Oligonucleotides for modulating tau expression
Patent Information
- Application Number
- JP2024216296
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-08-31
- Filing Date
- 2024-12-11
- Publication Date
- 2025-06-18
- Estimated Expiration
- Not applicable · inactive patent
Abstract
Description
[Technical field]
[0001] The present invention relates to oligonucleotides (oligomers) that are complementary to the microtubule associated protein Tau (MAPT) transcript and result in a reduction in the expression of Tau. Reduction of MAPT transcript and / or Tau protein expression is beneficial in medical disorders such as tauopathies, Alzheimer's disease, fronto-temporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, Dravet syndrome, depression, seizure disorders, and movement disorders. [Background technology]
[0002] Tau is a microtubule-associated protein (MAP) that interacts with tubulin and is involved in the assembly and stabilization of microtubules. Microtubules are important structural components of the cytoskeleton and are involved in a variety of cellular processes, including mitosis, cytokinesis, and vesicle transport. Tau protein is present in multiple cell and tissue types, but is particularly abundant in neurons where it plays an important role in regulating axonal transport and function.
[0003] Alterations in Tau expression levels and / or function contribute to the pathophysiology of various neurodegenerative disorders. For example, misfolded and hyperphosphorylated Tau aggregates are found in neurofibrillary inclusions associated with Alzheimer's disease (AD) and related tauopathies such as progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), frontotemporal dementia (FTD) and related tauopathies such as FTD with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), tangle-predominant senile dementia (TPSD), primary age-related Tauopathy (PART), Down's syndrome, and lytico-bodig disease. Pathological Tau upregulation is associated with infantile Tauopathies, including hemimegalencephaly (HME), tuberous sclerosis, focal cortical dysplasia type 2b, and ganglioglioma. In addition, abnormal Tau expression and / or function may also be associated with other diseases, such as Hallervorden-Spatz syndrome, also known as neurodegeneration with brain iron accumulation type 1 (NBIA1), gangliocytoma, and subacute sclerosing panencephalitis. Tau may also play a role in seizure disorders (e.g., epilepsy), network dysfunction (e.g., depression), and movement disorders (e.g., Parkinson's disease).
[0004] It has been described that antisense molecules and siRNA molecules can reduce Tau protein levels by targeting MAPT pre-mRNA or mRNA transcripts.See, for example, De Vos et al. (2013) Journal of Neuroscience 33:12887, International Publication Nos. WO2013 / 148260, WO2014 / 153236, WO2015 / 010135, WO2016 / 126995, WO2016 / 151523, WO2017 / 09679 and WO2018 / 064593. Antisense oligonucleotides capable of inducing splice regulation of the MAPT transcript are also described in Sud et al. (2014) Mol Ther Nucl Acid vol. 3, e180 and WO2016 / 019063.
[0005] Tau-related disorders such as AD are the most common cause of dementia in the elderly, and there is a great need for potent and effective drugs for the treatment of AD and related neurodegenerative diseases, including tauopathies, seizure disorders, and movement disorders.
[0006] Object of the invention The present invention provides antisense oligonucleotides that reduce Tau both in vivo and in vitro. The present invention has identified three specific target regions in MAPT pre-mRNA located in intron 1 or 2 of human MAPT pre-mRNA that can be targeted by antisense oligonucleotides to provide effective Tau inhibition. In particular, target positions 12051-12111, 39562-39593, and / or 72837-72940 of SEQ ID NO: 1 are advantageous in reducing Tau. The present invention also provides effective antisense oligonucleotide sequences and compounds that can reduce Tau, and their use in the treatment of diseases or disorders such as neurodegenerative diseases including tauopathies, Alzheimer's disease, FTDP-17, seizure disorders, and movement disorders. Summary of the Invention
[0007] The present invention relates to oligonucleotides targeted to Tau-encoding nucleic acids that are capable of modulating the expression of Tau, and to the use of the oligonucleotides for treating or preventing diseases associated with Tau function.
[0008] Thus, in a first aspect, the present invention provides an oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of at least 10 nucleotides having at least 90% complementarity to a specific region of MAPT represented by SEQ ID NOs: 3, 4, and 5.
[0009] The oligonucleotide may be an antisense oligonucleotide, preferably with a gapmer design.Preferably, the oligonucleotide can inhibit the expression of Tau by cleavage of the target nucleic acid.Cleavage is preferably achieved via nuclease recruitment.
[0010] In a further aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant.
[0011] In a further aspect, the present invention provides a method for an in vivo or in vitro method for modulating Tau expression in a target cell expressing Tau by administering to said cell an effective amount of an oligonucleotide or composition of the invention.
[0012] In a further aspect of the invention, the invention provides a method for the treatment or prevention of a disease, disorder, or dysfunction associated with the in vivo activity of Tau comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of the invention to a subject suffering from or susceptible to said disease, disorder, or dysfunction.
[0013] In a further aspect, the oligonucleotide or composition of the invention is used for the treatment or prevention of Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), or FTDP-17. [Brief description of the drawings]
[0014] [Figure 1] The screen is derived from an oligonucleotide library (Example 1) that covers the entire intron region on MAPT. Each point represents an oligonucleotide compound, the x-axis illustrates its position on the MAPT transcript, and the y-axis indicates the amount of MAPT mRNA remaining compared to the control (low values correspond to a large reduction in MAPT). A, B, and C indicate three regions on the MAPT transcript that are selected as target regions for further oligonucleotide compounds. [Diagram 2] Compound 9_103 (the nucleic acid base sequence is shown in SEQ ID NO: 9) [Diagram 3] Compound 9_104 (the nucleic acid base sequence is shown in SEQ ID NO: 9) [Figure 4] Compound 11_1 (the nucleic acid base sequence is shown in SEQ ID NO: 11) [Diagram 5] Compound 49_38 (the nucleic acid base sequence is shown in SEQ ID NO: 49) [Figure 6] Compound 49_189 (the nucleic acid base sequence is shown in SEQ ID NO: 49)
[0015] The compounds depicted in Figures 2, 3, 4, 5, and 6 are shown in protonated form, i.e., the S atom on the phosphorothioate bond is protonated. It will be understood that the presence of a proton depends on the acidity of the molecule's environment and the presence of an alternative cation (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist as tautomeric forms.
[0016] definition Oligonucleotides The term "oligonucleotide" as used herein is defined as it is commonly understood by those skilled in the art as a molecule comprising two or more covalently linked nucleosides. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are usually produced in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or modifications thereof. The oligonucleotides of the present invention are artificial and chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may comprise one or more modified nucleosides or nucleotides, such as, for example, 2' sugar modified nucleosides.
[0017] Antisense oligonucleotides The term "antisense oligonucleotide" as used herein is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid.Antisense oligonucleotides are not double-stranded in nature, and therefore are not siRNA or shRNA.Preferably, the antisense oligonucleotides of the present invention are single-stranded.It is understood that the single-stranded oligonucleotides of the present invention can form hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity over the entire length of the oligonucleotide is less than 50%.
[0018] Advantageously, the single-stranded antisense oligonucleotides of the present invention are free of RNA nucleosides to reduce nuclease resistance.
[0019] Advantageously, the antisense oligonucleotides of the invention comprise one or more modified nucleosides or nucleotides, such as, for example, 2' sugar modified nucleosides.Furthermore, it is advantageous for the unmodified nucleosides to be DNA nucleosides.
[0020] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid or target sequence. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, e.g., an FG-F' gapmer region, and may optionally comprise a nucleotide linker region that may be used to attach additional nucleotides, e.g., functional groups, to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of an oligonucleotide cannot be longer than the oligonucleotide itself, and that an oligonucleotide cannot be shorter than the contiguous nucleotide sequence.
[0021] nucleotide Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides. Naturally, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."
[0022] Modified Nucleosides The term "modified nucleoside" or "nucleoside modification," as used herein, refers to a nucleoside that has been modified by the introduction of one or more modifications in the sugar moiety or (nucleic acid) base moiety, as compared to an equivalent DNA or RNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used interchangeably herein with the term "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA if they are capable of Watson-Crick base pairing.
[0023] Modified Internucleoside Linkages The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides together, as generally understood by those skilled in the art. Thus, the oligonucleotide of the present invention may contain modified internucleoside linkages. In some embodiments, modified internucleoside linkages increase the nuclease resistance of the oligonucleotide compared to phosphodiester linkages. In the case of naturally occurring oligonucleotides, the internucleoside linkages include phosphate groups that form phosphodiester bonds between adjacent nucleosides. Modified internucleoside linkages are particularly useful for stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage in regions of DNA or RNA nucleosides of the oligonucleotide of the present invention, such as in the gap region G of a gapmer oligonucleotide, and in regions F and F' of modified nucleosides.
[0024] In one embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from natural phosphodiester, e.g., such that the one or more modified internucleoside linkages are more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. An internucleoside linkage that can improve the nuclease resistance of an oligonucleotide is referred to as a nuclease-resistant internucleoside linkage. In some embodiments, at least 50% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified, e.g., at least 60%, e.g., at least 70%, e.g., at least 75%, e.g., at least 80%, or e.g., at least 90% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified. It will be appreciated that in some embodiments, the nucleosides linking the oligonucleotides of the invention to non-nucleotidic functional groups, such as conjugates, can be phosphodiesters. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are nuclease-resistant internucleoside linkages.
[0025] The modified internucleoside linkage may be selected from the group including phosphorothioate, diphosphorothioate, and boranophosphate. In some embodiments, the modified internucleoside linkage is compatible with RNase H recruitment of the oligonucleotides of the invention, e.g., phosphorothioate, diphosphorothioate, or boranophosphate.
[0026] In some embodiments, the internucleoside linkage comprises sulfur (S), such as a phosphorothioate internucleoside linkage.
[0027] It is advantageous to use phosphorothioate internucleoside linkages in the oligonucleotides of the invention.
[0028] Phosphorothioate internucleoside linkages are particularly useful due to their nuclease resistance, favorable pharmacokinetics, and ease of manufacture.In some embodiments, at least 50% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate, and at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or at least 90% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.In some embodiments, all of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.
[0029] In some embodiments, the oligonucleotides of the invention contain, in addition to phosphorodithioate bond(s), both phosphorothioate internucleoside bond(s) and at least one phosphodiester bond, such as 2, 3, or 4 phosphodiester bonds. In gapmer oligonucleotides, phosphodiester bonds, if present, are not preferably located between consecutive DNA nucleosides in the gap region G.
[0030] In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkages, particularly internucleoside linkages selected from phosphotriester, methylphosphonate, MMI, amide-3, formaacetal, or thioformaacetal.
[0031] Further internucleoside linkages are disclosed in International Publication No. WO 2009 / 124238, which is incorporated herein by reference. In one embodiment, the internucleoside linkage is selected from the linkers disclosed in International Publication No. WO 2007 / 031091, which is incorporated herein by reference. In particular, the internucleoside linkage is selected from the linkers disclosed in International Publication No. WO 2007 / 031091, which is incorporated herein by reference. In particular, the internucleoside linkage is selected from the linkers disclosed in International Publication No. WO 2007 / 031091, which is incorporated herein by reference. H )-O-, 0-PO(OCH3)-0-, -O-PO(NR H )-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHR H )-O-, -OP(O)2-NR H -, -NR H -P(O)2-O-, -NR H -CO-O-, -NR H -CO-NR H and / or the internucleoside linker can be selected from the following: -O-CO-O-, -O-CO-NR H -, -NR H -CO-CH2-, -O-CH2-CO-NR H -, -O-CH2-CH2-NR H -, -CO-NR H -CH2-, -CH2-NR H CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NR H -, -O-CH2-CH2-NR H -CO-, -CH2-NCH3-O-CH2-, where R H is selected from hydrogen and C1-4-alkyl.
[0032] Nuclease-resistant linkages such as phosphorthioate linkages are particularly useful in regions of oligonucleotides that can recruit nucleases when duplexed with a target nucleic acid, such as region G of a gapmer. However, phosphorothioate linkages may also be useful in non-nuclease recruiting and / or affinity enhancing regions, such as regions F and F' of a gapmer. A gapmer oligonucleotide may, in some embodiments, contain one or more phosphodiester linkages in regions F or F', or both regions F and F', and all of the internucleoside linkages in region G may be phosphorothioate.
[0033] Advantageously, all internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate or all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
[0034] Nucleic acid bases The term nucleobase includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses modified nucleobases that may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, and non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) "Accounts of Chemical Research" vol. 45, p. 2055, and Bergstrom (2009) "Current Protocols in Nucleic Acid Chemistry Suppl." vol. 37, p. 1.4.1.
[0035] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, e.g., a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.
[0036] The nucleobase moieties are represented by the letter code of each corresponding nucleobase, for example, A, T, G, C, or U, where each letter can optionally include a modified nucleobase of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides can be used.
[0037] Modified Oligonucleotides The term modified oligonucleotide describes an oligonucleotide containing one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric" oligonucleotide is a term used in the literature to describe oligonucleotides having modified nucleosides.
[0038] Complementarity The term "complementarity" describes the ability of nucleosides / nucleotides to undergo Watson-Crick base pairing. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It will be understood that oligonucleotides may contain nucleosides with modified nucleobases, e.g., 5-methylcytosine is often used in place of cytosine, and thus the term complementarity encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research 45:2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37:1.4.1).
[0039] The term "% complementary" as used herein refers to the percentage of nucleotides of a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleobases (from Watson-Crick base pairs) that are complementary between two sequences (when aligned with the target sequence 5'-3' and the oligonucleotide sequence from 3'-5'), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in the calculation of the % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of nucleobases are disregarded so long as the functional ability of the nucleobase to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating % identity).
[0040] The term "fully complementary" refers to 100% complementarity.
[0041] The following are examples of oligonucleotides that are perfectly complementary to a target nucleic acid:
[0042] Below is an example of an oligonucleotide (SEQ ID NO:49) that is perfectly complementary to a target nucleic acid (SEQ ID NO:4).
[0043] 5'gaaggttgaaatgagaattgatttgagttaaa3' (SEQ ID NO: 4) 3'actcttaactaaactcaatt5' (SEQ ID NO: 49)
[0044] identity The term "identity" as used herein refers to the proportion (expressed as a percentage) of nucleotides of a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) over the contiguous nucleotide sequence. Thus, the percentage of identity is calculated by counting the number of aligned nucleobases that are identical (matching) between the two sequences (in the contiguous nucleotide sequence of the compound of the invention and the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (matching x 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percentage identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of nucleobases are disregarded so long as the functional ability of the nucleobase to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered to be identical to cytosine for purposes of calculating % identity).
[0045] Hybridization The term "hybridizing" or "hybridizing" as used herein should be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the binding between two nucleic acid strands is the strength of hybridization. This is often measured by the melting temperature (T), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. m ) Under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix (2003) Oligonucleotides 13:515-537). The standard state Gibbs free energy, ΔG°, more accurately represents binding affinity, ΔG°=-RTln(K d ) to calculate the dissociation constant (K d), where R is the gas constant and T is the absolute temperature. Thus, a very low ΔG° of the reaction of an oligonucleotide with a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1M, pH of 7, and temperature of 37°C. Hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and for spontaneous reactions, ΔG° is less than zero. ΔG° can be experimentally measured using isothermal titration calorimetry (ITC) methods, for example, as described in Hansen et al. (1965) Chem.Comm. 36-38 and Holdgate et al. (2005) Drug Discov Today. Those skilled in the art will know that commercially available equipment is available for measuring ΔG°. ΔG° can also be estimated numerically by using the nearest neighbor model, using appropriately derived thermodynamic parameters as described in SantaLucia (1998) Proc Natl Acad Sci USA 95:1460-1465, Sugimoto et al. (1995) Biochemistry 34:11211-11216 and McTigue et al. (2004) Biochemistry 43:5388-5405. To have the potential to modulate its intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for an oligonucleotide of 10-30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The oligonucleotides may hybridize to the target nucleic acid with estimated ΔG° values in the range of less than −10 kcal, such as less than −15 kcal, such as less than −20 kcal, and such as less than −25 kcal for oligonucleotides 8 to 30 nucleotides in length.In some embodiments the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal.
[0046] target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid that codes for mammalian Tau, and can be, for example, a gene, RNA, mRNA, and pre-mRNA, mature mRNA, or cDNA sequence. Thus, the target can be referred to as Tau target nucleic acid or MAPT target nucleic acid, and these terms can be used interchangeably. The oligonucleotide of the present invention can, for example, target the target exon region of mammalian MAPT, or can, for example, target the intron region of MAPT pre-mRNA (see Table 1).
[0047] [Table 1]
[0048] Suitably, the target nucleic acid encodes a Tau protein, in particular a mammalian Tau, such as human Tau (see, for example, Tables 2 and 3, which provide the pre-mRNA sequences for human and monkey Tau).
[0049] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1 and 2, or naturally occurring variants thereof (e.g., sequences encoding mammalian Tau proteins). When the oligonucleotides of the invention are used for research or diagnostic purposes, the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0050] For in vivo or in vitro application, the oligonucleotide of the present invention can typically inhibit the expression of Tau protein in cells expressing MAPT target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the present invention is typically measured over the length of the oligonucleotide and is complementary to MAPT target nucleic acid, optionally with one or two mismatches, and optionally with a nucleotide-based linker region that can connect the oligonucleotide to any functional group, such as a conjugate, or other non-complementary terminal nucleotide (e.g., D' or D''). The target nucleic acid can be RNA, such as messenger RNA, such as mature mRNA or pre-mRNA, or DNA, in some embodiments.
[0051] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian Tau protein, such as human Tau, for example the human MAPT pre-mRNA sequence as disclosed as SEQ ID NO: 1. Further information regarding exemplary target nucleic acids is provided in Tables 2 and 3.
[0052] [Table 2]
[0053] Fwd = forward strand Genomic coordinates provide the pre-mRNA sequence (genomic sequence). NCBI reference provides the mRNA sequence (cDNA sequence).
[0054] *The National Center for Biotechnology Information Reference Sequence Database is a comprehensive, integrated, nonredundant, well-annotated set of reference sequences, including genomes, transcripts, and proteins. It is hosted at www.ncbi.nlm.nih.gov / refseq.
