Compounds and methods for increasing STMN2 expression

Abstract

To provide compounds, methods, and pharmaceutical compositions for treating neurodegenerative diseases.SOLUTION: There are provided compounds, methods, and pharmaceutical compositions for increasing an amount or activity of STMN2 RNA in a cell or animal, and in certain embodiments, increasing an amount of STMN2 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom of a neurodegenerative disease. Such symptoms include ataxia, neuropathy, synaptic dysfunction, deficits in cognition, and decreased longevity. Such neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB).SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application is filed in electronic format with a sequence listing. The sequence listing is provided under the file name BIOL0338WOSEQ_ST25.txt, created May 23, 2019, which is 140KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for increasing the amount or activity of STMN2 RNA in cells or animals, and in certain examples, for increasing the amount of stathmin-2 protein in cells or animals. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom of a neurodegenerative disease. Such symptoms include ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced life span. Such neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB). [Background technology]

[0003] The STMN2 gene encodes the stathmin-2 protein, a member of the stathmin family of phosphoproteins that function in microtubule dynamics and signal transduction. Stathmin-2 is thought to play a regulatory role in nerve growth and to be involved in bone formation.

[0004] Amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) is a disease characterized by selective degeneration of upper and lower motor neurons (Rowland, N. Engl. J. Med. 2001, 344, 1688-1700). ALS is a devastating progressive neurodegenerative disease affecting as many as 30,000 Americans at any given time. The progressive degenerative damage of motor neurons in ALS eventually leads to their death. As motor neurons die, the brain's ability to initiate and control muscle movement is lost. As voluntary muscle action becomes progressively affected, patients in the later stages of the disease can become completely paralyzed.

[0005] Frontotemporal dementia (FTD) refers to a group of disorders caused by progressive neuronal loss in the frontal or temporal lobes of the brain. The neuronal damage caused by FTD leads to loss of function in the frontal or temporal lobes, which variably cause behavioral and personality deterioration, speech disorders, or changes in muscle or motor function.

[0006] Alzheimer's disease (AD) is an irreversible, progressive brain disorder that slowly destroys memory and thinking skills, and ultimately the ability to perform the simplest tasks. AD is the most common cause of dementia among older adults. Dementia is the loss of cognitive and behavioral functions to the extent that it interferes with a person's daily life and activities. Dementia ranges in severity from a moderate stage, when it just begins to affect a person's functioning, to the most severe stage, when a person must be completely dependent on others for basic activities of daily living.

[0007] Dementia with Lewy bodies (DLB) is a type of progressive dementia that leads to a decline in thinking, reasoning, and independent functioning due to abnormal Lewy body deposits in nerve cells. DLB causes a progressive decline in intelligence. People with DLB may experience visual hallucinations, and changes in alertness and attention. Other effects include parkinsonian symptoms such as muscle rigidity, bradykinesia, and tremors. Symptoms include those of glaucoma.

[0008] Currently, there is a lack of acceptable options for treating neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB). Accordingly, it is an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases. Summary of the Invention

[0009] Provided herein are compounds, methods, and pharmaceutical compositions for increasing the amount or activity of STMN2 RNA, and in certain embodiments, for increasing the amount of stathmin-2 protein in cells or animals. Without being limited to a particular mechanism, it is believed that the modified oligonucleotides described herein increase STMN2 RNA expression by preventing the use of a premature polyadenylation site in the first intron of STMN2 pre-mRNA. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the animal has amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB). In certain embodiments, the compound useful for increasing the expression of STMN2 RNA is an oligomeric compound or a modified oligonucleotide. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide.

[0010] Also provided is a method useful for improving at least one symptom of neurodegenerative disease.In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD) and dementia with Lewy bodies (DLB).In certain embodiments, the symptoms include ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced lifespan.In certain embodiments, the improvement of these symptoms results in improved motor function, reduced neuropathy, improved synaptic function, improved cognition, and survival rate. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is not limiting. Also, terms such as "element" or "component" encompass both elements and components that include one unit and elements and components that include two or more subunits, unless otherwise specified.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and papers, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0013] definition Unless specific definitions are provided, the terminology used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. All permitted patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise stated, the following terms have the following meanings.

[0015] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0016] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0017] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0018] As used herein, "administering" means providing a pharmaceutical agent to an animal.

[0019] As used herein, "animal" means a human or non-human animal.

[0020] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.

[0021] As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of achieving at least one antisense activity.

[0022] As used herein, "improve" in relation to treatment refers to an improvement in at least one symptom with respect to the same symptom in the absence of treatment.In certain embodiments, the improvement is a reduction in the severity or frequency of symptoms, or a delay in the onset of symptoms, or a delay in the progression of the severity or frequency of symptoms.In certain embodiments, the symptoms are ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced lifespan.In certain embodiments, the improvement of these symptoms results in improved motor function, reduced neuropathy, improved synaptic function, improved cognition, and survival rate.

[0023] As used herein, "bicyclic nucleoside" or "BNA" refers to a nucleoside that comprises a bicyclic sugar moiety. As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that comprises two rings, the second ring being formed via a bridge that connects two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0024] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, within a cell, animal, or human.

[0025] As used herein, "complementary" in reference to an oligonucleotide refers to a nucleic acid base of an oligonucleotide or one or more regions thereof that is complementary to another nucleic acid or one or more regions thereof. means that at least 70% of the nucleobases of an oligonucleotide and another nucleic acid are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at every nucleoside of the oligonucleotide.

[0026] As used herein, a "conjugate group" refers to a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that attach the conjugate moieties to the oligonucleotide.

[0027] As used herein, "composite linker" means a single bond or group of atoms that comprises at least one bond connecting a composite moiety to an oligonucleotide.

[0028] As used herein, "conjugated moiety" means a group of atoms that is attached to an oligonucleotide via a conjugated linker.

[0029] As used herein, "adjacent" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "adjacent nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0030] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar" means a β-D ribosyl bicyclic sugar moiety, where the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0031] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar.

