Modulators of APOL1 expression

Abstract

To treat, prevent, or ameliorate a disease associated with APOL1.SOLUTION: The present embodiments provide methods, compounds, and compositions useful for inhibiting APOL1 expression, which may be useful for treating, preventing, or ameliorating a disease associated with APOL1.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application is filed with a sequence listing in electronic format. The sequence listing is provided in a file named 200779-WO-PCT-SeqListingUpdated.txt, created May 20, 2019, and having a size of 465 kb. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] The present embodiments provide methods, compounds, and compositions useful for inhibiting APOL1 (apolipoprotein L, 1) expression, and in certain instances, reducing the amount of APOL1 protein in a cell or animal, which may be useful for treating, preventing, or ameliorating diseases associated with APOL1. [Background technology]

[0003] End-stage kidney disease (ESKD) affects more than 500,000 individuals in the United States. In the United States, the likelihood of individuals of African ancestry developing ESKD is approximately twice that observed among patients of other ethnic ancestry (Non-Patent Document 1; Non-Patent Document 2). There is no prescribed treatment for the majority of kidney diseases. Antihypertensive and anti-inflammatory treatments have been found to slow progression and reduce symptoms in some patients for some types of chronic kidney disease (CKD), but they do not result in disease remission or completely halt disease progression.

[0004] Recent data suggests an association between two common variants (G1 and G2) in the last exon of APOL1 and an increased risk of developing CKD among patients of African ancestry (Non-Patent Document 3; Non-Patent Document 4; Non-Patent Document 5; Non-Patent Document 6; Non-Patent Document 7). In a 2013 study, G1 and G2 risk variants in APOL1 were associated with a higher rate of ESKD and progression of CKD observed in patients of African ancestry compared to other ethnic ancestry groups, regardless of diabetes status (Non-Patent Document 8). While approximately 50% of subjects of African ancestry carry one risk allele in APOL1, approximately 13% of subjects of African ancestry (approximately 5 million individuals) carry two risk alleles in APOL1, and a significant proportion of them develop APOL1-related CKD. Studies in subjects of African ancestry carrying two APOL1 risk alleles have demonstrated increased odds ratios for the development of many forms of renal disease, including but not limited to focal segmental glomerulosclerosis (FSGS) (OR=10.5), ESKD due to hypertension (OR=7.3), HIV-associated nephropathy (HIVAN) (OR=29), sickle cell nephropathy (OR=3.4), and membranous lupus nephropathy (OR=5.4) (5; 6; 7). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] McClellan W.et al.Am.J.Kidney Dis.1988.12:285-290 [Non-Patent Document 2] Cowie CC.et al.N.Engl.J.Med.1989.321:1074-1079 [Non-Patent Document 3] Kao WH et al.Nat.Genet.2008.40:1185-1192 [Non-Patent Document 4] Lipkowitz MS et al.Kidney Int.2013.83:114-120 [Non-Patent Document 5] Genovese G.et al.Science.2010.329:841-845 [Non-Patent Document 6] Tzur et al. Hum Genet. 2010 [Non-Patent Document 7] Kopp et al.J Am Soc Nephrol.2011 [Non-Patent Document 8] Parsa A et al.N.Engl.J.Med.2013.369:2183-2196 Summary of the Invention [Means for solving the problem]

[0006] Certain embodiments provided herein are compounds and methods for reducing the amount or activity of APOL1 mRNA, and in certain embodiments, for reducing the amount of APOL1 protein in a cell or animal. In certain embodiments, the animal has APOL1-associated nephropathy, including, for example, HIV-associated nephropathy, focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, sickle cell nephropathy, arterionephro-sclerosis, lupus nephritis, hypertension-associated nephropathy, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the disease is focal segmental glomerulosclerosis (FSGS). In certain embodiments, the disease is CKD. In certain embodiments, the disease is arterionephro-sclerosis. In certain embodiments, the disease is lupus nephritis. In certain embodiments, the disease is CKD caused by hypertension. In certain embodiments, the disease is end-stage renal disease (ESRD). In certain embodiments, the disease is HIV-associated nephropathy. In certain embodiments, the disease is sickle cell nephropathy. In certain embodiments, the disease is membranous lupus nephropathy.

[0007] Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting APOL1 expression, which may be useful for treating, preventing, ameliorating, or slowing the progression of APOL1-associated proteinuria. Certain embodiments provided herein are directed to compounds and compositions that are more potent or have greater therapeutic value than publicly disclosed compounds. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] It should be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the claimed embodiments. As used herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is not limiting.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety and in the portions of the documents discussed herein.

[0010] It is understood that the sequence described in each SEQ ID NO in the examples listed herein is independent of any modification to the sugar moiety, internucleoside linkage, or nucleobase. Thus, a compound defined by a SEQ ID NO can independently contain one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase. A compound described by an ION / ISIS number represents a combination of nucleobase sequence, chemical modification, and motif.

[0011] definition Unless otherwise indicated, the following terms have the following meanings: "2'-deoxynucleoside" means a nucleoside containing a 2'-H(H) furanosyl sugar moiety found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxynucleosides can contain modified nucleobases or can contain RNA nucleobases (uracil).

[0012] "2'-O-Methoxyethyl" (also referred to as 2'-MOE) refers to 2'-O(CH2)2-OCH3) replacing the 2'-OH group on the ribosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0013] "2'-MOE nucleoside" (also referred to as 2'-O-methoxyethyl nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0014] "2'-substituted nucleoside" or "2-modified nucleoside" means a nucleoside that includes a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to a sugar moiety means a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0015] "3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3'-most nucleotide of a particular compound.

[0016] "5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5'-most nucleotide of a particular compound.

[0017] "5-methylcytosine" means a cytosine having a methyl group attached at the 5 position.

[0018] "About" means within ±10% of a value. For example, if it is stated that "the compound caused about 70% inhibition of APOL1," it is meant that APOL1 levels are inhibited within the range of 60% and 80%.

[0019] "Administration" or "administering" refers to a route by which a compound or composition provided herein is introduced into an individual to perform its intended function. One example of an administration route that can be used includes, but is not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0020] "Concurrent administration" or "co-administration" refers to the administration of two or more compounds in any manner in which both pharmacological effects are manifested in the patient. Concurrent administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only overlap over a period of time, not necessarily be coextensive. Concurrent or co-administration includes parallel or sequential administration.

[0021] "Amelioration" refers to the improvement or alleviation of at least one indicator, sign, or symptom of the relevant disease, disorder, or condition. In certain embodiments, improvement includes a slowing or deceleration of the progression or severity of one or more indicators of the condition or disease. The progression or severity of an indicator can be determined by subjective or objective measures known to those of skill in the art.

[0022] "Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0023] "Antisense activity" refers to any detectable and / or measurable activity resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound to the target.

[0024] "Antisense compound" refers to a compound that includes an oligonucleotide and optionally one or more additional features, such as a conjugate group or a terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0025] "Antisense inhibition" means a reduction in the level of a target nucleic acid in the presence of an antisense compound complementary to a target nucleic acid compared to the level of the target nucleic acid in the absence of the antisense compound.

[0026] An "antisense mechanism" is any mechanism involving hybridization of a compound with a target nucleic acid where the outcome or effect of hybridization is either target degradation or target occupancy with the concomitant stalling of cellular machinery including, for example, transcription or splicing.

[0027] "Antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid, or a region or segment thereof. In certain embodiments, an antisense oligonucleotide is capable of specifically hybridizing to a target nucleic acid, or a region or segment thereof.

[0028] "APOL1" refers to any nucleic acid or protein of APOL1. "APOL1 nucleic acid" refers to any nucleic acid encoding APOL1. For example, in certain embodiments, APOL1 nucleic acids include DNA sequences encoding APOL1, RNA sequences transcribed from DNA encoding APOL1 (e.g., genomic DNA including introns and exons), and mRNA sequences encoding APOL1. "APOL1 mRNA" refers to an mRNA encoding the APOL1 protein. Targets can be referred to in either uppercase or lowercase.

[0029] "APOL1 specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of APOL1 RNA and / or APOL1 protein at the molecular level. For example, APOL1 specific inhibitors include nucleic acids (e.g., antisense compounds), peptides, antibodies, small molecules, and other agents that can inhibit the expression of APOL1 RNA and / or APOL1 protein.

[0030] "Bicyclic nucleoside" or "BNA" refers to a nucleoside that includes a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0031] "Branched group" means a group of atoms having at least three positions capable of forming covalent bonds to at least three groups. In certain embodiments, the branched group provides multiple reactive sites for linking a tethered ligand to an oligonucleotide via a conjugate linker and / or a cleavable moiety.

[0032] "Cell targeting moiety" means a conjugated group or a portion of a conjugated group that is capable of binding to one or more specific cell types.

[0033] "cEt" or "constrained ethyl" means a ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0034] "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0035] A "chemical modification" in a compound describes the substitution or change, via a chemical reaction, of any of the units in that compound relative to the original state of such unit. A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or a modified nucleobase. A "modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0036] A "chemically distinct region" refers to a region of a compound that is chemically different in some sense from another region of the same compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides that do not have 2'-O-methoxyethyl modifications.

[0037] "Chimeric antisense compound" means an antisense compound having at least two chemically distinct regions, each position having multiple subunits.

[0038] "Cleavable bond" means any chemical bond that can be split. In certain embodiments, the cleavable bond is selected from among an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a disulfide, or a peptide.

[0039] "Cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0040] "Complementary" in reference to an oligonucleotide means that the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in reverse orientation. Nucleobase matches or complementary nucleobases as described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside and may contain one or more nucleobase mismatches. In contrast, "fully complementary" or "100% complementary" in reference to an oligonucleotide means that such oligonucleotide has a nucleobase match at each nucleoside without any nucleobase mismatches.

[0041] "Conjugate group" means a group of atoms attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that attach the conjugate moiety to the oligonucleotide.

[0042] "Conjugate linker" means a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0043] "Conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0044] "Contiguous" with respect to oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in the sequence.

[0045] "Designing" or "designed to" refers to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

[0046] "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharma- ceutically necessary or desirable. For example, a diluent in an injectable composition can be a liquid, such as a saline solution.

[0047] "Differentially modified" refers to chemical modifications or chemical substituents that differ from one another, including the absence of modification. Thus, for example, MOE nucleosides and unmodified DNA nucleosides are "differentially modified" even if the DNA nucleoside is unmodified. Similarly, DNA and RNA are "differentially modified" even if both are naturally occurring unmodified nucleosides. Nucleosides that are identical except that they contain different nucleobases are not differentially modified. For example, a nucleoside that contains a 2'-OMe modified sugar and an unmodified adenine nucleobase is not differentially modified compared to a nucleoside that contains a 2'-OMe modified sugar and an unmodified thymine nucleobase.

[0048] "Dose" refers to a specified amount of a compound or pharmaceutical agent provided in a single administration or in a specified period of time. In certain embodiments, a dose can be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume that is not easily accommodated by a single injection. In such embodiments, two or more injections can be used to achieve the desired dose. In certain embodiments, a dose can be administered in two or more injections to minimize injection site reactions in an individual. In other embodiments, a compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. A dose can be described as the amount of pharmaceutical agent per hour, day, week, or month.

[0049] A "dosing regimen" is a combination of doses designed to achieve one or more desired effects.

[0050] "Double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds which are complementary to each other and form a duplex, wherein one of the two oligomeric compounds comprises an oligonucleotide.

[0051] "Effective amount" means an amount of a compound sufficient to produce a desired pharmacological outcome in an individual in need of the compound. The effective amount may vary from individual to individual depending on the health and condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, an evaluation of the individual's medical condition, and other relevant factors.

[0052] "Efficacy" means the ability to produce a desired effect.

[0053] "Expression" includes all functions by which a gene's coded information is converted into structures present and operative in a cell, including, but not limited to, the products of transcription and translation.

[0054] "Gapmer" means an oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from one or more of the nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."

[0055] "Hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0056] "Directly adjacent" means that there are no intervening elements between elements of the same type that are directly adjacent (eg, there are no intervening nucleobases between directly adjacent nucleobases).

[0057] "Individual" means a human or non-human animal selected for treatment or therapy.

[0058] "Inhibiting expression or activity" refers to a reduction or blocking of expression or activity relative to expression of the activity in an untreated or control sample, and does not necessarily indicate a complete elimination of expression or activity.

[0059] "Internucleoside linkage" means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

[0060] An "extension oligonucleotide" is an oligonucleotide disclosed herein, eg, one having one or more additional nucleosides relative to a parent oligonucleotide.

[0061] "Linked nucleosides" means adjacent nucleosides that are linked together by an internucleoside bond.