[0055] [Table 3]
[0056] Target sequence The term "target sequence" as used herein refers to a sequence of nucleotides present in a target nucleic acid, which comprises a nucleobase sequence that is complementary to an oligonucleotide of the present invention. In some embodiments, the target sequence is comprised of a region on the target nucleic acid that has a nucleobase sequence that is complementary to the continuous nucleotide sequence of an oligonucleotide of the present invention. This region of the target nucleic acid can be interchangeably referred to as a target nucleotide sequence, a target sequence, or a target region. In some embodiments, the target sequence is longer than the complementary sequence of a single oligonucleotide, and can represent a preferred region of the target nucleic acid that can be targeted, for example, by several oligonucleotides of the present invention.
[0057] In some embodiments, the target sequence is a sequence selected from any of the regions in Table 4 (R_1-R_2254). In particular, the target sequence may be selected from one of the regions in the group consisting of R_223, R_738, or R_1298.
[0058] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9]
Table 4-10
Table 4-11
Table 4-12
Table 4-13
Table 4-14
Table 4-15
Table 4-16
Table 4-17
Table 4-18
Table 4-19
Table 4-20
Table 4-21
Table 4-22
Table 4-23
Table 4-24
Table 4-25
Table 4-26
[0059] In some embodiments, the target sequence is a sequence selected from a human MAPT mRNA intron, such as Tau human mRNA intron 1 or 2 (see Table 1 above).
[0060] The oligonucleotides of the invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, such as a target sequence described herein.
[0061] The target sequence to which the oligonucleotide is complementary or hybridizes generally comprises a contiguous nucleic acid base sequence of at least 10 nucleotides, the contiguous nucleotide sequence being 10 to 100 nucleotides, such as 12 to 60, for example 13 to 50, for example 14 to 30, for example 15 to 25, for example 16 to 20 contiguous nucleotides.
[0062] In one embodiment of the invention, the target sequence is SEQ ID NO: 3, which corresponds to region A. In certain embodiments, the target sequence is selected from positions 12051 to 12111 of SEQ ID NO: 1, such as positions 12051 to 12079, 12085 to 12111, or 12060 to 12078 of SEQ ID NO: 1.
[0063] In one embodiment of the invention, the target sequence is SEQ ID NO: 4, which corresponds to region B. In certain embodiments, the target sequence is selected from positions 39562-39593 of SEQ ID NO: 1, such as positions 39573-39592 of SEQ ID NO: 1.
[0064] In one embodiment of the invention, the target sequence is SEQ ID NO:5, which corresponds to region C. In certain embodiments, the target sequence is selected from positions 72837 to 72940 of SEQ ID NO:1, such as positions 72861 to 72891 or 72862 to 72890 of SEQ ID NO:1.
[0065] target cell The term "target cell" as used herein refers to a cell expressing a target nucleic acid. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.
[0066] In a preferred embodiment, the target cell expresses Tau mRNA, such as Tau pre-mRNA or Tau mature mRNA. The polyA tail of Tau mRNA is typically ignored for antisense oligonucleotide targeting.
[0067] Naturally occurring variants The term "naturally occurring variant" refers to variants of MAPT genes or transcripts that originate from the same locus as the target nucleic acid, but may differ, for example, due to the degeneracy of the genetic code, which causes multiple codons to code for the same amino acid, or due to alternative splicing of pre-mRNA or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of a sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the present invention can thus target the target nucleic acid and its naturally occurring variants.
[0068] In some embodiments, the naturally occurring variant has at least 95%, such as at least 98% or at least 99% homology to a mammalian MAPT target nucleic acid, such as a target nucleic acid selected from the group consisting of SEQ ID NO: 1 and 2. In some embodiments, the naturally occurring variant has at least 99% homology to the human MAPT target nucleic acid of SEQ ID NO: 1.
[0069] Regulation of expression The term "modulation of expression" as used herein should be understood as a general term for the ability of an oligonucleotide to modify the amount of Tau when compared to the amount of Tau before administration of the oligonucleotide. Alternatively, modulation of expression can be determined by reference to a control experiment. A control is generally understood to be an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock).
[0070] One type of modulation is the ability of the oligonucleotide to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid or terminate the expression of Tau, for example by degradation of mRNA or blocking transcription. Another type of modulation is the ability of the oligonucleotide to restore, increase or enhance the expression of Tau, for example by repairing splice sites or preventing splicing, or removing or blocking inhibitory mechanisms such as microRNA suppression.
[0071] High-affinity modified nucleosides High affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, e.g., have a higher melting temperature (T mThe high affinity modified nucleosides of the present invention preferably provide an increase in melting temperature of +0.5 to +12° C., more preferably +1.5 to +10° C., and most preferably +3 to +8° C. per modified nucleoside. A large number of high affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, for example, Freier & Altmann, Nucl. Acid Res. (1997) 25:4429-4443 and Uhlmann, Curr. Opinion in Drug Development (2000) 3:2:293-213).
[0072] sugar modification Oligomers of the invention may contain one or more nucleosides having modified sugar moieties, ie, modifications in the sugar moiety as compared to the ribose sugar moiety found in DNA and RNA.
[0073] A large number of nucleosides with modifications of the ribose sugar moiety have been produced with the primary goal of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.
[0074] Such modifications include those in which the ribose ring structure has been modified, for example, by replacing it with a hexose ring (HNA) or bicyclic ring (typically having a biradical bridge between the C2 and C4 carbons of the ribose ring (LNA)), or an unlinked ribose ring (typically lacking a bond between the C2 and C3 carbons (e.g., UNA)). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNAs), or morpholino nucleic acids.
[0075] Sugar modifications also include modifications by changing the substituents on the ribose ring to groups other than hydrogen or to the 2'-OH group that occurs naturally in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.
[0076] 2' sugar modified nucleosides A 2' sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or that contains a 2' linked biradical that can form a bridge between the 2' carbon and the second carbon of the ribose ring, e.g., LNA (2'-4' biradical bridge).
[0077] In fact, much attention has been paid to the development of 2' sugar-substituted nucleosides, and many 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2' modified sugars can provide oligonucleotides with improved binding affinity and / or increased nuclease resistance. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, e.g., Freier & Altmann; Nucl. Acid Res. (1997) 25:4429-4443 and Uhlmann; Curr. Opinion in Drug Development (2000) 3:2:293-213, and Deleavey and Damha, Chemistry and Biology (2012) 19:937. Below is a description of some 2'-substituted modified nucleosides.
[0078] [ka]
[0079] In the context of the present invention, 2' substituted sugar modified nucleosides do not include 2' bridged nucleosides such as LNA.
[0080] Locked Nucleoside (LNA) Nucleoside "LNA nucleosides" are 2' sugar modified nucleosides that contain a biradical (also referred to as a "2'-4' bridge") linking the C2' and C4' of the ribose sugar ring of the nucleoside, which restricts or fixes the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). Fixing the conformation of the ribose is associated with improved hybridization affinity (duplex stabilization) when LNA is incorporated into an oligonucleotide of a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.
[0081] Non-limiting exemplary LNA nucleosides are described in International Publication Nos. WO99 / 014226, WO00 / 66604, WO98 / 039352, WO2004 / 046160, WO00 / 047599, WO2007 / 134181, WO2010 / 077578, WO2010 / 036698, WO2007 / 090071, WO2 009 / 006478, International Publication No. WO2011 / 156202, International Publication No. WO2008 / 154401, International Publication No. WO2009 / 067647, International Publication No. WO2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett., Vol. 12, pp. 73-76; Seth et al., J. Org. Chem. (2010), Vol. 75, No. 5, pp. 1569-81; Mitsuoka et al., Nucleic Acids Research (2009), Vol. 37, No. 4, pp. 1225-1238; and Wan and Seth, J. Medical Chemistry (2016), Vol. 59, pp. 9645-9667.
[0082] The 2'-4' bridge contains from 2 to 4 bridging atoms and is particularly represented by the formula -XY-, where: X is oxygen, sulfur, -CR a R b -, -C(R a )=C(R b )-, -C(=CR a R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -;-O-NR a -, -NR a -O-, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b - and; Y is oxygen, sulfur, -(CR a R b ) n -, -CR a R b -O-CR a R b -, -C(R a )=C(R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -Although; However, -XY- is -OO-, Si(R a )2-Si(R a )2-, -SO2-SO2-, -C(R a )=C(R b )-C(R a )=C(R b ), -C(R a )=NC(R a )=N-, -C(Ra )=NC(R a )=C(R b ), -C(R a )=C(R b )-C(R a )=N- or -Se-Se-; J is oxygen, sulfur, =CH2, or =N(R a ) and; R a and R b is hydrogen, halogen, hydroxyl, cyano, thiohydroxyl, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclyl, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, carbamido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, thiohydroxyl sulfidoalkylsulfanyl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c , -OC(=X a )NR c R d , and -NR e C(=X a )NR c R d are independently selected from; Or, two geminal R a and R b taken together to form an optionally substituted methylene; Or, two geminal R a and R b together with the carbon atom to which it is attached forms a cycloalkyl or halocycloalkyl, and -XY- has only one carbon atom; wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy, and substituted methylene are alkyl, alkenyl, alkynyl, and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterosilyl, aryl, and heteroaryl; X a is oxygen, sulfur, or -NR c and; R c , R d , and R e is independently selected from hydrogen and alkyl; and n is 1, 2, or 3.
[0083] In a more specific embodiment of the invention, X is oxygen, sulfur, -NR a -, -CR a R b - or -C (=CR a R b )—, especially oxygen, sulfur, —NH—, —CH2—, or —C(═CH2)—, especially oxygen.
[0084] In another particular embodiment of the invention, Y is -CR a R b -, -CR a R b -CR a R b - or -CR a R b- CR a R b- CR a R b -, in particular -CH2-CHCH3-, -CHCH3-CH2-, -CH2-CH2- or -CH2-CH2-CH2-.
[0085] In a specific embodiment of the invention, -XY- is -O-(CR a R b ) n -,-S-CR a Rb -, -N(R a )CR a R b -, -CR a R b -CR a R b -, -O-CR a R b -O-CR a R b -, -CR a R b -O-CR a R b -, -C(=CR a R b )-CR a R b -, -N(R a )CR a R b -,-ON(R a )-CR a R b - or -N(R a )-O-CR a R b -It is.
[0086] In a specific embodiment of the present invention, R a and R b are independently selected from the group consisting of hydrogen, halogen, hydroxyl, alkyl, and alkoxyalkyl, particularly hydrogen, halogen, alkyl, and alkoxyalkyl.
[0087] In one embodiment of the present invention, R a and R b are independently selected from the group consisting of hydrogen, fluoro, hydroxyl, methyl, and -CH2-O-CH3, in particular hydrogen, fluoro, methyl, and -CH2-O-CH3.
[0088] Advantageously, R of -XY- a and R b is as defined above, and the others are all simultaneously hydrogen.
[0089] In a further particular embodiment of the present invention, R ais hydrogen or alkyl, in particular hydrogen or methyl.
[0090] In another particular embodiment of the present invention, R b is hydrogen or alkyl, in particular hydrogen or methyl.
[0091] In a specific embodiment of the present invention, R a and R b One or both of are hydrogen.
[0092] In a specific embodiment of the present invention, R a and R b Only one of the groups is hydrogen.
[0093] In one particular embodiment of the present invention, R a and R b One of these is methyl and the other is hydrogen.
[0094] In a specific embodiment of the present invention, R a and R b are both simultaneously methyl.
[0095] In a specific embodiment of the invention, -XY- is -O-CH2-, -S-CH2-, -S-CH(CH3)-, -NH-CH2-, -O-CH2CH2-, -O-CH(CH2-O-CH3)-, -O-CH(CH2CH3)-, -O-CH(CH3)-, -O-CH 2- It is O-CH2-, -O-CH2-O-CH2-, -CH2-O-CH2-, -C(=CH2)CH2-, -C(=CH2)CH(CH3)-, -N(OCH3)CH2-, or -N(CH3)CH2-.
[0096] In a specific embodiment of the invention, -XY- is -O-CR a R b -, wherein R a and R b are independently selected from the group consisting of hydrogen, alkyl, and alkoxyalkyl, particularly hydrogen, methyl, and -CH2-O-CH3.
[0097] In specific embodiments, -XY- is -O-CH2- or -O-CH(CH3)-, in particular -O-CH2-.
[0098] The 2'-4' bridge can be positioned either below the plane of the ribose ring (β-D-configuration) or above the plane of the ring (α-L-configuration), as illustrated in Formula (A) and Formula (B), respectively.
[0099] The LNA nucleosides according to the invention are in particular of formula (A) or (B), [ka] During the ceremony, W is oxygen, sulfur, -N(R a )-or-CR a R b -, especially oxygen; B is a nucleobase or a modified nucleobase; Z is an internucleoside linkage to an adjacent nucleoside or to the 5'-terminus; Z* is an internucleoside linkage to an adjacent nucleoside or the 3'-terminus; R 1 , R 2 , R 3 , R 5 , and R 5* is independently selected from hydrogen, halogen, alkyl, haloalkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, azido, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, and aryl; and X, Y, R a , and R b is as defined above.
[0100] In a specific embodiment, in the definition of -XY-, R a is hydrogen or alkyl, particularly hydrogen or methyl. In another specific embodiment, in the definition of -XY-, R bis hydrogen or alkyl, in particular hydrogen or methyl. In a further specific embodiment, in the definition of -XY-, R a and R b In a specific embodiment, in the definition of -XY-, one or both of R a and R b In one particular embodiment, in the definition of -XY-, only one of R a and R b In a specific embodiment, in the definition of -XY-, one of R a and R b are both simultaneously methyl.
[0101] In a further specific embodiment, in the definition of X, R a is hydrogen or alkyl, in particular hydrogen or methyl. In another specific embodiment, in the definition of X, R b is hydrogen or alkyl, in particular hydrogen or methyl. In a specific embodiment, in the definition of X, R a and R b In a specific embodiment, in the definition of X, one or both of R a and R b In one particular embodiment, in the definition of X, only one of R a and R b In a specific embodiment, in the definition of X, one of R a and R b are both simultaneously methyl.
[0102] In a further specific embodiment, in the definition of Y, R a is hydrogen or alkyl, in particular hydrogen or methyl. In another specific embodiment, in the definition of Y, R b is hydrogen or alkyl, in particular hydrogen or methyl. In a specific embodiment, in the definition of Y, R a and R b In a specific embodiment, in the definition of Y, one or both of R a and Rb In one particular embodiment, in the definition of Y, only one of R a and R b In a specific embodiment, in the definition of Y, one of R a and R b are both simultaneously methyl.
[0103] In certain embodiments of the present invention, R 1 , R 2 , R 3 , R 5 , and R 5* are independently selected from hydrogen and alkyl, particularly hydrogen and methyl.
[0104] In a further particular advantageous embodiment of the invention, R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen.
[0105] In another particular embodiment of the present invention, R 1 , R 2 , R 3 are all hydrogen at the same time, and R 5 and R 5* One of these is hydrogen and the other is as defined above, in particular alkyl, more particularly methyl.
[0106] In a specific embodiment of the present invention, R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, alkoxyalkyl, and azide, in particular hydrogen, fluoro, methyl, methoxyethyl, and azide. In a particular advantageous embodiment of the invention, R 5 and R 5* one of R is hydrogen and the other is alkyl, particularly methyl, halogen, particularly fluoro, alkoxyalkyl, particularly methoxyethyl or azido, or R 5 and R 5*are simultaneously hydrogen or halogen, in particular simultaneously fluoro hydrogen. In such particular embodiment, W may advantageously be oxygen, -XY- advantageously -O-CH2-.
[0107] In a specific embodiment of the invention, -XY- is -O-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such LNA nucleosides are disclosed in International Publication Nos. WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, and WO 2004 / 046160, all of which are incorporated herein by reference, and include those commonly known in the art as β-D-oxy LNA and α-L-oxy LNA nucleosides.
[0108] In another particular embodiment of the invention, -X-Y- is -S-CH-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such thio LNA nucleosides are disclosed in International Publication Nos. WO 99 / 014226 and WO 2004 / 046160, which are incorporated herein by reference.
[0109] In another particular embodiment of the invention, -XY- is -NH-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such amino LNA nucleosides are disclosed in International Publication Nos. WO 99 / 014226 and WO 2004 / 046160, which are incorporated herein by reference.
[0110] In another particular embodiment of the invention, -XY- is -O-CHCH- or -OCHCHCH-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such LNA nucleosides are disclosed in International Publication No. WO 00 / 047599, and in Morita et al., Bioorganic & Med. Chem. Lett., vol. 12, pp. 73-76, which are incorporated herein by reference, and include those commonly known in the art as 2'-O-4'C-ethylene-bridged nucleic acids (ENAs).
[0111] In another particular embodiment of the invention, -XY- is -O-CH2-, W is oxygen, and R 1 , R 2 , R 3 are all hydrogen at the same time, and R 5 and R 5* is hydrogen and the other is non-hydrogen, such as alkyl, e.g., methyl. Such 5' substituted LNA nucleosides are disclosed in International Publication No. WO 2007 / 134181, which is incorporated herein by reference.
[0112] In another particular embodiment of the invention, -XY- is -O-CR a R b - where R a and R b is not hydrogen, especially alkyl such as methyl, W is oxygen, R 1 , R 2 , R 3 are all hydrogen at the same time, and R 5 and R 5* is hydrogen and the other is not hydrogen, particularly alkyl, such as methyl. Such bis-modified LNA nucleosides are disclosed in International Publication No. WO2010 / 077578, which is incorporated herein by reference.
[0113] In another particular embodiment of the invention, -X-Y- is -O-CHRa -, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such 6'-substituted LNA nucleosides are disclosed in International Publication Nos. WO2010 / 036698 and WO2007 / 090071, both of which are incorporated herein by reference. In such 6'-substituted LNA nucleosides, R a is in particular C1-C6 alkyl, such as methyl.
[0114] In another specific embodiment of the invention, -XY- is -O-CH(CH2-O-CH3)- ("2'O-Methoxyethyl Bicyclic Nucleic Acid," Seth et al., J. Org. Chem. (2010) 75(5) 1569-81).
[0115] In another specific embodiment of the invention, -XY- is -O-CH(CH2CH3)- ("2'O-ethyl bicyclic nucleic acid," Seth et al., J. Org. Chem. (2010) 75(5):1569-81).
