AAV gene therapy for treating nephrotic syndrome

Abstract

To provide an adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome.SOLUTION: The present invention provides a pharmaceutical composition for renal-targeted gene therapy, comprising an AAV-LK03 vector, wherein the AAV-LK03 vector comprises a minimal nephrin promoter or podocin promoter.SELECTED DRAWING: Figure 1-1

Description

[Technical field]

[0001] The present invention relates to gene therapy for use in the treatment of monogenic forms of nephrotic syndrome. [Background technology]

[0002] Nephrotic syndrome (NS), a chronic kidney disease characterized by prominent proteinuria, hypoalbuminemia, edema, and hyperlipidemia, is the most common primary glomerular disease in children, affecting 2 per 100,000 children under the age of 16 in Europe and the United States. NS is associated with different ages of onset, ranging from less than 3 months of age at diagnosis to early adulthood, and is classified into different patient groups according to its sensitivity to corticoids; approximately 80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS) and can be successfully treated with corticosteroid therapy. A proportion of patients initially classified as SSNS relapse and require further steroid treatment, and a further 10–15% of NS patients do not achieve remission after several weeks of treatment with corticosteroids and are classified as having steroid-resistant nephrotic syndrome (SRNS). Up to 50% of these SRNS patients progress to end-stage renal disease within 10 years and commonly face an increased risk of recurrence after kidney transplantation, highlighting the lack of adequate and efficient treatment for these patients.

[0003] Podocyte dysfunction and the resulting disruption of the glomerular filtration barrier are central to the pathogenesis of NS. Podocytes extend cellular processes, called foot processes, to cover the exterior of the glomerular capillaries and, by interdigitation with adjacent foot processes, form the glomerular slit membrane, which is crucial for the efficiency of the glomerular filtration barrier and the retention of proteins in the bloodstream. In the NS genotype, mutations in genes encoding key podocyte processes, such as podocyte development, migration, basement membrane interaction, or regeneration, result in loss of glomerular slit membrane integrity and the nephrotic syndrome phenotype. Approximately 30% of SRNS cases in children are inherited, and the most common mutation in children is in NPHS2 encoding podocin, which accounts for 10-30% of sporadic genetic cases.

[0004] Podocin is a 42 kDa hairpin-like membrane-associated podocyte-specific protein that is a key component of a protein complex in the slit diaphragm, i.e., the intercellular junction between adjacent podocyte foot processes. Podocin localizes to lipid rafts and interacts with other important slit diaphragm proteins, such as nephrin, CD2AP, and TRPC6. Podocin is essential in the maintenance of the slit diaphragm and, therefore, for the integrity of the glomerular filtration barrier. To date, 126 mutations have been reported, with the most common mutation being R138Q, which causes mislocalization of podocin to the endoplasmic reticulum.

[0005] Since there is currently no effective treatment for patients with monogenic NS, the use of gene therapy to transfer functional gene copies into diseased podocytes may constitute a promising new strategy to address monogenic NS, reverse the NS phenotype, and correct renal dysfunction. Indeed, US2003 / 0152954 generally proposed the use of viral vectors to deliver nucleic acids encoding polypeptides with podocin activity, but did not disclose or test any specific gene therapy constructs. This may be because the kidney has a complex anatomical structure with specialized compartments composed of glomeruli, tubules, vasculature, and interstitium, making it a difficult target for gene therapy vectors. To date, kidney-targeted gene therapy has been largely unsuccessful because it can be difficult to target and specifically transduce the highly differentiated substructures of the kidney by viral vector approaches (van der Wouden et al., 2004).

[0006] A recent study attempted to target the kidney using rAAV vectors in combination with the CMV promoter and GFP or luciferase genes, which were administered via tail vein injection or renal vein injection (Rocca et al., 2014). However, tail vein injection was shown to be inappropriate for kidney transduction, and low levels of gene expression were observed in podocytes, while widespread expression was also observed in the liver, despite the use of a promoter that was purportedly kidney-specific. This study further failed to demonstrate successful transduction of NS-associated transgenes, such as podocin, and failed to demonstrate long-term functional expression of such genes. This study also did not explore AAV serotypes suitable for human kidney cell transduction. Summary of the Invention

[0007] The present invention aims to reverse the NS phenotype and correct podocyte-associated renal dysfunction in patients with monogenic NS by administering AAV gene therapy expressing an NS-associated transgene under the control of a podocyte-specific promoter.

[0008] The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in the treatment of monogenic nephrotic syndrome, wherein the AAV vector comprises an NS-associated transgene and a minimal nephrin promoter NPHS1 or a podocin promoter NPHS2. The gene therapy vector can reverse the NS phenotype and correct podocyte-associated renal dysfunction in patients with monogenic NS.

[0009] Suitable AAV serotypes for use in the vectors include 2 / 9, LK03, and 3B.

[0010] The AAV 2 / 9 serotype shows significant tropism for neonatal and adult mouse kidney, localizing to glomeruli and tubules (Luo et al., 2011; Picconi et al., 2014; Schievenbusch et al., 2010), and AAV2 / 9 vectors combined with renal vein injection have been shown to be suitable for kidney-targeted gene delivery (Rocca at al., 2014). Thus, AAV 2 / 9 is one suitable vector for use in the gene therapy of the present invention.

[0011] Synthetic AAV capsids, such as LK03, can also be suitable vectors for use in the gene therapy of the present invention. This vector has been shown to transduce human primary hepatocytes with high efficiency in vitro and in vivo. However, to date, it has not been utilized for kidney-targeted gene delivery. Herein, the inventors demonstrate that AAV-LK03 vectors can achieve high transduction rates approaching 100% in human podocytes in vitro, and can be used to specifically transduce podocytes in vitro.

[0012] The AAV-LK03 cap sequence is composed of fragments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, 9), with AAV-3B accounting for 97.7% of the cap gene sequence and 98.9% of the amino acid sequence. AAV-3B is also known for its human hepatocyte tropism and is another suitable vector for use in gene therapy of the present invention. To date, it has not been utilized for kidney-targeted gene delivery.