[0062] "Linker-nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of the compound. The linker-nucleoside is not considered to be part of the oligonucleotide of the compound even if they are contiguous with the oligonucleotide.

[0063] "Mismatch" or "non-complementary" refers to a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, a nucleobase, including but not limited to universal nucleobases, inosine and hypoxanthine, can hybridize with at least one nucleobase, but is still mismatched or non-complementary to the nucleobase to which it hybridizes. As another example, a nucleobase of a first oligonucleotide that cannot hybridize to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatched or non-complementary nucleobase.

[0064] "Modulating" refers to changing or adjusting a characteristic in a cell, tissue, organ, or organism. For example, modulating APOL1 RNA can mean increasing or decreasing the level of APOL1 RNA and / or APOL1 protein in a cell, tissue, organ, or organism. A "modulator" brings about a change in a cell, tissue, organ, or organism. For example, an APOL1 compound can be a modulator that decreases the amount of APOL1 RNA and / or APOL1 protein in a cell, tissue, organ, or organism.

[0065] "MOE" means methoxyethyl.

[0066] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

[0067] "Motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0068] "Natural" or "naturally occurring" means something found in nature.

[0069] By "non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" is meant a modified sugar moiety that includes modifications, e.g., substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0070] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0071] "Nucleobase" refers to a heterocyclic moiety that can pair with a base of another nucleic acid. As used herein, "naturally occurring nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleobases" are naturally occurring nucleobases that have been chemically modified. "Universal bases" or "universal nucleobases" are nucleobases other than naturally occurring and modified nucleobases, and can pair with any nucleobase.

[0072] "Nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkages.

[0073] "Nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moieties are each independently unmodified or modified. "Modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0074] "Oligomeric compound" means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or a terminal group.

[0075] "Oligonucleotide" means a polymer of linked nucleosides, each of which may be modified or unmodified, independently of each other. Unless otherwise indicated, an oligonucleotide consists of 8 to 80 linked nucleosides. "Modified oligonucleotide" means an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. "Unmodified oligonucleotide" means an oligonucleotide that does not contain any sugar modification, nucleobase modification, or internucleoside modification.

[0076] "Parent oligonucleotide" refers to an oligonucleotide whose sequence is used as a basis for the design of more oligonucleotides of similar sequence but for different lengths, motifs, and / or chemical structures. The newly designed oligonucleotides may have identical or overlapping sequences to the parent oligonucleotide.

[0077] "Parenteral administration" means administration via injection or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, or intracranial, e.g., intrathecal or intraventricular, administration.

[0078] "Pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to an individual. For example, a pharma- ceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water for injection.

[0079] "Pharmaceutically acceptable salt" means a salt of a compound, e.g., an oligomeric compound or an oligonucleotide, that is physiologically and pharma- ceutically acceptable, i.e., a salt that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects.

[0080] "Pharmaceutical agent" means a compound that provides a therapeutic benefit when administered to an individual.

[0081] "Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can include one or more compounds or salts thereof and a sterile aqueous solution.

[0082] "Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced by a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

[0083] "Phosphorus moiety" means a group of atoms that includes a phosphorus atom. In certain embodiments, the phosphorus moiety includes a mono-, di-, or triphosphate, or a phosphorothioate.

[0084] A "portion" refers to a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous bases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

[0085] "Prevent" refers to slowing or arresting the onset, occurrence, or progression of a disease, disorder, or condition for a period ranging from minutes to indefinitely.

[0086] "Prodrug" refers to an exogenous form of a compound that, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolic form is an active or more active form of the compound (e.g., a drug). Typically, the conversion of a prodrug within the body is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.

[0087] "Reduce" means to reduce to a smaller degree, size, amount, or number.

[0088] A "RefSeq number" is a unique combination of letters and numbers assigned to a sequence to indicate that the sequence is for a particular target transcript (e.g., a target gene). Such sequences and information about the target gene (collectively the gene record) can be found in gene sequence databases, including the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the last three of which make up the International Nucleotide Sequence Database Collaboration or INSDC).

[0089] A "region" is defined as a portion of a target nucleic acid that has at least one distinguishable structure, function, or characteristic.

[0090] "RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

[0091] A "segment" is defined as a smaller or subportion of a region within a nucleic acid.

[0092] "Side effects" refers to physiological disorders and / or conditions resulting from treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, renal function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and fatigue. For example, an increase in serum aminotransferase levels may indicate hepatotoxicity or hepatic function abnormalities. For example, an increase in bilirubin may indicate hepatotoxicity or hepatic function abnormalities.

[0093] "Single-stranded" in reference to a compound means that the compound has only one oligonucleotide. "Self-complementary" means that the oligonucleotide hybridizes at least partially to itself. A compound that consists of one oligonucleotide and where the oligonucleotide is self-complementary is a single-stranded compound. A single-stranded compound can bind to a complementary compound to form a double strand.

[0094] A "site" is defined as a unique nucleobase position within a target nucleic acid.

[0095] "Specifically hybridizable" refers to an oligonucleotide that has a sufficient degree of complementarity between the oligonucleotide and the target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

[0096] "Specifically inhibit" with respect to a target nucleic acid refers to reducing or blocking expression of the target nucleic acid while having a smaller effect on reduction, minimal effect, or no effect on reduction of non-target nucleic acids. Reduction does not necessarily refer to complete elimination of target nucleic acid expression.

[0097] By "standard cellular assay" is meant the assay described in the Examples and relevant modifications thereof.

[0098] "Standard in vivo experiments" refers to procedures described in the Examples and reasonable modifications thereof.

[0099] "Stereorandom chiral center" in reference to a population of molecules of the same molecular formula means a chiral center that has random stereochemical configuration. For example, in a population of molecules that contain stereorandom chiral centers, the number of molecules that have the (S) configuration of the stereorandom chiral center can be, but is not necessarily, the same as the number of molecules that have the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0100] "Sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" or "unmodified sugar" refers to a 2'-OH(H) ribosyl moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) moiety found in DNA (an "unmodified DNA sugar moiety"). "Modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate. "Modified furanosyl sugar moiety" refers to a furanosyl sugar that contains a non-hydrogen substituent in place of at least one hydrogen or hydroxyl of the unmodified sugar moiety. In certain embodiments, the modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic and non-bicyclic sugars.

[0101] "Sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group in an oligonucleotide, such as an internucleoside linkage, a conjugate group, or a terminal group. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary compounds or nucleic acids.

[0102] "Synergism" or "synergizing" refers to the effect of a combination that is greater than the additive effect of each component alone at the same dose.

[0103] "Target gene" refers to a gene that encodes a target.

[0104] "Targeting" refers to the specific hybridization of a compound to a target nucleic acid to induce a desired effect.

[0105] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid that can be targeted by the compounds described herein.

[0106] "Target region" means a portion of a target nucleic acid to which one or more antisense compounds are targeted.

[0107] "Target segment" refers to the sequence of nucleotides of a target nucleic acid to which a compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0108] "Terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0109] "Therapeutically effective amount" means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

[0110] "Treating" refers to the administration of a compound or pharmaceutical composition to an animal to effect an alteration or amelioration of a disease, disorder, or condition in the animal.

[0111] Specific Embodiments Certain embodiments provide methods, compounds and compositions for inhibiting APOL1 (APOL1) expression.

[0112] Certain embodiments provide compounds that are targeted to APOL1 nucleic acids. In certain embodiments, the APOL1 nucleic acid has a sequence set forth in RefSeq or GENBANK Accession No. NM_003661.3 (disclosed herein as SEQ ID NO:1, incorporated by reference), NT_011520.9 truncated from nucleotides 15986452 to 16001905 (SEQ ID NO:2), NM_001136541.1 (SEQ ID NO:3), NM_001136540.1 (SEQ ID NO:4), NM_145343.2 (SEQ ID NO:5), DC339680.1 (SEQ ID NO:6), AK309143.1 (SEQ ID NO:7), NT_011520.13 truncated from nucleotides 17543446 to 17543655 (SEQ ID NO:8), or NC_000022.11 truncated from nucleotides 36250001 to 36271000 (SEQ ID NO:9). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0113] Certain embodiments provide compounds comprising modified oligonucleotides having a nucleobase sequence that is 8 to 80 linked nucleosides in length and that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides are 10 to 30 linked nucleosides in length.

[0114] Certain embodiments provide compounds comprising modified oligonucleotides having a nucleobase sequence that is 12 to 80 linked nucleosides in length and that comprises at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides are 12 to 30 linked nucleosides in length.

[0115] In certain embodiments, the compound comprises a modified oligonucleotide 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or an oligomeric compound.

[0116] Certain embodiments provide a compound comprising a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0117] Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0118] In certain embodiments, the compounds target nucleotides 5849-5907, 5853-5869, 5855-5873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 8755-8840, 14342-14390, and 14342-14370 of an APOL1 nucleic acid. In certain embodiments, the compounds are targeted within nucleotides 5849-5907, 5853-5869, 5855-5873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 8755-8840, 14342-14390, and 14342-14370 of an APOL1 nucleic acid having the nucleobase sequence of SEQ ID NO:2. In certain embodiments, the compounds have a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases complementary to an equal length portion within nucleotides 5849-5907, 5853-5869, 5855-5873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 8755-8840, 14342-14390, and 14342-14370 of an APOL1 nucleic acid having the nucleobase sequence of SEQ ID NO: 2. In certain embodiments, these compounds are antisense compounds, oligomeric compounds, or oligonucleotides.

[0119] In certain embodiments, the compounds target a region of an APOL1 nucleic acid having the nucleobase sequence of SEQ ID NO:2 within nucleobases 5849-5907, 5853-5869, 5855-5873, 8145-8180, 8168-8216, 8306-8321, 8320-8338, 8723-8847, 8743-8760, 8829-8847, 8755-8840, 14342-14390, and 14342-14370. In certain embodiments, the compounds target at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases within the nucleobase region. In certain embodiments, the compounds are antisense compounds, oligomeric compounds, or oligonucleotides. In certain embodiments, the modified oligonucleotides are between 10 and 30 linked nucleosides in length.

[0120] In certain embodiments, the compound is 12 to 30 linked nucleosides in length and comprises a complementary modified oligonucleotide within nucleotides 5854-5869, 5855-5870, 8164-8179, 8306-8321, 8321-8336, 8744-8759, 8829-8844, or 14342-14357 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0121] In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence that includes a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0122] In certain embodiments, the compound comprises a modified oligonucleotide that is 12 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

[0123] In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs:1164, 13, 76, 81, 1095, 1326, 1730, and 1925.

[0124] In certain embodiments, any of the above modified oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and / or at least one modified nucleobase.

[0125] In certain embodiments, any of the above modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.

[0126] In certain embodiments, the modified sugar comprises at least one modified internucleoside linkage, eg, a phosphorothioate internucleoside linkage.

[0127] In certain embodiments, any of the above modified oligonucleotides contains at least one modified nucleobase, such as 5-methylcytosine.

[0128] In certain embodiments, any of the above modified oligonucleotides comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides Including, A gap segment is located between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16 to 80 linked nucleosides in length and has a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length and has a nucleobase sequence consisting of a sequence set forth in any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925.

[0129] In certain embodiments, the compound comprises or consists of a modified oligonucleotide that is 16 to 30 linked nucleobases in length having a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 13, 1095, 1730, 76, 1326, and 81, wherein the modified oligonucleotide is a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, and the 5' and 3' wing segments comprise cEt nucleosides; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is between 16 and 80 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is between 16 and 30 linked nucleosides in length.

[0130] In certain embodiments, the compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising or consisting of a sequence set forth in any one of SEQ ID NOs: 1164 and 1925, the modified oligonucleotide being between 16 and 30 linked nucleobases in length, a gap segment consisting of nine linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment; the 5' wing segment comprises a cEt nucleoside; the 3' wing segment comprises, in a 5' to 3' orientation, a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

[0131] In certain embodiments, the compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising or consisting of the sequence set forth in SEQ ID NO: 1164, the modified oligonucleotide being between 16 and 30 linked nucleobases in length, a gap segment consisting of nine linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment; the 5' wing segment comprises a cEt nucleoside; the 3' wing segment comprises, in a 5' to 3' orientation, a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

[0132] In certain embodiments, the compound comprises or consists of the formula Tks Tks Tks Tds Gds Tds Ads Ads Gds Tds Gds mCds Aks Aks mCks mCe, wherein: A=adenine, mC=5-methylcytosine G=guanine, T=thymine; e = 2'-methoxyethyl modified nucleoside, k = cEt modified nucleoside, d=2'-deoxynucleoside, and s=phosphorothioate internucleoside linkage.

