is ALS with FTD. In various embodiments, the neurological disorder is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally, orally, pulmonary, rectally, buccal, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamic, intravenously, intramuscularly, transdermally, or intraduodenal. In various embodiments, the pharmaceutical composition is administered intrathecally, intrathalamic, intracerebroventricularly, or intracisternally.In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamic, or intracisternally. In various embodiments, the patient is a human.

[0071] Additionally provided herein is a method of treating a neurological disorder in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoroamidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, and / or at least one (i.e., one or more) nucleosides are independently selected from the group consisting of a phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkyl phosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkyl phosphonate linkage, a thionoalkyl phosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. and wherein the oligonucleotide is substituted with a member selected from the group consisting of -(2-methoxyethyl)nucleosides, 2'-O-methylnucleosides, 2'-O-(N-methylacetamido)nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acid (PNA), and optionally the oligonucleotide further comprises a spacer.

[0072] Additionally provided herein is a method of treating ALS in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, phosphatidyl ... and / or at least one (i.e., one or more) nucleosides are independently selected from the group consisting of a phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkyl phosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkyl phosphonate linkage, a thionoalkyl phosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. and wherein the oligonucleotide is substituted with a member selected from the group consisting of 2-methoxyethyl)nucleosides, 2'-O-methylnucleosides, 2'-O-(N-methylacetamido)nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acid (PNA), and optionally the oligonucleotide further comprises a spacer.

[0073] Additionally provided herein is a method of treating FTD in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, phosphatidyl ... and / or at least one (i.e., one or more) nucleosides are independently selected from the group consisting of a phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkyl phosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkyl phosphonate linkage, a thionoalkyl phosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. and wherein the oligonucleotide is substituted with a member selected from the group consisting of 2-methoxyethyl)nucleosides, 2'-O-methylnucleosides, 2'-O-(N-methylacetamido)nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acid (PNA), and optionally the oligonucleotide further comprises a spacer.

[0074] Additionally provided herein is a method of treating ALS with FTD in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoroamidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, or thiophosphorodiamidate linkages. linkage, independently selected from the group consisting of phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkage, aminoalkyl phosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage, and / or at least one (i.e., one or more) nucleosides is / are 2'- Disclosed are methods in which the oligonucleotide is substituted with a member selected from the group consisting of O-(2-methoxyethyl)nucleosides, 2'-O-methylnucleosides, 2'-O-(N-methylacetamido)nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acid (PNA), and optionally the oligonucleotide further comprises a spacer.

[0075] In various embodiments, one or more internucleoside linkages linking the bases at positions 3 and 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one internucleoside linkage linking the bases at positions 3 or 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, both the nucleoside linkages linking the bases at positions 3 and 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, the base immediately preceding the spacer in the oligonucleotide is further linked to the previous base through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, and the base immediately preceding the second spacer is linked to the previous base through a phosphodiester bond.

[0076] In various embodiments, one or more bases immediately following the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, only the base immediately following the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, the two bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one or more bases immediately preceding the spacer in the oligonucleotide are linked through a phosphodiester bond, and one or more bases immediately following the spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one base immediately preceding the spacer and one base immediately following the spacer are linked through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, one or more bases immediately preceding the second spacer in the oligonucleotide are linked through a phosphodiester bond, and one or more bases immediately following the second spacer in the oligonucleotide are linked through a phosphodiester bond. In various embodiments, one base immediately preceding the second spacer and one base immediately following the second spacer are linked through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a range of bases linked through phosphodiester bonds, the range of bases comprising at least 2 bases. In various embodiments, the oligonucleotide comprises a range of bases linked through phosphodiester bonds, the range of bases comprising at least 5 bases. In various embodiments, the oligonucleotide comprises two or more spacers, the range of bases being disposed between at least two spacers. In various embodiments, the oligonucleotide is any one of a 19mer, a 21mer, a 23mer, or a 25mer.

[0077] In various embodiments, at least one (i.e., one or more) internucleoside linkages of the oligonucleotide are phosphorothioate linkages. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0078] Additionally, disclosed herein is an oligonucleotide and a pharmaceutically acceptable excipient, wherein the oligonucleotide comprises any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, an equal length portion of the sequence having 90% identity thereto, or a sequence that is at least 85% complementary to a 15-50 contiguous nucleobase portion thereof, wherein the oligonucleotide comprises a spacer, wherein the oligonucleotide is capable of increasing, restoring, or stabilizing expression of UNC13A mRNA that is capable of translating functional UNC13A, and / or activity and / or function of UNC13A protein in a cell or human patient with an immune-mediated demyelinating disease, and wherein the level of increase, restoration, or stabilization of expression and / or activity and / or function is sufficient for use of the oligonucleotide as a medicament for the treatment of an immune-mediated demyelinating disease.

[0079] In various embodiments, the oligonucleotide contains one or more chiral centers and / or double bonds. In various embodiments, the oligonucleotide exists as a stereoisomer selected from a geometric isomer, an enantiomer, and a diastereomer.

[0080] Additionally disclosed herein is a method of treating a neurological disease and / or disorder in a patient in need thereof, comprising administering a therapeutically effective amount of the pharmaceutical composition disclosed above to a patient in need thereof along with a second therapeutic agent. In various embodiments, the second therapeutic agent is selected from the group consisting of riluzole (Rilutek), PrimeC (a combination of celecoxib and ciprofloxacin), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g. , BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprogestrone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), anticonvulsants, and psychostimulants, and / or therapies (e.g., selected from respiratory care, physical therapy, occupational therapy, speech therapy, nutritional supplementation).

[0081] Additionally, disclosed herein is a method of treating a neurological disease and / or neurological disorder in a patient in need thereof, comprising administering a therapeutically effective amount of the pharmaceutical composition disclosed above to a patient in need thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, the oligonucleotide comprises a spacer, and the oligonucleotide further comprises a targeting or conjugating moiety selected from cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and an antibody that crosses the blood-brain barrier.

[0082] In various embodiments, the spacer is a nucleoside replacement group that includes a non-sugar substituent that cannot be linked to a nucleotide base. In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, the second spacer being located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are at least 5 nucleobases apart, at least 6 nucleobases apart, or at least 7 nucleobases apart in the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and the second spacer is located at position 16 of the oligonucleotide.

[0083] In various embodiments, the oligonucleotide further comprises a third spacer, the third spacer being located between positions 21 and 24 of the oligonucleotide. In various embodiments, the spacer being located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, the second spacer being located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, the third spacer being located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, the three spacers being located at positions of the oligonucleotide such that each segment of the oligonucleotide has a maximum of 7 linked nucleosides.

[0084] In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of the at least two of the three spacers immediately precedes a guanine nucleobase.

[0085] In various embodiments of the methods described herein, each of the first, second, or third spacers is a nucleoside replacement group that includes a non-sugar substituent, where the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

[0086] In certain embodiments, each of the first, second, or third spacers independently has the formula (X):

[0087] [ka] wherein Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl group or a 4-8 membered monocyclic heterocyclyl group, the heterocyclyl group containing 1 or 2 heteroatoms selected from O, S, and N, with the proviso that A is not capable of forming a covalent bond with a nucleobase; and

[0088] [ka] The symbols represent the points of attachment to the internucleoside linkages.

[0089] In some embodiments, each of the first, second, or third spacers independently has the formula (Xa):

[0090] [ka] It is represented by:

[0091] In some embodiments, Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl group selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, and azepanyl.

[0092] In a further embodiment, Ring A is tetrahydrofuranyl.

[0093] In other embodiments, ring A is tetrahydropyranyl.

[0094] In various embodiments, each of the first, second, or third spacers independently has the formula (I):

[0095] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0096] In various embodiments, the spacer or the second spacer has the formula (I'):

[0097] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0098] In various embodiments, each of the first, second, or third spacers has formula (Ia):

[0099] [ka] wherein n is 0, 1, 2, or 3.

[0100] In various embodiments, each of the first, second, or third spacers has formula (Ia'):

[0101] [ka] wherein n is 0, 1, 2, or 3.

[0102] In certain embodiments, each of the first, second, or third spacers independently has Formula II:

[0103] [ka] wherein X is selected from -CH2- and -O-.

[0104] In further embodiments, each of the first, second, or third spacers independently has formula II':

[0105] [ka] wherein X is selected from -CH2- and -O-.

[0106] In various embodiments, each of the first, second, or third spacers has formula (Iia):

[0107] [ka] are independently represented by

[0108] In various embodiments, each of the first, second, or third spacers has formula (Iia'):

[0109] [ka] are independently represented by

[0110] In some embodiments, the spacer has formula (IIi):

[0111] [ka] wherein X is selected from -CH2- and -O-.

[0112] In some embodiments, the spacer has formula (IIi'):

[0113] [ka] wherein X is selected from -CH2- and -O.

[0114] In some embodiments, the spacer has formula (IIib):

[0115] [ka] It is represented by:

[0116] In some embodiments, the spacer has formula (Iiib'):

[0117] [ka] It is represented by:

[0118] In various embodiments, each of the first, second, or third spacers independently has formula III:

[0119] [ka] wherein X is selected from -CH2- and -O-.

[0120] In further embodiments, each of the first, second, or third spacers independently has formula III':

[0121] [ka] wherein X is selected from -CH2- and -O-.

[0122] In some embodiments, each of the first, second, or third spacers independently has the formula (IIIa):

[0123] [ka] It is represented by:

[0124] In a further embodiment, each of the first, second, or third spacers independently has the formula (IIIa'):

[0125] [ka] It is represented by:

[0126] In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 10%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 20%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 25%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 30%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 40%. In various embodiments, the oligonucleotides comprising a spacer have a GC content of at least 50%. [Brief description of the drawings]

[0127] [Figure 1] Figure 1 shows an example of an antisense oligonucleotide (AON), some of which are complementary to an mRNA or pre-mRNA transcript. The dashed lines indicate the location of the AON, which may or may not be occupied by a spacer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0128] Detailed Description The features and other details of the present disclosure will now be described in more detail.Certain terms used in the present specification, examples and appended claims are summarized here.These definitions should be read in light of the remaining parts of this disclosure and should be understood as understood by those skilled in the art.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art.

[0129] Disclosed herein are oligonucleotides that can target a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target UNC13A transcripts. Disclosed herein further are oligonucleotides that include antisense oligonucleotide sequences, and methods of using them to treat neurological disorders, such as amyotrophic lateral sclerosis and frontotemporal dementia, and / or chemotherapy-induced neurological disorders. In various embodiments, the oligonucleotides target the sequence of UNC13A transcripts, resulting in a reduction in the level of mis-spliced ​​UNC13A transcripts. Disclosed herein are pharmaceutical compositions that include UNC13A oligonucleotides that target a region of UNC13A transcripts for treating neurological disorders and / or neurological disorders; and the manufacture of medicaments that contain the disclosed UNC13A oligonucleotides that target a region of UNC13A transcripts for use in treating neurological disorders and / or neurological disorders.

[0130] definition The terms "treat", "treatment", "treating" and the like are generally used herein to mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in that it partially or completely cures the disease and / or the deleterious effects caused by the disease. The term "treatment", as used herein, encompasses any treatment of disease in a mammal, particularly a human, and includes (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or extent; (b) palliating the disease, i.e., causing partial or complete improvement of the disease; or (c) preventing recurrence of the disease, i.e., treating the symptoms of the disease or preventing the disease from returning to an active state after previous successful treatment of the disease.

[0131] "Preventing" includes delaying the onset of clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or condition in a subject who may be suffering from or is predisposed to the condition, disorder, disease, or condition, but who has not yet experienced or exhibited clinical or subclinical symptoms of the condition, disorder, disease, or condition. "Preventing" includes prophylactically treating a condition, disorder, disease, or condition in or developing in a subject, including prophylactically treating clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or condition in or developing in a subject.

[0132] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" used interchangeably herein refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, etc., compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may also contain other active compounds that provide complementary, additional, or enhanced therapeutic functions.

[0133] The term "pharmaceutical composition," as used herein, refers to a composition comprising at least one biologically active compound, such as an UNC13A antisense oligonucleotide (AON) disclosed herein, formulated together with one or more pharma- ceutically acceptable excipients.

[0134] "Individual", "patient" or "subject" are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or non-human primates, most preferably humans. The compounds of the present invention can be administered to mammals, such as humans, but may also be other mammals, such as animals requiring veterinary treatment, for example livestock (e.g., dogs, cats, etc.), farm animals (e.g., cows, sheep, pigs, horses, etc.) and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammal treated by the method of the present invention is desirably a mammal in which modulation of UNC13A expression and / or activity is desired.

[0135] As used herein, "UNC13A" (also known as Unc-13 homolog A, Munc13-1, KIAA1032, unc-13 homolog A (C. elegans), or protein Unc-13 homolog A) refers to the gene or gene product (e.g., the protein or mRNA transcript (including pre-mRNA) encoded by the gene) identified by Entrez Gene ID number 23025, and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice).

[0136] The term "UNC13A transcript" refers to the UNC13A transcript, which may be the UNC13A pre-mRNA sequence or the UNC13A mature RNA sequence. Although the sequence of the UNC13A transcript is shown to contain thymine (T), those skilled in the art will understand that in RNA sequences, thymine (T) is generally replaced by uracil (U).

[0137] The term "UNC13A oligonucleotide", "UNC13A antisense oligonucleotide", or "UNC13A AON" refers to an oligonucleotide that can increase, restore, or stabilize full-length UNC13A activity, e.g., full-length UNC13A expression, e.g., full-length UNC13A mRNA and / or full-length UNC13A protein expression. Generally, the UNC13A oligonucleotide reduces the level of a mis-spliced ​​UNC13A transcript by targeting the UNC13A transcript (e.g., UNC13A pre-mRNA or a mis-spliced ​​UNC13A having a target sequence). In various embodiments, the UNC13A oligonucleotide comprises a sequence that is at least 90% identical to SEQ ID NO:5057-5065 or SEQ ID NO:5206-5208, or a sequence that is at least 85% complementary to an equal length portion of the transcript that comprises a contiguous 15-50 nucleobase portion of SEQ ID NO:5057-5065 or SEQ ID NO:5206-5208. Although the UNC13A target sequence is shown to contain thymine (T), one of skill in the art will recognize that in RNA sequences thymine (T) can generally be replaced by uracil (U).

[0138] In various embodiments, the UNC13A oligonucleotide is characterized by having one or more spacers, where each spacer divides the UNC13A oligonucleotide into segments of linked nucleosides. In various embodiments, the UNC13A oligonucleotide has two spacers. In some embodiments, the UNC13A oligonucleotide has two segments of linked nucleosides separated by one spacer. In some embodiments, the UNC13A oligonucleotide has three segments of linked nucleosides separated by two spacers. In such embodiments, the UNC13A oligonucleotide has one segment with up to 7 linked nucleosides. For example, the UNC13A oligonucleotide may have, from the 5' to 3' end, 5 linked nucleosides followed by a spacer, 10 linked nucleosides followed by a second spacer, and 8 linked nucleosides. Thus, the first segment of 5 linked nucleosides fills one segment with up to 7 linked nucleosides. In various embodiments, the UNC13A oligonucleotide has three spacers that divide the UNC13A oligonucleotide into four segments. In various embodiments, each of the four segments of the UNC13A oligonucleotide has up to seven linked nucleosides.

[0139] As used herein, the term "UNC13A oligonucleotide" encompasses "UNC13A parent oligonucleotide", "UNC13A oligonucleotide with one or more spacers" (e.g., UNC13A oligonucleotide with two spacers or UNC13A oligonucleotide with three spacers), and "UNC13A oligonucleotide variant with one or more spacers". Examples of UNC13A oligonucleotides include oligonucleotides comprising any one of the sequences set forth in SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0140] The term "UNC13A parent oligonucleotide" refers to an oligonucleotide that targets an UNC13A transcript and can increase, restore, or stabilize full-length UNC13A activity, such as full-length UNC13A expression, such as full-length UNC13A mRNA and / or full-length UNC13A protein expression. The UNC13A parent oligonucleotide does not contain a spacer. Examples of UNC13A parent oligonucleotides include oligonucleotides comprising any one of the sequences of SEQ ID NOs: 1-1264. As described below, UNC13A oligonucleotides and UNC13A oligonucleotide variants having spacers are described in relation to the corresponding UNC13A parent oligonucleotides.

[0141] The term "UNC13A oligonucleotide variant" refers to an UNC13A oligonucleotide that represents a modified version of the corresponding UNC13A parent oligonucleotide. For example, an UNC13A oligonucleotide variant represents a shortened version of an UNC13A parent oligonucleotide. In various embodiments, the UNC13A oligonucleotide variant is any one of a 15mer, a 16mer, a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, a 25mer, a 26mer, or a 27mer. An example of an UNC13A oligonucleotide variant includes an oligonucleotide comprising any one of SEQ ID NOs: 2529-3792. In various embodiments, an UNC13A oligonucleotide variant comprises one or more spacers. Such an UNC13A oligonucleotide variant comprises any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0142] The term "oligonucleotide with one or more spacers" or "oligonucleotide containing a spacer" refers to an oligonucleotide with at least one spacer. An oligonucleotide with one or more spacers may, in various embodiments, include one spacer, two spacers, three spacers, four spacers, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, an oligonucleotide containing one or more spacers includes at least one segment with up to seven linked nucleosides. For example, written in the 5' to 3' direction, an oligonucleotide containing a spacer may include a segment with seven linked nucleosides, followed by a spacer, a second segment with nine linked nucleosides, followed by a second spacer, and a third segment with seven linked nucleosides. Here, the first segment of seven linked nucleosides and the third segment of seven linked nucleosides each represent a segment with up to seven linked nucleosides. As another example, an oligonucleotide containing a spacer may include a segment with 10 linked nucleosides, followed by a spacer, a second segment with 10 linked nucleosides, followed by a second spacer, and a third segment with 3 linked nucleosides. Here, the third segment of 3 linked nucleosides represents a segment with up to 7 linked nucleosides. In various embodiments, an oligonucleotide with one or more spacers includes multiple segments with up to 7 linked nucleosides. In various embodiments, each segment of an oligonucleotide with one or more spacers has up to 7 linked nucleosides. For example, an oligonucleotide may be a 23mer and include two spacers that divide the 23mer into three separate segments of 7 linked nucleosides each. Thus, each segment of an oligonucleotide has up to 7 linked nucleosides.

[0143] Generally, UNC13A oligonucleotides containing one or more spacers are described with reference to the corresponding UNC13A parent oligonucleotide or the corresponding UNC13A oligonucleotide variant. Examples of UNC13A oligonucleotides containing one or more spacers include any of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0144] In various embodiments, one or more spacers can be located at one or more positions of oligonucleotide.Spacer can be located between 1st and 2nd positions of oligonucleotide.As used herein, the spacer located between 1st and 2nd positions includes that the spacer is located at 1st position, 2nd position, or any position of the oligonucleotide sandwiched between 1st and 2nd positions.

[0145] As used herein, the term "therapeutically effective amount" refers to an amount of oligonucleotide that elicits a biological or medical response in a tissue, system, animal, or human that is desired by a researcher, veterinarian, physician, or other clinician. In one embodiment, the oligonucleotide comprises a sequence that is at least 90% identical to SEQ ID NO:5057-5065 or SEQ ID NO:5206-5208, or a sequence that is at least 85% complementary to an equal length portion of a transcript that comprises a contiguous 15-50 nucleobase portion of SEQ ID NO:5057-5065 or SEQ ID NO:5206-5208. The oligonucleotide is administered in a therapeutically effective amount to treat and / or prevent a disease, condition, disorder, or situation, such as a neurological disease and / or neurological disorder. Alternatively, a therapeutically effective amount of an oligonucleotide is an amount necessary to achieve a desired therapeutic and / or prophylactic effect, such as an amount that results in the prevention of a disease associated with reduced UNC13A activity in motor neurons or a reduction in symptoms associated therewith.

[0146] The phrase "UNC13A oligonucleotide targeted to an UNC13A transcript" refers to an UNC13A oligonucleotide that binds to an UNC13A transcript.

[0147] The term "pharmaceutical acceptable salt" as used herein refers to salts of acidic or basic groups that may be present in the UNC13A oligonucleotides used in the compositions of the present invention. The UNC13A oligonucleotides contained in the compositions of the present invention that are basic in nature can form a wide variety of salts with various inorganic and organic acids. Acids which may be used to prepare pharma- ceutically acceptable acid addition salts of such basic compounds are those which form non-toxic acid addition salts, i.e., salts containing pharma- ceutically acceptable anions, including, but not limited to, malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, tartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoic acid)) salts. The UNC13A oligonucleotides contained in the compositions of the present invention that contain an amino moiety can form pharma- ceutically acceptable salts with various amino acids in addition to the acids mentioned above. Compounds contained in the compositions of the present invention that are acidic in nature can form base salts with various pharma- ceutically acceptable cations. Examples of such salts include alkali metal salts or alkaline earth metal salts, particularly calcium salts, magnesium salts, sodium salts, and lithium salts. Pharmaceutically acceptable salts of the present disclosure include, for example, pharma- ceutically acceptable salts of UNC13A oligonucleotides that contain any of the sequences of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0148] The UNC13A oligonucleotides of the present disclosure may contain one or more chiral centers, groups, linkages, and / or double bonds, and therefore exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. The term "stereoisomers" as used herein consists of all geometric isomers, enantiomers, or diastereomers. These compounds may be designated by the symbols "R" or "S" (or "Rp" or "Sp") depending on the configuration of the substituents around a stereogenic atom, such as a stereogenic carbon, phosphorus, or sulfur atom. In some embodiments, one or more linkages of the compound may have an Rp or Sp configuration (e.g., one or more phosphorothioate linkages have either an Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., one phosphorothioate linkage has an Rp configuration and a second phosphorothioate linkage has an Sp configuration). In various embodiments, UNC13A oligonucleotides can have mixed configurations of phosphorothioate linkages.For example, UNC13A oligonucleotides can have 5 phosphorothioate linkages in Rp configuration, followed by 15 phosphorothioate linkages in Sp configuration, followed by 5 phosphorothioate linkages in Rp configuration.The present invention encompasses various stereoisomers of these compounds and their mixtures.Stereoisomers include enantiomers and diastereomers.Mixtures of enantiomers or diastereomers can be designated as "(±)" in nomenclature, but those skilled in the art will recognize that structures can implicitly indicate chiral centers.

[0149] Individual stereoisomers of the UNC13A oligonucleotides of the present invention can be prepared synthetically from commercially available starting materials containing asymmetric or stereoisomeric centers, or by preparation of racemic mixtures followed by resolution methods well known to those skilled in the art. These resolution methods are exemplified by (1) attaching the mixture of enantiomers to a chiral auxiliary, recrystallizing or chromatographically separating the resulting mixture of diastereomers, and liberating the optically pure product from the auxiliary, (2) forming a salt with an optically active resolving agent, or (3) directly separating the mixture of optical enantiomers on a chiral chromatographic column. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods such as chiral phase gas chromatography, chiral phase supercritical fluid chromatography, chiral simulated moving bed chromatography, chiral phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereoisomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthesis methods.

[0150] The UNC13A oligonucleotides disclosed herein can exist in solvated and unsolvated forms with pharma- ceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the present invention encompasses both the solvated and unsolvated forms.

[0151] The present disclosure also includes the fluorescent labeling compound of the present invention.The present disclosure also includes the isotope-labeled compound of the present invention (i.e., isotope-labeled UNC13A oligonucleotide), which is the same as described herein, except that one or more atoms are replaced by atoms with atomic mass or mass number different from the atomic mass or mass number found abundantly in nature.Examples of isotopes that can be incorporated into the compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, for example, respectively: 2 H, 3 H, 11 C. 13 C.14 C. 15 N, 18 O. 17 O. 31 P, 32 P, 33 P, 35 S, 18 F, and 36 Examples include Cl.