[0116] In another particular embodiment of the invention, -XY- is -O-CH(CH2-O-CH3)-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such LNA nucleosides, also known in the art as cyclic MOE (cMOE), are disclosed in International Publication No. WO2007 / 090071.
[0117] In another specific embodiment of the invention, -XY- is -O-CH(CH3)-.
[0118] In another particular embodiment of the present invention, -X-Y- is -O-CH 2-O-CH2- (Seth et al., J. Org. Chem (2010), supra).
[0119] In another particular embodiment of the invention, -XY- is -O-CH(CH3)-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. Such 6'-methyl LNA nucleosides are also known in the art as cET nucleosides and can be either the (S)-cET or (R)-cET diastereoisomers, as disclosed in International Publication No. WO2007 / 090071 (β-D) and International Publication No. WO2010 / 036698 (α-L), both of which are incorporated herein by reference.
[0120] In another particular embodiment of the invention, -XY- is -O-CR a R b - where R a Also b is not hydrogen, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. In a specific embodiment, R a and R b are both simultaneously alkyl, in particular both simultaneously methyl. Such 6'-di-substituted LNA nucleosides are disclosed in International Publication No. WO2009 / 006478, which is incorporated herein by reference.
[0121] In another particular embodiment of the invention, -X-Y- is -S-CHR a -, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5*are all simultaneously hydrogen. Such 6'-substituted thio LNA nucleosides are disclosed in International Publication No. WO2011 / 156202, which is incorporated herein by reference. In certain embodiments of such 6'-substituted thio LNAs, R a is alkyl, in particular methyl.
[0122] In a specific embodiment of the invention, -XY- is -C(=CH2)C(R a R b )-, -C(=CHF)C(R a R b )- or -C(=CF2)C(R a R b )-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen at the same time. a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, in particular hydrogen, methyl, fluoro and methoxymethyl. a and R b is in particular simultaneously both hydrogen and methyl, or R a and R b one is hydrogen and the other is methyl. Such vinyl carbo LNA nucleosides are disclosed in International Publication Nos. WO2008 / 154401 and WO2009 / 067647, both of which are incorporated herein by reference.
[0123] In a specific embodiment of the invention, -XY- is -N(OR a )-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. In a specific embodiment, R ais alkyl, such as methyl. Such LNA nucleosides, also known as N-substituted LNAs, are disclosed in International Publication No. WO2008 / 150729, which is incorporated herein by reference.
[0124] In a specific embodiment of the present invention, -XY-, -ON(R a )-, -N(R a )-O-, -NR a -CR a R b -CR a R b - or -NR a -CR a R b -, W is oxygen, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen at the same time. a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, in particular hydrogen, methyl, fluoro and methoxymethyl. In a specific embodiment, R a is alkyl, e.g., methyl, and R b is hydrogen or methyl, especially hydrogen. (Seth et al., J. Org. Chem (2010), supra).
[0125] In specific embodiments of the invention, -XY- is -ON(CH3)- (Seth et al., J. Org. Chem (2010), supra).
[0126] In a specific embodiment of the present invention, R 5 and R 5* are both simultaneously hydrogen. In another particular embodiment of the present invention, R 5 and R 5* One of R is hydrogen and the other is alkyl, such as methyl. 1 , R 2 , and R 3 may in particular be hydrogen, -XY- may in particular be -O-CH2- or -O-CHC(Ra )3-, such as -O-CH(CH3)-.
[0127] In a specific embodiment of the invention, -XY- is -CR a R b -O-CR a R b -, for example -CH2-O-CH2-, W is oxygen, R 1 , R 2 , R 3 , R 5 , and R 5* are all simultaneously hydrogen. In certain such embodiments, R a is in particular alkyl, e.g. methyl, R b may be hydrogen or methyl, in particular hydrogen. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRN) and are disclosed in International Publication No. WO2013 / 036868, which is incorporated herein by reference.
[0128] In a specific embodiment of the invention, -XY- is -O-CR a R b -O-CR a R b -, for example -O-CH2-O-CH2-, W is oxygen, R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen at the same time. a and R b are advantageously independently selected from hydrogen, halogen, alkyl, and alkoxyalkyl, in particular hydrogen, methyl, fluoro, and methoxymethyl. In certain such embodiments, R a may in particular be alkyl, e.g. methyl, R bmay be hydrogen or methyl, in particular hydrogen. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research (2009) Vol. 37, No. 4, pp. 1225-1238, which is incorporated herein by reference.
[0129] Unless otherwise specified, it is recognized that LNA nucleosides can be in the β-D or α-L stereoisoform.
[0130] Specific examples of LNA nucleosides of the present invention are shown in Scheme 1, where B is as defined above.
[0131] Scheme 1 [ka]
[0132] Particular LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.
[0133] If the starting materials or compounds of the present invention contain one or more functional groups that are not stable or reactive under the reaction conditions of one or more reaction steps, suitable protecting groups (e.g., as described in "Protective Groups in Organic Chemistry", TW Greene and PG M Huts, 3rd Edition (1999), Wiley, New York) can be introduced prior to key steps of application methods well known in the art. Such protecting groups can be removed at a later stage of the synthesis using standard methods described in the literature. Examples of protecting groups are tert-butoxycarbonyl (Boc), 9-fluorenylmethylcarbamate (Fmoc), 2-trimethylsilylethylcarbamate (Teoc), carbobenzyloxy (Cbz), and p-methoxybenzyloxycarbonyl (Moz).
[0134] The compounds described herein may contain several asymmetric centers and may exist as optically pure enantiomers, mixtures of enantiomers, e.g., racemates, mixtures of diastereoisomers, diastereomeric racemates, or mixtures of diastereomeric racemates.
[0135] The term "asymmetric carbon atom" means a carbon atom that has four different substituents. According to the Cahn-Ingold-Prelog rules, the asymmetric carbon atom can be of the "R" or "S" configuration.
[0136] Chemical Group Definitions As used herein, the term "alkyl", alone or in combination, refers to a straight or branched chain alkyl group having 1 to 8 carbon atoms, particularly a straight or branched chain alkyl group having 1 to 6 carbon atoms, more particularly a straight or branched chain alkyl group having 1 to 4 carbon atoms. Examples of straight and branched chain C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, the isomeric pentyls, isomeric hexyls, isomeric heptyls, and isomeric octyls, particularly methyl, ethyl, propyl, butyl, and pentyl. Particular examples of alkyl are methyl, ethyl, and propyl.
[0137] The term "cycloalkyl", alone or in combination, refers to a cycloalkyl ring having 3 to 8 carbon atoms, particularly a cycloalkyl ring having 3 to 6 carbon atoms. Examples of cycloalkyl are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl, more particularly cyclopropyl and cyclobutyl. A particular example of "cycloalkyl" is cyclopropyl.
[0138] The term "alkoxy", alone or in combination, means a radical of the formula alkyl-O-, where the term "alkyl" has the meaning previously given, e.g., methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec.butoxy, and tert.butoxy. Particular "alkoxy" are methoxy and ethoxy. Methoxyethoxy is a particular example of "alkoxyalkoxy".
[0139] The term "oxy", alone or in combination, signifies the -O- group.
[0140] The term "alkenyl", alone or in combination, denotes a straight-chain or branched hydrocarbon residue containing an olefinic bond and up to 8, preferably up to 6, particularly preferably up to 4 carbon atoms. Examples of alkenyl groups are ethenyl, 1-propenyl, 2-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl and isobutenyl.
[0141] The term "alkynyl", alone or in combination, means a straight-chain or branched hydrocarbon residue containing a triple bond and up to 8, preferably up to 6, particularly preferably up to 4 carbon atoms.
[0142] The terms "halogen" or "halo", alone or in combination, mean fluorine, chlorine, bromine or iodine, particularly fluorine, chlorine or bromine, more particularly fluorine. The term "halo", in combination with another group, denotes substitution of said group with at least one halogen, particularly 1 to 5 halogens, especially 1 to 4 halogens, i.e. 1, 2, 3 or 4 halogens.
[0143] The term "haloalkyl", alone or in combination, refers to an alkyl group substituted with at least one halogen, particularly 1 to 5 halogens, especially 1 to 3 halogens. Examples of haloalkyl include monofluoro-, difluoro-, or trifluoro-methyl, -ethyl, or -propyl, such as 3,3,3-trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, fluoroethyl, or trifluoromethyl. Fluoromethyl, difluoromethyl, and trifluoromethyl are specific "haloalkyl".
[0144] The term "halocycloalkyl", alone or in combination, means a cycloalkyl group as defined above substituted with at least one halogen, particularly substituted with 1 to 5 halogens, especially substituted with 1 to 3 halogens. Particular examples of "halocycloalkyl" are halocyclopropyl, especially fluorocyclopropyl, difluorocyclopropyl, and trifluorocyclopropyl.
[0145] The terms "hydroxyl" and "hydroxy", alone or in combination, refer to an --OH group.
[0146] The terms "thiohydroxyl" and "thiohydroxy", alone or in combination, refer to a -SH group.
[0147] The term "carbonyl", alone or in combination, means the -C(O)- group.
[0148] The terms "carboxy" or "carboxyl", alone or in combination, refer to a -COOH group.
[0149] The term "amino," alone or in combination, means a primary amino group (-NH2), a secondary amino group (-NH-), or a tertiary amino group (-N-).
[0150] The term "alkylamino", alone or in combination, means an amino group as defined above substituted with one or two alkyl groups, as defined above.
[0151] The term "sulfonyl", alone or in combination, means the -SO2 group.
[0152] The term "sulfinyl", alone or in combination, signifies the -SO- group.
[0153] The term "sulfanyl", alone or in combination, signifies the -S- group.
[0154] The term "cyano", alone or in combination, means the radical -CN.
[0155] The term "azido", alone or in combination, means the -N3 group.
[0156] The term "nitro", alone or in combination, means a NO2 group.
[0157] The term "formyl", alone or in combination, means the group -C(O)H.
[0158] The term "carbamoyl", alone or in combination, means the group -C(O)NH2.
[0159] The term "carbamide", alone or in combination, means the group -NH-C(O)-NH.
[0160] The term "aryl," alone or in combination, denotes a monovalent aromatic carbocyclic mono- or bicyclic ring system containing 6 to 10 carbon ring atoms optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, and formyl. Examples of aryl include phenyl and naphthyl, especially phenyl.
[0161] The term "heteroaryl", alone or in combination, denotes a monovalent aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms containing 1, 2, 3, or 4 heteroatoms selected from N, O, and S, and the remaining ring atoms are carbon optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, and formyl. Examples of heteroaryl include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, benzofuranyl, isothiazolyl, benzothienyl, indolyl, isoindolyl, isobenzofuranyl, benzimidazolyl, benzoxazolyl, benzoisoxazolyl, benzothiazolyl, benzoisothiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzotriazolyl, purinyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, carbazolyl or acridinyl.
[0162] The term "heterocyclyl", alone or in combination, means a monovalent saturated or partially unsaturated monocyclic or bicyclic ring system of 4 to 12, especially 4 to 9, ring atoms containing 1, 2, 3, or 4 ring heteroatoms selected from N, O, and S, and the remaining ring atoms are carbon optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, and formyl. Examples of monocyclic saturated heterocyclyls include azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl, or oxazepanyl. Examples of bicyclic saturated heterocycloalkyl are 8-aza-bicyclo[3.2.1]octyl, quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl, 3-oxa-9-aza-bicyclo[3.3.1]nonyl, or 3-thia-9-aza-bicyclo[3.3.1]nonyl. Examples of partially unsaturated heterocycloalkyl are dihydrofuryl, imidazolinyl, dihydro-oxazolyl, tetrahydro-pyridinyl, or dihydropyranyl.
[0163] Pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the free base or free acid, without being biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine, etc. In addition, these salts can be prepared by adding an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. Compounds of formula (I) can also exist in zwitterionic form. Particularly preferred pharmaceutically acceptable salts of compounds of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and methanesulfonic acid.
[0164] protecting group The term "protecting group", alone or in combination, means a group that selectively blocks a reactive site of a multifunctional compound so that a chemical reaction can be selectively carried out at an otherwise unprotected reactive site. The protecting group can be removed. Exemplary protecting groups are an amino protecting group, a carboxy protecting group, or a hydroxy protecting group.
[0165] Nuclease-mediated degradation Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.
[0166] In some embodiments, oligonucleotides may function via nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that function via a nuclease-mediated mechanism are oligonucleotides that typically contain a region of at least 5 or 6 consecutive DNA nucleosides, flanked on one or both sides by affinity enhancing nucleosides, such as gapmers, headmers, and tailmers.
[0167] RNase H activity and recruitment RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when it forms a duplex with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RNase H when provided with a complementary target nucleic acid if it has at least 5%, e.g., at least 10% or more than 20%, of the initial rate, as determined when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested, measured in pmol / L / min, but containing only DNA monomers with phosphorothioate linkages between all monomers of the oligonucleotide, and using the methodology provided by Examples 91-95 of WO 01 / 23613 (incorporated herein by reference). Recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland, for use in determining RNase H activity.
[0168] Gapma The antisense oligonucleotide or its contiguous nucleotide sequence of the present invention may be a gapmer and may also be referred to as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used to inhibit target nucleic acids via RNase H-mediated degradation. Gapmer oligonucleotides contain at least three distinct structural regions, 5'-flank, gap and 3'-flank, FG-F', in a 5'->3' orientation. The "gap" region (G) contains a stretch of contiguous DNA nucleotides that allows the oligonucleotide to recruit RNase H. The gap region is flanked by a 5' flanking region (F) that contains one or more sugar-modified nucleosides, advantageously high affinity sugar-modified nucleosides, and a 3' flanking region (F') that contains one or more sugar-modified nucleosides, advantageously high affinity sugar-modified nucleosides. The one or more sugar-modified nucleosides of regions F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e., it is an affinity-enhancing sugar-modified nucleoside). In some embodiments, one or more sugar-modified nucleosides of regions F and F' are 2' sugar-modified nucleosides, e.g., high affinity 2' sugar modifications, independently selected from LNA and 2'-MOE.
[0169] In a gapmer design, the 5' and 3' most nucleosides of the gap region are DNA nucleosides, located adjacent to sugar-modified nucleosides in the 5' (F) or 3' (F') region, respectively. The flanks may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., at the 5' end of the 5' flank and the 3' end of the 3' flank.
[0170] The region FG-F' forms a contiguous nucleotide sequence. The antisense oligonucleotide of the present invention or its contiguous nucleotide sequence may comprise a gapmer region of the formula FG-F'.
[0171] The total length of the gapmer designed FG-F' may be, for example, 12 to 32 nucleosides, for example, 13 to 24, for example, 14 to 22 nucleosides, for example, 14 to 17, for example, 16 to 18 nucleosides, for example, 16 to 20 nucleotides.
[0172] By way of example, a gapmer oligonucleotide of the present invention can be represented by the following formula: F 1-8 -G 6-16 -F' 2-8 ,for example F 2-8 -G 6-14 -F' 2-8 ,for example F 3-8 -G 6-14 -F' 2-8 However, the total length of the gapmer region FG-F' is at least 10, at least 12, for example at least 14 nucleotides in length.
[0173] In one embodiment of the invention, the antisense oligonucleotide or its contiguous nucleotide sequence consists of or comprises a gapmer of the formula 5'-FG-F'-3', in which regions F and F' independently comprise or consist of 1 to 8 nucleosides, 2 to 4 of which are 2' sugar modified, define the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H.
[0174] Regions F, G, and F' are further defined below and can be combined into the formula FG-F'.
[0175] Gapmer region G The region G (gap region) of the gapmer is a region of nucleosides, typically DNA nucleosides, that allows the oligonucleotide to recruit RNase H, e.g. human RNase H1. RNase H is a cellular enzyme that recognizes a duplex between DNA and RNA and enzymatically cleaves the RNA molecule. Suitably, the gapmer may have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, such as 5-16 consecutive DNA nucleosides, such as 6-15 consecutive DNA nucleosides, such as 7-14 consecutive DNA nucleosides, such as 8-12 consecutive DNA nucleotides, such as 8-12 consecutive DNA nucleotides in length. The gap region G may in some embodiments consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides. The cytosine (C) DNA in the gap region may in some cases be methylated, such that such residues include 5'-methyl-cytosine ( me C, or e instead of c). Methylation of cytosine DNA in the gap is advantageous when a cg dinucleotide is present in the gap to reduce potential toxicity, and the modification does not significantly affect the potency of the oligonucleotide. 5'-substituted DNA nucleosides, such as 5'-methyl DNA nucleosides, have been reported for use in DNA gap regions (European Patent Application Publication No. EP2742136).
[0176] In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate linked DNA nucleosides, hi some embodiments, all internucleoside linkages within the gap are phosphorothioate linkages.
[0177] A traditional gapmer has a DNA gap region, but there are numerous examples of modified nucleosides that allow for RNase H recruitment when used within the gap region. Modified nucleosides that have been reported as capable of recruiting RNase H when contained within the gap region include, for example, α-L-LNA, C4'-alkylated DNA (as described in International Application No. PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) pp. 2296-2300, both of which are incorporated herein by reference), arabinose-derived nucleosides such as ANA and 2'F-ANA (Mangos et al., (2003) J. AM. CHEM. SOC. 125: 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst. (2009) vol. 10: 1039, which is incorporated herein by reference). UNAs are typically unlocked nucleic acids in which the bond between C2 and C3 of the ribose has been removed to form an unlocked "sugar" residue. The modified nucleosides used in such gapmers can be nucleosides that adopt a 2'endo (DNA-like) structure when introduced into the gap region (i.e., modifications that allow RNase H recruitment). In some embodiments, the DNA gap regions (G) described herein may optionally contain 1-3 sugar modified nucleosides that adopt a 2'endo (DNA-like) structure when introduced into the gap region.