[0133] In certain embodiments, the compound has the following chemical structure: [ka] The compound according to the present invention comprises or consists of ION972190 or a salt thereof,

[0134] In certain embodiments, the compound has the following chemical structure: [ka] The sodium salt of ION972190 having the formula:

[0135] In any of the above embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding APOL1.

[0136] In any of the above embodiments, the compound may be single stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double stranded. In certain embodiments, the compound is double stranded and comprises ribonucleotides. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0137] In any of the above embodiments, the compound may be 8-80, 10-30, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

[0138] In certain embodiments, a compound or composition provided herein comprises a pharma- ceutically acceptable salt of a modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

[0139] In certain embodiments, the compounds or compositions described herein are highly tolerable as demonstrated by at least one of a 4-fold, 3-fold, or 2-fold increase in alanine transaminase (ALT) or aspartate transaminase (AST) levels relative to saline-treated animals, or a 30%, 20%, 15%, 12%, 10%, 5%, or 2% or less increase in liver, spleen, or kidney weights compared to control-treated animals. In certain embodiments, the compounds or compositions described herein are highly tolerable as demonstrated by no increase in ALT or AST relative to control-treated animals. In certain embodiments, the compounds or compositions described herein are highly tolerable as demonstrated by no increase in liver, spleen, or kidney weights relative to control animals.

[0140] Certain embodiments provide compositions comprising at least one of the compounds of any of the above embodiments or any pharma- ceutically acceptable salts thereof and a pharma-ceutically acceptable carrier or diluent. In certain embodiments, the compositions have a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, the compositions having any of the above viscosities comprise the compounds provided herein in a concentration of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL, or about 300 mg / mL. In certain embodiments, a composition having any of the above viscosities and / or compound concentrations has a temperature at room temperature or about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

[0141] Specific Indicators Certain embodiments provided herein relate to a method of inhibiting APOL1 expression by administering a compound that targets APOL1, which may be useful for treating, preventing, or ameliorating APOL1-related diseases in an individual. In certain embodiments, the compound may be an APOL1-specific inhibitor. In certain embodiments, the compound may be an antisense compound, an oligomeric compound, or an oligonucleotide targeted to APOL1.

[0142] Examples of APOL1-associated diseases that are treatable, preventable, and / or ameliorated by the methods provided herein include APOL-1-associated nephropathy, focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, ESKD, glomerular injury, ESRD, arteriosclerosis, lupus nephritis, and other forms of APOL1-associated proteinuric disease.

[0143] In certain embodiments, the method of treating, preventing, or ameliorating an APOL1-related disease in an individual comprises administering a compound comprising an APOL1-specific inhibitor to the individual, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as having or at risk of having an APOL1-related disease. In certain embodiments, the disease is APOL1-related nephropathy. In certain embodiments, the APOL1-related nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, and other forms of APOL1-related proteinuric disease. In certain embodiments, the compound is an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925 ... In certain embodiments, the compounds are ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compounds may be single-stranded or double-stranded.In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.In certain embodiments, the compound is administered parenterally to an individual.In certain embodiments, administering the compound improves, preserves, or prevents edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and kidney failure.

[0144] In certain embodiments, the method of treating, preventing, or ameliorating edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal injury, glomerular injury, and renal failure comprises administering to an individual a compound comprising an APOL1 specific inhibitor, thereby treating, preventing, or ameliorating edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal injury, glomerular injury, and renal failure. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and comprises at least 8 consecutive nucleobases of any of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compounds are ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compounds can be single-stranded or double-stranded. In any of the above embodiments, the compounds can be antisense compounds or oligomeric compounds. In certain embodiments, the compounds are administered to the individual parenterally.In certain embodiments, administering the compound ameliorates, preserves, or prevents edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and kidney failure. In certain embodiments, the individual has been identified as having or at risk of having an APOL1-related disease.

[0145] In certain embodiments, a method of inhibiting the expression of APOL1 in an individual having or at risk of having an APOL1-related disease comprises administering a compound comprising an APOL1-specific inhibitor to the individual, thereby inhibiting the expression of APOL1 in the individual. In certain embodiments, administering the compound inhibits the expression of APOL1 in the kidney. In certain embodiments, the disease is APOL1-related nephropathy. In certain embodiments, the APOL1-related nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy caused by hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-related proteinuric disease. In certain embodiments, the individual has or is at risk of having edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal damage, glomerular damage, or renal failure, or a combination of these conditions. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925.In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION Nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound can be single-stranded or double-stranded. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, administering the compound improves, preserves, or prevents edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, kidney damage, glomerular damage, and kidney failure.

[0146] In certain embodiments, the method of inhibiting the expression of APOL1 in a cell comprises contacting the cell with a compound comprising an APOL1 specific inhibitor, thereby inhibiting the expression of APOL1 in the cell. In certain embodiments, the cell is a glomerulus. In certain embodiments, the cell is in a kidney. In certain embodiments, the cell is in a kidney of an individual having or at risk of having APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925 ... In certain embodiments, the compounds are ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compounds may be single-stranded or double-stranded.In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0147] In certain embodiments, the method of reducing or inhibiting edema, proteinuria, albuminuria, GFR reduction, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal damage, glomerular damage, or renal failure in an individual with or at risk of having APOL1-related disease comprises administering a compound comprising an APOL1 specific inhibitor to the individual, thereby reducing or inhibiting edema, proteinuria, GFR reduction, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal damage, glomerular damage, or renal failure in the individual. In certain embodiments, the individual has or is at risk of having APOL1-related nephropathy. In certain embodiments, the APOL1-related nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-related nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-related proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and that comprises a nucleobase sequence of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925.In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION Nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound can be single-stranded or double-stranded. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, the individual is identified as having or at risk of having a disease associated with APOL1.

[0148] Certain embodiments are directed to compounds comprising APOL1 specific inhibitors for use in the treatment of diseases associated with APOL1. In certain embodiments, the disease is focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, or other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and comprises a nucleobase sequence of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925, the length being 16-30 linked nucleosides. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION Nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally.

[0149] Certain embodiments are directed to compounds comprising APOL1 specific inhibitors used to reduce or inhibit edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal damage, glomerular damage, or renal failure in individuals with or at risk of having APOL1-associated nephropathy. In certain embodiments, the APOL1-associated nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925 ... In certain embodiments, the compounds are ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compounds can be single-stranded or double-stranded. In any of the above embodiments, the compounds can be antisense compounds or oligomeric compounds.

[0150] Certain embodiments are directed to the use of a compound comprising an APOL1 specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with APOL1. Certain embodiments are directed to the use of a compound comprising an APOL1 specific inhibitor for the preparation of a medicament for treating a disease associated with APOL1. In certain embodiments, the disease is APOL1-associated nephropathy. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16-30 linked nucleosides in length and has a nucleobase sequence that comprises any of the nucleobase sequences of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925 ... In certain embodiments, the compounds are ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163.In any of the above embodiments, the compound may be single-stranded or double-stranded.In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.

[0151] Certain embodiments are directed to the use of a compound comprising an APOL1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting edema, proteinuria, albuminuria, reduced GFR, high lipid levels, high cholesterol levels, nephrotic syndrome, high blood pressure or hypertension, renal damage, glomerular damage, or renal failure in an individual with or at risk of having APOL1-related nephropathy. In certain embodiments, the APOL1-related nephropathy is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-related nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-related proteinuric disease. Certain embodiments are directed to the use of a compound comprising an APOL1 specific inhibitor for the preparation of a medicament for treating a disease associated with APOL1. In certain embodiments, the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease. In certain embodiments, the compound comprises an antisense compound targeted to APOL1. In certain embodiments, the compound comprises an oligonucleotide targeted to APOL1. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and comprises at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence that is 16-30 linked nucleosides in length and comprises a nucleobase sequence of any of the nucleobase sequences of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any of SEQ ID NOs: 13-1941. In certain embodiments, the compound comprises a modified oligonucleotide that is 16 to 30 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925.In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1164, 13, 76, 81, 1095, 1326, 1730, and 1925. In certain embodiments, the compound is ION Nos. 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163. In any of the above embodiments, the compound can be single-stranded or double-stranded. In any of the above embodiments, the compound can be an antisense compound or an oligomeric compound.

[0152] In any of the above methods or uses, the compound may be targeted to APOL1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide 8-80 linked nucleosides in length, 10-30 linked nucleosides in length, 12-30 linked nucleosides in length, or 16 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences set forth in SEQ ID NOs: 1-9. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or 2'-O-methoxyethyl, and the modified nucleobase is 5-methylcytosine. In certain embodiments, a modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, where the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0153] In any of the above embodiments, the modified oligonucleotide is 12-30, 15-30, 15-25, 15-24, 16-24, 17-24, 18-24, 19-24, 20-24, 19-22, 20-22, 16-20, or 17 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences set forth in SEQ ID NOs: 1-9. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or 2'-O-methoxyethyl, and the modified nucleobase is 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, where the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0154] In any of the above methods or uses, the compound comprises or consists of a modified oligonucleotide that is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising any one of SEQ ID NOs: 13 to 1941, the modified oligonucleotide comprising: a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides Including, A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0155] In any of the above methods or uses, the compound comprises or consists of a modified oligonucleotide that is 16 to 30 linked nucleobases in length and has a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 13, 1095, 1730, 76, 1326, and 81, the modified oligonucleotide comprising: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, wherein the 5' and 3' wing segments comprise cEt nucleosides; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is between 16 and 30 linked nucleosides in length.

[0156] In any of the above methods or uses, the compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising or consisting of a sequence set forth in any one of SEQ ID NOs: 1164 and 1925, the modified oligonucleotide being between 16 and 30 linked nucleobases in length, a gap segment consisting of nine linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment; the 5' wing segment comprises a cEt nucleoside; the 3' wing segment comprises, in a 5' to 3' orientation, a cEt nucleoside, a cEt nucleoside, a cEt nucleoside, and a 2'-O-methoxyethyl nucleoside; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

[0157] In any of the above methods or uses, the compound has the following chemical structure: [ka] The compound according to the present invention comprises or consists of ION972190 or a salt thereof,

[0158] In any of the above methods or uses, the compound has the following chemical structure: [ka] The sodium salt of ION972190 having the formula:

[0159] In any of the above methods or uses, the compound can be administered parenterally. For example, in certain embodiments, the compound can be administered via injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal or intraventricular administration.

[0160] Specific Compounds In certain embodiments, the compounds described herein may be antisense compounds. In certain embodiments, the antisense compounds comprise or consist of oligomeric compounds. In certain embodiments, the oligomeric compounds comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides have a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid.

[0161] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides, hi certain embodiments, the modified oligonucleotides have a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid.

[0162] In certain embodiments, the compound or antisense compound is single-stranded. Such single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

[0163] In certain embodiments, the compound is double stranded. Such double stranded compounds include a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, a thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, the compound includes a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both of the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 12-30 linked nucleosides in length and the second modified oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of SEQ ID NOs: 13-1941.

[0164] In certain embodiments, the antisense compound is double-stranded. Such double-stranded antisense compounds include a first oligomeric compound with a region complementary to the target nucleic acid and a second oligomeric compound with a region complementary to the first oligomeric compound. The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double-stranded antisense compounds may be modified or unmodified. Either or both of the oligomeric compounds of the double-stranded antisense compounds may comprise a conjugate group. The oligomeric compound of the double-stranded antisense compounds may comprise non-complementary overlapping nucleosides.

[0165] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNAs, targeted oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

[0166] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of a target segment of a target nucleic acid to which it is targeted.

[0167] In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 10-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 12-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 12-22. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 14-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 14-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 15-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 15-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 16-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 16-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 17-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 17-20. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 18-30 linked subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 18-21 linked subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 18-20 linked subunits. In certain embodiments, the compounds described herein comprise oligonucleotides with a length of 20-30 linked subunits.In other words, such oligonucleotides are 12-30 linked subunits, 14-30 linked subunits, 14-20 subunits, 15-30 subunits, 15-20 subunits, 16-30 subunits, 16-20 subunits, 17-30 subunits, 17-20 subunits, 18-30 subunits, 18-20 subunits, 18-21 subunits, 20-30 subunits, or 12-22 linked subunits in length, respectively. In certain embodiments, the compounds described herein include oligonucleotides with a linked subunit length of 14. In certain embodiments, the compounds described herein include oligonucleotides with a linked subunit length of 16. In certain embodiments, the compounds described herein include oligonucleotides with a linked subunit length of 17. In certain embodiments, the compounds described herein include oligonucleotides with a linked subunit length of 18. In certain embodiments, the compounds described herein include oligonucleotides with a linked subunit length of 19. In certain embodiments, the compounds described herein comprise oligonucleotides of 20 linked subunits in length. In other embodiments, the compounds described herein comprise oligonucleotides of 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30 linked subunits.In certain such embodiments, the compounds described herein comprise oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunit lengths, or a range defined by any two of the above values. In some embodiments, the linking subunit is a nucleotide, a nucleoside, or a nucleobase.