[0152] Certain disclosed isotopically labeled compounds (e.g., 3 H, 14 C, or 35 S) are useful in compound and / or substrate tissue distribution assays. Tritium isotopes (i.e., 3 H), carbon-14 isotopes (i.e. 14 C) is particularly preferred because of its ease of preparation and detection. 2 Substitution with heavier isotopes, such as H, may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and therefore may be preferred in some circumstances.

[0153] As used herein, "2'-O-(2-methoxyethyl)" (also 2'-MOE and 2'-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification at the 2' position of the furanose ring. In this disclosure, 2'-O-(2-methoxyethyl) is used interchangeably as "2'-O-methoxyethyl." The sugar moiety in a nucleoside modified with 2'-MOE is the modified sugar.

[0154] As used herein, "2'-MOE nucleoside" (as well as 2'-O-(2-methoxyethyl) nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0155] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a substituent at the 2'-position of the furanose ring other than H or OH. In certain embodiments, 2'-substituted nucleosides include nucleosides having bicyclic sugar modifications.

[0156] As used herein, "5-methylcytosine" (5-MeC) means a cytosine modified with a methyl group attached to position 5. 5-Methylcytosine (5-MeC) is a modified nucleobase.

[0157] As used herein, "bicyclic sugar" means a furanose ring modified by bridging two atoms. A bicyclic sugar is a modified sugar.

[0158] As used herein, "bicyclic nucleoside" (also referred to as BNA) refers to a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

[0159] As used herein, "cap structure" or "terminal cap moiety" means a chemical modification incorporated at either end of an antisense compound.

[0160] As used herein, "cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety containing a bridge connecting the 4'-carbon and the 2'-carbon, where the bridge has the formula 4'-CH(CH3)-O-2'.

[0161] As used herein, "constrained ethyl nucleoside" (also referred to as cEt nucleoside) refers to a nucleoside that includes a bicyclic sugar moiety that includes a 4'-CH(CH3)-O-2' bridge. In some embodiments, the cEt can be modified. In some embodiments, the cEt can be an S-cEt (in an S-constrained ethyl 2'-4'-bridged nucleic acid). In some other embodiments, the cEt can be an R-cEt.

[0162] As used herein, "internucleoside linkage" refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, "non-natural linkage" refers to a "modified internucleoside linkage."

[0163] As used herein, "contiguous" in the context of oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside bonds that are immediately adjacent to each other.For example, "contiguous nucleobases" refers to nucleobases that are immediately adjacent to each other in sequence.As an opposite example, two nucleosides separated by a spacer are not contiguous.

[0164] As used herein, "locked nucleic acid" or "LNA" or "LNA nucleoside" refers to a nucleic acid monomer having a bridge (e.g., a methylene, ethylene, aminooxy, or oxyimino bridge) connecting the two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, (A) α-L-methyleneoxy (4'-CH2-O-2') LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'-(CH2)2-O-2') LNA, (D) aminooxy (4'-CH2-ON(R)-2') LNA, and (E) oxyamino (4'-CH2-N(R)-O-2') LNA; where R is H, C1-C2, or ... 12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008).

[0165] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' sugar positions, each bridge being independently -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x- and -N(R1)-; where x is 0, 1 or 2; n is 1, 2, 3 or 4; each R1 and R2 is independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfonyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0166] An example of a 4'-2' bridge group encompassed within the definition of LNA is a group of the formula: -[C(R1)(R2)] n -, -[C(R1)(R2)] nIn addition, other bridge groups encompassed within the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2' and 4'-CH2-N(R1)-O-2'-bridges, where each R1 and R2 is independently H, a protecting group or a C1-C2 alkyl group. 12 It is an alkyl.

[0167] Also included within the definition of LNA according to the present invention are LNAs in which the 2' hydroxy group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a bridge and forming a bicyclic sugar moiety. The bridge may be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-O-2') LNA is used. Furthermore, in the case of a bicyclic sugar moiety having an ethylene bridging group at this position, the term ethyleneoxy (4'-CH2CH2-O-2') LNA is used.

[0168] As used herein, "spacer" refers to a nucleoside-replacement group (e.g., a non-nucleoside group that replaces a nucleoside present in an UNC13A parent oligonucleotide). A spacer is characterized by the absence of a nucleotide base and the replacement of a nucleoside sugar moiety with a non-sugar substituent. The non-sugar substituent of the spacer lacks an aldehyde group, a ketone group, an acetal group, a ketal group, a hemiacetal group, or a hemiketal group. Thus, the non-sugar substituent of the spacer can be connected to the 3' and 5' positions of the nucleoside adjacent to the spacer via an internucleoside linker as described herein, but cannot form a covalent bond with the nucleotide base (i.e., the nucleobase cannot be linked to another group, such as an internucleoside linkage, a conjugate group, or a terminal group of an oligonucleotide). Generally, UNC13A oligonucleotides having a spacer are described in relation to an UNC13A parent oligonucleotide, where the spacer replaces a nucleoside in the UNC13A parent oligonucleotide. In all embodiments of the present disclosure, the spacer cannot hybridize to a nucleoside that comprises a nucleobase at a corresponding position in the UNC13A transcript within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is positioned after nucleoside 4 of the AON (i.e., position 5 from the 5' end), the spacer is not complementary to a nucleoside (A, C, G, or U) at the same corresponding position in the target UNC13A transcript).

[0169] As used herein, a "mismatch" or "non-complementary group" refers to an instance where a group (e.g., nucleobase) of a first nucleic acid is not able to pair with a corresponding group (e.g., nucleobase) of a second or target nucleic acid.

[0170] As used herein, a "modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside linkage (eg, a phosphodiester internucleoside bond).

[0171] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. "Unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0172] As used herein, "modified nucleoside" refers to a nucleoside that has, independently, modified sugar moiety and / or modified nucleobase. Universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides that lack nucleobase. However, modified nucleosides do not include spacers or other groups that cannot link nucleobases.

[0173] As used herein, "linked nucleosides" are nucleosides connected in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides). In various embodiments, an oligonucleotide can have different segments of linked nucleosides connected via a spacer. Here, the spacer (i.e., the replacement of a nucleoside) is not considered a nucleoside and thus divides the oligonucleotide into two segments of linked nucleosides. An oligonucleotide can have a first segment of Y-linked nucleosides (e.g., Y-nucleosides connected in a contiguous sequence) followed by a spacer and then a second segment of Z-linked nucleosides. Here, the Y- and Z-linked nucleosides are described in either the 5' to 3' direction or the 3' to 5' direction. In various embodiments, the first segment consists of seven or fewer linked nucleosides (eg, Y=7 or fewer), while the second segment comprises eight or more linked nucleosides (eg, Z=8 or more).

[0174] As used herein, "modified oligonucleotide" means an oligonucleotide that contains at least one (i.e., one or more) modified internucleoside linkages, modified sugars, and / or modified nucleobases.

[0175] As used herein, "modified sugar" or "modified sugar moiety" means a modified furanosyl sugar moiety or a modified sugar moiety having a moiety other than a furanosyl moiety that is capable of linking a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide.

[0176] As used herein, "monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0177] As used herein, a "motif" means a pattern of unmodified and modified nucleosides in an antisense compound.

[0178] As used herein, "naturally occurring sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0179] As used herein, a "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0180] As used herein, "non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise support hybridization.

[0181] As used herein, "nucleic acid" refers to a molecule composed of monomeric nucleotides.Nucleic acid includes, but is not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, non-coding RNA, small interfering ribonucleic acid (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA).

[0182] As used herein, "nucleobase" means a heterocyclic moiety capable of base pairing with a base of another nucleic acid.

[0183] As used herein, "nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to the nucleobase of an antisense compound that can base pair with the corresponding nucleobase of a target nucleic acid. For example, if the nucleobase at a certain position of an antisense compound can hydrogen bond with the nucleobase at a certain position of a target nucleic acid, the hydrogen bond position between the oligonucleotide and the target nucleic acid is considered to be complementary in the nucleobase pair.

[0184] As used herein, "nucleobase sequence" means the order of nucleobases independent of any sugar, linkage, and / or nucleobase modifications.

[0185] As used herein, "nucleoside" refers to a nucleobase linked to a sugar. The term "nucleoside" also includes "modified nucleosides" having, independently, a modified sugar moiety and / or a modified nucleobase.

[0186] As used herein, "nucleoside mimic" includes structures used to replace sugars, or sugars and bases, and not necessarily linkages, at one or more positions of an oligomeric compound, such as, for example, morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimics, e.g., nucleoside mimics having non-furanose sugar units. Nucleotide mimics include structures used to replace nucleosides and linkages at one or more positions of an oligomeric compound, such as, for example, peptide nucleic acids or morpholinos (morpholinos linked by phosphorodiamidate or other non-phosphodiester linkages). Sugar surrogates overlap with the somewhat broader term nucleoside mimics, but are intended to refer to the replacement of only the sugar unit (furanose ring). The tetrahydropyranyl ring provided herein is an illustrative example of a sugar surrogate in which the furanose sugar group is replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups substituted on the sugar, nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of a sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0187] As used herein, "nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0188] As used herein, "oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits that are capable of hybridizing to at least a region of a nucleic acid molecule.

[0189] As used herein, "oligonucleotide" means a polymer of one or more segments of linked nucleosides, each of which may be modified or unmodified, and which is independent of one another.

[0190] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated modulation of splicing of the target nucleic acid.

[0191] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids.Without being limited to a specific mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleic acid bases.

[0192] As used herein, "increased amount of activity" refers to greater transcript expression, full-length mature mRNA and / or protein expression resulting from more accurate splicing, and / or higher activity compared to transcript expression or activity in an untreated or control sample.

[0193] Antisense Therapeutics Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate transcription, such as mRNA. In various embodiments, antisense therapeutics can be used to modulate the transcripts transcribed from genes, such as UNC13A pre-mRNAs that contain one or more spacers and include cryptic exons.

[0194] Antisense therapeutics can be single-stranded or double-stranded deoxyribonucleic acid (DNA)-based, ribonucleic acid (RNA)-based, or DNA / RNA chemical analog compounds. In general, antisense therapeutics are designed to contain sequences that are complementary or nearly complementary to the mRNA or pre-mRNA sequence transcribed from a given gene to facilitate binding between the antisense therapeutic and the pre-mRNA or mRNA. In certain embodiments, antisense therapeutics act by binding to the mRNA or pre-mRNA, thereby inhibiting protein translation, altering splicing of the pre-mRNA into mature mRNA (e.g., by inhibiting the appropriate proteins, such as splicing activator proteins, from binding), and / or causing destruction of the mRNA. In certain embodiments, the antisense therapeutic sequence is complementary to a portion of the sense sequence of the targeted gene or mRNA. In certain embodiments, the antisense therapeutics described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to the sense of the pre-mRNA, or a portion thereof, and one or more spacers. In certain embodiments, the antisense therapeutics described herein can be nucleotide chemical analog-based compounds.

[0195] In certain embodiments, the oligonucleotides disclosed herein can be oligonucleotide sequences that are 5-100 oligonucleotide units long, e.g., 10-60 oligonucleotide units long, e.g., 12-50 oligonucleotide units long, 14-40 oligonucleotide units long, 10-30 oligonucleotide units long, e.g., 14-30 oligonucleotide units long, e.g., 14-25 or 15-22 oligonucleotide units long, or 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 oligonucleotide units long. As used herein, "oligonucleotide unit" refers to either a nucleoside (e.g., a nucleoside comprising a sugar and / or nucleobase) or a nucleoside replacement group (e.g., a spacer) of an oligonucleotide.

[0196] In certain embodiments, the oligonucleotides are 25 oligonucleotide units in length. In certain embodiments, the oligonucleotides are 23 oligonucleotide units in length. In certain embodiments, the oligonucleotides are 21 oligonucleotide units in length. In certain embodiments, the oligonucleotides are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 26 oligonucleotide units in length. In various embodiments, the oligonucleotides are at least 27 oligonucleotide units in length.

[0197] In certain embodiments, the AONs described herein may comprise chemically modified nucleosides (e.g., 2'-O-methylated nucleosides or 2'-O-(2-methoxyethyl)nucleosides) and modified internucleoside linkages (e.g., phosphorothioate linkages). In certain embodiments, the AONs described herein comprise an oligonucleotide sequence that is complementary to an RNA sequence, such as an UNC13A mRNA sequence. In certain embodiments, the AONs described herein may comprise chemically modified nucleosides and modified internucleoside linkages (e.g., phosphorothioate linkages). In certain embodiments, the AONs described herein comprise one or more spacers.

[0198] In various embodiments, the oligonucleotide comprises one or more spacers. In certain embodiments, the oligonucleotide comprises one spacer. In various embodiments, the oligonucleotide comprises two spacers. For example, the oligonucleotide comprises 23 oligonucleotide units having 21 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of the oligonucleotide having one spacer and the oligonucleotide having two spacers are described herein. In various embodiments, the oligonucleotide comprises three spacers.

[0199] In some embodiments, the antisense oligonucleotide can be, but is not limited to, an inhibitor of a gene transcript (e.g., shRNA, siRNA, PNA, LNA, 2'-O-methyl (2'OMe) antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomer (e.g., phosphorodiamidate morpholino (PMO))), or a composition comprising such a compound. In some embodiments, the oligonucleotide can be an antisense oligonucleotide (AON) comprising 2'OMe (e.g., AON comprising one or more 2'OMe modified sugars), MOE (e.g., AON comprising one or more MOE modified sugars), peptide nucleic acid (e.g., AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkages as repeating units in place of the sugar-phosphate backbone), locked nucleic acid (e.g., AON comprising one or more locked ribose, which can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., one or more c-ETs), or a combination of 2'-deoxynucleotides ... ET sugars), constrained methoxyethyl (cMOE) (e.g., AONs containing one or more cMOE sugars), morpholino oligomers (e.g., AONs containing a backbone containing one or more PMOs), deoxy-2'-fluoronucleosides (e.g., AONs containing one or more 2'-fluoro-β-D-arabinonucleosides), tricyclo-DNA (tcDNA) (e.g., AONs containing one or more tcDNA modified sugars), 2'-O,4'-C-ethylene-bridged nucleic acids (ENA) (e.g., AONs containing one or more ENA modifications, etc.), or hexitol nucleic acids (HNA) (e.g., AONs containing one or more HNA modified sugars).In some embodiments, the AON comprises one or more internucleoside linkages independently selected from phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, phosphorodiamidate morpholino (PMO) (morpholino) linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, phosphorodiamidate morpholino (PMO) (morpholino) linkages, and PNA linkages. In some embodiments, the UNC13A AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0200] Peptide nucleic acid (PNA) is a short, artificially synthesized polymer with a structure that mimics DNA or RNA. PNA contains a backbone composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In certain embodiments, the PNA described herein can be used as an antisense therapeutic agent that binds to RNA sequences with high specificity and increases, restores, and / or stabilizes levels (e.g., full-length UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).

[0201] Locked nucleic acid (LNA) is an oligonucleotide sequence that contains one or more modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and the 4' carbon. LNA is believed to have a higher Tm than similar oligonucleotide sequences. In certain embodiments, the LNA described herein can be used as an antisense therapeutic that binds to RNA sequences with high specificity. For example, LNA can bind to UNC13A pre-mRNA, prevent the mis-splicing of UNC13A pre-mRNA, and increase, restore and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).

[0202] Morpholino oligomers are oligonucleotide compounds that contain DNA bases linked to a backbone of methylene morpholine rings linked via phosphorodiamidate groups.In certain embodiments, the morpholino oligomers of the present invention can be designed to bind to a specific pre-mRNA sequence of interest.For example, morpholino oligomers bind to UNC13A pre-mRNA, thereby preventing pre-mRNA mis-splicing, and increasing, restoring, and / or stabilizing UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can be used as antisense therapeutics to bind to UNC13A pre-mRNA sequences with high specificity, prevent UNC13A pre-mRNA mis-splicing, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can also be used to bind to UNC13A pre-mRNA sequences, alter UNC13A pre-mRNA splicing and UNC13A gene expression, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, e.g., UNC13A activity).

[0203] UNC13A oligonucleotides complementary to the UNC13A transcript In some embodiments, the UNC13A AON comprises a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to a region of the UNC13A transcript (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208). In some embodiments, the UNC13A AON comprises a sequence that is 90-95% complementary to a region of the UNC13A transcript (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208) that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity. In certain embodiments, the UNC13A AON comprises a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of the UNC13A transcript (e.g., SEQ ID NO: 5057-5065 or SEQ ID NO: 5206-5208). In certain embodiments, the UNC13A AON comprises a sequence that is 84%-88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of the UNC13A transcript (e.g., SEQ ID NO: 5057-5065 or SEQ ID NO: 5206-5208). In certain embodiments, the UNC13A AON comprises a sequence that is 89%-92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a misspliced ​​UNC13A transcript (e.g., SEQ ID NOs: 5057-5065).In certain embodiments, the UNC13A AON comprises a sequence that is 94%-96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of the UNC13A transcript (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208).

[0204] In various embodiments, the UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0205] In some embodiments, the UNC13A AONs include a spacer and have segments with up to 7 linked nucleosides, hi some embodiments, the UNC13A AONs include a spacer and have segments with up to 6, 5, 4, 3, or 2 linked nucleosides.

[0206] UNC13A AON binding specificity can be assessed by measuring parameters such as dissociation constants, melting temperatures, or other criteria such as changes in protein or RNA expression levels, or other assays that measure UNC13A activity or expression.

[0207] In some embodiments, the UNC13A AON may comprise a non-duplex oligonucleotide. In some embodiments, the UNC13A AON may comprise a duplex of two oligonucleotides, where a first oligonucleotide comprises a nucleobase sequence that is completely or nearly completely complementary to the UNC13A pre-mRNA sequence, and a second oligonucleotide comprises a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0208] In some embodiments, UNC13A AON can target UNC13A pre-mRNA generated from one or more species of UNC13A gene.For example, UNC13A AON can target UNC13A pre-mRNA of mammalian UNC13A gene, for example, human (i.e., Homo sapiens) UNC13A gene.In certain embodiments, UNC13A AON targets human UNC13A pre-mRNA.In some embodiments, UNC13A AON comprises a nucleobase sequence that is complementary to the nucleobase sequence of UNC13A gene or UNC13A pre-mRNA or a part thereof.

[0209] The UNC13A AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below.

[0210] [Table 1-1]

[0211] [Table 1-2]

[0212] [Table 1-3]

[0213] [Table 1-4]

[0214]

Table 1-5

[0215]

Table 1-6

[0216]

Table 1-7

[0217]

Table 1-8

[0218]

Table 1-9

[0219]

Table 1-10

[0220]

Table 1-11

[0221]

Table 1-12

[0222]

Table 1-13

[0223]

Table 1-14

[0224]

Table 1-15

[0225]

Table 1-16

[0226]

Table 1-17

[0227]

Table 1-18

[0228]

Table 1-19

[0229]

Table 1-20

[0230]

Table 1-21

[0231]

Table 1-22

[0232]

Table 1-23

[0233]

Table 1-24

[0234] [Table 1-25]

[0235] [Table 1-26]

[0236] [Table 1-27]

[0237] [Table 1-28]

[0238] [Table 1-29]

[0239] [Table 1-30]

[0240] [Table 1-31]

[0241] UNC13A transcript In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5057.

[0242] [ka]

[0243] [ka]

[0244] [ka]

[0245] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5058.

[0246] [ka]

[0247] [ka]

[0248] [ka]

[0249] [ka]

[0250] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5059.

[0251] [ka]

[0252] [ka]

[0253] [ka]

[0254] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5060.

[0255] [ka]

[0256] [ka]

[0257] [ka]

[0258] [ka]

[0259] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5061.

[0260] [ka]

[0261] [ka]

[0262] [ka]

[0263] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5062.

[0264] [ka]

[0265] [ka]

[0266] [ka]

[0267] In various embodiments, the UNC13A mRNA transcript comprises the sequence given as SEQ ID NO:5063.

[0268] [ka]

[0269] [ka]

[0270] [ka]

[0271] In various embodiments, the UNC13A transcript is an UNC13A pre-mRNA transcript. In various embodiments, the UNC13A pre-mRNA transcript comprises the sequence given as SEQ ID NO:5064.

[0272] [ka]

[0273] [ka]

[0274] [ka]

[0275] [ka]

[0276]

change

[0277]

change

[0278]

change

[0279]

change

[0280]

change

[0281]

change

[0282]

change

[0283]

change

[0284]

change

[0285]

change

[0286]

change

[0287] [ka]

[0288] [ka]

[0289] [ka]

[0290] [ka]

[0291] [ka]

[0292] [ka]

[0293] [ka]

[0294] [ka]

[0295] In various embodiments, the UNC13A transcript is an UNC13A pre-mRNA transcript. In various embodiments, the UNC13A pre-mRNA transcript comprises the sequence given as SEQ ID NO: 5065. NCBI Reference Sequence NC_000019.10 reference GRCh38.p13 primary assembly is SEQ ID NO: 5065.

[0296] UNC13A transcripts with cryptic exons In some embodiments, the UNC13A AON targets a region of the UNC13A transcript that contains a cryptic exon sequence, where the UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO:5206.

[0297] [ka]

[0298] In some embodiments, the sequence of a cryptic exon within the UNC13A mRNA transcript is provided as SEQ ID NO:5207.

[0299] [ka]

[0300] In some embodiments, the sequence of a cryptic exon within the UNC13A mRNA transcript is provided as SEQ ID NO:5208.

[0301] [ka]

[0302] UNC13A oligonucleotides targeting regions of the UNC13A transcript In various embodiments, the UNC13A AON disclosed herein is complementary to a specific region of an UNC13A transcript (e.g., one UNC13A transcript) that includes a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or 5206-5208. In some embodiments, the UNC13A AON includes a sequence that is complementary to a specific region of an UNC13A transcript that includes a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or 5206-5208. In some embodiments, the UNC13A AON comprises a sequence that is at least 85% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 90-99% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 90-95% complementary to a particular region of the UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 95-99% complementary to a particular region of the UNC13A transcript.

[0303] In some embodiments, the UNC13A AON (e.g., UNC13A AON) has a segment with up to 7 linked nucleosides. In some embodiments, the UNC13A AON has a segment with up to 6, 5, 4, 3, or 2 linked nucleosides. A segment of the UNC13A AON can be separated from other segments of the UNC13A AON via a spacer. A segment of the UNC13A AON is complementary to a particular region of an UNC13A transcript (e.g., one UNC13A transcript) that includes a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5063, or an UNC13A pre-mRNA transcript transcribed from SEQ ID NOs: 5064 or 5065 or SEQ ID NOs: 5206-5208.

[0304] UNC13A Oligonucleotide Variants In various embodiments, the UNC13A AON includes different variants, hereinafter referred to as UNC13A AON variants. The UNC13A AON variants can be oligonucleotide sequences of 5-100 nucleobases in length, e.g., 10-40 nucleobases in length, e.g., 14-40 nucleobases in length, 10-30 nucleobases in length, e.g., 14-30 nucleobases in length, e.g., 16-28 nucleobases in length, e.g., 19-23 nucleobases in length, e.g., 21-23 nucleobases in length, e.g., 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. The UNC13A AON variants can be oligonucleotide sequences complementary to a portion of the UNC13A pre-mRNA sequence or UNC13A gene sequence.