[0013] The NS-associated transgene used in gene therapy is a gene associated with a single genotype of NS, expressed in podocytes, and encodes a protein of approximately 833 amino acids or less. This size restriction allows the NS-associated transgene to fit into the gene therapy vector of the present invention.

[0014] Suitable NS-related transgenes include NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; and APOL1.

[0015] In embodiments of the invention, the NS-associated transgene may be an SRNS-associated transgene, such as ADCK4, CD2AP, DGKE, EMP2, NPHS2, NUP86, NUP93, SGPL1, WDR73, or WT1.

[0016] In a preferred embodiment of the invention, the NS-related transgene is NPHS2, which encodes podocin. An example of a suitable human NPHS2 transgene cDNA sequence is shown in FIG.

[0017] The transgene species is preferably consistent with the patient's species.For example, when treating a human patient, typically a human transgene is used.The transgene may be naturally occurring, for example wild type, or may be recombinant.The transgene is typically included in a gene therapy vector as a cDNA sequence.

[0018] The use of a minimal nephrin promoter, such as NPHS1 or the podocin promoter NPHS2, allows the gene therapy vector to be specifically targeted to podocytes (Moeller et al., 2002, Picconi et al., 2014). This allows transgene expression to be specifically targeted to podocytes in the glomerular basement membrane of the kidney, minimizing off-target expression. Because podocytes are terminally differentiated, non-dividing cells, they can be targeted for stable expression of transgenes, reducing or avoiding any risk of vector dilution effects. In a preferred embodiment of the invention, the promoter is NPHS1. An example of a suitable DNA sequence for the NPHS1 promoter is shown in FIG. 5. As with the transgene, the species of the promoter is preferably matched to the species of the patient. For example, when treating a human patient, typically human NHPS1 or human NPHS2 is used.

[0019] The AAV vector may further comprise a woodchuck hepatitis post-transcriptional regulatory element (WPRE). The WPRE is a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression. The inclusion of the WPRE may increase the expression of the transgene delivered by the vector. The WPRE sequence may be mutated to reduce carcinogenicity without significantly losing RNA enhancing activity (Schambach et al., 2005, incorporated herein by reference). An example of a suitable WPRE sequence is shown in Figure 7.

[0020] The NS-associated transgene may include a hemagglutinin (HA) tag. HA can be used as an epitope tag and has been shown not to interfere with the biological activity or biodistribution of the protein to which it is attached. The HA tag can facilitate detection, isolation, and purification of the transgene.

[0021] The AAV vector may further comprise a Kozak sequence between the promoter and the podocin transgene, which is known to play a key role in the initiation of the translation process and thus can enhance expression of the podocin transgene.

[0022] The AAV vector may further include a polyadenylation signal, for example, a bovine growth hormone (bGH) polyadenylation signal, as shown in Figure 8. Polyadenylation is the addition of a poly(A) tail to messenger RNA. A poly(A) tail consists of multiple adenosine monophosphates, in other words, it is a stretch of RNA with only adenine bases. The poly(A) tail is important for the nuclear transport, translation, and stability of mRNA. Therefore, the inclusion of a polyadenylation signal can enhance the expression of the podocin transgene.

[0023] AAV vector gene therapy also typically includes an inverted terminal repeat (ITR) at either end of the vector. For example, the vector structure may be in the following order: ITR-promoter-transgene (optionally with HA tag)-optionally WRPE-polyadenylation signal-ITR.

[0024] Thus, the gene therapy vector of the present invention can be used to treat or manage monogenic NS in patients. The term "patient" as used herein can include any mammal, including humans. The patient can be an adult or pediatric patient, such as a neonate or infant. In an embodiment of the present invention, the patient can be a pediatric patient between about 1 year old and about 16 years old.

[0025] The patient suffers from monogenic NS. In other words, NS is caused by a mutation in one gene. Preferably, the mutation is in a gene expressed in podocytes. For example, NS can be SRNS caused by a mutation in NPHS2, which encodes podocin. Alternatively, monogenic NS can be caused by one or more mutations in any one of ADCK4, ALG1, ARHGAP24, ARGHDIA, CD151, CD2AP, COQ2, COQ6, DGKE, E2F3, EMP2, KANK2, LAGE3, LMNA, LMX1B, MAFB, NUP85, NUP93, NXF5, OSGEP, PAX2, PDSS2, PMM2, PODXL, SCARB2, SGPL1, Smad7, TP53RK, TPRKB, VDR, WDR73, WT1, ZMPSTE24, or APOL1. In an embodiment of the invention, the monogenic NS may be monogenic SRNS caused by one or more mutations in any one of ADCK4, CD2AP, DGKE, EMP2, NPHS2, NUP86, NUP93, SGPL1, WDR73, or WT1.

[0026] The genetic mutation causing SRNS can be an NPHS2 mutation that affects podocin expression, such as one or more of the mutations listed in Table A below.

[0027] [Table 1] TIFF2025011130000003.tif242103TIFF2025011130000004.tif35146

[0028] In a preferred embodiment of the present invention, the gene mutation can be p.Arg138Gln, also known as R138Q. R138Q is the most common podocin mutation in children with SRNS in the Caucasian population. The mutation causes endoplasmic reticulum retention of podocin, which prevents podocin from reaching the slit diaphragm and interacting with other important slit diaphragm proteins to form a functional filtration barrier.

[0029] Because NPHS2 mutations all affect the same gene, any combination of these mutations can be treated with the AAV gene therapy vector of the invention that contains the NPHS2 transgene. In other words, a patient can have the p.Arg138Gln mutation and also have one or more of the other mutations identified in Table A above.

