Method for suppressing expression of TRPC6

Abstract

To provide a staple nucleic acid to TRPC6 gene.SOLUTION: Provided herein is an inhibitor of the expression of TRPC6 protein comprising a staple nucleic acid against the TRPC6 gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for specifically suppressing the expression of TRPC6 protein using a staple nucleic acid. [Background technology]

[0002] Heart failure is a condition in which the heart's pumping function is impaired and the necessary amount of blood circulation cannot be ensured. When the myocardium becomes enlarged (cardiac hypertrophy) due to high blood pressure, the heart begins to malfunction, resulting in heart failure. Drugs that suppress the influx of Ca2+ into cells are currently on the market as existing drugs to suppress heart failure and cardiac hypertrophy. Ca2+ influx inhibition targets TRPC channels, but previous drugs were not selective and inhibited multiple TRPCs.

[0003] It has been found that the increased expression of TRPC6 (Transient receptor potential cation channel, subfamily C, member 6) correlates with the increased expression of hypertrophy marker molecules in pressure overloaded mice and in patients with heart failure (Non-Patent Document 1: Proc Natl Acad Sci USA., 2010, 107, 7000-5), suggesting that TRPC6 is involved in heart disease. Therefore, it is important to specifically inhibit TRPC6 in order to inhibit cardiac hypertrophy.

[0004] In addition, it has been found that both mice with the TRPC6 gene knocked out (TRPC6- / - mice) and mice pretreated with the TRPC6 inhibitor SAR7334 are protected from airway inflammatory responses induced by ozone (O3) (Non-Patent Document 2: Chen et al., Cell Death and Disease (2020) 11:170), suggesting that TRPC6 is involved in airway inflammation and other diseases.

[0005] Ca2+ channels, which allow calcium ions (Ca2+) to flow in from outside the cell, are classified into ligand-gated, voltage-gated, and receptor-activated types. While drug discovery targeting the former two has progressed, drug development for the receptor-activated TRP channel has not been sufficient. SK&F96365 (Cosmo Bio Co., Ltd.) and LOE908 (Fujifilm Wako Pure Chemical Co., Ltd.), which have been reported as receptor-activated calcium influx inhibitors, have contributed greatly to the elucidation of their functions and the development of research, but their IC50 value was 10 μM, which was a high effective concentration, making it difficult to specifically inhibit TRPC6. In addition, 2-APB, which was identified as an inhibitor of the inositol triphosphate (IP3) receptor, was also used as an inhibitor of the TRP channel at a certain concentration range, but it was also difficult to specifically inhibit TRPC6. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Proc Natl Acad Sci USA., 2010, 107, 7000-5 [Non-Patent Document 2] Chen et al. Cell Death and Disease (2020) 11:170 Summary of the Invention [Problem to be solved by the invention]

[0007] Under these circumstances, if a novel and specific TRPC6 antagonist were developed, it would not only elucidate the mechanism of TRPC channel activation and contribute to further academic advances, but it would also be highly likely to serve as a novel preventive and therapeutic drug for diseases caused by TRPC6 expression. Therefore, there is a need to develop a novel method for selectively inhibiting TRPC6.

[0008] Means for Solving the Problems The present inventors have conducted intensive studies to solve the above problems, and as a result, have succeeded in specifically suppressing TRPC6 using Staple nucleic acid technology, thereby completing the present invention. [Means for solving the problem]

[0009] That is, the present invention is as follows. (1) An agent for inhibiting the expression of TRPC6 protein, comprising a staple nucleic acid against the TRPC6 gene. (2) The expression inhibitor according to (1), wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:2. (3) A pharmaceutical composition for a disease caused by expression of TRPC6, comprising a staple nucleic acid for the TRPC6 gene. (4) A pharmaceutical composition for a disease caused by expression of TRPC6, comprising a vector having a staple nucleic acid for the TRPC6 gene. (5) The pharmaceutical composition according to (3) or (4), wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:2. (6) The pharmaceutical composition according to any one of (3) to (5), wherein the disease caused by expression of TRPC6 is a heart disease. (7) The pharmaceutical composition according to (6), wherein the heart disease is heart failure. (8) The pharmaceutical composition according to (7), wherein the heart failure is caused by myocardial hypertrophy. (9) The pharmaceutical composition according to (7), wherein the heart failure is caused by pulmonary arterial hypertension. (10) The pharmaceutical composition according to (4), wherein the vector is an adeno-associated virus. (11) The pharmaceutical composition according to any one of (3) to (10) above, for use in gene therapy. (12) A method for inhibiting expression of a TRPC6 protein, comprising the step of forming a guanine quadruplex structure using at least four guanine repeat sequences selected from the group consisting of guanine repeat sequences consisting of a three-base sequence represented by "GGG" and a guanine repeat sequence consisting of a four-base sequence represented by "GNGG" (N represents A, G, C, or U) from the base sequence of the TRPC6 gene, and a staple nucleic acid that hybridizes to a region adjacent to the guanine repeat sequences, thereby inhibiting expression of the TRPC6 gene. (13) A staple nucleic acid for the TRPC6 gene, comprising the base sequence shown in SEQ ID NO:2. (14) A kit for treating a disease caused by expression of TRPC6, comprising the composition according to any one of (3) to (11). (15) A kit for inhibiting expression of TRPC6 protein, comprising a staple nucleic acid for the TRPC6 gene. (16) The kit according to (15), wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:2. Effect of the Invention