[0305] In various embodiments, an UNC13A AON variant represents a modified version of a corresponding UNC13A parent oligonucleotide comprising a nucleobase sequence selected from any one of SEQ ID NOs: 1-1264. In some embodiments, an UNC13A AON variant comprises a nucleobase sequence representing a shortened version of a nucleobase sequence of an UNC13A AON selected from any one of SEQ ID NOs: 1-1264. As an example, if an UNC13A parent oligonucleotide comprises a 25mer (e.g., 25 oligonucleotide units in length), a variant (e.g., an UNC13A variant) can comprise a shorter version of the 25mer UNC13A parent oligonucleotide (e.g., a 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, or 23mer). In one embodiment, the nucleobase sequence of the UNC13A AON variant differs from the corresponding nucleobase sequence of the UNC13A parent oligonucleotide in that one, two, three, four, five, or six oligonucleotide units are removed from either or both of the 3'-end and 5'-end of the nucleobase sequence of the UNC13A parent oligonucleotide.In one embodiment, the corresponding UNC13A AON variant may comprise a 23mer in which two oligonucleotide units are removed from either the 3'-end or the 5'-end of the 25mer contained in the UNC13A parent oligonucleotide.In one embodiment, the corresponding UNC13A AON variant may comprise a 23mer in which one nucleotide base is removed from each of the 3'-end and the 5'-end of the 25mer contained in the UNC13A parent oligonucleotide.In one embodiment, the corresponding UNC13A AON variant may comprise a 21mer in which two oligonucleotide units are removed from each of the 3'-end and the 5'-end of the 25mer contained in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 21-mer with four oligonucleotide units removed from either the 3' or 5' end of the 25-mer contained in the UNC13A parent oligonucleotide.In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer in which two oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and three oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer in which three oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer in which five oligonucleotide units are removed from either the 3' end or the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer in which three oligonucleotide units are removed from each of the 3' end and the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer in which two oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and four oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer in which four oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer in which six oligonucleotide units are removed from either the 3' end or the 5' end of the 25mer in the UNC13A parent oligonucleotide.

[0306] In one embodiment, the corresponding UNC13A AON variant may comprise an 18-mer in which two oligonucleotide units are removed from the 3' end of the 25-mer in the UNC13A parent oligonucleotide and five oligonucleotide units are removed from the 5' end of the 25-mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18-mer in which five oligonucleotide units are removed from the 3' end of the 25-mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25-mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18-mer in which one oligonucleotide unit is removed from the 3' end of the 25-mer in the UNC13A parent oligonucleotide and six oligonucleotide units are removed from the 5' end of the 25-mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer with six oligonucleotide units removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and one oligonucleotide unit removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer with seven oligonucleotide units removed from either the 3' or 5' end of the 25mer in the UNC13A parent oligonucleotide.

[0307] In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer in which two oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and six oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer in which six oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer in which eight oligonucleotide units are removed from either the 3' end or the 5' end of the 25mer in the UNC13A parent oligonucleotide.

[0308] In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer in which two oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and seven oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer in which seven oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer in which nine oligonucleotide units are removed from either the 3' end or the 5' end of the 25mer in the UNC13A parent oligonucleotide.

[0309] In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer in which two oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and eight oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer in which eight oligonucleotide units are removed from the 3' end of the 25mer in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer in which ten oligonucleotide units are removed from either the 3' end or the 5' end of the 25mer in the UNC13A parent oligonucleotide. Examples of sequences of UNC13A AON variants are shown in Table 2A and Table 2B below.

[0310] [Table 2-1]

[0311] [Table 2-2]

[0312] [Table 2-3]

[0313] [Table 2-4]

[0314] [Table 2-5]

[0315] [Table 2-6]

[0316]

Table 2-7

[0317]

Table 2-8

[0318]

Table 2-9

[0319]

Table 2-10

[0320]

Table 2-11

[0321]

Table 2-12

[0322]

Table 2-13

[0323]

Table 2-14

[0324]

Table 2-15

[0325]

Table 2-16

[0326]

Table 2-17

[0327]

Table 2-18

[0328]

Table 2-19

[0329]

Table 2-20

[0330]

Table 2-21

[0331]

Table 2-22

[0332]

Table 2-23

[0333]

Table 2-24

[0334]

Table 2-25

[0335]

Table 2-26

[0336] [Table 2-27]

[0337] [Table 2-28]

[0338] [Table 2-29]

[0339] [Table 2-30]

[0340] [Table 2-31]

[0341] [Table 3]

[0342] In various embodiments, each nucleoside of the antisense oligonucleotides shown in Table 2B is a modified nucleoside having a 2'-O-(2-methoxyethyl) (2'MOE) sugar moiety, and each "C" is replaced with a 5-methylcytosine (5-MeC). Further, each internucleoside linkage between the nucleosides is a phosphorothioate internucleoside linkage.

[0343] Antisense oligonucleotides with one or more locked nucleic acids (LNAs) In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) contain one or more locked nucleic acids (LNAs). In certain embodiments, the antisense oligonucleotides contain one LNA. In certain embodiments, the antisense oligonucleotides contain two LNAs. In certain embodiments, the antisense oligonucleotides contain three LNAs. In general, LNA refers to a nucleic acid monomer having a bridge (e.g., a methylene, ethylene, aminooxyaminooxy, or oxyimino bridge) connecting the two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar.

[0344] In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 4 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 7 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 9 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 12 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 15 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 17 of the antisense oligonucleotide when counted from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise an LNA at position 20 of the antisense oligonucleotide when counted from 5' to 3'.

[0345] In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two LNAs located at two different positions of the antisense oligonucleotide. In some embodiments, the antisense oligonucleotides disclosed herein comprise a first LNA at position 4 of the antisense oligonucleotide and a second LNA at position 20 of the antisense oligonucleotide, counting from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise a first LNA at position 7 of the antisense oligonucleotide and a second LNA at position 15 of the antisense oligonucleotide, counting from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise a first LNA at position 7 of the antisense oligonucleotide and a second LNA at position 17 of the antisense oligonucleotide, counting from 5' to 3'. In some embodiments, the antisense oligonucleotides disclosed herein comprise a first LNA at position 9 of the antisense oligonucleotide and a second LNA at position 17 of the antisense oligonucleotide, counted from 5' to 3'.

[0346] In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise three LNAs located at three different positions of the antisense oligonucleotide. In some embodiments, the antisense oligonucleotides disclosed herein comprise a first LNA at position 4 of the antisense oligonucleotide, a second LNA at position 12 of the antisense oligonucleotide, and a third LNA at position 20 of the antisense oligonucleotide, counting from 5' to 3'.

[0347] Antisense oligonucleotides with one or more spacers In various embodiments, the antisense oligonucleotide comprises one or more spacers. In certain embodiments, the antisense oligonucleotide comprises one spacer. In certain embodiments, the antisense oligonucleotide comprises two spacers. In certain embodiments, the antisense oligonucleotide comprises three spacers. In general, spacer refers to a nucleoside replacement group that lacks a nucleotide base, and the nucleoside sugar moiety is replaced by a non-sugar substituent. The non-sugar substituent is not capable of linking the nucleobase, but is capable of linking the 3' and 5' positions of the nucleoside adjacent to the spacer through an internucleoside linking group.

[0348] In certain embodiments, oligonucleotides having one or more spacers, such as those disclosed herein, can be oligonucleotides having a length of 5-100 oligonucleotide units, e.g., 10-60 oligonucleotide units, e.g., 12-50 oligonucleotide units, 14-40 oligonucleotide units, 10-30 oligonucleotide units, e.g., 14-30 oligonucleotide units, e.g., 14-25 or 15-22 oligonucleotide units, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units. As used herein, "oligonucleotide unit" refers to either a nucleoside (e.g., a nucleoside comprising a sugar and / or nucleobase) or a nucleoside replacement group (e.g., a spacer) of an oligonucleotide.

[0349] In certain embodiments, the oligonucleotides having one or more spacers are 25 oligonucleotide units in length. In certain embodiments, the oligonucleotides having one or more spacers are 23 oligonucleotide units in length. In certain embodiments, the oligonucleotides having one or more spacers are 21 oligonucleotide units in length. In certain embodiments, the oligonucleotides having one or more spacers are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotides having one or more spacers are at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 23 oligonucleotide units in length.In various embodiments, the oligonucleotide having one or more spacers is at least 24 oligonucleotide units in length.In various embodiments, the oligonucleotide having one or more spacers is at least 25 oligonucleotide units in length.

[0350] In various embodiments, the UNC13A AON comprises a sequence that shares at least 80% identity with an equal length portion of any one of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0351] In some embodiments, the spacer has the formula (X):

[0352] [ka] is a spacer of the formula Ring A is as defined herein.

[0353] In some embodiments, the spacer has formula (Xa):

[0354] [ka] is a spacer of the formula Ring A is as defined herein and the -CH2-O- group is on the ring A atom adjacent to the -O- group.

[0355] As generally defined herein, ring A of formula (X) and (Xa) is an optionally substituted 4-8 membered monocyclic cycloalkyl group (e.g., ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or a 4-8 membered monocyclic heterocyclyl group, the heterocyclyl group containing one or two heteroatoms selected from O, S and N (e.g., ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring A is tetrahydrofuranyl. In some embodiments, ring A is tetrahydropyranyl. In some embodiments, ring A is pyrrolidinyl. In some embodiments, ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2, or 3 substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN.

[0356] In some embodiments, the tetrahydrofuranyl is substituted with one or two substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, the tetrahydrofuranyl is substituted with two substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, the tetrahydrofuranyl is substituted with one substituent selected from halo (e.g., -F, -Cl), -OMe, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, the tetrahydrofuranyl is substituted with -O(CH2)2OMe.

[0357] In some embodiments, the spacer has formula (I):

[0358] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0359] In some embodiments, the spacer has formula (I'):

[0360] [ka] wherein X is selected from -CH2- and -O-; and n is 0, 1, 2, or 3.

[0361] In some embodiments, the spacer has formula (Ia):

[0362] [ka] wherein n is 0, 1, 2, or 3.

[0363] In some embodiments, the spacer has formula (Ia'):

[0364] [ka] is represented by n is 0, 1, 2, or 3.

[0365] As generally defined herein, X is selected from -CH2- and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-.

[0366] As generally defined herein, n is 0, 1, 2, or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3.

[0367] In some embodiments, the spacer has formula (II):

[0368] [ka] wherein X is selected from -CH2- and -O-.

[0369] In some embodiments, the spacer has formula (II'):

[0370] [ka] wherein X is selected from -CH2- and -O.

[0371] In some embodiments, the spacer has formula (Iia):

[0372] [ka] It is represented by:

[0373] In some embodiments, the spacer has formula (Iia'):

[0374] [ka] It is represented by:

[0375] In some embodiments, the spacer has formula (IIi):

[0376] [ka] wherein X is selected from -CH2- and -O-.

[0377] In some embodiments, the spacer has formula (IIi'):

[0378] [ka] wherein X is selected from -CH2- and -O.

[0379] In some embodiments, the spacer has formula (IIib):

[0380] [ka] It is represented by:

[0381] In some embodiments, the spacer has formula (IIib'):

[0382] [ka] It is represented by:

[0383] In some embodiments, the spacer has formula (III):

[0384] [ka] wherein X is selected from -CH2- and -O-.

[0385] In some embodiments, the spacer has formula (III'):

[0386] [ka] wherein X is selected from -CH2- and -O.

[0387] In some embodiments, the spacer has formula (IIIa):

[0388] [ka] It is represented by:

[0389] In some embodiments, the spacer has formula (IIIa'):

[0390] [ka] It is represented by:

[0391] In some embodiments, open positions (i.e., positions not specifically shown as having only hydrogen atoms, including the -CH2- group of X) of formulas (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa) and (IIIa') are further substituted with 0-3 substituents independently selected from halo (e.g., -F, -Cl), -OMe, -OEt-O(CH2)OMe, -O(CH2)2OMe and CN. In some embodiments, formulas (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa) and (IIIa') are not further substituted.

[0392] As described in detail below, UNC13A oligonucleotides having one or more spacers are described with reference to corresponding UNC13A parent oligonucleotides or corresponding UNC13A variant oligonucleotides.In various embodiments, UNC13A oligonucleotides having spacers are different from UNC13A parent oligonucleotides or UNC13A variant oligonucleotides in that the spacer replaces a nucleoside in UNC13A parent oligonucleotides or UNC13A variant oligonucleotides.As used below, the "position" of an UNC13A oligonucleotide refers to a specific position when counting from the 5' end of the UNC13A oligonucleotide.In various embodiments, the spacer replaces a nucleoside at any one of the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, or 25th positions of an UNC13A parent oligonucleotide or UNC13A variant oligonucleotide. In certain embodiments, the spacer replaces a nucleoside at one of positions 7, 8, 11, 14, 16, 19, or 22 of an UNC13A parent oligonucleotide or an UNC13A variant oligonucleotide.

[0393] In various embodiments, the UNC13A oligonucleotide comprises a spacer replacing a nucleoside in the UNC13A oligonucleotide (e.g., a spacer replaces a nucleoside in the UNC13A oligonucleotide). In certain embodiments, the spacer replaces a nucleoside between positions 9 and 15 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces a nucleoside between positions 9 and 12 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces a nucleoside at position 10 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces a nucleoside at position 11 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces a nucleoside at position 12 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces a nucleoside between positions 12 and 16 of the UNC13A oligonucleotide. In certain embodiments, the spacer replaces the nucleoside at position 15 of the UNC13A oligonucleotide.

[0394] In various embodiments, the UNC13A oligonucleotide with one spacer comprises two segments, and at least one of the two segments has a maximum of 11 linked nucleosides. For example, the UNC13A oligonucleotide can be 23 oligonucleotide units long, and the spacer can be located at the 12th position. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, and both of the two segments are 11 nucleobases long. In various embodiments, the UNC13A oligonucleotide with one spacer comprises two segments, and at least one of the two segments has a maximum of 10 linked nucleosides. For example, the UNC13A oligonucleotide can be 21 oligonucleotide units long, and the spacer can be located at the 11th position. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, and both of the two segments are 10 nucleobases long. As another example, the UNC13A oligonucleotide can be 25 oligonucleotide units long, and the spacer can be located at the 15th position. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, one of the two segments being 14 nucleobases in length and the second of the two segments being 10 nucleobases in length.

[0395] In various embodiments, the UNC13A oligonucleotide comprises two spacers, each of which replaces a nucleoside in the UNC13A oligonucleotide (e.g., the two spacers replace two separate nucleosides in the UNC13A oligonucleotide).In various embodiments, the first spacer and the second spacer are at least 5 nucleobases apart, at least 6 nucleobases apart, at least 7 nucleobases apart, at least 8 nucleobases apart, at least 9 nucleobases apart, or at least 10 nucleobases apart in the oligonucleotide.In certain embodiments, the first spacer and the second spacer are at least 5 nucleobases apart, at least 6 nucleobases apart, or at least 7 nucleobases apart.In certain embodiments, the first spacer and the second spacer are not adjacent to each other in the oligonucleotide.

[0396] In certain embodiments, the first spacer replaces a nucleoside between positions 7 and 11 of the UNC13A oligonucleotide. In various embodiments, the first spacer replaces a nucleoside between positions 8 and 11, 9 and 11, 10 and 11, 7 and 10, 7 and 9, 7 and 8, 8 and 10, 8 and 9, or 9 and 10 of the UNC13A oligonucleotide. In certain embodiments, the second spacer replaces a nucleoside between positions 14 and 22 of the UNC13A oligonucleotide. In various embodiments, the second spacer is located at positions 15 and 22, 16 and 22, 17 and 22, 18 and 22, 19 and 22, 20 and 22, 21 and 22, 15 and 21, 16 and 21, 17 and 21, 18 and 21, 19 and 21, 20 and 21 of the UNC13A oligonucleotide. or replacing nucleosides between positions 15 and 20, 16 and 20, 17 and 20, 18 and 20, 19 and 20, 15 and 19, 16 and 19, 17 and 19, 18 and 19, 15 and 18, 16 and 18, 17 and 18, 15 and 17, 16 and 17, or 15 and 16.

[0397] In a preferred embodiment, the first spacer replaces the nucleoside at position 7 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 14 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 7 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 19 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 8 of the UNC13A parent oligonucleotide, and the second spacer replaces the nucleoside at position 16 of the UNC13A parent oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 8 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 15 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 11 of the UNC13A oligonucleotide and the second spacer replaces the nucleoside at position 22 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 9 of the UNC13A oligonucleotide and the second spacer replaces the nucleoside at position 19 of the UNC13A oligonucleotide.

[0398] In various embodiments, the UNC13A oligonucleotide comprises three spacers, each replacing a nucleoside in the UNC13A oligonucleotide (e.g., three spacers replacing three separate nucleosides in the UNC13A oligonucleotide). In certain embodiments, the first spacer replaces a nucleoside between positions 7 and 11 of the UNC13A oligonucleotide. In certain embodiments, the second spacer replaces a nucleoside between positions 14 and 22 of the UNC13A oligonucleotide. In certain embodiments, the third spacer replaces a nucleoside between positions 21 and 24 of the UNC13A oligonucleotide. In some embodiments, the first spacer replaces a nucleoside between positions 2 and 5 of the UNC13A oligonucleotide. In certain embodiments, the second spacer replaces a nucleoside between positions 8 and 12 of the UNC13A oligonucleotide. In certain embodiments, the third spacer replaces a nucleoside between positions 18 and 22 of the UNC13A oligonucleotide.

[0399] In various embodiments, the three spacers in UNC13A oligonucleotide are arranged so that each of the four segments of UNC13A oligonucleotide is up to 7 linked nucleosides in length.For example, UNC13A oligonucleotide can have a first segment with 7 linked nucleosides connected to a first spacer, then a second segment with 7 linked nucleosides connected to a first spacer at one end and a second spacer at the other end, then a third segment with 6 linked nucleosides connected to a second spacer at one end and a third spacer at the other end, then a fourth segment with 6 linked nucleosides connected to a third spacer.

[0400] In various embodiments, one or more spacers are arranged in the oligonucleotide to replace one or more adenosine or thymine nucleosides (as opposed to guanine or cytosine nucleosides). For example, one or more spacers can replace 1, 2, 3, 4, 5, 6, 7, 8, or 9 adenosine or thymine nucleosides in the oligonucleotide. In various embodiments, one or more spacers are arranged in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides). For example, one or more spacers can replace 1, 2, 3, 4, 5, 6, 7, 8, or 9 guanine or cytosine nucleosides in the oligonucleotide. In various embodiments, spacers are arranged in the oligonucleotide to replace an equal number of adenosine / thymine nucleosides and guanine / cytosine nucleosides. For example, a first spacer in the oligonucleotide may replace adenosine / thymine nucleosides and a second spacer in the oligonucleotide may replace guanine / cytosine nucleosides.

[0401] In various embodiments, one or more spacers are arranged in the oligonucleotide to control the sequence content in the oligonucleotide. For example, one or more spacers are arranged so that at least one of the spacers is located adjacent to a guanine group. In various embodiments, the oligonucleotide with spacers can include one spacer adjacent to a guanine group, two spacers adjacent to a guanine group, three spacers adjacent to a guanine group, four spacers adjacent to a guanine group, or five spacers adjacent to a guanine group. In one embodiment, when counting from the 5' end of the oligonucleotide, the spacer is immediately before the guanine group in the sequence. Thus, in various embodiments, the oligonucleotide with spacers can include one spacer immediately before the guanine group, two spacers each immediately before the guanine group, three spacers each immediately before the guanine group, four spacers each immediately before the guanine group, or five spacers each immediately before the guanine group. In one embodiment, when counting from the 5' end of the oligonucleotide, the guanine group is immediately after the spacer. Thus, in various embodiments, an oligonucleotide having spacers may include one spacer immediately following a guanine group, two spacers each immediately following a guanine group, three spacers each immediately following a guanine group, four spacers each immediately following a guanine group, or five spacers each immediately following a guanine group. In various embodiments, the spacers in the oligonucleotide may be positioned to maximize the number of spacers adjacent to a guanine group.

[0402] In various embodiments, one or more spacers are arranged to replace one or more adenosine or thymine nucleosides, so that one or more spacers are located adjacent to guanine base in oligonucleotide.For example, two spacers can replace adenosine or thymine nucleosides in oligonucleotide, so that each of the two spacers is located adjacent to guanine base.

[0403] In various embodiments, the UNC13A oligonucleotide with one or more spacers has a specific GC content.As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogenous bases in an oligonucleotide that are either guanine (G) or cytosine (C).In various embodiments, the UNC13A oligonucleotide with one or more spacers has at least 10% GC content, at least 20% GC content, at least 25% GC content, at least 30% GC content, at least 35% GC content, at least 40% GC content, at least 45% GC content, at least 50% GC content, at least 55% GC content, at least 60% GC content, at least 65% GC content, at least 75% GC content, at least 80% GC content, at least 85% GC content, at least 90% GC content, or at least 95% GC content.In certain embodiments, the UNC13A oligonucleotide with one or more spacers has at least 30% GC content. In certain embodiments, the UNC13A oligonucleotide with one or more spacers has at least 40% GC content.In various embodiments, one or more spacers are arranged in the UNC13A oligonucleotide to maximize GC content.For example, instead of selecting guanine or cytosine for replacement by spacer in UNC13A oligonucleotide, thymine or adenine can be selected for replacement by spacer.

[0404] In various embodiments, UNC13A oligonucleotides with spacers are designed such that 1) each segment of UNC13A oligonucleotide has up to 7 linked nucleosides, and 2) at least 2, 3 or 4 spacers are located adjacent to the guanine base.In some embodiments, UNC13A oligonucleotides with spacers are designed such that 1) each segment of UNC13A oligonucleotide has up to 7 linked nucleosides, and 2) each of two spacers is located before the guanine base.

[0405] In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide with a spacer in restoring full-length UNC13A protein or full-length UNC13A mRNA compared to the effect of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide with a spacer in restoring full-length UNC13A protein or full-length UNC13A mRNA compared to the effect of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide with a spacer in reducing the amount of UNC13A transcript compared to the effect of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide with a spacer in reducing the amount of UNC13A transcript compared to the effect of the corresponding UNC13A parent oligonucleotide.

[0406] Tables 3A, 3B, 4, and 5 report the association of example UNC13A oligonucleotides with one or more spacers and their corresponding UNC13A parent oligonucleotides. Each UNC13A oligonucleotide is assigned a sequence name. As used hereafter, the sequence name designation is written as "X_spA" (for UNC13A AON with one spacer), "X_spA_spB" (for UNC13A AON with two spacers), or "X_spA_spB_spC" (for UNC13A AON with three spacers). In this specification, "X" refers to the length of the UNC13A AON, "A" refers to the position of the UNC13A AON where the first spacer is located, "B" refers to the position of the UNC13A AON where the second spacer is located, and "C" refers to the position of the UNC13A AON where the third spacer is located, if present.

[0407] In various embodiments, the UNC13A oligonucleotide comprises one spacer. In various embodiments, the UNC13A oligonucleotide is an oligonucleotide variant, such as 23mer, 21mer, or 19mer. In various embodiments, the inclusion of a spacer divides the UNC13A oligonucleotide into two separate segments, and at least one of the segments is up to 11 linked nucleosides in length. In various embodiments, the inclusion of a spacer divides the UNC13A oligonucleotide into two separate segments, and at least one of the segments is up to 10 linked nucleosides in length.

[0408] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 12 of the oligonucleotide. In certain embodiments, the spacer is located at position 10 of the oligonucleotide. In certain embodiments, the spacer is located at position 11 of the oligonucleotide. In certain embodiments, the spacer is located at position 12 of the oligonucleotide. In certain embodiments, the spacer is located at position 15 of the oligonucleotide. An example of an UNC13A AON with one spacer is documented in Table 3A below.

[0409] [Table 4-1]

[0410] [Table 4-2]

[0411] In various embodiments, UNC13A oligonucleotide comprises two spacers.In various embodiments, the inclusion of spacers divides UNC13A oligonucleotide into three separate segments, and at least one of the segments is up to 7 linked nucleosides in length.The UNC13A AON as an example having two spacers is reported in the following table 3B.