[0030] The presence or absence of a monogenic type of NS can be determined by laboratory testing, such as the tests available from Bristol Genetics Laboratories, Bristol, UK. Typically, genetic testing can be performed by analysis of a blood sample obtained from the patient.

[0031] AAV vector gene therapy can be administered by systemic administration, for example, intravenous injection.In an embodiment of the present invention, AAV vector gene therapy can be administered by injection into the renal artery.In an alternative embodiment of the present invention, AAV vector gene therapy can be administered by retrograde administration, for example, via the ureter using a urinary catheter.

[0032] Gene therapy can be administered in one dose, in other words, subsequent administration of vector may not be required.If repeated administration is required, different AAV serotypes can be used in the vector.For example, the vector used in the first dose can include AAV-LK03 or AAV-3B, while the vector used in the subsequent dose can include AAV 2 / 9.

[0033] Optionally, gene therapy can be administered in combination with temporary immunosuppression of the patient, for example by administering gene therapy simultaneously with or after oral steroid treatment. Immunosuppression may be desirable before and / or during gene therapy treatment to suppress the patient's immune response to the vector. However, AAV capsids are not encoded by vectors and are only transiently present in transduced cells. Thus, capsids gradually degrade and disappear, meaning that a short-term immunomodulatory regimen that blocks immune responses to capsids until capsid sequences disappear from transduced cells may allow long-term expression of transgenes. Thus, immunosuppression may be desirable for a period of about 6 weeks after administration of gene therapy.

[0034] The AAV vector gene therapy can be administered in the form of a pharmaceutical composition.In other words, the AAV vector gene therapy can be combined with one or more pharma- ceutically acceptable carriers or excipients.Suitable pharmaceutical compositions are preferably sterile. The present invention also provides the following aspects. [1] An adeno-associated virus (AAV) vector gene therapy for use in the treatment of monogenic nephrotic syndrome, comprising an AAV vector: NS-related transgenes, and Minimal nephrin promoter NPHS1 or podocin promoter NPHS2 AAV vector gene therapy. [2] AAV vector gene therapy for use according to [1], wherein the AAV vector is AAV serotype 2 / 9, LK03, or 3B. [3] AAV vector gene therapy for use according to [1] or [2], wherein the NS-associated transgene is NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1. [4] AAV vector gene therapy for use according to any of [1] to [3], wherein the AAV vector further contains a woodchuck hepatitis post-transcriptional regulatory element (WPRE). [5] An AAV vector gene therapy for use according to any of [1] to [4], wherein the NS-associated transgene is human and / or contains a hemagglutinin (HA) tag. [6] The AAV vector gene therapy for use according to any one of [1] to [5], wherein the AAV vector further comprises a Kozak sequence between the promoter and the podocin transgene.[7] The AAV vector gene therapy for use according to any one of [1] to [6], wherein the AAV vector further comprises a polyadenylation signal, for example a bovine growth hormone (bGH) polyadenylation signal. [8] An AAV vector gene therapy for use according to any one of [1] to [7], administered to a human patient. [9] An AAV vector gene therapy for use as described in [8], wherein the patient is a pediatric patient.

[10] An AAV vector gene therapy for use according to any one of [1] to [9], wherein the monogenic NS is monogenic steroid-resistant nephrotic syndrome.

[11] An AAV vector gene therapy for use according to any one of [1] to

[10] , administered systemically.

[12] An AAV vector gene therapy for use according to any one of [1] to

[11] , administered by intravenous injection.

[13] An AAV vector gene therapy for use according to any of [1] to

[12] , administered by injection into the renal artery.

[0035] The invention will now be described in detail, by way of example only, with reference to the drawings in which: [Brief description of the drawings]