[0168] In certain embodiments, the compound may further comprise additional features or elements attached to the oligonucleotide, such as a conjugate group. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where the conjugate group comprises a nucleoside (i.e., the nucleoside that attaches the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

[0169] In certain embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation) or from the 3' end (3' truncation). A shortened or truncated compound targeted to an APOL1 nucleic acid may have two subunits deleted from the 5' end of the compound, or two subunits deleted from the 3' end. Alternatively, the deleted nucleosides may be distributed throughout the compound.

[0170] When a single additional subunit is present in an extended compound, the additional subunit may be located at the 5' or 3' end of the compound. When two or more additional subunits are present, the additional subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5' end (5' addition) or 3' end (3' addition) of the compound. Alternatively, the additional subunits may be dispersed throughout the compound.

[0171] It is possible to increase or decrease the length of a compound, e.g., an oligonucleotide, and / or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992,89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001,93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998,16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemical structure, and motifs can result in large differences in one or more of many properties required for clinical development (Seth et al. J. Med. Chem. 2009,52,10; Egli et al. J. Am. Chem. Soc. 2011,133,16642).

[0172] In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also referred to as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function, at least in part, through the RISC pathway to degrade and / or sequester target nucleic acids (and thus include microRNA / microRNA mimic compounds). The term siRNA as used herein is meant to be equivalent to other terms used to describe nucleic acid molecules that can mediate sequence-specific RNAi, such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotides, short interfering nucleic acids, short interfering modified oligonucleotides, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), etc. Furthermore, the term "RNAi" as used herein is meant to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetics.

[0173] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeted to APOL1 described herein. In certain embodiments, the compounds may be double-stranded. In certain embodiments, the compounds comprise a first strand and a second strand comprising a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise a first strand and a second strand comprising a nucleobase sequence of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise a ribonucleotide in which the first strand has uracil (U) instead of thymine (T) of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise (i) a first strand comprising a nucleobase sequence complementary to a site on APOL1 in any one of SEQ ID NOs: 13-1941 that is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the strand of the dsRNA compound. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides other than naturally occurring phosphodiester bonds. Examples of such bonds include phosphoramide, phosphorothioate, and phosphorodithioate bonds. The compound can also be a chemically modified nucleic acid molecule as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compounds contain one or two cap chains, for example as disclosed by WO 00 / 63364, filed April 19, 2000.

[0174] In certain embodiments, the first strand of the compound is an siRNA guide strand, and the second strand of the compound is an siRNA passenger strand.In certain embodiments, the second strand of the compound is complementary to the first strand.In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length.In certain embodiments, the first or second strand of the compound can include a conjugate group.

[0175] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeted to APOL1 described herein. In certain embodiments, the compounds are single stranded. In certain embodiments, such compounds are single stranded RNAi (ssRNAi) compounds. In certain embodiments, the compounds comprise a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise a nucleobase sequence of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise a ribonucleotide in which uracil (U) is present in place of thymine (T) of any one of SEQ ID NOs: 13-1941. In certain embodiments, the compounds comprise a nucleobase sequence complementary to a site on APOL1 to which any of SEQ ID NOs: 13-1941 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the chain of the compound. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides other than naturally occurring phosphodiester bonds. Examples of such bonds include phosphoramide, phosphorothioate, and phosphorodithioate bonds. The compound can also be a chemically modified nucleic acid molecule as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compounds contain cap chains, for example, as disclosed by WO 00 / 63364, filed April 19, 2000. In certain embodiments, the compounds consist of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.In certain embodiments, the compound may include a conjugate group.

[0176] Specific mechanisms In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein can hybridize to target nucleic acids and provide at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids and provides one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids, nor do they hybridize to one or more non-target nucleic acids in such a way that they provide significant undesired antisense activity.

[0177] In certain antisense activities, hybridization of the compounds described herein to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently "DNA-like" to induce RNase H activity. Furthermore, in certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0178] In certain antisense activities, the compounds or part of the compounds described herein are loaded into RNA-induced silencing complex (RISC), which ultimately leads to the cleavage of target nucleic acid.For example, certain compounds described herein lead to the cleavage of target nucleic acid by Argonaute.In certain embodiments, the compound loaded into RISC is an RNAi compound.RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0179] In certain embodiments, hybridization of a compound described herein to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in perturbation of splicing of the target nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of a compound to a target nucleic acid results in perturbation of translation of the target nucleic acid.

[0180] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0181] Target Nucleic Acids, Target Regions and Nucleotide Sequences In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mRNA and pre-mRNA, including introns, exons and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0182] Nucleotide sequences encoding APOL1 include, but are not limited to, the following: RefSEQ No. NM_003661.3 (incorporated by reference and disclosed as SEQ ID NO: 1), NT_011520.9 truncated from nucleotides 15986452 to 16001905 (SEQ ID NO: 2), NM_001136541.1 (SEQ ID NO: 3), NM_001136540.1 (SEQ ID NO: 4), NM_145343.2 (SEQ ID NO: 5), DC339680.1 (SEQ ID NO: 6), AK309143.1 (SEQ ID NO: 7), NT_011520.13 truncated from nucleotides 17543446 to 17543655 (SEQ ID NO: 8), or NC_000022.11 truncated from nucleotides 36250001 to 36271000 (SEQ ID NO: 9).

[0183] Hybridization In some embodiments, hybridization occurs between a compound disclosed herein and an APOL1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of a nucleic acid molecule.

[0184] Hybridization can occur under varying conditions, which are sequence-dependent and determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0185] Methods for determining whether a sequence specifically hybridizes to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable to APOL1 nucleic acids.

[0186] Complementarity An oligonucleotide is described as being complementary to another nucleic acid if the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in reverse orientation. Nucleobase matches or complementary nucleobases as described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside and may contain one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary if such oligonucleotide has a nucleobase match at each nucleoside without any nucleobase mismatches.

[0187] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleobases between the compounds and APOL1 nucleic acids can be tolerated if the compounds can still specifically hybridize to the target nucleic acid. Furthermore, the compounds can hybridize onto one or more segments of APOL1 nucleic acids such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).

[0188] In certain embodiments, the compounds provided herein or portions thereof are 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an APOL1 nucleic acid, target region, target segment, or portions thereof, and are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an APOL1 nucleic acid, target region, target segment, or portions thereof. %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary, or up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary. In certain embodiments, the compounds provided herein, or defined portions thereof, are 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, 95%-100%, or any number between these ranges, complementary to an APOL1 nucleic acid, target region, target segment, or defined portion thereof. The percent complementarity between a compound and a target nucleic acid can be determined using routine methods.

[0189] For example, a compound in which 18 of the 20 nucleobases of the compound are complementary to the target region and thus specifically hybridize represents 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered with complementary nucleobases or may be interspersed with complementary nucleobases, and do not need to be contiguous with each other or with complementary nucleobases. Thus, a compound that is 18 nucleobases long and has 4 non-complementary nucleobases flanked by two regions of perfect complementarity with the target nucleic acid has a total complementarity of 77.8% to the target nucleic acid. The percent complementarity of a compound to a region of the target nucleic acid can be routinely determined using BLAST (basic local alignment search tool) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656) known in the art. Percent homology, percent sequence identity or percent sequence complementarity can be determined, for example, using the default settings of the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0190] In certain embodiments, the compounds described herein or portions of their definitions are fully complementary (i.e., 100% complementary) to the target nucleic acid or portions of its definitions. For example, the compounds can be fully complementary to the APOL1 nucleic acid, or to a target region, or to a target segment, or to a target sequence. As used herein, "fully complementary" means that each nucleobase of the compound is complementary to the corresponding nucleobase of the target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a 400 nucleobase long target sequence as long as there is a portion of the 20 nucleobase in the corresponding target nucleic acid that is fully complementary to the compound. Fully complementary can also be used with respect to the portion of the definition of the first and / or second nucleic acid. For example, a portion of the 20 nucleobase of a 30 nucleobase compound can be "fully complementary" to a 400 nucleobase long target sequence. A portion of the 20 nucleobases of a 30 nucleobase compound is fully complementary to a target sequence if the target sequence has a corresponding portion of the 20 nucleobases (each nucleobase is complementary to a portion of the 20 nucleobases of the compound). At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0191] In certain embodiments, the compounds described herein contain one or more mismatched nucleobases with respect to the target nucleic acid. In certain such embodiments, the antisense activity with respect to the target is reduced by such mismatches, while the activity with respect to the non-target is reduced by a larger amount. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain such embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is located at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain such embodiments, the mismatch is located at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain such embodiments, the mismatch is located at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain such embodiments, the mismatch is located at 4, 3, 2, or 1 positions from the 3' end of the wing region. In certain such embodiments, the mismatch is located at 2, 3, or 4 positions from the 5' end of the wing region. In certain such embodiments, the mismatch is located at 1, 2, 3, or 4 positions from the 3' end of the wing region. In certain such embodiments, the mismatch is located at 1, 2, 3, or 1 positions from the 3' end of the wing region. In certain embodiments, the mismatch is located at ... In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0192] The location of the non-complementary nucleobase may be at the 5'-end or 3'-end of the compound. Alternatively, one or more non-complementary nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

[0193] In certain embodiments, compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, or that are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobases to a target nucleic acid, e.g., an APOL1 nucleic acid, or a defined portion thereof.

[0194] In certain embodiments, the compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, or that are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase to a target nucleic acid, e.g., an APOL1 nucleic acid, or a defined portion thereof.

[0195] In certain embodiments, the compounds described herein also include those that are complementary to a portion of a target nucleic acid. As used herein, a "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, a compound is complementary to a portion of at least 8 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 9 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 10 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 11 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 12 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 13 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 14 nucleobases of a target segment. In certain embodiments, a compound is complementary to a portion of at least 15 nucleobases of a target segment. In certain embodiments, the compounds are complementary to a portion of at least 16 nucleobases of a target segment. Compounds complementary to a portion of at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases of a target segment, or a range defined by any two of these values, are also contemplated.

[0196] identity The compounds provided herein may also have a defined percent identity to a compound or part thereof represented by a specific nucleotide sequence, SEQ ID NO: or a defined ION number. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. A compound used herein is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA containing uracil instead of thymidine in a disclosed DNA sequence is considered to be identical to the DNA sequence, since both uracil and thymidine pair with adenine. Shortened and extended versions of the compounds described herein, as well as compounds with non-identical bases to the compounds provided herein, are also contemplated. The non-identical bases may be adjacent to each other or distributed throughout the compound. The percent identity of a compound is calculated according to the number of bases with identical base pairing to the sequence being compared.

[0197] In certain embodiments, the compounds described herein or portions thereof are 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs disclosed herein or portions thereof. In certain embodiments, the compounds described herein are at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a compound or a portion thereof represented by a specific nucleotide sequence, SEQ ID NO: or a specified ION number, or any percentage between such values, and the compounds include oligonucleotides having one or more mismatched nucleobases. In certain such embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatches are at positions 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0198] In certain embodiments, the compound described herein comprises or consists of antisense compound.In certain embodiments, a portion of antisense compound is compared with a portion of equal length of target nucleic acid.In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared with a portion of equal length of target nucleic acid.

[0199] In certain embodiments, the compound described herein comprises or consists of an oligonucleotide.In certain embodiments, a portion of the oligonucleotide is compared to a portion of equal length of the target nucleic acid.In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared to a portion of equal length of the target nucleic acid.

[0200] Specific modified compounds In certain embodiments, the compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA (i.e., contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage).

[0201] A. Modified Nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0202] 1. Modified sugar moiety In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to other types of modified sugar moieties.

[0203] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents, including but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched chains. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, or aryl. and U.S. Pat. No. 6,005,087 to Cook et al., wherein each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl, as well as 2'-substituents as described in U.S. Pat. No. 6,531,584 to Cook et al.; U.S. Pat. No. 5,859,221 to Cook et al.; and U.S. Pat. No. 6,005,087 to Cook et al. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for linear non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars contain two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties and modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., U.S. Patent Application Publication No. 2013 / 0203836.

[0204] In certain embodiments, a 2'-substituted nucleoside or a 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl.

[0205] In certain embodiments, a 2'-substituted nucleoside or a 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N-(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0206] In certain embodiments, a 2'-substituted nucleoside or a 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0207] Nucleosides that include modified sugar moieties, e.g., non-bicyclic modified sugar moieties, are referred to by the position of substitution on the sugar moiety of the nucleoside. For example, nucleosides that include a 2'-substituted or 2-modified sugar moiety are referred to as 2'-substituted nucleosides or 2-modified nucleosides.