[0010] INDUSTRIAL APPLICABILITY The present invention makes it possible to specifically inhibit the expression of TRPC6, and is useful for the development of therapeutic agents for diseases caused by the expression of TRPC6 (such as heart disease). [Brief description of the drawings]

[0011] [Figure 1] Schematic diagram of a G-quadruplex. [Diagram 2] FIG. 1 shows the guanine consecutive regions involved in G4 formation and the binding regions of Staple nucleic acid in RNA encoding wild-type TRPC6. [Diagram 3] FIG. 1 shows an AAV6 viral vector expressing a Staple nucleic acid. [Figure 4] FIG. 1 shows the results of evaluating the infectivity of AAV6 viral vectors. [Diagram 5]FIG. 1 shows the results of Western blotting (in vivo, mouse, heart). [Figure 6] FIG. 1 shows the results of Western blotting (in vivo, mouse, liver). [Figure 7] FIG. 1 shows the results of Western blotting (in vivo, mouse, kidney). [Figure 8] This is a diagram showing the results of proteome analysis. Red indicates that the expression level has increased by 10 times, and blue indicates that it has decreased by 1 / 10. The genes listed here were hits on the off-target effect prediction site "gggenome," but the genes listed here were not included in the evaluation. [Figure 9] FIG. 1 shows the results of toxicity evaluation by blood test. [Figure 10] FIG. 1 shows the experimental schedule for the TAC method. [Figure 11] 1 shows the effect of suppressing TRPC6 expression by administration of staple nucleic acid, and the expression level of the target protein was evaluated after 14 days and 42 days. [Figure 12] FIG. 1 shows the results of echocardiography. [Figure 13] FIG. 1 shows the results of evaluating the therapeutic effect of Staple nucleic acids on cardiac hypertrophy. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention relates to a method for suppressing protein expression in TRPC6 RNA having at least four guanine repeat sequences by bringing the guanine repeat sequences closer together to form a G-quadruplex structure using an oligomer that hybridizes to a region adjacent to the guanine repeat sequences.

[0013] The present inventors have used a nucleic acid called Staple nucleic acid to perform a functional evaluation targeting the gene encoding TRPC6. In the existing gene expression suppression method (siRNA method), three siRNAs were administered, and only about 50% of gene expression suppression ability was confirmed at the cell experiment level. On the other hand, in an animal individual level study, a single Staple nucleic acid was administered to a mouse infected with adeno-associated virus (AAV) 6, and a gene expression suppression effect of about 70% was successfully confirmed. Considering that gene expression suppression at the animal level is generally considered to be more difficult than cell level study, the present invention can be said to be a very effective and versatile technology.

[0014] It is known that stable G-quadruplex structures (G-quadruplex structures, also known simply as "G4") present on mRNA inhibit the peptide elongation reaction of ribosomes. If it is possible to artificially induce G-quadruplex structures on any mRNA, it will be possible to suppress the expression of disease-related proteins. The present invention provides a novel nucleic acid drug that selectively captures and folds the target TRPC6 RNA in a sequence-selective manner, thereby inducing a stable G-quadruplex structure on the target RNA, thereby selectively inhibiting the translation of TRPC6 protein.