[0412] [Table 5-1]

[0413] [Table 5-2]

[0414] [Table 5-3]

[0415] [Table 5-4]

[0416] [Table 5-5]

[0417] In various embodiments, UNC13A oligonucleotide comprises three spacers. The inclusion of three spacers divides UNC13A oligonucleotide into four separate segments. In various embodiments, the three spacers are located at different positions of UNC13A oligonucleotide, so that each of the segments of UNC13A oligonucleotide is up to 7 linked nucleosides in length. The example UNC13A AON with three spacers is reported in Table 4 below.

[0418] [Table 6-1]

[0419] [Table 6-2]

[0420] [Table 6-3]

[0421] In various embodiments, the UNC13A AON with one or more spacers has a reduced length compared to the UNC13A AONs in Tables 3B and 4 above. For example, such an UNC13A AON can be an UNC13A oligonucleotide with one or more spacers. In various embodiments, the UNC13A oligonucleotide variant with one or more spacers is a 23mer, a 21mer, or a 19mer. In various embodiments, the UNC13A oligonucleotide variant includes two spacers, such that the UNC13A oligonucleotide variant includes three segments separated by two spacers. In various embodiments, at least one of the three segments has up to 7 linked nucleosides. In various embodiments, each of the three segments has up to 7 linked nucleosides. Exemplary UNC13A oligonucleotide variants with one or more spacers are shown in Table 5 below.

[0422] [Table 7-1]

[0423] [Table 7-2]

[0424] [Table 7-3]

[0425] In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise one or more spacers and one or more locked nucleic acids (LNAs). In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two spacers and two LNAs. In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two spacers and three LNAs.

[0426] In various embodiments, the spacer and the LNA are adjacent to each other in the antisense oligonucleotide.For example, when counting from 5' to 3', the LNA can be located at the 7th position of the antisense oligonucleotide, and the spacer can be located at the 8th position of the antisense oligonucleotide.As another example, when counting from 5' to 3', the LNA can be located at the 9th position of the antisense oligonucleotide, and the spacer can be located at the 8th position of the antisense oligonucleotide.As another example, when counting from 5' to 3', the LNA can be located at the 15th position of the antisense oligonucleotide, and the spacer can be located at the 16th position of the antisense oligonucleotide.As another example, when counting from 5' to 3', the LNA can be located at the 17th position of the antisense oligonucleotide, and the spacer can be located at the 16th position of the antisense oligonucleotide.

[0427] In certain embodiments, the first spacer is located adjacent to the first LNA in antisense oligonucleotide, and the second spacer is located adjacent to the second LNA.For example, when counting from 5' to 3', the first LNA can be located at the 7th position of antisense oligonucleotide, the first spacer can be located at the 8th position of antisense oligonucleotide, the second LNA can be located at the 15th position of antisense oligonucleotide, and the second spacer can be located at the 16th position of antisense oligonucleotide.As another example, when counting from 5' to 3', the first LNA can be located at the 7th position of antisense oligonucleotide, the first spacer can be located at the 8th position of antisense oligonucleotide, the second LNA can be located at the 17th position of antisense oligonucleotide, and the second spacer can be located at the 16th position of antisense oligonucleotide. As another example, counting from 5' to 3', a first LNA may be located at position 9 of the antisense oligonucleotide, a first spacer may be located at position 8 of the antisense oligonucleotide, a second LNA may be located at position 17 of the antisense oligonucleotide, and a second spacer may be located at position 16 of the antisense oligonucleotide.

[0428] In various embodiments, one or more spacers and one or more LNAs are not adjacent to each other in antisense oligonucleotide.For example, when counting from 5' to 3', LNA can be located at the 4th position of antisense oligonucleotide, and spacer can be located at the 8th position of antisense oligonucleotide.For example, when counting from 5' to 3', LNA can be located at the 20th position of antisense oligonucleotide, and spacer can be located at the 16th position of antisense oligonucleotide.In certain embodiments, when counting from 5' to 3', the first LNA can be located at the 4th position of antisense oligonucleotide, the first spacer can be located at the 8th position of antisense oligonucleotide, the second LNA can be located at the 20th position of antisense oligonucleotide, and the second spacer can be located at the 16th position of antisense oligonucleotide. In certain embodiments, counting from 5' to 3', the first LNA may be located at position 4 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 12 of the antisense oligonucleotide, the second spacer may be located at position 16 of the antisense oligonucleotide, and the third LNA may be located at position 20 of the antisense oligonucleotide.

[0429] UNC13A oligonucleotide performance Generally, UNC13A oligonucleotides and / or UNC13A parent oligonucleotides (e.g., UNC13A oligonucleotides having a sequence of any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292) target UNC13A transcripts (e.g., UNC13A pre-mRNAs) that contain a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NOs: 5057-5065 or 5206-5208, and produce UNC13A pre-mRNAs that are translatable to produce a functional UNC13A protein (e.g., full-length UNC13A). Increase, restore, rescue, or stabilize mRNA expression levels. In various embodiments, UNC13A AONs can show at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase in full-length UNC13A mRNA. In various embodiments, UNC13A AONs can show at least 100%, 200%, 300%, or 400% increase in full-length UNC13A mRNA. In various embodiments, UNC13A AONs can show at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction in mis-spliced ​​UNC13A mRNA. In various embodiments, UNC13A AONs can show at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase in full-length UNC13A protein. In various embodiments, UNC13A AON can show at least 100%, 200%, 300% or 400% increase in full-length UNC13A protein.In some embodiments, the percentage increase in full-length UNC13A protein is compared with the reduction in the level of full-length UNC13A protein achieved by using TDP43 antisense oligonucleotide.For example, TDP43 antisense oligonucleotide can be used to deplete full-length UNC13A protein, and then UNC13A AON can be used to increase full-length UNC13A protein.

[0430] In some embodiments, UNC13A AON can show at least 10%, 20%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% rescue of full-length UNC13A protein. In some embodiments, full-length UNC13A rescue percentage refers to the % of full-length UNC13A after depletion with TDP43 antisense oligonucleotide and treatment with UNC13A AON compared to negative control (e.g., cells that were not depleted or treated, or cells treated with vehicle solution).

[0431] In various embodiments, the UNC13A AON may show at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of UNC13A transcripts with cryptic exons. In various embodiments, the UNC13A AON may show at least 100% reduction of UNC13A transcripts with cryptic exons. In various embodiments, the reduction of UNC13A transcripts with cryptic exons is measured relative to the level of UNC13A transcripts with cryptic exons detected using TDP43 antisense oligonucleotides. In various embodiments, the UNC13A AON may show at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction of UNC13A transcripts with cryptic exons.

[0432] qualification A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of a nucleoside is usually a heterocyclic base moiety. A nucleotide is a nucleoside that further comprises a phosphate group covalently linked to the sugar portion of the nucleoside. In those nucleosides that contain a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed by covalently linking adjacent nucleosides to each other to form a linear polymeric oligonucleotide. In the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0433] Modifications to antisense compounds include substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms due to desirable properties, such as, for example, enhanced uptake into cells, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, and increased activity.

[0434] Chemically modified nucleosides may also be used to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids, such that shorter antisense compounds having such chemically modified nucleosides often achieve comparable results.

[0435] Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages due to desirable properties, such as, for example, enhanced cellular uptake, increased affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0436] The oligonucleotide with modified internucleoside linkage includes the internucleoside linkage that holds phosphorus atom and the internucleoside linkage that does not have phosphorus atom.Representative phosphorus-containing internucleoside linkage includes, but is not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate and phosphorothioate.The method of preparing phosphorus-containing and non-phosphorus-containing linkage is well known.

[0437] In certain embodiments, the antisense compound targeted to UNC13A nucleic acid comprises one or more modified internucleoside linkages.In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound.In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages.In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.In certain embodiments, the antisense compound targeted to UNC13A nucleic acid comprises at least one phosphodiester linkage and at least one phosphorothioate linkage.

[0438] modified sugar moiety Antisense compounds may optionally contain one or more nucleosides with modified sugar groups. Such sugar-modified nucleosides may impart improved nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs), modification of the ribosyl ring oxygen atoms with S, N(R) or C(R1)(R2) (where R, R1 and R2 are each independently selected from H, C1-C1, and H2O, respectively). 12Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (see PCT International Publication No. WO 2008 / 101157 published Aug. 21, 2008 for other disclosed 5',2'-bis substituted nucleosides), or ribosyl ring oxygen atom substituted with S and further substitution at the 2' position (see U.S. Patent Publication No. 2005 / 0130923 published Jun. 16, 2005), or 5' substitution of BNA (see PCT International Publication No. WO 2007 / 134181 published Nov. 22, 2007 (LNA substituted with, for example, a 5'-methyl or 5'-vinyl group)).

[0439] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or 5), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F and 2'-O(CH2)2OCH3 substituents. Substituents at the 2' position also include allyl, amino, azido, thio, O-allyl, O-C1-C2-alkyl, O-C1 ... 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n )-, where each R l , R m and R n are independently H or substituted or unsubstituted C1-C 10 It is an alkyl.

[0440] Further examples of modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'-MOE), 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4'-bridged nucleic acids (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0441] As used herein, "bicyclic nucleoside" refers to modified nucleosides that contain bicyclic sugar moieties. Examples of bicyclic nucleosides include, but are not limited to, nucleosides that contain a bridge between the 4' ribosyl ring atom and the 2' ribosyl ring atom. In certain embodiments, the antisense compounds provided herein contain one or more bicyclic nucleosides that contain a bridge from 4' to 2'. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, one of the following formulas: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see U.S. Pat. No. 7,399,845, issued July 15, 2008); 4'-C(CH3)(CH3)-O-2' (and analogs thereof, see U.S. Pat. No. 7,399,845, issued July 15, 2008); for analogs see Published International Application No. 2009 / 006478 published January 8, 2009; 4'-CH2-N(OCH3)-2' (and analogs see Published International Application No. 2008 / 150729 published December 11, 2008); 4'-CH2-ON(CH3)-2' (see Published U.S. Patent Application No. 2004-0171570 published September 2, 2004); 4'-CH2-N(R)-O-2', where R is H, C1-C 12alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C-(=CH2)-2' (and analogs thereof, see Published International Application WO 2008 / 154401, published Dec. 8, 2008).

[0442] Further reports relating to bicyclic nucleosides can also be found in the published literature (see, for example, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379;Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561;Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication Nos. 2008 / 0039618; 2009 / 0012281; U.S. Patent Application Publication Nos. 60 / 989,574; 61 / 026,99 No. 5; No. 61 / 026,998; No. 61 / 056,564; No. 61 / 086,231; No. 61 / 097,787; and No. 61 / 099,844; published PCT International Applications Nos. 1994 / 014226; 2004 / 106356; 2005 / 021570; 2007 / 134181; 2008 / 150729; 2008 / 154401; and 2009 / 006478). Each of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published as WO 99 / 14226 on March 25, 1999).

[0443] In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside includes compounds having at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, such bridge being independently selected from the group consisting of -[C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x- and -N(R a )-, or 2-4 linking groups independently selected from x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxy, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 This includes, but is not limited to, compounds in which the aryl group is an aminoalkyl, or a protecting group.

[0444] In certain embodiments, the bridge of the bicyclic sugar moiety is -[C(R a )(R b )] n -,-[-[C(R a )(Rb )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R b In certain embodiments, the bridges are 4'-CH-2', 4'-(CH)-2', 4'-(CH)-2', 4'-CH-O-2', 4'-(CH)-O-2', 4'-CH-ON(R)-2', and 4'-CH-N(R)-O-2'-, where each R is independently H, a protecting group, or a C1-C 12 is alkyl, R a and R b are each independently H, a protecting group, hydroxy, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); J1 and J2 are each independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008).

[0445] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration.For example, nucleosides that contain 4'-2' methylene-oxy bridges can be in α-L or β-D configuration.Previously, α-L-methyleneoxy (4'-CH2-O-2') BNAs have been incorporated into antisense oligonucleotides and have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0446] In certain embodiments, the bicyclic nucleoside is an α-L-methyleneoxy (4'-CH2-O-2') BNA, a β-D-methyleneoxy (4'-CH2-O-2') BNA, an ethyleneoxy (4'-(CH2)2-O-2) BNA, an aminooxy (4'-CH2-ON(R)-2') BNA, an oxyamino (4'-CH2-N(R)-O-2') BNA, a methyl (methyl) methyleneoxy) (4'-CH(CH3)-O-2') BNAs, methylene-thio (4'-CH2-S-2') BNAs, methylene-amino (4'-CH2-N(R)-2') BNAs, methyl carbocyclic (4'-CH2-CH(CH3)-2') BNAs, and propylene carbocyclic (4'-(CH2)3-2') BNAs; where R is H, C1-C 12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued Sep. 23, 2008).

[0447] The present disclosure provides, in some embodiments, a method for treating, improving, or preventing a neurological disease and / or neurological disorder, further comprising administering to a patient a pharma- ceutically acceptable composition, e.g., a pharma-ceutically acceptable formulation comprising one or more UNC13A oligonucleotides. The UNC13A oligonucleotides can increase, restore, or stabilize UNC13A activity, e.g., UNC13A activity, and / or UNC13A expression level, e.g., UNC13A mRNA and / or protein expression.

[0448] The present disclosure also provides pharmaceutical compositions in which UNC13A oligonucleotides are formulated with one or more pharma- ceutically or cosmetically acceptable excipients.These formulations include those suitable for oral, sublingual, intratracheal, nasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, for example, as part of a composition suitable for topical application to skin and / or mucosa, for example, as part of a composition in the form of a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor, or tincture.However, the most suitable administration form in any given case will depend on the extent and severity of the condition being treated and the nature of the particular UNC13A oligonucleotide being used.

[0449] The present disclosure also provides a pharmaceutical composition comprising an UNC13A oligonucleotide or a pharma- ceutically acceptable salt thereof (e.g., an UNC13A AON comprising any of the sequences set forth in SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292).

[0450] The present disclosure also provides methods that include the use of pharmaceutical compositions that include UNC13A AONs formulated with one or more pharma- ceutically acceptable excipients. Exemplary compositions provided herein include compositions that include UNC13A AONs and one or more pharma-ceutically acceptable excipients. Formulations include formulations that are suitable for oral, sublingual, intratracheal, nasal, transdermal, pulmonary, intracisternal, intrathalamic, intrathoracic, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or topical use. The most suitable administration form in any given case will depend on the clinical symptoms, complications, or biochemical indicators of the condition, disorder, disease, or condition that is being prevented in the subject; the condition, disorder, disease, or condition that is being prevented in the subject; and / or the nature of the specific compound and / or composition that is being used.

[0451] Additional chemically modified UNC13A oligonucleotides The UNC13A AON described herein may comprise chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides.Chemically modified nucleosides include, but are not limited to, uracil, uridine, 2'-O-(2-methoxyethyl) modified, such as 2'-O-(2-methoxyethyl) guanosine, 2'-O-(2-methoxyethyl) adenosine, 2'-O-(2-methoxyethyl) cytosine, and 2'-O-(2-methoxyethyl) thymidine.In certain embodiments, mixed modalities, such as a combination of UNC13A peptide nucleic acid (PNA) and UNC13A locked nucleic acid (LNA). Chemically modified nucleosides also include, but are not limited to, locked nucleic acid (LNA), 2'-O-methyl, 2'-fluoro, and 2'-fluoro-β-D-arabinonucleotide (FANA), and fluorocyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that can be included in the UNC13A AONs described herein are described in Johannes and Lucchino, (2018) "Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs" Nucleic Acid Ther. 28(3): 178-93; Rettig and Behlke, (2012) "Progress toward in vulivulo use of siRNAs-II" Mol Ther 20:483-512; and Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3):238-48, the contents of each of which are incorporated herein by reference.

[0452] The UNC13A AON described herein may include chemical modifications that promote the stabilization of the terminal 5'-phosphate of oligonucleotides, and phosphatase-resistant analogs of 5'-phosphate. Chemical modifications that promote the stabilization of the terminal 5'-phosphate of oligonucleotides, or phosphatase-resistant analogs of 5'-phosphate include, but are not limited to, 5'-methyl phosphonate, 5'-methylene phosphonate, 5'-methylene phosphonate analogs, 5'-E-vinyl phosphonate (5'-E-VP), 5'-phosphorothioate, and 5'-C-methyl analogs. Chemical modifications that promote the stabilization of AON terminal 5'-phosphate and phosphatase-resistant analogs of 5'-phosphate are described in Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3):238-48, the contents of which are incorporated herein by reference.

[0453] In some embodiments described herein, the UNC13A AON described herein may include chemically modified nucleosides, such as 2'O-methyl ribonucleosides, such as 2'O-methyl cytidine, 2'O-methyl guanosine, 2'O-methyl uridine, and / or 2'O-methyl adenosine. The UNC13A AON described herein may include one or more chemically modified bases, including 5-methyl pyrimidines, such as 5-methyl cytosine, and / or 5-methyl purines, such as 5-methyl guanine. The chemically modified nucleosides may further include pseudouridine or 5' methoxyuridine. The UNC13A AONs described herein can include any of the following chemically modified nucleosides: 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methylthymidine, 5-methylcytidine, 5-methyluridine, and / or 5-methyl2'-deoxycytidine.

[0454] The UNC13A AONs described herein can include a phosphate backbone in which one or more of the oligonucleoside linkages are phosphate linkages. The UNC13A AONs described herein may include modified oligonucleotide backbones, wherein one or more of the nucleoside linkages of the sequence are selected from the group consisting of phosphorothioate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoroamidothioate linkages, thiophosphorodiamidate linkages, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate linkages, thiophosphoramidate linkages, thionoalkylphosphonate linkages, thionoalkylphosphotriester linkages, thiophosphate linkages, selenophosphate linkages, and boranophosphate linkages. In some embodiments of the UNC13A AONs described herein, at least one (i.e., one or more) internucleoside linkages of the oligonucleotide are phosphorothioate linkages. For example, in some embodiments of the UNC13A AONs described herein, one, two, three, or more internucleoside linkages of the oligonucleotide are phosphorothioate linkages. In preferred embodiments of the UNC13A AONs described herein, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Thus, in some embodiments, all nucleotide linkages of the UNC13A AONs of any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 are phosphorothioate linkages. In some embodiments, one or more of the nucleotide linkages of the UNC13A AONs of any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292 are phosphorothioate linkages.

[0455] In various embodiments, the nucleotide linkages of the UNC13A AONs described herein, such as any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292, comprise a mixture of phosphodiester and phosphorothioate linkages.

[0456] In some embodiments, the nucleoside linkage linking the bases at position 3 of the UNC13A AON described herein is a phosphodiester bond.For example, the bases at position 3 may be linked to each adjacent base (e.g., the previous base and the following base) through a phosphodiester bond.An example of a 25mer UNC13A AON having a phosphodiester bond linking the bases at position 3 is: XXoDoXXXXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0457] In some embodiments, one of the nucleoside linkages linking the base at position 3 of the UNC13A AON described herein is a phosphodiester bond.For example, the base at position 3 may be linked to either the previous base or the next base through a phosphodiester bond.An example of a 25mer UNC13A AON having a phosphodiester bond linking the base at position 3 to the previous base is: XXoDXXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0458] An example 25mer UNC13A AON with a phosphodiester bond linking the 3rd base to the following base is: XXDoXXXXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0459] In various embodiments, in addition to one of the nucleoside linkages linking the bases at position 3 of the UNC13A AON described herein being a phosphodiester bond, the UNC13A AON further comprises two spacers. The two spacers can be positioned in the UNC13A AON such that the UNC13A AON comprises a segment with up to 7 linked nucleosides. An example 25mer UNC13A AON with two spacers and a phosphodiester bond linking the base at position 3 to the previous base is: XxoDS1XXXXXXXXXS2XXXXXXXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0460] An example 25mer UNC13A AON with two spacers and a phosphodiester bond connecting the 3rd base to the following base is: XXDoXXXXXXXS1XXXXXXXXXS2XXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0461] In some embodiments, the nucleoside linkage linking the bases at position 4 of the UNC13A AONs described herein is a phosphodiester bond.For example, the bases at position 4 may be linked to each adjacent base (e.g., the previous base and the following base) through a phosphodiester bond.An example 25mer UNC13A AON having a phosphodiester bond linking the bases at position 4 is: XXXoDoXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.

[0462] In some embodiments, one of the nucleoside linkages linking the base at position 4 of the UNC13A AON described herein is a phosphodiester bond.For example, the base at position 4 may be linked to either the previous base or the next base through a phosphodiester bond.An example 25mer UNC13A AON with a phosphodiester bond linking the base at position 4 to the previous base is: XXXoDXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.

[0463] An example 25mer UNC13A AON with a phosphodiester bond linking the base at position 4 to the following base is: XXXDoXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.

[0464] In some embodiments, the nucleoside linkages linking both the 3rd and 4th bases of the UNC13A AON described herein are phosphodiester bonds.For example, the 3rd base may be linked to each adjacent base (e.g., the previous base and the following base) through a phosphodiester bond, and the 4th base may be linked to each adjacent base (e.g., the previous base and the following base) through a phosphodiester bond.An example 25mer UNC13A AON with a phosphodiester bond linking the 3rd and 4th bases is: XXoDoEoXXXXXXXXXXXXXXXXXX where "o" represents a phosphodiester bond, "D" represents the base at position 3, and "E" represents the base at position 4. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0465] In various embodiments, the UNC13A AON described herein comprises one or more spacers, and the phosphodiester bond is located relative to the one or more spacers. In some embodiments, the Y bases immediately preceding the spacer are linked through a phosphodiester bond. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In certain embodiments, Y is 2 bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the UNC13A AON are each linked to their respective adjacent bases through a phosphodiester bond. As described herein, the spacer can be located at various positions in the UNC13A AON, and therefore the two bases immediately preceding the spacer can vary within the UNC13A AON depending on where the spacer is located.

[0466] In various embodiments, the UNC13A AON may contain more than one spacer. In some embodiments, only one of the spacers has Y bases immediately before the spacer linked through a phosphodiester bond. In such embodiments, the other spacers are linked to their respective previous bases through phosphorothioate bonds. In various embodiments, two of the spacers have Y bases immediately before the spacer linked through a phosphodiester bond. In various embodiments, each of the spacers in the UNC13A AON has Y bases immediately before the spacer linked through a phosphodiester bond. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds.

[0467] In some embodiments, the Y bases immediately before the spacer and the Z bases immediately after the spacer are linked through phosphodiester bonds. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. Y and Z can be independent of each other. In certain embodiments, Y is 1 base and Z is 1 base. For example, when the spacer is located at position 15, the bases at positions 14 and 16 of the UNC13A AON are each linked to their respective adjacent bases through phosphodiester bonds. For example, such an UNC13A AON (e.g., a 25mer) may be: XXXXXXXXXXXXXoDoSoEoXXXXXXXXX where "S" represents a spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the spacer, and "E" represents the base immediately following the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0468] As described herein, the spacer can be located at various positions in the UNC13A AON, and therefore the base immediately preceding or following the spacer can vary within the UNC13A AON depending on where the spacer is located.

