Achromosomal dynamic active systems

Abstract

To provide delivery vectors capable of targeting cells and delivering biological agents, compositions containing such delivery vectors, and associated methods of delivering the vectors to cells, thereby modulating biological systems including animal, plant, and insect cells, tissues, and organisms.SOLUTION: The invention provides achromosomal dynamic active systems (ADAS), e.g., ADAS comprising a heterologous cargo, methods of making them, compositions containing them, and associated methods of delivering ADAS and / or cargoes and of modulating biological systems.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, which is hereby incorporated by reference in its entirety. The ASCII copy, created on December 10, 2019, is named 51296-033WO2_Sequence_Listing_12.10.19_ST25 and is 51,393 bytes in size.

[0002] Provided herein are non-chromosomal dynamic activity systems and methods for making and using same. [Background technology]

[0003] There is a need for delivery vectors capable of targeting cells and delivering biological agents, compositions containing such delivery vectors, and related methods of delivering the vectors to cells and thereby modulating biological systems, including animal, plant, and insect cells, tissues, and organisms. Summary of the Invention [Means for solving the problem]

[0004] The present invention provides, inter alia, non-chromosomal dynamic activity systems (ADAS), e.g., ADAS with heterologous cargo, methods for making same, compositions containing same, and related methods for delivering ADAS and / or cargo and regulating biological systems. The present invention is based, at least in part, on the Applicant's discovery of non-chromosomal dynamic activity systems (ADAS) that have enhanced activity in certain embodiments (i.e., hyperactive ADAS). Such hyperactive ADAS have high capacity for activity, such as chemical activity, protein production, or cargo delivery.

[0005] In one aspect, the disclosure features a method for making a composition comprising a plurality of ADAS, the composition being substantially free of viable bacterial cells, the method including: (a) generating, providing, or obtaining a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor; (b) exposing the parent bacteria to conditions permissive for the formation of minicells, thereby producing an ADAS; and (c) separating the ADAS from the parent bacteria, thereby producing a composition comprising a plurality of ADAS, the composition being substantially free of viable bacterial cells.

[0006] In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence that is at least 40% identical to SEQ ID NO: 1. In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence that is at least 90% identical to SEQ ID NO: 1.

[0007] In some embodiments, the cell division topology specificity factor is a minE polypeptide.

[0008] In some embodiments, the parent bacterium is E. coli and the minE polypeptide is E. coli minE. In other embodiments, the parent bacterium is Salmonella typhimurium and the minE polypeptide is S. typhimurium minE.

[0009] In some embodiments, the parent bacterium exhibits a reduced level or activity of a Z-ring inhibitory protein. In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO: 2. In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 90% identical to SEQ ID NO: 2.

[0010] In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO: 3. In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 90% identical to SEQ ID NO: 3.

[0011] In some embodiments of the above aspects, the Z ring inhibitory protein is a minC polypeptide or a minD polypeptide.

[0012] In some embodiments of the above aspects, the ADAS exhibits reduced expression of at least two Z-ring inhibitory proteins, for example, reduced expression of a minC polypeptide and a minD polypeptide.

[0013] In some embodiments, the ADAS exhibits decreased expression of a minC polypeptide, a minD polypeptide, and a minE polypeptide.

[0014] In other embodiments of the above aspects, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO: 4, such as at least 90% identical to SEQ ID NO: 4. In some embodiments, the cell division topology specificity factor is a DivIVA polypeptide.

[0015] In some embodiments, the parent bacterium is Bacillus subtilis and the cell division topology specificity factor is B. subtilis DivIVA.

[0016] In some embodiments of the above aspects, the reduced level or activity occurs due to a loss-of-function mutation, hi some embodiments, the loss-of-function mutation is a deletion of the minCDE operon or a deletion of DiVIVA.

[0017] In some embodiments of the above aspects, the ADAS has an initial ATP concentration of at least 1 mM, 1.2 nM, 1.3 nM, 1.4 mM, 1.5 mM, 1.6 mM, 2 mM, 2.5 mM, 3 mM, 4 mM, 5 mM, 10 mM, 20 mM, 30 mM, or 50 mM.

[0018] In some embodiments of the above aspects, the parent bacterium is selected from the group consisting of Escherichia, Acinetobacter, Agrobacterium, Anabaena, Aquifex, Azoarcus, Azotobacter, Bordetella, Bradyrhizobium, Brucella, Buchnera, Burkho, and the like. The genera Burkholderia, Candidatus, Chromobacterium, Crocosphaera, Dechloromonas, Desulfitobacterium, Desulfotalea, Erwinia, Francisella, Fusobacterium, Gloeobacter, loeobacter, Gluconobacter, Helicobacter, Legionella, Magnetospirillum, Mesorhizobium, Methylococcus, Neisseria, Nitrosomonas, Nostoc, Photobacterium, Photorhabdus otorhabdus, Polaromonas, Prochlorococcus, Pseudomonas, Psychrobacter, Ralstonia, Rubrivivax, Salmonella, Shewanella, Shigella, Sinorhizobium, Synechococcus,The genera Synechocystis, Thermosynechococcus, Thermotoga, Thermus, Thiobacillus, Trichodesmium, Vibrio, Wigglesworthia, Wolinella, Xanthomonas, Xylella, Yersinia, Bacillus, Clostridium, The cell division topology specificity factor is any one of the genera Bacillus subtilis, Deinococcus, Exiguobacterium, Geobacillus, Lactobacillus, Moorella, Oceanobacillus, Symbiobacterium, and Thermoanaerobacter, and the cell division topology specificity factor is the endogenous minE or DivIVA of the parent bacterium.

[0019] In some embodiments of the above aspects, the composition in step (c) comprises less than 100 colony forming units (CFU / mL) viable bacterial cells, such as less than 10 CFU / mL, less than 1 CFU / mL, or less than 0.1 CFU / mL.

[0020] In some embodiments of the above aspects, the ADAS comprises a cargo.

[0021] In some embodiments of the above aspects, the composition is formulated for delivery to an animal; formulated for delivery to a plant; formulated for delivery to an insect; and / or formulated as a liquid, solid, aerosol, paste, gel, or gas composition.

[0022] In another aspect, the disclosure features a composition that includes a plurality of highly active non-chromosomal dynamic activation systems (ADAS), the ADAS having an initial ATP concentration of at least 1 mM, and the composition is substantially free of viable bacterial cells. In some embodiments, the ADAS has an initial ATP concentration of at least 1.2 nM, 1.3 nM, 1.4 mM, 1.5 mM, 1.6 mM, 2 mM, or 2.5 mM.

[0023] In yet another aspect, the disclosure features a composition that includes a plurality of highly active ADAS, the ADAS having an initial ATP concentration of at least 3 mM, and the composition is substantially free of viable bacterial cells.

[0024] In some embodiments, the ADAS composition has an initial ATP concentration of at least 4 mM, 5 mM, 10 mM, 20 mM, 30 mM, or 50 mM.

[0025] In some embodiments of the composition, the ATP concentration of the ADAS increases by at least 50%, at least 60%, at least 75%, at least 100%, at least 150%, or at least 200% after incubation at 37° C. for 12 hours.

[0026] In some embodiments of the composition, the ADAS is derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor.

[0027] In yet another aspect, the invention features a composition that includes a plurality of ADAS, where the ADAS do not include a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells.

[0028] In yet another aspect, the invention features a composition comprising a plurality of ADAS, the composition being substantially free of viable bacterial cells and produced by a method that includes: (a) producing, providing, or obtaining a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor; (b) exposing the parent bacteria to conditions that permit the formation of minicells, thereby producing a highly active ADAS; and (c) separating the ADAS from the parent bacteria, thereby producing a composition that is substantially free of viable bacterial cells.

[0029] In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence that is at least 40% identical to SEQ ID NO:1.

[0030] In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 90% identical to SEQ ID NO:1.

[0031] In some embodiments, the cell division topology specificity factor is a minE polypeptide.

[0032] In some embodiments, the parent bacterium is E. coli and the minE polypeptide is E. coli minE.

[0033] In some embodiments, the parent bacterium is Salmonella typhimurium and the minE polypeptide is S. typhimurium minE.

[0034] In some embodiments, the parent bacterium is selected from the group consisting of Escherichia, Acinetobacter, Agrobacterium, Anabaena, Aquifex, Azoarcus, Azotobacter, Bordetella, Bradyrhizobium, Brucella, Buchnera, Burkholderia, and the like. Burkholderia, Candidatus, Chromobacterium, Crocosphaera, Dechloromonas, Desulfitobacterium, Desulfotalea, Erwinia, Francisella, Fusobacterium, Gloeobacter bacter, Gluconobacter, Helicobacter, Legionella, Magnetospirillum, Mesorhizobium, Methylococcus, Neisseria, Nitrosomonas, Nostoc, Photobacterium, Photorhabdus torhabdus, Polaromonas, Prochlorococcus, Pseudomonas, Psychrobacter, Ralstonia, Rubrivivax, Salmonella, Shewanella, Shigella, Sinorhizobium, Synechococcus,The genera Synechocystis, Thermosynechococcus, Thermotoga, Thermus, Thiobacillus, Trichodesmium, Vibrio, Wigglesworthia, Wolinella, Xanthomonas, Xylella, Yersinia, Bacillus, Clostridium stridium, Deinococcus, Exiguobacterium, Geobacillus, Lactobacillus, Lactobacillus, Moorella, Oceanobacillus, Symbiobacterium, or Thermoanaerobacter, and the cell division topology specificity factor is the endogenous minE or DivIVA of the parent bacterium.

[0035] In some embodiments, the ADAS exhibits reduced levels of a Z-ring inhibitory protein.

[0036] In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO:2.

[0037] In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO:3.

[0038] In some embodiments, the Z-ring inhibitory protein is a minC polypeptide.

[0039] In some embodiments, the Z-ring inhibitory protein is a minD polypeptide.

[0040] In some embodiments, the ADAS exhibits reduced expression of at least two Z-ring inhibitory proteins.

[0041] In some embodiments, the ADAS exhibits decreased expression of minC and minD polypeptides.

[0042] In some embodiments, the ADAS exhibits decreased expression of a minC polypeptide, a minD polypeptide, and a minE polypeptide.

[0043] In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 40% identical to SEQ ID NO:4.

[0044] In some embodiments, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 90% identical to SEQ ID NO:4.

[0045] In some embodiments, the cell division topology specificity factor is a DivIVA polypeptide.

[0046] In some embodiments, the parent bacterium is Bacillus subtilis and the cell division topology specificity factor is B. subtilis DivIVA.

[0047] In some embodiments, the decrease in level or activity occurs due to a loss-of-function mutation.

[0048] In some embodiments, the loss-of-function mutation is a gene deletion.

[0049] In some embodiments, the loss-of-function mutation is an inducible loss-of-function mutation, wherein the loss-of-function is induced by exposing the parent cell to an inducing condition.

[0050] In some embodiments, the inducible loss-of-function mutation is a temperature sensitive mutation and the inducing condition is a temperature condition.

[0051] In some embodiments, the parent cell has a deletion of the minCDE operon.

[0052] In some embodiments, the ADAS comprises a functional transcription system and a functional translation system.

[0053] In some embodiments, the ADAS produces a heterologous protein.

[0054] In some embodiments, the ADAS comprises a plasmid that includes an inducible promoter and a nucleotide sequence encoding a heterologous protein, such that when the ADAS is contacted with an inducer of the inducible promoter under appropriate conditions, the heterologous protein is produced.

[0055] In some embodiments, production of the heterologous protein is increased by at least 1.6-fold in an ADAS contacted with an inducer compared to an ADAS not contacted with the inducer.

[0056] In some embodiments, the production rate of the heterologous protein reaches the target level within 3 hours of contacting the ADAS with the inducer.

[0057] In some embodiments, the heterologous protein is produced at a rate of at least 0.1 femtograms per hour for each ADAS.

[0058] In some embodiments, the heterologous protein is produced for a sustained period of at least 8 hours.

[0059] In some embodiments, the composition comprises less than 100 colony forming units (CFU / mL) viable bacterial cells.

[0060] In some embodiments, the composition comprises less than 10 CFU / mL, less than 1 CFU / mL, or less than 0.1 CFU / mL viable bacterial cells.

[0061] In some embodiments, the ADAS comprises a cargo.

[0062] In some embodiments, the cargo is a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory drug, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP).

[0063] In some embodiments, the cargo is encapsulated in the ADAS.

[0064] In some embodiments, the cargo is attached to a surface of the ADAS.

[0065] In some embodiments, the nucleic acid is DNA, RNA, or a plasmid.

[0066] In some embodiments, the nucleic acid encodes a protein.

[0067] In some embodiments, the enzyme alters a substrate such that a target product is produced.

[0068] In some embodiments, the substrate is present in an ADAS and the target product is produced in the ADAS.

[0069] In some embodiments, the substrate is present in the target cell or environment to which the ADAS is delivered.

[0070] In some embodiments, the ADAS comprises a heterologous bacterial secretion apparatus.

[0071] In some embodiments, the heterologous bacterial secretion system is a type 3 secretion system (T3SS).

[0072] In some embodiments, the cargo comprises a moiety that directs exocytosis by the bacterial secretion apparatus.

[0073] In some embodiments, the ADAS comprises a targeting moiety.

[0074] In some embodiments, the targeting moiety is a nanobody, a carbohydrate binding protein, or a tumor targeting peptide.

[0075] In some embodiments, the ADAS exhibits reduced protease levels or activity compared to an ADAS made from a wild-type parent bacterium.

[0076] In some embodiments, the ADAS is produced from a parent bacterium that has been modified to reduce or eliminate expression of at least one protease.

[0077] In some embodiments, the ADAS exhibits reduced RNase levels or activity compared to an ADAS produced from a wild-type patent bacterium.

[0078] In some embodiments, the ADAS is produced from a parent bacterium that has been modified to reduce or eliminate expression of at least one RNase.

[0079] In some embodiments, the RNase is an endoribonuclease or an exoribonuclease.

[0080] In some embodiments, the ADAS is modified to exhibit reduced lipopolysaccharide (LPS).

[0081] In some embodiments, the ADAS is generated from a parent bacterium that has been modified to exhibit reduced LPS.

[0082] In some embodiments, the modification is a mutation in the lipid A biosynthetic myristoyltransferase (msbB).

[0083] In some embodiments, the ADAS is derived from a parent bacterium that is a pathogen of a mammal or a commensal of a mammal.

[0084] In some embodiments, the mammalian commensal bacterium is a Staphylococcus, Bifidobacterium, Micrococcus, Lactobacillus, or Actinomyces species, or the mammalian pathogenic bacterium is Escherichia coli (EHEC), Salmonella typhimurium, Shigella flexneri, Yersinia enterolitica, or Helicobacter pylori.

[0085] In some embodiments, the ADAS is derived from a parent bacterium that is a plant pathogen or is commensal to the plant.

[0086] In some embodiments, the plant commensal bacterium is Bacillus subtilis or Psuedomonas putida, or the plant pathogenic bacterium is a Xanthomonas species or Pseudomonas syringae.

[0087] In some embodiments, the ADAS is derived from an auxotrophic parent bacterium.

[0088] In some embodiments, the ADAS is lyophilized and reconstituted, wherein the reconstituted ADAS has an ATP concentration that is at least 95% of the ATP concentration of the non-lyophilized ADAS.

[0089] In some embodiments, the reconstituted ADAS has an ATP concentration at least equal to the ATP concentration of the non-lyophilized ADAS.

[0090] In some embodiments, the composition is formulated for delivery to an animal.

[0091] In some embodiments, the compositions are formulated for intraperitoneal, intravenous, intramuscular, oral, topical, aerosol, or spray administration.

[0092] In some embodiments, the compositions are formulated for delivery to plants.

[0093] In some embodiments, the composition is formulated for delivery to insects.

[0094] In some embodiments, the composition is formulated as a liquid, solid, aerosol, paste, gel, or gas composition.

[0095] In another aspect, the invention features a method for delivering a highly active ADAS to a target cell, the method including: (a) providing a composition including a plurality of highly active ADAS, the ADAS having an initial ATP concentration of at least 1.25 mM, and the composition being substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0096] In yet another aspect, the invention features a method for delivering an ADAS to a target cell, the method including: (a) providing a composition including a plurality of ADAS, where the ADAS are derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0097] In some embodiments of such methods of delivering multiple ADAS, the target cell is an animal cell, a plant cell, or an insect cell.

[0098] In yet another aspect, the invention features a method of delivering a cargo to a target cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), where the ADAS have an initial ATP concentration of at least 1.25 mM, where the ADAS include a cargo, and where the composition is substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0099] In yet another aspect, the invention features a method of delivering a cargo to a target cell, the method including: (a) providing a composition comprising a plurality of ADAS, where the ADAS are derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, where the ADAS comprise a cargo, and where the composition is substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0100] In embodiments relating to delivering a cargo, the target cell is an animal cell, a plant cell, or an insect cell.

[0101] In another aspect, the invention features a method of modulating a state of an animal cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the animal cell with the composition of step (a), thereby modulating a state of the animal cell.

[0102] In yet another aspect, the method features a method of modulating a state of a plant cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activity systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting a plant cell with the composition of step (a), thereby modulating a state of the plant cell.

[0103] In another aspect, the invention features a method of modulating a state of an insect cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting an insect cell with the composition of step (a), thereby modulating a state of the insect cell.

[0104] In another aspect, the invention features a method of modulating a state of an animal cell, the method including: (a) providing a composition including a plurality of ADAS, where the ADAS are derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells; and (b) contacting the animal cell with the composition of step (a), thereby modulating the state of the animal cell.

[0105] In another aspect, the invention features a method of modulating a state of a plant cell, the method including: (a) providing a composition including a plurality of ADAS, where the ADAS are derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells; and (b) contacting a plant cell with the composition of step (a), thereby modulating a state of the plant cell.

[0106] In another aspect, the invention features a method of modulating a state of an insect cell, the method including: (a) providing a composition including a plurality of ADAS, the ADAS being derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and the composition being substantially free of viable bacterial cells; and (b) contacting an insect cell with the composition of step (a), thereby modulating a state of the insect cell.

[0107] In yet another aspect, the invention features a method of treating an animal in need thereof, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS has an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the animal with an effective amount of the composition of step (a), thereby treating the animal.

[0108] In yet another aspect, the invention features a method of treating an animal in need thereof, the method including: (a) providing a composition including a plurality of ADAS, where the ADAS are derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells; and (b) contacting the animal with an effective amount of the composition of step (a), thereby treating the animal.

[0109] In some embodiments of treating an animal, the animal has cancer.

[0110] In some embodiments, the ADAS carries a chemotherapeutic cargo (eg, an immunotherapeutic cargo).

[0111] In yet another aspect, the invention features a method of treating a plant in need thereof, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS has an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the plant or a pest thereof with an effective amount of the composition of step (a), thereby treating the plant.

[0112] In yet another aspect, the invention features a method of treating a plant in need thereof, the method including: (a) providing a composition including a plurality of ADAS, the ADAS being derived from a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, and the composition being substantially free of viable bacterial cells; and (b) contacting the plant or a pest thereof with an effective amount of the composition of step (a), thereby treating the plant.

[0113] In another aspect, the invention features a composition that includes a plurality of ADAS, where the ADAS includes an enzyme, and where the enzyme alters a substrate such that a target product is produced.

[0114] In some embodiments of this composition, the substrate is present in an ADAS and the target product is produced in the ADAS.

[0115] In some embodiments, the substrate is present in the target cell or environment to which the ADAS is delivered.

[0116] In some embodiments, the enzyme is diadenylate cyclase A, the substrate is ATP, and the target product is cyclic di-AMP.

[0117] Other features and advantages of the invention will become apparent from the following detailed description, and from the claims. [Brief description of the drawings]

[0118] [Figure 1A]A set of scanning electron micrographs showing E. coli parent bacterial cells and the achromosomal dynamically active subcellular septa (ADAS) derived from them. The left column shows bacterial cells of E. coli strain MACH009, which have not been modified to produce ADAS. The center column shows bacterial cells of E. coli strain MACH060(ΔminCDE), which have been modified to produce ADAS. The ADAS and parent cells undergoing an abnormal septation event are visible. The right column shows ADAS purified from a MACH060(ΔminCDE) culture. [Figure 1B] A set of micrographs showing ADAS from MACH060(ΔminCDE). The left panel is a phase contrast image showing the position of the particle. The middle panel is an immunofluorescence image showing the localization of the DNA stain DAPI. The right panel is an immunofluorescence image showing the localization of lipopolysaccharide (LPS) staining. The white arrow points to an ADAS, identified by the presence of LPS staining and the absence of DAPI staining. Scale bar is 10 μm. [Figure 1C] FIG. 1 is a graph showing the concentration (in particles / mL) of particles with a given diameter in a purified ADAS population from the ADAS-producing E. coli strain MACH124(ΔminCDE) as measured using a Spectradyne® nCS1 nanoparticle analyzer. [Figure 1D] 1 is a bar graph showing aggregate volumes of particles between 200 and 2000 nm in diameter in purified ADAS preparations. [Figure 1E] 1 is a bar graph showing the concentration in colony forming units (CFU) / mL of viable bacterial cells present in a MACH124(ΔminCDE) culture and in an ADAS preparation purified from this culture. [Figure 1F] 1 shows images of immunoblots for DnaK and GroEL from cultures of ADAS-producing E. coli strains MACH060 and MACH200 (both ΔminCDE) and from ADAS preparations purified from each culture. 10 ng of purified DnaK and GroEL serve as controls (Recomb. Prot.). [Figure 2A] 1 is a bar graph showing the average ATP concentration in mMol in purified ADAS populations from E. coli strain MACH060(ΔminCDE) as measured using the BacTiter-Glo™ microbial cell viability assay. The ATP concentration produced by the parent bacteria was subtracted as background. [Figure 2B] FIG. 1 is a bar graph showing the luminescence of aliquots of purified ADAS population from E. coli strain MACH060(ΔminCDE) at 0 hours or after 2 hours of shaking incubation at 37° C. in the presence of excess nutrients, as measured using the BacTiter-Glo™ microbial cell viability assay. [Figure 2C] Figure 1 shows GFP fluorescence (au) over time for MACH124(ΔminCDE) cultures incubated with or without the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression, and for ADAS preparations purified from these cultures. All samples were grown in the presence of antibiotics to prevent any bacterial growth. The concentration of parental bacteria was equivalent to the number of CFUs detected in the ADAS preparations (100 CFU / mL). [Figure 2D] 2C is a graph showing the GFP fluorescence data from FIG. 2C normalized by the number of ADAS in the preparation as measured using a Spectradyne® nCS1 nanoparticle analyzer, where the data is presented as fold induction per 10 ADAS particles. [Figure 2E] 2C is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of FIG. 2C. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 2F]A set of images of immunoblots of GFP in 250 μL aliquots from purified ADAS preparations purified from MACH124(ΔminCDE) and grown for 0, 2, 4, 17, or 24 h in the presence of the inducer anhydrotetracycline (top panel). Each lane corresponds to approximately 5.2×107 ADAS as determined by nCS1 analysis. GFP intensity was quantified by densitometry, normalized to the intensity of the loading control GroEL, and converted to mass of GFP (in ng) by comparison to a molecular standard of purified recombinant GFP run on the same blot (bottom panel). [Figure 3A] Figure 1 shows GFP fluorescence (au) per 108 ADAS particles over time for ADAS preparations purified from MACH124 (ΔminCDE), MACH556 (ΔminC), and MACH557 (ΔminD) E. coli parental bacterial strains. ADAS were incubated in the presence or absence of the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression. GFP fluorescence was calculated by subtracting the average value of uninduced replicates from each induced replicate. All samples were grown in the presence of antibiotics to prevent any bacterial growth. [Figure 3B] Figure 3B is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of Figure 3 A. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 3C] 13 shows images of immunoblots for GFP in ADAS purified from MACH124 (ΔminCDE), MACH556 (ΔminC), and MACH557 (ΔminD) and grown in the presence (+) or absence (-) of the inducer anhydrotetracycline. [Figure 3D] FIG. 3C is a bar graph showing background correction of the immunoblot of FIG. 3C. [Figure 3E] FIG. 3C is a bar graph showing normalized GFP density of the immunoblots in C. GFP intensity was quantified by densitometry and normalized to the intensity of the loading control GroEL. [Figure 3F] 1 is a bar graph showing total GFP production in fluorescence units (au) in purified ADAS from MACH124 (ΔminCDE), MACH556 (ΔminC), and MACH557 (ΔminD) as measured using a BioTek® microplate reader. ** indicates a p-value of 0.0021. *** indicates a p-value of 0.0006. [Figure 3G] 1 is a bar graph showing hourly GFP production of ADAS purified from MACH124 (ΔminCDE), MACH556 (ΔminC), and MACH557 (ΔminD). [Figure 3H] 1 is a bar graph showing the relative ratio of GFP production of ADAS purified from MACH556 (ΔminC) and MACH557 (ΔminD) to ADAS made from MACH124 (ΔminCDE). The protein production level of MACH124 was set to 100%, and the relative protein production amounts for MACH556 and MACH557 were normalized to MACH124. [Figure 4] 1 is a bar graph showing DyLight™ 550 fluorophore fluorescence of purified ADAS from MACH060 and MACH284, normalized to the optical density (OD600) of the culture. MACH284 expresses a Neae-NB2 (nanobody) fusion protein detectable by an antibody conjugated to the DyLight™ 550 fluorophore. [Figure 5A] FIG. 1 is a bar graph showing the luminescence readout of the THP1-Dual™ system in THP1-Dual™ monocytes contacted with ADAS purified from MACH060, uninduced ADAS purified from MACH198, and ADAS purified from MACH198 induced with anhydrotetracycline to produce the enzyme deadenylate cyclase A (DacA). [Figure 5B]FIG. 1 is a set of photomicrographs showing the phenotype of THP1-Dual™ monocytes contacted with ADAS purified from MACH060, uninduced ADAS purified from MACH198, and ADAS purified from MACH198 induced with anhydrotetracycline to produce the enzyme DacA. [Figure 5C] 1 is a bar graph showing the concentration of interferon beta (IFN-B1) in pg / mL secreted into culture by THP1-Dual™ monocytes contacted with ADAS purified from MACH060, uninduced ADAS purified from MACH198, and ADAS purified from MACH198 induced with anhydrotetracycline to produce the enzyme DacA, as measured using an ELISA assay. [Figure 6] Figure 1 is a set of photomicrographs showing the fluorescence of DyLight™ 800 NHS-ester labeled ADAS from MACH301 in European Corn Borer (ECB) larvae. Panels A and B show DyLight™ 800 fluorescence. Panels C and D show larval autofluorescence at 700 nm. Panels A and C show control larvae fed PBS, while panels B and D show larvae fed DyLight™ 800 NHS-ester labeled ADAS. [Figure 7A] Figure 1 shows GFP fluorescence (au) per 108 ADAS particles over time in ADAS preparations purified from the MACH124 (ΔminCDE) E. coli parental bacterial strain, where the ADAS preparations were stored at 4°C for 0 or 3 days. ADAS were incubated in the presence or absence of the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression. GFP fluorescence was calculated by subtracting the average value of uninduced replicates from each induced replicate. All samples were grown in the presence of antibiotics to prevent any bacterial growth. [Figure 7B]Figure 1 shows GFP fluorescence (au) per 108 ADAS particles over time in ADAS preparations purified from MACH556 (ΔminC) E. coli parental bacterial strain, where the ADAS preparations were stored at 4°C for 0 or 3 days. ADAS were incubated in the presence or absence of the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression. GFP fluorescence was calculated by subtracting the average value of uninduced replicates from each induced replicate. All samples were grown in the presence of antibiotics to prevent any bacterial growth. [Figure 7C] Figure 1 shows GFP fluorescence (au) per 108 ADAS particles over time in ADAS preparations purified from MACH557(ΔminD) E. coli parental bacterial strain, where the ADAS preparations were stored at 4°C for 0 or 3 days. ADAS were incubated in the presence or absence of the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression. GFP fluorescence was calculated by subtracting the average value of uninduced replicates from each induced replicate. All samples were grown in the presence of antibiotics to prevent any bacterial growth. [Figure 7D] 7B is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of Figure 7 A. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 7E] 7B is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of FIG. 7B. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 7F] 7C is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of Figure 7 C. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 7G]Figure 1 shows GFP fluorescence (au) per 108 ADAS particles over time in an ADAS preparation purified from the MACH124 (ΔminCDE) E. coli parental bacterial strain, where the ADAS preparation was lyophilized, stored for 6 weeks, and rehydrated. ADAS was incubated in the presence or absence of the inducer anhydrotetracycline (100 ng / mL), which activates GFP expression. GFP fluorescence was calculated by subtracting the average value of uninduced replicates from each induced replicate. All samples were grown in the presence of antibiotics to prevent any bacterial growth. [Figure 7H] 7B is a graph showing the fold change in GFP fluorescence between the induced and uninduced ADAS preparations of Figure 7G. Fold change was calculated by dividing the mean of the induced replicates by the mean of the uninduced replicates. [Figure 8A] 1 is a bar graph showing the number of parental bacterial cells (in CFU / mL) in ADAS preparations purified from control E. coli parental bacterial cell strain MACH060 or auxotrophic E. coli parental bacterial cell strain MACH002 stored in histidine-free and methionine-free medium. [Figure 8B] 1 is a bar graph showing the number of parental bacterial cells (in CFU / mL) in ADAS preparations purified from control E. coli parental bacterial cell strain MACH178 or auxotrophic E. coli parental bacterial cell strain MACH151 stored in leucine-free medium. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0119] I. Definition As used herein, the term "non-chromosomal dynamic system" or "ADAS" refers to a genome-free, non-replicating closed membrane system that includes at least one membrane and has an internal volume suitable for accommodating cargo (e.g., one or more of a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory drug, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP)). In some embodiments, the ADAS is a minicell or modified minicell derived from a parent bacterial cell (e.g., a gram-negative or gram-positive bacterial cell). The ADAS may be obtained from the parent bacterium using any suitable method, such as genetic manipulation of the parent cell or exposure to a culture medium or conditions that increase the likelihood of forming bacterial minicells. An exemplary method for creating an ADAS is to disrupt the cell division machinery of the parent cell. In some embodiments, the ADAS may include one or more endogenous or heterologous features of the parent cell surface, such as a cell wall, a cell wall modification, a flagellum, or a pilus, and / or one or more endogenous or heterologous features of the interior volume of the parent cell, such as a nucleic acid, a plasmid, a protein, a small molecule, a transcription machinery, or a translation machinery. In other embodiments, the ADAS may lack one or more features of the parent cell. In yet other embodiments, the ADAS may be loaded or otherwise modified with features not included in the parent cell.