[0015] The oligomer used in the present invention can be designed such that the nucleic acid of a part of a region on one end (one end region) and the nucleic acid of a part of a region on the other end (other end region) hybridize to the nucleic acid of the region between the kth (k represents an integer of 1 or more) G sequence and the k+1th G sequence, and the nucleic acid of another region other than the region, in n guanine repeat sequences (also called G sequence, n represents an integer of 4 or more) contained in TRPC6 RNA, respectively, or to the nucleic acid of the adjacent region adjacent to the kth sequence and the nucleic acid of the adjacent region adjacent to the kth sequence in the region between the kth G sequence and the k+1th G sequence (details will be described later). This oligomer is also called "staple nucleic acid" in the present invention. For an overview and production method of the Staple nucleic acid used in the present invention, please refer to WO2020 / 85510.

[0016] In the present invention, in order for the Staple nucleic acid of the present invention to function in cells, it is necessary to simultaneously satisfy the nucleic acid sequence recognition ability and the G-quadruplex structure formation ability, and target selectivity surpassing that of conventional nucleic acid drugs can be realized. The usefulness of the Staple nucleic acid of the present invention was verified using a model sequence, and it was demonstrated that (1) an RNA G-quadruplex is constructed by introducing the Staple nucleic acid regardless of the length or sequence of the guanine repeat region, and (2) the induced G-quadruplex structure inhibits the elongation reaction of reverse transcriptase and the protein translation reaction of ribosomes. It was also confirmed that the guanine cluster present in the 5'UTR of TRPC6 mRNA can be folded to inhibit protein synthesis.

[0017] In the present invention, we focused on the RNA G-quadruplex structure, which is an RNA quadruplex structure, as a mechanism for protein translation inhibition (Figure 1(a)). The RNA G-quadruplex structure is a stable RNA higher-order structure that is constructed when a guanine repeat sequence consisting of a three-base sequence represented by "GGG" or a guanine repeat sequence consisting of a four-base sequence represented by "GNGG" (N represents any of A, G, C, or U) is present at four or more locations with an adjacent spacing of seven bases or less (Figure 1(b)). When four guanine repeat regions are adjacent to each other, a G-quadruplex structure is formed (Figure 1a). When this RNA G-quadruplex structure is present in the 5' untranslated region (5'UTR) of mRNA, it inhibits the TRPC6 protein synthesis reaction of the ribosome (Figure 1(c)). In the present invention, inhibition of TRPC6 protein expression includes, for example, inhibition of reverse transcription reaction from mRNA, inhibition of translation reaction from RNA to protein, and the like.

[0018] Here, the target gene in the present invention is a gene (also called TRPC6 gene) encoding TRPC6 (Transient receptor potential cation channel, subfamily C, member 6). It may originate from human, mouse, or rat. Genetic information for TRPC6 is publicly known, and any gene that is classified as TRPC6 and encodes a protein having TRPC6 activity can be the target. Here, in the present specification, genes include RNA such as mRNA. For example, for human TRPC mRNA, the full-length or partial sequence of GenBank accession number AF080394.2 can be referenced, and for mouse TRPC mRNA, the full-length or partial sequence of accession number BC067391.1 can be referenced. Sequence information for orthologs of rat, dog, pig, monkey, etc. can also be referenced at the following GenBank URL. https: / / www.ncbi.nlm.nih.gov / gene / 7225 / ortholog / ?scope=40674&term=TRPC6

[0019] Furthermore, RNA that hybridizes under stringent conditions with a sequence complementary to the above base sequence and encodes a protein having TRPC6 activity, or RNA that has at least 80%, 90%, 95%, 97%, 98%, or 99% sequence identity with the above base sequence and encodes a protein having TRPC6 activity, can also be targeted.

[0020] "Stringent conditions" may be low stringent conditions, medium stringent conditions, or high stringent conditions. "Low stringent conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Medium stringent conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C. "High stringent conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 50°C.

[0021] The staple nucleic acid may be DNA, RNA, or a mixture thereof. The length of the staple nucleic acid is 26 to 40 nucleotides. The length of the region where the staple nucleic acid hybridizes to RNA is not limited, and the length of the one-end region and the other-end region may be the same or different. The staple nucleic acid can be easily obtained by using a commercially available nucleic acid synthesizer. In addition to the above-mentioned Staple nucleic acids, Staple nucleic acids that have been subjected to commonly used chemical modifications can also be used in the present invention.