[0032] As used herein, "chirally enriched population" refers to a plurality of molecules of the same molecular formula, and the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chirally enriched population of molecules with multiple chiral centers in each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that contains a modified oligonucleotide.

[0033] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage located between external regions having one or more nucleosides, the nucleosides comprising the internal region being chemically distinct from the nucleosides or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings." Unless otherwise indicated, "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2'-deoxyribosyl. Thus, an "MOE gapmer" refers to a gapmer having a 2'-MOE nucleoside sugar motif in both the wings and the 2'-deoxynucleoside gap. Unless otherwise indicated, an MOE gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0034] As used herein, a "hotspot region" is a range of nucleobases of a target nucleic acid that is amenable to oligomeric compound-mediated increase in the amount or activity of the target nucleic acid.

[0035] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0036] As used herein, "increasing the amount or activity" refers to more transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample.

[0037] As used herein, the term "internucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond.A "phosphorothioate bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0038] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if they are adjacent to the oligonucleotide.

[0039] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification, such as a substitution, that does not form a bridge between the two atoms of the sugar but rather forms a second ring.

[0040] As used herein, "mismatched" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or a target nucleic acid when the first and second oligonucleotides are aligned.

[0041] As used herein, "MOE" means methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group on a ribosyl sugar moiety.

[0042] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE modified sugar.

[0043] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0044] As used herein, "neurodegenerative disease" refers to a condition characterized by progressive loss of structure or function, including death of nerve cells. In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB).

[0045] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, "modified nucleobase" refers to a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A common base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of adjacent nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0046] As used herein, "nucleoside" refers to a compound that includes a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are present between the ones that are linked).

[0047] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a complex group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound".

[0048] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside bonds, where each nucleoside and internucleoside bond is modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide, where at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.

[0049] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to an animal. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as a tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, and lozenge for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0050] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharma- ceutically acceptable salt of a compound. Pharmaceutically acceptable salts are salts that possess the desired biological activity of the parent compound. It retains its properties and does not impart undesirable toxicological effects thereto.

[0051] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0052] As used herein, "phosphorus moiety" refers to a group of atoms that includes a phosphorus atom. In certain embodiments, the phosphorus moiety includes a mono-, di-, or tri-phosphate, or a phosphorothioate.

[0053] As used herein, "prodrug" refers to a therapeutic agent that is in an extracorporeal form that is converted into a different form within an animal or cells thereof. Typically, conversion of the prodrug within the animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.

[0054] As used herein, "RNAi compounds" refers to antisense compounds that act, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNAs, single-stranded RNAs (ssRNAs), and microRNAs, including microRNA mimics. In certain embodiments, RNAi compounds modulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compounds excludes antisense compounds that act through RNase H.

[0055] As used herein, "self-complementary" in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0056] As used herein, "standard cell assay" refers to the assay described in Example 1 and reasonable variations thereof.

[0057] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules that have the stereorandom chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereorandom chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0058] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH (H) furanosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H (H) moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0059] As used herein, a "sugar surrogate" refers to a furanoside that can link a nucleobase to another group, such as an internucleoside linkage, a conjugated group, or a terminal group in an oligonucleotide. The term "sugar surrogate" refers to a modified nucleoside having a sugar moiety other than a saccharide moiety. Modified nucleosides containing sugar surrogates can be conjugated at one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or nucleic acid.

[0060] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect.

[0061] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0062] As used herein, "end group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0063] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic effect to an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0064] The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an STMN2 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

[0065] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 10 to 321.

[0066] Embodiment 3.1 comprises 2 to 50 linked nucleosides, 8819 to 8841 of SEQ ID NO: 1 or 100 to 122 of SEQ ID NO: 2, 8827 to 8851 of SEQ ID NO: 1 or 108 to 132 of SEQ ID NO: 2, 8836 to 8880 in SEQ ID NO: 1 or 117 to 161 in SEQ ID NO: 2, or An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases complementary to 8913 to 8948 of SEQ ID NO:1 or 194 to 229 of SEQ ID NO:2.

[0067] Embodiment 4. The oligomeric compound of any one of embodiments 1 to 3, wherein the STMN2 nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0068] Embodiment 5. The oligomeric compound according to any one of embodiments 1 to 4, wherein said modified oligonucleotide is a single-stranded modified oligonucleotide.

[0069] Embodiment 6. The oligomeric compound according to any one of embodiments 1 to 5, wherein at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0070] Embodiment 7. The oligomeric compound of embodiment 6, wherein said modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0071] Embodiment 8. The oligomeric compound according to any one of embodiments 1 to 5, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0072] Embodiment 9. The oligomeric compound according to embodiment 8, wherein each modified internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0073] Embodiment 10. The oligomeric compound according to any one of embodiments 1 to 7, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

[0074] Embodiment 11. The oligomeric compound according to any one of embodiments 1 to 7 and 10, wherein each internucleoside linkage of said modified oligonucleotide is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0075] Embodiment 12. The oligomeric compound according to any one of embodiments 1 to 11, wherein at least one nucleobase of said modified oligonucleotide comprises a modified nucleobase.

[0076] Embodiment 13. The oligomeric compound of embodiment 12, wherein said modified nucleobase is 5-methylcytosine.

[0077] Embodiment 14. The oligomeric compound of any one of embodiments 1 to 13, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 modified nucleosides comprising a modified sugar moiety.

[0078] Embodiment 15. The oligomeric compound of embodiment 14, wherein said modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 modified nucleosides comprising a bicyclic sugar moiety.

[0079] Embodiment 16. The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0080] Embodiment 17. The oligomeric compound according to any one of embodiments 1 to 13, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic sugar moiety.

[0081] Embodiment 18. The modified oligonucleotide comprises at least one modified nucleoside that comprises a modified non-bicyclic sugar moiety that includes 2'-MOE or 2'-OMe. 18. The oligomeric compound according to embodiment 17.

[0082] Embodiment 19. The oligomeric compound of embodiment 18, wherein each modified nucleoside of said modified oligonucleotide comprises a modified non-bicyclic sugar moiety that includes 2'-MOE or 2'-OMe.