[0120] As used herein, the term "highly active ADAS" refers to an ADAS with a high potential for activity, e.g., an ADAS capable of performing a large number of useful activities. The activity can be a metabolic activity, including chemical synthesis (e.g., synthesis of proteins, nucleic acids, lipids, carbohydrates, polymers, or small molecules), chemical modification (e.g., modification of proteins, nucleic acids, lipids, carbohydrates, polymers, or small molecules), or transport (e.g., internalization, externalization, or secretion) under suitable conditions. In certain embodiments, a highly active ADAS starts with a large pool of energy, e.g., energy in the form of ATP. In other embodiments, the ADAS has the ability to import or generate energy / ATP from another source. A highly active ADAS may be identified, for example, by exhibiting an increased concentration of ATP, an increased ability to generate ATP, an increased ability to produce proteins, or an increased rate or amount of protein production, and / or an increased responsiveness to a biological signal, e.g., induction of a promoter.

[0121] As used herein, the term "parent bacterial cell" refers to a cell (e.g., a gram-negative or gram-positive bacterial cell) from which the ADAS is derived. The parent bacterial cell is typically a viable bacterial cell. The term "viable bacterial cell" refers to a bacterial cell that contains a genome and has the ability to divide. Preferred parent bacterial cells are derived from any of the strains in Table 4.

[0122] An ADAS composition or preparation that is "substantially free" of parental and / or viable bacterial cells is defined herein as a composition that has 500 or fewer colony forming units (CFU) per mL, e.g., 400, 300, 200, 150, 100 or fewer CFU. An ADAS composition that is substantially free of parental or viable bacterial cells may contain fewer than 50 CFU / mL, fewer than 25 CFU / mL, fewer than 10 CFU / mL, fewer than 5 CFU / mL, fewer than 1 CFU / mL, fewer than 0.1 CFU / mL, or fewer than 0.001 CFU / mL, including no bacterial cells.

[0123] The term "cell division topology specificity factor" refers to a component of the cell division machinery in a bacterial species that is involved in determining the septation site and functions by restricting the location of other components of the cell division machinery, for example, by restricting the location of one or more Z-ring inhibitory proteins. Exemplary cell division topology specificity factors include minE, which was first discovered in Escherichia coli (E. coli) and has since been identified in a wide variety of Gram-negative and Gram-positive bacterial species (Rothfield et al., Nature Reviews Microbiology, 3:959-968, 2005). minE functions by restricting the Z-ring inhibitory proteins minC and minD to the cell poles. A second exemplary cell division topology specificity factor is DivIVA, which was first discovered in Bacillus subtilis (Rothfield et al., Nature Reviews Microbiology, 3:959-968, 2005).

[0124] The term "Z-ring inhibitory protein" refers to a component of the cell division machinery in bacterial species that is involved in determining the septation site and functions by inhibiting the formation of a stable FtsZ ring or by anchoring such a component to the membrane. The localization of the Z-ring inhibitory protein can be regulated by cell division topology specificity factors, such as MinE and DivIVA. Exemplary Z-ring inhibitory proteins include minC and minD, which were first discovered in E. coli and have since been identified in a wide variety of Gram-negative and Gram-positive bacterial species (Rothfield et al., Nature Reviews Microbiology, 3:959-968, 2005). In E. coli, and in other species, minC, minD, and minE appear at the same locus, which is sometimes referred to as the "min operon," the minCDE operon, or the min or minCDE locus.

[0125] As used herein, the term "reduction in the level or activity of a cell topology specificity factor" refers to a global reduction of any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more in the level or activity of a cell topology specificity factor (e.g., a protein or nucleic acid (e.g., a gene or mRNA)) as detected by standard methods when compared to the level of a reference sample (e.g., an ADAS made from a wild-type cell or a cell having a wild-type minCDE operon or a wild-type divIVA gene), a reference cell (e.g., a wild-type cell or a cell having a wild-type minC, minD, minE, divIVA, or minCDE gene or operon), a control sample, or a control cell. In some embodiments, a decreased level or activity refers to a decrease in the level or activity in a sample that is at least about 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.05, or 0.01 fold the level or activity of the cell topology specificity factor in a reference sample, reference cell, control sample, or control cell.

[0126] As used herein, the term "percent identity" refers to the percent (%) sequence identity to a reference polynucleotide or polypeptide sequence after alignment by standard techniques. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in a variety of ways that are within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, PSI-BLAST, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximal alignment over the full length of the sequences under comparison. For example, percent sequence identity values ​​may be generated using the sequence comparison computer program BLAST. By way of illustration, the percent sequence identity of a given nucleic acid or amino acid sequence A to, with, or compared to a given nucleic acid or amino acid sequence B (which can alternatively be expressed as a given nucleic acid or amino acid sequence A having a certain percent sequence identity to, with, or compared to a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(ratio X / Y) where X is the number of nucleotides or amino acids that are evaluated by a sequence alignment program (e.g., BLAST) as perfect matches in the program's alignment of A and B, and where Y is the total number of nucleotides or amino acids in B. In some embodiments, sequence identity, for example sequence identity of a homologue of a MinE or DivIVA protein, will have at least about 40%, 50%, 60%, 70%, 80%, 85%, 90%, or even 95% or more amino acid or nucleic acid sequence identity, or at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more amino acid or nucleic acid identity to a native sequence MinE (or minE) or DivIVA (or divIVA) sequence as disclosed herein.

[0127] The phrase "modulating the state of a cell" as used herein refers to an observable change in the state (e.g., transcriptome, proteome, epigenome, biological effect, or health or disease state) of a cell (e.g., an animal, plant, or insect cell) as measured using techniques and methods known in the art for such measurements, such as methods that measure the level or expression of a protein, transcript, epigenetic mark, or methods that measure an increase or decrease in the activity of a biological pathway. Modulating the state of a cell can result in a change of at least 1% compared to before administration (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 98% or more compared to before administration; e.g., up to 100% compared to before administration). In some embodiments, modulating the state of a cell involves increasing a cellular parameter (e.g., a protein, transcript level or expression, or biological pathway activity). Increasing the state of a cell can result in an increase in the parameter of at least 1% compared to before administration (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 98% or more compared to before administration; e.g., up to 100% compared to before administration). In other embodiments, modulating the state involves decreasing a cellular parameter (e.g., a protein, transcript level or expression, or biological pathway activity). A reduction in the state of the cells can result in a decrease in a parameter of at least 1% compared to before administration (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or at least 98% or more compared to before administration; e.g., up to 100% compared to before administration).

[0128] As used herein, the term "heterologous" means not native to a cell or composition in its naturally occurring state. In some embodiments, "heterologous" refers to a molecule that is not naturally found in the ADAS or parent bacterium from which it is made (e.g., a gram-negative or gram-positive bacterial cell); for example, a cargo or payload (e.g., a nucleic acid such as an RNA or tRNA encoding a polypeptide, protein, or a small molecule) or a structure (e.g., a plasmid or a gene editing system).

[0129] II. Composition A.ADAS and Highly Active ADAS The present invention is based, at least in part, on the Applicant's discovery of non-chromosomal dynamic activation systems (ADAS), including highly active ADAS, capable of providing a wide range of functions in numerous environments. An "ADAS" is a genome-free, non-replicating, closed membrane system that includes at least one membrane (in some embodiments, two membranes, where the two membranes do not intersect) and has an internal volume suitable for accommodating cargo (e.g., nucleic acids, plasmids, polypeptides, proteins, enzymes, amino acids, small molecules, gene editing systems, hormones, immunomodulatory drugs, carbohydrates, lipids, organic particles, inorganic particles, or ribonucleoprotein complexes (RNPs)).

[0130] In some embodiments, the ADAS is a minicell or modified minicell derived from a parent bacterial cell (e.g., a gram-negative or gram-positive bacterial cell). The ADAS may be derived from the parent bacterium using any suitable method, such as genetic manipulation of the parent cell or exposure to media or conditions that increase the likelihood of bacterial minicell formation.

[0131] In some embodiments, the ADAS has a major axis cross section of about 100 nm to 500 μm (e.g., in certain embodiments, about: 100 to 600 nm, such as 100 to 400 nm; or about 0.5 to 10 μm, and 10 to 500 μm). In certain embodiments, the ADAS has a minor axis cross section of about: 0.001, 0.01, 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, up to 100% of the major axis. In certain embodiments, the ADAS has a minor axis cross section of about: 0.001 to 1 μm. 3 , 0.3~5μm 3 , 5~4000μm 3 , or 4000~50×10 7 μm 3 It has an internal volume of

[0132] In some embodiments, the present invention provides a highly active ADAS. A "highly active" ADAS is an ADAS with a high potential for activity, e.g., an ADAS capable of performing a large number of useful activities. Activity can be defined as metabolic activity, including, for example, chemical synthesis (e.g., synthesis of proteins, nucleic acids, lipids, carbohydrates, polymers, or small molecules), chemical modification (e.g., modification of proteins, nucleic acids, lipids, carbohydrates, polymers, or small molecules), or transport (e.g., internalization, externalization, or secretion) under suitable conditions. In some embodiments, a highly active ADAS starts with a large pool of energy, e.g., energy in the form of adenosine triphosphate (ATP). In other embodiments, the ADAS has the ability to import or generate energy (e.g., ATP) from another source. The term "ADAS provided by the present invention" encompasses all embodiments of the ADAS described herein, including the highly active ADAS that are part of the ADAS provided by the present invention, a set of which in a detailed embodiment can be referred to as "highly active ADAS provided by the present invention".

[0133] In one aspect, the present invention provides a composition comprising a plurality of highly active non-chromosomal dynamic activation systems (ADAS), the ADAS having an initial ATP concentration of at least 1 mM, and the composition being substantially free of viable bacterial cells.

[0134] In another aspect, the present invention provides a composition comprising a plurality of highly active non-chromosomal dynamic activation systems (ADAS), the ADAS having an initial ATP concentration of at least 3 mM, and the composition being substantially free of viable bacterial cells.

[0135] In some embodiments, highly active ADAS has an initial ATP concentration of at least 1 nM, 1.1 nM, 1.2 nM, 1.3 nM, 1.4 mM, 1.5 mM, 1.6 mM, 2 mM, 2.5 mM, 3 nM, 3.5 nM, 4 mM, 5 mM, 10 mM, 20 mM, 30 mM, or 50 mM. ATP concentration can be assessed by a variety of means, including, in certain embodiments, the BacTiter-Glo™ assay (Promega) for dissolved ADAS.

[0136] Additionally or alternatively, high activity may be determined as the rate or amount of increase in ATP concentration in the ADAS over time. In some embodiments, the ATP concentration of the ADAS increases by at least 50%, at least 60%, at least 75%, at least 100%, at least 150%, at least 200%, or more than 200% after incubation under suitable conditions, for example, after 12 hours of incubation at 37° C. In certain embodiments, a high activity ADAS is about: 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.05, 0.1, 0.5, 1.0, 2, 3, 5, 10, 15, 20, 30, 40, 50, 75, 100, 200, 300, 500, 1000, 10000 ATP / sec / nm 2 Having a higher ATP production rate for at least about: 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 1 day, 2 days, 4 days, 1 week, or 2 weeks.

[0137] In other aspects, high activity is determined as the rate of decrease in ATP concentration over time. In some embodiments, the ATP concentration of a high activity ADAS may not decrease as rapidly as an ADAS that is not high activity. In some embodiments, the drop in ATP concentration in the ADAS or ADAS composition 24 hours after preparation is less than about 50% (e.g., less than about: 45, 40, 35, 30, 25, 20, 15, 10, or 5%) compared to the initial ATP concentration (e.g., ATP per cell volume), as measured, for example, by BacTiter-Glo™ assay (Promega).

[0138] Additionally or alternatively, high activity may be determined as the longevity index of the ADAS. The longevity index is calculated as the ratio of GFP production rate at 24 hours to 30 minutes. In some embodiments, high activity ADAS has a longevity index higher than about: 0.13, 0.14, 0.15, 0.16, 0.18, 0.2, 0.25, 0.3, 0.35, 0.45, 0.5, 0.60, 0.70, 0.80, 0.90, 1.0 or more. In more specific embodiments, the longevity index is measured in ADAS containing a functional GFP plasmid with a species-appropriate promoter, where the GFP concentration is measured by a plate reader at 30 minutes and 24 hours relative to the number of ADAS, the average plasmid number of each ADAS, and the solution volume.

[0139] In some embodiments, the ADAS produces a protein, e.g., a heterologous protein. In some embodiments, high activity is determined as the rate, amount, or duration of protein production or the rate of protein expression induction (e.g., responsiveness of the ADAS to a signal). For example, the ADAS may comprise a plasmid that includes an inducible promoter and a nucleotide sequence encoding a heterologous protein, where contacting the ADAS with an inducer of the inducible promoter under appropriate conditions results in the production of the heterologous protein. In some embodiments, the production of the heterologous protein is increased by at least 1.6-fold in the ADAS contacted with the inducer, e.g., the highly active ADAS, compared to an ADAS not contacted with the inducer. For example, in some embodiments, the production of the heterologous protein is increased by at least 1.5-fold, 1.75-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, or more than 10-fold in the ADAS contacted with the inducer, e.g., the highly active ADAS. In some embodiments, the rate of heterologous protein production by the highly active ADAS reaches the target level within a certain period of time, for example, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, or more than 3 hours after the ADAS is contacted with the inducer. In some embodiments, the protein (e.g., heterologous protein) is produced at a rate of at least 0.1 femtogram per hour for each highly active ADAS, for example, at least 0.2 0.4, 0.6, 0.8, 1, 2, 4, 6, 8, 10, 25, 50, 100, 250, 500, 1000, 2000, 3000, or 3500 fg / hour for each ADAS. In some embodiments, the high activity of the ADAS is determined as the period during which the protein is produced. A highly active ADAS may produce a protein (eg, a heterologous protein) for a period of at least 2 hours, at least 4 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 48 hours, or more than 48 hours.

[0140] B. ADAS from parent bacteria lacking cell division topology specificity factors and highly active ADAS The ADAS may be derived from a bacterial parent cell as described herein.

[0141] In some aspects, the invention provides compositions comprising an ADAS and / or multiple ADAS derived from a parent bacterium that exhibits reduced levels, activity, or expression of a cell division topology specificity factor.

[0142] In some aspects, the invention provides a composition comprising a plurality of ADAS, wherein the ADAS does not comprise a cell division topology specificity factor, and wherein the composition is substantially free of viable bacterial cells.

[0143] In some aspects, the invention provides a composition comprising a plurality of ADAS, the composition being substantially free of viable bacterial cells and produced by a method comprising: (a) creating, providing, or obtaining a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor; (b) exposing the parent bacteria to conditions that permit the formation of minicells, thereby producing a highly active ADAS; and (c) separating the ADAS from the parent bacteria, thereby producing a composition that is substantially free of viable bacterial cells.

[0144] In some embodiments of the above aspects, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 20% identical to an E. coli minE polypeptide (SEQ ID NO:1), e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to SEQ ID NO:1. In some embodiments, the cell division topology specificity factor comprises the amino acid sequence of SEQ ID NO:1. In some embodiments, the cell division topology specificity factor is a minE polypeptide. Exemplary species having minE polypeptides are provided in Table 4 and in Rothfield et al., Nature Reviews Microbiology, 3:959-968, 2005.

[0145] In some embodiments, the parent bacterium is E. coli and the minE polypeptide is E. coli minE. In other embodiments, the parent bacterium is Salmonella typhimurium and the minE polypeptide is S. typhimurium minE. In yet other embodiments, the parent bacterium is Escherichia, Acinetobacter, Agrobacterium, Anabaena, Aquifex, Azoarcus, Azotobacter, Bordetella, Bradyrhizobium, ), Brucella, Buchnera, Burkholderia, Candidatus, Chromobacterium, Crocosphaera, Dechloromonas, Desulfitobacterium, Desulfotalea talea, Erwinia, Francisella, Fusobacterium, Gloeobacter, Gluconobacter, Helicobacter, Legionella, Magnetospirillum, Mesorhizobium bium, Methylococcus, Neisseria, Nitrosomonas, Nostoc, Photobacterium, Photorhabdus, Polaromonas, Prochlorococcus, Pseudomonas,Psychrobacter, Ralstonia, Rubrivivax, Salmonella, Shewanella, Shigella, Sinorhizobium, Synechococcus, Synechocystis, Thermosynechococcus, Thermotoga, Thermus, Thiobacillus, Trichodesmium, Vibrio, Wigglesworthia, Wolinella, The bacterium is a bacterium of the genus Xanthomonas, Xylella, Yersinia, Bacillus, Clostridium, Deinococcus, Exiguobacterium, Geobacillus, Lactobacillus, Moorella, Oceanobacillus, Symbiobacterium, or Thermoanaerobacter, and the cell division topology specificity factor is the endogenous minE or DivIVA of the parent bacterium.

[0146] In some embodiments of the above aspects, the cell division topology specificity factor is a polypeptide having an amino acid sequence at least 20% identical to a Bacillus subtilis DivIVA polypeptide (SEQ ID NO: 4), e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 4. In some embodiments, the cell division topology specificity factor comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the cell division topology specificity factor is a DivIVA polypeptide. Exemplary species having DivIVA polypeptides are provided in Table 4 and in Rothfield et al., Nature Reviews Microbiology, 3:959-968, 2005. In some embodiments, the parent bacterium is Bacillus subtilis and the cell division topology specificity factor is B. subtilis DivIVA.

[0147] In some embodiments, the ADAS or parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor also exhibits a reduced level of one or more Z-ring inhibitory proteins.

[0148] In some embodiments, the Z ring inhibitory protein is a polypeptide having an amino acid sequence at least 20% identical to an E. coli minC polypeptide (SEQ ID NO: 2), e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the Z ring inhibitory protein comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, the Z ring inhibitory protein is a minC polypeptide.

[0149] In some embodiments, the Z ring inhibitory protein is a polypeptide having an amino acid sequence at least 20% identical to an E. coli minD polypeptide (SEQ ID NO: 3), e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 3. In some embodiments, the Z ring inhibitory protein comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the Z ring inhibitory protein is a minD polypeptide.

[0150] In some embodiments, the ADAS or parent bacterium exhibits reduced levels, activity, or expression of at least two Z-ring inhibitory proteins. In some embodiments, the ADAS or parent bacterium exhibits reduced expression of minC and minD polypeptides. In some embodiments, the ADAS or parent bacterium exhibits reduced expression of minC, minD, and minE polypeptides, for example, a deletion of the minCDE operon (ΔminCDE).

[0151] The reduction in the level, activity or expression of the cell division topology specificity factor or Z-ring inhibitory protein, e.g., reduction in ADAS or reduction in parental bacterial cells, may be achieved using any suitable method. For example, in some embodiments, the reduction in level or activity occurs by a loss-of-function mutation, e.g., gene deletion. In some embodiments, the loss-of-function mutation is an inducible loss-of-function mutation, and the loss of function is induced by exposing the parental cell to an induction condition, e.g., the inducible loss-of-function mutation is a temperature-sensitive mutation, and the induction condition is a temperature condition.

[0152] In some embodiments, the parent cell has a deletion of the minCDE operon (ΔminCDE) or a deletion of a homologous operon.

[0153] C. ADAS including cargo In some embodiments, the ADAS provided by the present invention comprises a cargo housed within the ADAS. The cargo may be any moiety disposed within the ADAS (e.g., encapsulated in the ADAS) or conjugated to the surface of the ADAS. In some embodiments, the cargo comprises a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory drug, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP), or a combination of the foregoing.

[0154] In some embodiments, the nucleic acid is DNA, RNA, or a plasmid. In some embodiments, the nucleic acid (e.g., DNA, RNA, or a plasmid) encodes a protein. In some embodiments, the protein is transcribed and / or translated in the ADAS.

[0155] In some embodiments, the cargo is an enzyme. In some embodiments, the enzyme alters a substrate such that a target product is produced. In some embodiments, the substrate is present in the ADAS and the target product is produced in the ADAS. In other embodiments, the substrate is present in the target cell or environment to which the ADAS is delivered.

[0156] In certain embodiments, the cargo is modified to have improved stability compared to the unmodified version of the cargo. The "stability" of the cargo is a unitless ratio between the half-life of the unmodified cargo and the half-life of the modified cargo when measured under the same environmental conditions. In some embodiments, the environment is experimentally controlled, for example, simulated body fluid, RNase-free water, cytoplasm, extracellular space, or "ADAS plasm" (i.e., the contents of the internal volume of the ADAS, for example, after dissolution). In some applications, it is an agricultural environment, for example, various field soils, river water, or ocean water. In other embodiments, the environment is real or simulated: an animal's intestine, an animal's skin, an animal's reproductive system, an animal's respiratory tract, an animal's bloodstream, or an animal's extracellular space. In certain embodiments, the ADAS does not substantially degrade the cargo.

[0157] In certain embodiments, the cargo comprises a protein. In certain embodiments, the protein has a stability in the cytoplasm or other environment of greater than about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 1000000, 10000000. The protein may be any protein, including growth factors; enzymes; hormones; immunomodulatory proteins; antibiotic proteins, such as antibacterial, antifungal, insecticide proteins, etc.; targeting agents, such as antibodies or nanobodies, etc. In some embodiments, the protein is a hormone, e.g., paracrine, endocrine, autocrine.

[0158] In some embodiments, the cargo comprises a plant hormone, such as abscisic acid, an auxin, a cytokinin, ethylene, gibberellin, or a combination thereof.

[0159] In certain embodiments, the cargo is an immunomodulatory agent, such as an immunostimulant, a checkpoint inhibitor (e.g., an inhibitor of PD-1, PD-L1, CTLA-4), a chemotherapeutic agent, a suppressor, a superantigen, a small molecule (cyclosporine A, a cyclic dinucleotide (CDN), or a STING agonist (e.g., MK-1454)).

[0160] For ADASs that include a cargo, in some embodiments, the cargo is an RNA, such as a circular RNA, mRNA, siRNA, shRNA, ASO, tRNA, dsRNA, or a combination thereof. In certain embodiments, the RNA has a stability, for example in the ADAS plasma, of about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 1000000, 10000000. The RNA cargo can be stabilized in certain embodiments by the addition of a tRNA scaffold, for example, a step-loop structure. For example, non-human tRNALys3 and E. coli tRNAMet (Nat. Methods, Ponchon 2007). Both are well characterized and have been recombinantly expressed. However, various other types, such as aptamers, lncRNAs, ribozymes, etc., may be used as well. The RNA can also be stabilized when the ADAS is obtained from a parent strain that is null (or hypomorphic) for one or more ribonucleases.

[0161] In some detailed embodiments, the RNA is a protein-coding mRNA. In more detailed embodiments, the protein-coding mRNA encodes an enzyme (e.g., an enzyme that confers hepatic enzyme activity, such as human PBGD (hPBGD) mRNA) or encodes an antigen that elicits an immune response (e.g., elicits strong and durable neutralizing antibody titers), such as an mRNA that encodes an antigen, e.g., CMV glycoprotein gB and / or pentameric complex (PC). In certain detailed embodiments, the RNA is a small non-coding RNA, such as shRNA, ASO, tRNA, dsRNA, or a combination thereof.

[0162] In certain embodiments, the ADAS provided by the present invention comprises a cargo that includes a gene editing system. A "gene editing system" comprises (or encodes) a protein that can modify a target DNA sequence, such as a genomic DNA sequence, with suitable associated nucleic acid, whether by inserting or deleting a target sequence, and also modify changes in methylation status. Exemplary gene editing systems include Cas systems, such as Cas9, Cpf1 or other systems with their companion RNAs that are targeted by RNA, and those based on zinc finger nucleases and TAL effectors conjugated to nucleases.

[0163] Other embodiments of the ADAS provided by the present invention include plasmids, which contain DNA as cargo, and optionally the DNA contains protein coding sequences. Exemplary DNA cargoes include, in certain embodiments, plasmids (see examples above) that code for the RNA sequence of interest, which may be flanked on either side by tRNA inserts, for example. A variety of DNA cargoes are encompassed by the present invention, including ADAS producing (e.g., genome-degrading exonucleases that drive FTZ overexpression); long-lived plasmids (ATP synthase expression, rhodopsin expression); those that express stabilized non-coding RNA, tRNA, lncRNA; express secretion apparatus tag proteins, NleE2 effector domains and localization tags; secretion apparatus T3 / 4SS, T5SS, T6SS; logic circuits, conditionally expressed secretion apparatus; and combinations thereof. In some embodiments, the logic circuit includes an inducible expression or repression cassette, such as an IPTG-inducible Plac promoter and the hrpR portion of the AND gate, and, for example, a heat-inducible promoter pL (from lambda phage, which is normally repressed by a heat-labile protein) and the hrpS portion of the AND gate. To engineer the OR gate, the sytem described by Rosado et al., PLoS Genetics, 2018 can be used. Briefly, a cis-repressed mRNA encoding RFP under a constitutive promoter can be used. This repression can then be removed in the presence of RAJ11 sRNA. A plasmid can then be used that contains the IPTG-inducible promoter PLac and the heat-inducible promoter pL, both of which induce the expression of RAJ11 sRNA. The output would then be RFP expression, which is seen in response to either input. These systems can be adapted for various sensor-type functions.

[0164] The ADAS provided by the present invention, in some embodiments, comprises a transporter in the membrane, hi certain embodiments, the transporter is specific for glucose, sodium, potassium, a metal ion, an anionic solute, a cationic solute, or water.

[0165] In some embodiments, the membrane of the ADAS provided by the present invention comprises an enzyme. In particular embodiments, the enzyme is a protease, an oxidoreductase, or a combination thereof. In some embodiments, the enzyme is chemically conjugated to the ADAS membrane, optionally via a linker to the outer membrane.

[0166] D. ADAS containing the secretion apparatus In certain embodiments, the ADAS provided by the present invention comprises a bacterial secretion apparatus (e.g., an endogenous bacterial secretion apparatus or a heterologous secretion apparatus). A "bacterial secretion apparatus" is a protein or protein complex capable of translocating cargo from the cytoplasm of a bacterial cell (or, e.g., an ADAS derived therefrom) to the extracellular space, the periplasmic space of a gram-negative bacterium, or the intracellular space of another cell. In some embodiments, the bacterial secretion apparatus operates by an active (e.g., ATP-dependent or PMF-dependent) process, and in certain embodiments, the bacterial secretion apparatus comprises a tube or spike that spans from the host cell (or the ADAS) to the target cell. In other embodiments, the bacterial secretion apparatus is a transmembrane channel. Exemplary bacterial secretion apparatuses include the T3SS and T4SS (and T3 / T4SS, as defined below), which are tube-containing structures through which cargo traverses through a protein tube, and the T6SS, which carries cargo at the end of a spike. Other exemplary bacterial secretion apparatuses include the T1SS, T2SS, T5SS, T7SS, Sec, and Tat, which are transmembrane.

[0167] In some embodiments, the heterologous secretion apparatus is a T3SS.

[0168] In some embodiments, the ADAS comprises a cargo, where the cargo comprises a moiety that directs export by the bacterial secretion apparatus, for example, in some embodiments, the moiety is Pho / D, Tat, or a synthetic peptide signal.

[0169] In a particular embodiment, the ADAS provided by the present invention is a double membrane ADAS. In a more particular embodiment, the double membrane ADAS further comprises a bacterial secretion apparatus. In an even more particular embodiment, the bacterial secretion apparatus is selected from a T3SS, a T4SS, a T3 / 4SS, or a T6SS, optionally with an attenuated or non-functional effector that does not affect the fitness of the target cell.

[0170] The ADAS provided by the present invention, in some embodiments, comprises a bacterial secretion apparatus.

[0171] In some embodiments, the bacterial secretion apparatus has the ability to translocate cargo across the ADAS outer membrane, such as a T3SS, a T4SS, a T3 / T4SS, or a T6SS, into a target cell, such as an animal, fungal, bacterial, or plant cell.

[0172] In more particular embodiments, the bacterial secretion apparatus is a T3 / 4SS. A "T3 / 4SS" refers to a secretion apparatus based on a T3SS or a T4SS, including hybrid apparatus as well as unmodified versions, that links the two between the bacterium (or ADAS) and the target cell to form a protein tube that delivers one or more effectors. The target cell may be an animal, a plant, a fungus, or a bacterium. In some embodiments, the T3 / 4SS comprises an effector, which may be a modified effector. Examples of T3SS apparatus include the Salmonella SPI-1 apparatus, the EHEC coli ETT1 apparatus, the Xanthamonas Citri / Campestri T3SS apparatus, and the Pseudomonas syringae T3SS apparatus. Examples of T4SS apparatus include the Agrobacterium Ti plasmid apparatus and the Helicobacter pylori T4SS. In particular embodiments, the T3 / 4SS has a modified effector function, e.g., an effector selected from SopD2, SopE, Bop, Map, Tir, EspB, EspF, NleC, NleH2, or NleE2. In more particular embodiments, the modified effector function is a function of intracellular targeting, such as translocation into the nucleus, Golgi, mitochondria, actin, microvilli, ZO-1, microtubules, or cytoplasm. In yet more particular embodiments, the modified effector function is a function of nuclear targeting based on NleE2 from E. coli. In other particular embodiments, the modified effector function is a function of filopodia formation, disruption of tight junctions, loss of microvilli, or inactivation of SGLT-1.

[0173] In other embodiments, the ADAS provided by the present invention comprising a bacterial secretion apparatus comprises a T6SS. In some embodiments, the T6SS comprises an effector that targets and kills the bacterium in its natural host. In certain detailed embodiments, the T6SS is derived from P. putida K1-T6SS, optionally wherein the effector comprises the amino acid sequence of Tke2 (Accession No. AUZ59427.1), or a functional fragment thereof. In other embodiments, the T6SS comprises an effector that targets and kills the fungus in its natural host, for example, the T6SS is derived from Serratia Marcescens, and the effector comprises the amino acid sequence of Tfe1 (Genbank: SMDB11_RS05530) or Tfe2 (Genbank: SMDB11_RS05390).

[0174] In other embodiments of the ADAS provided by the present invention that include a bacterial secretion apparatus, the bacterial secretion apparatus is capable of exporting cargo outside the cell. In certain more specific embodiments, the bacterial secretion apparatus is a T1SS, a T2SS, a T5SS, a T7SS, a Sec, or a Tat.

[0175] E. ADAS lacking proteases, RNases, and / or LPS In another aspect, the invention provides compositions comprising multiple ADAS (e.g., hyperactive ADAS) that have reduced protease levels or activity compared to an ADAS made from a wild-type parent bacterium. In some aspects, the ADAS is made from a parent bacterium that has been modified to reduce or eliminate expression of at least one protease.

[0176] In another aspect, the invention provides compositions comprising multiple ADAS (e.g., hyperactive ADAS), which have reduced RNase levels or activity compared to an ADAS made from a wild-type parent bacterium. In some aspects, the ADAS is made from a parent bacterium that has been modified to reduce or eliminate expression of at least one RNase. In some embodiments, the RNase is an endoribonuclease or an exoribonuclease.

[0177] In another aspect, the present invention provides a composition comprising a plurality of ADAS, the ADAS being modified to have reduced lipopolysaccharide (LPS). In some embodiments, the modification is a mutation in lipid A biosynthesis myristoyltransferase (msbB).