[0178] Area G - "Gap Breaker" Alternatively, there are many reports of inserting modified nucleosides that confer a 3'-endo conformation to the gap region of a gapmer while retaining some RNase H activity. Such gapmers with a gap region containing one or more 3'-endo modified nucleosides are referred to as "gap breaker" or "gap-disrupting" gapmers. See, for example, International Publication No. WO 2013 / 022984. Gap breaker oligonucleotides retain a sufficient region of DNA nucleosides within the gap region to allow RNase H recruitment. The ability of a gap breaker oligonucleotide design to recruit RNase H is typically sequence or compound specific (see Rukov et al. (2015) Nucl. Acids Res. 43:8476-8487). This discloses "gap breaker" oligonucleotides that recruit RNase H, which in some cases provides more specific cleavage of the target RNA. Modified nucleosides used within the gap region of a gap breaker oligonucleotide may be, for example, modified nucleosides that confer 3' end confirmation, such as 2'-O-methyl (OMe) or 2'-O-MOE (MOE) nucleosides, or β-D LNA nucleosides (in which the bridge between the C2' and C4' of the ribose sugar ring of the nucleoside is in the β conformation), such as β-D-oxy LNA or ScET nucleosides.
[0179] Similar to the gapmer containing region G described above, the gap region of a gap breaker or gap disrupting gapmer has a DNA nucleoside at the 5' end of the gap (adjacent to the 3' nucleoside of region F) and a DNA nucleoside at the 3' end of the gap (adjacent to the 5' nucleoside of region F). Gapmers that contain disruptive gaps typically retain a region of at least three or four contiguous DNA nucleosides at either the 5' or 3' end of the gap region.
[0180] Exemplary designs of gap breaker oligonucleotides include: F 1-8 -[D 3-4-E1-D 3-4 ] - F' 1-8 F 1-8 -[D 1-4 -E1-D 3-4 ]-F' 1-8 F 1-8 -[D 3-4 -E1-D 1-4 ]-F' 1-8 The region G includes [D n -E r -D m ], D is a consecutive sequence of DNA nucleosides, E is a modified nucleoside (gap breaker or gap disrupting nucleoside), and F and F' are flanking regions as defined herein, with the proviso that the total length of the gapmer region FG-F' is at least 12, e.g., at least 14 nucleotides in length.
[0181] In some embodiments, region G of the gap disrupting gapmer comprises at least 6 DNA nucleosides, e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 DNA nucleosides. As noted above, the DNA nucleosides may be contiguous or may optionally be interspersed with one or more modified nucleosides, provided that gap region G is capable of mediating RNase H recruitment.
[0182] Gapmer flanking regions, F and F' Region F is positioned immediately adjacent to the 5' DNA nucleoside of region G. The 3'-most nucleoside of region F is a sugar-modified nucleoside, such as a high affinity sugar-modified nucleoside, such as a 2'-substituted nucleoside, such as an MOE nucleoside, or an LNA nucleoside.
[0183] Region F' is positioned immediately adjacent to the 3' DNA nucleoside of region G. The 5'-most nucleoside of region F' is a sugar-modified nucleoside, such as a high affinity sugar-modified nucleoside, such as a 2'-substituted nucleoside, such as an MOE nucleoside, or an LNA nucleoside.
[0184] Region F is 1 to 8 contiguous nucleotides in length, such as 2 to 6, such as 3 to 4 contiguous nucleotides in length. Advantageously, the 5'-most nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two 5'-most nucleosides of region F are sugar-modified nucleosides. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-most nucleosides of region F are 2'-substituted nucleosides, such as two 3'MOE nucleosides. In some embodiments, the 5'-most nucleosides of region F are 2'-substituted nucleosides, such as MOE nucleosides.
[0185] Region F' is 2 to 8 contiguous nucleotides in length, such as 3 to 6, such as 4 to 5 contiguous nucleotides in length. Advantageously, the 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are 2'-substituted nucleosides, such as two 3' MOE nucleosides. In some embodiments, the 3'-most nucleosides of region F' are 2'-substituted nucleosides, such as MOE nucleosides.
[0186] It should be noted that when the length of region F or region F' is 1, it is an LNA nucleoside.
[0187] In some embodiments, region F and region F' independently consist of or comprise a contiguous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F may be independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.
[0188] In some embodiments, region F and region F' independently comprise both LNA and 2'-substituted modified nucleosides (mixed wing design).
[0189] In some embodiments, region F and region F' are composed of only one type of sugar modified nucleoside, for example only MOE, or only β-D-oxy LNA, or only ScET. Such designs are also referred to as uniform flank or uniform gapmer designs.
[0190] In some embodiments, all nucleosides of regions F or F', or F and F', are LNA nucleosides, e.g., independently selected from β-D-oxy LNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1-5, e.g., 2-4, e.g., 3-4, e.g., 1, 2, 3, 4, or 5 contiguous LNA nucleosides. In some embodiments, all nucleosides of regions F and F' are β-D-oxy LNA nucleosides.
[0191] In some embodiments, all nucleosides of region F or F', or F and F', are 2'-substituted nucleosides, such as OMe or MOE. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 contiguous OMe or MOE nucleosides. In some embodiments, only one of the flanking regions can consist of a 2'-substituted nucleoside, such as an OMe or MOE nucleoside. In some embodiments, it is the 5' (F) flanking region that consists of a 2'-substituted nucleoside, such as an OMe or MOE nucleoside, while the 3' (F') flanking region comprises at least one LNA nucleoside, such as a β-D-oxyLNA nucleoside or a cET nucleoside. In some embodiments, it is the 3' (F') flanking region that consists of a 2' substituted nucleoside, such as an OMe or MOE nucleoside, while the 5' (F) flanking region comprises at least one LNA nucleoside, such as a β-D-oxyLNA nucleoside or a cET nucleoside.
[0192] In some embodiments, all modified nucleosides in regions F and F' are LNA nucleosides, e.g., independently selected from β-D-oxy LNA, ENA, or ScET nucleosides, where regions F or F', or F and F', may optionally include DNA nucleosides (alternating flanks, see these definitions for details). In some embodiments, all modified nucleosides in regions F and F' are β-D-oxy LNA nucleosides, where regions F or F', or F and F', may optionally include DNA nucleosides (alternating flanks, see these definitions for details).
[0193] In some embodiments, the 5'-most and 3'-most nucleosides of regions F and F' are LNA nucleosides, such as β-D-oxyLNA nucleosides or ScET nucleosides.
[0194] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F' and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between regions F or F', F and F' is a phosphorothioate internucleoside linkage.
[0195] LNA GapMa An LNA gapmer is a gapmer in which either one or both of regions F and F' comprises or consists of LNA nucleosides. A β-D-oxy gapmer is a gapmer in which either one or both of regions F and F' comprises or consists of β-D-oxy LNA nucleosides.
[0196] In some embodiments, the LNA gapmer has the formula: [LNA] 1-5 -[Area G]-[LNA] 1-5 where region G is as defined in the definition of gapmer region G.
[0197] In one embodiment, the LNA gapmer has the formula [LNA]4-[region G] 10-12 -[LNA]4.
[0198] MOE Gapma An MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, an MOE gapmer has the design [MOE] 1-8 -[Area G] 5-16 -[MOE] 1-8 , e.g. [MOE] 2-7 -[Understood G] 6-14 -[MOE] 2-7 , e.g. [MOE] 3-6 -[Area G] 8-12 -[MOE] 3-6 where the region G is as defined in the gapmer definition. MOE gapmers with the 5-10-5 design (MOE-DNA-MOE) are widely used in the art.
[0199] Mixed Wing Gap Ma A mixed wing gapmer is an LNA gapmer in which one or both of regions F and F' comprise a 2'-substituted nucleoside, e.g., an MOE nucleoside, independently selected from the group consisting of 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments, at least one of regions F and F', or both of regions F and F' comprise at least one LNA nucleoside, and the remaining nucleosides of regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments, at least one of regions F and F', or both of regions F and F' comprise at least two LNA nucleosides, and the remaining nucleosides of regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further comprise one or more DNA nucleosides.
[0200] Mixed wing gapper designs are disclosed in International Publication Nos. WO2008 / 049085 and WO2012 / 109395, both of which are incorporated herein by reference.
[0201] Alternating flank gapma The flanking regions may contain both LNA and DNA nucleosides and are referred to as "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing such alternating flanks are referred to as "alternating flank gapmers." An "alternating flank gapmer" is an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains DNA in addition to the LNA nucleoside(s). In some embodiments, at least one of regions F or F', or both regions F and F', contain both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking regions F or F', or both F and F', contain at least three nucleosides, where the 5'-most and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides.
[0202] Alternating flank LNA gapmers are disclosed in International Publication No. WO2016 / 127002.
[0203] The alternating flanking regions can include up to three consecutive DNA nucleosides, such as one to two, or one, or two, or three consecutive DNA nucleosides.
[0204] An alternating flak consists of several LNA nucleosides (L) followed by several DNA nucleosides (D), e.g. [L] 1-3 -[D] 1-4 -[L] 1-3 [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 can be annotated as a sequence of integers representing
[0205] In oligonucleotide design, these are often represented as numbers such that 2-2-1 represents 5'[L]2-[D]2-[L]3' and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The length of the flanks (regions F and F') in oligonucleotides with alternating flanks can be independently 3-10 nucleosides, such as 4-8 nucleosides, such as 5-6 nucleosides, such as 4, 5, 6, or 7 modified nucleosides. In some embodiments, only one of the flanks in a gapmer oligonucleotide is alternating, while the other is composed of LNA nucleotides. It can be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F') to confer additional exonuclease resistance. In one embodiment, the flanks in the alternating flank gapmer have a total length of 5-8 nucleosides, of which 3-5 are LNA nucleosides. Some examples of oligonucleotides with alternating flanks are: [L] 1-5 -[D] 1-4 -[L] 1-3 -[G] 5-16 -[L] 2-6 [L] 1-2 -[D] 2-3 -[L] 3-4 --[G] 5-7 -[L] 1-2 -[D] 2-3 -[L] 2-3 [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 -[G] 5-16 -[L] 1-2 -[D] 1-3 -[L] 2-4 [L] 1-5 -[G] 5-16 -[L]-[D]-[L]-[D]-[L]2 [L]4-[G] 6-10 -[L]-[D]3-[L]2, but However, the total length of the gapmer is at least 12, such as at least 14, nucleotides in length.
[0206] Region D' or D'' in the oligonucleotide The oligonucleotides of the invention may, in some embodiments, comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to a target nucleic acid, such as a gapmer FG-F', and further 5' and / or 3' nucleosides. The further 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.
[0207] The addition of region D' or D'' may be used for the purpose of linking a contiguous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used to link a conjugate moiety to a conjugate moiety, it may serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture.
[0208] Regions D' and D'' can be linked to the 5' end of region F or the 3' end of region F', respectively, and are represented by the following formulas: D'-FG-F', FG-F'-D'' or
[0209] A D'-FG-F'-D'' design can be generated, where FG-F' is the gapmer portion of the oligonucleotide and the regions D' or D'' constitute separate portions of the oligonucleotide.
[0210] Regions D' or D'' independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' regions are not sugar-modified nucleotides, e.g., DNA or RNA or base-modified versions thereof. The D' and D' regions may serve as nuclease-sensitive biocleavable linkers (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as regions D' and D'' are disclosed in International Publication No. WO2014 / 076195, which includes, as examples, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in International Publication No. WO2015 / 113922, where they have been used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.
[0211] In one embodiment, the oligonucleotide of the present invention comprises regions D' and / or D'' in addition to the contiguous nucleotide sequence that constitutes the gapmer.
[0212] In some embodiments, the oligonucleotides of the invention can be represented by the following formula: FG-F'; especially, F 2-8 -G 6-16 -F' 2-8 D'-FG-F', especially D' 2-3 -F 1-8 -G 6-16 -F' 2-8 FG-F'-D'', especially F 2-8 -G 6-16 -F' 2-8 -D'' 1-3 D'-FG-F'-D'', especially D' 1-3 -F 2-8 -G 6-16 -F' 2-8-D'' 1-3
[0213] In some embodiments, the internucleoside linkage located between region D' and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage located between region F' and region D'' is a phosphodiester linkage.
[0214] Conjugates The term conjugate as used herein refers to an oligonucleotide covalently attached to a non-nucleotide moiety (the conjugate moiety or region C or the third region).
[0215] Conjugation of the oligonucleotide of the present invention to one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotide, for example, by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. In some embodiments, the conjugate moiety regulates or improves the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide. In particular, the conjugate can target the oligonucleotide to a specific organ, tissue, or cell type, thereby enhancing the efficacy of the oligonucleotide in that organ, tissue, or cell type. At the same time, the conjugate can help reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs (e.g., off-target activity or activity in non-target cell types, tissues, or organs).
[0216] Oligonucleotide conjugates and their synthesis are also reported in a comprehensive review by Manoharan, Antisense Drug Technology, Principles, Strategies, and Applications, edited by S. T. Crooke, Chapter 16, Marcel Dekker, Inc. (2001) and Manoharan, Antisense and Nucleic Acid Drug Development (2002) Vol. 12, p. 103, each of which is incorporated herein by reference in its entirety.
[0217] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug substance, a hormone, a lipophile, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.
[0218] In some embodiments, the conjugate is an antibody or antibody fragment having specific affinity for the transferrin receptor, e.g., as disclosed in International Publication No. WO 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, e.g., an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment that targets the transferrin receptor.
[0219] linker A bond or linker is a connection between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest through one or more covalent bonds. A conjugate moiety can be attached to an oligonucleotide directly or through a linking moiety (e.g., a linker or tether). A linker serves to covalently link a third region (region C), such as a conjugate moiety, to a first region (region A), such as an oligonucleotide or a continuous nucleotide sequence that is complementary to a target nucleic acid.
[0220] In some embodiments of the invention, the conjugate or oligonucleotide conjugate of the invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
[0221] Region B refers to a biocleavable linker that comprises or consists of a physiologically labile bond that is cleavable under conditions normally or similar to those encountered in a mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions, or drugs, and salt concentrations similar to those found or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment, the nuclease-sensitive linker comprises 1-10 nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably 2-6 nucleosides, and most preferably 2-4 linked nucleosides, which comprise at least two consecutive phosphodiester bonds, such as at least 3 or 4 or 5 consecutive phosphodiester bonds. Preferably, the nucleosides are DNA or RNA. Phosphodiester-containing biocleavable linkers are described in more detail in International Publication No. WO2014 / 076195, which is incorporated herein by reference.
[0222] Region Y refers to a linker that is not necessarily biocleavable, but serves primarily to covalently link the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). Region Y linkers may include chain structures or oligomers of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugates of the present invention can be constructed from the following region elements AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as, for example, a C2-C36 aminoalkyl group, including, for example, a C6-C12 aminoalkyl group. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.
[0223] treatment The term "treatment" as used herein refers to both the treatment of an existing disease (e.g., a disease or disorder referred to herein) or the prevention of disease, i.e., prophylaxis. Thus, it will be appreciated that the treatment referred to herein may, in some embodiments, be prophylactic.
[0224] In some embodiments, the treatment is administered to a patient who has been diagnosed with a neurological disorder, such as a neurological disorder selected from the group consisting of Tauopathies, Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), frontotemporal dementia (FTD) and FTD with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic grain disease (AGD), predominantly senile dementia (TPSD), primary age-related tauopathies (PART), Down's syndrome, and neurodegenerative diseases including Ritiko-Bodig's disease. Pathological Tau upregulation is associated with infantile Tauopathies, including hemimegalencephaly (HME), tuberous sclerosis, focal cortical dysplasia type 2b, and ganglioglioma. In addition, abnormal Tau expression and / or function may be associated with other diseases such as Hallervorden-Spatz syndrome, also known as neurodegeneration with brain iron accumulation type 1 (NBIA1), gangliocytoma, and subacute sclerosing panencephalitis. Tau may also play a role in seizure disorders (e.g., epilepsy), network dysfunction (e.g., depression), and movement disorders (e.g., Parkinson's disease). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0225] The oligonucleotides of the present invention The present invention relates to oligonucleotides capable of modulating the expression of Tau, for example inhibiting (downregulating) Tau. This modulation is achieved by hybridizing to a target nucleic acid encoding Tau. The target nucleic acid may be a mammalian MAPT mRNA sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1 and 2.
[0226] The oligonucleotides of the present invention are antisense oligonucleotides targeting MAPT, which result in a decrease in Tau expression.
[0227] In some embodiments, the antisense oligonucleotides of the present invention can modulate by inhibiting or downregulating the expression of the target. Preferably, such modulation results in at least 20% inhibition compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the normal expression level of the target. In some embodiments, the oligonucleotides of the present invention can inhibit the expression level of Tau mRNA by at least 60% or 70% in vitro after application of 5 μM oligonucleotide to primary neuronal cells. In some embodiments, the compounds of the present invention can inhibit the expression level of Tau protein by at least 50% in vitro after application of 0.5 μM oligonucleotide to primary neuronal cells. Advantageously, the examples provide assays that can be used to measure Tau RNA or protein inhibition (e.g., Examples 1 and 3). Target modulation is caused by hybridization between the consecutive nucleotide sequences of the oligonucleotide and the target nucleic acid. In some embodiments, the oligonucleotides of the present invention include mismatches between the oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to indicate the desired modulation of Tau expression. The decrease in binding affinity resulting from the mismatch may be advantageously compensated for by increasing the number of nucleotides in the oligonucleotide and / or the number of modified nucleosides that can increase the binding affinity to the target, for example, increasing the number of 2' sugar modified nucleosides, including LNA, present in the oligonucleotide sequence.
[0228] One aspect of the present invention relates to an antisense oligonucleotide comprising a contiguous nucleotide sequence of 10 nucleotides in length having at least 90% complementarity to SEQ ID NO:3, 4, or 5.
[0229] In some embodiments the oligonucleotide comprises a contiguous sequence of 10-30 nucleotides in length that is at least 90% complementary to a region of a target nucleic acid or target sequence, such as at least 91%, for example at least 92%, such as at least 93%, for example at least 94%, such as at least 95%, for example at least 96%, for example at least 97%, such as at least 98%, or 100% complementary.
[0230] It is advantageous if the oligonucleotides of the present invention or their contiguous nucleotide sequences are fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may contain one or two mismatches between the oligonucleotide and the target nucleic acid.
[0231] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary, such as fully (or 100%) complementary to contiguous nucleotides within positions 12051-12111, 39562-39593, or 72837-72940 of SEQ ID NO:1.