[0469] In various embodiments, the UNC13A AON may contain more than one spacer. In some embodiments, only one of the spacers has Y bases immediately before the spacer and Z bases immediately after the spacer linked through phosphodiester bonds. In such embodiments, the other spacers of the UNC13A AON are linked to their respective previous and subsequent bases through phosphorothioate bonds. For example, such an UNC13A AON (e.g., 25mer) may be: XXXXoDoS1oEoXXXXXXXXXXXS2XXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the spacer, and "E" represents the base immediately following the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0470] As another example, such an UNC13A AON (e.g., a 25mer) may be: XXXXXS1XXXXXXXXXXXoDoS2oDoXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the spacer, and "E" represents the base immediately following the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0471] In some embodiments, one of the spacers is linked to the immediately preceding base through a phosphodiester bond. For example, the UNC13A AON comprises a first spacer linked to the immediately preceding base through a phosphodiester bond, which is: XXXXXXoS1XXXXXXXXXXXS2XXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0472] As another example, the UNC13A AON contains a second spacer linked to the immediately preceding base through a phosphodiester bond, which is: XXXXXXS1XXXXXXXXXXXoS2XXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0473] In various embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, a 21mer, or a 19mer) in which one of the spacers is linked to the immediately preceding base through a phosphodiester bond. For example, the UNC13A AON can be a 21mer with a first spacer linked to the immediately preceding base through a phosphodiester bond, which is: XXXXXXXoS1XXXXXS2XXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0474] As another example, the UNC13A AON can be a 21-mer with a second spacer linked to the immediately preceding base through a phosphodiester bond, which is: XXXXXXXS1XXXXXoS2XXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0475] In some embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, 21mer, or 19mer) in which one of the spacers is linked to the immediately preceding base through a phosphodiester bond, which in turn is linked to the previous base through a phosphodiester bond. An exemplary 21mer UNC13A AON is: XXXEoDoS1XXXXXXS2XXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S1, and "E" represents the base immediately preceding "D." Any nucleobase in the AON can be a nucleobase analog.

[0476] As another example, the 21mer UNC13A AON: XXXXXS1XXXXEoDoS2XXXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S2, and "E" represents the base immediately preceding D. Any nucleobase in the AON can be a nucleobase analog.

[0477] In some embodiments, the UNC13A AON can be an AON variant (e.g., 23mer, 21mer, or 19mer) in which the base immediately preceding the first spacer is linked to another base through a phosphodiester bond. The base immediately preceding the first spacer may be linked to the first spacer through a non-phosphodiester bond, such as a phosphorothioate bond. In addition, the second spacer is linked to the immediately preceding base through a phosphodiester bond. Examples of 21mer UNC13A AONs include: XXXEoDS1XXXXXXoS2XXXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S1, and "E" represents the base immediately preceding D. Herein, the base "D" is linked to the first spacer S1 through a non-phosphodiester bond (e.g., a phosphorothioate bond). In addition, the base "D" is linked to the base "E" through a phosphodiester bond. The second spacer S2 is linked to the immediately preceding base through a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0478] Another example of such a 21mer UNC13A AON is: XXXXXoS1XXXXEoDS2XXXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S2, and "E" represents the base immediately preceding D. Herein, base "D" is linked to second spacer S2 through a non-phosphodiester bond (e.g., phosphorothioate bond). In addition, base "D" is linked to base "E" through a phosphodiester bond. First spacer S1 is linked to the immediately preceding base through a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0479] In some embodiments, one of the spacers is linked to the immediately following base through a phosphodiester bond. For example, the UNC13A AON comprises a first spacer linked to the immediately following base through a phosphodiester bond, which is: XXXXXXS1oXXXXXXXXXXXS2XXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0480] As another example, the UNC13A AON contains a second spacer linked to the immediately following base through a phosphodiester bond, which is: XXXXXXS1XXXXXXXXXXXS2oXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0481] In various embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, a 21mer, or a 19mer) in which one of the spacers is linked to the immediately following base through a phosphodiester bond. For example, the UNC13A AON can be a 21mer with a first spacer linked to the immediately following base through a phosphodiester bond, which is: XXXXXXXS1oXXXXXS2XXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0482] As another example, the UNC13A AON can be a 21-mer with a second spacer linked to the immediately following base through a phosphodiester bond, which is: XXXXXXXS1XXXXXS2oXXXXXXX where "S1" represents a first spacer, "S2" represents a second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0483] In various embodiments, two of the spacers have Y bases immediately before the spacer and Z bases immediately after the spacer that are linked through a phosphodiester bond. In various embodiments, each of the spacers in the UNC13A AON has Y bases immediately before the spacer and Z bases immediately after the spacer that are linked through a phosphodiester bond. Examples of such UNC13A AONs (e.g., 25mers) include: XXXXoDoS1oEoXXXXXXXXXXoFoS2oHoXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding the first spacer, "E" represents the base immediately following the first spacer, "F" represents the base immediately preceding the second spacer, and "H" represents the base immediately following the second spacer. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0484] In various embodiments, the UNC13A AON comprises two or more spacers, and the range of bases located between the two spacers is linked through phosphodiester bonds. In various embodiments, the range of bases comprises 2, 3, 4, 5, 6, or 7 bases linked through phosphodiester bonds. In certain embodiments, the range of bases comprises 2 bases linked through phosphodiester bonds. In certain embodiments, the range of bases comprises 4 bases linked through phosphodiester bonds. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0485] In various embodiments, the range of bases linked through phosphodiester bonds is located Y bases after the first spacer and Z bases before the second spacer. In various embodiments, Y is 1, 2, 3, 4, 5, 6, or 7 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, or 7 bases. Y and Z can be independent of each other. Any nucleobase in the AON can be a nucleobase analog.

[0486] In certain embodiments, Y is 5 bases and Z is 4 bases. By way of example, such an UNC13A AON (e.g., a 25-mer) may be: XXXXXXXXS1XXXXoDoEoFoHoXXXS2XXXX where "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. The bases "D", "E", "F", and "H" represent a range of bases that are linked through phosphodiester bonds. In this example, the range of bases is located 5 bases after the first spacer (e.g., D is located 5 bases after the first spacer), and the range of bases is located 4 bases before the second spacer (e.g., H is located 4 bases before the second spacer). Any nucleobase in the AON can be a nucleobase analog.

[0487] In certain embodiments, Y is 4 bases and Z is 3 bases. By way of example, such an UNC13A AON (e.g., a 23mer) can be: XXXXXXXS1XXXoDoEoXXS2XXXXXXX where "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. The bases "D" and "E" represent the range of bases that are linked through phosphodiester bonds. In this example, the range of bases is located four bases after the first spacer (e.g., D is located four bases after the first spacer), and the range of bases is located three bases before the second spacer (e.g., E is located three bases before the second spacer). In various embodiments, the positions of the two spacers are different from those shown above, and therefore the range of bases that are linked through phosphodiester bonds are located differently. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0488] In some embodiments, the disclosed UNC13A AONs can have, for example, at least one modified nucleobase, e.g., 5-methylcytosine, and / or at least one methylphosphonate nucleotide, located at either only one of the 5' or 3' termini, or at both the 5' and 3' termini, or along the oligonucleotide sequence.

[0489] UNC13A AON may comprise at least one modified sugar.For example, the sugar moiety of at least one nucleotide that constitutes the oligonucleotide is a ribose, the 2'-OH group of which may be replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br and I (wherein R is alkyl or aryl, and R' is alkylene). Examples of modified sugar moieties include 2'-Ome modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'-MOE or MOE), 2'-O-(N-methylacetamide), 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4' bridged nucleic acids (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0490] In some embodiments, the UNC13A AON is a 2'OMe (e.g., an UNC13A AON containing one or more 2'OMe modified sugars), a 2'-MOE or MOE (e.g., an UNC13A AON containing one or more 2'-MOE modified sugars), a PNA (e.g., an UNC13A AON containing one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkages as repeating units in place of a sugar-phosphate backbone), an LNA (e.g., an UNC13A AON containing one or more locked ribose, and which can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), a c-ET (e.g., an UNC13A AON containing one or more cET sugars), a cMOE (e.g., an UNC13A AON containing one or more cMOE sugars), a morpholino oligomer (e.g., an UNC13A AON containing a backbone containing one or more PMOs), AON), deoxy-2'-fluoronucleosides (e.g., UNC13A AONs comprising one or more 2'-fluoro-β-D-arabinonucleosides), tcDNA (e.g., UNC13A AONs comprising one or more tcDNA modified sugars), ENA (e.g., UNC13A AONs comprising one or more ENA modified sugars), or HNA (e.g., UNC13A AONs comprising one or more HNA modified sugars). In some embodiments, the UNC13A AONs comprise one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphoroamidate linkages, thiophosphorodiamidate linkages, morpholino linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, and PNA linkages. In some embodiments, the UNC13A AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0491] In some embodiments, the UNC13A AON having any one of the sequences of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292 is a chiral controlled oligonucleotide, such as a chiral controlled oligonucleotide described in any one of U.S. Pat. Nos. 9,982,257, 10,590,413, 10,724,035, 10,450,568, and PCT Publication No. WO 2019200185, each of which is incorporated herein by reference in its entirety.

[0492] For example, an UNC13A AON having any one of the sequences of SEQ ID NOs: 1 to 1264, 2529 to 3792, 5066 to 5166, 5168 to 5202, 5209 to 5221, or 5235 to 5292 is a chiral controlled oligonucleotide comprising at least one type of multiple oligonucleotides, each type comprising: 1) a base sequence; 2) a backbone linkage pattern; 3) a backbone chiral center pattern; and 4) a backbone X-moiety (-XLR 1 ); at least one type of oligonucleotide comprises one or more phosphorothioate triester internucleotide linkages and one or more phosphate diester linkages; at least one type of oligonucleotide comprises at least two consecutive modified internucleotide linkages; and at least one oligonucleotide type of oligonucleotide comprises a pattern of:

[0493] [ka] independently having the structure: P * is an asymmetric phosphorus atom, either Rp or Sp; W is O, S, or Se; each of X, Y, and Z is independently -O-, -S-, -N(-LR 1)-, or L; L is a covalent bond or an optionally substituted straight or branched chain C1-C 50 alkylene, wherein one or more methylene units of L are optionally and independently replaced by optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; R 1 is halogen, R, or optionally substituted C1-C 10aliphatic, one or more methylene units being optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R each R' is optionally and independently replaced by -R, -C(O)R, - -CO2R, or -SO2R, or two R' on the same nitrogen together with their intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and each

[0494] [ka] represents a linkage to a nucleoside independently. In some embodiments, the UNC13A AON having any one of the sequences of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292 is a chiral controlled oligonucleotide containing certain chemical modifications (e.g., 2'F (containing a fluorine molecule at the 2' ribose position (instead of the 2'-hydroxyl group in the RNA monomer), 2'-OMe, phosphorothioate linkage, lipid conjugation, etc.) as described in U.S. Pat. No. 10,450,568.

[0495] Motor neuron disease Motor neuron diseases are a group of diseases characterized by the loss of motor neuron function, which coordinates voluntary muscle movements with the brain.Motor neuron diseases can affect upper and / or lower motor neurons and can be sporadic or familial.Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis.Spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.

[0496] Symptoms of motor neuron disease include muscle weakness or debility, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiffness in the limbs, difficulty breathing, drooling, and complete loss of muscle control, including basic functions such as breathing, swallowing, feeding, speaking, and moving the limbs. These symptoms are sometimes also accompanied by depression, memory loss, difficulty planning, speech disorders, behavioral changes, and difficulty assessing spatial relationships and / or personality changes.

[0497] Motor neuron disease can be evaluated and diagnosed by a skilled physician, such as a neurologist, using various tools and tests. For example, the presence or risk of developing motor neuron disease can be evaluated or diagnosed using blood and urine tests (e.g., tests that assay for the presence of creatine kinase), magnetic resonance imaging (MRI), electromyogram (EMG), nerve conduction studies (NCS), spinal tap, lumbar puncture, and / or muscle biopsy. Motor neuron disease can be diagnosed with the help of a physical examination and / or a neurological examination to evaluate motor and sensory skills, neurological function, hearing and speech, vision, coordination and balance, mental status, and changes in mood or behavior.

[0498] Amyotrophic lateral sclerosis ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons. Symptoms of ALS include bulbar muscle weakness and wasting, generalized and bilateral loss of muscle strength, spasticity, muscle spasms, cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe. Some people with ALS also have cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregation in the cytoplasm of motor neurons, including aggregation of the RNA-linked protein TDP43.

[0499] ALS is most common in men over the age of 40, although it can occur in women and children. The risk of ALS is also high in people who smoke, are exposed to chemicals such as lead, or have served in the military. Most cases of ALS are sporadic, with only 10% of cases being familial. Causes of ALS include sporadic or inherited gene mutations, high levels of glutamate, and protein misuse. Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.

[0500] frontotemporal dementia Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). It has an earlier average age of onset than Alzheimer's disease, age 40 years. Symptoms of FTD include extreme changes in behavior and personality, speech and language disorders, and movement-related symptoms such as tremors, rigidity, muscle spasms, weakness, and difficulty swallowing. Subtypes of FTD include behavioral frontotemporal dementia (bvFTD), characterized by personality and behavior changes, and primary progressive aphasia (PPA), which affects language skills, speech, writing, and comprehension. FTD is associated with tau protein accumulation (Pick bodies) and alterations in TDP43 function. Approximately 30% of FTD cases are familial, with no other known risk factors other than a family history of the disease. Genetic mutations associated with FTD include mutations in the genes C9orf72, progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1 and TBP.

[0501] Amyotrophic lateral sclerosis with frontotemporal dementia Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the most common cause of familial ALS and FTD. In addition, mutations in TBK1, VCP, SQSTM1, UBQLN2 and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic changes in personality, as well as muscle weakness, muscle atrophy, fasciculations, spasticity, neurogenic speech disorder, dysphagia, and degeneration of the spinal cord, motor neurons, and frontotemporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and / or FUS proteins. TBK1 mutations are associated with ALS, FTD, and ALS with FTD.

[0502] Limbic-predominant age-related TDP-43 encephalopathy (LATE) Limbic-predominant age-related TDP-43 encephalopathy (LATE) is characterized by the accumulation of misfolded TDP-43 protein in the brain, especially in the limbic system. LATE is a neurological disorder that typically appears in older patients (e.g., over 80 years of age). LATE can be a diagnosis of dementia and often resembles symptoms of Alzheimer's disease, including memory loss, confusion, and mood changes.

[0503] Treatment Method The present disclosure contemplates, in part, treating a neurological disease in a patient in need thereof, comprising administering the UNC13A AON of the present disclosure, including any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), limbic-predominant age-related TDP-43 encephalopathy (LATE), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial onset sensorimotor neuropathy, Guam Parkinson-Dementia Complex, multisystem proteinopathy, CTE, and synaptic diseases such as autism. In some embodiments, provided herein is a method for treating a neurological disease in a patient in need thereof, comprising administering the UNC13A AON of the present disclosure. In some embodiments of the present disclosure, an effective amount of an UNC13A oligonucleotide of the present disclosure may be administered to a patient in need thereof to treat a neurological disease and / or to increase, restore or stabilize expression of UNC13A mRNA that can be translated to produce a functional UNC13A protein, thereby increasing, restoring or stabilizing UNC13A activity and / or function.

[0504] In some embodiments, treating neurological disease comprises at least improving or reducing one symptom associated with neurological disease (e.g., reducing muscle weakness in ALS patients).Provides a method for treating neurological disease (e.g., ALS, FTD, or ALS with FTD) in a patient suffering from neurological disease, comprising administering the UNC13A AON of the present disclosure.In some embodiments, provides a method for slowing the progression of neurological disease, for example, motor neuron disease.

[0505] Provided herein is a method for treating, reducing the risk of developing, or delaying the onset of neurological disease in a subject in need thereof, comprising administering the UNC13A AON of the present disclosure.Methods include, for example, treating the subject at risk of developing neurological disease, for example, administering to the subject an effective amount of the UNC13A AON of the present disclosure.The neurological diseases that can be treated in this way include motor neuron disease, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

[0506] Methods for preventing or treating neurological diseases (e.g., PD, ALS, FTD, and ALS with FTD) form part of the present disclosure. Such methods can include administering to a patient in need thereof or at risk thereof a pharmaceutical preparation comprising the UNC13A AON disclosed herein. For example, a method for preventing or treating neurological diseases is provided, comprising administering to a subject in need thereof the UNC13A AON disclosed herein.

[0507] The patient treated using the above method may experience at least about 5%, 10%, 20%, 30%, 40%, or even 50% increase, restoration, or stabilization of UNC13A mRNA expression that can be translated to produce functional UNC13A protein, for example, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or more after administration of UNC13A oligonucleotide, thereby increasing, restoring, or stabilizing UNC13A activity and / or function in target cells (e.g., motor neurons).In some embodiments, administering such UNC13A oligonucleotide may be, for example, at least daily.The UNC13A oligonucleotide may be administered orally.In some embodiments, the UNC13A oligonucleotide is administered intrathecally, intrathalamus, or intracisternomagna. For example, in the embodiment described herein, UNC13A oligonucleotide is administered intrathecally, intrathalamus, or intracisternomagna every about 3 months.As a result of administering the UNC13A oligonucleotide disclosed herein, the delay or improvement of the clinical manifestation of neurological disease in patients can be at least, for example, 6 months, 1 year, 18 months, or even 2 years or more, compared to patients who do not administer the UNC13A oligonucleotide such as those disclosed herein.

[0508] UNC13A oligonucleotides can be used alone or in combination with each other, whereby at least two UNC13A oligonucleotides are used together in a single composition or as part of a treatment regimen.UNC13A oligonucleotides can also be used in combination with other drugs or AONs to treat neurological diseases or conditions.

[0509] In various embodiments, provided herein is a method of treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, and wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoroamino linkages, or phosphoamino linkages. and / or at least one (i.e., one or more) nucleosides are independently selected from the group consisting of 2'-O-(2-methoxyphenyl)thioate, 2'-aminophenyl ... and wherein the oligonucleotide is substituted with a member selected from the group consisting of 2'-O-(ethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamido) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNAs), and optionally the oligonucleotide further comprises a spacer.

[0510] In various embodiments, provided herein is a method of treating frontotemporal dementia (FTD) in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, phosphoramidate linkages, or phosphoamide linkages. and / or at least one (i.e., one or more) of the nucleosides is selected from the group consisting of 2'-O-(2-methoxyethyl)-, ... ) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamido) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNAs), and optionally the oligonucleotide further comprises a spacer.

[0511] In various embodiments, provided herein is a method of treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharma- ceutically acceptable salt thereof, wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292; and wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are selected from the group consisting of phosphodiester linkages, phosphorothioate linkages, alkylphosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylenephosphonate linkages, phosphinate linkages, and / or at least one (i.e., one or more) nucleosides are independently selected from the group consisting of a phosphoramidate linkage, a phosphoroamidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkyl phosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. and wherein the oligonucleotide is substituted with a member selected from the group consisting of 2'-O-(N-methylacetamido)nucleosides, 2'-O-methylnucleosides, 2'-O-(N-methylacetamido)nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNAs), and optionally the oligonucleotide further comprises a spacer.

[0512] Treatment and Evaluation A patient as described herein refers to any animal at risk for, suffering from, or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans. In certain embodiments, the patient may be a non-human mammal, such as, for example, a cat, dog, or horse. A patient may be an individual diagnosed as at high risk for developing a neurological disease, diagnosed with a neurological disease, previously suffering from a neurological disease, or an individual evaluated for symptoms or signs of a neurological disease, such as any of the signs or symptoms associated with a neurological disease, such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), neurodegenerative disorders (ND), neurodegenerative diseases (ND), neurodegenerative disorders ... Synaptic disorders such as transcranial injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, dementia with Lewy bodies associated with Alzheimer's disease, Parkinson's disease with or without dementia, limbic-predominant senile age-related TDP-43 encephalopathy (LATE)), epilepsy, brain aging-associated TDP-43 with sclerosis (CARTS), facial onset sensorimotor neuropathy, Guam Parkinson-Dementia Complex, multisystem proteinopathies, CTE, and autism.

[0513] "Patient in need," as used herein, refers to a patient suffering from any of the symptoms or manifestations of a neurological disease, a patient who may suffer from any of the symptoms or manifestations of a neurological disease, or a patient who may benefit from the disclosed methods for treating a neurological disease. Patients in need may include patients who have been diagnosed as at risk for developing a neurological disease, patients who have previously suffered from a neurological disease, or patients who have previously been treated for a neurological disease.

[0514] "Effective amount" as used herein refers to the amount of agent that is sufficient to at least partially treat a condition when administered to a patient. The therapeutically effective amount varies depending on the severity of the condition, the route of administration of the components, and the age, weight, etc., of the patient to be treated. Thus, the effective amount of the disclosed UNC13A oligonucleotide is the amount of UNC13A oligonucleotide required to treat a neurological disease in a patient such that administration of the agent prevents the occurrence of the neurological disease in the subject, prevents the progression of the neurological disease (e.g., prevents the onset or increase in severity of neurological symptoms such as muscle weakness, spasms, or muscle contractions), or relieves or completely improves all associated symptoms of the neurological disease, i.e., causes regression of the disease.

[0515] The effectiveness of treatment can be evaluated by evaluating the overall symptoms associated with neurological disease, histological analysis, biochemical assay, imaging methods such as magnetic resonance imaging, or other known methods.For example, the effectiveness of treatment can be evaluated by administering the disclosed UNC13A oligonucleotide to a patient suffering from neurological disease, and then analyzing the overall symptoms of disease, such as changes in muscle strength and control, or other aspects of the overall pathology associated with neurological disease.

[0516] The effectiveness of treatment can also be evaluated at the tissue or cell level, for example, by obtaining tissue biopsy (e.g., brain, spinal cord, muscle, motor neuron tissue biopsy, or olfactory neurosphere cell biopsy) and evaluating the morphology or staining characteristics of whole tissue or cells. The effectiveness of treatment can also be evaluated using biochemical assays that investigate protein or RNA expression. For example, the level of protein or gene product indicative of neurological disease can be evaluated in dissociated cells or non-dissociated tissue by immunocytochemical methods, immunohistochemical methods, Western blotting, or Northern blotting, or methods useful for evaluating RNA levels, such as quantitative or semi-quantitative polymerase chain reaction (e.g., digital PCR (dPCR, or dePCR), qPCR, etc.) reactions. Useful biomarkers found in spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles ("CSF exosomes"), such as those described in Welton et al., (2017) "Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis" J Extracell Vesicles, 6(1):1-10; and Street et al., (2012) "Identification and proteomic profiling of exosomes in human cerebrospinal fluid" J Transl. Med., 10:5), urine, feces, lymph, blood, plasma, or serum (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 extracellular domain (p75 ECDThe presence or expression levels of neurotrophin receptor p75 extracellular domain (p75) may also be assessed to assess disease status and efficacy of treatment. The presence or expression levels of useful biomarkers found in plasma, extraneuronal vesicles / exosomes may also be assessed. Additional measures of efficacy may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate four limb isometric strength test (ATLIS), compound muscle action potential (CMAP), and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75) may also be assessed to assess disease status and efficacy of treatment. ECD ) is a biomarker of disease progression and prognosis in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predicts disease progression and survival in patients with C9ORF72-associated amyotrophic lateral sclerosis (c9ALS). Using CSF pNFH as a prognostic biomarker in clinical trials may increase the chances of success in developing treatments for c9ALS.

[0517] When evaluating the effectiveness of treatment, appropriate controls can be selected to ensure valid evaluation. For example, the symptoms evaluated in a patient with a neurological disease after administration of the disclosed UNC13A oligonucleotide can be compared with those in the same patient before treatment or earlier in the course of treatment, or in another patient who has not been diagnosed with a neurological disease. Alternatively, the results of biochemical or histological analysis of tissue after administration of the disclosed UNC13A oligonucleotide can be compared with the results of tissue from the same patient or individual who has not been diagnosed with a neurological disease, or the same patient before administration of the UNC13A oligonucleotide. Furthermore, blood, plasma, serum, cells, urine, lymph, spinal fluid, cerebrospinal fluid, or fecal samples after administration of the UNC13A oligonucleotide can be compared with equivalent samples from individuals who have not been diagnosed with a neurological disease or the same patient before administration of the UNC13A oligonucleotide. In some embodiments, extracellular vesicles (e.g., CSF exosomes) after administration of the UNC13A oligonucleotide can be compared with extracellular vesicles from individuals who have not been diagnosed with a neurological disease or the same patient before administration of the UNC13A oligonucleotide.