[0083] Embodiment 20. The oligomeric compound of any one of embodiments 1 to 13, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0084] Embodiment 21. The oligomeric compound of embodiment 20, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

[0085] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 18 and 20 to 21, wherein the modified oligonucleotide is a gapmer.

[0086] Embodiment 23. The modified oligonucleotide comprises: a 5'-region consisting of 1 to 6 linked 5'-nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 22. The oligomeric compound according to any one of embodiments 1-18 and 20-21, having a sugar motif comprising a 3'-region consisting of 1-6 linked 5'-nucleosides, each of the 5'-region nucleosides and each of the 3'-region nucleosides comprising a modified sugar moiety, and each of the central region nucleosides comprising a 2'-deoxynucleoside sugar moiety.

[0087] Embodiment 24. The modified oligonucleotide consists of 20 linked nucleosides and has the following internucleoside motif: sooossssssssssssooss, s=phosphorothioate internucleoside linkage, and The oligomeric compound according to any one of embodiments 1 to 7 or 10 to 23, wherein o = phosphodiester internucleoside linkage.

[0088] Embodiment 25. The oligomeric compound according to any one of embodiments 1 to 23, wherein the modified oligonucleotide consists of 12 to 18, 12 to 20, 14 to 20, 16 to 20, or 17 to 19 linked nucleosides.

[0089] Embodiment 26. The oligomeric compound according to any one of embodiments 1 to 23 and 25, wherein the modified oligonucleotide consists of 16, 17, or 18 linked nucleosides.

[0090] Embodiment 27. An oligomeric compound according to any one of embodiments 1 to 26, which comprises the modified oligonucleotide.

[0091] Embodiment 28. An oligomeric compound according to any one of embodiments 1 to 26, comprising a composite group comprising a composite moiety and a composite linker.

[0092] Embodiment 29. The oligomeric compound according to embodiment 28, wherein said complex group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0093] Embodiment 30. The method of embodiment 28 or 29, wherein the composite linker consists of a single bond. Oligomeric compounds.

[0094] Embodiment 31 The oligomeric compound of embodiment 28, wherein said composite linker is cleavable.

[0095] Embodiment 32. The oligomeric compound of embodiment 28, wherein the composite linker comprises 1 to 3 linker nucleosides.

[0096] Embodiment 33. The oligomeric compound of any of embodiments 28-32, wherein said composite group is attached to said modified oligonucleotide at the 5'-end of said modified oligonucleotide.

[0097] Embodiment 34. The oligomeric compound of any of embodiments 28-32, wherein said composite group is attached to said modified oligonucleotide at the 3'-end of said modified oligonucleotide.

[0098] Embodiment 35. The oligomeric compound of any one of embodiments 1 to 26 or 28 to 34, comprising a terminal group.

[0099] Embodiment 36. The oligomeric compound of any one of embodiments 1 to 35, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0100] Embodiment 37. The oligomeric compound of any one of embodiments 1-31 or 33-34, wherein the oligomeric compound does not comprise a linker nucleoside.

[0101] Embodiment 38. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1 to 35 and 37.

[0102] Embodiment 39. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 37 or an oligomeric duplex according to embodiment 38.

[0103] Embodiment 40. A modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence that includes at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 10-321.

[0104] Embodiment 41. A pharmaceutical composition comprising at least one of an oligomeric compound according to any one of embodiments 1 to 37, an oligomeric duplex according to embodiment 38, an antisense compound according to embodiment 39, or a modified oligonucleotide according to embodiment 40, and a pharma- ceutically acceptable carrier or diluent.

[0105] Embodiment 42. The pharmaceutical composition of embodiment 41, wherein the modified oligonucleotide is a sodium salt.

[0106] Embodiment 43. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 41 to 42.

[0107] Embodiment 44 The method of embodiment 43, wherein the animal is a human.

[0108] Embodiment 45. A method for treating a disease associated with STMN2, comprising administering to an individual having or at risk of developing a disease associated with STMN2 a therapeutically effective amount of a pharmaceutical composition described in embodiments 41 and 42, thereby treating the disease associated with STMN2.

[0109] Embodiment 46 The method of embodiment 45, wherein the disease associated with STMN2 is a neurodegenerative disease.

[0110] Embodiment 47. The method of embodiment 46, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB).

[0111] Embodiment 48 The method of embodiment 47, wherein at least one symptom of the neurodegenerative disease is ameliorated.

[0112] Embodiment 49. The method of embodiment 48, wherein the symptoms are ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced lifespan.

[0113] I. Certain Oligonucleotides In certain embodiments, oligonucleotides consisting of linked nucleosides are provided herein. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside bond.

[0114] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0115] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to other types of modified sugar moieties.

[0116] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be at any position of the furanosyl, including but not limited to the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituent groups for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C2, O-C3, O-C4, O-C5, O-C6, O-C7, O-C8, O-C9, O-C10, O-C11, O-C12, O-C13, O-C14, O-C15, O-C16, O-C17, O-C18, O-C19, O-C20, O-C19, O-C21, O-C22, O-C23, O-C14, O-C15, O-C16, O-C17, O-C18, O-C19, O-C22, O-C19, O-C23, O-C14, O-C15, O-C16, O-C17, O-C18, O-C19, O-C19, O-C20, O-C19, O-C19, O-C21, O-C19, O-C19, 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl Aryl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected from each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 and alkyl, with the 2'-substituents being as described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and Manoharan. et al., WO2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836).

[0117] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.

[0118] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0119] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0120] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety, hi certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridged sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' (referred to as "constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686; al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8, 278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US7,696,345 and Allerson et al., US8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R bare independently H, a protecting group, or C1-C 12 Alkyl (e.g., Imanishi et al., US 7,427,672).