[0178] In certain embodiments, the ADAS provided by the present invention lacks one or more metabolically non-essential proteins. "Metabolically non-essential proteins" include, but are not limited to, fimbriae, flagella, undesired secretion apparatus, transposases, effectors, phage elements, or regulatory elements thereof, such as flhC or OmpA. In some embodiments, the ADAS provided by the present invention lacks one or more of RNases, proteases, or combinations thereof, and in particular embodiments, lacks one or more endoribonucleases (such as RNase A, RNase h, RNase III, RNase L, RNase PhyM) or exoribonucleases (such as RNase R, RNase PH, RNase D); or serine, cysteine, threonine, aspartic acid, glutamic acid, and metalloproteases; or any combination of the foregoing.

[0179] E. ADAS Containing a Targeting Moiety In another embodiment, the present invention provides a composition comprising a plurality of ADAS (e.g., highly active ADAS), the ADAS comprising a targeting moiety, in some embodiments, the targeting moiety is a nanobody, a carbohydrate binding protein, or a tumor targeting peptide.

[0180] In certain embodiments, the nanobody is a nanobody directed against a tumor antigen, such as HER2, PSMA, or VEGF-R. In other embodiments, the carbohydrate binding protein is a lectin, such as mannose-binding lectin (MBL). In yet other embodiments, the tumor targeting peptide is an RGD motif or a CendR peptide.

[0181] F. ADAS derived from commensal or pathogenic parent strains In another embodiment, the present invention provides a composition comprising a plurality of ADAS (e.g., highly active ADAS), the ADAS being derived from a parent bacterium that is a mammalian pathogen or a mammalian commensal bacterium. In some examples, the mammalian commensal bacterium is a Staphylococcus, Bifidobacterium, Micrococcus, Lactobacillus, or Actinomyces species, or the mammalian pathogenic bacterium is Escherichia coli (EHEC), Salmonella typhimurium, Shigella flexneri, Yersinia enterolitica, or Helicobacter pylori.

[0182] In another embodiment, the invention provides a composition comprising a plurality of ADAS (e.g., a highly active ADAS), the ADAS being derived from a parent bacterium that is a plant pathogen or a plant commensal bacterium. In some examples, the plant commensal bacterium is Bacillus subtilis or Psuedomonas putida, or the plant pathogenic bacterium is a Xanthomonas species or Pseudomonas syringae.

[0183] G. ADAS derived from auxotrophic parent strain In another embodiment, the present invention provides a composition comprising multiple ADAS (e.g., a highly active ADAS) that are derived from an auxotrophic parent bacterium, i.e., a parent bacterium that lacks the ability to synthesize an organic compound required for growth. Such bacteria can only grow when the organic compound is provided.

[0184] H. ADAS with additional parts In certain embodiments, the ADAS comprises a functional ATP synthase and, in some embodiments, a proton pump embedded in the membrane. The ADAS can be derived from a variety of sources, including parental bacterial strains ("parental strains") engineered or induced to produce genome-free closed membrane systems, bacteria from which the genome has been excised, bacterial cell preparation extracts (e.g., by mechanical or other means), or total synthesis, optionally including fractions of bacterial cell preparations. In some embodiments, the highly active ADAS has a molecular mass of at least: 10,000 nm 2 1 per unit, 5000nm 2 1 per unit, 3500nm 2 1 per 1000nm 2 The concentration of ATP synthase is one per unit.

[0185] The ADAS provided by the present invention can include a variety of additional components, including, for example, photovoltaic pumps, retinals and retinal-producing cassettes, metabolic enzymes, targeting agents, cargo, bacterial secretion apparatus, and transporters, including combinations of the foregoing, including the specific detailed embodiments described below. In certain embodiments, the ADAS lacks other elements, such as metabolically non-essential genes and / or certain nucleases or proteases.

[0186] In certain embodiments, the ADAS provided by the present invention comprises an ATP synthase that optionally lacks a regulatory domain, such as lacking the ε domain. The deletion can be achieved by various means. In certain embodiments, the deletion is by inducible deletion of the native ε domain. In certain embodiments, the deletion may be achieved by flanking LoxP sites and inducible Cre expression or CRISPR knockout, or may be inducible (placed under the tTa tet transactivator on a plasmid in an ATP synthase knockout strain).

[0187] In some embodiments, the ADAS can include a photovoltaic proton pump. In certain embodiments, the photovoltaic proton pump is a proteorhodopsin. In more specific embodiments, the proteorhodopsin comprises the amino acid sequence of a proteorhodopsin from the uncultured marine bacterial clade SAR86, GenBank accession number AAS73014.1. In other embodiments, the photovoltaic proton pump is a Gloeobacter rhodopsin. In certain embodiments, the photovoltaic proton pump is bacteriorhodopsin, delta rhodopsin, or halorhodopsin from Halobacterium salinarum, Natronomonas pharaonis, Exiguobacterium sibiricum, Haloterrigena turkmenica, or Haloarcula marismortui.

[0188] In some embodiments, the ADAS provided by the present invention further comprises retinal. In certain embodiments, the ADAS provided by the present invention further comprises a retinal synthesis protein (or protein machinery), or a nucleic acid encoding the same.

[0189] In certain embodiments, the ADAS provided by the present invention further comprises one or more glycolytic pathway proteins. In some embodiments, the glycolytic pathway protein is, for example, phosphofructokinase (Pfk-A) comprising the amino acid sequence of UniProt Accession No. P0A796 or a functional fragment thereof. In other embodiments, the glycolytic pathway protein is, for example, triosephosphate isomerase (tpi) comprising the amino acid sequence of UniProt Accession No. P0A858 or a functional fragment thereof.

[0190] I. ADAS Compositions and Formulations The invention provides compositions or preparations containing the ADAS provided by the invention, including, inter alia, highly active ADAS preparations provided by the invention or ADAS preparations in which a plurality of individual ADAS are devoid of cell division topology specificity factors, e.g., devoid of the minE gene product, and optionally substantially free of viable cells. Collectively, these are "compositions provided by the invention" or "a composition provided by the invention" and the like, and can contain any ADAS provided by the invention and any combination of ADAS provided by the invention.

[0191] For example, in some embodiments, compositions provided herein contain at least about: 80, 81, 82, 83, 84, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% or more of an ADAS that comprises the bacterial secretion apparatus. In particular embodiments, the bacterial secretion apparatus is one of a T3SS, a T4SS, a T3 / 4SS, or a T6SS.

[0192] In some embodiments, the compositions provided herein include an ADAS that comprises a T3SS, the ADAS having a molecular weight of about: 40000, 35000, 30000, 25000, 19600, 15000, 10000, or 5000 nm. 2In certain detailed embodiments, the ADAS is derived from a S. typhimurium or E. coli parent strain.

[0193] Certain embodiments of the compositions provided by the present invention include an ADAS that contains a T3SS, the ADAS having a molecular weight of about: 300,000, 250,000, 200,000, 150,000, 100,000, 50,000, 20,000, 10,000, 5,000 nm 2 In certain detailed embodiments, the ADAS is derived from an Agrobacterium tumefaciens parent strain.

[0194] In another aspect, the present invention provides an ADAS composition, wherein at least about: 80, 81, 82, 83, 84, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% or more of the ADAS comprises a bacterial secretion apparatus including a T3, T4, T3 / 4SS, T6SS, and optionally one or more of an exogenous carbohydrate, a phosphate producing synthase, a light responsive protein, an intracellular internalization protein, an enzyme, a functional cargo, an organism-specific effector, a fusion protein.

[0195] As will be readily apparent, the compositions and preparations provided by the invention can contain any ADAS provided by the invention, such as a highly active ADAS or an ADAS lacking the minE gene product.

[0196] The composition provided by the present invention can be prepared into any suitable formulation.For example, the formulation can be suitable for IP, IV, IM, oral, topical (cream, gel, ointment, transdermal patch), aerosol or spray administration.In some embodiments, the formulation is a liquid formulation.In other embodiments, the formulation is a lyophilized formulation.

[0197] In some embodiments, the ADAS compositions described herein comprise less than 100 colony forming units (CFU / mL) viable bacterial cells, e.g., less than 50 CFU / mL, less than 20 CFU / mL, less than 10 CFU / mL, less than 1 CFU / mL, or less than 0.1 CFU / mL.

[0198] In some embodiments, the invention provides an ADAS composition, where the ADAS is lyophilized and reconstituted, and the reconstituted ADAS has an ATP concentration that is at least 90%, e.g., at least 95%, 98%, or at least equal to the ATP concentration of the non-lyophilized ADAS.

[0199] In some embodiments, the invention provides an ADAS composition, where the ADAS is stored, e.g., stored at 4° C., and after storage, the ADAS has an ATP concentration that is at least 90%, e.g., at least 95%, 98%, or at least equal to the ATP concentration of the non-stored ADAS. In some embodiments, the storage is for at least 1 day, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 6 months, or at least 1 year.

[0200] In some embodiments, the ADAS may be maintained or in some "resting" state and then rapidly activated.

[0201] In some embodiments, the ADAS composition is formulated for delivery to an animal, for example, formulated for intraperitoneal, intravenous, intramuscular, oral, topical, aerosol, or spray administration.

[0202] In some embodiments, the ADAS composition is formulated for delivery to a plant.

[0203] In some embodiments, the ADAS composition is formulated for delivery to insects.

[0204] In some embodiments, the composition is formulated as a liquid, solid, aerosol, paste, gel, or gas composition.

[0205] J. ADAS containing enzymes In one aspect, the invention features a composition that includes a plurality of ADAS, the ADAS including an enzyme that alters a substrate such that a target product is produced. In some embodiments, the substrate is present in the ADAS, and the target product is produced in the ADAS. In other embodiments, the substrate is present in a target cell or environment to which the ADAS is delivered. In some embodiments, the enzyme is diadenylate cyclase A, the substrate is ATP, and the target product is cyclic di-AMP.

[0206] III. ADAS Manufacturing Method A. Creation of ADAS and Highly Active ADAS In some aspects, the invention features a method for making a composition comprising a plurality of ADAS, the composition being substantially free of viable bacterial cells, the method including: (a) generating, providing, or obtaining a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topology specificity factor; (b) exposing the parent bacteria to conditions that permit the formation of minicells, thereby producing a highly active ADAS; and (c) separating the highly active ADAS from the parent bacteria, thereby producing a composition that is substantially free of viable bacterial cells.

[0207] The parent bacterium includes any suitable bacterial species from which an ADAS can be produced (e.g., a species that may be modified to produce an ADAS using the methods described herein). Table 4 provides a non-limiting list of suitable genera from which an ADAS can be derived.

[0208] TIFF2025032096000002.tif233170

[0209] TIFF2025032096000003.tif241170

[0210] TIFF2025032096000004.tif124170 In some aspects, the invention features methods of making any of the ADAS compositions described in Section I herein, e.g., highly active ADAS compositions. For example, provided herein are methods of making a highly active ADAS; a method of making an ADAS that lacks a cell division topology specificity factor, and optionally lacks a Z-ring inhibitory protein (e.g., a method of making an ADAS from a ΔminCDE parent bacterium); and a method of making any of the ADASs mentioned herein, where the ADAS includes a cargo.

[0211] The highly active ADAS of any one of the preceding claims may be produced from bacterial cells, where the parent strain is a plant bacterium such as a plant commensal (e.g., B. Subtilis or Pseudomonas putida) or a plant pathogen (e.g., Xanthomonas sp. or Psuedomonas syringae) or a commensal human bacterium (e.g., E. coli, Staphylococcus sp., Bifidobacterium sp., Micrococcus sp., Lactobacillus sp., or Actinomyces sp.) or a pathogenic human bacterium (e.g., Escherichia coli EHEC, Salmonella typhimurium ... The host organism may be selected from human bacteria such as Streptomyces Typhimurium, Shigella flexneri, Yersinia enterolitica, Helicobacter pylori, or extremophilic microorganisms, including functionalized derivatives of any of the foregoing, including functional cassettes, such as functional cassettes that induce the bacteria to one or more of: secrete antimicrobials, digest plastics, secrete insecticides, survive extreme environments, make nanoparticles, integrate into other organisms, respond to the environment, and produce reporter signals.

[0212] The parent bacterium can include any of the functionalized derivatives described above, such as those that include functional cassettes, such as functional cassettes that induce the bacterium to do one or more of the following: secrete antimicrobials, digest plastics, secrete pesticides, survive extreme environments, make nanoparticles, integrate into other organisms, respond to the environment, and produce reporter signals.

[0213] In some embodiments, the ADAS is derived from a parent strain that has been engineered or induced to overexpress ATP synthase. In some more particular embodiments, the ATP synthase is heterologous to the parent strain. In certain particular embodiments, the parent strain contains a functional F o It is modified to express F1 ATP synthase.

[0214] In certain embodiments, the ADAS provided by the present invention is obtained from a parent strain cultured under conditions selected from an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1-5% O2, 5-10% O2, 10-15% O2, 25-30% O2), a low pH (about: 4.5, 5.0, 5.5, 6.0, 6.5), or a combination thereof.

[0215] The highly active ADAS of any one of the preceding claims, which is made from an extremophile microorganism, including functionalized derivatives of any of the foregoing, including functional cassettes, such as functional cassettes that induce the bacteria to do one or more of the following: secrete antimicrobials, digest plastics, secrete insecticides, survive extreme environments, make nanoparticles, integrate into other organisms, respond to the environment, and produce a reporter signal.

[0216] Due to the diversity of bacteria, the ADAS can be made with a membrane modified to improve, for example, the biodistribution of the ADAS upon administration to target cells. In certain embodiments, the membrane is modified to be less immunogenic or immunostimulatory in plants or animals. For example, in certain embodiments, the ADAS is obtained from a parent strain, where the immunostimulatory capacity of the parent strain has been reduced or eliminated by post-production treatment with detergents, enzymes, or functionalization with PEG. In certain embodiments, the ADAS is made from a parent strain, and the membrane is modified with a knockout of the LPS synthesis pathway in the parent strain, for example by knocking out msbB. In other detailed embodiments, the ADAS is made from a parent strain that produces cell wall-deficient particles upon exposure to hyperosmotic conditions.

[0217] In some embodiments, the method includes transforming the parent strain with an inducible DNase system, such as exoI (NCBI GeneID: 946529) and sbcD (NCBI GeneID: 945049) nucleases, or I-CeuI (e.g., Swissprot: P32761.1) nuclease. In more particular embodiments, the method includes using a single, double, triple, or quadruple auxotroph and having a complementing gene on a plasmid encoding an inducible nuclease.

[0218] In some embodiments of the methods provided by the present invention, the parent strain is cultured under conditions selected from an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1-5% O2, 5-10% O2, 10-15% O2, 25-30% O2), a low pH (4.5-6.5), or a combination thereof.

[0219] In certain embodiments of the methods provided by the invention, the parent strain lacks flagella and unwanted secretion apparatus, and optionally the flagella and unwanted secretion apparatus are removed using λ Red recombineering.

[0220] In some embodiments, methods provided by the present invention, flagellar regulatory components are excised from the parental strain genome by insertion of a plasmid containing a CRISPR domain targeting flagellar regulatory genes, such as, for example, flhD and flhC.

[0221] In a particular embodiment, the method provided by the present invention is a method for producing a highly active ADAS, in which an ADAS containing a plasmid containing a rhodopsin-encoding gene is cultured in the presence of light. In a more specific embodiment, the rhodopsin is a proteorhodopsin from SAR86 uncultured bacteria having the amino acid sequence of GenBank Accession No. AAS73014.1, or a functional fragment thereof. In yet a more specific embodiment, the culture is supplemented with retinal. In another more specific embodiment, the rhodopsin is a proteorhodopsin, and the plasmid further contains a gene that synthesizes retinal (such a plasmid is the pACYC-RDS plasmid from Kim et al., Microb Cell Fact, 2012).

[0222] In certain particular embodiments, the parental line contains a nucleic acid sequence encoding a Nanobody that is in turn expressed on the membrane of the ADAS.

[0223] In some embodiments of the methods provided by the invention, the parent strain contains a nucleic acid sequence encoding one or more bacterial secretion apparatus operons. Exemplary plasmids include the Salmonella SPI-1 T3SS, the Shigella flexneri T3SS, the Agrobacterium (Agro) Ti plasmid, and the P. putida K1-T6SS apparatus.

[0224] In certain embodiments, the parent strain comprises a cargo, hi some embodiments, the parent strain contains a nucleic acid sequence encoding a set of genes that synthesize a small molecule cargo.

[0225] IV. Purification of ADAS and ADAS Compositions In some embodiments of the methods and compositions provided herein, the ADAS is purified from a composition (e.g., a culture) that includes a viable bacterium, e.g., a parent bacterium. For example, the invention features a method of making a composition that includes a plurality of ADAS, the composition being substantially free of viable bacterial cells, the method including: (a) generating, providing, or obtaining a plurality of parent bacteria that exhibit a reduced level or activity of a cell division topological specificity factor; (b) exposing the parent bacteria to conditions that permit the formation of minicells, thereby generating a highly active ADAS; and (c) separating the highly active ADAS from the parent bacteria, thereby generating a composition that is substantially free of viable bacterial cells.

[0226] Purification separates the ADAS from the larger, genome-containing, viable parent bacterial cells. Separation of the highly active ADAS from the parent bacteria can be performed using a number of methods as described herein. Exemplary purification methods described herein include centrifugation, selective growth, and buffer exchange / concentration processes.

[0227] In some aspects, provided herein are ADAS compositions, and methods for comparing such compositions, that are substantially free of parental and / or viable bacterial cells, e.g., have no more than 500 colony forming units (CFU) per mL, e.g., 400, 300, 200, 150, or 100 CFU, or less than 50, less than 25, less than 10, less than 5, less than 1, less than 0.1. In some embodiments, an ADAS composition that is substantially free of parental bacterial cells may not contain any bacterial cells at all.

[0228] Auxotrophic parent strains can be used to generate the ADAS provided by the invention. As described in more detail below, such production methods are useful for purifying the ADAS. For example, after production of the ADAS, the parent bacterial cells may be removed by growing in a medium lacking nutrients (e.g., amino acids) essential for the viability of the parent bacteria. In some embodiments, the ADAS provided by the invention lacks auxotrophic amino acids such as arginine (e.g., knockout of argA, strains JW2786-1 and NK5992), cysteine ​​(e.g., knockout of argA, strains JW2786-1 and NK5992), ... knockout of cysE (such as strains JW3582-2 and JM15), knockout of glutamine, e.g., glnA (such as strains JW3841-1 and M5004), knockout of glycine, e.g., glyA (such as strains JW2535-1 and AT2457), knockout of histidine, e.g., hisB (such as strains JW2004-1 and SB3930), knockout of isoleucine, e.g., ilvA (such as strains JW3745-2 and AB1255), knockout of leucine, e.g., leuB (such as strains JW5807-2 and CV514), lysine, e.g., knockout of lysA (such as strains JW2806-1 and KL334); methionine, e.g., knockout of metA (such as strains JW3973-1 and DL41); phenylalanine, e.g., knockout of pheA (such as strains JW2580-1 and KA197); proline, e.g., knockout of proA (such as strains JW0233-2 and NK5525); serine, e.g., knockout of serA (such as strains JW2880-1 and JC158); threonine, e.g., knockout of thrC (strains JW0003-2 and Gif 41), tryptophan, e.g., a knockout of trpC (such as strains JW1254-2 and CAG18455), tyrosine, e.g., a knockout of tyrA (such as strains JW2581-1 and N3087), valine / isoleucine / leucine, e.g., a knockout of ilvd (such as strains JW5605-1 and CAG18431).

[0229] In certain embodiments, the method comprises using a single-, double-, triple-, or quadruple-auxotrophic parent strain, optionally wherein the parent strain further comprises a plasmid expressing ftsZ.

[0230] How to use V.ADAS A. ADAS Delivery Method In one aspect, the invention features a method for delivering a highly active ADAS to a target cell, the method including: (a) providing a composition including a plurality of highly active ADAS, the ADAS having an initial ATP concentration of at least 1.25 mM, and the composition being substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0231] In another aspect, the invention features a method for delivering an ADAS (e.g., a highly active ADAS) to a target cell, the method including: (a) providing a composition including a plurality of ADAS, where the ADAS are derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and where the composition is substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0232] The target cell may be, for example, an animal cell, a plant cell, or an insect cell.

[0233] B. Cargo Delivery Method In another aspect, the invention features a method of delivering a cargo (e.g., a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory agent, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP)) to a target cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS has an initial ATP concentration of at least 1.25 mM, the ADAS includes a cargo, and the composition is substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0234] In another aspect, the invention features a method of delivering a cargo (e.g., a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory agent, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP)) to a target cell, the method including: (a) providing a composition including a plurality of ADAS, wherein the ADAS are derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, the ADAS including a cargo, and the composition being substantially free of viable bacterial cells; and (b) contacting the target cell with the composition of step (a).

[0235] The target cell to which the cargo is delivered may be, for example, an animal cell, a plant cell, or an insect cell.

[0236] C. Methods for Regulating Cellular Conditions In one aspect, the invention features a method of modulating a state of an animal cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the animal cell with the composition of step (a), thereby modulating a state of the animal cell.

[0237] In another aspect, the invention features a method of modulating a state of a plant cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activity systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting a plant cell with the composition of step (a), thereby modulating a state of the plant cell.

[0238] In another aspect, the invention features a method of modulating a state of an insect cell, the method including: (a) providing a composition including a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS have an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting an insect cell with the composition of step (a), thereby modulating a state of the insect cell.

[0239] In another aspect, the invention features a method of modulating a state of an animal cell, the method including: (a) providing a composition including a plurality of ADAS, the ADAS being derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and the composition being substantially free of viable bacterial cells; and (b) contacting the animal cell with the composition of step (a), thereby modulating the state of the animal cell.

[0240] In another aspect, the invention features a method of modulating a state of a plant cell, the method including: (a) providing a composition including a plurality of ADAS, the ADAS being derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and the composition being substantially free of viable bacterial cells; and (b) contacting a plant cell with the composition of step (a), thereby modulating a state of the plant cell.

[0241] In another aspect, the invention features a method of modulating a state of an insect cell, the method including: (a) providing a composition including a plurality of ADAS, the ADAS being derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and the composition being substantially free of viable bacterial cells; and (b) contacting an insect cell with the composition of step (a), thereby modulating a state of the insect cell.

[0242] Modulation may be any observable change in the state (e.g., transcriptome, proteome, epigenome, biological effect, or health or disease state) of a cell (e.g., an animal, plant, or insect cell) as measured using techniques and methods known in the art for such measurements, e.g., methods for measuring the level or expression of a protein, transcript, epigenetic mark, or methods for measuring an increase or decrease in activity of a biological pathway. In some embodiments, modulating the state of a cell involves increasing a parameter of the cell (e.g., the level or expression of a protein, transcript, or activity of a biological pathway). In other embodiments, modulating the state involves decreasing a parameter of the cell (e.g., the level or expression of a protein, transcript, or activity of a biological pathway).

[0243] D. Methods for Treating Animals, Plants, or Insects In some aspects, the invention features a method of treating an animal in need thereof, the method including: (a) providing a composition comprising a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS has an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the animal with an effective amount of the composition of step (a), thereby treating the animal.

[0244] In another aspect, the invention features a method of treating an animal in need thereof, the method including: (a) providing a composition including a plurality of ADAS, wherein the ADAS are derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the animal with an effective amount of the composition of step (a), thereby treating the animal.

[0245] The animal in need of treatment may have a disease, for example cancer. In some embodiments, the ADAS carries a chemotherapeutic or immunotherapeutic cargo.

[0246] In some aspects, the invention features a method of treating a plant in need thereof, the method including: (a) providing a composition comprising a plurality of highly active non-chromosomal dynamic activation systems (ADAS), wherein the ADAS has an initial ATP concentration of at least 1.25 mM, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the plant or a pest thereof (e.g., an insect) with an effective amount of the composition of step (a), thereby treating the plant.

[0247] In another aspect, the invention features a method of treating a plant in need thereof, the method including: (a) providing a composition including a plurality of ADAS, wherein the ADAS are derived from a parent bacterium that exhibits a reduced level or activity of a cell division topology specificity factor, and wherein the composition is substantially free of viable bacterial cells; and (b) contacting the plant or a pest thereof (e.g., an insect pest) with an effective amount of the composition of step (a), thereby treating the plant.

[0248] In a further aspect, the invention provides a method of modulating a target cell. The target cell may be any cell, including an animal cell (e.g., human and non-human animals, including farm animals or livestock animals, including pests), a plant cell (including from crops or pests), a fungal cell, or a bacterial cell. The cell may be isolated, e.g., in vitro, or in other embodiments, in an organism, in vivo. These methods involve providing an effective amount of an ADAS provided by the invention or a composition provided by the invention to the target cell. The access to the target cell may be either direct (e.g., the target cell is directly modulated by the ADAS, such as by secretion of some agent in proximity to the target cell or injection of an agent into the target cell) or indirect. Indirect modulation of the target cell may be by targeting another cell, e.g., modulating a neighboring cell adjacent to the target cell, which may be commensal or pathogenic to the target cell. The neighboring cell, like the target cell, may be in vitro or in vivo - i.e., in an organism, which may be commensal or pathogenic. These methods are collectively referred to as "methods of use provided by the present invention." In related aspects, the present invention provides targeted uses of the ADAS and compositions provided by the present invention according to the methods of use provided by the present invention.

[0249] For example, in some embodiments, the present invention provides a method of modulating the condition of an animal cell by providing an effective amount of the ADAS provided by the present invention or a composition provided by the present invention with access to the animal cell. In certain embodiments, the ADAS or composition is provided with access to the animal cell in vivo in an animal, such as a mammal, such as a human. In some embodiments, the animal cell is exposed to bacteria in a healthy animal. In more specific embodiments, the animal cell is a lung epithelial, immune cell, skin cell, oral epithelial cell, intestinal epithelial cell, genital epithelial cell, or urinary tract cell. In still more specific embodiments, the animal cell is an intestinal epithelial cell, such as an intestinal epithelial cell from a human subject with inflammatory bowel disease, such as Crohn's disease or colitis. In even more specific embodiments, the animal cell is an intestinal epithelial cell from a subject with inflammatory bowel disease, and the ADAS comprises a bacterial secretion apparatus and a cargo comprising an anti-inflammatory agent.

[0250] In other embodiments, the animal cells are exposed to the bacteria in a diseased state. In certain embodiments, the animal cells are pathogenic, such as a tumor. In other embodiments, the animal cells are exposed to the bacteria in a diseased state, such as a wound, an ulcer, a tumor, or an inflammatory disorder.

[0251] In certain embodiments, the ADAS is derived from an animal commensal parent strain, hi other embodiments, the ADAS is derived from an animal pathogenic parent strain.

[0252] In certain detailed embodiments, the animal cell is contacted with an effective amount of an ADAS comprising a T3 / 4SS or T6SS and a cargo, where the cargo is delivered to the animal cell. In some detailed embodiments, the animal cell is provided with access to an effective amount of an ADAS comprising a cargo and a secretion apparatus, where the cargo is secreted outside the cell and contacted with the animal cell.

[0253] In some embodiments, the state of the animal cell is modulated by providing an effective amount of the ADAS provided by the invention or the composition provided by the invention with access to bacterial or fungal cells in the vicinity of the animal cell. That is, these methods involve indirectly modulating the state of the animal cell. In certain embodiments, the bacterial or fungal cell is pathogenic. In more particular embodiments, the fitness of the pathogenic bacterial or fungal cell is decreased. In other particular embodiments, the bacterial or fungal cell is commensal. In more particular embodiments, the fitness of the commensal bacterial or fungal cell is increased. In still more particular embodiments, the fitness of the commensal bacterial or fungal strain is increased by decreasing the fitness of the number of competing bacteria or fungi, which may be neutral, commensal, or pathogenic.

[0254] In certain detailed embodiments, bacterial or fungal cells in the vicinity of the animal cell are contacted with an effective amount of an ADAS comprising a T3 / 4SS or T6SS and a cargo, where the cargo is delivered to the bacterial or fungal cell. In other detailed embodiments, bacterial or fungal cells in the vicinity of the animal cell are provided with access to an effective amount of an ADAS that extracellularly secretes the cargo that contacts the bacterial or fungal cell.

[0255] In certain embodiments, the ADAS is derived from a parent strain that is a competitor of the bacterial or fungal cell, while in other embodiments, the ADAS is derived from a parent strain that is a mutualistic bacterium of the bacterial or fungal cell.

[0256] As will be appreciated, the various methods of use provided by the present invention for modulating the state of animal cells can be readily adapted to corresponding methods for modulating the state of plant, fungal, or bacterial cells. For purposes of illustration, a method for modulating a plant cell or a fungal cell will be described in more detail.

[0257] Thus, in a related aspect, the invention provides a method of modulating the condition of a plant or fungal cell by providing an effective amount of an ADAS provided by the invention or a composition provided by the invention with access to: a) the plant or fungal cell, b) a neighboring bacterial or fungal cell in the vicinity of the plant or fungal cell, or c) an insect or nematode cell in the vicinity of the plant or fungal cell.

[0258] In certain embodiments, the ADAS is provided with access to plant cells in planta, for example, in crop plants, such as row crops including corn, wheat, soybean, and rice, as well as solanaceous plants such as tomato and pepper; cucurbits such as melon and cucumber; cruciferous plants such as cabbage and broccoli; leafy vegetables such as kale and lettuce; tuberous roots and stems such as potato and carrot; large seed vegetables such as beans and corn; and vegetable crops including mushrooms. In some embodiments, the plant or fungal cells are exposed to the bacteria in a healthy plant or fungus. In other embodiments, the plant or fungal cells are exposed to the bacteria in a diseased state.

[0259] In certain embodiments, the plant or fungal cell is a dividing cell, such as a meristematic cell, or is a pathogenic cell, such as a tumor. In some embodiments, the plant or fungal cell is exposed to bacteria in a diseased state, such as a wound, or the plant or fungal cell is not part of the human diet.

[0260] For certain embodiments, the ADAS is derived from a commensal parent strain, hi other embodiments, the ADAS is derived from a plant or fungal pathogenic parent strain.

[0261] In some embodiments, the ADAS comprises a T3 / 4SS or T6SS and a cargo, and the cargo is delivered to the plant or fungal cell. In other embodiments, the plant or fungal cell is provided with access to an effective amount of an ADAS comprising a bacterial secretion apparatus and a cargo, where the bacterial secretion apparatus secretes the cargo extracellularly, thereby contacting the cargo with the plant or fungal cell.

[0262] In some embodiments, the methods involve providing an effective amount of the ADAS or composition with access to neighboring bacteria or fungal cells in the vicinity of the plant or fungal cell. In more detailed embodiments, the neighboring bacteria or fungal cells are pathogenic, and optionally the fitness of the pathogenic neighboring bacteria or fungal cells is reduced. In other more detailed embodiments, the neighboring bacteria or fungal cells are commensal, and optionally the fitness of the commensal neighboring bacteria or fungal cells is increased. In still more detailed embodiments, the fitness is increased by the reduction of competing bacteria or fungi, which may be neutral, commensal, or pathogenic.