[0036] [Figure 1-1] Figure 1: AAV 2 / 9 administered by tail vein injection transduces the kidney and expresses HA-tagged podocin in podocytes. A) AAV vectors used to express mouse or human podocin or GFP. All vectors contained a Kozak sequence between the promoter and transgene, as well as the WPRE (woodchuck hepatitis posttranscriptional regulatory element) and bovine growth hormone (bGH) polyadenylation signal. B) Vector or saline was injected via the tail vein of 8-week-old iPD NPHS2fl / fl mice, and induction with doxycycline began 10-14 days later. C) qPCR showing the presence of AAV ITRs in the mouse kidney cortex of mice injected with viral vectors. D) Representative immunofluorescence showing expression of HA-tagged podocin along with podocyte-specific proteins nephrin and podocin in iPD NPHS2fl / fl mice injected with AAV 2 / 9. Since mice with diseased glomeruli showed loss of podocyte markers, the control (saline) images are of mice that were not injected with the full iPod NPHS2fl / fl genotype and therefore did not develop proteinuria or diseased glomeruli. [Figure 1-2] This is a continuation of Figure 1-1. [Figure 1-3] This is a continuation of Figure 1-2. [Figure 2-1]Figure 2: Tail vein injection of AAV 2 / 9 expressing wild-type podocin under a podocyte-specific promoter ameliorates proteinuria in a conditional podocin knockout mouse model (ipod NPHS2fl / fl). A) Comparison of urinary albumin:creatinine ratios in mice injected with AAV 2 / 9 mNPHS1.mpod, AAV 2 / 9 hNPHS1.mpod, and saline (n=9 per group, **p<0.01, ***p<0.001). B) Coomassie staining showing representative images of the extent of albuminuria in one mouse from each experimental group. The saline group showed proteinuria from day 14 onwards, with large amounts of albumin, whereas the vector-treated group showed delayed onset of albuminuria and milder albuminuria. C) Survival curves showing improved survival in mice injected with either AAV 2 / 9 hNPHS1.mpod or AAV 2 / 9 mNPHS1.mpod (Log-rank (Mantel-Cox) test, p=0.049, n=3 for each virus group and n=4 for saline group). D) Viral DNA copy number per 50ng of total DNA inversely correlates with urinary albumin:creatinine ratio at day 42 (Spearman r=-0.4596, p=0.0477). E) Blood test results including cholesterol, albumin, urea, and creatinine at 6 weeks post-doxycycline (minimum n=3 mice per group except cholesterol minimum n=2 per group). F) Histology showing representative images of light microscopy from each group. Saline-injected groups showed tubular dilatation along with glomerular hypertrophy, increased collagen deposition, and segmental sclerosis, consistent with FSGS. Mice injected with AAV 2 / 9 expressing mouse podocin showed a wide range of histological findings that correlated roughly with urinary albumin:creatinine ratios at time of death. Some mice had healthy, normal glomeruli, while others showed mild evidence of disease, such as the pseudocrescent formation (arrows) seen in mice injected with AAV 2 / 9 mNPHS1.mpodHA. G) Saline-injected iPod NPHS2fl / fl mice showed loss of podocin, but nephrin expression changed from a predominantly membrane staining to a diffuse pattern. [Figure 2-2] This is a continuation of Figure 2-1. [Figure 2-3] This is a continuation of Figure 2-2. [Figure 2-4] This is a continuation of Figure 2-3. [Figure 2-5] This is a continuation of Figure 2-4. [Figure 3-1] Figure 1 shows that AAV LK03 efficiently transduces human podocytes in vitro with a minimal human nephrin promoter. A, C, E) Immunofluorescence demonstrating transduction of human podocytes (Pod), glomerular endothelial cells (GEnC) and proximal tubular epithelial cells (PTEC) with AAV LK03 CMV GFP, where GFP expression was obtained in podocytes only when the minimal nephrin promoter AAV LK03 hNPHS1 GFP was used. B) Western blot demonstrating GFP expression in podocytes only when the minimal human nephrin promoter was used with AAV LK03. D) Flow cytometry demonstrating highly efficient transduction of podocytes with AAV LK03 CMV GFP and supporting the fact that GFP expression was restricted to podocytes when the minimal nephrin promoter was used. In comparison, AAV 2 / 9 CMV GFP showed low transduction efficiency in podocytes (n=3). F) Bar graph shows median fluorescence intensity in podocytes transduced with AAV LK03, and histograms show the extent of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right peak), AAV LK03 hNPHS1 GFP (middle peak), and non-transduced cells (left peak). [Figure 3-2] This is a continuation of Figure 3-1. [Figure 3-3] This is a continuation of Figure 3-2. [Diagram 3-4] This is a continuation of Figure 3-3. [Figure 4-1]Figure 1 shows that AAV LK03 expressing wild type human podocin rescues function in mutant podocin R138Q podocyte cell lines. A) Western blot showing that AAV LK03.CMV.hpodocinHA and AAV LK03.hNPHS1.hpodocinHA transduce R138Q podocytes and express HA-tagged podocin. B) Immunofluorescence demonstrating expression of HA-tagged wild type podocin in mutant podocin R138Q podocytes. C) Adhesion assay showing reduced adhesion in mutant podocin R138Q podocytes and rescue of adhesion in R138Q podocytes treated with AAV LK03.hNPHS1.hpodHA.WPRE.bGH. D) Confocal microscopy showing that HA-tagged podocin does not co-localize with calnexin, an endoplasmic reticulum marker. E) TIRF microscopy demonstrating expression of HA-tagged podocin within 100 nm of the plasma membrane, showing some colocalization with the lipid raft marker caveolin. [Figure 4-2] This is a continuation of Figure 4-1. [Figure 4-3] This is a continuation of Figure 4-2. [Figure 4-4] This is a continuation of Figure 4-3. [Diagram 5] FIG. 1 shows an exemplary DNA sequence of the minimal human nephrin promoter (NPHS1). [Figure 6] FIG. 1 shows an exemplary cDNA sequence of the human podocin transgene. [Figure 7] FIG. 1 shows exemplary DNA sequences of WPRE sequences. [Figure 8] FIG. 1 shows exemplary DNA sequences of the bGH poly(A) signal sequence. [Figure 9] FIG. 1 shows human podocytes transduced with either HAVDR (A) or HASmad7 (B) using AAV LK03 with the minimal human nephrin promoter. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0037] [Example] method Vector production We prepared pAV.hNPHS1.mpodHA.WPRE.bGH, pAV.mNPHS1.mpodHA.WPRE.bGH, and pAV.hNPHS1.hpodHA.WPRE.bGH (FIG. 1A), pAV.mNPHS1.hHAVDR.WPRE.bGH, and pAV.mNPHS1.hHASmad7.WPRE.bGH from the CMV eGFP L22Y pUC-AV2 construct (a kind gift from Amit Nathwani) using human (FIG. 6) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNAs in our laboratory. Human embryonic kidney 293T cells were transfected with capsid plasmids (pAAV9 from Penn Vector Core, pAAV LK03 was donated by Mark Kay), helper plasmids carrying adenovirus genes, and transgene plasmids using polyethyleneimine. Cells and supernatants were harvested 72 hours post-transfection. Cells were subjected to five freeze-thaw cycles and supernatants were subjected to PEG precipitation (8% PEG 0.5N NaCl). These were combined and incubated with 0.25% sodium deoxycholate and 70 units / ml benzonase for 30 minutes at 37°C. Vectors were purified by iodixanol gradient ultracentrifugation and then concentrated in PBS. Vectors were titrated by qPCR using the standard curve method with the following primers: ITR F GGAACCCCTAGTGATGGAGTT, ITR R CGGCCTCAGTGAGCGA; ITR probe FAM-5'-CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.