[0022] The region where the staple nucleic acid hybridizes with the RNA can be appropriately designed depending on the type of RNA. The guanine repeat sequence contained in the target TRPC6 RNA and the region where the staple nucleic acid hybridizes are shown in Figure 2. Figure 2 shows the RNA encoding wild-type mouse TRPC6 (Trpc6_WT RNA, SEQ ID NO: 1), in which the bases within the box are the guanine consecutive regions involved in G4 formation, and the underlined region is the staple nucleic acid binding region. In the sequence of Trpc6_WT RNA in Figure 2, of the five consecutive guanine sequences (i.e., three "GGG" sequences, a "GGGG" sequence, and a "GUGG" sequence), four consecutive guanine sequences are used to form a G-quadruplex structure. In the present invention, a predetermined oligomer (staple nucleic acid) is used to bring the four guanine repeat regions present on the RNA closer together.

[0023] In Fig. 2, if the five consecutive guanine sequences are, from the upstream, the first guanine repeat sequence (referred to as the first G sequence), the second guanine repeat sequence (referred to as the second G sequence), the third guanine repeat sequence (referred to as the third G sequence), the fourth guanine repeat sequence (referred to as the fourth G sequence), and the fifth guanine repeat sequence (referred to as the fifth G sequence), a region of 13 to 20 bases is selected as the hybridizing region from a region of 13 to 20 bases downstream of the second G sequence, and a region of 13 to 20 bases is selected as the hybridizing region from a region of 13 to 20 bases upstream of the third G sequence. The same applies when designing staple nucleic acids for other regions.

[0024] That is, in the embodiment shown in Figure 2, the Staple nucleic acid of the present invention hybridizes to the region adjacent to the second G sequence (GGGG) and the region adjacent to the third G sequence (GUGG). The base sequence of the Staple nucleic acid (DNA) shown in Figure 2 is shown in SEQ ID NO: 2. The bases within the double-lined frame are the region to which the fluorescent primer (SEQ ID NO: 3) hybridizes.

[0025] The reaction between the staple nucleic acid designed as above and RNA, i.e., the reaction to form a G-quadruplex structure, can be carried out, for example, by mixing the staple nucleic acid in a solution containing RNA and annealing it. Alternatively, the staple nucleic acid may simply be mixed in a solution containing RNA. Alternatively, the reaction can be carried out by introducing a short hairpin expression vector and expressing the staple nucleic acid from within a cell. The reaction time between the RNA and the staple nucleic acid is, for example, 1 minute (test tube experiment) to 2 days (cell experiment), and the reaction temperature is, for example, 24 to 55°C. The formation of the G-quadruplex structure can be confirmed by an in vitro translation assay, a fluorescent signal measurement method by reacting with thioflavin T, a stop assay method, or the like.

[0026] The staple nucleic acid of the present invention can be used by linking it to an appropriate vector, which may be any vector such as a plasmid vector or a viral vector.

[0027] "Vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operatively linked to a nucleotide sequence to be expressed, and is preferably an expression vector. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all vectors known in the art, such as cosmids, plasmids, and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0028] According to one embodiment of the present invention, the viral vector is an adeno-associated viral (AAV) vector.The adeno-associated viral (AAV) vector is a useful gene delivery tool for treating various disorders.The expression of the gene contained in the AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter and delivery method.

[0029] In one embodiment of the invention, the expression vector may include regulatory sequences, in particular promoter sequences. Such promoters may be natural or synthetic, and may be inducible or constitutive. In one embodiment, the vector of the present invention may have a β-actin promoter, a CMV promoter, or the like.

[0030] The staple nucleic acid designed by the method of the present invention, or a vector having the nucleic acid, is used to suppress the expression of TRPC6, and therefore can be included in a TRPC6 expression suppression kit. Therefore, the present invention provides a TRPC6 expression suppression kit including the staple nucleic acid or a vector having the nucleic acid. The kit of the present invention can include, in addition to the staple nucleic acid or the vector having the nucleic acid, a buffer solution, a PCR reagent, an in vitro translation reagent, luciferase, an instruction manual, and the like.

[0031] The present invention provides a pharmaceutical composition comprising the Staple nucleic acid of the present invention or the vector of the present invention. Such a composition comprises a therapeutically effective amount of a therapeutic agent (the Staple nucleic acid or vector of the present invention) and a pharma- ceutically acceptable carrier. A "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers are sterile liquids, such as water and oils (e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc.). When the pharmaceutical composition is administered intravenously, particularly in the case of an injectable solution, carriers include water, saline, and aqueous dextrose and glycerol solutions. Excipients also include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene glycol, water, ethanol, etc.