[0263] In some embodiments, an adjacent bacterial or fungal cell is contacted with an effective amount of an ADAS comprising a T3 / 4SS or a T6SS and a cargo, where the cargo is delivered to the adjacent bacterial or fungal cell.

[0264] In other embodiments, adjacent bacterial or fungal cells are provided with access to an effective amount of an ADAS comprising a bacterial secretion apparatus and a cargo, wherein the bacterial secretion apparatus secretes the cargo outside the cell, thereby contacting the cargo with the adjacent bacterial or fungal cells.

[0265] In some embodiments, the ADAS is derived from a parent strain that is a competitor of a neighboring bacterial or fungal cell, while in other embodiments, the ADAS is derived from a parent strain that is a mutualistic bacterium of a neighboring bacterial or fungal cell.

[0266] In certain embodiments, the method includes providing an effective amount of the ADAS or composition to reach an insect or nematode cell in the vicinity of the plant or fungus. In more particular embodiments, the insect or nematode is pathogenic. In still more particular embodiments, the fitness of the pathogenic insect or nematode cell is reduced. In even more particular embodiments, the fitness of the pathogenic insect or nematode cell is reduced by modulation of a symbiont of the insect or nematode cell. In other particular embodiments, the insect or nematode is commensal. In still more particular embodiments, the fitness of the commensal insect or nematode cell is increased. In still more particular embodiments, the fitness is increased by reduction of a competing bacterium or fungus, which may be neutral, commensal, or pathogenic.

[0267] In yet another aspect, the present invention provides a method for removing one or more undesirable materials from an environment comprising contacting the environment with an effective amount of an ADAS provided by the present invention or a composition provided by the present invention, where the ADAS comprises one or more molecules (such as proteins, polymers, nanoparticles, binding agents, or combinations thereof) that capture, chelate, or degrade the one or more undesirable materials. "Environment" is defined as non-cellular targets such as oceans, soils, Superfund sites, skin, ponds, the intestinal lumen, and food in containers.

[0268] In certain embodiments, the undesirable material includes a heavy metal such as mercury, and the ADAS includes one or more molecules (such as proteins, polymers, nanoparticles, binders, or combinations thereof) that bind to the heavy metal, such as MerR for mercury. In some embodiments, the undesirable material includes a plastic such as PET, and the ADAS includes one or more plastic-degrading enzymes, such as PETase. In certain embodiments, the undesirable material includes one or more small organic molecules, and the ADAS includes one or more enzymes capable of metabolizing the one or more small organic molecules.

[0269] E. RNA delivery method In another aspect, the invention provides a composition comprising a bacterium or ADAS provided by the invention, the bacterium or ADAS comprising a T4SS, an RNA binding protein cargo, and an RNA cargo to which the RNA binding protein binds and suitable for delivery to a target cell via the T4SS. In a particular embodiment, the RNA binding protein is Cas9 fused to VirE2 and VirF, the RNA cargo is a guide RNA, and optionally the T4SS is an Agrobacterium Ti apparatus. In another embodiment, the RNA binding protein is Carnation Italian ringspot virus p19 fused to VirE2 or VirF, the RNA cargo is an siRNA, and optionally the T4SS is an Agrobacterium Ti apparatus.

[0270] In related aspects, the invention provides methods of making these particular compositions, which involve transfecting Agrobacterium cells with a plasmid comprising Cas9 fused to VirE2 and VirF and an RNA cargo.

[0271] In a further related aspect, the invention provides a method of delivering RNA to a plant or animal cell comprising contacting said plant or animal cell with a bacterium or ADAS comprising a T4SS, an RNA binding protein cargo and an RNA cargo, wherein the RNA is delivered to the plant or animal cell. In a more particular embodiment, the RNA binding protein cargo is also delivered to the plant or animal cell. EXAMPLES

[0272] TIFF2025032096000005.tif232170

[0273] TIFF2025032096000006.tif177170

[0274] Example 1: Creation of ADAS by genetic engineering ADAS can be produced from parent bacterial cells by several means. In this example, ADAS is produced by disruption of one or more genes involved in regulating parent cell division functions, i.e., disruption of a z-ring inhibitory protein (e.g., ΔminC or ΔminD) or disruption of a z-ring inhibitory protein and a cell division topology specificity factor (e.g., ΔminCDE). This example details genetic means to generate ADAS-producing strains by disruption of the min operon or overexpression of the septation machinery component FtsZ.

[0275] A. Creation of ADAS by min mutation For disruption of the min operon, the λ-RED recombineering methodology was employed according to the protocol described in Datsenko and Wanner, PNAS, 97(12):6640-6645, 2000. Strains for engineering and harboring the plasmids of the λ-RED system were obtained from the Coli Genetic Stock Center (CGSC) at Yale University. Briefly, primers were designed to non-polarly delete the coding sequences of E. coli minC (to generate parental bacterial strain MACH061), minD (to generate parental bacterial strain MACH062), or the entire minCDE operon (to generate parental bacterial strain MACH060) by encoding approximately 40 base pairs of genomic homology at their 5' ends. The 3' ends of these primers were homologous to the plasmids pKD3 and pKD4 of the λ-RED system, which provided antibiotic markers and were used to select parental bacterial strains that inherited the targeted mutation. The primer sequences used for the deletions are provided in Table 1. After standard PCR using primers with pKD3 as the DNA template, the purified amplicons were transformed by electroporation into bacteria prepared with pKD46, a plasmid harboring the phage-derived λ-RED homologous recombination system, by the method of Datsenko and Wanner, PNAS, 97(12):6640-6645, 2000. Transformants were selected on LB agar containing 35 μg / mL chloramphenicol. Standard allele-specific PCR was used to confirm that the resulting colonies had gene disruptions (i.e., ΔminC, ΔminD, or ΔminCDE). Strain genotypes are provided in Table 2.

[0276] TIFF2025032096000007.tif74170

[0277] TIFF2025032096000008.tif210170

[0278] Creation of ADAS by overexpression of B. ftsZ To generate ADAS from overexpression of the septation machinery, we constructed a plasmid that drives expression of the FtsZ Z-ring protein from wild-type E. coli. Briefly, the strong ribosome binding site and coding sequence of the E. coli FtsZ protein were optimized de novo using De Novo DNA computational tools. This translational unit was ordered from Integrated DNA Technologies (IDT™) for de novo DNA synthesis and cloned into the backbone using standard cloning techniques. The resulting plasmid, pFtsZ (Table 3), features a TetR repressor, a TetA promoter repressed by the TetR protein, a kanamycin resistance marker, and a pMB1 origin of replication. When transformed into compatible bacteria, pFtsz can be induced to overproduce the FtsZ protein by the addition of anhydrotetracycline to the culture. This protein, in turn, has the ability to spontaneously form protofilaments, which triggers asymmetric division of the parent bacterial cell and thus ADAS production.

[0279] TIFF2025032096000009.tif180170

[0280] Example 2: Purification of ADAS This example describes a method for purifying an ADAS population from a culture of an ADAS-producing bacterial parent strain. This method can be used to purify any of the ADAS-producing strains described herein, including the strains in Example 1 or Table 3. Purification separates ADAS from larger, genome-containing, viable parent bacterial cells. ADAS was purified from high-density cell cultures of ADAS-producing strains by a combination of 1) low-speed centrifugation, 2) selective growth, and 3) buffer exchange / concentration. The low-speed centrifugation procedure was used to concentrate ADAS in the mixed suspension while selectively depleting viable parent bacterial cells and large cell debris. The selective growth procedure was used to reduce the number of viable parent bacterial cells present in the sample by the addition of compounds that are directly antimicrobial (i.e., toxic to cells carrying the microbial genome) and / or that enhance sedimentation of viable cells by low-speed centrifugation. The buffer exchange / concentration procedure was used to transfer ADAS from a large volume of bacterial culture medium to a small volume of 1×PBS while removing culture additives and cell debris.

[0281] A.ADAS purification The ADAS producing strain was generated using the molecular cloning procedure described in Example 1 and then grown to high cell density in culture medium. The culture may be scaled up, for example, from 1 mL to 1000 mL or more of culture medium.

[0282] The culture was transferred to a centrifuge tube and subjected to a low-speed centrifugation procedure aimed at pelleting intact cells and large cell debris while maintaining ADAS in the supernatant. The low-speed centrifugation procedure was performed at either 4° C. or room temperature. In some cases, the low-speed centrifugation procedure consisted of a series of 10-minute spins at 1,000×g, 2,000×g, 3,000×g, and 4,000×g in an Allegra® X14R tabletop centrifuge (Beckman Coulter) or an Eppendorf™ 5424 R tabletop centrifuge (Fisher Scientific). In some cases, the low-speed centrifugation procedure consisted of a series of 20-minute 2,000×g spins at 4° C., where the supernatant from the first spin was decanted into a sterile centrifuge bottle before the second spin. In some cases, this low speed centrifugation procedure was a single 40 minute spin at 4,000 x g in a Sorvall™ Lynx 6000 Superspeed centrifuge (Thermo Scientific™) with rotor acceleration set to the lowest possible setting.

[0283] After low-speed centrifugation, the culture supernatant was decanted into a sterile culture tube and subjected to the selective growth process. In some cases, concentrated antibiotic solutions (e.g., ceftriaxone, kanamycin, carbenicillin, gentamicin, and / or ciprofloxacin) or other concentrated chemical solutions (e.g., sodium chloride, sodium hydroxide, M hydrochloric acid, glucose, cas-amino acids, and / or D-amino acids) were added directly to the culture supernatant. In other cases, the culture supernatant was pelleted by high-speed centrifugation at 10,000×g to 20,000×g for 5 to 60 minutes and the pellet was resuspended in fresh culture medium containing a concentrate of antibiotic or other chemical solution inhibitory to viable cells. Selective growth was performed by incubating the ADAS at 4°C to 42°C for 1 to 3 hours with agitation at 250 rpm. The ADAS were then transferred to a sterile centrifuge tube and subjected to another round of low-speed centrifugation at 4°C and 4,000×g for 15 minutes.

[0284] After selective growth and low-speed centrifugation, the supernatant was subjected to a buffer exchange / concentration procedure. In some cases, this was done by passing the supernatant through a 0.2 μm asymmetric polyethersulfone (aPES) membrane filter (Thermo Fisher), followed by passage through 1–9 volumes of 1× PBS. In other cases, ADAS were pelleted by centrifugation at 10,000×g–20,000×g for 5–60 min, washed in 1–9 volumes of 1× PBS, pelleted again, and resuspended in 1× PBS at concentrations 1–100,000-fold higher than the starting culture volume.

[0285] B. Purification of ADAS from the auxotrophic ADAS-producing parent strain ADAS-producing parent strains that are auxotrophic, i.e., incapable of synthesizing an organic compound required for growth, are useful for the production of ADAS. Such strains can grow only when the organic compound is provided. Thus, auxotrophic parent strains can be counter-selected by storing or incubating the ADAS preparation in a medium lacking the organic compound, thus providing a further method of reducing the parent load in the ADAS preparation.

[0286] Preparation of auxotrophic E. coli parent bacteria One auxotrophic ADAS producing parent strain was obtained and a second strain was generated. MACH002 (Table 2) was obtained from the Yale University Coli Genetic Stock Center (CGSC) (strain CGSC14165). MACH002 is a histidine (his-53) and methionine (metB65) dual auxotroph with a minB disruption that produces ADAS. To construct the second auxotrophic ADAS producing parent strain, the pFtsZ plasmid described in Example 1 and Table 3 was transformed into a leucine auxotroph (leu-) Top10 E. coli strain and selected with 50 μg / mL kanamycin to generate MACH151 (see Table 2 for full-length genotype). Addition of anhydrotetracycline to the culture supernatant releases TetR repression of the TetA promoter, resulting in expression of the FtsZ protein and the parent bacteria producing ADAS (Example 1). E. coli ADAS was produced by the method of Example 2, except that the medium contained histidine and methionine for MACH002, or leucine and anhydrotetracycline for MACH151. ADAS was purified using the method in Example 2 and then stored in histidine- and methionine-free medium for MACH002, or leucine-free medium for MACH151.

[0287] ADAS from auxotrophic parent strains exhibits increased purity ADAS was produced from auxotrophic and non-auxotrophic parent strains. MACH060 (non-auxotrophic) and MACH002 (histidine-methionine auxotroph) ADAS were prepared and purified by the process outlined in Example 2. MACH178 (non-auxotrophic FtsZ overexpressing strain) and MACH151 (leucine auxotrophic FtsZ overexpressing strain) ADAS were prepared and purified by the process outlined in Example 2 with minor modifications to the growth protocol: to induce ADAS production due to FtsZ expression, anhydrotetracycline was added to the culture during growth to a final concentration of 50 ng / mL. To measure the purity of the ADAS preparation, 1 mL samples of supernatant were collected after the initial 4000×g sequential centrifugation steps of the purification process in Example 2. These samples contained both ADAS and any parent bacterial cells that were not removed by the sequential centrifugation. 100 μl aliquots were then plated on non-permissive medium (M9 + 0.2% glucose) and incubated overnight at 37°C. The following day, parental loads were enumerated by counting the number of CFU per plate (Figures 8A and 8B). While ADAS preparations made from wild type MACH060 and MACH178 harboured large parental loads, MACH002 and MACH151 demonstrated undetectable levels of parental bacteria in ADAS preparations from either auxotroph. Thus, auxotrophic ADAS preparations made by the two different methods each have a higher purity than the ADAS preparation from a non-auxotrophic ADAS. In some non-exhaustive embodiments, MACH002 is at least 10 times purer than MACH060. 6 MACH151 showed at least 10 fewer parental loadings than MACH178. 4 The loadings for fewer parents are shown.

[0288] Example 3: Characterization of ADAS This example describes how to characterize purified ADAS populations and / or crude ADAS-producing bacterial cultures using a variety of techniques, including electron microscopy, light microscopy and immunofluorescence, nanoparticle characterization, live cell plating, immunoblotting, and flow cytometry.

[0289] Scanning Electron Microscopy (SEM) SEM was used to visualize the septum formation process and confirm the presence of ADAS populations in various target bacterial strains. To prepare SEM samples, coverslips were placed in 24-well plates, coated with 0.01% polylysine, and dried. Strains of interest were then generated using the molecular cloning procedure described in Example 1, grown to high cell density, and, in some cases, subjected to the ADAS purification procedure described in Example 2. Strains of interest or purified ADAS were suspended in PBS, transferred to 24-well plates containing polylysine-coated coverslips, and allowed to settle for 30 min at room temperature. This solution was carefully blotted off and supplemented with SEM fixative (2.5% formaldehyde-glutaraldehyde in 0.1 M sodium cacodylate (sod cac) buffer. The next day, the fixative was removed, the samples were washed with water, and the coverslips were removed from the 24-well plates and dried using the critical point drying method. After drying, the coverslips were mounted on carbon tape on a Hitachi SEM mount, sputter coated with a 10 nm thin film of platinum, and then incubated at 4°C for 30 min at 4°C for 1 h. Imaged using a S-4700 field emission scanning electron microscope (FE-SEM). Figure 1A shows representative images of MACH009 (wild type E. coli), MACH060 (E. coli with a minCDE deletion to allow ADAS production), and purified ADAS from MACH060 (see Table 2). The MACH009 wild type E. coli strain exhibits the normal phenotype of E. coli, where all daughter cells are of equal size (Figure 1A, left panel). The unpurified MACH060 strain exhibits a smaller, more spherical ADAS particle size and The unpurified population shows an increased polydispersity in terms of abundance (Fig. 1A, middle panel). Purified MACH060 shows only the ADAS population (Fig. 1A, right panel). Using SEM as described above, ADAS produced from bacterial species of the genus Vibrio and Salmonella using different ADAS production techniques (overexpression of ftsZ and deletion of minCDE, respectively) can also be visualized in the unpurified population (data not shown). Furthermore, aberrant septation events are prominent in the unpurified images; aberrant septation is an event that precedes ADAS production.

[0290] Light microscopy and immunofluorescence The MACH060 E. coli strain was generated using the molecular cloning procedure described in Example 1 and then grown overnight to high cell density. Separately, 35 mm coverslip-bottom dishes from ibidi® were coated with 0.01% polylysine solution for 5 minutes; the solution was blotted off and the dishes were allowed to dry. A 1 μL drop of a dense suspension of MACH060 was placed on the coverslip bottom and allowed to nearly dry. 1 mL of 2.8% paraformaldehyde / 0.04% glutaraldehyde fixative was then added for 30 minutes. Samples were washed three times with PBS, permeabilized with 0.1% Triton™ X-100 (Sigma-Aldrich), washed twice with PBS, further permeabilized with 10 μg / mL lysozyme, washed twice with PBS, blocked with 1% donkey serum, washed twice with PBS, stained with primary antibody (anti-E. coli LPS), washed, and stained with secondary antibody conjugated to Alexa Fluor® 555 (Thermo Fisher). Dishes were counterstained with DAPI for 10 min and washed three times with PBS. The final dishes were imaged using a 100x oil immersion objective on an Olympus IX83 inverted microscope (Olympus). Images were rendered using the publicly available software package Fiji. Figure 1B shows representative images of 100x phase contrast (left panel) and fluorescence (middle and right panels) microscopy demonstrating that within the parental population there are ADAS that have LPS membrane staining but lack genomes (no DAPI positive staining).

[0291] Nanoparticle characterization The ADAS producing strain of E. coli BW25113, MACH124, was generated using the molecular cloning procedure described in Example 1, and then grown to high cell density in 1 L of culture medium and subjected to the ADAS purification procedure described in Example 2. The purified ADAS population was suspended in 1× PBS and diluted with 10 7 ~10 9The ADAS suspension was diluted to a concentration of 10,000 particles / mL and TWEEN® 20 (Sigma Aldrich) was added to a final concentration of 0.1% (v / v) to minimize particle aggregation. The ADAS suspension was diluted 20-fold, loaded onto a TS2000 cartridge (Technology® Supplies Ltd.) and analyzed on a Spectradyne® nCS1™ nanoparticle analyzer. The nCS1™ measures both the size and concentration of individual particles in the suspension by applying a bias voltage across a constriction of defined size and monitoring the change in electrical resistance as a function of time (Fraikin et al., Nature Nanotechnology, 6(5):308-313, 2011). 24,392 particles were measured within the range of 200-2,000 nm. In other examples, the number of particles measured is between 10 and 100,000 particles. The data obtained is also plotted as a cumulative size distribution (Figure 1C), which reveals the concentration of particles with diameters between 200 and 2,000 nm in the suspension of purified ADAS from MACH124. The highest concentration of purified ADAS from MACH124 is in the size range of 400-800 nm. In addition, the data is exported as an integral range report, which counts the aggregate volume of 200-2,000 nm particles in the suspension of purified ADAS (Figure 1D). Taken together, these data demonstrate that the concentration and size distribution of purified ADAS can be quantified through nanoparticle characterization methods. In addition, quantification of small molecules (e.g., ATP - Examples 4 and 5), nucleic acids, or proteins (e.g., GFP - Examples 4 and 5) observed within the purified ADAS population can be divided by the aggregate volume of ADAS or the number of particles present in the assay, allowing calculation of the average concentration of the small molecule, nucleic acid, or protein of interest within the purified ADAS population.

[0292] Viable cell plating method To determine the concentration of viable parental bacterial cells present before and after purification, the ADAS producing cultures and purified ADAS populations described in Example 3C were assayed by viable cell plating. Serial dilutions were prepared by repeatedly transferring 100 μL of either the ADAS producing cultures or the purified ADAS population into 900 μL of 1×PBS. 10 μL of each dilution was then spotted onto selective medium and incubated at 37°C to allow viable cells to grow. After 24 hours, dilutions containing 1–100 colonies were counted and this colony count was multiplied by the appropriate dilution factor to enumerate the number of colony forming units (CFU) per mL of sample (i.e., the concentration of viable cells present in each sample) (Figure 1E). MACH124 cultures were >10 8 CFU / mL, consistent with a high density culture of Escherichia coli; however, the number of viable cells present in the purified ADAS population was below 100 CFU / mL, the detection limit of this assay. Thus, the concentration of viable cells present in a sample can be enumerated by viable cell plating, and the ADAS purification procedure described in Example 2 is sufficient to reduce the number of viable cells present in the purified ADAS to at least below 100 CFU / mL in some embodiments.

[0293] Immunoblotting To evaluate the ability to measure ADAS protein composition, we characterized the presence in ADAS of two housekeeping proteins, DnaK and GroEL, known to be present in parental E. coli bacterial cells. ADAS producing strains of Escherichia coli BW25113 (MACH060) and MG1655 (MACH200) were generated using the molecular cloning procedure described in Example 1, then grown to high cell density in 100 mL culture medium and subjected to the ADAS purification procedure described in Example 2. In parallel, 5 mL aliquots of ADAS producing cultures were pelleted at 20,000×g, resuspended in 5 mL 1×PBS, and then diluted 100-fold in 1×PBS. Samples were dissolved by adding 4× NuPAGE™ LDS sample buffer (Thermo Fisher) to 100 μL aliquots of diluted cultures and purified ADAS. The various lysates were incubated at 85°C for 2 minutes, then 40 μL of each sample was separated on an SDS-polyacrylamide gel. Positive controls containing 10 ng of purified recombinant E. coli GroEL protein (Abcam, ab51307) or recombinant DnaK protein (Abcam, ab51121) were also denatured in 1×LDS sample buffer at 85°C for 2 minutes and separated on the gel. Proteins were transferred to nitrocellulose membranes blocked in Intercept® (PBS) blocking buffer (LI-COR®) for 1 hour at room temperature and incubated overnight at room temperature with antibodies targeting GroEL (Abcam, ab90522) or DnaK (Abcam, ab69617) at a 1:1,000 dilution. Blots were then washed with excess PBS + 0.05% TWEEN® 20, incubated with fluorochrome-conjugated anti-mouse (LI-COR®, 926-68070) and anti-rabbit (LI-COR®, 926-32211) antibodies for 1 hour at room temperature, washed again with excess PBS + 0.05% TWEEN® 20, and imaged on an Invitrogen™ iBright™ imager (Thermo Fisher).Specific bands corresponding to GroEL and DnaK were present in the lanes containing lysates from ADAS-producing cultures and in the lanes containing lysates from purified ADAS (Figure 1F); thus, the protein content of ADAS can be detected by immunoblotting.

[0294] Example 4: Measurement of ADAS activity The inventors tested the potential of ADAS to perform cellular functions and our ability to measure this function. We measured the potential of function by examining adenosine triphosphase (ATP) levels in the ADAS and determining the ability of the ADAS to transcribe and translate target proteins. The potential of a cell to perform functions is directly related to its ATP levels. ATP is the main energy carrier in prokaryotes and eukaryotes, carrying chemical energy in the bond between its three phosphate groups, and energy is released when the bond is broken. ATP is required for essential cellular processes such as transcription, translation, transport, and metabolism.

[0295] A.ATP measurement ADAS from the MACH060 (BW25113 ΔminCDE; Table 2) parental bacteria was purified using selective growth from culture supernatant concentrate as described in Example 2. The purified ADAS was subjected to nanoparticle characterization and live cell plating procedures as described in Example 3. The ADAS concentration of the purified ADAS preparation was 5×10 8 ADAS / mL, the total volume of particles present is 3.2 × 10 16 nm 3 CFU plating revealed that the concentration of viable cells (eg, parental cells) present in the purified ADAS population was below the limit of detection (100 CFU / mL).

[0296] The concentration of ATP present in the purified ADAS population was measured in triplicate using the BacTiter-Glo™ Microbial Cell Viability Assay (Promega) according to the manufacturer's instructions. Briefly, 100 μL of rehydration assay buffer was added to wells containing 100 μL of purified ADAS or a defined mass of ATP, which served as a molecular standard. The luminescence signal from each well was recorded on a plate reader. The log-transformed luminescence signal of a defined mass of ATP was plotted against the log-transformed mass of ATP, and a standard curve was fitted to these data. The luminescence signal observed in wells containing purified ADAS was then fitted to this standard curve to calculate the mass of ATP present in the wells (Figure 2A). ATP levels caused by contaminating viable cells were below the detection limit of the assay and were subtracted from the total ADAS amount as background. The mass of ATP present in each well of purified ADAS was divided by the aggregate particle volume of ADAS present in the well: this ratio represents the concentration of ATP present in the ADAS population purified to less than 100 CFU / mL.

[0297] B.ATP generation To determine the ability of ADAS to generate ATP in the absence of genome, the ATP concentration from purified ADAS was measured over time. ADAS from MACH124 (BW25113 ΔminCDE; Table 2) was purified using selective growth from culture supernatant concentrate as indicated in Example 2. Purified ADAS was supplemented with rich medium (10% Luria Broth) with 50 μg / mL of the antibiotic carbenicillin. ADAS was divided into two aliquots and tested in parallel; one aliquot was immediately placed under storage at 4° C., and the other aliquot was incubated in an Eppendorf ThermoMixer® at 37° C. and 800 rpm for 2 hours. After 2 hours of incubation, the ATP concentration of both aliquots was measured as described above. After 2 hours of incubation, the amount of ATP increased by 54.9%, indicating that ADAS can generate ATP in the absence of genome (FIG. 2B).

[0298] C. Transcription and translation of target protein: GFP To measure the potential of ADAS to transcribe and translate target genes, MACH060 (BW25113 ΔminCDE (Table 2)) was transformed with pGFP, a plasmid encoding green fluorescent protein (GFP). This sequence was codon-optimized for expression in E. coli and cloned into a plasmid containing the TetA promoter, the TetR repressor (which represses the TetA promoter), the pMB1 origin of replication, and a kanamycin resistance gene for antibiotic selection. ADAS was then derived from this strain (MACH124) and purified using selective growth from culture supernatant concentrate as indicated in Example 2. The parental load was determined to be at the limit of detection (<100 CFU / mL) by CFU plating. Two methods were used to examine the protein expression of ADAS: (1) measuring GFP fluorescence over time using a plate reader, and (2) immunoblotting.

[0299] (1) Plate reader method Purified ADAS or parental bacteria were incubated in minimal growth medium (minimal salts (M9) medium containing 0.2% casamino acids, 0.2% glucose, and 100 ug / mL ceftriaxone). Purified ADAS samples were supplemented with antibiotics to prevent growth of any genome-containing parental bacteria. In addition, for induced samples, the inducer anhydrotetracycline was added to the medium to a final concentration of 100 ng / mL. Addition of anhydrotetracycline relieved TetR repression of the TetA promoter, resulting in expression of GFP protein. GFP signal detection was measured using wavelengths of 479 nm and 520 nm for emission and excitation, respectively. Figures 2C-E demonstrate inducer-dependent increases in GFP transcription and translation over 12 hours in MACH124 ADAS as measured by GFP fluorescence. In the absence of inducer (uninduced), there was no increase in GFP signal. This finding indicates that ΔminCDE ADAS is capable of inducing agent-dependent target gene transcription and translation. Furthermore, Figure 2C shows that the GFP signal produced by purified ADAS was not due to parental contamination, since the GFP signal from 100 CFU / mL parent bacteria was significantly lower than that from ADAS and did not increase over time.

[0300] (2) Immunoblotting MACH124 purified ADAS supplemented with 100 μg / mL carbenicillin and anhydrotetracycline (1000 ng / mL) inducer and an equal volume of Luria broth were aliquoted into sterile centrifuge tubes. Samples were incubated for 24 hours at 37° C. and 800 rpm in an Eppendorf ThermoMixer®. After 24 hours, ADAS was centrifuged at 20,000×g for 10 minutes at 4° C. The supernatant was removed and resuspended in 1× NuPAGE™ LDS sample buffer (Thermo Pelleted ADAS was resuspended in lysis buffer (1x BugBuster™ Protein Extraction Reagent (MilliporeSigma™) containing lysis buffer (Fisher)) and heated to 85°C for 2 minutes. An equal volume of lysed ADAS was then loaded onto a 4-12% BisTris polyacrylamide gel. Proteins on the gel were separated, transferred to a nitrocellulose membrane and incubated in Intercept® (PBS) blocking buffer (LI-COR®) for 60 minutes at room temperature. The membrane was then incubated with primary antibodies (mouse anti-GroEL (Abcam, ab90522) at 1:500 dilution and rabbit anti-GFP (Abcam, ab6556) at 1:500 dilution) for 60 minutes at room temperature. Antibodies were resuspended in Intercept® PBS Blocking Buffer supplemented with 0.2% TWEEN® 20. Membranes were then washed 3 times with 1× PBS + 0.05% TWEEN® 20 before being incubated in Intercept® PBS Blocking Buffer containing 0.2% TWEEN® 20 supplemented with the relevant secondary antibodies (goat anti-mouse 800 (Abcam, ab216772) and goat anti-rabbit 680 (Abcam, ab175773), both diluted 1:5,000). Membranes were washed 3 times with 1× PBS + 0.05% TWEEN® 20 and imaged using an Invitrogen™ iBright™ Imager (Thermo The cells were imaged using a Fluorescence Microscopy (FISC). Band intensities were quantified by densitometry and GFP intensity was normalized to the loading control GroEL. Figure 2F demonstrates a time-dependent increase in the amount of GFP protein detected in induced ADAS.

[0301] Example 5: ADAS generated from ΔminCDE parent is highly active We assayed purified ADAS from parental cells containing the mutant ΔminC, ΔminD, or ΔminCDE by plate reader and immunoblotting to compare their ability to transcribe and translate a GFP reporter gene. Unexpectedly, we found that ADAS from ΔminCDE parental cells had higher activity than ADAS from either ΔminC or ΔminD parental bacterial cells.

[0302] A. Purification of ADAS from ΔminCDE, ΔminC, or ΔminD cultures The ADAS producing strains MACH124 (BW25113 ΔminCDE+pGFP), MACH556 (BW25113 ΔminC+pGFP), and MACH557 (BW25113 ΔminD+pGFP) (see Table 2) were grown to high cell density in 1 L of culture medium and subjected to the ADAS purification procedure described in Example 2. The pGFP plasmid carried by all three of these strains is described in more detail in Table 3. The purified ADAS was subjected to nanoparticle characterization and viable cell plating procedures described in Example 3. The concentration of ADAS was: MACH124=2.4×10 9 ADAS / mL, MACH556 = 1.86 x 10 9 ADAS / mL, and MACH557 = 1.98 x 10 9 The load of viable parental bacterial cells present in the purified ADAS was found to be below the detection limit of the CFU plating method (<100 CFU / mL).