[0232] In some embodiments, the oligonucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO:1 and SEQ ID NO:2.
[0233] It is advantageous if the antisense oligonucleotide is complementary to a target sequence selected from one of the regions listed in Table 4. In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, e.g., fully complementary to a selected R1-R2254 target sequence (Table 4). In some embodiments, the oligonucleotide sequence is 100% complementary to R_223, R_738, or R_1298 (see Table 4).
[0234] In some embodiments, the oligonucleotide or contiguous nucleotide sequence is 90% complementary, e.g., fully complementary, to a region of a target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of positions 12051-12111 of SEQ ID NO:1, e.g., positions 12051-12079, 12085-12111, or 12060-12078 of SEQ ID NO:1.
[0235] In another embodiment, the oligonucleotide or contiguous nucleotide sequence is 90% complementary, e.g., fully complementary, to a region of a target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of positions 39562-39593 of SEQ ID NO:1, e.g., positions 39573-39592 of SEQ ID NO:1.
[0236] In another embodiment, the oligonucleotide or contiguous nucleotide sequence is 90% complementary, e.g., fully complementary, to a region of a target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of positions 72837-72940 of SEQ ID NO:1, e.g., positions 72861-72891 or 72862-72890 of SEQ ID NO:1.
[0237] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 16 to 22 nucleotides, e.g., 16 to 20 nucleotides, in length that is 100% complementary to contiguous nucleotides within positions 12060 to 12078, or positions 39573 to 39592, or positions 72862 to 72890 of SEQ ID NO:1.
[0238] In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 35 nucleotides in length, such as 10 to 30, such as 11 to 25, such as 12 to 22, such as 14 to 20, or 14 to 18 consecutive nucleotides in length. In one embodiment, the oligonucleotide comprises or consists of 16 to 22 nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 16 to 20 nucleotides in length.
[0239] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or fewer nucleotides, such as 20 or fewer nucleotides, such as 16, 17, 18, 19, or 20 nucleotides. Any range provided herein should be understood to include the endpoints of the range. Thus, when an oligonucleotide is described as comprising 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.
[0240] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. In preferred embodiments, the oligonucleotide comprises or consists of 16, 17, 18, 19, or 20 nucleotides in length.
[0241] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of the sequences listed in Table 5 (Materials and Methods section).
[0242] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NOs: 6 to 65 (see motif sequences listed in Table 5).
[0243] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NOs: 9, 11, 49, 53, 56, and 62 (see motif sequences listed in Table 5).
[0244] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10-30 nucleotides that is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NOs: 6-37 (see motif sequences listed in Table 5).
[0245] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to the sequence of SEQ ID NO: 9 or 11 (see motif sequences listed in Table 5).
[0246] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NOs: 38 to 51 (see motif sequences listed in Table 5).
[0247] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to the sequence of SEQ ID NO: 49 or 51 (see motif sequences listed in Table 5).
[0248] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to a sequence selected from the group consisting of SEQ ID NOs: 52 to 65 (see motif sequences listed in Table 5).
[0249] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides that is at least 90% identical, preferably 100% identical, to the sequence of SEQ ID NO: 56 or 62 (see motif sequences listed in Table 5).
[0250] It is understood that the consecutive nucleobase sequence (motif sequence) may be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.
[0251] The pattern in which modified nucleosides (such as high affinity modified nucleosides) are incorporated into an oligonucleotide sequence is commonly referred to as the oligonucleotide design.
[0252] The oligonucleotides of the invention are designed with modified nucleosides and DNA nucleosides. It is advantageous to use high affinity modified nucleosides.
[0253] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 1-10 modified nucleosides, such as 2-9 modified nucleosides, such as 3-8 modified nucleosides, such as 4-7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described in the "Definitions" sections of "Modified Nucleosides", "High Affinity Modified Nucleosides", "Sugar Modifications", "2' Sugar Modifications", and Locked Nucleic Acid (LNA).
[0254] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2' sugar-modified nucleosides.Preferably, the oligonucleotide of the present invention comprises one or more 2' sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).
[0255] In further embodiments, the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the "Definitions" section under "Modified Internucleoside Linkages". It is advantageous if at least 75%, such as 80%, such as all internucleoside linkages in a contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments, all internucleoside linkages in a contiguous sequence of the oligonucleotide are phosphorothioate linkages.
[0256] In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as 2-6 LNA nucleosides, such as 3-7 LNA nucleosides, 4-8 LNA nucleosides, or 3, 4, 5, 6, 7, or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides, in particular β-D-oxyLNA or ScET. In still further embodiments, all of the modified nucleosides in the oligonucleotide are LNA nucleosides. In further embodiments, the oligonucleotide may comprise both β-D-oxy-LNA and one or more of the following LNA nucleosides: thio-LNA in either β-D or α-L configuration, amino-LNA, oxy-LNA, ScET, and / or ENA, or a combination thereof. In further embodiments, all LNA cytosine units are 5-methyl-cytosine. For nuclease stability of an oligonucleotide or a contiguous nucleotide sequence, it is advantageous to have at least one LNA nucleoside at the 5' end and at least two LNA nucleosides at the 3' end of the nucleotide sequence.
[0257] In one embodiment of the invention, the oligonucleotide of the invention is capable of recruiting RNase H.
[0258] In the present invention, advantageous structural designs are those described in the "Definitions" section, e.g. "Gapmer", "LNA Gapmer", "MOE Gapmer", "Mixed Wing Gapmer", "Alternating Flank Gapmer". Gapmer designs include uniform flank, mixed wing flank, alternating flank and gap breaker designed gapmers. In the present invention, the oligonucleotide of the invention is advantageous when it is a gapmer of FG-F' design, in particular a gapmer of the formula 5'-FG-F'-3', where the regions F and F' independently comprise 1-8 nucleosides, 2-5 of which are 2' sugar modified and define the 5' and 3' ends of the F and F' regions, and G is a region of 6-16 nucleosides capable of recruiting RNase H, e.g. a region comprising 6-16 DNA nucleosides.
[0259] In some embodiments the gapmer is an LNA gapmer.
[0260] In some embodiments of the invention, the LNA gapmer is selected from the following uniform flank designs: 4-10-4, 3-11-4, 4-11-4, 4-12-4, or 4-14-2.
[0261] In some embodiments of the invention, the LNA gapmer is selected from the following alternating flank designs: 3-1-3-10-2, 1-3-4-6-1-3-2, 1-2-1-2-2-8-4, or 3-3-1-8-2-1-2.
[0262] Table 5 (Materials and Methods section) lists the preferred designs for each motif sequence.
[0263] In all cases, the FG-F' design may further comprise regions D' and / or D" as described in the "Definitions" section of "Region D' or D" in an Oligonucleotide." In some embodiments, oligonucleotides of the invention have one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region.
[0264] For some embodiments of the invention, the oligonucleotides are selected from the group consisting of CMP numbers 6_1, 7_1, 8_1, 9_1, 9_2, 9_3, 9_4, 9_5, 9_6, 9_7, 9_8, 9_9, 9_10, 9_11, 9_12, 9_13, 9_14, 9_15, 9_16, 9_17, 9_18, 9_19, 9_20, 9_21, 9_22, 9_23, 9_24, 9_25, 9_26, 9_27, 9_28, 9_29, 9_30, 9_31, 9_32, 9_33, 9_34, 9_35, 9_36, 9_37, 9_38, 9_39, 9_40, 9_41, 9_42, 9_43, 9_44, 9_45, 9_46, 9_47, 9_48, 9_49, 9_50, 9_51, 9_52, 9_53, 9_54, 9_55, 9_56, 9_57, 9_58, 9_59, 9_60, 9_61, 9_62, 9_63, 9_64, 9_65, 9_66, 9_67, 9_68, 9_69, 9_70, 9_71, 9_72, 9_73, 9_74, 9_75, 9_76, 9_77, 9_78, 9_79, 9_80, 9_8 43, 9_44, 9_45, 9_46, 9_47, 9_48, 9_49, 9_50, 9_51, 9_52, 9_53, 9_54, 9_55, 9_56, 9_57, 9_58, 9_59, 9_60, 9_61, 9_62, 9_63, 9_64, 9_65, 9_66, 9_67, 9 _68, 9_69, 9_70, 9_71, 9_72, 9_73, 9_74, 9_75, 9_76, 9_77, 9_78, 9_79, 9_80, 9_81, 9_82, 9_83, 9_84, 9_85, 9_86, 9_87, 9_88, 9_89, 9_90, 9_91, 9_92, 9 _93, 9_94, 9_95, 9_96, 9_97, 9_98, 9_99, 9_100, 9_101, 9_102, 9_103, 9_104, 9_105, 9_106, 10_1, 10_2, 10_3, 10_4, 10_5, 10_6, 10_7, 10_8, 10_9, 10_ 10, 10_11, 10_12, 10_13, 10_14, 10_15, 10_16, 10_17, 10_18, 10_19, 10_20, 10_21, 10_22, 10_23, 10_24, 10_25, 10_26, 10_27, 10_28, 10_29, 10_30, 10 _31, 10_32, 10_33, 10_34, 10_35, 10_36, 10_37, 10_38, 10_39, 10_40, 10_41, 10_42, 10_43, 10_44, 10_45, 10_46, 10_47, 10_48, 10_49, 10_50, 10_51, 1 0_52, 10_53, 10_54, 10_55, 10_56, 10_57, 10_58, 10_59, 10_60, 10_61, 10_62, 10_63, 10_64, 10_65, 10_66, 10_67, 10_68, 10_69, 10_70, 10_71, 10_72,10_73、10_74、10_75、10_76、10_77、10_78、10_79、10_80、10_81、10_82、10_83、10_84、10_85、10_86、10_87、10_88、10_89、11_1、12_1、13_1、14_1、15_1、16_1、17_1、18_1、19_1、20_1、21_1、22_1、23_1、24_1、24_2、24_3、24_4、24_5、24_6、24_7、24_8、24_9、24_10、24_11、24_12、24_13、24_14、24_15、24_16、24_17、24_18、24_19、24_20、24_21、24_22、24_23、24_24、24_25、24_26、24_27、24_28、24_29、24_30、24_31、24_32、24_33、24_34、24_35、24_36、24_37、24_38、24_39、24_40、24_41、24_42、24_43、24_44、24_45、24_46、24_47、24_48、24_49、24_50、24_51、24_52、24_53、24_54、24_55、24_56、24_57、24_58、24_59、24_60、24_61、24_62、25_1、25_2、25_3、25_4、25_5、25_6、25_7、25_8、25_9、25_10、25_11、25_12、25_13、25_14、25_15、25_16、25_17、25_18、25_19、25_20、25_21、25_22、25_23、25_24、25_25、25_26、25_27、25_28、25_29、25_30、25_31、25_32、25_33、25_34、25_35、25_36、25_37、25_38、25_39、25_40、25_41、25_42、25_43、26_1、26_2、26_3、26_4、26_5、26_6、26_7、26_8、26_9、26_10、26_11、26_12、26_13、26_14、26_15、26_16、26_17、26_18、26_19、26_20、26_21、26_22、26_23、26_24、26_25、26_26、26_27、26_28、26_29、26_30、26_31、27_1、28_1、28_2、28_3、28_4、28_5、28_6、28_7、28_8、28_9、28_10、28_11、28_12、28_13、28_14、28_15、28_16、28_17、28_18、28_19、28_20、28_21、28_22、28_23、28_24、28_25、28_26、28_27、28_28、28_29、28_30、28_31、28_32、28_33、29_1、29_2、29_3、29_4、29_5、29_6、29_7、29_8、29_9、29_10、29_11、29_12、29_13、29_14、30_1、30_2、30_3、30_4、30_5、30_6、30_7、30_8、30_9、30_10、30_11、30_12、30_13、30_14、30_15、30_16、30_17、30_18、30_19、30_20、30_21、30_22、30_23、30_24、30_25、31_1、31_2、31_3、32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_15、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_24、32_25、32_26、32_27、32_28、32_29、32_30、32_31、32_32、32_33、32_34、32_35、32_36、32_37、32_38、32_39、32_40、32_41、32_42、32_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、33_1、33_2、33_3、33_4、33_5、33_6、33_7、33_8、33_9、33_10、33_11、33_12、33_13、33_14、33_15、33_16、33_17、33_18、33_19、33_20、33_21、33_22、33_23、33_24、33_25、33_26、33_27、33_28、33_29、33_30、33_31、33_32、33_33、34_1、35_1、35_2、35_3、36_1、37_1、38_1、39_1、40_1、41_1、42_1、43_1、44_1、45_1、46_1、47_1、48_1、49_1、49_2、49_3、49_4、49_5、49_6、49_7、49_8、49_9、49_10、49_11、49_12、49_13、49_14、49_15、49_16、49_17、49_18、49_19、49_20、49_21、49_22、49_23、49_24、49_25、49_26、49_27、49_28、49_29、49_30、49_31、49_32、49_33、49_34、49_35、49_36、49_37、49_38、49_39、49_40、49_41、49_42、49_43、49_44、49_45、49_46、49_47、49_48、49_49、49_50、49_51、49_52、49_53、49_54、49_55、49_56、49_57、49_58、49_59、49_60、49_61、49_62、49_63、49_64、49_65、49_66、49_67、49_68、49_69、49_70、49_71、49_72、49_73、49_74、49_75、49_76、49_77、49_78、49_79、49_80、49_81、49_82、49_83、49_84、49_85、49_86、49_87、49_88、49_89、49_90、49_91、49_92、49_93、49_94、49_95、49_96、49_97、49_98、49_99、49_100、49_101、49_102、49_103、49_104、49_105、49_106、49_107、49_108、49_109、49_110、49_111、49_112、49_113、49_114、49_115、49_116、49_117、49_118、49_119、49_120、49_121、49_122、49_123、49_124、49_125、49_126、49_127、49_128、49_129、49_130、49_131、49_132、49_133、49_134、49_135、49_136、49_137、49_138、49_139、49_140、49_141、49_142、49_143、49_144、49_145、49_146、49_147、49_148、49_149、49_150、49_151、49_152、49_153、49_154、49_155、49_156、49_157、49_158、49_159、49_160、49_161、49_162、49_163、49_164、49_165, 49_166, 49_167, 49_168, 49_169, 49_170, 49_171, 49_172, 49_173, 49_174, 49_175, 49_176, 49_177, 49_178, 49_179, 49_180, 49_181, 49_182, 49_183, 49_184, 49_185, 49_1 86, 49_187, 49_188, 49_189, 49_190, 49_191, 49_192, 50_1, 51_1, 52_1, 53_1, 54_1, 55_1, 56_1, 57_1, 58_1, 59_1, 60_1, 61_1, 62_1, 63_1, 64_1, and 65_1.
[0265] For certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 9_102, 9_103, 9_104, 11_1, 49_38, 49_51, 49_179, 49_189, 53_1, 56_1, and 62_1.
[0266] For certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 9_102, 9_103, 9_104, and 11_1.
[0267] For certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 49_38, 49_51, 49_179, and 49_189.
[0268] For certain embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 53_1, 56_1, and 62_1. Particularly advantageous antisense oligonucleotides in the context of the present invention are [ka] The oligonucleotide compound is selected from the group consisting of:
[0269] where capital letters are β-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, all LNA C's are 5-methylcytosine and all internucleoside linkages are phosphorothioate internucleoside linkages.
[0270] In one embodiment, the antisense oligonucleotide is CMP number 9_103, as shown in FIG.
[0271] In one embodiment, the antisense oligonucleotide is CMP number 9_104, as shown in FIG.
[0272] In one embodiment, the antisense oligonucleotide is CMP number 11_1, as shown in FIG.
[0273] In one embodiment, the antisense oligonucleotide is CMP number 49_38, as shown in FIG.
[0274] In one embodiment, the antisense oligonucleotide is CMP number 49_189, as shown in FIG.
[0275] Manufacturing method In a further aspect, the invention provides a method for making an oligonucleotide of the invention, comprising reacting nucleotide units to thereby form covalently linked contiguous nucleotide units comprising an oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al. (1987) Methods in Enzymology vol. 154, pp. 287-313). In a further embodiment, the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently link the conjugated moiety to the oligonucleotide. In a further aspect, a method for making a composition of the invention is provided, comprising mixing an oligonucleotide or conjugated oligonucleotide of the invention with a pharma- ceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.
[0276] Pharmaceutical Salts The compounds of the present invention may exist in the form of their pharma- ceutically acceptable salts. The term "pharma- ceutically acceptable salts" refers to conventional acid or base addition salts that retain the biological effectiveness and properties of the compounds of the present invention and are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutical compounds into salts is a technique well known to pharmacists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development (2000), Vol. 4, pp. 427-435, or Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th Edition (1995), pp. 196 and 1456-1457. For example, a pharma- ceutically acceptable salt of the compounds provided herein can be a sodium salt.
[0277] In a further aspect, the present invention provides a pharma- ceutically acceptable salt of the antisense oligonucleotide or conjugate thereof. In a preferred embodiment, the pharma- ceutically acceptable salt is a sodium or potassium salt.
[0278] Pharmaceutical Compositions In a further aspect, the present invention provides a pharmaceutical composition comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates or salts thereof, and a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS) and pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharma- ceutically acceptable diluent is sterile phosphate-buffered saline. In some embodiments, the oligonucleotide is used in the pharma- ceutically acceptable diluent at a concentration of 50-300 μM solution.
[0279] Suitable formulations for use in the present invention can be found in "Remington's Pharmaceutical Sciences", Mack Publishing Company, Philadelphia, PA, 17th Edition (1985). For a brief review of methods of drug delivery, see, for example, Langer (Science, vol. 249, pp. 1527-1533 (1990)). International Publication No. WO2007 / 031091 provides further suitable and preferred examples of pharma-ceutically acceptable diluents, carriers and adjuvants (herein incorporated by reference). Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in International Publication No. WO2007 / 031091.
[0280] The oligonucleotide or oligonucleotide conjugate of the present invention may be mixed with pharma- ceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and method for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.