[0518] Validation of UNC13A oligonucleotides can be determined by direct or indirect assessment of UNC13A expression levels or activity. For example, biochemical assays measuring UNC13A protein or RNA expression may be used to assess the overall effect on UNC13A transcripts (e.g., UNC13A pre-mRNA) that contain sequences that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. For example, UNC13A protein levels can be measured in cells or tissues by Western blot to assess overall UNC13A levels. UNC13A mRNA levels can also be measured by Northern blot or quantitative polymerase chain reaction to determine the overall effect on UNC13A transcripts (e.g., UNC13A pre-mRNA) that contain sequences that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. UNC13A protein levels or levels of another protein indicative of UNC13A signaling activity can also be assessed by immunocytochemical or immunohistochemical methods in dissociated cells, non-dissociated tissues, extracellular vesicles (e.g., CSF exosomes), blood, serum, or feces.

[0519] Modulation of expression levels of UNC13A transcripts (e.g., UNC13A pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208 is associated with a number of phenotypic and molecular characteristics, including but not limited to, autophagy, endocytosis, protein aggregation, and the like. Biomarkers useful for assessing modulation of expression levels of UNC13A transcripts (e.g., UNC13A pre-mRNA) that contain sequences that share at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) with the target gene (e.g., a gene encoding a marker for ... ECD Modulation of the expression level of an UNC13A transcript (e.g., UNC13A pre-mRNA) comprising a sequence sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208 can also be indirectly assessed by measuring parameters such as the presence or expression level of physiological biomarkers such as autophagy, endocytosis, protein aggregation, and compound muscle action potential (CMAP). Additional measurements may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate four limb isometric strength testing (ATLIS), compound muscle action potential (CMAP), and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75 ECD) is a biomarker of disease progression and prognosis in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predicts disease progression and survival in c9ALS patients. Using CSF pNFH as a prognostic biomarker in clinical trials could increase the chances of success in developing treatments for c9ALS.

[0520] The present disclosure also provides a method for restoring the expression of full-length UNC13A transcript in cells of a patient suffering from a neurological disease.Full-length UNC13A transcript can be restored in any cell in which UNC13A expression or activity occurs, including cells of the nervous system (including the central nervous system (e.g., spinal cord or brain), peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, brain, brainstem, frontal lobe, temporal lobe, spinal cord), musculoskeletal system, spinal fluid, and cerebrospinal fluid.Musculoskeletal system cells include skeletal muscle cells (e.g., muscle cells).Motor neurons include upper motor neurons and lower motor neurons.

[0521] Pharmaceutical Compositions and Routes of Administration The present disclosure also provides a method of treating a neurological disease by administering a pharmaceutical composition comprising the disclosed UNC13A oligonucleotide. In another aspect, the present disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition can be composed of the disclosed UNC13A oligonucleotide and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutical composition" refers to a mixture containing a certain amount of a therapeutic compound, e.g., a therapeutically effective amount of a therapeutic compound, in a pharmaceutically acceptable carrier, which is administered to a mammal, e.g., a human, to treat a neurological disease. In some embodiments, described herein is a pharmaceutical composition comprising the disclosed UNC13A oligonucleotide and a pharmaceutically acceptable carrier. In another aspect, the present disclosure provides the use of the disclosed UNC13A oligonucleotide in the manufacture of a medicament for treating a neurological disease. As used herein, "medicament" has essentially the same meaning as the term "pharmaceutical composition".

[0522] As used herein, "pharmaceutically acceptable carriers" refers to buffers, carriers, and excipients suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio. A carrier should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coating agents, isotonicity agents, and absorption delaying agents, etc., that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment, the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the site of absorption of the encapsulated substance in the digestive system or intestine. For example, the enteric coating may include ethyl acrylate-methacrylic acid copolymer.

[0523] In one embodiment, the disclosed UNC13A oligonucleotides, as well as any pharmaceutical compositions thereof, can be administered by one or several routes, including topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, rectal, buccal, sublingual, vaginal, pulmonary, intratracheal, intranasal, transdermal, or intraduodenal.The term parenteral as used herein includes subcutaneous injection, intrapancreatic administration, intravenous, intracisternal, intraventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques.For example, the disclosed UNC13A oligonucleotides can be administered subcutaneously to a subject.In another example, the disclosed UNC13A oligonucleotides can be administered orally to a subject. In another example, the disclosed UNC13A oligonucleotides can be administered directly to the nervous system, or to specific regions or cells of the nervous system (e.g., brain, brain stem, lower motor neurons, spinal cord, upper motor neurons) by parenteral administration, for example, the disclosed UNC13A oligonucleotides can be administered intrathecally, intrathalamus, intracisternae, or intracerebroventricularly.

[0524] In various embodiments, UNC13A oligonucleotide, for example, UNC13A AON, can be exposed to calcium-containing buffer before administration. Such calcium-containing buffer can alleviate the toxic adverse effects of UNC13A oligonucleotide. Further details of exposing exemplary antisense oligonucleotide to calcium-containing buffer are described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is incorporated herein by reference in its entirety.

[0525] In some embodiments, UNC13A oligonucleotides, such as UNC13A AONs, can be encapsulated in nanoparticle coatings. Nanoparticle encapsulation is believed to prevent AON degradation and promote cellular uptake. For example, in some embodiments, UNC13A oligonucleotides can be encapsulated in coatings of cationic polymers, such as synthetic polymers (e.g., poly-L-lysine, polyamidoamine, poly(β-amino ester), and polyethyleneimine) or naturally occurring polymers (e.g., chitosan and protamine). In some embodiments, UNC13A oligonucleotides are encapsulated in lipids or lipid-like materials, such as cationic lipids, cationic lipid-like materials, or ionizable lipids that are positively charged only at acidic pH. An example of lipid nanoparticle nucleotide therapy includes XCUR-FXN from Exicure, which is a lipid nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, UNC13A oligonucleotides are encapsulated in lipid nanoparticles that contain hydrophobic moieties, such as cholesterol and / or polyethylene glycol (PEG) lipids.

[0526] In various embodiments, pharmaceutical compositions comprising the UNC13A oligonucleotides of the present disclosure may further comprise a bolaamphiphile. Exemplary bolaamphiphiles are described in WO2014039493, WO2014039500, WO2014039502, WO2014039503, and WO2014039504, each of which is incorporated herein by reference in its entirety. In certain embodiments, the bolaamphiphile is represented by formula I:HG 2 L 1 H.G. 1 or a pharma- ceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; 1 and H.G. 2 are independently hydrophilic head groups; and L 1 is an alkylene, alkenyl, heteroalkylene, or heteroalkenyl linker that is unsubstituted or substituted with C1-C20 alkyl, hydroxyl, or oxo.

[0527] In one embodiment, with respect to the bolaamphiphile of formula I, the bolaamphiphile can be represented by formula II, III, IV, V, or VI:

[0528] [ka] Compounds according to or a pharma- ceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; During the ceremony, Each HG 1 and H.G. 2 is independently a hydrophilic head group; Each Z 1 and Z 2 are independently -C(R 3 )2-, -N(R 3)- or -0-; Each R la , R lb , R 3 , and R 4 are independently H or C1-C8 alkyl; Each R 2a and R 2b are independently H, C1-C8 alkyl, OH, alkoxy, or O-HG 1 or O-HG 2 each of n8, n9, n11, and n12 is independently an integer from 1 to 20; n10 is an integer from 2 to 20; and Each dashed line is independently a single bond or a double bond.

[0529] In one embodiment, with respect to the bolaamphiphile of formula I, II, III, IV, V, or VI, each H 1 and H.G. 2 teeth,:

[0530] [ka] are independently selected from During the ceremony, X is -NR 5a R 5b , or -N + R 5a R 5b R 5c and each R 5a and R 5b are independently H or substituted or unsubstituted C1-C 20 alkyl or R 5a and R 5b are joined together to form an N-containing substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclyl; each R 5c are independently substituted or unsubstituted C1-C 20 alkyl; each R 8 are independently H, substituted or unsubstituted C1-C 20is alkyl, alkoxy, or carboxy; ml is 0 or 1; and each of n13, n14, and n15 is independently an integer from 1 to 20.

[0531] In various embodiments, the pharmaceutical compositions disclosed herein form a complex between a bolaamphiphilic compound and a pharmacologically or biologically active compound (e.g., an UNC13A oligonucleotide disclosed herein). In various embodiments, the pharmaceutical compositions disclosed herein include a bolaamphiphilic vesicle complex comprising one or more bolaamphiphilic compounds, and the biologically active compound is an oligonucleotide (e.g., an UNC13A oligonucleotide disclosed herein).

[0532] Pharmaceutical compositions containing the UNC13A oligonucleotide of the present disclosure, such as pharmaceutical compositions disclosed herein, can be presented in unit dosage form and can be prepared by any suitable method.Pharmaceutical compositions should be formulated to be compatible with its intended route of administration.Useful formulations can be prepared by methods well known in the pharmaceutical field.See, for example, Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).

[0533] In some embodiments, the pharmaceutical preparation is sterile.Sterilization can be achieved, for example, by filtration through a sterile filtration membrane.If the composition is lyophilized, filter sterilization can be performed before or after lyophilization and reconstitution.

[0534] Parenteral Administration The pharmaceutical composition of the present disclosure can be formulated for parenteral administration, for example, it can be formulated for injection via intravenous, intracisternal, intracerebroventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional or intraperitoneal route.The preparation of aqueous compositions, such as aqueous pharmaceutical compositions containing the disclosed UNC13A oligonucleotide, will be known to those skilled in the art in light of the present disclosure.Typically, such compositions can be prepared as injections, either as liquid solutions or suspensions;solid forms suitable for use in preparing solutions or suspensions by adding liquid before injection can also be prepared;preparations can be emulsified.

[0535] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations containing normal saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that it can be easily injected. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0536] Solutions of the active compounds as free bases or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. In addition, sterile fixed oils can be used as a solvent or suspending medium. For this purpose, any bland fixed oil can be used, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. Sterile injectable preparations can be sterile injectable solutions, suspensions or emulsions in non-toxic parenterally acceptable diluents or solvents, for example, as a solution in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. In one embodiment, the disclosed UNC13A antisense oligonucleotides can be suspended in a carrier fluid that includes 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) TWEEN™ 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0537] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known technology using suitable dispersing or wetting agents and suspending agents.Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing basic dispersion medium and other required ingredients from above-listed.The sterile injectable solutions of the present disclosure can be prepared by incorporating the disclosed UNC13A antisense oligonucleotides into the required amount of suitable solvent with various other ingredients as above-listed as necessary, and then sterilizing by filtration.In the case of sterile powder for preparing sterile injectable solutions, the preferred preparation method is vacuum drying and freeze-drying technology, which allows the powder of active ingredient plus any additional desired ingredient to be obtained from the solution that has been previously sterilized and filtered.Injectable preparations can be sterilized, for example, by filtration through a bacteria-retaining filter.

[0538] The preparation of more or more concentrated solutions for intramuscular injection is also contemplated. In this regard, the use of DMSO as a solvent is preferred since it provides extremely rapid penetration and delivers the disclosed oligonucleotides in high concentrations to small areas.

[0539] Suitable preservatives for use in such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal, and the like. Suitable buffering agents include boric acid, sodium and potassium bicarbonate, sodium and potassium borate, sodium and potassium carbonate, sodium acetate, sodium diphosphate, and the like in an amount sufficient to maintain the pH at about pH 6 to pH 8, e.g., about pH 7 to pH 7.5. Suitable isotonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is in the range of 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfate, thiourea, and the like. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282, and tyloxapol. Suitable viscosity enhancing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethyl cellulose, hydroxymethylpropyl cellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethyl cellulose, and the like.

[0540] Oral route In some embodiments, contemplated herein are compositions suitable for oral delivery of the disclosed UNC13A oligonucleotides, e.g., tablets, which include an enteric coating, e.g., a gastroresistant coating, such that the composition can deliver the UNC13A oligonucleotide, e.g., to the gastrointestinal tract of a patient.

[0541] For example, a tablet for oral administration is provided that includes an UNC13A oligonucleotide of the present disclosure, such as any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292, that targets an UNC13A transcript containing a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 5057-5065 or 5206-5208, and a granule (e.g., at least partially formed from a granule) that includes a pharmaceutically acceptable excipient. Such a tablet may be coated with an enteric coating. Contemplated tablets may include pharma- ceutically acceptable excipients such as fillers, binders, disintegrants, and / or lubricants, as well as colorants, release agents, coating agents, sweeteners, flavors such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, as well as flavoring agents, preservatives, and / or antioxidants.

[0542] In some embodiments, contemplated pharmaceutical formulations include an UNC13A oligonucleotide of the present disclosure, e.g., an UNC13A oligonucleotide represented by any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292, targeting an UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 5057-5065 or 5206-5208, and an intragranular phase comprising a pharmaceutical acceptable salt. In some embodiments, contemplated pharmaceutical formulations include an UNC13A oligonucleotide of the present disclosure, such as an UNC13A oligonucleotide represented by any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292, that targets an UNC13A transcript containing a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of SEQ ID NOs: 5057-5065 or 5206-5208, and an intragranular phase that includes a pharmacologic acceptable filler. For example, the UNC13A oligonucleotide of the present disclosure and the filler are mixed with other excipients as needed and formed into a granule. In some embodiments, the intragranular phase may be formed using wet granulation, for example, a liquid (e.g., water) is added to the blended UNC13A oligonucleotide and a filler, and then the combination is dried, milled, and / or sieved to produce granules.Those skilled in the art will understand that other processes may be used to achieve the intragranular phase.

[0543] In some embodiments, contemplated formulations include an extragranular phase, which may include one or more pharma- ceutically acceptable excipients, and can be blended with the intragranular phase to form the disclosed formulations.

[0544] The disclosed formulations can include an intragranular phase that includes a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropyl methylcellulose, partially pregelatinized starch, calcium carbonate, and others, including combinations thereof.

[0545] In some embodiments, the disclosed formulations may include an intragranular phase and / or an extragranular phase that includes a binder that may generally function to hold the components of the pharmaceutical formulation together. Exemplary binders of the present disclosure include, but are not limited to, starch, sugar, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pregelatinized corn starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropyl methylcellulose, low-substituted hydroxypropyl cellulose, sodium carboxymethylcellulose, methylcellulose, ethylcellulose, sugar alcohols, and others including combinations thereof.

[0546] Contemplated formulations, such as those containing an intragranular and / or extragranular phase, can include starch, cellulose, cross-linked polyvinylpyrrolidone, sodium starch glycolate, sodium carboxymethylcellulose, alginate, corn starch, crosmellose sodium, cross-linked carboxymethylcellulose, low-substituted hydroxypropylcellulose, acacia, and others, including combinations thereof. For example, the intragranular and / or extragranular phase can include a disintegrant.

[0547] In some embodiments, contemplated formulations include an intragranular phase comprising the disclosed UNC13A oligonucleotide and an excipient selected from mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose, and sodium starch glycolate or a combination thereof, and an extragranular phase comprising one or more of microcrystalline cellulose, sodium starch glycolate, and magnesium stearate, or a mixture thereof.

[0548] In some embodiments, the contemplated formulation may include a lubricant, for example, the granular outer phase may contain a lubricant.Lubricants include, but are not limited to, talc, silica, fat, stearin, magnesium stearate, calcium phosphate, silicon dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metal stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0549] In some embodiments, the pharmaceutical preparation comprises an enteric coating.In general, enteric coating creates a barrier for oral medication that controls where drug is absorbed along the digestive tract.Enteric coating can include polymers that disintegrate at different rates depending on pH.Enteric coating can include, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropyl methylcellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate phthalate, and cellulose acetate phthalate.

[0550] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, and Eudragit® grades. In some embodiments, the enteric coating may comprise about 5% to about 10%, about 5% to about 20%, about 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% by weight of a contemplated tablet. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

[0551] For example, in contemplated embodiments, tablets are provided that contain or consist essentially of about 0.5% to about 70% by weight, e.g., about 0.5% to about 10% by weight, or about 1% to about 20% by weight of the disclosed UNC13A oligonucleotides or pharma- ceutically acceptable salts thereof. Such tablets may contain, for example, about 0.5% to about 60% by weight mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and / or about 20% to about 40% by weight microcrystalline cellulose, or about 10% to about 30% by weight microcrystalline cellulose. For example, the disclosed tablets may contain about 30% to about 60% by weight, e.g., about 45% to about 65% by weight, or alternatively, about 5% to about 10% by weight, of the disclosed UNC13A oligonucleotide, about 30% to about 50% by weight, or alternatively, about 5% to about 15% by weight, of mannitol, about 5% to about 15% by weight, of microcrystalline cellulose, about 0% to about 4% by weight, or alternatively, about 1% to about 7% by weight, of hydroxypropylmethylcellulose, and about 0% to about 4% by weight, e.g., about 2% to about 4% by weight, of sodium starch glycolate.

[0552] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of the disclosed UNC13A oligonucleotides comprises an intragranular phase, which comprises the disclosed UNC13A AON or a pharma- ceutically acceptable salt thereof (such as a sodium salt), and a pharma- ceutically acceptable filler, and may further comprise an extragranular phase, which may comprise a pharma- ceutically acceptable excipient, such as a disintegrant. The extragranular phase may comprise a member selected from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may comprise about 12% to 20% enteric coating by weight of the tablet. For example, a pharma- ceutical acceptable tablet for oral use may comprise about 0.5% to about 10% by weight of the disclosed UNC13A AON, such as the disclosed UNC13A AON or a pharma- ceutically acceptable salt thereof, about 30% to 50% by weight of mannitol, about 10% to 30% by weight of microcrystalline cellulose, and an enteric coating comprising ethyl acrylate-methacrylic acid copolymer.

[0553] In another example, a pharma- ceutically acceptable tablet for oral use may comprise about 5 to about 10% by weight of the disclosed UNC13A AON, e.g., the disclosed UNC13A AON or a pharma- ceutically acceptable salt thereof, an inner granular phase comprising about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethylcellulose, and about 2% by weight sodium starch glycolate; an outer granular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating over the tablet comprising ethyl acrylate-methacrylic acid copolymer.

[0554] In some embodiments, the pharmaceutical composition may contain an enteric coating comprising about 13%, or about 15%, about 16%, about 17%, or about 18% by weight AcyrlEZE® (see, e.g., PCT Publication No. WO 2010 / 054826, which is incorporated by reference in its entirety).

[0555] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In one embodiment, contemplated tablets may have a dissolution profile in which, for example, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37° C. in a phosphate buffer at pH 7.2, about 50% to about 100% of the UNC13A oligonucleotide is released after about 120 minutes to about 240 minutes, for example, after 180 minutes. In another embodiment, contemplated tablets may have a dissolution profile in which, for example, when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37° C. in dilute HCl at pH 1.0, substantially no UNC13A oligonucleotide is released after 120 minutes. In another embodiment, a contemplated tablet may have a dissolution profile in which, for example, about 10% to about 30%, or about 50% or less of the UNC13A oligonucleotide is released after 30 minutes when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37°C in phosphate buffer at pH 6.6.

[0556] In some embodiments, the methods provided herein may further include administering at least one other agent for the treatment of the diseases and disorders disclosed herein. In one embodiment, the other agents contemplated may be co-administered (e.g., sequentially or simultaneously).

[0557] Dosage and frequency of administration The dosages or amounts set forth below refer to either the oligonucleotide or a pharma- ceutically acceptable salt thereof.

[0558] In some embodiments, the methods described herein include administering at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of an UNC13A antisense oligonucleotide, e.g., an UNC13A oligonucleotide. In some embodiments, the methods include administering at least 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 70 mg to 80 mg, 80 mg to 90 mg, 90 mg to 100 mg, 100 mg to 150 mg, 150 mg to 200 mg, 200 mg to 250 mg, 250 mg to 300 mg. g, 300 mg to 350 mg, 350 mg to 400 mg, 400 mg to 450 mg, 450 mg to 500 mg, 500 mg to 600 mg, 600 mg to 700 mg, 700 mg to 800 mg, 800 mg to 900 mg, 900 mg to 1 g, 1 mg to 50 mg, 20 mg to 40 mg, or 1 mg to 500 mg of UNC13A antisense oligonucleotide.

[0559] In some embodiments, the methods described herein include administering a formulation comprising about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain about 40 mg, 80 mg, or 160 mg of the disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain at least 100 μg of the disclosed UNC13A oligonucleotide. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of the disclosed UNC13A oligonucleotide. The amount administered depends on variables such as the type and extent of the disease or indication being treated, the overall health and size of the patient, the in vivo potency of the UNC13A oligonucleotide, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased above the upper level to rapidly achieve the desired blood or tissue level. Alternatively, the initial dosage can be less than optimal, and the dosage can be gradually increased over the course of treatment. The dosage for humans can be optimized, for example, in a conventional Phase I dose escalation study. The frequency of administration may vary depending on factors such as route of administration, dosage and disease to be treated.Exemplary administration frequencies are once a day, once a week, and once every two weeks.In some embodiments, administration is once a day for 7 days.In some embodiments, administration is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks.In some embodiments, administration is once a month to once every 3 months.In some embodiments, administration is once every two weeks for three doses, then once a month, once every two months, or every three or four months.

[0560] Combination therapy In various embodiments, the UNC13A AONs disclosed herein can be administered in combination with one or more additional therapies. Combination therapy of the oligonucleotides of the present disclosure with one or more additional therapies may, in some embodiments, be synergistic in treating any of the synaptic diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, Parkinson's disease-associated dementia with Lewy bodies, Parkinson's disease with or without dementia, and limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), sensorimotor neuropathy with facial onset, Guam Parkinson-Dementia Complex, multisystem proteinopathies, CTE, and autism.

[0561] Non-limiting examples of therapies for Parkinson's disease (PD) include deep brain stimulation, levodopa and carbidopa (Duopa, Lytali, Sinemet, Inbrieja), istradefylline (Nouriast), safinamide (Xadago), pramipexole (Mirapex), rotigotine (Neupro), ropinirole (Requip), amantadine (Gocobli, Symmetrel, Osmolex), benign prostatic hyperplasia (Benvironmental Therapy), and cerebrovascular disease (Cyclovir). These include Ztropine (Cogentin), Trihexyphenidyl (Altan), Selegiline (Eldepryl, Zelapar), Rasagiline, Entacapone (Comtan), Opicapone (Ongentys), Tolcapone (Tasmar), Apomorphine (Apokyne, Kinmobi), Exenatide, Ganoderma lucidum, BIIB054, BIIB094, Caffeine, Sarizotan, Nuplazid, and Embryonic Dopamine Cell Transplants.

[0562] Non-limiting examples of therapies for Alzheimer's disease (AD) include Aducanamab (Aduhlem), Memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (Razadyne), Namzeric, Suvorexant (Belsomra), and Lecanemab.

[0563] A non-limiting example of a therapy for amyotrophic lateral sclerosis (ALS) is pridopidine.

[0564] Non-limiting examples of therapies for frontotemporal dementia (FTD) include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogesterone.

[0565] Non-limiting examples of treatments for epilepsy include brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar XR, Trileptal), Perampanel (Fycompa), Phenobarbital, Phenytoin (Dilantin), Pregabalin (Lyrica), Tiagabine (Gabitril), Topiramate (Topamax), Valproate (Depakene, Depakote), and Zonisamide (Zonegran).