[0303] B. Kinetics of GFP expression assayed on a plate reader. The ability of ADAS to express GFP in an inducer-dependent manner was determined as described in Example 4C. Figures 3A and 3B show the inducer-dependent increase in GFP transcription and translation in MACH124, MACH556, and MACH557 ADAS that was sustained over 12 hours. In the absence of inducer (uninduced), ADAS did not produce GFP. The data in Figures 3A and 3B are normalized as described in Example 4C. ADAS from all three min locus deletion strains were able to express GFP upon induction, but ADAS from MACH124 (BW25113 ΔminCDE) produced a higher GFP signal over time. At 12 hours, the MACH124 ADAS GFP signal was about 119% higher than MACH557 ADAS and about 186% higher than MACH556 ADAS. Thus, ADAS generated from the ΔminCDE parent express higher levels of GFP upon induction than those generated from the ΔminC or ΔminD parents.

[0304] The uncorrected GFP production curves observed for MACH124, MACH556, and MACH557 were used to compare the total protein production and average protein production rates of ADAS purified from each strain and incubated in the presence of inducer. A regression line was fitted to each data set using GraphPad Prism, and the area under the curve reflecting the total GFP production at 12 hours was calculated. MACH124 ADAS produced significantly more GFP than MACH556 or MACH557 ADAS (Figure 3D). To determine the average GFP production rate over the course of the experiment, the area under each curve was divided by the duration of the experiment. The average GFP production rate at 12 hours was significantly higher for MACH124 ADAS compared to MACH556 or MACH557 ADAS (Figure 3E). Finally, the total GFP production by MACH556 and MACH557 ADAS was expressed as a percentage of the GFP production by MACH124 ADAS normalized to 100%. These data are plotted in (Figure 3F). MACH124(ΔminCDE) ADAS produced higher total amounts of GFP than both MACH556(ΔminC) and MACH557(ΔminD).

[0305] C. GFP expression assayed by immunoblotting MACH124, MACH556, and MACH557 ADAS were incubated in 50% LB culture medium containing 50 μg / mL carbenicillin with or without anhydrotetracycline (1 μg / mL) for 24 hours at 37° C. and 800 rpm in an Eppendorf ThermoMixer®. Immunoblotting was performed as described in Example 3. After 24 hours, ADAS were centrifuged at 20,000×g for 10 minutes at 4° C. The supernatant was removed and the pelleted ADAS was washed with 1× NuPAGE™ LDS sample buffer (Thermo The ADAS were resuspended in lysis buffer (1x BugBuster™ Protein Extraction Reagent (MilliporeSigma™) containing 0.01% glycerol (Fisher)) and heated to 85°C for 2 min. Equal volumes of lysed ADAS were then loaded onto a 4-12% BisTris polyacrylamide gel. Proteins on the gel were separated, transferred to a nitrocellulose membrane and incubated in Intercept® PBS blocking buffer at room temperature for 60 min. The membrane was incubated with primary antibodies (mouse anti-GroEL at 1:500 dilution and rabbit anti-GFP at 1:500 dilution) for 60 min at room temperature. Antibodies were resuspended in Intercept® PBS blocking buffer supplemented with 2% TWEEN® 20. Membranes were then washed 3 times with 1× PBS + 0.05% TWEEN® 20 and then incubated with the relevant secondary antibodies (goat anti-mouse 800 and goat anti-rabbit 680, both diluted 1:5,000) in Intercept PBS blocking buffer + TWEEN® 20. Membranes were washed 3 times with 1× PBS + 0.05% TWEEN® 20 and imaged using an Invitrogen™ iBright™ Imager (Thermo The cells were imaged using a Fluorescence Microscopy (FISC) microscope (Fig. 3C). Band intensities were quantified by densitometry (Fig. 3C, middle panel) and GFP intensity was normalized to the loading control GroEL (Fig. 3C, bottom panel). MACH124 ADAS demonstrated increased GFP production compared to MACH556 and MACH557 ADAS, indicating that MACH124(ΔminCDE) exhibits higher activity in terms of protein production.

[0306] Example 6: ADAS with membrane-displayed proteins This example demonstrates membrane display of nanobodies as model targeting agents for ADAS. Nanobodies are the smallest known functional antibody fragments, and recent studies have shown that they can be expressed on the surface of Escherichia coli (E. coli) cells (Salema and Fernandez, Microb Biotechnol, 10(6), 2017). Surface nanobodies can efficiently bind to target proteins and can be used to enhance cell-specific binding affinity. This example demonstrates that targeting agents, in this case nanobodies, can be expressed on the surface of ADAS.

[0307] A. Generation of E. coli strains containing HER2-targeting nanobodies To construct an ADAS capable of targeting the HER2 receptor (associated with breast cancer), a plasmid (pNeae-NB2) (Table 3) was synthesized with the nanobody sequence fused to the intimin gene of EHEC O157:H7 strain EDL933stx-. Specifically, the N-terminal 583 amino acids of the intimin gene (Neae) were fused to an E-tag (SEQ ID NO:5), a glycine-glycine-serine linker, the NB2 nanobody sequence (SEQ ID NO:6), a serine-glycine linker, and a C-terminal FLAG tag (SEQ ID NO:7). This sequence was codon-optimized for expression in Escherichia coli (E. coli) and cloned into a plasmid containing the TetA promoter, the TetR repressor (which represses the TetA promoter), a CloDF13 origin of replication, and a kanamycin resistance gene for antibiotic selection to generate pNeae-NB2 (see Table 3). Addition of anhydrotetracycline to the culture supernatant relieved TetR repression of the TetA promoter, resulting in expression of the Neae-NB2 fusion protein, which assembled in the outer membrane of the parent E. coli bacterial cell carrying the plasmid and externally displayed the NB2 nanobody. MACH284 was generated by transforming the pNeae-NB2 plasmid together with a chloramphenicol resistance cassette into E. coli BW25113 strain carrying a deletion of the minCDE locus and selecting with the addition of 50 μg / mL kanamycin and 35 μg / mL chloramphenicol to the growth medium (see Table 2).

[0308] B. Creation of ADAS with HER2 nanobody expression MACH060 (unmodified, negative control ADAS) and MACH284 ADAS bearing targeting antibodies on their surface were prepared and purified by the process outlined in Example 2 with minor modifications to the growth media, where cultures were supplemented with anhydrotetracycline to a final concentration of 50 ng / mL during growth to allow for the production of ADAS from the parent that expressed the targeting Neae-NB2 fusion protein from a plasmid.

[0309] C. Confirmation of HER2 nanobody presentation on the ADAS surface Immunofluorescence labeling was performed to confirm the expression of Neae-NB2 on the surface of ADAS. ADAS from MACH060 and MACH284 were incubated in PBS with approximately 5×10 nanoparticles as determined by analysis using a Spectradyne® nCS1™ nanoparticle analyzer. 8The ADAS were diluted to a concentration of 10000pg / mL particles. An antibody targeting the E-tag feature in the Neae-NB2 fusion (Abcam, ab3397) was added to the sample to a final concentration of 5 μg / mL in 1 mL of sample. The samples were gently mixed and allowed to incubate on ice for 2.5 hours. After incubation, the ADAS were collected by centrifugation at 15,000×g for 10 minutes at 4° C. The supernatant was discarded and the pellet was gently resuspended in 800 μL PBS+0.05% v / v TWEEN® 20. This wash was repeated twice and the final pellet was resuspended in 0.5 mL PBS+0.05% TWEEN® 20. 2.5 μL donkey anti-rabbit conjugated to DyLight® 550 fluorophore (Abcam, ab98489) was added to the sample, gently mixed and incubated on ice for 1 hour. After this incubation, the ADAS were collected by centrifugation at 15,000×g for 10 min at 4° C. The supernatant was discarded and the pellet was resuspended in 500 μL PBS+0.05% TWEEN® 20. This wash was repeated a total of three times and the final pellet was resuspended in 250 μL of buffer. 200 μL of sample was removed and placed into a black-walled, clear-bottom 96-well polypropylene plate. The plate was then read for DyLight® 550 fluorescence (excitation: 487 nm, emission: 528 nm) at an optical density of 600 nm using area scanning of the wells. Figure 4 shows the results of this labeling experiment using DyLight® 550 fluorescence normalized to optical density. While wild-type MACH060 ADAS showed negligible fluorescence, the Neae-NB2 nanobody-displaying MACH284 ADAS showed a statistically significant, almost 10-fold increase in fluorescence. Thus, the targeting nanobody was efficiently expressed and presented on the outer membrane of ADAS.

[0310] Example 7: Production and delivery of cargo by ADAS This example demonstrates that the ADAS of the present invention has the ability to produce and deliver cargo that exerts a specific effect on a target cell or organism. As a model, the inventors have created an E. coli ADAS that produces a specific cyclic dinucleotide (CDN). In particular, the ADAS was induced by expression of a heterologous enzyme to produce the bacterial nucleotide c-di-AMP (Witte et al., Mol Cell, 30(2):167-178, 2008), which is involved in the Stimulator of Interferon Genes (STING) pathway via RECON (REductase CONtrolling NF-κB) in mammalian cells. This example further demonstrates that the ADAS can express an enzyme that catalyzes the production of a cargo, which can then be delivered to a target cell.

[0311] A. Construction of a STING agonist E. coli ADAS To generate an ADAS capable of activating the STING pathway, diadenylate cyclase was expressed in the BW25113 E. coli ΔminCDE::CamR (MACH060) strain as prepared in Example 1. To this end, the amino acid sequence of the diadenylate cyclase A (DacA) protein of Listeria monocytogenes (Accession No. Q8Y5E4) was codon-optimized for expression in E. coli, de novo synthesized by Integrated DNA technologies, and cloned into a plasmid containing the TetA promoter (pTet), the TetR repressor (which represses the TetA promoter), the pMB1 origin of replication, and the β-lactamase gene for antibiotic selection, resulting in the pSTING plasmid (Table 3). This plasmid was transformed into MACH060 (BW25113 E. coli ΔminCDE::CamR) and selected with 100 μg / mL carbenicillin and 35 μg / mL chloramphenicol in the growth medium, resulting in strain MACH198 (Table 2). Upon induction with the addition of anhydrotetracycline to the growth medium, MACH198 produced DacA, which catalyzes the condensation of two ATP molecules into cyclic di-AMP, a potent STING activator.

[0312] B. Purification of MACH060 and MACH198 ADAS For the STING activation assay, MACH060 and MACH198 were prepared using minor modifications of the method outlined in Example 2. Briefly, two cultures of MACH198 were used, one grown normally (uninduced) and one grown with 200 ng / mL anhydrotetracycline (induced). ADAS was concentrated and harvested using a 0.2 μm bottle-top filter and approximately 10 9 The cultures were resuspended in THP1-Dual™ Growth Medium (InvivoGen) to a final concentration of particles / mL. The residual parental load, as determined by the CFU plating method outlined in Example 2, indicated less than 200 CFU / mL of parental bacterial cells.

[0313] C. Determining Function Using Mammalian Cell Assays The THP1-Dual™ monocytic cell line (Invivogen) was used to determine the activation of the STING pathway using a luminescent readout. THP1-Dual™ cells feature the Lucia gene, a secreted luciferase reporter gene, under the control of the ISG54 minimal promoter in conjunction with five IFN-stimulated response elements. When the IFN-stimulated response elements are activated, for example by exposure to c-di-AMP (e.g., by phagocytosis of ADAS (e.g., MACH198 ADAS) containing c-di-AMP), the ISG54 minimal promoter is activated, transcribing and translating luciferase, and secreting luciferase into the cell culture medium. To quantify luciferase, the substrate QUANTI-Luc™ (InvivoGen) is added to the cell culture medium. QUANTI-Luc™ contains the luciferase substrate coelenterazine, which upon hydrolysis by luciferase produces a light signal that can be quantified using a plate reader.

[0314] To determine whether ADAS activates the STING pathway in THP1-Dual™ cells, THP1-Dual™ cells were cultured according to InvivoGen's specifications and 5×10 5 ADAS from MACH060, uninduced MACH198, and induced MACH198 (Table 2) were seeded into 96-well plates at a concentration of 125 μL per well at 100 cells / mL. 7ADAS / mL was added in a volume of 100 μL per well. After 42 hours of incubation at 37° C., the plate was centrifuged at 300×g for 5 minutes. Finally, 20 μL of medium was removed from each well and placed in a white-walled plate containing 50 μL of QUANTI-Luc™ per well. Luminescence was read immediately on a plate reader. FIG. 5A shows the average luminescence of samples from each experimental condition normalized by the volume of ADAS added, as determined using a Spectradyne® nCS1™ nanoparticle analyzer as described in Example 1. Six biological replicates were included in each ADAS condition. Little to no luminescence signal was obtained from MACH060 ADAS, which does not contain the DacA gene, and for the most part did not elicit the IFN-stimulated response element of THP1-Dual™ cells. However, MACH198 ADAS, which contained the DacA gene under the control of pTet, did stimulate THP1-Dual cells. The strongest stimulation was observed in samples in which DacA expression was induced by culturing with anhydrotetracycline. Furthermore, when monocytes are stimulated with IFN genes, the cells adopt an activated phenotype, changing from non-adherent monocytes in suspension to activated, adherent macrophages. We observed this change in samples exposed to various ADAS populations. Figure 5B shows that the activated, adherent phenotype is most evident in samples in which THP1-Dual™ cells were treated with anhydrotetracyline-inducible MACH198 ADAS.

[0315] Eliciting a downstream type I interferon response is essential for the function of the STING pathway. A signature of this response is the secretion of type I interferons, such as interferon-β (IFNB1). To further elucidate the ability of ADAS to induce a functional STING response, IFNB1 was quantified in each sample using a human IFN-β Quantikine ELISA kit (DIFNB0, R&D Systems®). Cell supernatants were aspirated from the assayed wells above and diluted to the linear range of the ELISA. The ELISA was performed according to the manufacturer's instructions. Figure 5C shows the results of the ELISA. While MACH060 ADAS and the small molecule STING agonist (served as a control) showed IFNB1 levels below the detection limit of the ELISA assay (<5 pg / mL), uninduced MACH198 ADAS showed trace amounts of IFNB1 (~7 ng / mL) and induced MACH198 showed a more than 40-fold increase in secreted IFNB1 in the cell supernatant (~300 ng / mL). Thus, ADAS demonstrated the ability to generate cargo through expression of a heterologous enzyme, which was delivered to a target cell (target call) and induced a functional, in this case immunomodulatory, response.

[0316] Example 8: Loading of E. coli ADAS with RNA cargo This example describes the expression and packaging of an RNA cargo, in this case a dsRNA targeting the gene for chymotrypsin (chy1) from the diamondback moth (Plutella xylostella), into an ADAS.

[0317] A. Construction of an E. coli parent strain containing dsRNA To construct ADAS packaged with dsRNA, a 412 bp sequence (SEQ ID NO:8) corresponding to a portion of the coding region of the Plutella xylostella chy1 chymotrypsin gene was cloned into plasmid L4440 (Fire et al., Nature, 391(6669):806-811, 1999), which contains a dual T7 promoter, a pMB1 origin of replication, and an ampicillin resistance gene for antibiotic selection, to obtain pRNAi (see Table 3). This plasmid was transformed into MACH300 (Table 2), an E. coli HT115(DE3)ΔminCDE strain containing a chloramphenicol resistance cassette, and selected with 50 μg / mL carbenicillin and 35 μg / mL chloramphenicol in the growth medium to generate MACH301 (Table 2). MACH301 also carries a disruption of the rnc gene, which encodes RNase III, which degrades dsRNA, along with a tetracycline resistance cassette. The strain additionally carries a DE3 prophage encoding a copy of the T7 RNA polymerase gene behind a lac promoter. Addition of isopropyl β-d-1-thiogalactopyranoside (IPTG) to the medium results in expression of the T7 RNA polymerase. The T7 RNA polymerase then transcribes the chy1 insertion sequence from both T7 promoters, producing the corresponding dsRNA.

[0318] B. Preparation of ADAS containing dsRNA MACH301 ADAS loaded with dsRNA was prepared and purified by the process outlined in Example 2 with modifications to the growth conditions. Briefly, an overnight culture of MACH301 was diluted 1:200 into LB containing 50 μg / mL carbenicillin and the OD 600 = 0.4. The culture was then supplemented with IPTG to a final concentration of 1 mM and growth was continued for 4 hours to allow for ADAS production from the parental expressed dsRNA construct from the plasmid.

[0319] C. Quantification of dsRNA load in ADAS To quantify dsRNA levels in ADAS, we analyzed the nucleic acid content by gel electrophoresis. Approximately 3.3×10 dsRNA in PBS was detected as determined by Spectradyne® nCS1™ nanoparticle analyzer analysis as described in Example 3. 10 ADAS at a concentration of particles / mL was dissolved by heat treatment at 80°C for 20 min. This treatment resulted in the release of nucleic acids and easy visualization by agarose gel electrophoresis. 20 μL of heat-treated ADAS lysate was run on 2% agarose E-Gel™ EX (Thermo Fisher) alongside a standard curve generated by a dilution series of 125 ng / μL in vitro transcribed dsRNA using the manufacturer's recommended settings. The gel was imaged using an Invitrogen™ iBright™ Imager (Thermo Fisher) with the nucleic acid gel setting. Band intensity was quantified with ImageJ. The amount of dsRNA loaded was determined by quantification of 10 9 The total loading capacity was calculated to be 97 ng per ADAS. This example demonstrates that ADAS can be effectively loaded with RNA cargo.

[0320] Example 9: Delivery of E. coli ADAS to Lepidoptera This example describes the fluorescent labeling and visualization of ADAS in a lepidopteran insect, specifically the European corn borer, after inclusion of the ADAS in an artificial diet.

[0321] A. Fluorescent labeling of ADAS for visualization To visualize ADAS in European corn borer, we fluorescently labeled ADAS with an NHS-ester fluorescent dye. MACH301 ADAS was prepared and purified by the process outlined in Example 8. It was found to be 1×10 ADAS as determined by Spectradyne® nCS1™ nanoparticle analyzer analysis. 11To 1 mL of ADAS at a concentration of 1000 mM sodium borate was added 30 μL of 0.5 M sodium borate. DyLight™ 800 NHS ester (ThermoFisher), which reacts with amine-containing molecules (e.g., primary amines of proteins) on the outer membrane surface of ADAS, was dissolved in anhydrous dimethylformamide at a concentration of 10 mg / mL. 20 μL of DyLight™ 800 NHS ester stock was added to the ADAS in a 1.5 mL tube and vortexed briefly. The reaction mixture was then wrapped in foil and placed on a rocker at room temperature for 1 hour. To remove excess dye, the ADAS was pelleted at 20,000×g for 10 minutes at room temperature and resuspended in 1 mL of PBS. This wash was repeated three times and the ADAS was resuspended in PBS to a final volume of 1 mL.

[0322] B. Feeding labeled ADAS to European Corn Borers (ECB) European corn borer (Ostrinia nubilalis) eggs were obtained from Benzon Research Inc. and reared on an artificial diet (general moth diet) purchased from Benzon Research Inc. The diet was prepared as follows: 162 g of general moth diet powder was added to boiling water; the contents were mixed thoroughly for 15 min while maintaining the temperature at 80°C-90°C; the mixture was cooled to 70°C, 5 mL of linseed oil was added and mixed thoroughly; and the diet was dispensed into rearing containers and allowed to cool and solidify.

[0323] ECB eggs were placed on the diet, allowed to hatch, and fed. All rearing containers were maintained at 25°C, with a 16:8 h light:dark cycle and 50-60% humidity. Once the larvae reached the second instar, they were used for the feeding assay. To prepare the feeding set-up, 25 mL of common moth diet was prepared and poured (hot, 70°C) into the lid of a 0.4 liter container (Sistema 1543 Klip It box), and a 48-well PCR plate with the bottom cut out (approximately 2 mm removed from the bottom) was placed into the immediately solidifying diet: this created individual wells containing the correct amount of diet for this second instar feeding assay. To administer DyLight™ 800 NHS ester labeled ADAS or PBS as a control, 2 μL of labeled ADAS or PBS was added individually to 5 wells and allowed to dry. An individual second instar larva was then added to each well and allowed to feed for 1 h.

[0324] C. Visualization of fluorescent ADAS in the European corn borer To visualize ADAS in ECB larvae, larvae fed with PBS or DyLight™ 800 NHS ester-labeled ADAS were removed from the wells and placed on sticky tape to immobilize them, then placed on the imaging surface. Both 700 nm and 800 nm channels were used to scan the larvae. Larvae autofluorescence in the 700 nm channel; thus, this channel was used to identify the location of the larvae on the imager. The 800 nm channel was used to detect the labeled ADAS in the larvae.

[0325] Figure 6 shows the results of the feeding experiment, where the signal in the 800 nm channel in PBS-fed larvae was very low, whereas the fluorescent signal present in larvae fed with DyLight™ 800 NHS ester-labeled MACH301 ADAS was strong. Thus, ADAS is ingested by and present in the body of the European corn borer when added to the diet.

[0326] Example 10: Storage of ADAS In this example, we demonstrate methods for formulating and storing ADAS using E. coli as a model ADAs-producing bacterium. E. coli ADAS containing an inducible GFP plasmid were synthesized and purified by the methods provided in Examples 1-3. They were then evaluated for their ability to be reconstituted and viability by storing them under various conditions.

[0327] A. Longitudinal ADAS Storage in Low Temperature Conditions In this example, the ability of ADAS to inducibly express GFP after 0 and 3 days of storage at 4°C was determined. ADAS was derived from three strains containing the pGFP plasmid (Table 3) driving GFP expression under the control of a tetracycline-inducible promoter: MACH124 (BW25113 ΔminCDE), MACH556 (BW25113 ΔminC), and MACH557 (BW25113 ΔminD); see Table 2 for genotype information. ADAS was purified using selective growth from culture supernatant concentrates as indicated in Example 2. For purified MACH124 preparations, the ADAS concentration was 2.4 x 10 immediately after purification. 9 ADAS / mL and 2.18 × 10 after 3 days of storage 9 For the purified MACH556 preparation, the ADAS concentration was determined to be 1.86 × 10 9 ADAS / mL and 2.2 × 10 after 3 days of storage 9 For the purified MACH557 preparation, the ADAS concentration was determined to be 1.98 × 10 9 ADAS / mL and 2.08 × 10 after 3 days of storage 9The concentration of ADAS was determined as ADAS / mL. All ADAS concentration measurements were taken using a Spectradyne® nCS1™ nanoparticle analyzer (outlined in Example 3). Purified ADAS preparations were subjected to nanoparticle characterization and viable cell plating procedures as described in Example 3. For each preparation, the viable cell load was determined to be below the detection limit (100 CFU / mL) by the CFU plating method as described in Example 3. The ability of stored ADAS to express GFP in an inducer-dependent manner was determined as described in Example 4C. On day 0 (no day under storage), an increased inducer-dependent GFP signal was observed over a 12-hour period in all three strains. After 3 days of storage, we observed an inducer-dependent increase in GFP transcription and translation in MACH124 and MACH557 ADAS that persisted over a 12-hour period (Figures 7A-F). MACH556 showed an inducer-dependent increase in GFP signal until approximately 6 hours, after which the signal declined and returned to uninduced levels by 12 hours. In the absence of inducer (uninduced), there was no increase in GFP signal for any of the strains tested. Data in Figures 7A-7F have been normalized as described in Example 4C.

[0328] B. Lyophilization and reconstitution of ADAS To determine the potential for ADAS to function after freeze-drying, ATP levels were measured in rehydrated ADAS 1, 2, or 6 weeks after freeze-drying. Additionally, the ability of freeze-dried ADAS to transcribe and translate the target gene GFP after rehydration was also determined. ADAS from MACH124 was purified as indicated in Example 2. To freeze-dry ADAS, purified ADAS was pelleted at 21,000×g for 20 minutes and resuspended in Microbial Freeze-Drying Buffer (OPS Diagnostics). ADAS was flash frozen in liquid nitrogen and freeze-dried for 18 hours on the automatic setting of a Labconco™ FreeZone freeze-dryer set at 0.3 mbar vacuum. Freeze-dried ADAS was stored in Ziploc bags in the dark at room temperature until rehydration. To determine the ATP levels of ADAS after freeze-drying, ADAS was rehydrated at 1, 2, and 6 weeks after freeze-drying, and ATP levels were measured using the BacTiter-Glo™ Microbial Cell Viability Assay Kit (Promega) according to the manufacturer's instructions. This assay showed that freeze-dried and rehydrated ADAS maintained similar ATP levels after 1, 2, or 6 weeks of storage, with ATP levels at 2 and 6 weeks increasing slightly (1.49-fold and 1.48-fold, respectively) compared to ATP levels measured at 1 week. This data demonstrates that ATP levels were maintained through the freeze-drying, storage, or rehydration process.

[0329] In addition, the ability of rehydrated ADAS to transcribe and translate GFP in an inducer-dependent manner was tested using the protocol outlined in Example 4C. Figures 7G and 7H show an inducer-dependent increase in GFP signal in rehydrated MACH124 ADAS that was sustained over 15 hours. In the absence of inducer (uninduced), there was no increase in GFP signal. Data in Figures 7G and 7H were normalized as described in Example 4C.

[0330] The activity observed in the rehydrated ADAS indicates that the integrity of ADAS is maintained through the freeze-drying process.

[0331] Example 11. Supplementary methods for characterizing ADAS This example describes a variety of complementary analytical methods used to characterize the composition of the ADAS and parent cells.

[0332] A. Electron Microscopy ADAS are purified from parent bacteria, cell debris, and endotoxins as described in Example 12. To visualize periplasmic structures, including flagella and secretion apparatus, ADAS are subjected to osmotic shock after isolation as in the previous method (HC Neu and LA Heppel. 240:3685-3692, 1965). The isolated periplasmic structures are then visualized under a transmission electron microscope (JEOL Ltd., Tokyo) following the protocol from Wu et al., Analyst, 2015.

[0333] B. Fluorescence and Light Microscopy ADAS and parent bacteria are visualized using an upright microscope equipped with a fluorescence device (Leica, Zeiss, CCD camera, and broad spectrum light source). Samples are imaged live in tissue culture multiwells (Thermo Fisher), transwell inserts (Corning), or agar-coated polystyrene Petri dishes (Thermo Fisher) in 6-, 12-, 24-, or 96-well formats. Additionally, samples can be fixed in these containers or on cover slips for further analysis.

[0334] C.OD600 concentration measurement To quantify the number of ADAS or parental bacteria present in a given medium volume, measure the optical density at OD600 and use the following formula: ADAS number / ml=OD600×A×B where A is the relative size of the ADAS compared to the parent cell and B is the calibration coefficient relating the OD600 of the ADAS to its LPS content, derived from standard AD600 measurements on bacterial cells.

[0335] D. Nanoparticle tracking analysis of ADAS and parent bacteria Nanoparticle tracking analysis is typically used to measure vesicle purity and is modified for measuring ADAS purity. Briefly, nanoparticle tracking is performed using a NanoSight LM10 system (NanoSight Ltd, Amesbury, UK) configured with a laser and a sensitive digital camera. Images are collected using standard software and analyzed using the expected particle size as input. Each sample is 10 8 They are diluted (with spectrophotometric quantification) to known concentrations in the range of particles / ml and administered and recorded under controlled flow using the NanoSight pump system. The camera is operated at maximum frame rate and resolution. The number of particles in the correct size range is quantified along with the percentage of the total number of particles (e.g. parent cells) outside the size range.

[0336] E. Dynamic Light Scattering and Zeta Potential Dynamic light scattering (DLS) (Zetasizer Nano S, Malvern Instruments Ltd.) is used to measure the size distribution of the ADAS and parent bacterial populations. By illuminating the ADAS suspension with light, the hydrodynamic radius is measured by relating the scattered light intensity to the diffusion coefficient of the object in solution using a published protocol (Jorge Stetefield, Biophys Rev (2016) 8:409-427). These studies have been previously performed with nanoparticles, bacteria, proteins, and nucleic acids in a similar fashion. Disposable cuvettes are typically used for ADAS size measurements to maintain sterility and avoid cross-sample contamination. For applications requiring organic solvents, reusable glass cuvettes are used with a careful cleaning protocol that includes successive washes with detergent (Alconox), 5% acetic acid, DI water, and 70% ethanol followed by a thorough drying step.

[0337] F. Immunofluorescence staining: ADAS are isolated from parent bacteria using the method described in Example 12. ADAS are diluted, placed on clean coverslips, spun at 500g, and fixed with 4% paraformaldehyde in PBS solution for 20 minutes. Samples are washed, incubated in antibody staining solution according to the manufacturer's instructions, mounted on slides with antifade mounting medium according to the manufacturer's instructions, dried, and imaged under a confocal microscope. Images are processed using ImageJ.

[0338] G. Flow Cytometry: Parental bacteria and ADAS are analyzed using flow cytometry on a NanoFCM (NanoFCM, China) according to the manufacturer's instructions. Fluorescent ADAS is used to confirm various characteristics of ADAS including plasmid uptake, protein expression, and purity by using the NanoFCM in either one-color or two-color mode (illumination at 488 nm and 555 nm wavelengths). For example, a fluorescent lipophilic dye such as DiOC6 (ICN Biomedical) is incorporated into the ADAS membrane as described by the manufacturer. ADAS is fractionated and purified as described in Example 12, then washed with cold phosphate buffered saline (pH=7), pelleted again (40,000 g, 5 min, 4° C.), diluted to (1E5, 1E6, 1E7) ADAS / mL, and DiOC6 fluorescence intensity is measured at 488 nm excitation and 535 emission.

[0339] H.PCR The purified ADAS is lysed and DNA is purified using a QIAquick PCR purification kit according to the manufacturer's instructions (Qiagen). Oligonucleotide primers 23S-sense (59 GAA AGG CGC GCG ATA CAG 39) and 23S-antisense (59 GTC CCG CCC TAC TCA TCG A 39) are used to amplify a 70 bp fragment of the 23S ribosomal RNA gene present in seven copies of the E. coli genome as described by Vilalta et al., Anal Biochem, 2001. Amplification reactions are performed using TaqMan reagents (ThermoFisher Scientific) according to the manufacturer's instructions.

[0340] I. RNA SEQ Whole transcriptome analysis is performed using RNAseq as described by Giannoukos et al., Genome Biol, 2012. Briefly, ADAS is purified in LB broth to an OD600 of approximately 0.5 and harvested by centrifugation at 4,000 x g for 10 min at room temperature. The pellet is resuspended in 25 ml of RNAlater (Ambion, Carlsbad, CA, USA). The tube is agitated overnight on a rotator at 4°C, centrifuged at 4,000 x g for 10 min, and the pellet is flash frozen by placing in an ethanol / dry ice bath and stored at -80°C.

[0341] RNA extraction is performed using the Ion Total RNA-seq Kit v2 (ThermoFisher Scientific) according to the manufacturer's instructions. Enzymatic reactions using the mRNA-ONLY Prokaryotic mRNA Isolation Kit (Epicentre) are performed according to the manufacturer's specifications. The Ovation Prokaryotic RNA-Seq System (NuGEN Technologies, Inc., San Carlos, CA, USA) is used as follows: Intact RNA is DNase treated as described above and synthesized into cDNA according to the manufacturer's protocol.