[0032] The pharmaceutical compositions of the present invention, if desired, may contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of a solution, suspension, emulsion, sustained-release formulation, etc. Such compositions contain a therapeutically effective amount of the therapeutic agent, preferably in purified form, together with a suitable amount of carrier. In a preferred embodiment, the composition is formulated as a pharmaceutical composition adapted for intravenous or intramuscular administration to humans.Typically, it is a solution in a sterile isotonic aqueous buffer.If necessary, the pharmaceutical composition can also contain a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the injection site. The pharmaceutical compositions of the present invention are suitable for administration to humans and other mammals, such as monkeys, horses, goats, sheep, dogs, mice, rats, etc. The compositions are preferably in the form of a liquid, such as a phosphate buffered saline (PBS) composition or lactated Ringer's solution.

[0033] The pharmaceutical composition (staple nucleic acid or vector) of the present invention is useful in treating (cure, alleviate, prevent, etc.) diseases caused by the expression of TRPC6. The effective amount to be administered can be determined by standard clinical techniques. In addition, in vivo and / or in vitro assays may be optionally employed to predict optimal dosage ranges. The present invention also provides a kit for treating a disease caused by expression of TRPC6, comprising the pharmaceutical composition. The kit of the present invention may contain, in addition to the pharmaceutical composition, a buffer solution, a PCR reagent, an in vitro translation reagent, luciferase, an instruction manual, and the like.

[0034] In the present invention, examples of disease tissues or organs to be treated include the cerebral cortex, cerebellum, olfactory region, hippocampus, amygdala, basal ganglia, thalamus, hypothalamus, midbrain, pons and medulla oblongata, corpus callosum, spinal cord, retina, thyroid gland, parathyroid gland, adrenal gland, pituitary gland, lung, bronchi, airway, salivary gland, esophagus, tongue, stomach, duodenum, small intestine, colon, rectum, liver, gallbladder, pancreas, bladder, testis, epididymis, seminal vesicle, prostate, vas deferens, vagina, ovary, fallopian tube, endometrium, cervix, uterus, placenta, mammary gland, cardiac muscle, smooth muscle, skeletal muscle, adipose tissue, skin, thymus, appendix, spleen, lymph node, tonsils, bone marrow, granulocytes, monocytes, T cells, B cells, NK cells, dendritic cells, total PBMCs, and the like.

[0035] Among the above, the heart, liver, and respiratory system are typically treated. Examples of cardiac diseases include heart failure, particularly heart failure due to cardiac hypertrophy, heart failure due to myocardial hypertrophy, and heart failure due to pulmonary arterial hypertension, and examples of respiratory diseases include airway inflammation.

[0036] Suitable administration allows delivery of a therapeutically effective amount of the composition to target tissues, particularly the heart and liver. In the present invention, a therapeutic dose is defined as the amount of viral particles (vg for viral genome) containing the Staple nucleic acid sequence per kilogram (kg) of the subject to be administered. Routes of administration include, for example, parenteral, including intramuscular and systemic (intravenous) administration. Injections are usually performed using a syringe or catheter. The dose injected is 10 per kg of patient body weight. 12 ~10 14 vg.

[0037] Working Example The present invention will be described in more detail below with reference to examples, although the scope of the present invention is not limited to these examples. EXAMPLES

[0038] <Method> Materials & Methods (Animal Experiments) DNA oligonucleotides DNA oligonucleotides were purchased from Thermo Fisher Scientific and Eurofins Genomics, Inc. All samples were desalted or OPC purified and used for the construction of AAV6 viral vectors expressing Staple nucleic acids and for reverse transcription reactions.

[0039] In vivo evaluation of Staple nucleic acid using BALB / c (6 weeks old) 1. Construction of AAV6 viral vector expressing staple nucleic acid (Figure 3) Annealing was performed using staple nucleic acid having the following base sequence (sense strand and antisense strand), and the resulting product was inserted between the Xba I-Spe I sites of the pAAV-U6-ZsGreen1 vector (pAAV-Empty) (Takara Bio) by HiFi cloning (pAAV-Staple).