[0208] Certain modified sugar moieties include a bridged sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring.Examples of such 4' to 2' bridging sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845 to Seth et al., U.S. Pat. No. 7,569,686 to Bhat et al., U.S. Pat. No. 7,571,686 to Swayz et al., U.S. Pat. No. 7,631,621, and U.S. Pat. No. 7,711,515 to Swayz et al. ... No. 7,741,457 to Seth et al., and U.S. Pat. No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,283 to Seth et al.), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,425 to Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al., and U.S. Pat. No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al., and U.S. Pat. No. 8,124,745 to Allerson et al.), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,426 to Seth et al.), 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, Ra, and Rb is independently H, a protecting group, or C1-C12 alkyl (see, e.g., U.S. Pat. No. 7,427,672 to Imanishi et al.).

[0209] In certain embodiments, such 4' to 2' bridges contain from 1 to 4 linking groups independently selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each Ra and Rb is independently H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0210] Freier et al., Nucleic Acids et al., 2013. Freier et al., Nucleic Acids. Research,1997,25(22),4429-4443、Albaek et al.,J.Org.Chem.,2006,71,7731-7740、Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al. al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,219-222; al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,258-51;Braasch et al.; al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther., 2001, 3,239-243; U.S. Pat. No. 7,053,207 to Wengel et al.; U.S. Pat. No. 6,268,490 to Imanishi et al.; U.S. Pat. No. 6,770,748 to Imanishi et al.; U.S. Pat. Re. No. 44,779 to Imanishi et al.; U.S. Pat. No. 6,794,499 to Wengel et al.; U.S. Pat. No. 6,670,461 to Wengel et al.; U.S. Pat. No. 7,034,133 to Wengel et al., U.S. Pat. No. 8,080,644 to Wengel et al., U.S. Pat. No. 8,034,909 to Wengel et al., U.S. Pat. No. 8,153,365 to Wengel et al., U.S. Pat. No. 7,572,582 to Wengel et al., and U.S. Pat. No. 6,525,191 to Ramasamy et al., International Publication WO 2004 / 106356 to Torsten et al., Wenge No. 7,666,854 to Seth et al.; U.S. Pat. No. 8,088,746 to Seth et al.; U.S. Pat. No. 7,750,131 to Seth et al.; U.S. Pat. No. 8,030,467 ...547,684 to Seth et al.; U.S. Pat. No. 7,666,854 to Seth et al.; U.S. Pat. No. 8,088,746 to Seth et al.; U.S. Pat. No. 7,750,131 to Seth et al.; U.S. Pat. No. 8,030,467 to Seth et al.; U.S. Pat. No. 8,030,467 to Seth et al. See U.S. Patent Nos. 8,546,556 to Seth et al., 8,530,640 to Seth et al., 9,012,421 to Migawa et al., 8,501,805 to Seth et al., U.S. Patent Application Publication No. 2008 / 0039618 to Allerson et al., and U.S. Patent Application Publication No. 2015 / 0191727 to Migawa et al..

[0211] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Here, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of defined bicyclic nucleosides (e.g., LNA or cEt) are identified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0212] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0213] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, an oxygen atom of the sugar moiety is replaced, for example, by a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., U.S. Pat. Nos. 7,875,733 to Bhat et al. and 7,939,677 to Bhat et al.) and / or the 5' position.

[0214] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., U.S. Pat. Nos. 8,088,904 to Swayze et al.; 8,440,803 to Swayze et al.; and 9,005,906 to Swayze et al., F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and of the formula: [ka] wherein, for each of said modified THP nucleosides, independently: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl.

[0215] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0216] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used herein, the term "morpholino" refers to the following structure: [ka] In certain embodiments, morpholinos can be modified, for example, by adding or varying substituents from the morpholino structure above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0217] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that include such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in U.S. Patent Application Publication No. 2013 / 130378 to Manoharan et al.

[0218] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0219] 2. Modified Nucleobases The modification or substitution of nucleobase (or base) is structurally distinct from naturally occurring or synthetic unmodified nucleobase, but functionally interchangeable with naturally occurring or synthetic unmodified nucleobase. Both natural and modified nucleobases can participate in hydrogen bonding. Such nucleobase modification can provide antisense compounds with nuclease stability, binding affinity or some other beneficial biological properties.

[0220] In certain embodiments, the compound described herein comprises modified oligonucleotide.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobase, which are referred to as abasic nucleosides.

[0221] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thiolalkyl, 8-hydroxymethyl, 8-hydroxypropyl ... cytosine, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halo cytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808 to Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0222] Publications which teach the preparation of certain of the above and other modified nucleobases include, but are not limited to, U.S. Patent Application Publication No. 2003 / 0158403 to Manoharan et al., U.S. Patent Application Publication No. 2003 / 0175906 to Manoharan et al.; U.S. Patent No. 4,845,205 to Dinh et al.; U.S. Patent No. 5,130,302 to Spielvogel et al.; U.S. Patent No. 5,134,066 to Rogers et al.; U.S. Patent No. 5,134,066 to Bischofberger et al. No. 175,273 to Urdea et al.; U.S. Pat. No. 5,367,066 to Urdea et al.; U.S. Pat. No. 5,432,272 to Benner et al.; U.S. Pat. No. 5,434,257 to Matteucci et al.; U.S. Pat. No. 5,457,187 to Gmeiner et al.; U.S. Pat. No. 5,459,255 to Cook et al.; U.S. Pat. No. 5,484,908 to Froehler et al.; U.S. Pat. No. 5,502,177 to Matteucci et al.; U.S. Pat. No. 5,525,711 to Hawkins et al. ;Haralambidis et al., U.S. Pat. No. 5,552,540;Cook et al., U.S. Pat. No. 5,587,469;Froehler et al., U.S. Pat. No. 5,594,121;Switzer et al., U.S. Pat. No. 5,596,091;Cook et al., U.S. Pat. No. 5,614,617;Froehler et al., U.S. Pat. No. 5,645,985;Cook et al., U.S. Pat. No. 5,681,941;Cook et al., U.S. Pat. No. 5,811,534;Cook et al., U.S. Pat. No. 5, No. 750,692 to Cook et al.; U.S. Pat. No. 5,948,903 to Cook et al.; U.S. Pat. No. 5,587,470 to Cook et al.; U.S. Pat. No. 5,457,191 to Cook et al.; U.S. Pat. No. 5,763,588 to Matteucci et al.; U.S. Pat. No. 5,830,653 to Froehler et al.; U.S. Pat. No. 5,808,027 to Cook et al.; U.S. Pat. No. 6,166,199 to Cook et al.; and U.S. Pat. No. 6,005,096 to Matteucci et al.

[0223] In certain embodiments, the compound targeted to the APOL1 nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

[0224] Modified Internucleoside Linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, compounds described herein having one or more modifications, i.e., non-naturally occurring internucleoside linkages, are often selected over compounds having naturally occurring internucleoside linkages due to desirable properties, such as improved cellular uptake, improved affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0225] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages of a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, the methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be of a specific stereochemical configuration.

[0226] In certain embodiments, the compound targeted to APOL1 nucleic acid comprises one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

[0227] In certain embodiments, the compounds described herein include oligonucleotides.The oligonucleotides with modified internucleoside linkages include internucleoside linkages that hold phosphorus atoms and internucleoside linkages that do not have phosphorus atoms.Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate.The methods of preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0228] In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside bond.Two main classes of internucleoside linkages are defined by the presence or absence of phosphorus atom.Exemplary phosphorus-containing internucleoside bond include, but are not limited to, phosphate, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P=S"), and phosphorodithioate ("HS-P=S"), containing phosphodiester bond ("P=O") (also referred to as unmodified or naturally occurring bond). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to vary, and typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0229] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 moieties.

[0230] In certain embodiments, the oligonucleotide comprises modified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, the internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of the two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the wings are phosphodiester linkages and the internucleoside linkages in the gap are phosphorothioate linkages. Because the nucleoside motifs are independently selected, such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif, and if they have a gapped nucleoside motif, the wing length and gap length may or may not be the same.

[0231] In certain embodiments, the oligonucleotide comprises a region having an alternating internucleoside linkage motif. In certain embodiments, the oligonucleotide comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioates. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate.

[0232] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides from the 3' end of the oligonucleotide.

[0233] In certain embodiments, the oligonucleotide comprises one or more methylphosponate linkages. In certain embodiments, the oligonucleotide having a gapmer nucleoside motif comprises a linkage motif that is all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is present in the central gap of the oligonucleotide having a gapmer nucleoside motif.

[0234] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while maintaining nuclease activity.

[0235] 3. Specific motifs In certain embodiments, the compounds described herein include oligonucleotides. Oligonucleotides may have motifs, such as unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkage patterns. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugars. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differentially modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motifs, nucleobase motifs, and / or internucleoside linkage motifs (nucleobase motifs as used herein describe the modification of nucleobases independent of the sequence of nucleobases).

[0236] A specific glyco motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise one or more types of modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in defined patterns or sugar motifs. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0237] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif, which comprises two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to one another. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0238] In certain embodiments, the gapmer wing comprises 1-5 nucleosides. In certain embodiments, the gapmer wing comprises 2-5 nucleosides. In certain embodiments, the gapmer wing comprises 3-5 nucleosides. In certain embodiments, the nucleosides of the gapmer are all modified nucleosides.

[0239] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, the gapmer gap comprises 7-10 nucleosides. In certain embodiments, the gapmer gap comprises 8-10 nucleosides. In certain embodiments, the gapmer gap comprises 10 nucleosides. In certain embodiments, each nucleoside of the gapmer gap is an unmodified 2'-deoxynucleoside.

[0240] In certain embodiments, the gapmer is a deoxygapmer. In such embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

[0241] In certain embodiments, a modified oligonucleotide has a fully modified sugar motif, and each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, and each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, and each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniform modification comprises the same 2'-modification.

[0242] B specific nucleobase motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosine.

[0243] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0244] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is present in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0245] C specific internucleoside linkage motifs In certain embodiments, the compounds described herein include oligonucleotides. In certain embodiments, the oligonucleotides include modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linkage group is a phosphate internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is independently selected from phosphorothioate and phosphate internucleoside linkages. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkages in the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioate and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0246] 4. Specific Modified Oligonucleotides In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modifications, motifs, and overall length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of a sugar gapmer may be identical or different from each other, and may be identical or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such gapmer oligonucleotides may include one or more modified nucleobases independent of the gapmer pattern of sugar modification. Furthermore, in certain instances, an oligonucleotide is described by a total length or range and by the length or length range of two or more regions (e.g., regions of nucleosides with defined sugar modifications), in such situations, it may be possible to select a number for each range that results in an oligonucleotide having a total length outside the specified range. In such situations, both elements must be satisfied. For example, in certain embodiments, the modified oligonucleotide is comprised of 15-20 linked nucleosides and has a sugar motif comprised of three regions A, B, C, where region A is comprised of 2-6 linked nucleosides with a defined sugar motif, region B is comprised of 6-10 linked nucleosides with a defined sugar motif, and region C is comprised of 2-6 linked nucleosides with a defined sugar motif. Such an embodiment does not include a modified oligonucleotide in which A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are allowed within the requirements of A, B, and C), because the total length of such an oligonucleotide would be 22, exceeding the upper limit for the total length of a modified oligonucleotide (20).In this specification, when the description of an oligonucleotide is silent about one or more parameters, such parameters are not limited.Thus, a modified oligonucleotide that is described only as having a gapmer sugar motif and has no further description can have any length, internucleoside linkage motif, and nucleobase motif.Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0247] Specific conjugate compounds In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both termini of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0248] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleobase sequence that is complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to the sense transcript.

[0249] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0250] A. Specific Conjugation Groups In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups.In certain embodiments, conjugate groups modify one or more properties of attached oligonucleotides, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.In certain embodiments, conjugate groups give attached oligonucleotides new properties, such as fluorophores or reporter groups that allow detection of oligonucleotides.

[0251] Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1997, 20, 533-538), Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO 2014 / 179620).

[0252] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, phorates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0253] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indo-methicin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0254] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain embodiments, the conjugate group is a single chemical bond (i.e., the conjugate moiety is attached to the oligonucleotide via a single bond via the conjugate linker). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleosides, or amino acid units.