[0566] Exemplary additional therapies include Riluzole (Rilutek), PrimeC, Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants, and psychostimulants. Additional therapies further include respiratory care, physical therapy, occupational therapy, speech therapy, and nutritional support. Further non-limiting examples of additional therapies include deep brain stimulation, levodopa and carbidopa (Duopa, Lytali, Sinemet, Inbrilla), istradefylline (Nouriast), safinamide (Xadago), pramipexole (Mirapex), rotigotine (Neupro), ropinirole (Requip), amantadine (Gocobli, Symmetrel, Osmorex), benztropine (Cogentin), trihexyphenidyl (Altan), selegiline (Eldepryl, Zelapar), rasagiline, entacapone (Comtan), opicapone (Ongentys), tolcapone (Tasmar), apomorphine (Apokyne, Kinmobi). , Exenatide, Ganoderma lucidum, BIIB054, BIIB094, Caffeine, Sarizotan, Embryonic dopamine cell transplantation, Aducanamab (Aduhlem), Memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (Razadyne), Namzeric, Suvorexant (Belsomra), Lecanemab, Olanzapine (Zyprexa), Quetiapine (Seroquel), SSRIs (Citalopram (Cipramil), Dapoxetine (Priligy), Escitalopram (Cipralex), Fluoxetine (Prozac or Oxactin),Fluvoxamine (Faverin), Paroxetine (Seroxat), Sertraline (Lustral), Vortioxetine (Brintellix), Divalproex Sodium (Depakote), Carbamazepine (Tegretol), Medroxyprogesterone, Brivarectam (Brivaact), Cannabidiol (Epidiolex), Carbamazepine (Carbatrol, Tegretol), Cenobamate (Xcopri), Diazepam (Valium), Lorazepam (Ativan), Clonazepam (Klonopin), Eslicarbazepine (Aptiom), ethosuximide (Zarrontin), felbamate (Felvator), fenfluramine (Fintepra), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (Oxteraxr, Trileptal), perampanel (Ficompa), phenobarbital, phenytoin (Dilantin), pregabalin (Lyrica), tiagabine (Gabitril), topiramate (Topamax), valproate (Depakene, Depakote), and zonisamide (Zonegran). In various embodiments, the additional therapy can be a second antisense oligonucleotide. For example, the second antisense oligonucleotide can target an UNC13A transcript (e.g., UNC13A pre-mRNA, mature UNC13A mRNA) to modulate the expression level of full-length UNC13A protein.

[0567] Non-limiting examples of therapies for spinal cord injury include bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion. Further details of examples of bioactive scaffolds as therapies for spinal cord injury are described in Alvarez et al., "Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury." Science, 374, 848-856 (2021), which is incorporated herein by reference in its entirety.

[0568] In various embodiments, the disclosed oligonucleotide and one or more additional therapies can be conjugated with each other and provided in conjugate form.Further description of the conjugates comprising the disclosed oligonucleotides is provided below.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously.In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially.

[0569] Conjugates In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (e.g., an UNC13A oligonucleotide) and optionally one or more conjugate groups and / or terminal groups. The conjugate group comprises one or more conjugate moieties and a conjugate linker that links the conjugate moieties to the oligonucleotide. The conjugate group can be attached to either or both termini of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' termini of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' termini of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' termini of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0570] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0571] Conjugate Group In certain embodiments, the UNC13A AON is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group modifies (e.g., increases) the circulation time of the oligonucleotide in the bloodstream, such that the concentration of the oligonucleotide delivered to the brain is increased. In certain embodiments, the conjugate group modifies (e.g., increases) the residence time of the oligonucleotide in the target organ (e.g., brain), such that the increased residence time of the oligonucleotide improves its performance (e.g., efficacy). In certain embodiments, the conjugate group increases the delivery of the oligonucleotide to the brain through the blood-brain barrier and / or brain parenchyma (e.g., via receptor-mediated transcytosis). In certain embodiments, the conjugate group allows the oligonucleotide to target a specific organ (e.g., brain). In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, for example, a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been described previously, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118;Kabanov et al., FEBS Lett., 1990, 259, 327-330;Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654;Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid with a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (see, for example, WO 2014 / 179620).

[0572] Conjugate moiety Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, dyes, bile acids, and phenylbutyric acid. In certain embodiments, the conjugate moiety is selected from peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, antibodies (e.g., antibodies for crossing the blood-brain barrier, such as anti-transferrin receptor antibodies), or cell-penetrating peptides (e.g., transactivator of transcription (TAT) and penetratin).

[0573] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetic drugs, antibacterial drugs, or antibiotics.

[0574] Conjugate Linker Conjugate moiety is linked to UNC13A AON via conjugate linker.In certain oligomeric compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide by single bond).In certain embodiments, conjugate linker comprises chain structure such as hydrocarbon chain, or repeating unit oligomer such as ethylene glycol, nucleoside, or amino acid unit.

[0575] In certain embodiments, the conjugate linker comprises one or more groups selected from an alkyl group, an amino group, an oxo group, an amide group, a disulfide group, a polyethylene glycol group, an ether group, a thioether group, and a hydroxylamino group. In certain such embodiments, the conjugate linker comprises a group selected from an alkyl group, an amino group, an oxo group, an amide group, and an ether group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0576] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, which is known in the art to be useful for binding a conjugate group to a parent compound, such as the oligonucleotides provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site of the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from an amino group, a hydroxy group, a carboxylic acid group, a thiol group, an alkyl group, an alkenyl group, and an alkynyl group.

[0577] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl groups.

[0578] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 linker-nucleosides.

[0579] In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides include modified sugar moieties. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides include an optionally protected heterocyclic base selected from purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. Usually, it is desirable for linker-nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.

[0580] Here, linker-nucleoside is not considered to be part of oligonucleotide.Therefore, in the embodiment where oligomeric compound comprises the oligonucleotide consisting of specified number or range of linked nucleosides and / or specified percentage complementarity to reference nucleic acid, and oligomeric compound also comprises conjugate group that comprises conjugate linker that comprises linker-nucleoside, those linker-nucleosides are not counted in the length of oligonucleotide and are not used when determining the percentage complementarity of oligonucleotide to reference nucleic acid.

[0581] In certain embodiments, it is desirable for the conjugate group to be cleaved from the UNC13A AON. For example, in certain situations, oligomeric compounds that include certain conjugate moieties are prone to be taken up by certain cell types, but after the oligomeric compounds are taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated oligonucleotide or parent oligonucleotide. Thus, certain conjugate linkers may include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms with one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved in a cell or a compartment within a cell, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0582] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide.In certain embodiments, the cleavable bond is one or both esters of phosphodiester.In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester.In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or the conjugate group.

[0583] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and covalently linked to the conjugate linker or the remainder of the conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0584] terminal group In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, a 5'-phosphonate, including, but not limited to, a 5'-vinyl phosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides. In various embodiments, the terminal group comprises one or more spacers.

[0585] Diagnostic methods The present disclosure also provides a method for diagnosing a patient with neurological disease, which relies on detecting UNC13A expression signal level in one or more biological samples of the patient.As used herein, the term "UNC13A expression signal" can refer to any indication of UNC13A gene expression or the activity of gene or gene product.UNC13A gene product includes RNA (e.g., mRNA), peptide and protein. Indicators of UNC13A gene expression that can be assessed include, but are not limited to, the UNC13A gene or chromatin state, the interaction of the UNC13A gene with cellular components that regulate gene expression, the expression level of an UNC13A gene product (e.g., the expression level of an UNC13A transcript (e.g., an UNC13A pre-mRNA) that includes a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or 5206-5208), or the interaction of the UNC13A RNA or protein with transcriptional, translational, or post-translational processing machinery.

[0586] Detection of UNC13A expression signal can be achieved by in vivo, in vitro or ex vivo methods.In a preferred embodiment, the method of the present disclosure can be carried out in vitro.Detection method can involve detection in patient's blood, serum, feces, tissue, cerebrospinal fluid, spinal fluid, urine, extracellular vesicles (e.g., CSF exosomes) or cells. Detection can be accomplished by measuring expression signals of UNC13A transcripts (e.g., UNC13A pre-mRNA) comprising sequences that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to SEQ ID NOs: 5057-5065 or 5206-5208 in whole tissues, tissue explants, cell cultures, dissociated cells, cell extracts, extracellular vesicles (e.g., CSF exosomes), or bodily fluids including blood, spinal fluid, cerebrospinal fluid, urine, lymph, plasma, or serum. Detection methods include assays that measure expression levels of UNC13A gene products, such as Western blots, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).

[0587] General modification While certain compounds, compositions and methods described herein are described with specificity according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to be limiting thereof. Each document, GenBank accession number, etc. described in this application is incorporated herein by reference in its entirety.

[0588] Although the sequence listing attached to this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily recognize that designations such as "RNA" or "DNA" to describe modified oligonucleotides are arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleic acid bases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including such compounds that contain RNA bases, for example, those having the sequence "AUCGAUCG," as well as those that have some DNA bases and some RNA bases, such as "AUCGATCG," and those that have some DNA bases and some RNA bases, such as "AT m CGAUCG" (where m These include, but are not limited to, oligomeric compounds having other modified nucleobases such as cytosine bases containing a methyl group at the 5-position.

[0589] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the indicated compound. Compounds provided herein that contain a stereocenter depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise specified. Similarly, all tautomeric forms of the compounds described herein are included, unless otherwise specified. Compounds described herein are intended to include corresponding salt forms, unless otherwise specified.

[0590] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, the following: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36 S. In certain embodiments, non-radioactive isotope substitution may confer new properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. EXAMPLES

[0591] The present disclosure is further illustrated by the following examples, which are provided for illustrative purposes only and should not be construed as limiting the scope or content of the present disclosure in any way.

[0592] [Example 1] Design and selection of UNC13A oligonucleotides UNC13A AON oligonucleotides targeting UNC13A transcripts are designed and tested to identify UNC13A AONs that can reduce the amount of UNC13A transcripts (e.g., mis-spliced ​​UNC13A transcripts). Such UNC13A AONs include UNC13A parent oligonucleotides represented by any of SEQ ID NOs: 1-1264 or UNC13A oligonucleotide variants represented by SEQ ID NOs: 2529-3792. The UNC13A parent oligonucleotides are 25 nucleosides in length. Each nucleoside of the UNC13A parent oligonucleotide is a modified nucleoside having a 2'MOE sugar moiety, and each "C" is replaced with a 5-MeC. Additionally, each internucleoside linkage between nucleosides of the UNC13A oligonucleotide is a phosphorothioate internucleoside linkage.

[0593] Generally, the length of UNC13A antisense oligonucleotide is 25 nucleotide units in length. However, variants of UNC13A antisense oligonucleotides have also been designed with various lengths (e.g., 23mer, 21mer, or 19mer). These exemplary variant UNC13A antisense oligonucleotides are designed to include a subset of the sequences of SEQ ID NOs: 2529-3792.

[0594] [Table 8-1]

[0595] [Table 8-2]

[0596] [Table 9-1]

[0597] [Table 9-2]

[0598] [Example 2] Methods for evaluating UNC13A antisense oligonucleotides UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded in 96-well plates at a density of 50,000 cells / well. Antisense oligonucleotides (AONs) against TDP43 were transfected with Endoporter (Gene Tools, Philomath, OR, USA) to reduce the expression of full-length UNC13a transcripts. Vehicle controls were motor neurons treated with Endoporter alone. Positive controls included cells treated with TDP43 AONs alone ("AON TDP43" or "TDP43 AONs").

[0599] The TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5'A * A * G * G * C * T * T * C * A * T * A * T * T * G * T * A * C * T * T *T3' (SEQ ID NO:5167) Where: * = phosphorothioate, underlined = DNA, others = 2'MOE RNA; each "C" is 5-MeC.

[0600] To assess the ability of UNC13a AONs to restore full-length UNC13A (UNC13A FL) mRNA (also called correctly spliced ​​UNC13A (UNC13A CS) mRNA), antisense oligonucleotides against UNC13A were co-incubated with TDP43 AONs in Endoporter in culture medium before adding to cells. After 72 h, the antisense oligonucleotides and Endoporter were washed out and replaced with fresh medium alone. After another 72 h, RNA was harvested from the 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR assays were performed using Taqman probes for full-length UNC13A transcripts and reference GAPDH quantification.

[0601] Transcript levels (e.g., full-length UNC13A transcript or TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed to detect GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was performed to detect UNC13A-FL using Thermofisher® TaqMan Gene Expression Assay Hs00392638_m1.

[0602] RT-qPCR was performed on an Applied Biosystems® 7500 Real-Time PCR System. One cycle of reverse transcription was performed at a temperature of 50° C. for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95° C. for 20 s. Forty-five cycles of amplification were performed at a temperature of 95° C. for 1 s followed by a temperature of 60° C. for 20 s.

[0603] UNC13A-FL (Ct) was normalized to GAPDH (delta Ct). To visualize quantitative changes (e.g., % reduction in UNC13A-FL), the normalized UNC13A-FL signal was further normalized to vehicle (treated with Endoporter alone, delta delta Ct). The relative abundance (RG) of the transcript level was calculated using the formula RQ=2 -デルタデルタCt and is used to describe the comparison of treatment conditions to normal healthy levels (1.0). The RQ values ​​for UNC13A FL were normalized using the following formula: (((RQAON-RQTDP43) / (RQendo-RQTDP43))*100

[0604] Table 7 shows the RT-qPCR results of UNC13A AON with spacer and the performance of UNC13A AON without spacer in human motor neurons. UNC13A AON (e.g., UNC13A oligonucleotide with no spacer or with one or two spacers) was tested for its ability to increase or restore full-length UNC13A mRNA (i.e., the mRNA from which full-length UNC13A protein is translated) level. In some cases, UNC13A AON with spacer increases full-length UNC13A mRNA ("UNC13A FL"), also referred to herein as correctly spliced ​​UNC13A (UNC13A CS). In some cases, UNC13A AON without spacer increases full-length UNC13A mRNA or correctly spliced ​​UNC13A mRNA (UNC13A CS). Specific AON sequences are labeled according to the corresponding sequence numbers.

[0605] As shown in Table 7, a 500 nM dose of SEQ ID NO:5153 (ACACAAASGGCCCAASCCTGAGT with two spacers) rescued full-length UNC13A mRNA by 55.69%. In comparison, a 500 nM dose of SEQ ID NO:2788 (ACACAAACGGCCCAATCCTGAGT without a spacer) rescued full-length UNC13A mRNA by 41.87%. This indicates that the addition of the spacer of SEQ ID NO:5153 improves performance compared to the UNC13A AON counterpart without a spacer (e.g., SEQ ID NO:2788).

[0606] As further shown in Table 7, a 200 nM dose of SEQ ID NO:5159 (GATCCGCSACTTAATSCACCTAC with two spacers) rescued 55.88% of full-length UNC13A mRNA. A 500 nM dose of SEQ ID NO:5159 (GATCCGCSACTTAATSCACCTAC with two spacers) rescued 66.62% of full-length UNC13A mRNA. In comparison, a 200 nM dose of SEQ ID NO:3547 (GATCCGCAACTTAATCCACCTAC without a spacer) rescued 43.88% of full-length UNC13A mRNA. A 500 nM dose of SEQ ID NO:3547 (GATCCGCAACTTAATCCACCTAC without a spacer) rescued 66.98% of full-length UNC13A mRNA. This indicates that at doses of 200 nM and 500 nM, the performance of the AON with SEQ ID NO:5159 (with a spacer) is similar to that of the UNC13A AON counterpart without a spacer (eg, SEQ ID NO:3547).

[0607] As further shown in Table 7, a 200 nM dose of SEQ ID NO:5162 (CACCCACSCATCTAASTACCCCA with two spacers) rescued full-length UNC13A mRNA to 47.94%. A 500 nM dose of SEQ ID NO:5162 (CACCCACSCATCTAASTACCCCA with two spacers) rescued full-length UNC13A mRNA to 83.19%. In comparison, a 200 nM dose of SEQ ID NO:3652 (CACCCACCCATCTAACTACCCCA without a spacer) rescued full-length UNC13A mRNA to 47.68%. A 500 nM dose of SEQ ID NO:3652 (CACCCACCCATCTAACTACCCCA without a spacer) rescued full-length UNC13A mRNA to 41.16%. This shows that at the 200 nM dose, the performance of SEQ ID NO:5162 (with a spacer) is similar to that of the UNC13A AON counterpart without a spacer (e.g., SEQ ID NO:3652). However, at the 500 nM dose, the addition of the spacer of SEQ ID NO:5162 improves performance compared to the UNC13A AON counterpart without a spacer (e.g., SEQ ID NO:3652).

[0608] As further shown in Table 7, a 500 nM dose of SEQ ID NO:5161 (CCCACCCSTCTAACTSCCCCAAA with two spacers) rescued full-length UNC13A mRNA by 43.10%. In comparison, a 500 nM dose of SEQ ID NO:3650 (CCCACCCATCTAACTACCCCAAA without a spacer) rescued full-length UNC13A mRNA by 23.37%. This indicates that at the 500 nM dose, the addition of a spacer improves the performance of the AON with SEQ ID NO:5161 compared to its UNC13A AON counterpart without a spacer (e.g., SEQ ID NO:3650).

[0609] As further shown in Table 7, a 200 nM dose of SEQ ID NO:5164 (AAGTGTCSTGGAGAGSGCAAGGG with two spacers) rescued full-length UNC13A mRNA to 35.39%. A 500 nM dose of SEQ ID NO:5164 (AAGTGTCSTGGAGAGSGCAAGGG with two spacers) rescued full-length UNC13A mRNA to 6.60%. In comparison, a 200 nM dose of SEQ ID NO:3774 (AAGTGTCATGGAGAGTGCAAGGG without a spacer) rescued full-length UNC13A mRNA to 19.04%. A 500 nM dose of SEQ ID NO:3774 (AAGTGTCATGGAGAGTGCAAGGG without a spacer) rescued full-length UNC13A mRNA to -34.58%. This indicates that at doses of 200 nM and 500 nM, the addition of a spacer improves the performance of the AON with SEQ ID NO:5164 compared to its UNC13A AON counterpart without a spacer (eg, SEQ ID NO:3774).

[0610] As further shown in Table 7, a 200 nM dose of SEQ ID NO:5142 (GAAAGTGTSATGGAGAGTSCAAGGG with two spacers) rescued 67.77% of full-length UNC13A mRNA. A 500 nM dose of SEQ ID NO:5142 (GAAAGTGTSATGGAGAGTSCAAGGG with two spacers) rescued 84.79% of full-length UNC13A mRNA. In comparison, a 200 nM dose of SEQ ID NO:1248 (GAAAGTGTCATGGAGAGTGCAAGGG without a spacer) rescued 22.48% of full-length UNC13A mRNA. A 500 nM dose of SEQ ID NO:1248 (GAAAGTGTCATGGAGAGTGCAAGGG without a spacer) rescued 24.84% of full-length UNC13A mRNA. This indicates that at doses of 200 nM and 500 nM, the addition of a spacer improves the performance of the AON with SEQ ID NO:5142 compared to its UNC13A AON counterpart without a spacer (eg, SEQ ID NO:1248).

[0611] Taken together, these results demonstrate that different UNC13A AONs containing two spacers can increase UNC13A-FL mRNA to levels comparable to or improved beyond their spacer-free counterparts.

[0612] [Table 10-1]

[0613] [Table 10-2]

[0614] [Table 10-3]

[0615] [Table 10-4]

[0616] [Example 3] Methods for evaluating UNC13A antisense oligonucleotides UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded in 96-well plates at a density of 40,000 cells / well. Antisense oligonucleotides (AONs) against TDP43 were transfected with Endoporter (Gene Tools, Philomath, OR, USA) to reduce expression of full-length UNC13A transcripts and increase expression of UNC13A cryptic exons. Vehicle controls were motor neurons treated with Endoporter alone. Positive controls included cells treated with TDP43 AONs alone ("AON TDP43" or "TDP43 AONs").

[0617] The TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5'A * A * G * G * C * T * T * C * A * T * A * T * T * G * T * A * C * T * T * T3' (SEQ ID NO:5167) Where: * = phosphorothioate, underlined = DNA, others = 2'-MOE RNA; each "C" is 5-MeC.

[0618] To assess the ability of UNC13A AONs to reduce the levels of UNC13A cryptic exons, antisense oligonucleotides against UNC13A were co-incubated with TDP43 AONs in Endoporter in culture medium before adding to cells. After 72 hours, the antisense oligonucleotides and Endoporter were washed out and replaced with fresh medium alone. After an additional 6 days, RNA was harvested from the 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR assays were performed using Taqman probes for UNC13A cryptic exons and reference GAPDH quantification.

[0619] Transcript levels (e.g., UNC13A cryptic exon and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed to detect GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. UNC13a cryptic exon was detected using a custom sequence. UNC13a Cryptic Exon: Forward primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 5203) Reverse primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 5204) Probe sequence: AGTTCTTTCCAGGAAAACCCAGGCA (SEQ ID NO: 5203)

[0620] RT-qPCR was performed on an Applied Biosystems® 7500 Real-Time PCR System. One cycle of reverse transcription was performed at a temperature of 50° C. for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95° C. for 20 s. Forty-five cycles of amplification were performed at a temperature of 95° C. for 1 s followed by a temperature of 60° C. for 20 s.

[0621] UNC13A cryptic (Ct) was normalized to GAPDH (delta Ct). To visualize quantitative changes (e.g., % reduction in UNC13A cryptic), the normalized UNC13A cryptic signal was further normalized to vehicle (treated with Endoporter alone, delta delta Ct). The relative abundance (RG) of transcript levels was calculated using the formula RQ=2 -デルタデルタCt and is used to describe the comparison of treatment conditions to normal healthy levels (1.0). RQ values ​​for UNC13A cryptic were normalized using the following formula: (((RQAON-RQendo) / (RQTDP43-RQendo))*100

[0622] Table 8 shows the RT-qPCR results of UNC13A AONs with spacers and the performance of UNC13A AONs without spacers in human motor neurons.

[0623] As shown in Table 8, UNC13A AONs (e.g., UNC13A oligonucleotides with no spacer or with one or two spacers) were tested for their ability to reduce UNC13A transcripts with cryptic exons. In some cases, UNC13A AONs with spacers reduced UNC13A cryptic exon levels. In some cases, UNC13A AONs without spacers reduced UNC13A cryptic exon levels. Specific AON sequences are labeled according to the corresponding sequence numbers.

[0624] As shown in Table 8, a 200 nM dose of SEQ ID NO:273 (GAGACATACCCAGACACAAACGGCC without a spacer) reduced UNC13A cryptic exon levels to 4.4%. A 50 nM dose of SEQ ID NO:273 (GAGACATACCCAGACACAAACGGCC without a spacer) reduced UNC13A cryptic exon levels to 20.3%.

[0625] As shown in Table 8, a 200 nM dose of SEQ ID NO:2831 (GTTCTTTCCAGGAAACCCAGGCA without a spacer) reduced UNC13A cryptic exon levels to 5.1%. A 50 nM dose of SEQ ID NO:2831 (GTTCTTTCCAGGAAACCCAGGCA without a spacer) reduced UNC13A cryptic exon levels to 26.0%.

[0626] As shown in Table 8, a 200 nM dose of SEQ ID NO:5156 (GTTCTTTSCAGGAAASCCAGGCA with two spacers) reduced UNC13A cryptic exon levels by 6.6%. A 50 nM dose of SEQ ID NO:5156 (GTTCTTTSCAGGAAASCCAGGCA with two spacers) reduced UNC13A cryptic exon levels by 41.2%.