[0040] Sense strand: 5'- GAGAAAAGCCTCTAGGCGCAGACAGGCGGTGGAAGTCACTATTT TTTCTAGTGATATCGATA -3' (SEQ ID NO: 4) Antisense strand: 5'- TATCGATATCACTAGAAAAAAT AGTGACTTCCACCGCCTGTCTGCGCCTAGAGGCTTTTCTC -3' (SEQ ID NO: 5)

[0041] 2. Preparation of AAV (AAV6) expressing staple nucleic acid The HEK293T cells used for AAV6 production were cultured in a 5% CO2 humidified incubator at 37°C using Dulbecco's modified Eagle medium, supplemented with 100 units / mL penicillin, 100 μg / mL streptomycin sulfate, and 10% (v / v) fetal bovine serum. For AAV6 production, pAAV-Staple or pAAV-Empty, pRC6 vector, and pHelper vector were mixed at a ratio of 1:1:1 (5 μg each, total amount 15 μg), and the above solution was transfected into HEK293T cells at 80-90% confluency in a 10 cm dish using TransIT-VirusGEN (registered trademark) Transfection Reagent (Mirus). After 72 hours, AAV6 viruses were collected and purified (Staple_AAV, Empty_AAV) using AAVpro (registered trademark) Purification Kit Midi (All Serotype) (Takara Bio). The titer of each AAV6 was measured using AAVpro (registered trademark) Titration Kit (for Real Time PCR) Ver. 2 (Takara Bio). Staple_AAV was 1.2 × 10 10 vg / ml, Empty_AAV was 2.5 × 10 10 vg / ml.

[0042] 3. Animal treatment (AAV6 administration, body weight and organ weight measurement) All experiments using mice were conducted in accordance with the Animal Experiment Committee of Kumamoto University. BALB / c mice were purchased from KBT Oriental Co., Ltd. Six-week-old BALB / c mice (male) were anesthetized with isoflurane and injected with 1 × 10 9 450 μl of PBS containing 1 × 10 vg Staple_AAV was injected into the tail vein of control mice. 9 450 μl of PBS supplemented with vg Empty_AAV6 was injected via the tail vein. The body weight of each mouse was measured on days 0, 7, and 14 after administration, and on the 14th day, the heart, liver, and kidney were removed from each mouse, after which the weight of each organ was measured and tissue pieces were collected.

[0043] 4. Western Blot Lysis Buffer (CST) containing 150 μl of protease inhibitor cocktail (Nacalai Tesque) was added per 10 mg of collected tissue pieces, and the pieces were homogenized using a bead crusher (TITEC) and then left to stand on ice for 30 min. The pieces were then sonicated using an ultrasonic homogenizer (BRANSON) (amplitude: 30%, 5 seconds x 4 sets, operated on ice) and centrifuged at 4°C and 15,000 x g for 30 min. The supernatant was collected, 2x Laemmli sample buffer (Bio-Rad) was added, and the mixture was treated at 95°C for 5 min, then left to stand on ice, and this was used as a sample for Western blotting.

[0044] Electrophoresis was performed on a 3% acrylamide stacking gel and a 10% acrylamide separation gel at 125 V (constant voltage) for 65 min, and then transferred to a nitrocellulose membrane at 100 mA (constant current) for 50 min. The membrane was then blocked using Bullet Blocking One for WB (Nacalai Tesque), and incubated with rabbit monoclonal Trpc6 antibody (Cat. 16716, CST, Lot: 1, 1:1000) and mouse monoclonal β-tubulin antibody (Cat. 66240-1-Ig, Proteintech, Lot: 10004491, 1:10000) at room temperature for 1 hour with shaking. In addition, after shaking at room temperature for 1 hour using rabbit IgG antibody (Cat. 7074, CST, Lot: 28, 1:5000) or mouse IgG antibody (Cat. NA931, GE Healthcare, Lot: 16912704, 1:5000), bands were detected using chemiluminescence reagents Chemi-Lumi One Super (Nacalai Tesque) and Las-500 (GE Healthcare).

[0045] 5. RT-qPCR mRNA was extracted from each tissue fragment using ISOGEN (Nippon Gene). Specifically, 1 ml of ISOGEN was added per 50-100 mg of each collected tissue fragment (heart, liver, kidney), and homogenized using a bead crusher (TITEC). Then, 200 μl of chloroform was added, mixed vigorously, and left at room temperature for 5 min. After centrifugation at 12,000 × g at 4 °C for 15 min, the aqueous phase was collected, 0.8 volumes of isopropanol were added, and left at room temperature for 5 min. After centrifugation at 12,000 × g at 4 °C for 10 min, the supernatant was discarded, 100 μl of 70% ethanol was added, and the mixture was centrifuged at 7,500 × g at 4 °C for 5 min. After centrifugation, the supernatant was discarded, the mixture was air-dried for 15 min, and mRNA was recovered with TE buffer.