[0255] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0256] In certain embodiments, the conjugate linker, for example the conjugate linker described above, is a bifunctional linking moiety, such as one known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site of the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0257] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-merimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, with a non-limiting list of preferred substituents including hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0258] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker-nucleoside to be cleaved from the compound after it has reached the target tissue. Thus, the linker-nucleosides are typically attached to each other and to the remainder of the compound via cleavable bonds, hi certain embodiments, such cleavable bonds are phosphodiester bonds.

[0259] Herein, linker-nucleosides are not considered to be components of an oligonucleotide. Thus, in embodiments where a compound comprises an oligonucleotide consisting of a defined number or range of linked nucleosides and / or a defined percentage of complementarity with a reference nucleic acid, and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted towards the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide with respect to the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is greater than 30. Alternatively, a compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker-nucleoside.

[0260] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, compounds containing certain conjugate moieties are better taken up by certain cell types, but it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide once the compound is taken up. Thus, certain conjugates may typically include one or more cleavable moieties within the conjugate linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has 1, 2, 3, 4, or 5 or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0261] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0262] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are attached to each other and / or to the remainder of the compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is attached to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0263] Compositions and methods of formulating pharmaceutical compositions The compounds described herein can be mixed with pharma- ceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The method of formulating the compositions and pharmaceutical compositions depends on a number of criteria, including but not limited to the route of administration, the extent of the disease, or the dose to be administered.

[0264] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of a compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. The composition and the method of formulating the pharmaceutical composition are dependent on a number of criteria, including but not limited to the route of administration, the extent of the disease, or the amount to be administered.

[0265] The compound targeted to APOL1 nucleic acid described herein can be utilized in a pharmaceutical composition by combining the compound with a suitable pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharma-ceutically acceptable diluent is water, e.g., sterile water suitable for injection. Thus, in one embodiment, a pharmaceutical composition comprising a compound targeted to APOL1 nucleic acid and a pharma-ceutically acceptable diluent is used in the methods described herein. In certain embodiments, the pharma-ceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0266] Pharmaceutical compositions comprising the compounds provided herein include any pharma- ceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to an animal, e.g., a human. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of modified oligonucleotides. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of the compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0267] Prodrugs can include the incorporation of additional nucleosides at one or both termini of the compound that are cleaved by endogenous nucleases in the body to form the active compound, hi certain embodiments, the compound or composition further comprises a pharma- ceutically acceptable carrier or diluent.

[0268] Specific Selected Compounds Approximately 1930 newly designed compounds of various lengths, chemical structures, and motifs and a small number of previously disclosed compounds were tested in vitro in several cell types for their effects on human APOL1 mRNA (Example 1). Of the 1930 compounds tested for efficacy in a single dose in vitro, 373 selected compounds were tested in A431 cells for dose-dependent inhibition (Example 2). Of the 373 compounds tested by dose-response assay, 86 oligonucleotides were selected for in vivo efficacy and tolerability in rodents.

[0269] In the in vivo rodent tolerance model, body and organ weights, liver function markers (e.g., alanine transaminase, aspartate transaminase, and bilirubin), blood markers (e.g., HCT, white blood cell count, platelet count, RBC count, MCH, and MCHC), and kidney function markers (e.g., BUN and creatinine) were measured. In the hAPOL1 transgenic mouse model, in vivo reduction of hAPOL1 mRNA was measured.

[0270] ION numbers 793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163 were tested for activity, pharmacokinetic profile, and tolerability in cynomolgus monkeys (Example 9). Treatment with some of the compounds caused a reduction in APOL1 mRNA expression in liver tissue. Specifically, treatment with ION904763 and ION972190, which are cross-reactive with the APOL1 cynomolgus monkey gene sequence, caused a significant reduction in APOL1 mRNA expression in liver tissue compared to the PBS control. It was noted that ION972190 caused the greatest reduction in APOL1 mRNA expression compared to the PBS control. Treatment with the compounds, especially ION972190, was well tolerated in monkeys.

[0271] Thus, provided herein are compounds having any one or more of the improved properties. In certain embodiments, the compounds described herein are potent and well tolerated. EXAMPLES

[0272] The following examples describe screening methods for identifying lead compounds targeted to APOL1. For example, ION793406, 904763, 905469, 905505, 905634, 905665, 972190, and 972163 have demonstrated high efficacy and tolerability. ION972190 has demonstrated high efficacy and tolerability.

[0273] Non-Limiting Disclosure and Incorporation by Reference Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" where appropriate, in practice the sequences may be modified by any combination of chemical modifications. One of skill in the art will readily recognize that such designations of "RNA" or "DNA" to describe modified oligonucleotides are, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH for the natural 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) for the natural uracil of RNA).

[0274] Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those nucleic acids with modified nucleobases. As a further example, and without limitation, an oligonucleotide having the nucleobase sequence "ATCGATCG" encompasses any oligonucleotide having such a nucleobase sequence, whether modified or unmodified, including but not limited to those compounds that contain RNA bases, such as those having the sequence "AUCGAUCG", as well as those that have some DNA bases and some RNA bases, such as "AUCGATCG", as well as compounds with other modified nucleobases, such as "ATmCGAUCG" (mC denotes a cytosine base with a methyl group at the 5-position).

[0275] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), e.g., as α or β for sugar anomers, or as (D) or (L) for amino acids. Compounds provided herein that are depicted or described as having a particular stereochemical configuration include only the compound depicted. Compounds provided herein that are depicted or described as having an unspecified stereochemical configuration include all such possible isomers, e.g., their stereorandom and optically pure forms. Similarly, all tautomers of the compounds provided herein are included unless otherwise indicated. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

[0276] The compounds described herein include variations in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the elements shown.For example, compounds described herein that contain hydrogen atoms include all possible deuterium substitutions for each 1H hydrogen atom.Isotopic substitutions encompassed by compounds described herein include, but are not limited to, 2H or 3H instead of 1H, 13C or 14C instead of 12C, 15N instead of 14N, 17O or 18O instead of 16O, and 33S, 34S, 35S, or 36S instead of 32S.

[0277] While certain compounds, compositions and methods described herein have been described with particularity in accordance with certain embodiments, the following examples serve only to illustrate, but not to limit, the compounds described herein. Each of the references cited in this application is incorporated herein by reference in its entirety.

[0278] Example 1: Antisense inhibition of human APOL1 in A431 cells Antisense oligonucleotides with various chemical motifs targeting APOL1 nucleic acid were designed and tested for their effects on APOL1 mRNA in vitro.

[0279] 3-10-3cEt gapmer The newly designed chimeric antisense oligonucleotides in the table below were designed as 3-10-3 cEt gapmers. The gapmers are 16 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by wing segments on the 5' and 3' directions containing 3 nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a cEt modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

[0280] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below is targeted to either the human APOL1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_003661.3), or the human APOL1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_011520.9, truncated from nucleotides 15986452 to 16001905). "n / a" indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0281] Antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are presented in a separate table below. A431 cells cultured at a density of 10,000 cells per well were transfected with 4,000 nM of antisense oligonucleotides by free uptake. After a treatment period of about 24 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 (forward sequence GCTACTCCTGCTGACTGATAATG, designated herein as SEQ ID NO: 10; reverse sequence AAGGTTGTCCAGAGCTTTACG, designated herein as SEQ ID NO: 11; probe sequence TGCCCAGGAATGAGGCAGATGAG, designated herein as SEQ ID NO: 12) was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells. The oligonucleotides listed in Table 28 were screened in subsequent experiments.

[0282] [Table 1]

[0283] [Table 2]

[0284] [Table 3]

[0285] [Table 4]

[0286] [Table 5]

[0287]

Table 6

[0288]

Table 7

[0289]

Table 8

[0290]

Table 9

[0291]

Table 10

[0292]

Table 11

[0293]

Table 12

[0294]

Table 13

[0295]

Table 14

[0296]

Table 15

[0297]

Table 16

[0298]

Table 17

[0299]

Table 18

[0300]

Table 19

[0301]

Table 20

[0302]

Table 21

[0303]

Table 22

[0304]

Table 23

[0305]

Table 24

[0306]

Table 25

[0307]

Table 26

[0308]

Table 27

[0309]

Table 28

[0310]

Table 29

[0311]

Table 30

[0312]

Table 31

[0313]

Table 32

[0314]

Table 33

[0315]

Table 34

[0316]

Table 35

[0317]

Table 36

[0318]

Table 37

[0319]

Table 38

[0320]

Table 39

[0321]

Table 40

[0322]

Table 41

[0323]

Table 42

[0324]

Table 43

[0325]

Table 44

[0326]

Table 45

[0327]

Table 46

[0328]

Table 47

[0329] [Table 48]

[0330] [Table 49]

[0331] [Table 50]

[0332] [Table 51]

[0333] [Table 52]

[0334] [Table 53]

[0335] [Table 54]

[0336] [Table 55]

[0337] Deoxy, MOE, and cEt gapmers The newly designed chimeric antisense oligonucleotides in the table below were designed as deoxy, MOE, and cEt gapmers. The deoxy, MOE, and cEt oligonucleotides have nucleosides with either MOE sugar modifications, (S)-cEt sugar modifications, or deoxy modifications. The "Chemical Structure" column describes the sugar modification of each oligonucleotide. "k" indicates (S)-cEt sugar modification; "d" indicates deoxyribose; and "e" indicates MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. The sugar motifs of the gapmers are shown in the Chemical Structure column in the table below, where "k" refers to a cEt sugar; "e" refers to a 2'-MOE sugar; "d" refers to a deoxy sugar, and the number after "d" indicates the number of deoxynucleosides.

[0338] "Start site" indicates the 5'-most nucleoside in the human gene sequence to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleoside in the human gene sequence to which the gapmer is targeted. Each gapmer listed in the table below is targeted to either the human APOL1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_003661.3), or the human APOL1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_011520.9, truncated from nucleotides 15986452 to 16001905). "n / a" indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

[0339] Antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are presented in a separate table below. A431 cells cultured at a density of 5,000 cells per well were transfected with 2,000 nM of antisense oligonucleotides by free uptake. After a treatment period of about 24 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as the percentage inhibition of APOL1 relative to untreated control cells.

[0340] [Table 56]

[0341] [Table 57]

[0342] [Table 58]

[0343] [Table 59]

[0344] [Table 60]

[0345] [Table 61]

[0346] [Table 62]

[0347]

Table 63

[0348]

Table 64

[0349]

Table 65

[0350]

Table 66

[0351]

Table 67

[0352]

Table 68

[0353]

Table 69

[0354]

Table 70

[0355]

Table 71

[0356]

Table 72

[0357] [Table 73]

[0358] [Table 74]

[0359] [Table 75]

[0360] Example 2: Dose-dependent antisense inhibition of human APOL1 in A431 cells Gapmers from Example 1 that showed significant in vitro inhibition of APOL1 mRNA were selected and tested at various doses in A431 cells. Antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are presented in a separate table below.

[0361] Cells were plated at a density of 10,000 cells per well and transfected with various concentrations of 3-10-3cEt gapmers by free incorporation, as specified in the table below. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0362] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0363] [Table 76]

[0364]

Table 77

[0365]

Table 78

[0366]

Table 79

[0367]

Table 80

[0368]

Table 81

[0369]

Table 82

[0370]

Table 83

[0371]

Table 84

[0372]

Table 85

[0373]

Table 86

[0374] [Table 87]

[0375] Cells were further plated at a density of 10,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the following table by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set HTS7376 (forward sequence GGCAGCCTTGTACTCTTGGAA, designated herein as SEQ ID NO: 1942; reverse sequence GCTGGTAATCCGGTCAAAG, designated herein as SEQ ID NO: 1943; probe sequence CTGGATGGAGTTGGGAATCACAGCCX, designated herein as SEQ ID NO: 1944) was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0376] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0377] [Table 88]

[0378] [Table 89]

[0379] [Table 90]

[0380] [Table 91]

[0381] In another assay, cells were plated at a density of 10,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the following table by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0382] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0383] [Table 92]

[0384] [Table 93]

[0385] In another assay, cells were plated at a density of 11,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the table below by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0386] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0387] [Table 94]

[0388] In another assay, cells were plated at a density of 10,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the following table by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0389] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0390] [Table 95]

[0391] [Table 96]

[0392] [Table 97]

[0393] [Table 98]

[0394] [Table 99]

[0395] [Table 100]

[0396] [Table 101]

[0397] Example 3: Tolerance of modified oligonucleotides targeting human APOL1 in BALB / c mice BALB / c mice are a versatile mouse model frequently used for safety and efficacy studies. Mice were treated with selected antisense oligonucleotides from the studies described above and assessed for changes in the levels of various plasma chemistry markers.

[0398] process Groups of 6-7 week old male mice were injected subcutaneously once with 200 mg / kg of the modified oligonucleotide. One group of male BALB / c mice was injected with PBS. Mice were sacrificed 72-96 hours after the single dose and plasma was collected for further analysis.