[0281] These compositions may be sterilized by conventional sterilization techniques or may be sterile and filtered. The resulting aqueous solutions may be packaged for use as is or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparation will typically be 3-11, more preferably 5-9 or 6-8, most preferably 7-8, e.g., 7-7.5. The resulting solid form compositions may be packaged in a plurality of single dose units, each containing a fixed amount of the agent or agents, such as a sealed package of tablets or capsules. The solid form compositions may also be packaged in flexible volume containers, such as squeezable tubes designed for topically applicable creams or ointments.
[0282] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. Particularly with respect to oligonucleotide conjugates, when the prodrug is delivered to the site of action, e.g., a target cell, the conjugate moiety is cleaved from the oligonucleotide.
[0283] Purpose The oligonucleotides of the invention can be utilized, for example, as research reagents for diagnosis, therapy and prophylaxis.
[0284] In research, such oligonucleotides can be used to specifically regulate the synthesis of Tau protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating the functional analysis of the target or the evaluation of its usefulness as a target for therapeutic intervention.Typically, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting a modulator of the gene or mRNA that produces the protein.
[0285] For research or diagnostic uses of the oligonucleotides of the invention, the target nucleic acid can be cDNA or synthetic nucleic acid derived from DNA or RNA.
[0286] The present invention provides an in vivo or in vitro method for modulating Tau expression in a target cell expressing Tau, the method comprising administering to said cell an effective amount of an oligonucleotide of the invention.
[0287] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells forming part of mammalian tissue. In a preferred embodiment, the target cells are present in the brain or central nervous system. In particular, cells of the brainstem, cerebellum, cerebal cortex, frontal cortex, medulla / pons and midbrain, and spinal cord are relevant target regions. For the treatment of progressive supranuclear palsy (PSP), targeted reduction in the brain regions medulla / pons and midbrain is advantageous. For the treatment of Alzheimer's, targeted reduction in the cerebral cortex, medulla / pons, midbrain regions of the brain is advantageous. In particular, for neurons, the important cell types are nerve cells, neurons, axons, and basal ganglia.
[0288] In diagnostics, oligonucleotides can be used to detect and quantitate MAPT expression in cells and tissues by Northern blotting, in situ hybridization, or similar techniques.
[0289] For therapeutic purposes, the oligonucleotides can be administered to an animal or human suspected of having a disease or disorder that can be treated by modulating the expression of Tau.
[0290] The present invention provides a method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.
[0291] The present invention also relates to an oligonucleotide, a composition or a conjugate as defined herein for use as a medicament.
[0292] The oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions according to the invention are typically administered in effective amounts.
[0293] The present invention also provides the use of an oligonucleotide or an oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder referred to herein or for a method of treatment of a disorder referred to herein.
[0294] The diseases or disorders referred to herein are associated with the expression of Tau. In some embodiments, the diseases or disorders may be associated with mutations in the Tau gene or in genes whose protein products associate with or interact with Tau. Thus, in some embodiments, the target nucleic acid is a mutated form of the Tau sequence, and in other embodiments, the target nucleic acid is a regulator of the Tau sequence.
[0295] The methods of the present invention are preferably used for the treatment or prevention of a disease caused by abnormal levels and / or activity of Tau.
[0296] The present invention further relates to the use of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and / or activity of Tau.
[0297] In one embodiment, the invention relates to an oligonucleotide, an oligonucleotide conjugate, or a pharmaceutical composition for use in the treatment of a disease or disorder selected from the following: Here, the disease is selected from tauopathy, Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), frontotemporal dementia (FTD), FTDP-17, Pick's disease (PiD), argyrophilic grain disease (AGD), senile dementia with predominantly tauopathy (TPSD), primary age-related tauopathy (PART), Down's syndrome, Ritiko-Bodig's disease, and pediatric tauopathy (including unilateral megalencephaly (HME), tuberous sclerosis, focal cortical dysplasia type 2b, ganglioglioma, Hallervorden-Spatz syndrome, neurodegeneration with intracerebral iron deposition type 1 (NBIA1), gangliocytoma, subacute sclerosing panencephalitis, seizure disorders (e.g., epilepsy), network dysfunction (e.g., depression), and movement disorders (e.g., Parkinson's disease).
[0298] In certain embodiments, the disease is selected from Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), or FTDP-17.
[0299] Administration The oligonucleotide or pharmaceutical composition of the present invention can be administered parenterally (intravenous, subcutaneous, intramuscular, intracerebral, intraventricular, intraocular, or intrathecal administration, etc.).
[0300] In some embodiments, administration is via intrathecal administration.
[0301] Advantageously, eg for the treatment of neurological disorders, the oligonucleotides or pharmaceutical compositions of the invention are administered intrathecally or intracranially, eg via intracerebral or intraventricular administration.
[0302] The present invention also provides the use of an oligonucleotide or conjugate thereof, such as a pharmaceutical salt or composition of the present invention, for the manufacture of a medicament in a dosage form for subcutaneous administration.
[0303] The present invention also provides the use of an oligonucleotide or conjugate thereof of the present invention, such as a pharmaceutical salt or composition of the present invention, for the manufacture of a medicament in a dosage form for intrathecal administration.
[0304] The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament in a dosage form for intrathecal administration.
[0305] Combination therapy In some embodiments, the oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention is for use in combination therapy with another therapeutic agent, which may be, for example, a standard therapeutic agent for the disease or disorder described above.
[0306] Embodiment The following embodiments of the invention may be used in combination with any other embodiments described herein.
[0307] 1. An antisense oligonucleotide having a length of 10 to 50 nucleotides, the antisense oligonucleotide comprising a contiguous nucleotide sequence having a length of at least 10 nucleotides, for example, 10 to 30 nucleotides, and having at least 90% complementarity, for example, 100% complementarity, to any of the target sequences in Table 4 (R_1 to R_2254).
[0308] 2. The oligonucleotide of embodiment 1, wherein the target sequence is selected from any of the target regions R_223, R_738, or R_1298, corresponding to SEQ ID NO: 3, 4, or 5, respectively.
[0309] 3. The oligonucleotide according to embodiment 1 or 2, wherein the contiguous nucleotide sequence is 100% complementary to contiguous nucleotides within positions 12051 to 12111, 39562 to 39593, or 72837 to 72940 of SEQ ID NO:1.
[0310] 4. The oligonucleotide according to any one of embodiments 1 to 3, wherein the contiguous nucleotide sequence is at least 16 nucleotides and is 100% complementary to contiguous nucleotides within positions 12060 to 12078, 39573 to 39592, or 72862 to 72890 of SEQ ID NO:1.
[0311] 5. The oligonucleotide according to any one of embodiments 1 to 4, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 6 to 65.
[0312] 6. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide comprises the sequence of SEQ ID NO: 9 or 11.
[0313] 7. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide has the sequence of SEQ ID NO:49.
[0314] 8. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 53, 56, and 62.
[0315] 9. The oligonucleotide of embodiment 1, 2, or 5, or 6, wherein the contiguous nucleotide sequence has 0 to 3 mismatches compared to the target sequence to which it is complementary.
[0316] 10. The oligonucleotide of embodiment 9, wherein the contiguous nucleotide sequence has one mismatch compared to the target sequence.
[0317] 11. The oligonucleotide of embodiment 9, wherein the contiguous nucleotide sequence has two mismatches compared to the target sequence.
[0318] 12. The oligonucleotide of embodiment 9, wherein the contiguous nucleotide sequence is perfectly complementary to the target sequence.
[0319] 13. The oligonucleotide according to embodiments 1 to 12, wherein said oligonucleotide is capable of modulating the expression of Tau.
[0320] 14. The oligonucleotide according to embodiment 13, wherein the oligonucleotide is capable of reducing the expression of Tau.
[0321] 15. The oligonucleotide of embodiments 1-14, wherein the oligonucleotide is capable of hybridizing to the target sequence with a ΔG° of less than -10 kcal.
[0322] 16. The oligonucleotide according to embodiments 1 to 15, wherein the target sequence is located in RNA.
[0323] 17. The oligonucleotide of embodiment 16, wherein the RNA is mRNA.
[0324] 18. The oligonucleotide of embodiment 17, wherein the mRNA is a pre-mRNA.
[0325] 19. The oligonucleotide according to embodiments 1 to 18, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, in particular 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides.
[0326] 20. The oligonucleotide according to any one of the preceding embodiments, wherein the contiguous nucleotide sequence comprises or consists of 16 to 22 nucleotides.
[0327] 21. The oligonucleotide according to embodiment 20, wherein the contiguous nucleotide sequence comprises or consists of 18 to 20 nucleotides.
[0328] 22. The oligonucleotide according to any one of the preceding embodiments, wherein said oligonucleotide comprises or consists of a length of 14 to 30 nucleotides.
[0329] 23. The oligonucleotide according to embodiment 22, wherein said oligonucleotide comprises or consists of a length of 16 to 24 nucleotides.
[0330] 24. The oligonucleotide according to embodiment 22 or 24, wherein said oligonucleotide comprises or consists of a length of 18 to 20 nucleotides.
[0331] 25. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide or the contiguous nucleotide sequence is single-stranded.
[0332] 26. The oligonucleotide according to any one of embodiments 1 to 25, wherein the oligonucleotide is neither an siRNA nor self-complementary.
[0333] 27. The oligonucleotide of any one of the preceding embodiments, comprising one or more modified nucleosides.
[0334] 28. The oligonucleotide of embodiment 27, wherein the one or more modified nucleosides are high affinity modified nucleosides.
[0335] 29. The oligonucleotide of embodiment 27 or 28, wherein the one or more modified nucleosides are 2' sugar modified nucleosides.
[0336] 30. The oligonucleotide of embodiment 29, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleosides.
[0337] 31. The oligonucleotide of embodiment 29 or 30, wherein the one or more 2' sugar modified nucleosides are LNA nucleosides.
[0338] 32. The antisense oligonucleotide of embodiment 31, wherein the LNA nucleoside is selected from oxy-LNA, amino-LNA, thio-LNA, cET, and ENA.
[0339] 33. The antisense oligonucleotide of embodiment 31 or 32, wherein the modified LNA nucleoside is oxy-LNA having the following 2'-4' bridge -O-CH2-.
[0340] 34. The antisense oligonucleotide of embodiment 33, wherein said oxy-LNA is β-D-oxy-LNA.
[0341] 35. The antisense oligonucleotide of embodiment 31 or 32, wherein the modified LNA nucleoside is cET having the following 2'-4' bridge: -O-CH(CH3)-.
[0342] 36. The antisense oligonucleotide of embodiment 35, wherein said cET is (S)cET, i.e. 6'(S)methyl-β-D-oxy-LNA.
[0343] 37. The antisense oligonucleotide of embodiment 31 or 32, wherein said LNA is an ENA having the following 2'-4' bridge: -O-CH2-CH2-.
[0344] 38. The oligonucleotide of embodiment 29 or 30, wherein the one or more 2' sugar modified nucleosides are MOE nucleosides.
[0345] 39. The oligonucleotide according to any one of embodiments 1 to 38, wherein the oligonucleotide comprises at least one modified internucleoside linkage.
[0346] 40. The oligonucleotide of embodiment 39, wherein the modified internucleoside linkages are nuclease-resistant.
[0347] 41. The oligonucleotide according to embodiment 39 or 40, wherein at least 50% of said internucleoside linkages within said contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages.
[0348] 42. The oligonucleotide according to embodiment 39 or 41, wherein 80% of the internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
[0349] 43. The oligonucleotide according to embodiments 39-42, wherein all of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
[0350] 44. The oligonucleotide according to embodiments 1 to 43, wherein the oligonucleotide is capable of recruiting RNase H.
[0351] 45. The oligonucleotide according to embodiment 44, wherein the oligonucleotide or the contiguous nucleotide sequence is a gapmer.
[0352] 46. The oligonucleotide of embodiment 45, wherein the gapmer has the formula 5'-FG-F'-3', where the F and F' wing regions independently comprise or consist of 1 to 8 nucleosides, of which 2 to 5 are 2' sugar modified nucleosides as described in embodiments 32 to 38, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H.
[0353] 47. The antisense oligonucleotide of embodiment 46, wherein each wing region (F and F') is characterized by having at least one 2' sugar-modified nucleoside at the 5' and 3' ends of the wing, and the G region has at least one DNA nucleoside adjacent to the wing region (e.g., at the 5' and 3' ends of the G region).
[0354] 48. The oligonucleotide according to embodiment 46 or 47, wherein all of the 2' sugar modified nucleosides within regions F and F' are the same LNA nucleoside.
[0355] 49. The oligonucleotide of embodiment 48, wherein all of said LNA nucleosides are oxy-LNA nucleosides.
[0356] 50. The oligonucleotide according to embodiment 46 or 47, wherein all of the 2' sugar modified nucleosides within regions F and F' are the same MOE nucleoside.
[0357] 51.a. the F' region is 3-8 nucleotides in length and consists of 3-5 identical LNA nucleosides and 0-4 DNA nucleosides; b. the F' region is 2 to 6 nucleotides in length and consists of 2 to 4 identical LNA nucleosides and 0 to 2 DNA nucleosides; c. The oligonucleotide of any one of embodiments 46 to 50, wherein region G is 6 to 14 DNA nucleotides.
[0358] 52. The oligonucleotide of embodiment 46 or 47, wherein at least one of regions F or F' further comprises at least one 2'-substituted modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, and 2'-fluoro-DNA.
[0359] 53. The oligonucleotide according to any one of embodiments 46 to 50 or 52, wherein the RNase H recruiting nucleosides in region G are independently selected from DNA, α-L-LNA, C4' alkylated DNA, ANA and 2'F-ANA, and UNA.
[0360] 54. The oligonucleotide according to embodiment 53, wherein the nucleosides within region G are DNA and / or α-L-LNA nucleosides.
[0361] 55. The oligonucleotide according to embodiment 53 or 54, wherein region G consists of at least 75% DNA nucleosides.
[0362] 56. The oligonucleotide of embodiments 53-55, wherein all of the nucleotides of the G region are DNA.
[0363] 57. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide is selected from CMP numbers 9_102, 9_103, 9_104, 11_1, 49_38, 49_51, 49_179, 49_189, 53_1, 56_1, and 62_1. 58. The oligonucleotide, [ka] 58. The oligonucleotide of embodiment 57, wherein the upper case letters are β-D-oxy LNA nucleosides, the lower case letters are DNA nucleosides, all LNA C's are 5-methylcytosines, and all internucleoside linkages are phosphorothioate internucleoside linkages.
[0364] 59. The antisense oligonucleotide according to any one of embodiments 1 to 58, wherein the antisense oligonucleotide is CMP number 9_103 as shown in FIG. 2.
[0365] 60. The antisense oligonucleotide according to any one of embodiments 1 to 58, wherein the antisense oligonucleotide is CMP number 9_104 as shown in FIG. 3.
[0366] 61. The antisense oligonucleotide according to any one of embodiments 1 to 58, wherein the antisense oligonucleotide is CMP number 11_1 as shown in FIG. 4.
[0367] 62. The antisense oligonucleotide according to any one of embodiments 1 to 58, wherein the antisense oligonucleotide is CMP number 49_38 as shown in FIG. 5.
[0368] 63 The antisense oligonucleotide of any one of embodiments 1 to 58, wherein the antisense oligonucleotide is CMP number 49_189 as shown in FIG.
[0369] 64. A conjugate comprising an oligonucleotide according to any one of claims 1 to 58 and at least one conjugate moiety covalently attached to said oligonucleotide.
[0370] 65. The oligonucleotide conjugate according to embodiment 59, wherein the conjugate moiety is selected from a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin, a vitamin, a viral protein, or a combination thereof.
[0371] 66. The oligonucleotide conjugate according to embodiment 59 or 65, wherein the conjugate facilitates delivery across the blood-brain barrier.
[0372] 67. The oligonucleotide conjugate according to embodiment 66, wherein the conjugate is an antibody or antibody fragment that targets the transferrin receptor.
[0373] 68. The oligonucleotide conjugate according to embodiments 59 to 67, comprising a linker located between the oligonucleotide and the conjugate moiety.
[0374] 69. The oligonucleotide conjugate according to embodiment 68, wherein the linker is a physiologically labile linker.
[0375] 70. A pharmaceutical composition comprising an oligonucleotide according to embodiments 1 to 58 or a conjugate according to embodiments 59 to 69, and a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant.
[0376] 71. A method for producing an oligonucleotide according to any one of embodiments 1 to 58 is provided, comprising reacting nucleotide units, thereby forming covalently linked contiguous nucleotide units comprising said oligonucleotide.
[0377] 72. The method of embodiment 71, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide conjugation moiety.
[0378] 73. A method for producing a composition according to embodiment 70, comprising mixing said oligonucleotide with a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant.
[0379] 74. An in vitro or in vivo method for modulating Tau expression in a target cell expressing Tau, comprising administering to said cell an effective amount of an oligonucleotide as defined in embodiments 1-57, or a conjugate as defined in embodiments 59-69, or a pharmaceutical composition as defined in embodiment 70.
[0380] 75. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide according to embodiments 1 to 58, or a conjugate according to embodiments 59 to 69, or a pharmaceutical composition according to embodiment 70 to a subject suffering from or susceptible to the disease.
[0381] 76. An oligonucleotide according to embodiments 1 to 57, or a conjugate according to embodiments 59 to 69, or a pharmaceutical composition according to embodiment 70, for use as a medicament for the treatment or prevention of a disease in a subject.
[0382] 77. Use of an oligonucleotide according to embodiments 1 to 58 or a conjugate according to embodiments 59 to 69 for the preparation of a medicament for the treatment or prevention of a disease in a subject.
[0383] 78. The method, oligonucleotide or use according to embodiments 75 to 77, wherein the disease is associated with the in vivo activity of Tau.
[0384] 79. The method, oligonucleotide or use according to embodiments 75 to 78, wherein the disease is associated with overexpression of Tau and / or abnormal levels of Tau.
[0385] 80. The method, oligonucleotide or use according to embodiment 79, wherein the Tau is reduced by at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the expression without the oligonucleotide according to embodiments 1 to 58, or the conjugate according to embodiments 59 to 69, or the pharmaceutical composition according to embodiment 70.