[0038] animal All animal experiments and procedures were approved by the UK Home Office in accordance with the Animals (Scientific Procedures) Act 1986 and the Guide for the Care and Use of Laboratory Animals was followed during the experiments. flox / floxMice (kindly provided by Corinne Antignac, INSERM U983, Paris) were crossed with NPHS2-rtTA / Tet-On Cre mice to obtain NPHS2-rtTA / Tet-On Cre / NPHS2 flox / flox These mice, hereafter referred to as iPod NPHS2, produce offspring carrying the NPHS2 gene. These mice, upon exposure to doxycycline, produce a podocyte-specific knockout of podocin. fl / fl Mice were of mixed background and equal numbers of each sex were used. Eight-week-old mice were administered AAV via tail vein injection (Figure 1B). After 10-14 days, mice were provided with drinking water supplemented with 2 mg / ml doxycycline and 5% sucrose for 3 weeks. Urine was collected weekly. Mice were sacrificed by schedule 1 method 6 weeks after initiation of doxycycline. A small number of mice were maintained beyond 6 weeks to test effects on survival. All mice were re-genotyped from tissues harvested at the time of death.

[0039] cell culture Conditionally immortalized human podocytes (Pod) were cultured in RPMI with 10% fetal bovine serum (Sigma Aldrich, Gillingham, UK) with L-glutamine and NaHCO3. Conditionally immortalized human glomerular endothelial cells (GEnCs) were cultured in EBMTM-2 Endothelial Cell Growth Basal Medium-2 supplemented with EGMTM-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Basel, Switzerland). Immortalized proximal tubule epithelial cells (ATCC, Teddington, UK) (PTECs) were cultured in DMEM / F12 supplemented with insulin, transferrin, and selenium, hydrocortisone, and 10% FBS.

[0040] Add 5 x 10 AAV to cells. 5 For GFP expression, cells were used 5–7 days after transduction to allow comparisons between the different cell lines. For podocin, VDR, and Smad7 expression, cells were used 10–14 days after transduction, when podocytes were maximally differentiated.

[0041] quantitative PCR DNA was extracted from mouse kidney cortex using the DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK). AAV DNA was detected using the primers described above for virus titration and normalized to mouse beta-actin.

[0042] RNA was extracted using the RNeasy Mini Kit with RNase-Free DNase set (Qiagen, Manchester, UK).

[0043] Immunofluorescence Five-μm sections were fixed using 4% PFA and blocked with 3% BSA, 0.3% Triton X-100, and 5% goat or donkey serum. Primary antibodies were high affinity anti-HA from rat IgG1 (Roche, Basel, Switzerland), guinea pig anti-nephrin (1243-1256) antibody (Origene, Hereford, Germany), and rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK).

[0044] Cells were fixed with either 4% PFA and / or ice-cold methanol, incubated with 0.03 M glycine for 5 min, permeabilized with 0.3% Triton, and blocked with 3% BSA. Primary antibodies were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-calnexin (Merck Millipore, Darmstadt, Germany), and rabbit anti-caveolin-1 (Cell Signaling, Danvers, USA).

[0045] Secondary antibodies were AlexaFluor 488 donkey anti-mouse, AlexaFluor 488 donkey anti-rabbit, AlexaFluor 488 goat anti-guinea pig, AlexaFluor 555 goat anti-rabbit, and AlexaFluor 633 goat anti-rat, as well as AlexaFluor 633 phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted with Mowiol. Images were acquired using LAS (Leica Application Suite) X software on a Leica SPE single channel confocal laser scanning microscope connected to a Leica DMi8 inverted epifluorescence microscope, or a Leica SP5-II confocal laser scanning microscope connected to a Leica DMI 6000 inverted epifluorescence microscope, or a Leica AM TIRF MC (multicolor) system connected to a Leica DMI 6000 inverted epifluorescence microscope.

[0046] Western blotting Cells were extracted in SDS lysis buffer. Samples were run on a 12.5% ​​gel and transferred to a PVDF membrane. Membranes were blocked in 5% milk in 0.1% TBST. Primary antibodies used were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland) in 3% BSA in 0.1% TBST, or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). Secondary antibodies were anti-rabbit or anti-mouse IgG peroxidase (Sigma Aldrich, Gillingham, UK) in 3% BSA in 0.1% TBST. Membranes were imaged in an Amersham Imager 600.

[0047] Flow cytometry Viable cells were stained with propidium iodide and only viable single cells were included in the analysis.Flow cytometry was performed on a NovoCyte flow cytometer.

[0048] Adhesion assay Cells were trypsinized and incubated for 10 5 After resuspension at 100 / ml and recovery for 10 min, 96-well plates were seeded with 50 μl of cells diluted 2-fold in PBS. Technical triplicates were used. Cells were left to adhere for approximately 1 h at 37°C. Cells were washed with PBS to remove non-adherent cells and then fixed with 4% PFA for 20 min. Cells were washed with distilled water and then stained with 0.1% crystal violet in 2% ethanol for 60 min at room temperature. Cells were washed and incubated with 10% acetic acid for 5 min on a shaker. Absorbance at 570 nm was measured and results were normalized to wild-type cell lines transduced with AAV LK03 CMV GFP.

[0049] urine Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA) and creatinine levels were measured in a Konelab Prime 60i analyzer.

[0050] Blood tests Mouse plasma was processed using either a Konelab Prime 60i analyzer or a Roche Cobas system using reagents and protocols supplied by the manufacturer.

[0051] statistical analysis All data are expressed as mean ± SEM unless otherwise stated. Statistical analysis was performed in GraphPad Prism (Graphpad softward, La Jolla, USA). Statistical tests used included two-tailed t-test, one-way ANOVA with Tukey's multiple comparison post-hoc analysis, two-way ANOVA with Tukey's multiple comparison post-hoc analysis, and log-rank (Mantel-Cox) test for survival analysis.

[0052] result Tail vein injection of AAV serotype 9 demonstrates transduction of renal cells and expression in podocytes At 8 weeks of age, mice were injected with 1.5 × 10 12 Either AAV2 / 9 hNPHS1.mpod, AAV2 / 9 mNPHS1.mpod, or saline was administered via the tail vein. After 6 weeks, AAV ITRs were detected in the renal cortex of mice injected with AAV (AAV 2 / 9 hNPHS1.mpod = 39,067 ± 13,285 copies ssDNA, AAV 2 / 9 mNPHS1mpod = 76,533.33 ± 32047 copies ssDNA, n = 5–6 / group) (Figure 1C). HA-tagged podocin was shown to colocalize with podocyte markers nephrin and podocin (Figure 1D).