[0121] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0122] Additional bicyclic sugar moieties are known in the art and are described, for example, in Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., al.,J.Am.Chem.Soc.,2007,129,8362-8379, Wengel et a.,US7,053,207, Imanishi et al.,US6,268,490, Imanishi et al.US6,770,748, Imanishi et al.,USRE44,779, Wengel et al. al.,US6,794,499, Wengel et al.,US6,670,461, Wengel et al.,US7,034,133, Wengel et al.,US8,080,644, Wengel et al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al. al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al., WO2007 / 134181, Seth et al. See, e.g., Allerson et al., US7,547,684, Seth et al., US7,666,854, Seth et al., US8,088,746, Seth et al., US7,750,131, Seth et al., US8,030,467, Seth et al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, and U.S. Patent Publications Allerson et al., US2008 / 0039618 and Migawa et al., US2015 / 0191727.

[0123] In certain embodiments, bicyclic sugar moieties and nucleosides conjugated to such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been conjugated to oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in the embodiments illustrated herein, they are in β-D configuration unless otherwise specified.

[0124] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0125] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom as well as substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5'-position.

[0126] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, Examples include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] "F-HNA" (see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including the additional modified THP compound having the formula: [ka] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugated group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0127] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0128] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and 2 or more heteroatoms. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, "morpholino" refers to a sugar surrogate having the following structure: [ka] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents from the morpholino structures described above. Such sugar surrogates are referred to herein as "modified morpholinos." In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0129] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in the modified nucleosides.

[0130] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobase, which are called abasic nucleoside.

[0131] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- Thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, The base is selected from silyl, general base, hydrophobic base, promiscuous base, size-expanded base, and fluorinated base.Modified nucleobases further include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which purine or pyrimidine bases are replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0132] Publications teaching the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al.,6,166,199, and Matteucci et al., US6,005,096.

[0133] 3. Certain modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom.Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphate, phosphotriester, including phosphodiester linkage ("P=O") (also referred to as unmodified or natural linkage), These include methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to natural phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0134] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the particular arrangement of the particular phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0135] Neutral internucleoside linkages include, without limitation, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH2 constituent moieties.

[0136] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0137] 1. Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif, hi certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.

[0138] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing most adjacent to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0139] In certain embodiments, a gapmer wing comprises 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.

[0140] In certain embodiments, the gapmer gap comprises between 7 and 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap is a modified 2'-deoxynucleoside.

[0141] In certain embodiments, the gapmer is a deoxy gapmer. In embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

[0142] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is a modification in each sugar moiety of each wing, and the gap nucleosides include unmodified deoxynucleoside sugars. Thus, a 5-10-5 MOE gapmer consists of five linked MOE modified nucleosides in the 5'-wing, ten deoxynucleosides in the gap, and five linked MOE nucleosides in the 3'-wing.

[0143] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. -3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.

[0144] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety (a uniformly modified sugar motif). In certain embodiments, the uniformly modified sugar moiety is 7-20 nucleosides in length. In certain embodiments, each nucleoside of the uniformly modified sugar motif is a 2'-substituted nucleoside, sugar surrogate, or bicyclic nucleoside. In certain embodiments, each nucleoside of the uniformly modified sugar motif comprises either a 2'-OCH2CH2OCH3 group or a 2'-OCH3 group. In certain embodiments, modified oligonucleotides having at least one fully modified sugar motif may also have at least one, at least two, at least three, or at least four 2'-deoxynucleosides.

[0145] In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety (fully modified oligonucleotide). In certain embodiments, the fully modified oligonucleotide comprises a different 2'-modification. In certain embodiments, each nucleoside of the fully modified oligonucleotide is a 2'-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside. In certain embodiments, each nucleoside of the fully modified oligonucleotide comprises either a 2'-OCH2CH2OCH3 group or at least one 2'-OCH3 group.

[0146] In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same 2'-modification (uniformly modified oligonucleotide). In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2'-substituted nucleoside, a sugar surrogate, or a bicyclic nucleoside. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises either a 2'-OCH2CH2OCH3 group or a 2'-OCH3 group.

[0147] In certain embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides that comprise a modified sugar moiety. In certain embodiments, each nucleoside of the modified oligonucleotide is a 2'-substituted nucleoside, a sugar surrogate, a bicyclic nucleoside, or a 2'-deoxynucleoside. In certain embodiments, each nucleoside of the modified oligonucleotide comprises a 2'-OCH2CH2OCH3 group, a 2'-H(H) deoxyribosyl sugar moiety, or a cEt modified sugar.

[0148] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0149] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.

[0150] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside that comprises a modified nucleobase. In certain such embodiments, one nucleoside that comprises a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0151] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.

[0152] C. A certain length The length of the oligonucleotide can be increased or decreased without eliminating activity. See, e.g., Woolf et al. (Proc. Natl. Acad. Sci. In a paper published in the journal Cell Biology, USA 89:7305-7309, 1992, a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to direct specific cleavage of the target RNA, although to a lesser extent than oligonucleotides containing no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0153] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of linked nucleosides X to Y, where X represents the smallest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, with the proviso that X≦Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-20, 13-21, 13-22, 13-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, ~19, 13~20, 13~21, 13~22, 13~23, 13~24, 13~25, 13~26, 13~27, 13~28, 13~29, 13~30, 14~15, 14~16, 14~17, 14~18, 14~19, 14~20, 14~21, 14~22, 14~23, 14~24, 14~25, 14~26, 14~27, 14~28, 14~29, 14~30, 1 5~16, 15~17, 15~18, 15~19, 15~20, 15~21, 15~22, 15~23, 15~24, 15~25, 15~26, 15~27, 15~28, 15~29, 15~30, 16~17, 16~18, 16~19, 16~20, 16~21, 16~22, 16~23, 16~24, 16~25, 16~26, 16~27, 16~28, 16~29, 16~30, 17~18, 17~19, 17~20, 17~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21,19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-2 8, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0154] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are conjugated to modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modifications, motifs, and overall length. In certain embodiments, each such parameter is independent of the other. Thus, Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases that are independent of the gapmer pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0155] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All of the chiral centers of the modified oligonucleotides are stereorandom in the stereorandom population. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0156] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence.In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0157] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugated groups and / or terminal groups. A conjugated group consists of one or more conjugated moieties and a conjugated linker that connects the conjugated moieties to the oligonucleotide. A conjugated group can be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugated group can be attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugated group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, a conjugated group or terminal group is attached at the 3' and / or 5'-terminus of the oligonucleotide. In certain such embodiments, a conjugated group or terminal group is attached at the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugated group is attached proximal to the 3'-terminus of the oligonucleotide. In certain embodiments, a conjugated group or terminal group is attached at the 5'-terminus of the oligonucleotide. In certain embodiments, a conjugated group is attached proximal to the 5'-terminus of the oligonucleotide.