[0046] The total RNA obtained was used as a template to synthesize cDNA using the ReverTra Ace® qPCR RT Kit (TOYOBO) and oligo(dT)(15T) primer. qPCR analysis was performed using the THUNDERBIRD® SYBR qPCR Mix (TOYOBO) and MJ Mini TM The PCR was performed using a Personal Thermal Cycler (Bio-Rad). The forward (fw.) and reverse primers (rv.) for Trpc6 and Gapdh had the following sequences:

[0047] Trpc6: fw.:5'-AACTCGGGGAGAGACTG-3' (SEQ ID NO:6) rv.:5'-ATATGGCTTCAAGTGGAG-3' (SEQ ID NO:7) Gapdh: fw.:5'- AACAGCAACTCCCACTCTTCC -3' (SEQ ID NO:8) rv.:5'-GTGGTCCAGGTTTCTTACTC-3' (SEQ ID NO:9)

[0048] 6. Proteome Analysis 6-1. Pretreatment of analysis samples Each heart sample was diluted with 100 μl of lysis buffer (10 mM Tris-HCl, pH 8, 7 M urea, 2 M thiourea, 5 mM magnesium acetate, 4% (w / v) CHAPS, 1 tablet per 50 ml Complete TM Protease Inhibitor Cocktail Tablets) was added, and the mixture was ground using the Sample Grinding Kit. It was then sonicated (20 seconds x 2, with a cycle of 0.2 seconds ON + 0.5 seconds OFF) and concentrated using an Amicon 0.3 kDa.

[0049] After measuring the protein concentration of the obtained supernatant by the Bradford method, 1 mg of each sample was taken, and 100 μl of reduction treatment solution (1.5 mg of DTT dissolved in 1 ml of 100 mM ammonium bicarbonate) was added, and the mixture was treated at 57° C. for 30 minutes. Furthermore, 100 μl of alkylation treatment solution (10 mg of IAA dissolved in 1 ml of 100 mM ammonium bicarbonate) was added, and the mixture was treated at room temperature for 30 minutes. Then, 100 μl of trypsin digestion solution and 100 μl of 50 mM ammonium bicarbonate were added in that order, and the mixture was treated at 30° C. overnight. The obtained sample was dried using a centrifugal concentrator, 30 μl of 0.1% formic acid was added, vortexed, and centrifuged (20,000×g, 10 min.) The obtained supernatant was used as the MS analysis sample.

[0050] 6-2. LC-MS / MS NanoLC-MS / MS analysis of the MS analysis samples was performed twice using an UltiMate (registered trademark) 3000 liquid chromatograph (LC) and a Q-Exactive Plus mass spectrometer (MS), with LC and MS controlled by Xcalibur (Thermo Fisher Scientific). The obtained results were subjected to a database search using Mascot (Ver. 2.6) and Proteome Discoverer (Ver. 2.3), and the search result dat file was loaded into Scaffold (Ver. 4.11.1, Proteome Software) for analysis.

[0051] 6-3.Blood Test The toxicity of Staple Nucleic Acid was evaluated by blood tests, which were outsourced to Mouse Clinic.

[0052] <Result> The results of AAV infectivity evaluation are shown in Figure 4. In addition, the results of a test on whether Staple nucleic acids suppress the expression of TRPC6 in the mouse heart, liver, and kidney are shown in Figure 5 (heart), Figure 6 (liver), and Figure 7 (kidney). FIG. 4 showed that AAV infected HEK293T cells. Furthermore, Figures 5 to 7 show that the Staple nucleic acid of the present invention suppresses the expression of Trpc6 in the heart and liver.

[0053] For most of the 830 genes analyzed, the gene expression levels did not change significantly after administration of Staple Nucleic Acid, but the expression levels of some genes decreased (Figure 8). When the expression level of Glutathione S-transferase A4, which showed the greatest decrease, decreased, the expression levels of related genes (SOD2, GPX1) increased, but in this result, the expression levels of related genes did not increase (SOD2: 1.0 times, GPX1: 0.7 times). Therefore, the results this time include measurement errors, and it was determined that it is necessary to confirm reproducibility in the future to obtain more accurate results (Figure 8).

[0054] In addition, the RNA sequence database (GGGenome) was used to predict the off-target effects of Staple nucleic acids, resulting in hits of 115 genes (search criteria: RefSeq mouse RNA release 205 Mar. 2021). Of the hit genes, two genes (Tns1, Ehd2) were also present in the proteome analysis results, and their expression levels did not change significantly (Tns1: 1.5 times, Ehd: 0.8 times). Therefore, it was determined that the ribosome protein synthesis reaction did not stop even when Staple nucleic acids bound to off-target sequences.