[0399] Test 1 To assess the effect of modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, Calif.). Modified oligonucleotides that caused changes in transaminase levels outside the predicted range for the antisense oligonucleotides were excluded from further testing. Compound ID793406, 903807, 903822, 903853, 904016, 904063, 904082, 904084, 904101, 904212, 904223, 904224, 904226, 904424, 904426, 9044 43, 904444, 904619, 904627, 904628, 904763, 904766, 905031, 905032, 905036, 905095, 905121, 905123, 905139, 905141, 905143, 905146 , 905147, 905269, 905373, 905408, 905418, 905469, 905471, 905491, 905496, 905505, 905510, 905511, 905521, 905581, 905582, 905633, 905634, 905636, 905654, 905655, 905665, 905684, 905688, 905690, 905697, 905700, 905758 and 905867 were deemed tolerable in this study and were selected for further evaluation.

[0400] Test 2 In a second study evaluating the effect of modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, Calif.). Modified oligonucleotides that caused changes in transaminase levels outside the predicted range for antisense oligonucleotides were excluded from further studies. Compound IDs 969157, 969160, 969162, 969210, 969214, 969231, 969318, 969347, 969361, 969362, 969408, 969433, 969437, 969479, 969501, 969502, 971925, 971973, 971997, 972002, 972116, 972139, 972163, 972190, 972268, and 972288 were deemed tolerable in this study and were selected for further evaluation.

[0401] Example 4: Effect of antisense inhibition of hAPOL1 in a transgenic mouse model A transgenic mouse model was generated using fosmid ABC12-49114000M18 digested to produce a 31.6 Kb fragment containing only the APOL1 gene, 5 Kb upstream and 12 Kb downstream of the gene. The gene fragment was inserted by pronuclear injection into eggs from C57BL / 6NTAc mice to generate two founder lines. Line 1 was used for the experiments described herein. Human APOL1 transcripts are detectable primarily in the liver, and hAPOL1 protein is robustly detectable in the plasma of these mice. The efficacy of modified oligonucleotides was evaluated in this model.

[0402] Transgenic mice were maintained on a 12-hour light / dark cycle and fed regular Purina mouse chow ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. Antisense oligonucleotides (ASOs) were prepared in buffered saline (PBS) and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in PBS for injection.

[0403] Test 1 hAPOL1 transgenic mice were divided into groups of 2-4 mice each. The groups received subcutaneous injections of the modified oligonucleotide at a dose of 25 mg / kg, three times per week for one week, for a total of three doses. One group of mice received subcutaneous injections of the control oligonucleotide 549148 (GGCTACTACGCCGTCA, designated as SEQ ID NO: 1948; a 3-10-3cEt gapmer with no known target) at a dose of 25 mg / kg, three times per week for one week, for a total of three doses. One group of mice received subcutaneous injections of PBS, three times per week for one week. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0404] On the seventh day, animals were sacrificed, and RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression. Results are presented as percentage change of mRNA relative to PBS control normalized by RIBOGREEN®. Two separate experiments were performed using similar conditions and presented in separate tables. As shown in the table below, treatment with antisense oligonucleotides resulted in a significant reduction of hAPO1 mRNA compared to PBS control.

[0405] [Table 102]

[0406] [Table 103]

[0407] Test 2 The hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of the modified oligonucleotide at a dose of 25 mg / kg twice a week for one week for a total of three doses. One group of mice received subcutaneous injections of the control oligonucleotide 549148 at a dose of 25 mg / kg three times a week for one week for a total of three doses. One group of mice received subcutaneous injections of PBS three times a week for one week. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0408] On day 7, animals were sacrificed and RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression. Results are presented as percent change in mRNA relative to PBS control normalized by RIBOGREEN®. As shown in the table below, treatment with antisense oligonucleotides resulted in a significant reduction in hAPO1 mRNA compared to PBS control.

[0409] [Table 104]

[0410] Study 3: Effects of antisense inhibition of APOL1 on mice with proteinuria hAPOL1 transgenic mice were divided into groups of 3-4 mice each. The groups received subcutaneous injections of modified oligonucleotide 972190 at 50 mg / kg once a week for 4 weeks. One group of mice received subcutaneous injections of control oligonucleotide 549148 at a dose of 50 mg / kg once a week for 4 weeks. One group of mice received subcutaneous injections of PBS once a week for 4 weeks. A single dose of IFNγ was administered at 1.125×107 U / kg 1 day after the last oligonucleotide administration to induce proteinuria in the mice. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0411] Urine was collected and animals were sacrificed 48 hours after IFNγ administration. RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression measurement. Results are presented as percent change in mRNA relative to PBS control normalized by RIBOGREEN®. As shown in the table below, treatment with antisense oligonucleotides resulted in a significant reduction in hAPO1 mRNA compared to PBS control. As also shown in the table below, treatment with 972190 resulted in a significant reduction in urinary albumin and plasma ALT levels compared to control animals administered IFNγ. The results show that treatment with modified oligonucleotides targeting APOL1 protected APOL1 transgenic mice from proteinuria and reduced the elevation of plasma ALT levels.

[0412] [Table 105]

[0413] [Table 106]

[0414] Example 5: Tolerance of modified oligonucleotides targeted to hAPOL1 in CD1 mice CD1® mice (Charles River, MA) are a versatile mouse model frequently used for safety and efficacy studies. Mice were treated with selected 3-10-3cEt gapmer oligonucleotides from the studies described above and assessed for changes in the levels of various plasma chemistry markers.

[0415] process Groups of 7-8 week old male CD1 mice were subcutaneously injected twice weekly for 6 weeks with 25 mg / kg ISIS oligonucleotide (at a dose of 50 mg / kg / week). One group of male CD1 mice was subcutaneously injected twice weekly for 6 weeks with PBS. Mice were sacrificed 48 hours after the last dose and organs and plasma were collected for further analysis. Two separate studies were performed using similar conditions and the respective end point analyses are presented in separate tables.

[0416] Test 1 Plasma Chemistry Markers To evaluate the effect of ISIS oligonucleotide on liver function and kidney function, use an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA) to measure the plasma levels of transaminases, albumin, bilirubin, creatinine and BUN.The results are shown in the following table.ISIS oligonucleotides that cause changes in the levels of either liver function or kidney function markers outside the predicted range for antisense oligonucleotides are excluded from further testing.

[0417] [Table 107]

[0418] Blood Assays The blood from all mouse groups was sent to IDEXX BioResearch for hematocrit (HCT) measurement and analysis, and for the measurement of various blood cells, such as WBC, RBC, lymphocytes, monocytes and platelets.The results are shown in the following table.The ISIS oligonucleotides that caused the changes in the levels of any blood markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0419] [Table 108]

[0420] Test 2 Plasma Chemistry Markers To evaluate the effect of ISIS oligonucleotide on liver function and kidney function, use an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) to measure the plasma levels of transaminases, bilirubin, creatinine and BUN.The results are shown in the following table.The ISIS oligonucleotide that causes changes in the levels of either liver function or kidney function markers outside the predicted range for antisense oligonucleotide is excluded from further testing.

[0421] [Table 109]

[0422] Blood Assays The blood from all mouse groups was sent to IDEXX BioResearch for hematocrit (HCT) measurement and analysis, and for the measurement of various blood cells, such as WBC, RBC, lymphocytes, monocytes and platelets.The results are shown in the following table.The ISIS oligonucleotides that caused the changes in the levels of any blood markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0423] [Table 110]

[0424] Test 3 Body and organ weights To evaluate the effect of ISIS oligonucleotide on animal health, body weight and organ weight are measured at the end of the test.Results are shown in the following table.ISIS oligonucleotide that causes any level of weight change outside the expected range for antisense oligonucleotide is excluded from further test.

[0425] [Table 111]

[0426] Plasma Chemistry Markers To evaluate the effect of ISIS oligonucleotide on liver function and kidney function, use an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA) to measure the plasma levels of transaminases, albumin, bilirubin, creatinine and BUN.The results are shown in the following table.ISIS oligonucleotides that cause changes in the levels of either liver function or kidney function markers outside the predicted range for antisense oligonucleotides are excluded from further testing.

[0427] [Table 112]

[0428] Blood Assays The blood from all mouse groups was sent to IDEXX BioResearch for hematocrit (HCT) measurement and analysis, and for the measurement of various blood cells, such as WBC, RBC, lymphocytes, monocytes and platelets.The results are shown in the following table.The ISIS oligonucleotides that caused the changes in the levels of any blood markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0429] [Table 113]

[0430] Example 6: Tolerance of modified oligonucleotides targeted to hAPOL1 in Sprague-Dawley rats The Sprague-Dawley rat is a versatile model used for safety and efficacy evaluation. Rats were treated with the 3-10-3cEt gapmer oligonucleotide from the study described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

[0431] process Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina normal rat chow 5001 ad libitum. Groups of four Sprague-Dawley rats each were subcutaneously injected once a week for six weeks with 50 mg / kg of ISIS oligonucleotide. 48 hours after the last dose, the rats were sacrificed and organs and plasma were harvested for further analysis. Two separate studies were performed using similar conditions.

[0432] Test 1 Liver function To evaluate the effect of ISIS oligonucleotide on liver function, the plasma levels of transaminases are measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) are measured, and the results are presented in the following table, expressed in IU / L. The ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0433] [Table 114]

[0434] renal function To evaluate the effect of ISIS oligonucleotide on renal function, blood urinary nitrogen (BUN) and creatinine plasma levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in the following table and expressed in mg / dL. ISIS oligonucleotides that caused changes in the levels of any of the renal function markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0435] [Table 115]

[0436] Blood Assays The blood from all rat groups was sent to Antech Diagnostics for hematocrit (HCT) measurement and analysis, and for measurement of various blood cells, such as WBC, RBC and total hemoglobin content.The results are shown in the following table.The ISIS oligonucleotide that caused any change in the level of blood markers outside the predicted range for antisense oligonucleotide was excluded from further testing.

[0437] [Table 116]

[0438] [Table 117]

[0439] Organ weight Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

[0440] [Table 118]

[0441] Test 2 Liver function To evaluate the effect of ISIS oligonucleotide on liver function, the plasma levels of transaminases are measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) are measured, and the results are presented in the following table, expressed in IU / L. The ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0442] [Table 119]

[0443] renal function To evaluate the effect of ISIS oligonucleotide on renal function, blood urinary nitrogen (BUN) and creatinine plasma levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in the following table and expressed in mg / dL. ISIS oligonucleotides that caused changes in the levels of any of the renal function markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0444] [Table 120]

[0445] Blood Assays The blood from all rat groups was sent to Antech Diagnostics for hematocrit (HCT) measurement and analysis, and measurement of various blood cells such as WBC, RBC, and total hemoglobin content.The results are presented in the following table.ISIS oligonucleotides that caused changes in the levels of any blood markers outside the predicted range for antisense oligonucleotides were excluded from further testing.nd indicates that the parameter was not measured for that particular oligonucleotide.

[0446] [Table 121]

[0447] Organ weight Liver, spleen and kidney weights were measured at the end of the study and are presented in the table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

[0448] [Table 122]

[0449] Test 3 Liver function To evaluate the effect of ISIS oligonucleotide on liver function, the plasma levels of transaminases are measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) are measured, and the results are presented in the following table, expressed in IU / L. The ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0450] [Table 123]

[0451] renal function To evaluate the effect of ISIS oligonucleotide on renal function, blood urinary nitrogen (BUN) and creatinine plasma levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are shown in the following table and expressed in mg / dL. ISIS oligonucleotides that caused changes in the levels of any of the renal function markers outside the predicted range for antisense oligonucleotides were excluded from further testing.

[0452] [Table 124]

[0453] [Table 125]

[0454] Blood Assays The blood from all rat groups was sent to Antech Diagnostics for hematocrit (HCT) measurement and analysis, and measurement of various blood cells such as WBC, RBC, and total hemoglobin content.The results are presented in the following table.ISIS oligonucleotides that caused changes in the levels of any blood markers outside the predicted range for antisense oligonucleotides were excluded from further testing.nd indicates that the parameter was not measured for that particular oligonucleotide.

[0455] [Table 126]

[0456] Organ weight Liver, spleen and kidney weights, as well as body weight, were measured at the end of the study and are presented in the table below. ISIS oligonucleotides that caused any changes in weight outside the expected range for antisense oligonucleotides were excluded from further studies.