[0158] Examples of terminal groups include, but are not limited to, composite groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides, independently modified or unmodified.

[0159] A. Certain complex groups In certain embodiments, oligonucleotides are covalently linked to one or more conjugated groups.In certain embodiments, conjugated groups modify one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.In certain embodiments, conjugated groups provide new properties to the linked oligonucleotide, for example, fluorophores or reporter groups that allow detection of the oligonucleotide.Certain conjugate groups and conjugate moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0160] 1. Composite part Conjugated moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0161] In certain embodiments, the conjugate moiety is an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, These drugs include, but are not limited to, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0162] 2. Composite Linker The conjugated moiety is linked to the oligonucleotide by a conjugated linker.In certain oligomeric compounds, the conjugated linker is a single chemical bond (i.e., the conjugated moiety is directly linked to the oligonucleotide by a single bond).In certain embodiments, the conjugated linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0163] In certain embodiments, the composite linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the composite linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the composite linker comprises a group selected from alkyl and amide groups. In certain embodiments, the composite linker comprises a group selected from alkyl and ether groups. In certain embodiments, the composite linker comprises at least one phosphorus moiety. In certain embodiments, the composite linker comprises at least one phosphate group. In certain embodiments, the composite linker comprises at least one neutral linking group.

[0164] In certain embodiments, composite linkers, including those described above, are known in the art to be useful for attaching bifunctional linking moieties, such as composite groups, to parent compounds, such as the oligonucleotides provided herein. In general, bifunctional linking moieties include at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the composite group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties include one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0165] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10Alkenyl, or substituted or unsubstituted C2-C 10 Alkynyl is included, and a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0166] In certain embodiments, a composite linker comprises 1-10 linker nucleosides. In certain embodiments, a composite linker comprises 2-5 linker nucleosides. In certain embodiments, a composite linker comprises exactly 3 linker nucleosides. In certain embodiments, a composite linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside is a purine, a substituted purine, a pyrimidine, or a substituted purine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desired that the linker nucleosides are cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically attached to each other and to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0167] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also comprises a composite group that includes a composite linker that includes linker nucleosides, those linker nucleosides are not calculated into the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a composite group that includes 1-10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no composite group is present. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise indicated, a composite linker comprises 10 or fewer linker nucleosides. In certain embodiments, a composite linker comprises 5 or fewer linker nucleosides. In certain embodiments, a composite linker comprises 3 or fewer linker nucleosides. In certain embodiments, a composite linker comprises 2 or fewer linker nucleosides. In certain embodiments, a composite linker comprises 1 or fewer linker nucleosides.

[0168] In certain embodiments, it is desirable to cleave the composite group from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain composite moieties are well taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable to cleave the composite group to release the uncomplexed or parent oligonucleotide. Thus, certain composite linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms with 1, 2, 3, 4, or 5 or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0169] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and a conjugated moiety or group.

[0170] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the composite linker or composite moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0171] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, a 5'-phosphanate, including, but not limited to, a 5'-vinyl phosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0172] III. Oligomeric duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence that is complementary to the sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region that is complementary to the target nucleic acid, and a second oligomeric compound having a region that is complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a composite group, and (2) a second modified or unmodified oligonucleotide and optionally a composite group. Either or both of the oligomeric compounds of the oligomeric duplex may comprise a composite group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0173] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and provide at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they increase the amount or activity of target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids, provide one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids in such a way as to provide significant undesired antisense activities, or do not hybridize to one or more non-target nucleic acids.

[0174] In certain antisense activities, the hybridization of antisense compounds to target nucleic acid results in the recruitment of proteins that cleave the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0175] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound that is loaded into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0176] In certain embodiments, the hybridization of the antisense compound to the target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the modification of the splicing of the target nucleic acid. In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in the modification of the translation of the target nucleic acid. In certain embodiments, the hybridization of the antisense compound to the target nucleic acid results in an increase in the amount or activity of the target nucleic acid.

[0177] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity includes observing or detecting changes in the amount of target nucleic acid or protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in the phenotype of a cell or animal.

[0178] V. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature RNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is mature RNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0179] A. Complementarity / Mismatch with Target Nucleic Acid Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches with bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, 28 and 42 nucleobase oligonucleotides that contained two or three sequences of the tandem oligonucleotide, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was shown to be highly complementary to the 28 or 42 nucleobase oligonucleotides. It was able to inhibit translation, albeit at a more modest level than nucleotides.

[0180] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0181] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity with respect to the target is reduced by such mismatches, while the activity with respect to the non-target is reduced by a larger amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located in the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5'-end of the gap region. In certain embodiments, the mismatches are at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3'-end of the gap region. In certain embodiments, the mismatches are at 1, 2, 3, or 4 positions from the 5'-end of the wing region. In certain embodiments, the mismatches are at 4, 3, 2, or 1 positions from the 3'-end of the wing region.

[0182] B.STMN2 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being STMN2. In certain embodiments, the STMN2 nucleic acid has the sequence shown in SEQ ID NO:1 (the complement of GENBANK Accession No. NC_000008.11 truncated from nucleobases 79608001-79669000) and SEQ ID NO:2.

[0183] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 increases the amount of STMN2 RNA, and in certain embodiments, increases the amount of stathmin-2 protein. In certain embodiments, contacting a cell in an animal with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 improves one or more symptoms of a neurodegenerative disease. Such symptoms include ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced lifespan. In certain embodiments, contacting a cell in an animal with an oligonucleotide complementary to SEQ ID NO:1 or SEQ ID NO:2 results in improved motor function, reduced neuropathy, improved synaptic function, improved cognition, and survival.