[0342] The purified products are size-selected on a gel (approximately 300-450 bp). Samples are concentrated with Illumina PE1.0 and PE2.0 primers (1 μM each), 1× AccuPrime PCR Buffer I (10×), and 0.5 U of AccuPrime Taq High Fidelity polymerase (5 U / μL; Invitrogen) in a final volume of 25 μL. The enrichment reaction is purified using Agencourt AMPure XP beads (0.8× reaction volume). Libraries are sequenced on either an Illumina GAII or Hi-Seq instrument. Raw reads from the RNA-seq data are processed using the Picard pipeline. Briefly, reads are aligned and assigned to a reference genome using the program HISAT2. E. coli sequence data are aligned to the respective genome sequences. The aligned reads are then analyzed with HISAT2 and assigned to individual genes according to the genome annotation provided by GenBank.

[0343] J.DNA SEQ The resDNASEQ Quantitative E. coli DNA Kit (ThermoFisher Scientific) is used to automate the extraction of host cell line residual DNA using the KingFisher Flex Express 96 deep-well automation platform following the manufacturer's instructions to measure residual DNA from the parental strain. Briefly, two wash plates and one elution plate are prepared and samples are loaded. Samples are then lysed and processed using the PrepSEQ_resDNA_v1 script in KingFisher Flex. A standard curve is generated using the E. coli parental strain, samples are amplified using a master mix, and results are read and analyzed using SDS software.

[0344] K. Gel DNA from the ADAS and E. coli parent strains is extracted using standard protocols and loaded onto an agarose gel following the manufacturer's instructions for size analysis. Genomic DNA is approximately 4.5 Mb, while plasmid DNA is approximately 3-5 kb.

[0345] I. ELISA For ELISA detection of parental cells, the FluoroSELECT E. coli Assay Kit (Sigma-Aldrich) is used. This detection system utilizes a fluorogenic substrate that produces a fluorescent signal when hydrolyzed by a specific enzyme (during peptide hydrolysis). Briefly, samples are prepared according to the manufacturer's instructions and read using a fluorimeter. After calibration, if P1>30,000 is measured, the sample is positive for parental cells. If P1<30,000, P2 is measured. If the value (P2-P1)<(3% x P1), the sample is negative.

[0346] Example 12. Supplementary methods for the production of E. coli ADAS This example describes additional methods for the production and characterization of ADAS from Escherichia coli.

[0347] A. Creation of E. coli ADAS To generate the ADAS, E. coli is transfected with a plasmid overexpressing the ftsZ protein under the T7 promoter. Alternatively, an E. coli mutant in which the MIN gene is disrupted is generated by transfection of E. coli with an integrative plasmid. The plasmid is commercially synthesized by Thermo Fisher. Transfection is performed using standard bacterial transfection methods (Thermo Fisher Molecular Biology Handbook). Briefly, competent cells are plated on agar plates at room temperature. 0.5–2 ng / ml of DNA is added to the competent cells in the vial and incubated for 20–30 min. Each tube is then heat shocked by placing the tube in a 42°C water bath for 30–60 s, creating transient pores on the cell surface. The cells are then plated on agar gel preloaded with selective antibiotics and allowed to grow overnight, thereby allowing only bacteria transfected with the plasmid to survive. Pick a single colony and culture it at 37 °C with continuous shaking at 120 rpm in LB medium containing 50-100 µg / mL ampicillin. Over time, the selected colony will grow and continue to produce ADAS.

[0348] Example 13. Supplementary methods for purification and efficiency measurement of ADAS from E. coli This example describes complementary methods for purifying Escherichia coli ADAS from crude preparations as well as characterizing the viable bacterial load.

[0349] A. Purification of E. coli ADAS Separation of ADAS from parent bacteria for high purity production uses a combination of washing, centrifugation, sterile filtration, and antibiotic treatment. We use a protocol adapted from published methods (Reeve, J 1979, Jivrajani 2013, Rampley et al 2017) with some modifications. Briefly, to purify the solution, the mixture of parent bacteria and ADAS solution is collected and centrifuged at 4°C (Beckman Coulter) for 10 minutes at speeds ranging from 1000g to 4000g, with incremental 1000g increments at each step to remove increasing fractions of parent cells from the suspension. To further ensure that the parent bacteria have been removed, 100μg / mL of a strong antibiotic (ceftriaxone) is added and the sample is incubated with the final supernatant solution overnight at 4°C. The next day, the solution is centrifuged at 400g at 4°C to pellet any cellular debris, and the ADAS-rich supernatant is collected and then centrifuged at 4000g at 4°C for 5 minutes. Finally, the solution is sterile filtered using a 0.2 μm membrane filter and the ADAS is then resuspended at the desired concentration in sterile PBS containing Ca 2+ and Mg 2+ .

[0350] B. Measuring ADAS purification efficiency At each stage of ADAS production, the supernatant or sediment is collected, placed on an agar plate, and incubated at 37°C to visually confirm the removal of parental cells from the solution. In parallel, the number of ADAS and parental bacteria is counted using light microscopy by using a hemocytometer. In addition, to ensure that the ADAS do not contain residual DNA, a fluorescence-based assay is performed using NucBlue Live ReadyProbes reagent (Invitrogen, R37605), which becomes ultraviolet fluorescent if the ADAS is positive for residual DNA. The reagent is added as instructed by the manufacturer (2 drops / 1 mL of sample), incubated for 15-30 minutes, washed with PBS solution, and then imaged to remove excess reagent. When exposed to 405 nm wavelength light, the dye excites in the blue spectrum if it is coupled to any residual DNA. As a counterstain, red fluorescent FM 4-64 dye (Invitrogen) is used as an intercalating lipophilic membrane-based dye that stains the outer leaflet of the ADAS and parental bacteria. Excitation and emission spectra are set aside from the nuclear stain to ensure that a unique signal can be collected. Sample purity is calculated as the percentage of ADAS in the remaining population = 100 x (red count - blue count) / (red count). In addition, purity is assessed using dynamic light scattering (DLS) techniques (Zeta Sizer Malvern) by comparing the magnitude of the peaks associated with approximately 1 μm (parental cells) and approximately 500 nm (ADAS), and showing that the parental cell peak approaches zero in samples of increasing purity.

[0351] Alternatively, residual ADAS DNA is determined using the Quant-iT™ PicoGreen™ DNA Assay Kit (Invitrogen, Cat. No. P11496) using a protocol established by the supplier. ADAS is collected in PBS and dissolved using lysis buffer. PicoGreen reagent is mixed and the reaction is observed in the sample using fluorescence measurement.

[0352] Alternatively, ADAS can be concentrated and cultured in suitable culture medium at 2.5 x 10 11Spread 4 mL of the mixture onto a 60 mm plate containing the appropriate growth agar and incubate under appropriate conditions. 12 Count the colonies to determine the number of viable bacteria per ADAS.

[0353] Alternatively, determine particle size distribution using a nanoparticle tracking Zetasizer and other particle size distribution tracking methods following the protocol of Example 11 to confirm the presence of a large particle peak indicative of viable bacteria. Alternatively, test samples with a qNano Gold (Izon Science Ltd.), which uses tunable resistive pulse sensing to measure particle size, concentration, and changes as it passes through a nanopore.

[0354] Example 14. Preparation of large E. coli ADAS The ADAS of Example 12 is prepared by disruption of septation genes leading to asymmetric cell division and production of ADAS from the parental bacterial cell line. This example demonstrates the generation of ADAS using an exonuclease that selectively degrades the genome of the parental bacteria directly, which provides several advantages over the ADAS preparation described in Example 12, including improved control of cytoplasmic composition, increased copy number of cargo, and increased ATP.

[0355] A. Creation of a large E. coli ADAS Two plasmids are constructed: (1) a plasmid containing the arabinose promoter to overexpress the sbcB or sbcCD genes, which encode exonucleases that degrade DNA of many conformations and allow digestion of the genome by the naturally expressed RecBCD, and (2) a plasmid containing a cassette knocking out the recA gene under the control of an IPTG-inducible lac promoter. These plasmids are commercially synthesized and (1), (2), or both are transfected into E. coli cells according to standard protocols, such as those in Example 12.

[0356] B. Purification of large E. coli ADAS After the bacterial culture reaches 600 O.D., 0.1% arabinose and glucose free medium or IPTG or both are used to activate the Exo1 gene. After 15 min, 1 hr, 2 hr, and 6 hr, the cells are harvested, centrifuged for 5 min at 4° C., and resuspended in PBS. As described in Example 15, an auxotrophic ADAS is used to increase solution purity, as determined using the scale in Examples 2 or 12.

[0357] Example 15. Supplementary methods for generating auxotrophic ADAS-producing bacterial strains for increased purity This example describes the synthesis of ADAS from an auxotrophic parent strain as a mechanism to reduce the number of viable bacteria contaminating ADAS preparations.

[0358] A. Preparation of Auxotrophic E. coli Parent Bacteria An auxotrophic strain of E. coli, such as the arginine synthesis knockout (argA) strain JW2786-1, is used to generate ADAS with reduced levels of parental bacterial contaminants. E. coli ADAS is produced by the method in Example 12, except that arginine is added to the medium. ADAS is purified using the method in Example 13 and then stored in arginine-free medium.

[0359] B. Preparation of large E. coli ADAS from auxotrophs An auxotrophic strain of E. coli, such as the arginine synthesis knockout (argA) strain JW2786-1, is used to generate the large ADAS from the auxotrophic parent strain. The E. coli large ADAS is produced by the method of Example 14, but grown in arginine-containing medium. The ADAS is then purified using the method of Example 14.

[0360] C. Demonstrating increased purity of auxotrophic large and normal size ADAS Large and normal size ADAS are prepared using the methods described above. ADAS from the non-auxotrophic parent strain and non-auxotrophic large ADAS are also prepared using the methods in Examples 12, 13 and 14. ADAS purity is measured using the method in Example 15.

[0361] Example 16. Supplementary methods for measuring ADAS activity This example describes a complementary method for measuring the activity of ADAS.

[0362] A.ATP measurement The ADAS sample is split into two. The ATP of half the sample is measured by BacTiter Glo assay (Promega) according to the manufacturer's instructions. The size and concentration of the other half is measured by either nanoparticle tracking or NanoFCM using the protocol from Example 11. ATP per unit of ADAS surface area is determined by calculating the total membrane surface area of ​​the ADAS using the appropriate formula and dividing the amount of ATP from the BacTiter Glo assay by this area.

[0363] B.ATP droplet measurement The ADAS are incubated at 37° C. for mammalian relevant and 30° C. for non-relevant ones and the ratio of ATP concentration between measurements taken at preparation and after 24 hours is determined using the method in part a).

[0364] C. Life index measurement ADAS are synthesized with a functional GFP plasmid containing a species-appropriate promoter. The number of ADAS, the average number of plasmids per ADAS, and the GFP concentration relative to the solution volume are measured by a plate reader at 30 minutes and 24 hours. The lifespan index is calculated as the ratio of the GFP production rate at 24 hours to that at 30 minutes.

[0365] D. ATP consumption measurement To assess the activity of the parent bacteria and the ADAS, the ATP production rate is measured using a Seahorse XF (Agilent) according to the manufacturer's instructions.

[0366] Alternatively, an ADAS sample is split in half. One half of the sample is treated with an ATP synthesis inhibitor, such as dicyclohexylcarbodiimide. Both halves are then assayed with BacTiter-Glo (Promega) according to the manufacturer's instructions. The difference between these two samples is considered the rate of ATP production.

[0367] Example 17. Supplementary methods for storage of ADAS derived from E. coli This example describes complementary methods for storage and formulation of ADAS using E. coli as a model ADAS. E. coli ADAS containing the pBAD GFP plasmid are synthesized as described in Example 12 and purified as described in Example 13. These ADAS are then stored under various conditions to demonstrate their reconstitution and viability.

[0368] A. Longitudinal storage of ADAS E. coli ADAS is stored in an isotonic buffer at 4° C. to maintain structural integrity and chemical activity. ADAS is rewarmed to 37° C. immediately prior to use.

[0369] B. Longitudinal storage of ADAS at low temperatures The ADAS is stored in an isotonic buffer at 4° C. for 0, 30, 60, 90, or 180 days.

[0370] C. Lyophilization and reconstitution of ADAS The ADAS is centrifuged and resuspended in the following solutions: 20% w / vol skim milk in growth medium, 20% w / vol skim milk in water, 12% w / vol sucrose in a 50:50 mixture of water and growth medium, Reagent 18: Trypticase Soy Broth, 1.5 g; Sucrose, 10 g; Bovine Serum Albumin Fraction V, 5 g; Distilled Water, 100 ml, and Reagent 20: Sucrose, 20 g; Bovine Serum Albumin Fraction V, 10 g; Distilled Water, 100 ml. All solutions are filter sterilized through a 0.2 μm filter. The ADAS is then flash frozen in liquid nitrogen and lyophilized. The powder is stored at 0° C., −20° C., and 25° C. for 0, 30, 60, 90, and 180 days. At the end of the test period, the powder is reconstituted with water or LB broth.

[0371] The ADAS activity after reconstitution is evaluated using the evaluation method of Example 16.

[0372] D. Freezing and Reconfiguring ADAS The ADAS is centrifuged and resuspended in 10%, 20%, and 30% vol / vol glycerol and growth medium. The ADAS is flash frozen in liquid nitrogen or slow frozen in Nalgene Mr. Frosty. The ADAS is stored at -20°C and -80°C for 0, 30, 60, 90, and 180 days. At the end of the test period, the powder is reconstituted in water or LB broth.

[0373] The ADAS activity after storage is evaluated using the evaluation method of Example 16.

[0374] E. Spray drying and reconstitution of ADAS The ADAS is centrifuged and resuspended in 20% w / vol skim milk in growth medium, 20% w / vol skim milk in water, or 12% w / vol sucrose in a 50:50 mixture of water and growth medium. The ADAS is then spray dried in a lab-scale unit and collected. The powder is stored at 0° C., -20° C., and 25° C. for 0, 30, 60, 90, and 180 days. At the end of the test period, the powder is reconstituted with water or LB broth.

[0375] The ADAS activity after spray drying is evaluated using the evaluation method of Example 16.

[0376] Example 18. Determination of similarity of large ADAS to parent bacteria This example describes a large ADAS that has greater similarity to the parent bacterium than the normal-sized ADAS.

[0377] A. Comparison of E. coli ADAS with other ADAS E. coli ADAS is synthesized as described in Example 12 and purified as described in Example 13. Samples of ADAS, large ADAS, and parent bacteria are plated in well plates and assays are performed within 30 minutes of initial plating. The different RNA transcripts present in the different samples are characterized by characterizing the cytoplasmic composition using RNAseq (described in Example 14). The copy number of the different samples is evaluated using qPCR using a method based on an existing protocol (Anindyajati et al. "Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction" Scientia pharmaceutica vol.84,1 89-101.14 Feb.2016) to quantify the signal from a single plasmid relative to the signal of a plasmid standard of known copy number. In addition, the longevity of the three conditions is compared using the ATP activity assay described in Example 11.

[0378] All ADAS, large ADAS, and parental bacterial samples are prepared and purified using methods previously described in Examples 12 to 15. Whole transcriptome analysis is performed using RNAseq as described in Example 12, and differences in transcriptome magnitude are observed.

[0379] Example 19. Supplementary methods for demonstrating higher purity of auxotrophic ADAS This example describes the increased purity of ADAS generated from auxotrophic parents after isolation compared to those generated from non-auxotrophic parents.

[0380] A. Preparation of Auxotrophic E. coli Parent Bacteria An auxotrophic strain of E. coli, such as the arginine synthesis knockout (argA) strain JW2786-1, is used to generate ADAS with reduced parental bacterial contamination. E. coli ADAS is produced according to the method in Example 12, except that arginine is added to the medium. ADAS is purified using the method in Example 13 and then stored in arginine-free medium.

[0381] B. Preparation of auxotrophic E. coli ADAS To generate an auxotrophic large ADAS, an auxotrophic strain of E. coli, such as the arginine synthesis knockout (argA) strain JW2786-1 E. coli, is used. The large ADAS is generated by the method of Example 14, modified so that the sbcB plasmid is expanded by expression of the argA protein, allowing only the sbcB-containing ADAS to survive in the medium. The ADAS is purified using the method of Example 14.

[0382] C. Demonstrating increased purity of auxotrophic large and normal size ADAS Auxotrophic large and normal size ADAS are prepared using the methods described above. Non-auxotrophic ADAS and large ADAS are also prepared using the methods in Examples 12, 13 and 14. ADAS purity is measured using the method in Example 13.

[0383] Example 20. Supplementary methods for determining whether ADAS with ATP synthase expression is highly active The expression and assembly of ATP synthase is a tightly regulated process in all living organisms. E. coli resists transcription of plasmids containing ATP synthase because overexpression can be lethal to the cell. This example describes two strategies to synthesize ADAS involving overexpression of ATP synthase.

[0384] Generation of E. coli ADAS with overexpression of A.atpI E. coli K12 strains are grown under normal culture conditions, and total RNA is purified using TRIzol reagent (Invitrogen, Carlsbad, CA) and treated with 2 U of RNase-free DNase for 1 h. RT-PCR is performed using the following primers for atpI, a gene involved in energy production by ATP synthase, as described by Chen et al., Adv Mat Res, 2014: 5'-TCAGGCAGTCAGGCGGCTT-3', atpI-F; 5'-TTACCCTTTGTTGTTAATTACAGC-3', atpI-R. PCR conditions include an initial denaturation at 96°C for 5 min, followed by 15 cycles of 96°C for 1 min, 55°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 7 min. PCR products are separated on a 1.2% agarose gel. The intensities of the expected bands are analyzed and compared by Bio-Rad software. To overexpress energy metabolism genes, use the expression vector pET15b. The PCR product of the atpI gene is introduced into the plasmid pET15b to obtain the expression vector, pAtpI. This expression vector is electroporated into E. coli BL21(DE3) and induced by adding IPTG at an OD550 of 0.4-0.5.

[0385] E. coli ADAS is produced from this strain as described in Example 12 and purified as described in Example 13.

[0386] B. Generation of E. coli ADAS Containing a Plasmid Containing ATP Synthase Plasmid pBAD33.atp, containing the ATP synthase cassette as described in Brockmann et al., J Bacteriol, 2013, is commercially synthesized and transfected into E. coli BL21(DE3) using the methods described in that paper. ADAS is then produced from these cells according to Example 12, removing glucose from the medium and supplementing it with 0.03% wt / vol arabinose. ADAS is then purified using the methods in Example 13.

[0387] C. Comparison of E. coli ADAS and E. coli ADAS containing ATP synthase activity E. coli ADAS produced by the methods described above and E. coli ADAS without added ATP synthase are synthesized and characterized using the methods described in Example 15.

[0388] Example 21. Assay for increased activity of ADAS with suppressed ATP synthase ε component The ε subunit (atpC) of the bacterial FoF1 ATP synthase is an intrinsic inhibitor of ATP synthesis / hydrolysis activity. Mutants lacking this regulatory domain exhibited no significant differences in growth rate, molar growth yield, membrane potential, or intracellular ATP concentration compared to wild-type cells under a wide range of growth conditions and stressors (Klionsky et al., J Bacteriol, 1984). In this example, E. coli cells were synthesized with inducible excision of the ε subunit or made from knockout strains.

[0389] A. Generation of an E. coli parent strain containing an inducible excision of the ATP synthase epsilon subunit Obtain E. coli strain JW3709 or other strain with an atpC knockout. A plasmid that inducibly expresses atpC in the absence of tetracycline (tet) using a tetracycline-controlled transactivator (tTA) is constructed by a commercial service. This construct is electroporated into the atpC knockout strain, allowing expression of atpC in the absence of tet, and grown in tet-free medium. ADAS is synthesized from these cells using the protocol described in Example 12 and purified as described in Example 13.

[0390] The E. coli ADAS generated from the above methods in the presence and absence of tet, the E. coli ADAS generated from strain JW3709, and the full-sized E. coli ADAS are characterized using the methods in Example 15.

[0391] Example 22. Highly active ADAS with modified glycolytic pathway Since the glycolysis pathway is one of the steps by which ATP is synthesized, upregulating key enzymes can lead to more ATP in cells. This example describes the generation of a highly active ADAS from E. coli containing plasmids expressing pfkA and tpi, which have been shown to produce more ATP (see Shimosaka et al, Ag. Bio. Chem, 1981).

[0392] A. Synthesis of ADAS expressing pfkA and tpi Grow E. coli strain pLC16-4 from the E. coli Genetic Stock Center and extract plasmid pLC16-4 using a commercially available plasmid purification kit. Prepare electrocompetent E. coli C600 cells and electroporate plasmid pLC16-4 following the protocol in Eppendorf protocol number 4308 915.511. Briefly, grow cells from a fresh overnight culture of E. coli at 37 °C in LB medium to a density of OD600 of 0.5-0.6. Cells are then placed on ice, centrifuged, refrigerated, resuspended in 0 °C water, washed in cold water, and isolated at 2 × 10 11 The cells are then diluted to a concentration of 1000 cells / mL. 40 μL of cells are then mixed with 10 pg of plasmid in water and electroporated. The cells are then immediately grown in SOC medium at 37° C. for 30-60 minutes, plated, and then grown under standard culture conditions. E. coli ADAS is then prepared from E. coli C600 with and without the pLC16-4 plasmid by the protocol in Example 12 and purified by Example 13.

[0393] Comparison of ADAS overexpressing B. pfkA and tpi with normal-sized ADAS The activity of E. coli C600 with and without the pLC16-4 plasmid is measured using the protocol in Example 15.

[0394] Example 23. Assay for increased activity of ADAS synthesized under special culture conditions In vitro growth, maturation, and survival of cells can be dramatically altered by culture conditions (Wang D, Yu X, Gongyuan W. Pullulan production and physiological characteristics of Aureobasidium pullulans under acid stress. Appl Microbiol Biotechnol. 2013;97:8069-77). This example describes a screen for compounds and conditions that increase intracellular ATP. Although not exhaustive, we initially use E. coli with an emphasis on pH, oxygen concentration, and applied voltage. This represents a complementary method to identify novel media additives that modulate cellular ATP levels.

[0395] ADAS is synthesized and isolated using the method described in Example 12. After isolation, ADAS is cultured under various media conditions and ATP production rates are measured using Seahorse (Agilent, ATP ASSAY kit) according to the manufacturer's instructions. 0.1 mM, 0.3 mM, 0.4 mM, 1 mM, or 10 mM glucose is used as baseline.

[0396] A. Synthesis of ADAS at low pH Adjust the pH of ADAS growth medium using dropwise addition of citric acid and NaOH. Use medium at pH 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 and measure intracellular ATP using the Seahorse ATP assay immediately and after 1, 4, 6, 10 hours.

[0397] Our results show increased ATP supply at low pH conditions, including 4.5, 5, 5.5, 6, and 6.5.

[0398] B. Synthesis of ADAS in a hypoxic environment To mimic hypoxic medium conditions, the medium was incubated in various gas mixtures (1, 5, 7.5, 10, 15, 20.95% O2) for 24 hours before exposure to ADAS. E. coli ADAS were then cultured in the preconditioned medium and intracellular ATP was measured immediately and after 2 hours using the Seahorse ATP assay.

[0399] Our results show that media containing oxygen concentrations of 1, 5, 7.5, 10, 15 and 20.95% lead to an increase in intracellular ATP after 2 h.

[0400] C. Synthesis of ADAS with Applied AC Electric Field According to a defined protocol developed for E. coli cultures (Zrimec et al., CELL. MOL. BIOL. LETT. Vol. 7. No. 1. 2002), an externally applied alternating electric field of intensity amplitudes between 1 and 100 V / cm is applied to ADAS growing in standard LB medium in a stimulation cell. Briefly, two parallel platinum electrodes (0.75 cm 2 A voltage is established between the electrodes (active area, 2 mm spacing) and the electric field is applied using a frequency generator (Metex MS-9150). The sample is kept cool (<5 °C during stimulation) and the electrode voltage amplitude is varied from 0 V to 100 V with no DC component and frequencies ranging from 50 Hz to 1000 kHz.

[0401] The results show that the highest voltage samples showed increased de novo ATP production to ADAS as measured by intracellular ATP using the BacTiter Glo assay (Promega) as specified by the manufacturer.

[0402] Example 24. Assay for increased activity of ADAS with removal of flagella and other non-essential features To minimize the presence of non-essential structural features in E. coli ADAS, parent strains are synthesized with simplified genomes that contain genes essential for growth, division, and metabolism. Studies have shown that E. coli synthesized with such "essential" genomes can not only survive and divide, but can even provide some useful properties. Posfai et al., Science, 2006, showed that these strains exhibit high electroporation efficiency and accurate growth of recombinant genes and plasmids that are unstable in other unmodified strains. Thus, these modified strains not only produce E. coli ADAS that lack unnecessary structures, but also have enhanced activity compared to those from the unmodified parent strain.

[0403] A genome-based approach is used to identify essential genes in the E. coli genome, as described, for example, in Arigoni et al., Nature Biotech., 1998. Briefly, by comparing the E. coli genome with the genomes of other bacteria, it is possible to identify key genes involved in growth, maturation and division. Systematic gene disruption is used to confirm key genes involved in survival and division. In addition to this, in silico methods are used to analyze the genome organization in order to stabilize the minimal genome. Deletions of large regions of the genome are performed using CRISPR-Cas9 and phage-mediated deletions. To create Scarfly deletions, a protocol adapted from Tear et al., Applied Biochem Biotech, 2015 is used. In addition, the growth medium may mask or enhance the effect of such gene deletions, and it may be necessary to grow these strains in different media to fully test the effect (Ish-Am et al., PLoS One, 2015). Generate a library of strains containing varying numbers of non-essential genes required for a specific function (e.g., transporter, structural).

[0404] A. Generation of E. coli ADAS with a flagellar deletion E. coli MG1655 (CGSC 6300) was obtained from the E. coli Genetic Stock Center and is a wild-type strain lacking the IS1 element of the flhDC promoter. These mutants are non-motile and have deletions of various lengths beginning immediately downstream of the IS1 element located in the regulatory region of the flhDC operon that encodes FlhD4C2, the master regulator of flagellar biosynthesis. ADAS is synthesized from these cells using the protocol described in Example 12 and purified as described in Example 13.

[0405] B. Generation of E. coli Parent Strains with Fimbrial and TXSS Deletions The Quick and Easy E. coli Gene Deletion Kit (Gene Bridges) is used to generate multiple parental E. coli strains with disruptions of genes encoding pilus and TXSS proteins. The kit uses Red / ET recombination to target DNA molecules that are precisely modified by homologous recombination in E. coli expressing either the RecE / RecT or Redα / Redβ phage-derived protein pairs. RecE and Redα are 5'-3' exonucleases, while RecT and Redβ are DNA annealing proteins. Briefly, PCR products targeting the gene of interest are inserted into a pRedET expression plasmid and the E. coli strain to be modified is transformed according to the manufacturer's instructions. Red / ET expression is induced by the addition of L-arabinose and a temperature shift. In Red / ET-mediated recombination, the insertion of the repeat cassette disrupts the target locus, and PCR is used to confirm the results. ADAS is synthesized from these cells using the protocol described in Example 12 and purified as described in Example 13.

[0406] C. Comparison of E. coli ADAS with and without flagella, pili, and TXSS ADAS is produced from the parent strain described above and activity is measured using the method described in Example 15.

[0407] Example 25. Assay for increased activity of ADAS with photosynthetic ability This example describes the synthesis of highly active ADAS with the ability to convert light into PMF or ATP by adding a plasmid expressing a protein capable of harvesting light energy, using various rhodopsins as model proteins.

[0408] A. Synthesis of proteorhodopsin-expressing E. coli ADAS Proteorhodopsin (PR)-expressing E. coli strains are generated using the protocol described by Walter et al., PNAS, 2007. Briefly, a plasmid containing the SAR86 γ-proteobacterial PR mutant in E. coli cells is expressed under the T7 promoter. Cells are grown in T broth and PR expression is induced with 1 mM isopropyl β-D-thiogalactoside. ADAS is synthesized from PR-containing and non-PR-containing E. coli cells using the method in Example 12 and purified by the method in Example 13, where some ADAS is expressed at 70 μmol photons / (m 2 s) light and a portion in the dark.

[0409] Following an adaptation of the protocol from Kim et al, Microb Cell Fact, 2012, E. coli cells expressing genes required for PR and retinal are generated. Briefly, the pAcyc-RDS plasmid from this paper is commercially synthesized and transfected into chemically competent E. coli BL21(DE3) following the manufacturer's instructions (NEB, protocol C2527). Briefly, cells are slowly thawed on ice, 1 pg-100 ng of plasmid DNA is added to a tube of cells, the cells are flicked 4-5 times with a fingertip, kept on ice for 30 min, heat shocked at 42°C for 10 s, kept on ice for 5 min, SOC is added to the mixture, and the cells are incubated at 37°C for 60 min. The cells are then plated on selective chloramphenicol plates and grown in LB medium containing chloramphenicol. ADAS was synthesized from PR-containing and non-PR-containing E. coli cells using the method in Example 12 and purified by the method in Example 13, where some ADAS was 70 μmol photons / (m 2 s) light and a portion in the dark.

[0410] B. Comparison of proteorhodopsin-containing ADAS and non-proteorhodopsin-containing ADAS The activity of E. coli grown with and without PR and in the dark or under light is measured using the protocol in Example 15.

[0411] C. Comparison of proteorhodopsin-containing ADAS with retinal and proteorhodopsin-containing ADAS The activity of PR-containing E. coli grown with or without retinal and in the dark or in light is measured using the protocol in Example 15.

[0412] Example 26. Additional methods for generating E. coli ADAS with stable nucleic acid and protein payloads Since nucleic acids can be easily degraded by endonucleases in the cytoplasm, intracellular RNAs (e.g., miRNAs, siRNAs, and RNA aptamers) stabilized in ADAS are an important step toward the creation of novel RNA delivery technologies. In addition, upon entry into the host cell, the tRNA-RNA scaffold is then cleaved by cellular tRNase Z, which serves to define the 3' end of the cellular tRNA, to precisely separate the 5' tRNA and 3' pre-miRNA. Using a recently developed protocol (RNA. 2015 Sep; 21(9): 1683-1689), tRNase Z can be used to cleave guide RNA-tRNA fusions. This example describes the expression of a non-coding RNA scaffold derived from tRNA in E. coli as an illustrative example, however, other nucleic acids, proteins, and molecules can also be stabilized in ADAS using similar scaffold-based approaches.

[0413] A. E. coli ADAS with tRNA-stabilized recombinant RNA payload Briefly, E. coli ADAS is produced and purified using the methods described by Examples 12 and 13. Based on a previously developed protocol, two types of tRNA are used: human tRNALys3 and E. coli tRNAMet (Nat. Methods, Ponchon 2007). Both are well characterized and recombinantly expressed. In principle, any structured RNA that terminates in a stem motif can be included. These include aptamers, lncRNAs, and ribozymes. Briefly, a plasmid is created that contains the RNA sequence of interest flanked on both sides by tRNA inserts. In this example, an mRNA encoding GFP is used.