[0055] The results of the blood tests are shown in Figure 9. As shown in Figure 9, although there were some items that were outside the standard values, no significant difference between Empty and Staple could be confirmed, and no significant toxicity due to the presence of Staple nucleic acid was confirmed. EXAMPLES

[0056] TAC procedure and echocardiogram TAC treatment Male BALB / c mice (7 weeks old) were anesthetized with isoflurane, intubated, and maintained under controlled breathing (tidal volume: 0.6 mL, respiratory rate: 110 breaths / min). After exposing the aortic arch through a left thoracic incision, a 7-0 prolene suture was placed around the transverse aorta and a stenosis was formed using a 27G needle (Figure 10).

[0057] Echocardiogram The day before the echocardiogram, the hair on the chest of each mouse was removed with hair removal cream, and the next day, echocardiograms were taken of each mouse using an ultrasound diagnostic device (Aplio-300). Left ventricular end-diastolic dimension (LVIDd) and left ventricular end-systolic dimension (LVIDs) were measured from the obtained echocardiogram images, and cardiac function parameters, left ventricular ejection fraction (EF) [%] and left ventricular fractional shortening (FS) [%], were calculated from these values ​​(Figures 11, 12, and 13).

[0058] <Results / Discussion> 11 is a graph showing the effect of administering Staple nucleic acid on suppressing TRPC6 expression. As a result of evaluating the expression level of the target protein after 14 days and 42 days, both Staple nucleic acids of the present invention suppressed the expression of TRPC6. Furthermore, in mice that were not administered Staple nucleic acid, EF and FS values ​​were significantly reduced by TAC treatment (EF value: 96.9% → 68.6%, FS value: 68.9% → 32.1%). On the other hand, in mice that were administered Staple nucleic acid, EF and FS values ​​hardly changed before and after TAC treatment (EF value: 94.1% → 93.2%, FS value: 62.2% → 59.6%). Therefore, it was determined that administration of Staple nucleic acid was successful in suppressing the progression of cardiac hypertrophy (Figures 12 and 13). [Sequence List Free Text]

[0059] SEQ ID NOs: 2 to 9: synthetic DNA

Claims

1. An inhibitor of TRPC6 protein expression, comprising a staple nucleic acid against the TRPC6 gene.

2. The expression inhibitor according to claim 1, wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:

2.

3. A pharmaceutical composition for treating a disease caused by expression of TRPC6, comprising a staple nucleic acid for the TRPC6 gene.

4. A pharmaceutical composition for a disease caused by expression of TRPC6, comprising a vector having a staple nucleic acid for the TRPC6 gene.

5. The pharmaceutical composition according to claim 3 or 4, wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:

2.

6. The pharmaceutical composition according to any one of claims 3 to 5, wherein the disease caused by the expression of TRPC6 is a heart disease.

7. The pharmaceutical composition according to claim 6, wherein the heart disease is heart failure.

8. The pharmaceutical composition according to claim 7, wherein the heart failure is caused by myocardial hypertrophy.

9. The pharmaceutical composition according to claim 7, wherein the heart failure is caused by pulmonary arterial hypertension.

10. The pharmaceutical composition according to claim 4, wherein the vector is an adeno-associated virus.

11. The pharmaceutical composition according to any one of claims 3 to 10 for gene therapy.

12. A method for inhibiting expression of TRPC6 protein, comprising the step of forming a guanine quadruplex structure using at least four guanine repeat sequences selected from the group consisting of guanine repeat sequences consisting of a three-base sequence represented by "GGG" and a guanine repeat sequence consisting of a four-base sequence represented by "GNGG" (N represents A, G, C, or U) among the base sequences of the TRPC6 gene, and a staple nucleic acid that hybridizes to a region adjacent to the guanine repeat sequences, thereby inhibiting expression of the TRPC6 gene.

13. A staple nucleic acid for the TRPC6 gene, consisting of the base sequence shown in SEQ ID NO:

2.

14. A kit for treating a disease caused by expression of TRPC6, comprising the composition according to any one of claims 3 to 11.

15. A kit for inhibiting the expression of TRPC6 protein, containing staple nucleic acid against the TRPC6 gene.

16. The kit according to claim 15, wherein the staple nucleic acid for the TRPC6 gene consists of the base sequence shown in SEQ ID NO:2.

Images