[0184] VI. Specific hotspot areas 1. Nucleic acid bases 8819 to 8841 of SEQ ID NO: 1 (also 100 to 122 of SEQ ID NO: 2) In certain embodiments, nucleobases 8819-8841 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 8819-8841 of SEQ ID NO: 1. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are uniformly MOE-modified oligonucleotides. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

[0185] The nucleobase sequences of SEQ ID NOs: 32, 33, 110, 188, 265, and 266 are complementary to nucleobases 8819 to 8841 of SEQ ID NO:1.

[0186] In certain embodiments, a modified oligonucleotide complementary to nucleobases 8819-8841 of SEQ ID NO:1 achieves at least 151% expression of STMN2 RNA in vitro in a standard cell assay.

[0187] 2. Nucleic acid bases 8827 to 8851 of SEQ ID NO: 1 (also 108 to 132 of SEQ ID NO: 2) In certain embodiments, nucleobases 8827-8851 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 8827-8851 of SEQ ID NO: 1. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are uniformly MOE-modified oligonucleotides. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

[0188] The nucleobase sequences of SEQ ID NOs: 34, 35, 112, 113, 190, 191, 267, and 268 are complementary to nucleobases 8819 to 8841 of SEQ ID NO:1.

[0189] In certain embodiments, a modified oligonucleotide complementary to nucleobases 8827-8851 of SEQ ID NO:1 achieves at least 146% expression of STMN2 RNA in vitro in a standard cell assay.

[0190] 3. Nucleic acid bases 8836 to 8880 of SEQ ID NO: 1 (also 117 to 161 of SEQ ID NO: 2) In certain embodiments, nucleobases 8836-8880 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 8836-8880 of SEQ ID NO: 1. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are uniformly MOE-modified oligonucleotides. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

[0191] The nucleobase sequences of SEQ ID NOs: 36 to 42, 114 to 120, 192 to 198, and 270 to 276 are complementary to nucleobases 8836 to 8880 of SEQ ID NO:1.

[0192] In certain embodiments, a modified oligonucleotide complementary to nucleobases 8836-8880 of SEQ ID NO:1 achieves at least 136% expression of STMN2 RNA in vitro in a standard cell assay.

[0193] 4. Nucleic acid bases 8913 to 8948 of SEQ ID NO: 1 (also 194 to 229 of SEQ ID NO: 2) In certain embodiments, nucleobases 8913-8948 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, a modified oligonucleotide is complementary to nucleobases 8913-8948 of SEQ ID NO: 1. In certain embodiments, such modified oligonucleotides are 18 nucleobases in length. In certain embodiments, such modified oligonucleotides are uniformly MOE-modified oligonucleotides. In certain embodiments, the nucleosides of the modified oligonucleotides are linked by phosphorothioate internucleoside linkages.

[0194] The nucleobase sequences of SEQ ID NOs: 56 to 59, 133 to 137, 211 to 215, and 289 to 293 are complementary to nucleobases 8913 to 8948 of SEQ ID NO:1.

[0195] In certain embodiments, a modified oligonucleotide complementary to nucleobases 8913-8948 of SEQ ID NO:1 achieves at least 150% expression of STMN2 RNA in vitro in a standard cell assay.

[0196] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS), including the spinal cord, cortex, cerebellum, and pons.

[0197] VII. Certain Pharmaceutical Compositions In certain embodiments, provided herein is a pharmaceutical composition comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0198] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0199] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0200] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0201] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutical acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides are biologically active upon administration to an animal, including a human. It can provide (directly or indirectly) a metabolite or a residue thereof. Thus, for example, the present disclosure also focuses on pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0202] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made with a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0203] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0204] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0205] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary considerably without significantly altering their solubility and toxicity properties. Additionally, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0206] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may be formulated with suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0207] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0208] While certain compounds, compositions, and methods described herein have been described with specificity according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references listed in this application, GenBank Accession Numbers, etc., are incorporated herein by reference in their entirety.

[0209] The sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, and indeed sequences that may be modified with any combination of chemical modifications. Those of skill in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein are intended to encompass nucleic acids that contain any combination of natural or modified RNA and / or DNA, including, but not limited to, those in the sequence listing, including such nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with a nucleic acid sequence such as, but not limited to, those having the sequence "AUCGAUCG", as well as those compounds containing RNA bases, such as those having some DNA bases and some RNA bases, such as "AUCGATCG". m The term "nucleobase" encompasses any oligomeric compound having such a nucleobase sequence, including oligomeric compounds having other modified nucleobases such as "AACGAUCG", where mC denotes a cytosine base containing a methyl group at the 5-position.

[0210] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are noted or described as having a certain stereoisomeric configuration include only the compounds shown. Compounds described herein that are noted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optionally pure forms, unless otherwise specified. Similarly, all tautomeric forms of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds disclosed herein are intended to include the corresponding salt forms.