[0627] As shown in Table 8, a 200 nM dose of SEQ ID NO:5140 (GCAGCTGGSAGAGACATASCCAGAC with two spacers) reduced UNC13A cryptic exon levels to 8.3%. A 50 nM dose of SEQ ID NO:5140 (GCAGCTGGSAGAGACATASCCAGAC with two spacers) reduced UNC13A cryptic exon levels to 31.0%.

[0628] As shown in Table 8, a 200 nM dose of SEQ ID NO: 303 (GTTCTTTCCAGGAAACCCAGGCAGC without a spacer) reduced UNC13A cryptic exon levels by 8.8%. A 50 nM dose of SEQ ID NO: 303 (GTTCTTTCCAGGAAACCCAGGCAGC without a spacer) reduced UNC13A cryptic exon levels by 35.4%.

[0629] As shown in Table 8, a 200 nM dose of SEQ ID NO:5135 (GCAGCTSGAAGAGACATASCCAGAC with two spacers) reduced UNC13A cryptic exon levels by 11.8%. A 50 nM dose of SEQ ID NO:5135 (GCAGCTSGAAGAGACATASCCAGAC with two spacers) reduced UNC13A cryptic exon levels by 30.6%.

[0630] As shown in Table 8, a 200 nM dose of SEQ ID NO:283 (GCAGCTGGAAGAGACATACCCAGAC without a spacer) reduced UNC13A cryptic exon levels by 13.8%. A 50 nM dose of SEQ ID NO:283 (GCAGCTGGAAGAGACATACCCAGAC without a spacer) reduced UNC13A cryptic exon levels by 66.0%.

[0631] As shown in Table 8, a 200 nM dose of SEQ ID NO:2830 (TTCTTTCCAGGAAACCCAGGCAG with no spacer) reduced UNC13A cryptic exon levels by 15.2%. A 50 nM dose of SEQ ID NO:2830 (TTCTTTCCAGGAAACCCAGGCAG with no spacer) reduced UNC13A cryptic exon levels by 34.4%.

[0632] As shown in Table 8, a 200 nM dose of SEQ ID NO: 3585 (ACATCCATCCATCCATCCATTCA without a spacer) reduced UNC13A cryptic exon levels by 15.8%. A 50 nM dose of SEQ ID NO: 3585 (ACATCCATCCATCCATCCATTCA without a spacer) reduced UNC13A cryptic exon levels by 45.4%.

[0633] As shown in Table 8, a 200 nM dose of SEQ ID NO:5155 (TCTTTCCSGGAAACCSAGGCAGC with two spacers) reduced UNC13A cryptic exon levels by 18.2%. A 50 nM dose of SEQ ID NO:5155 (TCTTTCCSGGAAACCSAGGCAGC with two spacers) reduced UNC13A cryptic exon levels by 41.9%.

[0634] As shown in Table 8, a 200 nM dose of SEQ ID NO:5157 (TTCTTTCSAGGAAACSCAGGCAG with two spacers) reduced UNC13A cryptic exon levels by 20.1%. A 50 nM dose of SEQ ID NO:5157 (TTCTTTCSAGGAAACSCAGGCAG with two spacers) reduced UNC13A cryptic exon levels by 42.8%.

[0635] As shown in Table 8, a 200 nM dose of SEQ ID NO: 1059 (ACACATCCATCCATCCATCCATTCA without a spacer) reduced UNC13A cryptic exon levels by 23.1%. A 50 nM dose of SEQ ID NO: 1059 (ACACATCCATCCATCCATCCATTCA without a spacer) reduced UNC13A cryptic exon levels by 50.2%.

[0636] As shown in Table 8, a 200 nM dose of SEQ ID NO:2829 (TCTTTCCAGGAAACCCAGGCAGC without a spacer) reduced UNC13A cryptic exon levels by 25%. A 50 nM dose of SEQ ID NO:2829 (TCTTTCCAGGAAACCCAGGCAGC without a spacer) reduced UNC13A cryptic exon levels by 40.6%.

[0637] As shown in Table 8, a 200 nM dose of SEQ ID NO:269 (CATACCCAGACACAAACGGCCCAAT without a spacer) reduced UNC13A cryptic exon levels by 27.2%. A 50 nM dose of SEQ ID NO:269 (CATACCCAGACACAAACGGCCCAAT without a spacer) reduced UNC13A cryptic exon levels by 43.4%.

[0638] As shown in Table 8, a 200 nM dose of SEQ ID NO: 1142 (CTCTTTTATCCATCCACACACCCAC without a spacer) reduced UNC13A cryptic exon levels by 34.4%. A 50 nM dose of SEQ ID NO: 1142 (CTCTTTTATCCATCCACACACCCAC without a spacer) reduced UNC13A cryptic exon levels by 64.3%.

[0639] As shown in Table 8, a 200 nM dose of SEQ ID NO: 3670 (CTCTTTTATCCATCCACACACCC without a spacer) reduced UNC13A cryptic exon levels by 40.5%. A 50 nM dose of SEQ ID NO: 3670 (CTCTTTTATCCATCCACACACCC without a spacer) reduced UNC13A cryptic exon levels by 82.2%.

[0640] As shown in Table 8, a 200 nM dose of SEQ ID NO: 301 (TCTTTCCAGGAAACCCAGGCAGCTG without a spacer) reduced UNC13A cryptic exon levels by 41.6%. A 50 nM dose of SEQ ID NO: 301 (TCTTTCCAGGAAACCCAGGCAGCTG without a spacer) reduced UNC13A cryptic exon levels by 54.2%.

[0641] As shown in Table 8, a 200 nM dose of SEQ ID NO:5165 (GAAAGTGSCATGGAGSGTGCAAG with two spacers) reduced UNC13A cryptic exon levels by 42.0%. A 50 nM dose of SEQ ID NO:5165 (GAAAGTGSCATGGAGSGTGCAAG with two spacers) reduced UNC13A cryptic exon levels by 54.0%.

[0642] As shown in Table 8, a 200 nM dose of SEQ ID NO:5198 (ATCTACSCTTTTATCCATSCACACA with two spacers) reduced UNC13A cryptic exon levels by 44.5%. A 50 nM dose of SEQ ID NO:5198 (ATCTACSCTTTTATCCATSCACACA with two spacers) reduced UNC13A cryptic exon levels by 45.5%.

[0643] As shown in Table 8, a 200 nM dose of SEQ ID NO: 1147 (ATCTACTCTTTTATCCATCCACACA without a spacer) reduced UNC13A cryptic exon levels by 46.4%. A 50 nM dose of SEQ ID NO: 1147 (ATCTACTCTTTTATCCATCCACACA without a spacer) reduced UNC13A cryptic exon levels by 69.7%.

[0644] As shown in Table 8, a 200 nM dose of SEQ ID NO:3587 (ACACATCCATCCATCCATCCATT with no spacer) reduced UNC13A cryptic exon levels by 47.8%.

[0645] As shown in Table 8, a 200 nM dose of SEQ ID NO:5202 (CTACTCTSTTATCCASCCACACA with two spacers) reduced UNC13A cryptic exon levels by 48.1%. A 50 nM dose of SEQ ID NO:5202 (CTACTCTSTTATCCASCCACACA with two spacers) reduced UNC13A cryptic exon levels by 76.5%.

[0646] As shown in Table 8, a 200 nM dose of SEQ ID NO:5199 (ATCTACTCSTTTATCCATSCACACA with two spacers) reduced UNC13A cryptic exon levels by 48.2%. A 50 nM dose of SEQ ID NO:5199 (ATCTACTCSTTTATCCATSCACACA with two spacers) reduced UNC13A cryptic exon levels by 62.8%.

[0647] As shown in Table 8, a 200 nM dose of SEQ ID NO:5192 (CTTTCAGSAATTCAASCACACAT with two spacers) reduced UNC13A cryptic exon levels by 49.6%. A 50 nM dose of SEQ ID NO:5192 (CTTTCAGSAATTCAASCACACAT with two spacers) reduced UNC13A cryptic exon levels by 70.9%.

[0648] As shown in Table 8, a 200 nM dose of SEQ ID NO: 3774 (AAGTGTCATGGAGAGTGCAAGGG without a spacer) reduced UNC13A cryptic exon levels by 49.8%. A 50 nM dose of SEQ ID NO: 3774 (AAGTGTCATGGAGAGTGCAAGGG without a spacer) reduced UNC13A cryptic exon levels by 67.0%.

[0649] [Table 11-1]

[0650] [Table 11-2]

[0651] [Table 11-3]

[0652] [Table 11-4]

[0653] [Table 11-5]

[0654] [Table 11-6]

[0655] [Table 11-7]

[0656] [Table 11-8]

[0657] [Table 11-9]

[0658] [Table 11-10]

[0659] [Example 4] Methods for evaluating UNC13A antisense oligonucleotides UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded in 96-well plates at a density of 40,000 cells / well. Antisense oligonucleotides (AONs) against TDP43 were transfected with Endoporter (Gene Tools, Philomath, OR, USA) to reduce expression of full-length UNC13A transcripts and increase expression of UNC13A cryptic exons. Vehicle controls were motor neurons treated with Endoporter alone. Positive controls included cells treated with TDP43 AONs alone ("AON TDP43" or "TDP43 AONs").

[0660] The TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5'A * A * G * G * C * T * T * C *A * T * A * T * T * G * T * A * C * T * T * ...

Claims

1. An oligonucleotide comprising a sequence that is at least 85% complementary to one equal-length portion of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, The oligonucleotide has a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides, at least one nucleoside linkage of the oligonucleotide is a modified linkage, and two or three nucleotides independently form the following formula: Formula (II): 【Chemistry 1】 (In the formula, X is selected from -CH2- and -O-); Formula (II'): 【Chemistry 2】 (In the formula, X is selected from -CH2- and -O-); Formula (Iia): 【Transformation 3】 ； Formula (Iia'): 【Chemistry 4】 ； Formula (IIb): 【Transformation 5】 ； Formula (IIib'): 【Transformation 6】 ； Formula (IIIa): 【Transformation 7】 ; and Formula (IIIa'): 【Transformation 8】 The oligonucleotide is replaced by one of the following formulas.

2. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises a segment having up to 11, 10, 9, or 8 linked nucleosides.

3. The oligonucleotide according to claim 1 or 2, wherein the oligonucleotide comprises a segment having up to seven linked nucleosides.

4. The oligonucleotide according to claim 3, wherein the oligonucleotide comprises a segment having up to 6, 5, 4, 3, or 2-linked nucleosides.

5. The oligonucleotide according to claim 1, wherein the oligonucleotide has a length of 23, 24, or 25 nucleotides and includes a sequence that is at least 90% identical to any of SEQ ID NOs: 1 to 1264, SEQ ID NOs: 2529 to 3792, SEQ ID NOs: 5066 to 5166, SEQ ID NOs: 5168 to 5202, SEQ ID NOs: 5209 to 5221, and SEQ ID NOs: 5235 to 5292.

6. The oligonucleotide according to claim 1, wherein the oligonucleotide has a length of 23, 24, or 25 nucleotides and comprises a sequence that is at least 90% identical to SEQ ID NO: 2812, SEQ ID NO: 2801, SEQ ID NO: 5566, or SEQ ID NO: 2834.

7. The oligonucleotide according to claim 6, wherein the first nucleotide replaced by the formula is located between the 10th and 15th positions of the oligonucleotide.

8. The oligonucleotide according to claim 7, wherein the first nucleotide replaced by the formula is located between the 7th and 11th positions of the oligonucleotide.

9. The oligonucleotide according to claim 8, wherein the oligonucleotide comprises a second nucleotide substituted by the formula, and the second nucleotide substituted by the formula is located between the 14th and 22nd positions of the oligonucleotide.

10. The oligonucleotide according to claim 9, wherein the first nucleotide replaced by the formula is located at position 8 of the oligonucleotide, and the second nucleotide replaced by the formula is located at position 16 of the oligonucleotide.

11. The oligonucleotide according to claim 10, wherein the oligonucleotide comprises a third nucleotide substituted by the formula, and the third nucleotide substituted by the formula is located between the 21st and 24th positions of the oligonucleotide.

12. The formula is formula (Iia): 【Chemistry 9】 The oligonucleotide according to claim 1.

13. The formula is formula (Iia'): 【Chemistry 10】 The oligonucleotide according to claim 1.

14. The oligonucleotide according to claim 1, wherein the oligonucleotide further comprises locked nucleic acid (LNA).

15. The oligonucleotide according to claim 14, wherein the locked nucleic acid (LNA) is located at one of the positions 4, 7, 9, 12, 15, or 20 of the oligonucleotide.

16. The oligonucleotide according to claim 1, wherein at least one modified nucleoside linkage of the oligonucleotide is independently selected from the group consisting of phosphodiester linkage, phosphorothioate linkage, alkyl phosphate linkage, phosphorodithioate linkage, phosphotryester linkage, alkylphosphonate linkage, 3-methoxypropylphosphonate linkage, methylphosphonate linkage, aminoalkylphosphotryester linkage, alkylenephosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphoramidothioate linkage, thiophosphodiamidate linkage, phosphorodiamidate linkage, aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotryester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

17. The oligonucleotide according to claim 16, wherein at least one modified nucleoside linkage of the oligonucleotide is a phosphorothioate linkage, and the phosphorothioate linkage has an Rp configuration or an Sp configuration.

18. The oligonucleotide according to claim 17, wherein all nucleoside links of the oligonucleotide are modified nucleoside links, and all modified nucleoside links are phosphorothioate links, and further, the phosphorothioate links have an Rp configuration or an Sp configuration.

19. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises at least one modified sugar moiety, and the modified sugar moiety is one of a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl)(2'-MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), restricted ethyl 2'-4' crosslinked nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA), and a tricyclic analog (e.g., tcDNA).

20. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises at least one modified sugar moiety, and the modified sugar moiety is 2'-O-(2-methoxyethyl)(2'-MOE).

21. The oligonucleotide according to claim 1, further comprising a targeted or conjugated moiety, wherein the targeted or conjugated moiety is selected from cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and an antibody that crosses the blood-brain barrier.

22. A modified oligonucleotide comprising a sequence that is at least 85% identical to sequence number 2812 (GGCAGCTGGAAGAGATACCCA), The modified oligonucleotide has a length of 23, 24, 25, 26, or 27 nucleotides, and at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a modified linkage, and two or three nucleotides independently form the following formula: Formula (II): 【Chemistry 11】 (In the formula, X is selected from -CH2- and -O-); Formula (II'): 【Chemistry 12】 (In the formula, X is selected from -CH2- and -O-); Formula (Iia): 【Chemistry 13】 ； Formula (Iia'): 【Chemistry 14】 ； Formula (IIb): 【Chemistry 15】 ； Formula (IIib'): 【Chemistry 16】 ； Formula (IIIa): 【Chemistry 17】 ;or Formula (IIIa'): [Chemistry 18] The modified oligonucleotide is replaced by one of the following formulas.

23. The oligonucleotide is (a) up to 11, 10, 9, or 8 linked nucleosides; (b) up to seven linked nucleosides; or (c) up to 6, 5, 4, 3, or 2-linked nucleosides A modified oligonucleotide according to claim 22, comprising a segment having the following characteristics.

24. The first nucleotide replaced by the formula is (a) between the 10th and 15th positions of the oligonucleotide; or (b) Between the 7th and 11th positions of the oligonucleotide A modified oligonucleotide according to claim 22 or 23, located at [location].

25. The modified oligonucleotide according to claim 22, wherein the oligonucleotide further comprises a second nucleotide substituted with the formula, the second nucleotide substituted with the formula is located between the 14th and 22nd positions of the oligonucleotide.

26. The modified oligonucleotide according to claim 22, wherein the first nucleotide replaced by the formula is located between positions 7 and 9 of the oligonucleotide, and the second nucleotide replaced by the formula is located between positions 15 and 18 of the oligonucleotide.

27. ​​The modified oligonucleotide according to claim 22, wherein the oligonucleotide further comprises a third nucleotide substituted with the formula, the third nucleotide substituted with the formula is located between the 21st and 24th positions of the oligonucleotide.

28. The modified oligonucleotide according to claim 22, wherein at least one nucleoside linkage is a phosphorothioate linkage, and at least one nucleotide comprises a modified sugar moiety, the modified sugar moiety being one of a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl)(2'-MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), restricted ethyl 2'-4' crosslinked nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA), and a tricyclic analog (e.g., tcDNA).

29. The modified oligonucleotide according to claim 22, wherein the oligonucleotide has a length of 23 nucleotides and comprises a sequence that is at least 90% identical to SEQ ID NO: 2812 (GGCAGCTGGAAGAGACATACCCA).

30. The modified oligonucleotide according to claim 29, wherein the first nucleotide replaced by the formula is located at position 8 of the oligonucleotide, and the second nucleotide replaced by the formula is located at position 16 of the oligonucleotide.

31. The first nucleotide at position 8 is of formula (Iia'): 【Chemistry 19】 It has been replaced with, and, The second nucleotide at position 16 is given by formula (Iia'): 【Chemistry 20】 It has been replaced with The modified oligonucleotide according to claim 22.

32. A modified oligonucleotide comprising a sequence that is at least 90% identical to Sequence ID No. 2812 (GGCAGCTGGAAGAGATACCCA), The oligonucleotide in question has a length of 23 nucleotides, and the nucleotide at position 8 and position 16 of sequence number 2812 are given by formula (Iia'): 【Chemistry 21】 It is replaced by and at least one linkage is a modified nucleoside linkage, The modified oligonucleotide.

33. The modified oligonucleotide according to claim 32, comprising at least one nucleotide containing a modified sugar moiety.

34. The modified oligonucleotide according to claim 33, wherein each nucleotide comprises a modified sugar moiety in which 2'-O-(2-methoxyethyl)(2'-MOE).

35. The modified oligonucleotide according to claim 34, wherein each linkage is a modified nucleotide linkage, and each modified nucleoside linkage is optionally a phosphorothioate linkage.

36. A modified oligonucleotide comprising SEQ ID NO: 5254 (GGCAGCTSGAAGAGASATACCCA), wherein S is of formula (Iia'): 【Chemistry 22】 The modified oligonucleotide is characterized in that each nucleotide comprises a modified sugar moiety in which 2'-O-(2-methoxyethyl)(2'-MOE), each cytidine is 5-methylcytosine(5-MeC), each nucleoside linkage is a phosphorothioate linkage, and the oligonucleotide has a length of 23 nucleotides.

37. The modified oligonucleotide according to claim 36, comprising SEQ ID NO: 5254 (GGCAGCTSGAAGAGASATACCCA), wherein S is the formula (Iia'), each nucleotide comprises a modified sugar moiety in which 2'-O-(2-methoxyethyl)(2'-MOE), each cytidine is 5-methylcytosine (5-MeC), and each nucleoside linkage is a phosphorothioate linkage.

38. The modified oligonucleotide according to claim 22, wherein the oligonucleotide further comprises a targeted or conjugated moiety, the targeted or conjugated moiety being cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, or an antibody that crosses the blood-brain barrier.

39. A pharmaceutical composition comprising the modified oligonucleotide described in Claim 1 and a pharmaceutically acceptable excipient.

40. A modified oligonucleotide according to claim 1 or a pharmaceutical composition according to claim 39, for use in the treatment of a neurological disease or neurological disorder, wherein the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or ALS with FTD.

41. The modified oligonucleotide or pharmaceutical composition according to claim 40, wherein the modified oligonucleotide or pharmaceutical composition is administered intrathecally, intrathalamus, or into the cisterna magna.

42. A modified oligonucleotide or pharmaceutical composition according to claim 40, for use in combination with a second therapeutic agent, or further comprising a second therapeutic agent, wherein the second therapeutic agent may optionally be riluzole (Rilutek), PrimeC, edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPL, etc., for treating the neurological disorder. AN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 mouth openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants, and psychostimulants, therapies (e.g., selected from respiratory care, physiotherapy, occupational therapy, speech-language therapy, nutritional support), deep brain stimulation Levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, symmetrel, osmolex), benztropin (cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapo Ongentys, Tolcapone (Tasmar), Apomorphine (Apokyn, Kynmobi), Exenatide, Reishi mushroom, BIIB054, BIIB094, Caffeine, Salizotan, Fetal dopamine cell transplantation, Aducanumab (Aduhlem), Memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (Razadyne), Namzaric, Suvorexant (Belsomra), Recanemab, Olanzapine (Zyplexa), Quetiapine (Seroquel),SSRIs (Citalopram (Cipramil), Dapoxetine (Priligy), Escitalopram (Cipralex), Fluoxetine (Prozac or Oxactin), Fluvoxamine (Faverin), Paroxetine (Seroxat), Sertraline (Lustral), Vortioxetine (Brintellix)), Divalproex sodium (Depakote), Carbamazepine (Tegretol), Medroxyprogesterone (medroxyprogesterone), Brivaracetam (Briviact) Cannabidiol (epidiolex), carbamazepine (carbatrol, tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aption), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar) Modified oligonucleotides or pharmaceutical compositions selected from XR, Trileptal, perampanel (Fycompa), phenobarbital, phenytoin (Dilantin), pregabalin (Lyrica), thiagabin (Gabitril), topiramate (Topamax), valproate (Depakene, Depakote), and / or zonisamide (Zonegran).

43. The use of the modified oligonucleotide according to claim 1 or the pharmaceutical composition according to claim 39 in the manufacture of a pharmacopoeia for treating a neurological disease or neurological disorder, wherein the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or ALS with FTD.

44. A pharmaceutical composition comprising the modified oligonucleotide described in claim 22 and a pharmaceutically acceptable excipient.

45. A modified oligonucleotide according to claim 22 or a pharmaceutical composition according to claim 44, for use in the treatment of a neurological disease or neurological disorder, wherein the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or ALS with FTD.

46. The modified oligonucleotide or pharmaceutical composition according to claim 45, wherein the modified oligonucleotide or pharmaceutical composition is administered intrathecally, intrathalamus, or into the cisterna magna.

47. A modified oligonucleotide or pharmaceutical composition according to claim 45, for use in combination with a second therapeutic agent, or further comprising a second therapeutic agent, wherein the second therapeutic agent may optionally be riluzole (Rilutek), PrimeC, edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPL, for treating the neurological disorder. AN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 mouth openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants, and psychostimulants, therapies (e.g., selected from respiratory care, physiotherapy, occupational therapy, speech-language therapy, nutritional support), deep brain stimulation Levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, symmetrel, osmolex), benztropin (cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapo Ongentys, Tolcapone (Tasmar), Apomorphine (Apokyn, Kynmobi), Exenatide, Reishi mushroom, BIIB054, BIIB094, Caffeine, Salizotan, Fetal dopamine cell transplantation, Aducanumab (Aduhlem), Memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (Razadyne), Namzaric, Suvorexant (Belsomra), Recanemab, Olanzapine (Zyplexa), Quetiapine (Seroquel),SSRIs (Citalopram (Cipramil), Dapoxetine (Priligy), Escitalopram (Cipralex), Fluoxetine (Prozac or Oxactin), Fluvoxamine (Faverin), Paroxetine (Seroxat), Sertraline (Lustral), Vortioxetine (Brintellix)), Divalproex sodium (Depakote), Carbamazepine (Tegretol), Medroxyprogesterone (medroxyprogesterone), Brivaracetam (Briviact) Cannabidiol (epidiolex), carbamazepine (carbatrol, tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aption), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar) Modified oligonucleotides or pharmaceutical compositions selected from XR, Trileptal, perampanel (Fycompa), phenobarbital, phenytoin (Dilantin), pregabalin (Lyrica), thiagabin (Gabitril), topiramate (Topamax), valproate (Depakene, Depakote), and / or zonisamide (Zonegran).

48. The use of the modified oligonucleotide according to claim 22 or the pharmaceutical composition according to claim 44 in the manufacture of a pharmacopoeia for treating a neurological disease or neurological disorder, wherein the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or ALS with FTD.

Images