[0457] [Table 127]

[0458] Example 7: Dose-dependent inhibition of hAPOL1 in a transgenic mouse model The transgenic hAPOL1 mice were maintained on a 12-hour light / dark cycle and fed a normal Purina mouse diet ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. Antisense oligonucleotides (ASOs) were prepared in buffered saline (PBS) and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0459] Test 1 hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of 3-10-3cEt gapmer at doses of 5, 15, or 50 mg / kg as shown in the table below, once per week for 4 weeks for a total of 4 doses. One group of mice received subcutaneous injections of PBS once per week for 4 weeks. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0460] RNA analysis Mice were sacrificed 48 hours after the last administration, and RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression measurement. Results are presented as percentage change of mRNA relative to PBS control normalized by RIBOGREEN®. Two separate experiments were performed using similar conditions and presented in separate tables. As shown in the table below, treatment with antisense oligonucleotides resulted in significant reduction of hAPO1 mRNA compared to PBS control.

[0461] [Table 128]

[0462] [Table 129]

[0463] Test 2 hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of 3-10-3cEt gapmer at doses of 5, 15, or 50 mg / kg as shown in the table below, once per week for 4 weeks for a total of 4 doses. One group of mice received subcutaneous injections of PBS once per week for 4 weeks. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0464] RNA analysis Mice were sacrificed 48 hours after the last administration, and RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression measurement. Results are presented as percentage change of mRNA relative to PBS control normalized by RIBOGREEN®. Two separate experiments were performed using similar conditions and presented in separate tables. As shown in the table below, treatment with antisense oligonucleotides resulted in significant reduction of hAPO1 mRNA compared to PBS control.

[0465] [Table 130]

[0466] [Table 131]

[0467] Test 3 hAPOL1 transgenic mice were divided into groups of 4 mice each. The groups received subcutaneous injections of modified oligonucleotides at doses of 1.5, 5, 15, or 50 mg / kg as shown in the table below, once per week for 4 weeks, for a total of 4 doses. One group of mice received subcutaneous injections of PBS once per week for 4 weeks. The saline-injected group served as a control group to compare the oligonucleotide-treated groups.

[0468] RNA analysis Mice were sacrificed 48 hours after the last administration, and RNA was extracted from kidney and liver for real-time PCR analysis of hAPOL1 mRNA expression measurement. Results are presented as percentage change of mRNA relative to PBS control normalized by RIBOGREEN®. As shown in the table below, treatment with antisense oligonucleotides results in significant reduction of hAPO1 mRNA compared to PBS control.

[0469] [Table 132]

[0470] [Table 133]

[0471] Example 8: Confirmation of dose-dependent antisense inhibition of human lead compounds targeting APOL1 in A431 cells Selected gapmers from the above studies were tested at various doses in A431 cells.

[0472] Test 1 Cells were plated at a density of 10,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the following table by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0473] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0474] [Table 134]

[0475] Test 2 Cells were plated at a density of 10,000 cells per well and transfected with various concentrations of antisense oligonucleotides as specified in the following table by free uptake. After a treatment period of about 16 hours, RNA was isolated from the cells and APOL1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS35962 was used to measure mRNA levels. APOL1 mRNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are presented as percent inhibition of APOL1 relative to untreated control cells.

[0476] The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. APOL1 mRNA levels were significantly reduced in antisense oligonucleotide-treated cells in a dose-dependent manner.

[0477] [Table 135]

[0478] Example 9: Effect of ISIS antisense oligonucleotides targeting human APOL1 in cynomolgus monkeys Cynomolgus monkeys are treated with the ISIS antisense oligonucleotides selected from the study described in the above example.The efficacy and tolerability of antisense oligonucleotides and their pharmacokinetic profile in liver and kidney are evaluated.Cynomolgus monkeys are reported to have APOL1 pseudogene.

[0479] The human antisense oligonucleotides tested are cross-reactive with the cynomolgus genomic sequence (the complement of GENBANK Accession No. NC_022281.1 truncated from nucleotide 15021761 to 15036414, designated as SEQ ID NO: 1949). The greater the complementarity between the human oligonucleotide and the cynomolgus sequence, the greater the likelihood that the human oligonucleotide will be able to cross-react with the cynomolgus sequence. The start and end sites of each oligonucleotide relative to SEQ ID NO: 1949 are provided in the table below. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the cynomolgus gene sequence. "Mismatch" indicates the number of nucleobases of the human oligonucleotide that mismatch with the cynomolgus gene sequence along its length.

[0480] [Table 136]

[0481] process Prior to the study, the monkeys were housed in isolation, during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Eight randomly assigned groups of four male cynomolgus monkeys each were administered 30 mg / kg of the modified oligonucleotide or PBS once a week for 12 weeks. One group of monkeys received a saline dose once a week for 12 weeks. The saline-injected group served as a control group to which the oligonucleotide-treated groups were compared. Approximately 48 hours after the last dose, the monkeys were sacrificed and tissues were collected for analysis.

[0482] Tolerability assessment was based on clinical observations, body weight, food consumption, and clinical pathology. A complete necropsy was performed and any gross abnormalities were recorded. A terminal necropsy was performed on day 85. Organ weights were measured. In addition, blood, CSF, and tissues (at necropsy) were collected for toxicokinetic evaluation. The protocol described in this example was approved by the Institutional Animal Care and Use Committee (IACUC).

[0483] Targeted Reduction RNA analysis RNA was extracted from liver for real-time PCR analysis of cynomolgus APOL1 mRNA expression. RTS35787 (forward sequence: CTCCTGCTGAGTGACCATAAAG (SEQ ID NO: 1945); reverse sequence: GGACTTCTTCGAGCCAGTTT (SEQ ID NO: 1946); probe sequence: AGAGTGGTGGCACTGCTGAACTG (SEQ ID NO: 1947)) was used to detect cynomolgus APOL1. Results are presented as percent change in mRNA relative to saline control normalized by monkey cyclophilin A. As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of cynomolgus APOL1 mRNA for some oligonucleotides compared to PBS control.

[0484] [Table 137]

[0485] Tolerability study Body and organ weight measurements To evaluate the effect of ISIS oligonucleotides on the general health of animals, body weight and organ weight were measured. Body weight was measured on day 84 and is shown in the table below. After sacrifice, organ weight was measured and the data is also shown in the table below. The results show that the effect of antisense oligonucleotide treatment on body weight and organ weight was within the expected range for antisense oligonucleotides. In particular, ISIS 972190 treatment was well tolerated in terms of monkey body weight and organ weight.

[0486] [Table 138]

[0487] Liver function To evaluate the effect of ISIS oligonucleotides on liver function, blood samples were collected from all test groups. Blood samples were collected 48 hours after administration via femoral vein puncture. Monkeys were fasted overnight before blood collection. Blood was collected in tubes containing K2-EDTA anticoagulant and centrifuged to obtain plasma. The levels of various liver function markers were measured using a Toshiba 200FR NEO chemical analyzer (Toshiba Corporation, Japan). Plasma levels of ALT and AST were measured, and the results are presented in the table below and expressed in IU / L. The liver function marker bilirubin was similarly measured, and the results are presented in the table below and expressed in mg / dL. The results show that antisense oligonucleotides did not have an effect on liver function outside the expected range for antisense oligonucleotides. In particular, treatment with ISIS 972190 was well tolerated with respect to liver function in monkeys.

[0488] [Table 139]

[0489] renal function To evaluate the effect of ISIS oligonucleotides on renal function, blood samples were collected from all test groups. Blood samples were collected 48 hours after administration via femoral vein puncture. Monkeys were fasted overnight before blood collection. Blood was collected in tubes containing K2-EDTA anticoagulant and centrifuged to obtain plasma. BUN and creatinine levels were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Corporation, Japan). They are presented in the table below and expressed in mg / dL.

[0490] Urinalysis was also performed before slaughter using a COBAS U411 analyzer, Combur 10 Test M urine stick (Roche, Germany), and a Toshiba 120 FR automated chemistry analyzer (Toshiba Corporation, Japan). Urine was tested for potassium (UK), microprotein (UTP), creatinine (UCRE), albumin (UALB), chloride (Ca), sodium (Na) and protein / creatinine ratios were calculated (P / C). The results are presented in the table below.

[0491] Plasma and urine chemistry data indicate that most of the ISIS oligonucleotides did not have any effects on renal function outside the range expected for antisense oligonucleotides. In particular, treatment with ISIS 972190 was well tolerated with respect to renal function in monkeys.

[0492] [Table 140]

[0493] [Table 141]

[0494] Blood tests To evaluate any effect of ISIS oligonucleotides on blood parameters in cynomolgus monkeys, blood samples of about 1.3mL of blood are collected from each available test animal in tubes containing K2-EDTA.Using ADVIA120 hematology analyzer (Bayer, USA), samples are analyzed for red blood cell (RBC) count, white blood cell (WBC) count, individual white blood cell counts such as monocytes, neutrophils, lymphocytes, as well as platelet count, hemoglobin content and hematocrit.Data are presented in the following table.

[0495] The data show that the oligonucleotides did not cause any changes in blood parameters outside the expected range for antisense oligonucleotides at this dose. In particular, treatment with ISIS 972190 was well tolerated with respect to the blood parameters of the monkeys.

[0496] [Table 142]

[0497] [Table 143]

[0498] C-reactive protein and C3 activation To evaluate any inflammatory effects of ISIS oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. Monkeys were fasted overnight before blood collection. Approximately 1.5 mL of blood was collected from each animal and placed in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for at least 90 minutes, and then centrifuged at room temperature for 10 minutes at 3,000 rpm to obtain serum. C3 levels were measured to evaluate any complement activation resulting from oligonucleotide treatment. A Toshiba 200FR NEO chemical analyzer (Toshiba Corporation, Japan) was used to measure C-reactive protein (CRP), which is synthesized in the liver and serves as a marker of inflammation. The results show that treatment with ISIS972190 did not cause any inflammation in monkeys.

[0499] [Table 144]

[0500] Oligonucleotide concentration analysis Quantitative analysis of the concentration of each antisense oligonucleotide in different organs was performed. Most of the oligonucleotides had acceptable pharmacokinetic profiles in the liver and kidney.

[0501] [Table 145]

[0502] Taken together, the results of the study indicate that ISIS 972190 is the most potent and well-tolerated compound tested for inhibition of APOL1 and is an important candidate for the treatment of APOL1-related diseases.

Claims

1. 1. A compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1164, or a pharmaceutically acceptable salt thereof.

2. The compound of claim 1 , wherein the modified oligonucleotide comprises at least one modified sugar, and / or at least one modified internucleoside linkage, and / or at least one modified nucleobase.

3. 3. The compound of claim 2, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

4. 4. The compound of claim 3, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

5. The compound of claim 2 , wherein at least one modified sugar is a bicyclic sugar.

6. The bicyclic sugar is 4'-CH ２ -O-2' group or 4'-CH(CH ３ )-O-2' group or 4'-(CH ２ ) ２ The compound of claim 5, comprising an -O-2' group.

7. At least one modified sugar is 2'-O(CH ２ )-OCH ３ group or 2'-O-CH ３ The compound of claim 2 comprising a group.

8. 3. The compound of claim 2, wherein at least one modified nucleobase is 5-methylcytosine.

9. 9. The compound of claim 8, wherein each cytosine is a 5-methylcytosine.

10. 3. The compound of claim 2, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, at least one modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl sugar, and at least one modified nucleobase is 5-methylcytosine.

11. the modified oligonucleotide is a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and 3' wing segment consisting of linked nucleosides Including, 2. The compound of claim 1, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

12. 12. The compound of claim 11, wherein each wing segment comprises 2 to 5 nucleosides and the gap segment comprises 7 to 10 nucleosides.

13. 2. The compound of claim 1, wherein the pharmaceutically acceptable salt is a sodium salt.

14. 2. The compound of claim 1, wherein the pharmaceutically acceptable salt is a potassium salt.

15. A pharmaceutical composition comprising a compound according to any one of claims 1 to 14 and a pharmaceutically acceptable carrier.

16. 15. Use of a compound according to any one of claims 1 to 14 for the manufacture of a pharmaceutical composition for inhibiting the expression of APOL1 in a cell, wherein the expression of APOL1 in the cell is inhibited by contacting the cell with the pharmaceutical composition.

17. 17. The use according to claim 16, wherein the cells are kidney cells of an individual.

18. A pharmaceutical composition for treating, preventing or ameliorating a disease associated with APOL1, comprising a compound according to any one of claims 1 to 14 and a pharmaceutically acceptable carrier.

19. 19. The pharmaceutical composition of claim 18, wherein the disease is one of focal segmental glomerulosclerosis (FSGS), collapsing nephropathy, CKD, nephropathy due to hypertension, HIV-associated nephropathy, sickle cell nephropathy, arteriosclerosis, lupus nephritis, ESKD, and other forms of APOL1-associated proteinuric disease.

Images