[0053] AAV2 / 9 expressing wild-type podocin iPod NPHS2 fl / fl Reduces albuminuria in mice The vector-treated group showed a reduction in urinary albumin:creatinine ratio (ACR) (Figures 2A, 2B). The effect of tail vein injection of AAV 2 / 9-expressing podocin on urinary ACR yielded an F ratio of F(2, 24) = 9.61, p < 0.001 (n = 9 / group). At day 14 post-doxycycline, urinary ACR was higher in the saline group than either vector treatment group, but this was not significant (AAV 2 / 9 hNPHS1.mpod=758.1±488.1 mg / mmol, AAV 2 / 9 mNPHS1.mpod=59.8±28.0 mg / mmol, saline=3,770.1±1337.6 mg / mmol; p=0.40 for AAV 2 / 9 hNPHS1.mpod vs saline, p=0.25 for AAV 2 / 9 mNPHS1.mpod vs saline). The mean ... There was a significant reduction in urinary ACR in the vector-treated groups (p<0.001 for hNPHS1.mpod vs. saline, p<0.001 for AAV 2 / 9 mNPHS1.mpod vs. saline). In the vector-treated groups, 2 of 9 mice in the AAV 2 / 9 hNPHS1.mpod group and 1 of 9 mice in the AAV 2 / 9 mNPHS1.mpod group had a urinary ACR below 30 mg / mmol at day 42.

[0054] Although mice in the vector-treated group showed improvement, there was a large variation between groups, which we hypothesize may be due to the amount of vector that reached the kidney after systemic injection. The amount of viral DNA detected in the renal cortex correlated inversely with the degree of albuminuria at day 42 (Spearman r = -0.4596, p = 0.0477) (Figure 2D).

[0055] AAV2 / 9 expressing wild-type podocin iPod NPHS2 fl / fl Partially rescues the phenotype in mice Vector-treated mice had reduced creatinine (saline = 39.0 ± 8.5 μmol / L, AAV 2 / 9 hNPHS1.mpod = 27.3 ± 7.9 μmol / L, AAV 2 / 9 mNPHS1.mpod = 18.6 ± 4.4 mmol / L, p = 0.1622), reduced urea (saline = 39.4 ± 17.6 mmol / L, AAV 2 / 9 hNPHS1.mpod = 12.0 ± 2.0 mmol / L, AAV 2 / 9 mNPHS1.mpod = 11.6 ± 1.6 mmol / L, p = 0.058), and increased albumin (saline = 10.5 ± 5.4 g / L, AAV 2 / 9 hNPHS1.mpod = 4.8 ± 17.1 g / L, AAV 2 / 9 mNPHS1.mpod = 17.1 ± 4.1 mmol / L, p = 0.058). mNPHS1.mpod=17.1±3.6g / L, p=0.5602), and a significant reduction in cholesterol (saline=15.76±1.75mmol / L, AAV 2 / 9 hNPHS1.mpod=2.64±0.60mmol / L, AAV 2 / 9 mNPHS2.mpod=4.86±0.76mmol / L, p=0009) (Figure 2E).

[0056] Saline-treated mice showed histological features of FSGS by 6 weeks. Vector-treated mice did not show histological features of FSGS by light microscopy, but demonstrated a wide range of histological findings, ranging from completely normal glomeruli to pseudocrescents or mesangial hypercellularity (Figure 2F).

[0057] These mice also showed increased survival (n=3-4 / group) with a median survival of 75.5 days (range 38-111 days) in the saline group compared to a median survival of 192 days (range 74-206 days and still alive) in the AAV 2 / 9 hNPHS1.mpod and a median survival of 192 days (range 131-206 days and still alive) in the AAV 2 / 9 mNPHS1.mpod (p=0.049).

[0058] Untreated mice showed a loss of podocin expression and the expression pattern of nephrin shifted to a diffuse pattern (Fig. 2G), in stark contrast to the predominantly membrane expression pattern of nephrin and podocin seen in vector-treated mice (Fig. 1D).

[0059] AAV LK03 efficiently transduces human podocytes in vitro with a minimal human nephrin promoter AAV LK03 with CMV GFP and AAV LK03 hNPHS1 GFP were used to inject 5 × 10 human podocytes, glomerular endothelial cells, and proximal tubule epithelial cells. 5 The podocytes were transduced with an MOI of 1000 μg / mL. Flow cytometry (n=3) showed that AAV LK03 CMV GFP had very efficient transduction of podocytes (%GFP expression=98.83±0.84), AAV LK03 hNPHS1 GFP had good transduction (%GFP expression=71.3±3.39), and non-transduced cells had insignificant expression (%GFP expression=0.89±0.36) (Figure 3D). This was reflected in immunofluorescence (Figures 3A, 3C, 3E) and Western blot (Figure 3B). The percentage of cells positive for GFP expression was higher in podocytes transduced with AAV LK03 hNPHS1 GFP, but the cells had lower fluorescence intensity than cells transduced with AAV LK03 CMV GFP (Figure 3F).

[0060] Interestingly, AAV LK03 CMV GFP showed rather low transduction in glomerular endothelial cells (% GFP expression = 7.35 ± 0.19). AAV LK03 hNPHS1 GFP showed minimal transduction in glomerular endothelial cells (% GFP expression = 0.59 ± 0.10), which was at a similar level to non-transduced glomerular endothelial cells (% GFP expression = 0.23 ± 0.02). Since AAV 2 / 9 was the serotype found to best transduce renal cells in vivo in rodent kidneys, we investigated the expression of AAV 2 / 9 CMV GFP in human renal cell lines. AAV 2 / 9 CMV GFP showed low transduction efficiency in both podocytes (% GFP expression = 13.9 ± 1.98) and glomerular endothelial cells (% GFP expression = 21.99 ± 4.35) (Figure 3D). AAV LK03 carrying AAV LK03 hNPHS1 HAVDR and AAV LK03 hNPHS1 hSmad7 was used to transduce human podocytes, showing good expression of both proteins (FIG. 9).