[0211] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36 In certain embodiments, non-radioactive isotope substitution may provide new properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution may make the compound suitable for research or diagnostic purposes, such as imaging. Without being limited thereto, the present specification includes the following aspects. [Aspect 1] 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an STMN2 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage. [Aspect 2] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 10 to 321. [Aspect 3] It consists of 12 to 50 linked nucleosides, 8819 to 8841 of SEQ ID NO: 1 or 100 to 122 of SEQ ID NO: 2, 8827 to 8851 of SEQ ID NO: 1 or 108 to 132 of SEQ ID NO: 2, 8836 to 8880 in SEQ ID NO: 1 or 117 to 161 in SEQ ID NO: 2, or An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases complementary to 8913 to 8948 of SEQ ID NO:1 or 194 to 229 of SEQ ID NO:2. [Aspect 4] The oligomeric compound according to any one of aspects 1 to 3, wherein the STMN2 nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2. [Aspect 5] The oligomeric compound according to any one of aspects 1 to 4, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide. [Aspect 6] The oligomeric compound according to any one of aspects 1 to 5, wherein at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. [Aspect 7] 7. The oligomeric compound according to embodiment 6, wherein said modified internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 8] 6. The oligomeric compound according to any one of aspects 1 to 5, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. [Aspect 9] The oligomeric compound according to embodiment 8, wherein each modified internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage. [Aspect 10] The oligomeric compound according to any one of aspects 1 to 7, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage. [Aspect 11] 11. The oligomeric compound according to any one of aspects 1 to 7 and 10, wherein each internucleoside linkage of said modified oligonucleotide is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Aspect 12] 12. The oligomeric compound according to any one of aspects 1 to 11, wherein at least one nucleobase of said modified oligonucleotide comprises a modified nucleobase. [Aspect 13] 13. The oligomeric compound according to embodiment 12, wherein said modified nucleobase is 5-methylcytosine. [Aspect 14] 14. The oligomeric compound of any one of embodiments 1-13, wherein said modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 modified nucleosides comprising a modified sugar moiety. [Aspect 15] 15. The oligomeric compound of embodiment 14, wherein the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 modified nucleosides that comprise a bicyclic sugar moiety. [Aspect 16] 16. The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-. [Aspect 17] 14. The oligomeric compound according to any of the preceding aspects, wherein said modified oligonucleotide comprises at least one modified nucleoside that comprises a non-bicyclic sugar moiety. [Aspect 18] The oligomeric compound according to embodiment 17, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified non-bicyclic sugar moiety that comprises 2'-MOE or 2'-OMe. [Aspect 19] The oligomeric compound according to embodiment 18, wherein each modified nucleoside of said modified oligonucleotide comprises a modified non-bicyclic sugar moiety that comprises 2'-MOE or 2'-OMe. [Aspect 20] 14. The oligomeric compound according to any one of aspects 1 to 13, wherein said modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate. [Aspect 21] 21. The oligomeric compound according to embodiment 20, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA. [Aspect 22] The oligomeric compound according to any one of aspects 1 to 18 and 20 to 21, wherein the modified oligonucleotide is a gapmer. [Aspect 23] The modified oligonucleotide is a 5'-region consisting of 1 to 6 linked 5'-nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and 22. The oligomeric compound according to any one of aspects 1 to 18 and 20 to 21, having a sugar motif comprising a 3'-region consisting of one to six linked 5'-nucleosides, each of the 5'-region nucleosides and each of the 3'-region nucleosides comprising a modified sugar moiety, and each of the central region nucleosides comprising a 2'-deoxynucleoside sugar moiety. [Aspect 24] the modified oligonucleotide consists of 20 linked nucleosides and has the following internucleoside motif: sooossssssssssssooss, s=phosphorothioate internucleoside linkage, and The oligomeric compound according to any one of embodiments 1 to 7 or 10 to 23, wherein o = phosphodiester internucleoside linkage. [Aspect 25] 24. The oligomeric compound according to any one of the preceding aspects, wherein said modified oligonucleotide consists of 12 to 18, 12 to 20, 14 to 20, 16 to 20, or 17 to 19 linked nucleosides. [Aspect 26] 26. The oligomeric compound according to any one of aspects 1 to 23 and 25, wherein said modified oligonucleotide consists of 16, 17, or 18 linked nucleosides. [Aspect 27] 27. The oligomeric compound according to any one of aspects 1 to 26, comprising the modified oligonucleotide. [Aspect 28] 27. The oligomeric compound according to any one of the preceding aspects, comprising a composite group comprising a composite moiety and a composite linker. [Aspect 29] 29. The oligomeric compound according to embodiment 28, wherein said composite group comprises a GalNAc cluster comprising from 1 to 3 GalNAc ligands. [Aspect 30] 30. The oligomeric compound according to embodiment 28 or 29, wherein said composite linker consists of a single bond. [Aspect 31] 29. The oligomeric compound according to embodiment 28, wherein said composite linker is cleavable. [Aspect 32] 29. The oligomeric compound according to embodiment 28, wherein said composite linker comprises from 1 to 3 linker nucleosides. [Aspect 33] 33. The oligomeric compound according to any one of aspects 28 to 32, wherein said composite group is attached to said modified oligonucleotide at the 5'-end of said modified oligonucleotide. [Aspect 34] 33. The oligomeric compound according to any one of aspects 28 to 32, wherein said composite group is attached to said modified oligonucleotide at the 3'-end of said modified oligonucleotide. [Aspect 35] The oligomeric compound according to any one of embodiments 1 to 26 or 28 to 34, comprising a terminal group. [Aspect 36] The oligomeric compound according to any one of aspects 1 to 35, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 37] The oligomeric compound according to any one of aspects 1 to 31 or 33 to 34, wherein the oligomeric compound does not comprise a linker nucleoside. [Aspect 38] 38. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1 to 35 and 37. [Aspect 39] 38. An antisense compound comprising or consisting of an oligomeric compound according to any one of aspects 1 to 37 or an oligomeric duplex according to aspect 38. [Aspect 40] A modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 10 to 321. [Aspect 41] A pharmaceutical composition comprising at least one of an oligomeric compound according to any of aspects 1 to 37, an oligomeric duplex according to aspect 38, an antisense compound according to aspect 39, or a modified oligonucleotide according to aspect 40, and a pharma- ceutically acceptable carrier or diluent. [Aspect 42] 42. The pharmaceutical composition of embodiment 41, wherein the modified oligonucleotide is a sodium salt. [Aspect 43] A method comprising administering to an animal a pharmaceutical composition according to any one of aspects 41 to 42. [Aspect 44] The method of embodiment 43, wherein the animal is a human. [Aspect 45] A method for treating a disease associated with STMN2, comprising administering to an individual having or at risk of developing a disease associated with STMN2 a therapeutically effective amount of a pharmaceutical composition described in aspects 41 and 42, thereby treating the disease associated with STMN2. [Aspect 46] The method of embodiment 45, wherein the disease associated with STMN2 is a neurodegenerative disease. [Aspect 47] 47. The method of embodiment 46, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), and dementia with Lewy bodies (DLB). [Aspect 48] The method of embodiment 47, wherein at least one symptom of the neurodegenerative disease is ameliorated. [Aspect 49] The method of embodiment 48, wherein the symptoms are ataxia, neuropathy, synaptic dysfunction, cognitive impairment, and reduced lifespan. EXAMPLES