[0386] 81. The disease is tauopathy, Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), frontotemporal dementia (FTD), FTDP-17, Pick's disease (PiD), argyrophilic grain disease (AGD), senile dementia with predominantly change patterns (TPSD), primary age-related tauopathy (PART), Down's syndrome, Ritiko-Bodig's disease, pediatric tauopathy (unilateral megalencephaly ( 80. The method, oligonucleotide or use of embodiments 75 to 79, wherein the disease is selected from the group consisting of myeloma, myelomas with cerebral iron accumulation (HME), tuberous sclerosis, focal cortical dysplasia type 2b, ganglioglioma, Hallervorden-Spatz syndrome, neurodegeneration with cerebral iron accumulation type 1 (NBIA1), gangliocytoma, subacute sclerosing panencephalitis, seizure disorders (e.g. epilepsy), network dysfunction (e.g. depression), and movement disorders (e.g. Parkinson's disease).
[0387] 82. The method, oligonucleotide or use according to embodiments 75 to 79, wherein the disease is selected from Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), or FTDP-17.
[0388] 83. The method, oligonucleotide or use according to embodiments 75 to 82, wherein the subject is a mammal.
[0389] 84. The method, oligonucleotide or use according to embodiment 83, wherein the mammal is a human. EXAMPLES
[0390] Materials and Methods Oligonucleotide motif sequences and oligonucleotide compounds
[0391] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10]
Table 5-11
Table 5-12
Table 5-13
Table 5-14
Table 5-15
Table 5-16
Table 5-17
Table 5-18
Table 5-19
Table 5-20
Table 5-21
Table 5-22
Table 5-23
Table 5-24
Table 5-25
Table 5-26
Table 5-27
Table 5-28
Table 5-29
Table 5-30
Table 5-31
Table 5-32
Table 5-33
Table 5-34
Table 5-35
Table 5-36
Table 5-37
Table 5-38
Table 5-39
[0392] The design refers to the gapmer design FG-F'. In classical gapmer designs, e.g. 3-10-3, all nucleotides in the flanks (F and F') are composed of the same 2' sugar modified nucleoside, e.g. LNA, cET, or MOE, and a central DNA stretch forming a gap (G). In gapmers with alternating flank designs, the flanks of the oligonucleotide are annotated as a series of integers, representing some 2' sugar modified nucleosides (M) followed by some DNA nucleosides (D). For example, the flanks of the 2-2-1 motif represent 5'[M]2-[D]2-[M]3', and the 1-1-1-1-1 motif represents 5'[M]-[D]-[M]-[D]-[M]3'. Both flanks have 2' sugar modified nucleosides at the 5' and 3' ends. The gap region (G) consists of several DNA nucleosides (typically 6-16) located between the flanks.
[0393] The heading "oligonucleotide compound" in the table represents the specific design of the motif sequence. Capital letters represent β-D-oxy LNA nucleosides, underlined capital letters represent MOE nucleosides, lower case letters represent DNA nucleosides, all LNA C's are 5-methylcytosine, e represents 5-methylcytosine DNA, all internucleoside linkages are phosphorothioate internucleoside linkages unless marked with an internucleotide subscript, and subscript o represents a phosphodiester linkage.
[0394] Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art. Below are applicable protocols. The oligonucleotides of the invention may be produced by methods that differ slightly in terms of the equipment, supports, and concentrations used.
[0395] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite approach of Oligomaker 48 on a 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support with aqueous ammonia at 60 °C for 5-16 h. Oligonucleotides are purified by reversed-phase HPLC (RP-HPLC) or solid-phase extraction, characterized by UPLC, and molecular weights are further confirmed by ESI-MS.
[0396] Oligonucleotide extension: Coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using 0.1 M of the 5'-O-DMT protected amidite in acetonitrile and a solution of DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. In the final cycle, a phosphoramidite with the desired modification can be used, such as a C6 linker for attaching a conjugate group, or such a conjugate group. Thiolation to introduce a phosphorothioate bond is carried out by using hydrogenated xanthan (0.01 M in acetonitrile / pyridine 9:1). A phosphodiester bond can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those typically used in oligonucleotide synthesis.
[0397] For conjugation after solid-phase synthesis, commercially available C6 amino linker phorphoramidites can be used in the last cycle of solid-phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked deprotected oligonucleotide is isolated. The conjugates are introduced by activation of functional groups using standard synthetic methods.
[0398] Purification by RP-HPLC: The crude compound is purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10μ 150×10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile are used as buffers at a flow rate of 5 mL / min. The collected fractions are lyophilized to give the purified compound, typically as a white solid.
[0399] Abbreviations: DCI: 4,5-dicyanoimidazole DCM: dichloromethane DMF: Dimethylformamide DMT: 4,4'-dimethoxytrityl THF: tetrahydrofuran Bz: Benzoyl Ibu: Isobutyryl RP-HPLC: Reversed-phase high-performance liquid chromatography
[0400] T m Assay: Dilute the oligonucleotide and RNA target (phosphate-linked, PO) duplex to 3 mM in 500 mL of RNase-free water and suspend in 500 mL of 2x T m Mix with buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM phosphate, pH 7.0). Heat the solution at 95° C. for 3 min and then anneal at room temperature for 30 min. The melting temperature of the duplex (T m ) is measured on a Lambda 40 UV / VIS spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is increased from 20°C to 95°C and then decreased to 25°C and the absorbance is recorded at 260 nm. The first derivative and both the melting and annealing maxima are used to calculate the duplex T m Rate the following.
[0401] Primary neuronal cell cultures Primary neuronal cultures were established from the forebrains of E18 transgenic mice expressing a human Tau transgene on a mouse Tau knockout background (Andorfer et al., J Neurochem 86:582-590 (2003)). Primary neurons were generated by papain digestion according to the manufacturer's protocol (Worthington Biochemical Corporation, LK0031050). Briefly, forebrains were dissected from hTau mouse E18 BAC-Tg embryos expressing the entire human microtubule-associated protein Tau (MAPT) gene on a mouse MAPT null background and incubated in papain / DNase / Earle's balanced salt solution (EBSS) solution for 30-45 min at 37°C. After trituration and centrifugation of the cell pellet, the reaction was stopped by incubation with EBSS containing protease inhibitors, bovine serum albumin (BSA), and DNase. Cells were disrupted and washed with Neurobasal (NB, Invitrogen) supplemented with 2% B-27, 100 μg / mL penicillin, 85 μg / mL streptomycin, and 0.5 mM glutamine.
[0402] Transgenic Tau mice (hTau mice) Male and female transgenic mice (30-40 g) expressing a human PAC-derived Tau transgene, the H1 haplotype driven by the Tau promoter (Polydoro et al., J. Neurosci. (2009) 29:34:10741-9), lacking the native mouse Tau gene, were used to assess tolerability, pharmacodynamic endpoints, and tissue drug concentrations.
[0403] Animals were kept in a colony room maintained at constant temperature (21 ± 2 °C) and humidity (50 ± 10%) and exposed to 12 h / day light (lights on at 0600 h). All animals had free access to food and water during the study period. Behavioral studies were conducted between 0700 and 1500 h.
[0404] Intracerebroventricular (ICV) injections were performed using a Hamilton microsyringe fitted with a 27 or 30 gauge needle according to the method of Haley and McCormick. The needle was fitted with a polyethylene guard 2.5 mm from the tip to limit entry into the brain. Mice were anesthetized with isoflurane anesthetic (1.5–4%). The mouse to be injected was held by holding the loose skin at the back of the neck with the thumb and index finger of one hand. The animal's head was then immobilized by applying gentle but firm pressure to press it against a firm, flat surface. The tip of the needle was then inserted through the scalp and skull approximately 1 mm lateral to and 1 mm caudal to the bregma suture. The needle was positioned to administer the ASO in a volume of 5 microliters in saline vehicle and injected over 20–30 seconds into the right (or left) lateral ventricle. The needle was left in place for 10 seconds and then removed. This procedure does not require surgery or incision. The animals were kept warm on a heating pad until they recovered from the procedure.
[0405] Three days and / or four weeks after treatment, mice were sacrificed by isoflurane overdose followed by rapid decapitation, and brain tissue (right frontal cortex region) was harvested on dry ice for subsequent Tau qPCR.
[0406] [ka]
[0407] [ka]
[0408] Example 1 In vitro screening of ASO targeting MAPT introns An antisense oligonucleotide (ASO) screen was performed in primary neurons derived from humanized Tau mice with 807 ASOs targeting the MAPT intron.
[0409] The ability of ASOs to reduce MAPT mRNA in vitro was measured by QuantiGene® analysis. Each Tau mRNA reduction was normalized by subtracting the background signal of the assay and normalizing each well via the housekeeping gene tubulin mRNA signal.
[0410] Primary neuronal cultures were prepared as described in the Materials and Methods section, seeded at 10,000 cells / well on poly-D-lysine-coated 384-well plates, and maintained in Neurobasal medium containing B27, GlutaMAX, and penicillin-streptomycin. ASOs were diluted in water and added to cells at DIV01 to a final concentration of 0.5 μM. After ASO addition, neurons were incubated at 37° C. and 5% CO2 for 5 days to achieve a steady-state reduction in mRNA. The medium was removed and cells were washed once in DPBS. Lysate messenger RNA measurements were performed using the QuantiGene® 2.0 Reagent System (Affymetrix®), which quantifies RNA using a branched DNA-signal amplification method that relies on specifically designed RNA capture probe sets. Cells were lysed using working cell lysis buffer made by adding 50 μL of Proteinase K to 5 mL of pre-warmed Lysis mix and diluted to a final dilution of 1:4 in dH20. Working lysis buffer was added to the plate (45 μL / well), mixed by trituration, sealed and incubated at 55° C. for 30 minutes. After lysis, wells were either stored at -80° C. or assayed immediately.
[0411] Lysates were diluted in lysis mix depending on the specific capture probe used (Tau or Tubulin). A total of 27 μL / well was then added to the capture plate (a 384-well polystyrene plate coated with capture probes). Working probe set reagents were generated by combining 2.2 mL of nuclease-free water, 1.2 mL of lysis mix, 184 μL of blocking reagent, and 66.8 μL of specific 2.0 probe sets human MAPT (catalog no. 15486) and mouse β3 tubulin (catalog no. SB-17245) according to the manufacturer's instructions (QuantiGene® 2.0 Affymetrix®). 7 μL of working probe set reagents were then added to 27 μl of lysate dilution on the capture plate (or 27 μL of lysis mix for background samples). Plates were centrifuged and then incubated at 55°C for 16-20 hours to allow hybridization (target RNA capture). Signal amplification and detection of target RNA was initiated by washing the plate three times with buffer to remove unbound material. 2.0 Preamplification Hybridization Reagent (30 μL / well) was added and incubated at 55°C for 1 hour, then aspirated, and wash buffer was added and aspirated three times. 2.0 Amplification Hybridization Reagent was then added as described (30 μL / well), incubated at 55°C for 1 hour, and washes were repeated as previously described. 2.0 Label-Probe-Hybridization Reagent was then added (30 μL / well), incubated at 50°C for 1 hour, and washes were repeated as previously described. Finally, the plate was centrifuged to remove all excess wash buffer, and 2.0 Substrate (30 μL / well) was added. The plate was incubated at room temperature for 5 minutes, and the plate was imaged within 15 minutes on a PerkinElmer Envision multilabel reader in luminometer mode.
[0412] For genes of interest, the mean assay background signal was subtracted from the mean signal of each technical replicate. The background-subtracted mean signal of the gene of interest was divided by the background-subtracted mean signal of housekeeping tubulin RNA. Percent inhibition for treated samples was calculated relative to untreated samples (i.e., lower values indicate greater inhibition). Variability in the background of untreated samples may result in percent inhibition of treated samples equal to or higher than background. In these cases, percent inhibition is expressed as 100% inhibition of the control (i.e., no inhibition).
[0413] Figure 1 shows the MAPT mRNA reduction achieved by all 807 ASOs. The figure shows three regions A, B, and C on the MAPT target nucleic acid. These regions have a high distribution of ASOs, reducing the target by 40% or less compared to the control (100%).
[0414] Example 2 In vitro screening of ASOs targeting selected regions on MAPT Based on the screening of Example 1, a new library of ASOs was designed to target regions A, B, and C as shown in Figure 1. The motif sequences and oligonucleotide compounds are shown in Table 5 above.
[0415] Screening was performed as described in Example 1. The results are shown in Table 6.
[0416] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13]
[0417] Example 3 IC50 values of selected oligonucleotides The IC50 of some of the best performing oligonucleotides from Example 2 was determined in vitro in primary neuronal cells using a 96-well assay.
[0418] Primary neuronal cultures were prepared as described in the Materials and Methods section, seeded at 50,000 cells / well on poly-D-lysine-coated 96-well plates, and maintained in Neurobasal medium containing B27, GlutaMAX, and penicillin-streptomycin. ASOs were diluted in water (for IC50 determination) and added to cells 1 day after seeding (DIV01). IC 50For determination, neurons were treated with the highest concentration of 0.5-5 μM and IC50 was determined using a concentration-response dilution of approximately 1:4. CMP number 66_1, corresponding to ASO-001933 in International Publication No. WO2016 / 126995, was included as a positive control. After ASO treatment, neurons were incubated at 37 °C for 5 days to achieve a steady-state reduction in mRNA. The medium was removed and cells were lysed as follows. Measurement of lysate messenger RNA was performed using the QUANTIGENE® 2.0 Reagent System (AFFYMETRIX®). It quantifies RNA using a branched DNA-signal amplification method that relies on specifically designed RNA capture probe sets. A working cell lysis buffer was made by adding 50 μL of proteinase K to 5 mL of pre-warmed lysis mix and diluted to a final dilution of 1:4 in dH20. Working lysis buffer was added to the plates (150 μL / well), mixed by trituration, sealed and incubated for 30 minutes at 55° C. After lysis, wells were either stored at −80° C. or assayed immediately.
[0419] Lysates were diluted in lysis mix depending on the specific capture probe used (Tau or Tubulin). A total of 80 μL / well was then added to the capture plate (a 96-well polystyrene plate coated with capture probes). Working probe set reagents were generated by combining 12.1 μL nuclease-free water, 6.6 μL lysis mix, 1 μL blocking reagent, and 0.3 μL of specific 2.0 probe sets of either human MAPT (catalog no. 15486) and mouse β3 tubulin (catalog no. SB-17245) according to the manufacturer's instructions (QUANTIGENE® 2.0 AFFYMETRIX®). 20 μL of working probe set reagents were then added to 80 μl of lysate dilution on the capture plate (or 80 μL of lysis mix for background samples). Plates were centrifuged and then incubated at 55°C for 16-20 hours to allow hybridization (target RNA capture). Signal amplification and detection of target RNA was initiated by washing the plate three times with buffer to remove unbound material. 2.0 Preamplification Hybridization Reagent (100 μL / well) was added and incubated at 55°C for 1 hour, then aspirated, and wash buffer was added and aspirated three times. 2.0 Amplification Hybridization Reagent was then added as described (100 μL / well), incubated at 55°C for 1 hour, and washes were repeated as previously described. 2.0 Label-Probe-Hybridization Reagent was then added (100 μL / well), incubated at 50°C for 1 hour, and washes were repeated as previously described. Finally, the plate was centrifuged to remove all excess wash buffer, and 2.0 Substrate (100 μL / well) was added. The plate was incubated at room temperature for 5 minutes, and the plate was imaged within 15 minutes on a PerkinElmer Envision multilabel reader in luminometer mode.
[0420] Data determination: For genes of interest, the mean assay background signal was subtracted from the mean signal of each technical replicate. The background-subtracted mean signal of the gene of interest was divided by the background-subtracted mean signal of housekeeping tubulin RNA. Percent inhibition for treated samples was calculated relative to untreated samples (i.e., lower values indicate greater inhibition). Variability in the background of untreated samples may result in percent inhibition of treated samples equal to or higher than background. In these cases, percent inhibition is expressed as 100% inhibition of the control (i.e., no inhibition). Results are shown in Table 7.
[0421] [Table 7]
[0422] Example 4 In vivo tolerability and in vivo Tau mRNA reduction Some of the best performing oligonucleotides from Example 2 were tested in vivo in humanized Tau mice to assess acute tolerability in the CNS and MAPT mRNA reduction 3 or 28 days after a single injection.
[0423] Transgenic Tau mice were administered 100 μg of ASO by intracerebroventricular (ICV) injection (see Materials and Methods, Transgenic Tau Mice section). CMP number 66_1, corresponding to ASO-001933 in International Publication No. WO2016 / 126995, was included as a positive control. Animals were observed for behavioral side effects for 1 h after a single ICV injection of ASO. Acute tolerability for the severity of side effects was scored on a scale of 0 (no side effects) to 20 (convulsions leading to euthanasia). The tolerability scale was divided into five neurobehavioral categories: (1) hyperactivity, (2) decreased activity and alertness, (3) motor dysfunction / ataxia, (4) abnormal posture and respiration, and (5) tremors / convulsions. Each category was scored on a scale of 0 to 4, with a minimum total score of 20. The animals were observed in their home cages for changes in behavior and then removed from the home cage for more detailed observation, including measurements of grip strength and righting reflex. Data from the acute tolerability of the ASOs of the invention are shown in Table 8.
[0424] MAPT mRNA reduction in the right frontal cortex region was analyzed by qPCR as follows: Collected mouse brain tissue (see Materials and Methods section, Transgenic Tau mice) was homogenized in 10 volumes of high salt / sucrose buffer (10 mM Tris-HCl, pH 7.4, 800 mM NaCl, 10% sucrose (w / v), 1 mM EGTA) supplemented with phosphatase inhibitor cocktail set 2 and 3, 1 mM PMSF (Sigma, St. Louis, MO), and complete protease inhibitor cocktail EDTA-free (Roche, Indianapolis, IN) using a Quiagen Tissue Lyzer II. The homogenate was centrifuged at 20,000×g for 20 min at 4° C. The supernatant was centrifuged at 100,000×g for 1 h at 4° C.
[0425] For cDNA synthesis and subsequent PCR, 300 ng of RNA from brain tissue supernatant was added to one well of a 96-well plate (Axygen, PCR-96-CS). To each well, 7.5 μL of master mix (5 μL of 2.5 mM NTP mix and 2.5 μL of random primers per reaction) was added, the plate was centrifuged at 1000 rpm, and placed in a thermocycler for 3 minutes at 70°C. The plate was immediately cooled on ice, and 4 μL of reaction master mix was added. Prior to PCR, the plate was briefly centrifuged to collect samples at the bottom of the wells. cDNA synthesis was performed at 42°C for 60 minutes, 95°C for 10 minutes, and then held at 4°C. The cDNA samples were diluted 1:3 with molecular biology grade water and stored at -20°C until further use.