[0414] After synthesizing ADAS containing tRNA-mRNA construct, RNA and protein half-life is measured. Briefly, cells are transferred to well plate and lysed with lysis buffer at various time points, and RNA SEQ is performed at various time points including 1 min, 10 min, 50 min, 100 min, 200 min, 500 min, 1000 min, 2000 min, and up to 1000000 min, and stability is evaluated using relative abundance. In addition, a defined number of cells are lysed at the same time points, and GFP expression is observed by measuring fluorescence with a plate reader.

[0415] Example 27. Increased cargo stability by removing ribonuclease from E. coli ADAS RNase E is a general initiator of RNA degradation, and chromosomal deletions in E. coli abolish the colony forming ability (CFA) of E. coli strains. This example shows that by placing RNase E under the control of a conditional promoter, enhanced protein and RNA stability can be achieved.

[0416] A. Synthesis of an E. coli parent strain with an RNase E deletion An E. coli parent strain with a chromosomal deletion of Eco-rne encoding RNase E was generated by inserting the Eco-rne gene carried by the plasmid under the control of the araBAD promoter, which allows E. coli to synthesize RNase E in the presence of arabinose. The method of plasmid integration into E. coli is derived from a previous protocol (Tamura et al. PLoS One, 2017).

[0417] B. Synthesis of RNase-free ADAS ADAS is produced from a parental E. coli strain lacking the chromosomal Eco-rne. Prior to synthesis and purification of ADAS as described in Examples 12 and 13, the parental strain is grown in arabinose-free medium for 1, 2, 3, 4, 8, 12, 24, 48 hours or 3, 4, 5, 10, 14 days to degrade residual RNase E.

[0418] C. Metabolic activity and mRNA stability index RNase-free unmodified ADAS is grown in LB broth and ATP production is measured using Seahorse XF (Agilent, ATP Rate assay) at 2 hours, 12 hours, 1 day, 7 days and 30 days. RNase-free ADAS shows similar metabolism to unmodified ADAS. Both ADAS strains express GFP after transformation with a plasmid containing GFP. Fluorescence imaging is used to measure GFP expression and RNAseq is used to measure mRNA levels.

[0419] D. Inhibition of ribonuclease from E. coli ADAS To block the degradation of RNA that is essential for the creation and maintenance of function in the E. coli ADAS, existing ribonucleases can be inhibited using small molecule inhibitors of RNase E. RNase E is considered a global initiator of RNA decay in E. coli and forms the platform for the degradasome complex. The N-terminus forms the catalytic portion of the enzyme and is therefore amenable to inhibition by small molecules.

[0420] A small molecule screening method previously developed for intact E. coli (Kime et al., Sci. Rep., 2015) is applied to determine inhibition of RNase E in E. coli ADAS and the best candidates for inhibition are tested in vitro. A stability index is calculated using the example method described above to quantify GFP over time.

[0421] Example 28. Synthesis of B. subtilis ADAS with Tat signal peptide This example describes an ADAS that can be used to secrete peptides through a channel-like secretion apparatus, and a hyperactive B. subtilis ADAS that has the ability to secrete more protein for a longer period of time.

[0422] A. Synthesis of B. subtilis ADAS secreting GFP B. Subtilis ADAS is synthesized with tagged "cargo" for translocation into the cytoplasmic space using a modified method (Feucht et al. Microbiology. 2005 Jun;151(Pt 6):2053-64.). Alternatively, B. Subtilis ADAS is produced through targeted divIVA1 mutations (JH Cha, GC Stewart-Journal of bacteriology, 1997-Am Soc Microbiology), but otherwise harvested, purified, and characterized as previously described in Examples 12 and 13. The Tat secretion apparatus signal is fused to the target protein to induce production and translocation of ADAS from the cytoplasm to the extracellular space. Using modifications of a previously described protocol (Wickner et al. Science 2005, BC Berks, Mol. Microbiol. 22, 393, 1996), the TAT signal peptide is incorporated into green fluorescent protein (GFP) fused to the PhoD Tat signal peptide and exported from B. subtilus. Extracellular GFP is measured using fluorescence microscopy.

[0423] B. Synthesis of Highly Active B. subtilis ADAS By applying the methods for B. subtilis from Examples 20-25, the identified B. subtilis version of the gene, promoter and plasmid are used to synthesize a highly active B. subtilis ADAS. The GFP plasmid fused with the TAT-signal from part a) is also transfected into B. subtilis, leading to the secretion of GFP. The ADAS synthesized from parts a) and b) are tested for protein secretion at 1, 2, 4, 8, 12, 24, 48, 36 and 72 hours.

[0424] Example 29. Immunomodulatory ADAS for Tumor Suppression This example describes a highly active ADAS capable of accommodating and delivering cargo that exerts a specific effect on the host's immune system. As a model, but not the only or exclusive embodiment of this concept, a highly active B. subtilis ADAS is created that secretes a specific cyclic dinucleotide (CDN). In particular, this ADAS specifically secretes the bacterial nucleotide c-di-AMP (Mol Cell. 2008; 30: 167-78), which is involved in the STING pathway via RECON (REductase COntrolling NF-κB) in mammalian cells.

[0425] B. subtilis ADAS is synthesized as previously described in Example 28. Briefly, human peripheral blood mononuclear cells are exposed to (1E6, 1E7, 1E8, 1E9, 1E10) B. subtilis ADAS / mL concentrations for (10, 20, 30, 60, 120, 1200 min) using a modified assay described in (MacFarland et al: Immunity. 2017 March 21; 46(3): 433-445.). Cells are then lysed and PCR is used to determine the fold increase in immune stimulatory genes, such as IRF3-, IFN-, and NF-κB-dependent genes in hPBMCs.

[0426] Example 30. Synthesis of Pseudomonas putida ADAS and highly active ADAS This example describes the synthesis of an ADAS and a highly active ADAS from a plant commensal bacterium expressing a T6SS, using P. putida as a model organism.

[0427] Synthesis of Pseudomonas putida ADAS Obtain Pseudomonas putida KT2440 from ATCC and culture according to the manufacturer's instructions. A plasmid overexpressing P. putida ftsZ under the inducible pLac-1k-J23107 promoter (Cook et al., J. Ind. Microb. Biotech., 2018) is constructed from a pBBR1MCS-2 backbone by a commercial vector generation company. Synthesize the P. putida ADAS parent strain by electroporating the plasmid DNA into bacteria following the protocol described by Chen et al., Chin. J. Appl. Env. Bio., 2010. Briefly, P. putida KT2440 is grown to an OD600 of 0.6-0.75, pelleted at 4°C, washed with 3 mmol / L HEPES, electroporated using a Bio-Rad gene pulser or equivalent machine, reconstituted in SOC medium, and incubated at 30°C. The cells are then plated on LB kanamycin agar for selection and grown according to the manufacturer's instructions with the addition of IPTG to induce ADAS formation. ADAS is then purified using the methods in Example 13.

[0428] B. Synthesis of highly active Pseudomonas putida ADAS by removal of flagella and T3SS Obtain either P. putida EM42 and EM383 or synthesize another amastigotes derivative of P. putida KT2440 according to the procedures in Martinez-Garcia et al., Microb. Cell. Fact., 2014 and Martinez-Garcia et al., Environ. Microbiol., 2013. Briefly, the upstream 750 bp (TS1) and downstream 816 bp (TS2) regions of the PP4329 and PP4297 genes are PCR amplified and the TS1 and TS2 fragments are ligated by overlapping PCR (see Horton et al., Gene, 1989). The complete TS1-TS2 fragment is digested with EcoRI and BamHI and ligated into the plasmid pEMG (GenBank: JF965437.1) to generate the plasmid pEMG-Flagellar. The plasmid is transformed into E. coli DH5α λpir and electroporated into P. putida KT2440 prepared with I-SceI meganuclease under the 3-methylbenzoate promoter as described in Martinez-Garcia and de Lorenzo, Meth. Mol. Bio., 2012. Positive cointegrates are selected through PCR amplification of the TS1-TS2 fragment, isolated by induction of the I-SceI enzyme and derived from the pSW-I plasmid using 15 mM 3-methylbenzoate. The culture is plated on LB-Ap500 agar plates and the deletion is confirmed by PCR.

[0429] Produce ADAS from the obtained strain using the method described in part a).

[0430] C. High T6SS expression ADAS The K1 T6SS as directed by Bernal et al., ISME J., 2017 is cloned into the pBBR1 origin vector with amp resistance, including its native promoter and replacing the native promoter with the pLac-1k-J23107 promoter (Cook et al., J. Ind. Microb. Biotech., 2018), via commercial gene synthesis. This plasmid is then transfected into an ADAS-producing P. putida strain using the method described above, grown in LB medium containing ampicillin and kanamycin, and the ADAS is purified using the method from Example 13.

[0431] D. Determine the number of T6SS on the ADAS A quantum dot-conjugated antibody against the VgrG trimer is used to label the T6SS secretion apparatus on the surface of the ADAS, which is imaged by confocal microscopy and active T6SS are manually counted by the presence of punctate spots. The average distance between T6SS on the membrane is calculated and squared, which is treated as the surface area covered by the T6SS.

[0432] Example 31. T6SS-expressed ADAS as an antimicrobial and plant protection agent Pseudomonas putida is a bacterium found in plants and has been demonstrated to have plant defense activity due to T6SS attack of potential plant pathogens. This example describes the P. putida ADAS, which has the ability to lyse bacteria using the T6SS apparatus, using E. coli as a model bacterium and X. campestris as a model plant pathogen.

[0433] Killing Escherichia coli using Pseudomonas putida ADAS Pseudomonas putida ADAS and highly active ADAS are synthesized using the method from Example 30. These ADAS are used to lyse E. coli cells using a protocol adapted from Bernal et al., ISME J., 2017. Briefly, a competition assay is performed on LB plates. E. coli is grown in PBS to an OD600 of 1 and mixed with the P. putida ADAS on the plates in a 1:1 ratio. Plates are also grown without any P. putida ADAS. Plates are incubated at 30°C for 5 hours and colony forming units are counted with antibiotic selection.

[0434] B. Killing Xanthomonas campestris using Pseudomonas putida ADAS. Pseudomonas putida ADAS is used to lyse X. campestris cells using the same assay as described in part b) except that X. campestris cells are grown on plates for 24 hours. The same assay is performed to demonstrate that P. putida ADAS reduces the number of X. campestris colonies and that high activity ADAS reduces the number even further.

[0435] Use of Pseudomonas putida ADAS as a plant protection agent P. putida ADAS is used for plant wound protection following a protocol adapted from Bernal et al., ISME J., 2017. Briefly, an in planta competition assay is performed by infiltrating the bacteria into Nicotiana benthamiana leaves. An overnight culture of Xanthomonas campestris is adjusted to an OD600 of 0.1 with PBS. P. putida ADAS is mixed with the bacteria in a 1:1 ratio. An infiltration area is marked by infiltrating the underside of a one-month-old leaf with a volume of approximately 100 μL. After 24 h of incubation in a plant chamber (23 °C, 16 h light), colony forming units are determined. Leaf sections from the infiltration area are cut and homogenized in PBS, followed by serial dilutions. Leaves are visualized by fluorescence microscopy. The assessment of necrosis was based on leaf coloration according to Katzen et al., J. Bacteriol, 1998, using visible changes in the color of the leaf tissue, which can range from green to yellowish (chlorosis), yellowish to brownish, and blackening of the leaf (necrosis), leading in later stages to complete decay of the leaf.

[0436] Example 32. Serratia marcescens ADAS as a model antifungal ADAS S. marcescens is a rod-shaped, Gram-negative bacterium that has recently been demonstrated to kill fungal cells through T6SS delivery of the effectors Tfe1 and Tfe2 (Trunk et al., Nat Microb, 2018). This example describes the use of S. marcescens ADAS to reduce fungal fitness.

[0437] A. Synthesis and Purification of S. marcescens ADAS A plasmid containing the Pseudomonas ampR promoter PampR and the S. marcescens ftsZ gene is introduced into a pUC19 backbone with a synthetic RBS in the same manner as the PQY38 plasmid in Yan and Fong, Appl. Microbiol. Biotech., 2017. This plasmid is introduced into S. marcescens Db10 (Caenorhabditis Genetics Center) using electroporation according to the method in Yan and Fong, Appl. Microbiol. Biotech., 2017. Briefly, cells are washed cold with cold water using a refrigerated centrifuge, resuspended in cold water, plasmid DNA is added, and the mixture is electroporated. Cells are then grown in 1 mL SOC medium for 60 min at 30° C. and then plated on LB amp agar plates. S. marcescens cells containing ftsZ are then grown in M9 medium 0.1% yeast extract, 2% glucose, and 200 mg / L ampicillin at 30° C. ADAS is then purified using the method in Example 13.

[0438] B. Demonstrate the ability of S. marcescens ADAS to kill fungi Antifungal activity is measured using a co-culture assay similar to that from Trunk et al., Nat Microb, 2018. Parental strain, ADAS and target cells are normalized using optical density. Target cells are mixed with either parental strain, ADAS or control E. coli in a 1:1 volume ratio and 12.5 μl of this mixture is spotted onto solid SC+2% glucose medium. Cultures are incubated for 2, 7 and 24 hours and surviving fungal cells are quantified by serial dilution and viable counts on streptomycin-supplemented YPDA medium to exclude bacteria and ADAS. Fungal cells are also visualized in real time using DIC to measure cell growth and division. E. coli is used as a negative control in the co-culture. Both the S. marcescens parental strain and ADAS are able to kill fungal cells after 7 hours of co-culture.

[0439] Example 33. Protein delivery to human intestinal epithelial cells via overexpressed T3SS The ability to deliver intracellular proteins to mammalian cells may enable a variety of applications in human therapeutics. This example describes the use of the ADAS T3 secretion system to deliver heterologous proteins to human intestinal epithelial cells. This model embodiment may be applied to a number of animal and plant applications where intracellular proteins may have a significant effect on the target organism.

[0440] In this experiment, human intestinal epithelial cells are exposed to various concentrations of ADAS (1E6, 1E7, 1E8, 1E9, 1E10 ADAS / mL) and intracellular GFP in the epithelial cells is measured using fluorescence microscopy. The number of GFP positive cells for the various conditions is divided by the total number of cells to calculate the delivery and administration efficiency.

[0441] Caco-2 mammalian cell line is cultured according to ATCC. These cells are modified to express truncated GFP (tGFP) as described by Huang and Bystroff, Biochemistry, 2009. This truncated form of GFP is expressed and correctly folded, but does not fluoresce until the missing β-strand is provided. E. coli and ADAS are produced and purified as described in Examples 12 and 13, respectively. Briefly, they are cultured at 37°C in Corning® tissue culture flasks (T-25, 75, T-150, or T255, Cat. No. 430641) with ATCC's custom Eagle's Minimum Essential Medium (Cat. No. 30-2003) containing non-essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1500 mg / L sodium bicarbonate, supplemented with 20% fetal bovine serum. To harvest Caco-2 cells for the delivery assay, wash the cells with divalent cation (Ca2+ and Mg2+)-free PBS, add 2-3 mL of 0.25% (w / v) trypsin and 0.05 mM EDTA solution to the cell surface for 10-15 min, and quench the enzyme activity with 6-8 mL of complete growth medium. After harvesting, count the cells using an automated cell counter (Countess II, Thermo Fisher) and viability stains (calcein - live cells, ethidium homodimer - dead cells).

[0442] A. Preparation and Purification of E. coli ADAS Containing the T3SS of Shigella SPI-1 E. coli ADAS is prepared using the method described in Example 12. To increase the abundance of T3SS on the ADAS surface, a plasmid encoding HilA is introduced. HilA regulates the SPI-1 T3SS, which is adapted from an existing protocol (Bajaj et al. Molecular Microbiology (1995) 18(4), 715-727). ADAS is prepared using the method described in Example 13. T3SS are visually inspected and counted using immunofluorescence microscopy and TEM. After comparing the isolated high purity T3SS-expressing ADAS with unpurified T3SS-expressing ADAS.

[0443] B. Protein-secretion apparatus tag fusion To allow protein secretion with a functional T3SS, the GFP β-chain is fused to the first 104 amino acids of the T3SS secretion tag SopE using a previously described plasmid design methodology (Evans, et. al. J. Virol., Feb. 2003, p. 2400-2409). The plasmid is expressed in parental E. coli followed by ADAS containing the truncated SopE-GFP hybrid.

[0444] C. Protein Delivery Assay Prior to exposure to ADAS, cells are cultured for 1, 3, or 5 days post-confluence to ensure reproducible cell maturity and polarization. For each sample, ADAS is added to confluent epithelial samples and incubated for 2 hours at 37° C. ADAS delivery efficiency is calculated by dividing the total number of fluorescent cells by the total number of cells in culture and compared between the various conditions.

[0445] Example 34. Supplementary methods for targeted delivery of E. coli ADAS with the T3SS apparatus In drug delivery, targeted delivery is important. This example describes the use of nanobodies as model targeting agents for ADAS. Nanobodies are the smallest known functional antibody fragments, and recent studies have shown that they can be expressed on the surface of Escherichia coli (E. coli) (Salema and Fernandez, Microb Biotechnol, 2017). Surface nanobodies can efficiently bind to target proteins and can be used to generate specificity for individual cell types.

[0446] A. Synthesis of E. coli parent strains containing EGFR nanobodies A parental E. coli strain expressing a surface nanobody against epidermal growth factor receptor (EGFR) is synthesized as described by Salema et al., MAbs, 2016. Briefly, the sequence encoding the nanobody against EGFR (TYNPYSRDHYFPRMTTEYDY) is cloned into the respective sites of the E. coli display vector pNeae2, which fuses the nanobody to the C-terminus of the intimin polypeptide Neae to enable surface expression. Plasmid pNeae2(CmR) is a derivative of the pNeae vector and encodes intimin residues 1-659 (derived from EHEC O157:H7 strain EDL933stx-) followed by an E tag, a hexahistidine (His) epitope, and a C-terminal myc tag (EQKLISEED).

[0447] Bacteria carrying the nanobody-bearing plasmid are grown at 30°C in LB broth on agar plates containing the appropriate antibiotic for plasmid selection. LB plates and pre-inoculation medium before induction contained 2% (w / v) glucose for repression of the lac promoter. Pre-inoculation cultures are started from individual colonies (for single clones) or from a mixture of clones (for libraries), freshly grown, harvested from plates, diluted to an initial OD600 of 0.5 and grown overnight under static conditions. For induction, bacteria (corresponding to an OD600 of 0.5) are harvested by centrifugation (4000 x g, 5 min) and grown in the same medium with 0.05 mM isopropylthio-β-D-galactoside (IPTG) but without glucose for 3 h with agitation (160 rpm) unless otherwise indicated.

[0448] B. Synthesis of ADAS with EGFR nanobody expression From these parental lines, ADAS is synthesized as described in Example 12 and loaded with cargo (protein and gene delivery for GFP) as described above.

[0449] C. Specificity Assay of ADAS with EGFR Nanobodies Caco-2 (human epithelial colorectal adenocarcinoma) and A-431 (epidermoid carcinoma) cell lines are co-cultured according to the standard cell culture protocol provided by the manufacturer. The co-culture is then incubated with the modified parent line or ADAS carrying cargo (GFP) as described above. FACS is used to separate A-431 and Caco-2 cells and quantify the proportion of target cells expressing GFP. Fluorescence microscopy is also used to quantify the fluorescence level of individual cells to measure the number of protein subunits injected or the amount of protein expression resulting from transfection. Microscopy is also used to quantify the GFP expression of cell types based on cell morphology, in conjunction with immunocytochemistry to label cell-specific markers, to distinguish between Caco-2 and A-431 cells.

[0450] Example 35. Synthesis of Xanthomonas citri ADAS for T3SS delivery to plants This example describes the generation of an ADAS from a plant pathogenic bacterium and the use of its natural delivery function using Xanthomonas citri as a model organism. The T3SS found in plant pathogens forms the basis of an efficient protein delivery system into plant cells. Because the T3SS effectors of X. citri are not well characterized, an assay that measures biofilm formation is used to determine the ability of the T3SS in X. citri ADAS. The effector can then be replaced with a reporter protein (e.g., GFP) to determine the ability to import heterologously expressed proteins via the T3SS.

[0451] A. Synthesis of T3SS-deficient X. citri T3SS is required for biofilm formation during infection and increases virulence in X. citri. T3SS-deficient X. citri is generated by creating a mutant deleted in the hrpB operon (described by Dunger et al., Plant Pathol, 2005), which encodes the key T3SS proteins. The primers used are 5'-GAACTGGGCGGGAAGAACGACGAG-3' and 5'-GCCGCCGCCGAAGAAGTGATG-3'. Genomic DNA (100 ng) is used as template in a 50 μL reaction mixture. PCR is performed in an Eppendorf thermal cycler with denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 62°C for 40 s, and 72°C for 1 min, with a final extension at 72°C for 5 min. PCR amplification products are analyzed on a 0.9% agarose gel. Southern blot hybridization is performed using the Xachrp mutant DNA fragment generated by digestion with BamHI, electrophoretically fragmented, and then transferred to a Hybond-N membrane. Hybridization and detection protocols are performed using the amplified hrp 840 bp PCR product labeled with [α-32P]dATP.

[0452] hrpB mutants are constructed by plasmid integration. The amplification products are cloned into the suicide vector pK19mobGII digested with SmaI to obtain pKmobB and pKmobF, respectively. The plasmids are transferred to Xanthomonas axonopodis pv. citri by biparental mating from the broad-host-range mobilizable E. coli S17-1 strain. The bacterial mixture is spotted onto a Hybond-C membrane, placed on nutrient agar and incubated at 28°C for 48 hours. The membrane is then washed and the bacteria are transferred to selective medium. Xanthomonas axonopodis pv. citri mutants are selected by the antibiotic resistance (Km) encoded by the vector and confirmed by Southern hybridization.

[0453] B. Synthesis of X. citri ADAS To generate X. citri ADAS, X. citri (hrpB mutant and non-transformed) are transfected with a plasmid overexpressing ftsZ protein under arabinose promoter (Lacerda et al., Plasmid, 2017) as in Example 12. The ftsZ gene sequence is from Kopacz et al., Microbiology Open, 2018. The primer sequences used are forward-GAGCCCATGGCACATTTCGAACTGATTGAAAAAATGGCTCCCAACGCGGTCATCAAGG; reverse-AGTTCATATGCGACGCAGCCGACGCTCCTCAG. The plasmid is commercially synthesized by Thermo Fisher. The transfection is carried out using the process described above. Over time, the selected colonies continue to grow and produce ADAS.

[0454] Ability of X. citri ADAS to form biofilms on oranges (Citrus sinensis) The T3SS is essential for biofilm formation by X. citri. ADAS from hrpB mutant and normal strains are used for infection assays in orange (C. sinensis) plants. All plants are grown at 28°C in a growth chamber with incandescent lights and a 16-h photoperiod. ADAS is purified to an OD600 of 1 and diluted in 10 mM MgCl2 for 10 min. 4 ~10 7 The ADAS is resuspended at 1000 cfu / ml. The leaves are infiltrated with a needleless syringe. Canker counts are performed on 20 orange leaves inoculated with the various strains, and the leaf area counted is measured from digitized images using Adobe Photoshop software. The ADAS from T3SS-expressing X. citri shows significantly more canker formation compared to the T3SS-deficient parent strain.

[0455] Example 36. Synthesis of Agrobacterium ADAS as a plant transformation agent using T4SS This example describes the generation of an ADAS with a T4SS capable of delivering a payload such as a model DNA plasmid, using Agrobacterium tumefaciens as a method for plant transformation using its native T4SS machinery, allowing the deployment of non-replicating Agrobacteria in a spray modality without the risk of leakage in large field settings.

[0456] A. Transfection of Plasmids into Agrobacterium For transfection of Nicotiana benthamiana, the plasmid carrying the antibiotic resistance gene is introduced into Agrobacterium strain GV3101 using the freeze-thaw method and materials as described in the Agrobacterium transformation kit (MPbio). Briefly, Agrobacterium is grown to an OD600 of 1.0-2.0, resuspended in transformation solution, mixed with plasmid DNA, submerged in liquid nitrogen for 1 min, submerged in a 30 °C water bath for 5 min, and grown again in Luria-Bertani medium containing the selection marker on the plasmid.

[0457] For tomato transfection, the plasmid carrying the antibiotic resistance gene is introduced into Agrobacterium strain LBA4404 ElectroMAX cells (Thermo Fisher) using the method described by the manufacturer's instructions. Briefly, Agrobacterium is thawed on wet ice and mixed with purified plasmid DNA free of salt, ethanol, and other contaminants. This mixture is electroporated, immediately mixed with room temperature medium, and grown again for 3 hours.

[0458] Cells from either protocol are then diluted and plated onto agar containing the necessary antibiotic for selection. The next day, or when colonies become visible, they are selected for sequencing. After confirmation of plasmid identity, suitable colonies are grown overnight with shaking in culture medium (specified by the manufacturer's instructions) containing the necessary selection marker.

[0459] B. Synthesis of Agrobacterium ADAS A plasmid containing Agrobacterium ftsZ in a pSRKGm backbone (Khan et al, Appl. Environ. Microbiol., 2008) is commercially synthesized and then transfected into Agrobacterium using the method described in part a) to form the A. tumefaciens ADAS parent strain. This parent strain is then grown with IPTG according to the manufacturer's instructions and ADAS is purified using the method in Example 15.

[0460] C. Synthesis of large Agrobacterium ADAS A plasmid containing Exonuclease V in a pSRKGm backbone (Khan et al, Appl. Environ. Microbiol., 2008) is commercially synthesized and then transfected into Agrobacterium using the method described in part a) to form the A. tumefaciens ADAS parent strain. This parent strain is then grown with IPTG according to the manufacturer's instructions and ADAS is purified using the method in Example 13.

[0461] D. Synthesis of A. tumefaciens ADAS with a GFP payload Use the plasmid pLSLGFP.R, see Baltes et al., The Plant Cell, 2014. Transfect the plasmid pLSLGFP.R using the method shown in part a). Synthesize the A. tumefaciens ADAS using the method in part b) or c).

[0462] E. Transfection of Agrobacterium ADAS with GFP Payload into Plants Grow tobacco (Nicotiana tabacum var Xanthi) plants at 21 °C with 60% humidity under a 16-hour light and 8-hour dark cycle. Leaves (fully expanded upper leaves) from 4-6 week-old tobacco plants are used for ADAS transformation. Infiltrate one leaf per plant. Infiltrate leaves from tobacco plants with Agrobacterium using a 1 mL syringe. Immediately after infiltration, water the plants and cover with a plastic dome to maintain high humidity. Remove the plastic dome approximately 24 hours after infiltration. Image the plants with a fluorescence reader to measure the percentage of leaves with visible GFP.

[0463] Example 37. Measurement of ADAS secretion efficiency To measure the secretion efficiency of the ADAS, the ability to synthesize and secrete proteins endogenously as well as heterologously expressed proteins is measured.

[0464] A. Parental E. coli strain that synthesizes GFP An E. coli strain containing a vector carrying GFP and ampicillin resistance is ordered from ATCC (ATCC® 25922GFP™) and cultured according to the manufacturer's instructions.

[0465] B. ADAS ability to synthesize molecules ADAS are produced from the GFP-expressing E. coli parent strain as well as from native E. coli. Fluorescence measurements are taken from the GFP-expressing E. coli parent strain as a positive control, and used as a baseline to measure GFP intensity from the ADAS. ADAS are synthesized according to Example 12, plated in a 96-well plate, and fluorescence is measured using a plate reader. Because ADAS do not need to synthesize proteins required for growth or division, both of the produced ADAS exhibit higher GFP intensity compared to the parent strain due to their high efficiency of protein synthesis. To measure intensity at the cellular level, the E. coli parent strain and ADAS are fixed and mounted on glass slides using standard cell preparation protocols. They are imaged using a confocal microscope with fluorescence imaging. These images are used to measure fluorescence intensity per square unit area, which is used for direct comparison with the parent strain.

[0466] C. Ability of ADAS to secrete molecules E. coli uses T1SS-mediated lipase secretion to facilitate infection. The T1SS contains an ABC transporter that recognizes specific C-terminal sequences of secreted proteins. A parent E. coli strain expressing the native T1SS along with the endogenous lipase is generated, as well as another strain transfected with a plasmid containing GFP fused to the C-terminal sequence for transport, as described by Chung et al., Microb Cell Fact, 2009.

[0467] Briefly, a lipase ABC transporter domain (LARD) for secretion of fusion proteins is designed. The LARD contains four glycine-rich repeats containing a β-roll structure and is added to the C-terminus of the test protein. Either a Pro-Gly linker or a factor Xa site is added between the fusion protein and the LARD. Before analyzing the secretion of the GFP fusion protein, the expression of the GFP fusion protein is confirmed. These proteins are expressed in E. coli and their expected size is confirmed by Western blotting (Rockland Inc., PA, Cat. No. KCA215). In addition, GFP fluorescence is demonstrated. Representative colonies of E. coli expressing these proteins are observed under ultraviolet (UV) light. A secretion phenotype can be traced by lipase activity. E. coli is cultured on tributyltin agar to detect the secretion of the TliA fusion protein. When the GFP fusion protein is also detected with an antibody against GFP, the same bands detected by the antibody against LARD are detected in the cells and in the supernatant.

[0468] Secretion is also measured using a method adapted from Chung et al., which is outlined below. ADAS is produced from the E. coli parent strain outlined in Example 12.

[0469] To measure lipase secretion by ADAS, ADAS is plated on solid medium (LAT: LB broth, 1.5% Bacto agar, 0.5% tributyltin). Secreted lipase has a typical phenotype with a halo developing around the colony. ADAS develops the halo more rapidly than the parent strain. In addition to this, lipase activity is measured spectrophotometrically by adding p-nitrophenyl palmitate (pNPP) dissolved in ethanol and Tris-HCL as substrate. 50 μL of supernatant from ADAS and parent strain cultures is added to 200 μL of substrate and the absorbance at 420 nm is measured using a plate reader. The increase in optical density is used to measure activity.

[0470] Since lipase is an endogenously expressed protein, secretion of the heterologously expressed protein is measured using GFP. ADAS and parental strains are grown in LB broth and supernatants from the broth are collected and GFP expression is measured. GFP secretion is measured using a standard immunoblot (Rockland Inc., PA, Cat. No. KCA215) with a GFP-specific antibody according to the manufacturer's instructions.

[0471] Example 38. Non-rod-shaped nanoparticles containing ADAS (Magnetospirillum magneticum) This example describes that ADAS can be synthesized from non-rod shaped bacteria and that it can include larger structures such as nanoparticles.