[0212] The following examples show certain specific embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for additional oligonucleotides having the same or similar motifs.Furthermore, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0213] Example 1: Effects of uniformly MOE-modified oligonucleotides with phosphorothioate internucleoside linkages on human STMN2 in vitro at a single dose We designed modified oligonucleotides complementary to human STMN2 nucleic acid and tested their effects on STMN2 RNA-cultured CRISPR-edited SH-SY5Y cells, which were engineered to express the familial ALS-causing mutation (asparagine substituted with serine at amino acid 352-TDP-43N352S) from both endogenous TDP-43 alleles using CRISPR-Cas9 site-selective nuclease.

[0214] CRISPR-edited SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected using electroporation with modified oligonucleotides at a concentration of 7,000 nM or without modified oligonucleotides for untreated control. After about 24 hours, RNA was isolated from the cells and STMN2 RNA levels were measured by quantitative real-time PCR. mRNA levels were measured using human primer probe set RTS40280 (forward sequence CCACGAACTTTAGCTTCTCCA, designated herein as SEQ ID NO: 3; reverse sequence GCCAATGTTTCAGCACCTG, designated herein as SEQ ID NO: 4; probe sequence ACTTTCTTCTTTCCTCTGCAGCCTCC, designated herein as SEQ ID NO: 5). STMN2 mRNA levels were adjusted according to total RNA content, as measured by RiboGreen®. The results are presented in the table below as control percentages of the amount of STMN2 RNA for untreated control cells.

[0215] The modified oligonucleotides in the table below are uniformly modified oligonucleotides. The oligonucleotides are 18 nucleobases long, with each nucleoside having a 2'-MOE group. Each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine residue is a 5-methylcytosine. "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary in a human nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in a human nucleic acid sequence.

[0216] Each modified oligonucleotide listed in the table below is complementary to the human STMN2 nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 2, as indicated. As shown below, the modified oligonucleotides complementary to human STMN2 increased the amount of human STMN2 RNA. Table 1 Percent control of human STMN2 RNA with uniformly MOE-modified oligonucleotides containing phosphorothioate internucleoside linkages [Table 1-1] [Table 1-2] [Table 1-3] Table 2 Percent control of human STMN2 RNA with uniformly MOE-modified oligonucleotides containing phosphorothioate internucleoside linkages [Table 2-1] [Table 2-2] [Table 2-3] Table 3 Percent control of human STMN2 RNA with uniformly MOE-modified oligonucleotides containing phosphorothioate internucleoside linkages [Table 3-1] [Table 3-2] [Table 3-3] Table 4 Percent control of human STMN2 RNA with uniformly MOE-modified oligonucleotides containing phosphorothioate internucleoside linkages [Table 4-1] [Table 4-2] [Table 4-3]

[0217] Example 2: Effects of uniformly MOE-modified oligonucleotides with phosphorothioate internucleoside linkages on human STMN2 in vitro, multiple doses Modified oligonucleotides selected from the above examples were tested at various doses in CRISPR-edited SH-SY5Y cells (described in Example 1 above). Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at 555 nM, 1,666 nM, 5,000 nM, and 15,000 nM concentrations, as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and STMN2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using human STMN2 primer probe set RTS40280 (described in Example 1 above). STMN2 RNA levels were adjusted according to total RNA content, as measured by RiboGreen®. The results are presented in the table below as a percentage of control of the amount of STMN2 RNA relative to untreated control cells. As shown in the table below, STMN2 RNA levels were increased in a dose-dependent manner in modified oligonucleotide-treated cells. IC 50 was calculated using the Prism 6 software using the formula "log(agonist) vs. response-variable slope (4 parameters)" (min=100, max=249). Table 5 Dose-dependent percent increase in human STMN2 RNA by uniformly modified oligonucleotides [Table 5] Table 6 Dose-dependent percent increase in human STMN2 RNA by uniformly modified oligonucleotides [Table 6]

[0218] Example 3: Effects of uniformly MOE-modified oligonucleotides with phosphorothioate internucleoside linkages on human STMN2 in vitro, multiple doses Modified oligonucleotides selected from the above examples were tested at various doses in CRISPR-edited SH-SY5Y cells (described in Example 1 above). Cells were seeded at a density of 20,000 cells per well and transfected using electroporation with modified oligonucleotides at 555 nM, 1,666 nM, 5,000 nM, and 15,000 nM concentrations, as specified in the table below. After a treatment period of about 24 hours, total RNA was isolated from the cells and STMN2 RNA levels were measured by quantitative real-time PCR. RNA levels were measured using human STMN2 primer probe set RTS41911 (forward sequence AAGGCAATCCTGCCTACTAAC, designated herein as SEQ ID NO: 6; reverse sequence GGTGGGTATCTGGTGATTCTTAG, designated herein as SEQ ID NO: 7; probe sequence TCCATCTGTGAAGCTGACGCAGTT, designated herein as SEQ ID NO: 8). STMN2 RNA levels were adjusted according to total RNA content, as measured by RiboGreen®. Results are presented in the table below as a percentage of the amount of STMN2 RNA relative to untreated control cells. As shown in the table below, STMN2 RNA levels were increased in a dose-dependent manner in modified oligonucleotide-treated cells. IC 50 was calculated using the Prism 6 software using the formula "log(agonist) vs. response-variable slope (4 parameters)" (min=100, max=100). large=249). Table 7 Dose-dependent percent increase in human STMN2 RNA by uniformly modified oligonucleotides [Table 7] Table 8 Dose-dependent percent increase in human STMN2 RNA by uniformly modified oligonucleotides [Table 8]

Claims

[Claim 1] The invention described in the specification or drawings of this application.

Images