[0061] AAV LK03 expressing human podocin under a minimal nephrin promoter shows rescue of function in mutant podocinR138Q podocyte cell line The R138Q podocin mutant results in the mislocalization of podocin from the plasma membrane to the endoplasmic reticulum. The mutant podocin R138Q podocyte cell line was obtained from a patient kidney and conditionally immortalized using temperature-sensitive SV40 T antigen. AAV LK03 hNPHS1 hpod transduced R138Q podocytes to express HA-tagged podocin (Figure 4A, 4B). HA-tagged podocin is seen at the plasma membrane in confocal microscopy and colocalizes with caveolin-1, a lipid raft protein, as seen in TIRF microscopy (Figure 4B, 4E). Non-transduced R138Q podocytes do not show any podocin expression at the plasma membrane (Figure 4B). HA-tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker (Figure 4D).

[0062] Podocytes show decreased or increased adhesion in disease states. Previous studies in our laboratory have shown that R138Q mutation causes decreased podocyte adhesion. Although AAV transduction causes decreased podocyte adhesion, R138Q podocytes still show reduced adhesion compared to wild-type podocytes, and transduction of AAV LK03 hNPHS1 hpod results in rescue of the adhesive function of R138Q podocytes (Figure 4C).

[0063] Consideration Herein, we successfully targeted podocytes to express mouse podocin with AAV 2 / 9 using a minimal nephrin promoter in a conditional mouse knockout model, and observed partial phenotypic rescue and amelioration of albuminuria in vector-treated mice. As an initial proof-of-principle study, we chose to inject the vector before doxycycline induction, so that effective rescue by the vector would occur when podocin was knocked out. The effect of doxycycline induction was rapid, with progression to severe nephrosis (8-14 days) and FSGS being relatively rapid (~6 weeks). Herein, we showed that introduction of wild-type human podocin into R138Q podocytes in vitro allowed expression of podocin that reached the cell membrane and rescued podocyte adhesion.

[0064] We show that the vector improves albuminuria and survival in these mice, but there is a large degree of variability in the degree of albuminuria in both treated and untreated mice, which may be explained at least in part by the amount of viral transduction in the kidney (Figure 2D).

[0065] AAV LK03 shows high transduction of human podocytes in vitro, approaching 100%, which is reduced to 72.3% when using the minimal human nephrin promoter. We have shown that we can specifically transduce podocytes in vitro using this serotype, and that expression of wild-type podocin in R138Q mutant podocytes shows rescue of function. The use of AAV LK03 has translational implications, as such efficient transduction of human podocytes allows for a significant reduction in the effective dose in humans. A recent UK study showed a low seropositivity rate of anti-AAV LK03 neutralizing antibodies of 23%, nadir in late childhood (Perocheau, DP et al.), making this particular serotype a promising candidate for translational studies.

[0066] We demonstrated that AAV transduction of podocytes with a podocyte-specific promoter iPod NPHS2 fl / fl We describe the first proof-of-principle study demonstrating that AAV LK03 improves albuminuria in a mouse model. We also show that the synthetic capsid AAV LK03 shows highly efficient transduction of human podocytes. Combined, this study is the first step toward the translation of AAV gene therapy targeting monogenic diseases of podocytes.

[0067] References TIFF2025011130000005.tif53154TIFF2025011130000006.tif169154

[0068] Sequence Listing Free Text [SEQ ID NO: 1] shows the ITR forward primer.

[0069] [SEQ ID NO: 2] shows the ITR reverse primer.

[0070] [Sequence number 3] shows the DNA sequence of the ITR probe FAM-5'-CACTCCCTCTCTGCGCGCTCG-3'-TAMRA.

[0071] [SEQ ID NO: 4] shows an exemplary DNA sequence of the minimal human nephrin promoter (NPHS1) shown in FIG.

[0072] [SEQ ID NO:5] shows an exemplary cDNA sequence of the human podocin transgene shown in FIG.

[0073] [SEQ ID NO: 6] shows a DNA sequence as an example of the WPRE sequence shown in FIG.

[0074] [SEQ ID NO: 7] shows the DNA sequence of an example of the bGH poly(A) signal sequence shown in FIG.