[0426] For PCR, each sample was run in triplicate with two probe sets (MAPT: Taqman Expression Assay Hs00902193_m1; GAPDH GAPDH Taqman Expression Assay Hs01922876_u1). 4 μL of pre-diluted cDNA and 6 μL of master mix were added to each reaction and the plate was centrifuged. Samples were incubated at 95°C for 20 seconds, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds.
[0427] Data was analyzed using the ΔΔCt method, where each sample was first normalized to GAPDH and then expressed as a percent of the untreated control (percent inhibition). If the percent inhibition was equal to or greater than the control cells, the percent inhibition was expressed as 0 inhibition.
[0428] [Table 8-1] [Table 8-2]
[0429] Example 5 In vitro efficacy in human embryonic stem cell (hESC)-derived neurons Selected ASOs from Example 2 were tested at three different concentrations (200 nM, 8 nM, and 0.32 nM) in an alternative in vitro assay using human embryonic stem cell (hESC)-derived neurons. For comparison purposes, two prior art oligonucleotides targeting MAPT were included: CMP number 66_1, corresponding to ASO-001933 in International Publication No. WO2016 / 126995, and CMP number 67:1, corresponding to compound no. 814907 in International Publication No. WO2018 / 064593.
[0430] Culture of human embryonic stem cells (ESCs) and ASO treatment: Neural stem cells (NSCs) were derived from human ESCs according to published procedures (Chambers et al. (2009) Nat. Biotech. 7:275-280). NSCs were expanded into ventralized progenitor cells in SFA medium for 1 week and then differentiated into neurons in BGAA medium for 6 weeks. See Materials and Methods section for medium contents.
[0431] Cells were cultured at 10,000 cells / cm 2 Cells were seeded in polyornithine and laminin-coated flasks at a density of 50,000 cells / well in N2B27+SFA medium. The medium was changed on day 4. After 7 days, cells were trypsinized in N2B27+SFA medium and seeded in 96-well plates at a density of 50,000 cells / well as ventralized progenitor cells in N2B27+BGAA medium.
[0432] The medium was changed twice weekly, and treatment with ASO was initiated at the first medium change and continued for 6 weeks. Cells were then harvested as described below.
[0433] qPCR analysis: Treated neurons were harvested as follows: the medium was removed, followed by the addition of 125 μL of PURELINK® Pro 96 lysis buffer and 125 μL of 70% ethanol. RNA was purified according to the manufacturer's instructions and eluted in a final volume of 50 μL of water, resulting in an RNA concentration of 10-20 ng / μL. RNA was then diluted 10-fold with water prior to the one-step qPCR reaction.
[0434] For one-step qPCR reactions, qPCR mix (qScriptTMXLE 1-step RT-qPCR TOUGHMIX® Low ROX from QauntaBio) was mixed with two Taqman probes in a 10:1:1 ratio (qPCR mix:probe 1:probe 2) to generate a master mix. qPCR was performed as technical replicates and Taqman probes were obtained from Life Technologies: MAPT_Hs00902193_m1; GAPDH 4325792 (housekeeping gene used for normalization).
[0435] Master mix (6 μL) and RNA (4 μL, 1-2 ng / μL) were then mixed in a qPCR plate (MICROAMP® Optical 384-well, Cat. No. 4309849). After seeding the plate, it was rapidly spun at 1000 g for 1 min at room temperature and transferred to a Viia™ 7 system (Applied Biosystems, Thermo). The following PCR conditions were used: 50° C. for 15 min; 95° C. for 3 min; 40 cycles of the following: 95° C. for 5 s, followed by a 1.6° C. / s ramp, followed by 60° C. for 45 s. Data was analyzed using QuantStudio™ real-time PCR software. Percent inhibition of ASO-treated samples was generated compared to control-treated samples (lower values indicate higher reduction in MAPT). Results are shown in Table 9 as the average of two technical replicates.
[0436] Measurement of Tau and pTau proteins in hESC neurons Cells washed with PBS were extracted in a buffer containing Cytobuster Protein Extraction Reagent (Merck Millipore, no. 71009), 1% Phosphatase Inhibitor Cocktail 3 (Sigma, no. P0044), 1% Proteases Inhibitor Set III (Calbiochem, no. 539134), 1% DNAse-I (Roche, no. 4536282001), and 10 mM MgCl2. Cell extracts were lysed by pipetting up and down and then stored at -20°C until use.
[0437] Total Tau levels in cell extracts were measured by AlphaLISA using an in-house assay format including the Tau-specific antibody 5A6 (DSHB Antibody Registry number: AB_528487) and the Roche in-house Tau monoclonal antibody Tau 4 / 2. The latter antibody was generated by immunizing mice with human full-length Tau, i.e., 441 amino acids, the longest human brain isoform. Tau 4 / 2 binds to a C-terminal epitope of Tau located between amino acids 369 and 441. Briefly, cell extracts were diluted in AlphaLISA HiBlock assay buffer (PerkinElmer, AL004C) and mixed with biotinylated 5A6 and Tau 4 / 2-coated AlphaLISA acceptor beads. After 1 h of incubation at room temperature, streptavidin-coated donor beads are added to the mixture. After 30 min of incubation, samples were measured on an Envision plate reader (excitation 680 nm, emission 615 nm). Recombinant human Tau (Merck Millipore, No. AG960) was used to generate a standard curve.
[0438] Phosphorylated Tau (Tau-pS422) levels in cell extracts were measured by AlphaLISA using a Roche in-house assay format containing the Tau-specific antibody 5A6 (DSHB Antibody Registry ID: AB_528487) and the Tau-pS422-specific antibody 5.6.11 (described in WO2010 / 142423 and Collin et al. (2014) Brain 137:2834-2846). Cell extracts were diluted in assay buffer B prior to the assay. Buffer B contains 25 mM HEPES pH 7.4, 0.5% Triton X-100, 0.1% Top Block (LuBio Science), 1 mg / mL dextran 500, 10% ELISA blocking reagent (Roche). A standard curve was prepared using ERK phosphorylated Tau prepared as follows: Recombinant human Tau was produced as described by Grueninger et al. (Neurobiology of Disease vol. 37 (2010) pp. 294-306). Recombinant His-tagged ERK2 (self-produced) was activated by incubation with activated MEKK1 (self-produced). Activated ERK2 was then incubated with Tau at a molar ratio of 1:50 in a buffer containing 2 mM ATP. ERk2 was subsequently removed by passage over Ni-NTA agarose (Qiagen). The extent of phosphorylation at S422 was then determined by mass spectrometry.
[0439] The results are shown in Table 9.
[0440] [Table 9]
[0441] Example 6 IC50 of selected compounds of Example 5 A selection of effective ASOs from Example 5 were tested in the same hESC-derived neuron assay along with two prior art controls (CMP No. 66_1 and CMP No. 67_1) to determine IC50 for target mRNA reduction and Tau protein reduction.
[0442] The experiments were performed as described in Example 5 using the following oligonucleotide concentrations: 1000, 200, 40, 8, 1.6, 0.32, 0.064, 0.0128, 0.00256 nM.
[0443] The IC50 values were fitted using GraphPad PRISM software, and the results are shown in Table 10.
[0444] [Table 10]
[0445] From these data, CMP Nos. 9_103 and 49_38 of the present invention appear to be more effective and have better IC50s than the prior art compounds for all parameters, while CMP No. 53_1 appears to have a superior maximum knockdown than the prior art compounds and a similar IC50 to CMP No. 66_1.
[0446] Example 7 In vivo activity in specific brain regions of hTau mice A selection of ASOs from Example 5 were tested for their ability to reduce targets in vivo in specific brain regions of humanized Tau mice (hTau mice) 4 weeks after a single low dose ICV administration.
[0447] The humanized Tau mice used in this example are an in-house Roche hTau P301S transgenic mouse line that overexpresses human Tau (the longest human brain isoform) with the point mutation P301S on a mouse Tau background.
[0448] Humanized Tau mice were administered 25 μg of ASO by intracerebroventricular (ICV) injection as follows: CMP number 66_1, corresponding to ASO-001933 in WO2016 / 126995, was included for comparison purposes.
[0449] In vivo ICV mouse evaluation: Animal Husbandry: Mixed-sex animals weighing 16-23 grams were kept in a colony room maintained at constant temperature (22 ± 2 °C) and humidity (55 ± 10%) and exposed to 12 h / day light (lights on at 0600 h). All animals had free access to food and water during the study period. All mouse protocols were approved by the Danish National Committee for Ethics in Animal Experiments.
[0450] Intraventricular injection: Compounds were administered to mice by intracerebroventricular (ICV) injection. Six to eight mice of mixed sex were included in each treatment group. Before ICV administration, mice were weighed and anesthetized with isoflurane or propofol (30 mg / kg). Intracerebroventricular injections were performed using a Hamilton micro syringe with a FEP catheter fitted with a 23-gauge needle fixed on a stand adjusted to penetrate a precise distance (3.9 mm) through the skin and skull into the right lateral ventricle. The mouse to be injected was held at the neck crease between the thumb and index finger of one hand. With gentle but firm pressure, the head was pushed upwards so that the needle penetrated 1-2 mm to the right of the skull midline (mediolateral) and 1-2 mm behind the eye. A 5 μL bolus of test compound or vehicle was injected over 30 seconds at a pre-determined injection rate. To avoid reflux, the mouse was held in this position for an additional 5 seconds and then carefully withdrawn downwards away from the needle. This procedure does not require surgery or incision. Animals were placed under a heat lamp until they recovered from the procedure.
[0451] At the end of the study (4 weeks), brain tissue (cortex, medulla / pons, and midbrain) was harvested on dry ice for analysis of Tau mRNA and protein.
[0452] Tissue homogenization: Mouse brain tissue samples were homogenized in MagNA Pure LC RNA Isolation Tissue Lysis Buffer (Roche, Indianapolis, IN) using Qiagen's TissueLyzer II. The homogenate was incubated at room temperature for 30 min to ensure complete lysis. After lysis, the homogenate was centrifuged at 13,000 rpm for 3 min, and the supernatant was used for analysis.
[0453] RNA purification from tissues: RNA was purified from 350 μL of the supernatant using a MagNA Pure 96 instrument (Roche, Indianapolis, IN) using the kit Cellular RNA Large Volume Kit. RNA samples were normalized to 2 ng / μL in RNase-free water and stored at −20° C. until further use. MAPT mRNA levels were quantified as described in Example 5.
[0454] Tau protein measurement from mouse brain tissue: Pre-weighed frozen tissue was extracted with 10 volumes (wt / vol) of extraction buffer containing 10 mM TrisCl pH 7.4, 800 mM NaCl, 1 mM EGTA, 10% sucrose, 1% Phosphatase Inhibitor Cocktail 3 (Sigma, no. P0044), 1% Proteases Inhibitor Set III (Calbiochem, no. 539134). Homogenates were prepared using PreCellys tissue disrupter (20 sec, 6500 rpm). Homogenates were then centrifuged at 10'000xg for 20 min at 4°C and the supernatant was retained for analysis.
[0455] Tau levels in the extracts were measured by AlphaLISA using a total Tau AlphaLISA kit provided by Perkin Elmer (catalog number AL271C). The antibodies used in this assay were BT2 and Tau-12, provided with the kit, both of which bind to the central region of Tau. Extracts were diluted in HiBlock assay buffer, and then 5 μl of each sample was used in the assay. The assay was otherwise performed as described by the supplier.
[0456] The results of mRNA and protein quantification are shown in Table 11.
[0457] [Table 11]
[0458] From these data it can be observed that even at a fairly low concentration of 25 μg, the compound of the invention shows a reduction of 20% or more in most brain regions, while the control compound shows virtually no target reduction at this concentration.
[0459] Example 8 In vivo dose response and time course in hTau mice The dose responsiveness of two ASOs (CMP Nos. 9_103 and 49_189) was evaluated using three different doses (25, 50, and 100 μg) and target reduction was measured in specific brain regions 1 and 4 weeks after administration. For comparison purposes, two prior art compounds (CMP Nos. 66_1_103 and 67_1) were included at several doses in a 1-week study.
[0460] The experiment was carried out essentially as described in Example 7. However, Tau protein was not measured in the dose-response study, which was carried out for 1 week, since Tau protein has a half-life of more than 1 week. The results are shown in Tables 12 and 13.
[0461] [Table 12]
[0462] [Table 13]
[0463] From the data in Tables 12 and 13, it can be seen that the compounds of the present invention perform significantly better than the compounds of the prior art, especially when administered at 100 μg. It can also be seen that MAPT reduction is maintained over 4 weeks. Furthermore, the compounds of the present invention show significant reduction of Tau protein after 4 weeks of treatment with a single dose of 100 μg of the compounds.
Claims
1. An antisense oligonucleotide of 10 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides in length that is at least 90% complementary to contiguous nucleotides within positions 12051-12111, 39562-39593, or 72837-72940 of SEQ ID NO:
1.
2. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence is at least 16 nucleotides and is 100% complementary to contiguous nucleotides within positions 12060 to 12078, 39573 to 39592, or 72862 to 72890 of SEQ ID NO:
1.
3. The antisense oligonucleotide of claim 1 or 2, wherein the oligonucleotide has a sequence selected from the group consisting of SEQ ID NOs: 9, 11, 49, 53, 56, and 62.
4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein said oligonucleotide is capable of reducing the expression of Tau.
5. The antisense oligonucleotide of any one of claims 1 to 4, comprising one or more 2' sugar modified nucleosides in the contiguous nucleotide sequence.
6. 6. The antisense oligonucleotide of claim 5, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.
7. The antisense oligonucleotide according to claim 5 or 6, comprising 4 to 8 LNA nucleosides in the consecutive nucleotide sequence.
8. The antisense oligonucleotide of any one of claims 1 to 7, wherein at least 80% of the internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
9. The antisense oligonucleotide of any one of claims 1 to 8, wherein the oligonucleotide is capable of recruiting RNase H.
10. The antisense oligonucleotide according to claim 9, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof consists of or comprises a gapmer of the formula 5'-F-G-F'-3', in which regions F and F' independently comprise 1 to 8 nucleosides, of which 2 to 5 are 2' sugar modified, and define the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H, e.g. a region comprising 6 to 16 DNA nucleosides.
11. The antisense oligonucleotide, CTTtAATttaatcactcAT SEQ ID NO: 9; CMP No. 9_102 CTTTaatttaatcacTCAT SEQ ID NO: 9; CMP No. 9_103 CTTTaatttaatcaCtCAT SEQ ID NO: 9; CMP No. 9_104 CTTTaatttaatcaCTCA SEQ ID NO: 11; CMP number 11_1 TtaaCTCAaatcaaTtctCA SEQ ID NO: 49; CMP number 49_38 TtaActCAaatcaattCTCA SEQ ID NO: 49; CMP No. 49_51 TTAactCaaatcaatTCtCA SEQ ID NO: 49; CMP No. 49_179 TTAActcaaatcaattCTCA SEQ ID NO: 49; CMP No. 49_189 CAACacctttaattcATTA SEQ ID NO: 53; CMP number 53_1 CTCAtcaacacctttaaTT SEQ ID NO: 56; CMP number 56_1 TTAactcatcaacaCCTT SEQ ID NO: 62; CMP No. 62_1, 11. The antisense oligonucleotide of any one of claims 1 to 10, wherein capital letters are β-D-oxy LNA nucleosides, lower case letters are DNA nucleosides, all LNA C's are 5-methylcytosines, and all internucleoside linkages are phosphorothioate internucleoside linkages.
12. The antisense oligonucleotide according to any one of claims 1 to 11, which is CMP number 9_103 as shown in Figure 2.
13. The antisense oligonucleotide according to any one of claims 1 to 11, which is CMP number 9_104 as shown in Figure 3.
14. The antisense oligonucleotide according to any one of claims 1 to 11, which is CMP number 11_1 as shown in Figure 4.
15. The antisense oligonucleotide according to any one of claims 1 to 11, which is CMP number 49_38 as shown in Figure 5.
16. The antisense oligonucleotide according to any one of claims 1 to 11, which is CMP number 49_189 as shown in Figure 6.
17. A conjugate comprising the antisense oligonucleotide of any one of claims 1 to 16 and at least one conjugate moiety covalently attached to said oligonucleotide.
18. A pharma- ceutically acceptable salt of the antisense oligonucleotide according to any one of claims 1 to 16, or the conjugate according to claim 17.
19. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of claims 1 to 16 or a conjugate according to claim 17, and a pharma- ceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.
20. An in vitro or in vivo method for modulating Tau expression in a target cell expressing Tau, comprising administering to said cell an effective amount of an antisense oligonucleotide according to any one of claims 1 to 16, or a conjugate according to claim 17, or a pharmaceutical composition according to claim 19.
21. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide according to any one of claims 1 to 16, or the conjugate according to claim 17, or the pharmaceutical composition according to claim 19 to a subject suffering from or susceptible to said disease.
22. 22. The method of claim 21, wherein the disease is selected from the group consisting of Alzheimer's disease (AD), progressive supranuclear palsy (PSP), fronto-temporal dementia (FTD), or FTDP-17.
23. 23. The method of claim 22, wherein the disease is progressive supranuclear palsy (PSP).
24. An antisense oligonucleotide according to any one of claims 1 to 16, or a conjugate according to claim 17, or a pharmaceutical composition according to claim 19, for use as a medicament.
25. 20. The antisense oligonucleotide of any one of claims 1 to 16, or the conjugate of claim 17, or the pharmaceutical composition of claim 19, for use in the treatment or prevention of Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), or FTDP-17.
26. 26. The antisense oligonucleotide, conjugate or pharmaceutical composition for use in treatment of claim 25, wherein the disease is progressive supranuclear palsy (PSP).
27. Use of an antisense oligonucleotide according to claims 1 to 16, or a conjugate according to claim 17, or a pharmaceutical composition according to claim 19, for the preparation of a medicament for the treatment or prevention of Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), or FTDP-17.