[0075] SEQUENCE LISTING <110> The University of Bristol <120> AAV GENE THERAPY FOR TREATING NEPHROTIC SYNDROME <130> PA24-495 <140> JP 2024-167091 <141> 2020-01-17 <150> GB 1900702.0 <151> 2019-01-18 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> ITR Forward primer <400> 1 ggaaccccta gtgatggagt t 21 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ITR Reverse primer <400> 2 cggcctcagt gagcga 16 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ITR probe <400> 3 cactccctct ctgcgcgctc g 21 <210> 4 <211> 1192 <212> DNA <213> Homo sapiens <400> 4 cacctgaggt caggagttcg agaccagcgt ggccaacatg atgaaacccc gtctctagta 60 aaaatacaaa aattagccag gcatggtgct atatacctgt agcaccagct acttgggaga 120 cagaggtggg agaattactt gaacctggga ggttcaagcc atgggaggtg gaagttgcag 180 tgagccgaga tgccactgca ctccagcctg agcaacagag caagactatc tcaagaaaag 240 aaagaaagaa agaaagagac ttgccaaggt catgtatcag ggcaaggaag agctgggggc 300 ccagctggct gctcccctgc tgagctggga gaccaccttg atctgacttc tcccatcttc 360 ccagcctaag ccaggccctg gggtcacgga ggctggggag gcaccgagga acgcgcctgg 420 catgtgctga caggggattt tatgctccag ctgggccagc tgggaggagc ctgctgggca 480 gaggccagag ctgggggctc tggaaggtac ctgggggagg ttgcactgtg agaatgagct 540 caagctgggt cagagagcag ggctgactct gccagtgcct gcatcagcct catcgctctc 600 ctaggctcct ggcctgctgg actctgggct gcaggtcctt cttgaaaggc tgtgagtagt 660 gagacaagga gcaggagtga ggggtggcag gagagaagat agagattgag agagagagag 720 shake shake shake shake shake shake shake shake shake 780 ggagagaaag atggaagat aagagactg ggcgcagtgg ctcacgcctg taatcccaac 840 acttgggag gccaaggtgg gaggatggct tgaggaag agtctgagat cacctggcc 900 aacatagtga gaccccgtct ctaaaaaaaaaaaaaaaaaaaaaaaaaaaaagg 960 tttttttaa gagagagaga agagactca gagattgaga ctgagagaca gagagaga 1020 gatccaca ggagagggg gagagaaaagggaagggaagggaaagg 1080 aaaaaaga aaagcaggtg gcagagacac acagagggg accagagaa accagacac 1140 acggcaggtgg ctggcagcgg gcgctgtggg gtcacagta gggggacctg tg 1192 <210> 5 <211> 1149 <212> DNA <213> Homo sapiens <400> 5 atggagagga gggcgcggag ctcctccagg gagtcccgg ggcgaggcgg caggactccg 60 cacaaggaga acaagagggc aaaggccgag aggagcggcg ggggccgcgg gcgccaggag 120 gctgggcccg agccgtcggg ctccggacgg gcggggaccc cggggagcc ccgagcgccc 180 gccgccacgg tggtggacgt ggatgaggtc cgaggctccg gcgaggaggg caccgaggtg 240 gtggcgctgt tggagagcga gcggcccgag gaaggtacca aatcctccgg cttaggggcc 300 tgtgagtggc ttcttgtcct catttccctg ctcttcatca tcatgacctt ccctttttcc 360 atctggttct gcgtaaaggt tgtacaagag tatgaaagag taattatatt ccgactggga 420 catctgcttc ctggagaagc caaaggccct ggtcttttct tttttttgcc ctgcctggat 480 acctaccaca aggttgacct tcgtctccaa actctggaga taccttttca tgagatcgtg 540 accaaagaca tgtttataat ggagatagat gccatttgct actaccgaat ggaaaatgcc 600 tctcttctcc taagcagtct tgctcatgta tctaaagctg tgcaattcct tgtgcaaacc 660 actatgaagc gtctcctagc acatcgatcc ctcactgaaa ttcttctaga gaggaagagc 720 atcgcccaag atgcaaaggt tgccttggat tcagtgacct gtatttgggg aatcaaagtg 780 gagagaatag aaattaaaga tgtgaggttg ccagctgggc ttcagcactc actggctgtg 840 gaggctgaag cgcaaagaca agccaaagtg cggatgattg ctgcagaagc ggaaaaggct 900 gcttctgagt ccctgaggat ggcagctgag attctgtcag gcacccctgc tgctgttcag 960 cttcgatacc tccacaccct tcagtctctg tccacagaga agccttccac tgtggtttta 1020 cctttgccat ttgacctact gaattgcctg tcttccca gcaacagaac tcagggaagc 1080 ctccccttcc caagtccttc caaacctgtt gagccactaa atcctaaaaa gaaagactct 1140 cccatgtta 1149 <210> 6 <211> 589 <212> DNA <213> Woodchuck hepatitis virus <400> 6 aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60 ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120 atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180 tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240 ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360 ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420 gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480 aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540 cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589 <210> 7 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> bGH poly(A) <400> 7 ctgtgccttc tagttgccag ccatctgttg tttgccccctc cccgtgcct tccttgaccc 60 tggaaggtgc cactcccact gtccttttcct aataaaatga ggaaattgca tcgcattgtc 120 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

Claims

1. 1. An adeno-associated virus (AAV) vector gene therapy for use in the treatment of monogenic nephrotic syndrome, comprising an AAV vector comprising: NS-related transgenes, and Minimal nephrin promoter NPHS1 or podocin promoter NPHS2 AAV vector gene therapy.

2. The AAV vector gene therapy for use according to claim 1, wherein the AAV vector is AAV serotype 2 / 9, LK03, or 3B.

3. AAV vector gene therapy for use according to claim 1 or 2, wherein the NS-associated transgene is NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1.

4. The AAV vector gene therapy for use according to any one of claims 1 to 3, wherein the AAV vector further comprises a woodchuck hepatitis post-transcriptional regulatory element (WPRE).

5. 5. The AAV vector gene therapy for use according to any one of claims 1 to 4, wherein the NS-associated transgene is human and / or comprises a hemagglutinin (HA) tag.

6. The AAV vector gene therapy for use according to any one of claims 1 to 5, wherein the AAV vector further comprises a Kozak sequence between the promoter and the podocin transgene.

7. The AAV vector gene therapy for use according to any one of claims 1 to 6, wherein the AAV vector further comprises a polyadenylation signal, such as the bovine growth hormone (bGH) polyadenylation signal.

8. 8. An AAV vector gene therapy for use according to any one of claims 1 to 7, administered to a human patient.

9. The AAV vector gene therapy for use according to claim 8, wherein the patient is a pediatric patient.

10. The AAV vector gene therapy for use according to any one of claims 1 to 9, wherein the monogenic NS is monogenic steroid-resistant nephrotic syndrome.

11. The AAV vector gene therapy for use according to any one of claims 1 to 10, which is administered systemically.

12. 12. The AAV vector gene therapy for use according to any one of claims 1 to 11, administered by intravenous injection.

13. 13. The AAV vector gene therapy for use according to any one of claims 1 to 12, administered by injection into the renal artery.

Images