[0472] Preparation of AM magneticum (M. magneticum) ADAS To generate the ADAS, M. magneticum is transfected with a plasmid overexpressing the ftsZ protein (Q2W8K6_MAGSA) under the T7 promoter. The plasmid is commercially synthesized by Thermo Fisher. The transfection is performed using a standard bacterial transfection process (see Thermo Fisher Handbook of Molecular Biology). Briefly, competent cells are plated on agar plates at room temperature. 0.5–2 ng / ml of DNA is added to the competent cells in the vial and incubated for 20–30 min. Each tube is then heat shocked by placing the tube in a 42°C water bath for 30–60 s, creating transient pores on the cell surface. The cells are then plated on agar gel preloaded with selective antibiotics and allowed to grow overnight. Only bacteria transfected with the plasmid survive. A single colony is picked and cultured in LB medium containing 50-100 μg / mL ampicillin at 37 °C with continuous shaking at 120 rpm. Over time, the selected colony continues to grow and produce ADAS. Alternatively, large ADAS are prepared using a protocol similar to that used in Example 14.

[0473] In addition, deletion of the ftsZ-like gene in these bacteria results in the production of superparamagnetic magnetite magnetosomes (Ding et al., J Bacteriol., 2010).

[0474] Characterization of nanoparticle retention in M. magneticum ADAS The morphology of ADAS magnetosomes is analyzed using TEM as described by Wang et al., Front Microbiol., 2013. Briefly, 20 μL of cells are dropped onto a copper TEM grid covered with a carbon-coated formvar film for 2 h, then washed twice with sterile distilled water and air-dried. Magnetosome size is defined as (length + width) / 2 by measuring TEM micrographs, and the shape factor is defined as width / length.

[0475] CM Magneticum (M.magneticum) ADAS magnetic demonstration To characterize the magnetic properties of M. magneticum ADAS, we use a protocol modified from Ding et al., J Bacteriol., 2010. Briefly, samples were freeze-dried and subjected to magnetic resonance imaging using a Quantum Design MPMS XL-5 magnetometer (sensitivity, 5.0 × 10 -10 Am 2 ) to take low-temperature magnetic measurements. Thermal demagnetization of the remanence collected at 5 K in a 2.5 T magnetic field (hereafter referred to as SIRM5K_2.5T) after two pretreatments is measured from 5 K to 300 K. The first pretreatment is to cool the sample from 300 K to 5 K in zero magnetic field (Zero Field Cooling [ZFC]), and the second is to cool it from 300 K to 5 K in a 2.5 T magnetic field (Field Cooling [FC]). The Verwey transition point (Tv) is defined as the temperature corresponding to the maximum of the first derivative dM / dT of the FC curve. An alternating field gradient magnetometer (sensitivity, 1.0 × 10 -11 Am 2Room temperature first order reversal curves (FORC) are measured using a 3000 quartz crystal (MicroMag model 2900). The FORC diagram is calculated using FORCinel version 1.05 software with a smoothing factor (SF) of 2. The FORC diagram provides information on the domain state, coercivity, and magnetostatic interactions of the magnetic crystals.

[0476] Example 39. Environmentally responsive ADAS Logic operations based on Boolean logic gates are coded into gene regulatory networks to allow cells to integrate or discriminate between environmental and cellular cues and respond accordingly. Customized genetic logic circuits can be designed to link various cellular sensors and actuators not found in natural cells. These modified cells can be programmed to respond to specific inputs to produce desired outcomes, either intracellularly or extracellularly. Despite some drawbacks, such as the non-modular nature of genetic circuits and the limitations of the host chassis, they are extremely useful in engineered organisms and libraries of genetic logic circuits are currently being deployed. Several such circuits have been described in E. coli and are incorporated into E. coli ADAS.

[0477] These circuits form the basis of environmentally responsive ADAS that can produce tunable outputs in response to inputs (e.g., metabolites, pH, heat, light, external ligands). They are engineered with AND gates to respond to the presence of multiple inputs, or with OR gates to respond to any of the coded inputs. This repertoire can be expanded to include other logic gates such as NOR, NAND, XOR, etc.

[0478] A. Synthesis of E. coli ADAS with AND / OR gates P. syringae contains a type III secretion regulatory apparatus, called the hrpR / hrpS apparatus, which forms an AND gate that tightly regulates the expression of the T3SS. The expression of both of these proteins is required for the production of the T3SS apparatus. Plasmid construction and DNA manipulation are performed using standard molecular biology techniques, and for the construction of the AND gate, the protocol described by Wang et al., Nat Commun., 2011 is modified. Briefly, a plasmid is constructed that contains a) the IPTG-inducible Plac promoter and the hrpR part of the AND gate, and b) the heat-inducible promoter pL (derived from λ phage, normally repressed by a thermolabile protein) and the hrpS part of the AND gate. The output is GFP protein expression, which contains the T3SS promoter and is expressed when both hrpR and hrpR are expressed.

[0479] Plasmid construction and DNA manipulation are carried out according to standard molecular biology techniques. The hrpR and hrpS gene promoters are synthesized by GENEART according to BioBrick standards. The plasmid pAPT110 (p15A ori, Kanr) containing IPTG-inducible Plac and with an AND gate of hrpR (XbaI / KpnI) is used for characterization. The plasmid pBAD18-Cm (pBR322 ori, Cmr) containing the heat-inducible pL promoter with an AND gate of hrpS is obtained. The synthetic AHL-inducible Plux promoter (BBa_F2620) is cloned and characterized using pSB3K3 (p15A ori, Kanr) that is later used to drive hrpR (XbaI / PstI). The various sequences of each gene construct are introduced by PCR amplification (using PfuTurbo DNA polymerase from Stratagene and an Eppendorf Mastercycler gradient thermal cycler) with primers containing the corresponding RBS and appropriate restriction sites. Alternatively, all constructs are commercially synthesized. All constructs are verified by DNA sequencing (Eurofins MWG Operon) prior to their use in target cell lines.

[0480] All characterization experiments are carried out in M9 minimal medium (11.28 g M9 salts / l, 1 mM thiamine hydrochloride, 0.2% (w / v) casamino acids, 2 mM MgSO4, 0.1 mM CaCl2) supplemented with the appropriate carbon source. Two M9 media with different carbon sources are used: M9-glycerol (0.4% (v / v) glycerol) and M9-glucose (0.01% (v / v) glucose). The antibiotic concentrations used are 25 μg / ml for kanamycin, 25 μg ml-1 for chloramphenicol and 25 μg / ml for ampicillin. Cells inoculated from single colonies on freshly streaked plates are grown in 4 ml M9 in 14 ml Falcon tubes overnight at 37°C with shaking (200 rpm). Overnight cultures are diluted into pre-warmed M9 medium at OD600=0.05 for 1-day cultures, which are induced and grown for 5 h at 30° C. before analysis unless otherwise indicated. For fluorimetric fluorescence assays, diluted cultures are loaded into 96-well microplates (Bio-Greiner, chimney-shaped black, clear flat bottom) and induced by multichannel pipette with 5 μL (for single-input induction) or 10 μL (for double-input induction) of inducer at various concentrations to a final volume of 200 μL per well.

[0481] To engineer the OR gate, we use the apparatus described by Rosado et al., PLoS Genetics, 2018. First, we construct a cis-repressed mRNA that codes for RFP under a constitutive promoter. This repression is removed in the presence of RAJ11 sRNA. We synthesize a plasmid containing the IPTG-inducible promoter PLac and the heat-inducible promoter pL, both of which drive the expression of RAJ11 sRNA. The output is RFP expression, which is seen in response to either input.

[0482] A synthetic PL-based promoter regulated by the transcription factors LacI and pL is used as the element sensing the input signals (IPTG and heat). The riboregulatory sequences (sRNA and 5'UTR) of the device RAJ11 are obtained from a previous study (Rodrigo et al., PNAS, 2012). The various sequences of each gene construct are introduced by PCR amplification (using PfuTurbo DNA polymerase from Stratagene and an Eppendorf Mastercycler gradient thermal cycler) with primers containing the corresponding RBS and appropriate restriction sites. All constructs are verified by DNA sequencing (Eurofins MWG Operon) before their use in the target cell line.

[0483] LB medium is used for overnight cultures, while M9 minimal medium (1x M9 salts, 2 mM MgSO4, 0.1 mM CaCl2, 0.4% glucose, 0.05% casamino acids, and 0.05% thiamine) is used for characterization cultures. Ampicillin and kanamycin are used as antibiotics at a concentration of 50 μg / mL.

[0484] GFP and RFP cultures are assayed in a fluorometer (Perkin Elmer Victor X5) to measure absorbance (600 nm absorbance filter), green fluorescence (485 / 14 nm excitation filter, 535 / 25 nm emission filter), and red fluorescence (570 / 8 nm excitation filter, 610 / 10 nm emission filter). The background mean absorbance and fluorescence values ​​corresponding to M9 minimal medium are subtracted to correct the readout. Normalized fluorescence is calculated as the ratio of fluorescence to absorbance. The mean normalized fluorescence corresponding to cells transformed with a control plasmid is then subtracted to obtain the final expression estimate.

[0485] These gates are model devices and can be further modified to be activated by any input, including other chemicals, cell contact, pH, and light.

[0486] B. Generation of ADAS with AND / OR gates ADAS is produced by the protocol described in Example 12 and purified by the method in Example 13.

[0487] C. Logic gates function in ADAS As mentioned before, both hrpR / hrpS require input to effectively generate product creating an AND logic gate. E. coli ADAS is subjected to four conditions: 1. No IPTG / No heat, 2. ITPG / No heat, 3. No IPTG / Heat, and 4. ITPG / Heat. Only condition 4, where both heat and IPTG are present, will cause expression of hrpR / hrpS, which leads to expression of GFP.

[0488] GFP expression could be modulated by varying the concentration of IPTG and duration of stimulus exposure. E. coli ADAS exposed to various conditions were loaded into a 96-well plate and a fluorescent plate reader was used to quantify GFP expression relative to the different conditions. Double-blind experiments confirmed that the presence of GFP indicated the presence of both IPTG and heat, forming the basis of a device that was responsive to stimuli.

[0489] Example 40. Heavy metal capture ADAS derived from Escherichia coli (E. coli) and extreme environmental microorganisms Heavy metals pose environmental and health risks and are often difficult to remove in an efficient and non-invasive manner. Bacteria are engineered to capture heavy metals such as mercury using expression of proteins such as MerR, a metalloregulatory protein with high affinity and selectivity for mercury.

[0490] A. Synthesis of an E. coli parent strain expressing MerR The E. coli parent strain is synthesized using the method described by Bae et al., App Environ Microbiol, 2003. Briefly, MerR is fused to ice nucleation protein (INP) for surface expression. A hexahistidine tag is added to the C-terminus of this fusion protein to confirm expression.

[0491] Briefly, the INP-MerR fusion is constructed as follows: a merR fragment is PCR amplified from plasmid pT7KB with primers merR1 (5'CCGGGATCCTATGGAAAACAATTTGGAGA 3') and merR2 (5'CAGCTGCAGCCCTAAGGCATAGCCGAACC 3'). This amplified fragment is digested with BamHI and PstI, gel purified, and subcloned into similarly digested pUNI containing the EcoRI-BamHI INP fragment inserted into pUC18Not to generate pUNIM. The resulting construct allows for expression of MerR on the surface of E. coli.

[0492] To investigate the surface localization of MerR, a hexahistidine tag is added to the C-terminal portion of the INP-MerR fusion. The merR fragment is amplified again with a new reverse primer, merR3 (5'ATTCTGCAGCTAATGATGATGGTGGTGGTGATAAGGCATAGCCGAACCTGCCAAGCTT 3'), which codes for six histidines at the C-terminus. The resulting plasmid, pUNIMH, encoding the INP-MerR-H6 fusion is prepared.

[0493] Mercury uptake is measured in the presence of HgCl2 at concentrations of 0, 5, 10, 20, 40, 80, 100, 120, 140, and 160 μM by growing the bacterial clones in LB broth along with non-transformed E. coli as a control. For each bacterial clone, absorbance is measured at 600 nm after 16 and 120 hours of incubation to determine growth and its relative mercury resistance.

[0494] B. Synthesis and Purification of E. coli ADAS ADAS is produced by the protocol described in Example 12 and purified by the method in Example 13.

[0495] C. Mercury capture by E. coli ADAS E. coli ADAS are incubated for 16 and 120 hours in LB broth containing HgCl2 at concentrations of 0, 5, 10, 20, 40, 80, 100, 120, 140, and 160 μM. Residual levels of mercury are tested using an assay designed to detect extremely low levels of mercury (e.g., chelating strips designed by Brummer et al., Bioorg. Med. Chem., 2001).

[0496] Example 41. Lactose uptake and metabolism by E. coli ADAS Lactose uptake in E. coli is carried out by the membrane-bound protein β-galactoside permease, which allows the transport of lactose and other β-galactosides into the cell. The transport of the sugar molecule is accompanied by the cotransport of protons, which allows the uptake to be assayed using pH-sensitive dyes.

[0497] A. Synthesis of an E. coli parent strain expressing β-galactosidase permease Broth containing only lactose as a sugar source is used to synthesize the E. coli parent strain. E. coli contains the lac operon system to uptake and utilize lactose as a sugar source in the absence of preferred sugars. Removal of the preferred sugar induces expression of this protein involved in lactose uptake and metabolism. Since uptake is mediated by a membrane-bound transporter, induction of this system is required to increase transporter expression in the parent strain, which in part governs expression in the ADAS. Additionally, a plasmid containing the lac operon system is introduced into the E. coli ADAS for expression of the transporter.

[0498] B. Lactose uptake by E. coli ADAS E. coli ADAS is synthesized and purified as described in Examples 12 and 13. Lactose uptake by E. coli ADAS is measured using a pH-sensitive assay. Lactose uptake is measured using the pH-sensitive dye pyranine as described by Prabhala et al., FEBS Letters, 2014. Briefly, E. coli ADAS are pelleted, washed at least three times and resuspended in unbuffered Krebs solution containing 140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.8 mM MgSO4, 0.3 mM pyranine and various concentrations of lactose (1 mM to 5 mM). The pH of the suspension is carefully adjusted to 6.5 while the suspension is bubbled with nitrogen for 5 minutes and 30 mL liquid paraffin is added on top of the cell suspension to prevent pH changes as a result of carbon dioxide dissolution. The cell suspension is transferred directly into an assay plate for fluorescence measurement (using a fluorimeter at an excitation wavelength of 455 nm and an emission wavelength of 509 nm). Control experiments are performed using empty transformed E. coli cells as a negative control and the parental strain as a positive control.

[0499] C. E. coli ADAS converts lactose to glucose and galactose In the absence of glucose, E. coli uses the bacterial operon, the lac operon, to use lactose as a sugar source. Bacterial operons are polycistronic transcripts capable of producing multiple proteins from one mRNA transcript, lacZ, lacY, and lacA in the case of the lac operon. The gene products of lacZ, lacY, and lacA are, respectively, β-galactosidase, which cleaves lactose into glucose and galactose, β-galactoside permease, which allows the transport of lactose into the cell, and galactoside acetyltransferase, an enzyme that transfers the acetyl group from acetyl-CoA to galactosides, glucosides, and lactosides. The conversion of lactose to glucose and galactose is mediated by the enzyme β-galactosidase, the function of which can be measured directly using an enzyme activity assay.

[0500] D. Synthesis and Purification of E. coli ADAS E. coli ADAS is synthesized and purified as described in Examples 12 and 13. Lactose uptake in E. coli ADAS in the absence of glucose is evaluated.

[0501] E. Conversion of lactose to glucose and galactose by E. coli ADAS To assess the activity of the enzyme β-galactoside permease, E. coli ADAS cells are harvested and first lysed using a lysis buffer containing protease inhibitors to prevent proteolysis, for example as described by the EMBL protocol.

[0502] A commercial kit from ThermoFisher (catalog number K145501) is used to measure the activity of this enzyme using the manufacturer's instructions. Briefly, β-galactosidase catalyzes the hydrolysis of β-galactosides such as ortho-nitrophenyl-D-galactopyranoside (ONPG). Hydrolysis of ONPG to the ONP anion produces a bright yellow color. Quantify the β-galactosidase activity of this solution using a spectrophotometer or microplate reader to determine the amount of substrate converted at 420 nm.

[0503] The E. coli parent strain is used as a positive control. The ability of E. coli ADAS to break down lactose will be determined by the lactose conversion index (L), where L = (enzyme activity of E. coli ADAS) / (enzyme activity of parent strain) x 100.

[0504] Example 42. PETase-expressing E. coli ADAS for plastic degradation Ideonella sakaiensis, isolated from an outdoor bottle recycling facility, is a bacterium capable of breaking down and metabolizing the common plastic, poly(ethylene teraphthalate), or PET (Yoshida et al., Science, 2016). It secretes the enzyme PETase, which breaks down the polymer into monomers. E. coli ADAS expressing I. sakaiensis PETase has the ability to degrade the widely used plastic PET (approximately 3.5 billion pounds of PET bottles alone end up in landfills in the United States annually).

[0505] A. Transformation of E. coli to express PETase Synthesize a PETase-synthesizing E. coli ADAS parent strain using the protocol described by Han et al., Nat. Commun., 2017. Briefly, the PETase from Ideonella sakaiensis (GenBank accession no. GAP38373.1), lacking the N-terminal 29 amino acids, is commercially cloned and ligated into the pET32a vector. Either wild-type or mutant pET32a-PETase plasmids are transformed into E. coli BL21trxB(DE3) cells, which are grown in LB medium at 37 °C to an OD600 of approximately 0.8, and then induced with 0.6 mM isopropyl β-d-thiogalactopyranoside (IPTG) for 24 h at 16 °C. The parent strain is incubated with a PET film (described in c below) to confirm PETase activity.

[0506] B. Synthesis and Purification of E. coli ADAS E. coli ADAS is synthesized and purified as described in Examples 12 and 13. Lactose uptake in E. coli ADAS in the absence of glucose is evaluated.

[0507] C. Degradation of PET using E. coli ADAS expressing PETase Ideonella sakaiensis 201-F6 was obtained from BCRC and cultured according to the manufacturer's instructions, which serves as a positive control for measuring activity of E. coli expressing PETase.

[0508] The ability to degrade PET is measured using the protocol described by Yoshida et al., Science, 2016. Briefly, cultured samples of I. sakaiensis and E. coli ADAS are suspended in 10 mM phosphate buffer (pH 7.0) containing a low crystallinity PET film (approximately 60 mg, 20 x 15 x 0.2 mm, Mw: 45 x 103, Mw / Mn: 1.9, Tg: 77°C, Tm: 255°C, crystallinity: 1.9%, density: 1.3378 g / cm3). The PET film is sterilized with 70% ethanol, air-dried with sterile air, and then placed in a test tube. The test tube is shaken at 300 strokes / min at 30°C.

[0509] Quantification of CO2 production is used as a measure of PET degradation. The produced CO2 is captured in Ascarite and weighed to calculate the absorbed CO2. The biofilm-like material and treated PET films are separated from the medium to determine the carbon content of the degraded films. The conversion rate of PET to CO2 (R) is calculated as follows: TIFF2025032096000010.tif20161In the formula, CO2(PET+) and CO2(PET-) refer to the carbon amount of CO2 produced when cultured in the presence and absence of PET, respectively.

[0510] The PETase index (Y) is used to measure the plastic degradation efficiency of E. coli ADAS and is calculated as follows: Y = R(E. coli ADAS) / R(I. sakaiensis) where R refers to the conversion rate as shown above.

[0511] As described by Austin et al., PNAS, 2018, the ADAS can be further optimized to express mutant PETase enzymes that have been shown to have higher activity and increase the range of plastics degraded.

[0512] Example 43. RNA secretion via the T4 secretion apparatus Although it has been shown that T4SSs can secrete DNA, it remains to be shown that T4SSs can secrete RNA. This example describes the secretion of RNA via coupling of an RNA-binding protein to the RNA.

[0513] A. Synthesis of Agrobacterium Containing the RNA Secretion T4 Secretion Apparatus S. cerevisiae optimized Cas9 (from Generoso et al., J. Microbiol. Meth., 2016) and tombusvirus p19 (Uniprot Q66104) sequences are fused to the N-terminus of VirE2 and VirF under the virF promoter. The sgRNA or siRNA sequence is also placed in this sequence under the control of the virF promoter. The sgRNA sequence for ILV1 is described in Generoso et al., J. Microbiol. Meth., 2016. The protocol is as described in Vergunst et al., PNAS, 2005 and Vergunst et al., Science, 2000 with some modifications. Briefly, the plasmid is commercially synthesized and electroporated into Agrobacterium containing the T4SS apparatus and Agrobacterium without the T4SS apparatus. The Agrobacteria are then cultured on LB plates and grown according to standard protocols. The presence of the fusion protein is confirmed by Western blot. Furthermore, after RNA isolation, the sgRNA or siRNA sequences are confirmed by Quantigene assay with a commercial small scale RNA isolation kit from Thermo Fisher.

[0514] B. Demonstrating T4SS delivery of RNA into yeast The protocol for delivery of the T4SS into yeast is described in Schrammeijer et al., Nucl. Acids Res., 2003. Briefly, Agrobacterium strains are grown overnight in minimal medium containing antibiotics, harvested, diluted into induction medium, and then grown for 5 hours before use. S. cerevisiae strains are grown overnight in standard medium, diluted 1:10, and grown again for an additional 5 hours. Agrobacterium and yeast cultures are combined, mixed 1:1, and grown on cellulose nitrate filters. After 6 days of co-cultivation, the mixtures are analyzed by plating on cefotaxime-containing yeast medium, and yeast colonies are grown and analyzed for the presence of delivered RNA after RNA isolation by Quantigene assay with a commercial small-scale RNA isolation kit from Thermo Fisher.

[0515] C. Demonstrating T4SS-mediated DNA editing in yeast Following the protocol described above, yeast colonies are grown in isoleucine-free medium and colonies are counted for co-culture with Agrobacterium with and without the T4SS and with and without the sgRNA / Cas9 cassette.

[0516] Other embodiments Some embodiments of the invention are within the scope of the following numbered paragraphs.

[0517] 1. Isolated highly active non-chromosomal dynamic activation system (ADAS).

[0518] 2. The high activity ADAS of paragraph 1, comprising an ATP synthase concentration of at least: 1 per 10,000 nm2, 1 per 5,000 nm2, 1 per 3,500 nm2, or 1 per 1,000 nm2.

[0519] 3. The highly active ADAS of any one of the preceding paragraphs, wherein the ADAS comprises an ATP synthase that optionally lacks a regulatory domain, such as lacking an ε domain.

[0520] 4. The highly active ADAS of any one of the preceding paragraphs, further comprising a photovoltaic proton pump.

[0521] 5. The highly active ADAS of paragraph 4, wherein the photovoltaic proton pump is proteorhodopsin.

[0522] 6. The highly active ADAS of paragraph 5, wherein the proteorhodopsin comprises the amino acid sequence of proteorhodopsin from the uncultured marine bacterial clade SAR86, GenBank accession number AAS73014.1.

[0523] 7. The highly active ADAS of paragraph 4, wherein the photovoltaic proton pump is Gloeobacter rhodopsin.

[0524] 8. The highly active ADAS of paragraph 4, wherein the photovoltaic proton pump is bacteriorhodopsin, delta rhodopsin, or halorhodopsin from Halobium salinarum, Natronomonas pharaonis, Exiguobacterium sibiricum, Haloterrigena turkmenica, or Haloarcula marismortui.

[0525] 9. The highly active ADAS of any one of the preceding paragraphs, further comprising retinal.

[0526] 10. The highly active ADAS of any one of the preceding paragraphs, further comprising a retinal synthesis protein (or protein machinery), or a nucleic acid encoding same.

[0527] 11. The highly active ADAS of any one of the preceding paragraphs, further comprising one or more glycolytic pathway proteins.

[0528] 12. The highly active ADAS of paragraph 11, wherein the glycolytic pathway protein is phosphofructokinase (Pfk-A).

[0529] 13. The highly active ADAS of paragraph 12, wherein Pfk-A comprises the amino acid sequence of UniProt accession number P0A796.

[0530] 14. The highly active ADAS of paragraph 12, wherein the glycolytic pathway protein is triosephosphate isomerase (tpi).

[0531] 15. The highly active ADAS of paragraph 14, wherein tpi comprises the amino acid sequence of UniProt accession number P0A858.

[0532] 16. A hyperactive ADAS according to any one of the preceding paragraphs, lacking one or more metabolically non-essential proteins.

[0533] 17. The highly active ADAS of any one of the preceding paragraphs, which is devoid of one or more of RNases, proteases, or combinations thereof, and in particular embodiments, is devoid of one or more endoribosuclease (such as RNase A, RNase h, RNase III, RNase L, RNase PhyM) or exoribonuclease (such as RNase R, RNase PH, RNase D); or serine, cysteine, threonine, aspartic acid, glutamic acid and metalloproteases; or any combination of the foregoing.

[0534] 18. The highly active ADAS of any one of the preceding paragraphs, further comprising a bacterial secretion apparatus.

[0535] 19. The highly active ADAS of paragraph 18, wherein the bacterial secretion apparatus has the ability to translocate cargo across the ADAS outer membrane and into a target cell, such as an animal, fungal, bacterial, or plant cell.

[0536] 20. The highly active ADAS of paragraph 18 or 19, wherein the bacterial secretion system is a T3SS, a T4SS, or a T6SS.

[0537] 21. The highly active ADAS of paragraph 18 or 19, wherein the bacterial secretion system is a T3 / 4SS.

[0538] 22. The highly active ADAS of paragraph 21, wherein the T3 / 4SS has a modified effector function, for example an effector selected from SopD2, SopE, Bop, Map, Tir, EspB, EspF, NleC, NleH2, or NleE2.

[0539] 23. The highly active ADAS of paragraph 22, wherein the modified effector function is a function of intracellular targeting, such as translocation into the nucleus, Golgi, mitochondria, actin, microvilli, ZO-1, microtubules, or cytoplasm.

[0540] 24. The highly active ADAS of paragraph 22, wherein the modified effector function is nuclear targeting based on NleE2 derived from E. coli.

[0541] 25. The hyperactive ADAS of paragraph 22, wherein the modified effector function is filopodia formation, disruption of tight junctions, loss of microvilli, or SGLT-1 inactivation.

[0542] 26. The highly active ADAS of paragraph 18 or 19, wherein the bacterial secretion system is a T6SS.

[0543] 27. The highly active ADAS of paragraph 26, wherein the T6SS comprises an effector that targets and kills the bacterium in its natural host.

[0544] 28. The highly active ADAS of paragraph 26 or paragraph 27, wherein the T6SS is derived from P. putida K1-T6SS, and optionally the effector comprises the amino acid sequence of Tke2 (Accession No. AUZ59427.1).

[0545] 29. The highly active ADAS of paragraph 26, wherein the T6SS comprises an effector that targets and kills the fungus in its natural host.

[0546] 30. The highly active ADAS of paragraph 29, wherein the T6SS is derived from Serratia Marcescens and the effector comprises the amino acid sequence of Tfe1 (Genbank: SMDB11_RS05530) or Tfe2 (Genbank: SMDB11_RS05390).

[0547] 31. A highly active ADAS according to paragraph 18, wherein the bacterial secretion apparatus has the ability to translocate cargo outside the cell.

[0548] 32. The highly active ADAS of paragraph 31, wherein the bacterial secretion system is T1SS, T2SS, T5SS, T7SS, Sec, or Tat.

[0549] 33. A highly active ADAS according to any one of the preceding paragraphs, comprising a transporter in the membrane.

[0550] 34. The highly active ADAS of paragraph 33, wherein the transporter is specific for glucose, sodium, potassium, a metal ion, an anionic solute, a cationic solute, or water.

[0551] 35. The highly active ADAS of any one of the preceding paragraphs, wherein the membrane comprises a targeting agent.

[0552] 36. The highly active ADAS of paragraph 35, wherein the targeting agent is a nanobody, such as a nanobody directed against a tumor antigen, such as HER2, PSMA, or VEGF-R.

[0553] 37. The highly active ADAS of paragraph 35, wherein the targeting agent is a carbohydrate-binding protein, such as a lectin, e.g., mannose-binding lectin (MBL).

[0554] 38. The highly active ADAS of paragraph 35, wherein the targeting agent is a tumor targeting peptide, such as an RGD motif or a CendR peptide.

[0555] 39. The highly active ADAS of any one of the preceding paragraphs, wherein the ADAS membrane comprises an enzyme.

[0556] 40. The highly active ADAS of paragraph 39, wherein the enzyme is a protease, an oxidoreductase, or a combination thereof.

[0557] 41. The highly active ADAS of paragraph 39 or paragraph 40, wherein the enzyme is chemically conjugated to the ADAS membrane, optionally via a linker to the outer membrane.

[0558] 42. The highly active ADAS of any one of the preceding paragraphs, comprising a cargo dispersed within the interior volume of the ADAS, wherein the cargo comprises a nucleic acid, a ribosome, a peptide, a hormone, an amino acid, a carbohydrate, a lipid, a protein, an organic particle, an inorganic particle, a small molecule, or a combination thereof.

[0559] 43. The highly active ADAS of any one of the preceding paragraphs, wherein the ADAS comprises a bacterial secretion apparatus and a cargo, and optionally the cargo comprises a moiety that directs extracellular export by the bacterial secretion apparatus, e.g., in some embodiments the moiety is Pho / D, Tat, or a synthetic peptide signal.

[0560] 44. The ADAS of paragraph 42 or 43, wherein the cargo has been modified to have increased stability compared to an unmodified version of the cargo.

[0561] 45. A highly active ADAS according to any one of paragraphs 42 to 44, wherein the cargo comprises a protein.

[0562] 46. ​​The highly active ADAS of paragraph 45, wherein the protein is a hormone, e.g., paracrine, endocrine, or autocrine.

[0563] 47. The highly active ADAS of paragraph 60 or paragraph 61, wherein the protein has a stability in the cytoplasm or other environment greater than about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 10000000.

[0564] 48. The highly active ADAS of any one of paragraphs 42 to 44, wherein the cargo comprises a plant hormone, such as abscisic acid, auxin, cytokinin, ethylene, gibberellin, or a combination thereof.

[0565] 49. The highly active ADAS of any one of paragraphs 42 to 44, wherein the cargo is an immunomodulatory agent, such as an immunostimulant, a checkpoint inhibitor (e.g., an inhibitor of PD-1, PD-L1, CTLA-4), a suppressor, a superantigen, a small molecule (cyclosporine A, a cyclic dinucleotide (CDN), or a STING agonist (e.g., MK-1454)).

[0566] 50. The highly active ADAS of any one of paragraphs 42 to 44, wherein the cargo comprises RNA, such as circular RNA, mRNA, siRNA, shRNA, ASO, tRNA or a combination thereof.

[0567] 51. The highly active ADAS of paragraph 50, wherein the cargo comprises a protein-coding mRNA.

[0568] 52. The highly active ADAS of paragraph 51, wherein the protein-coding mRNA encodes an enzyme (e.g., an enzyme that confers hepatic enzyme activity, such as human PBGD (hPBGD) mRNA) or encodes an antigen that elicits an immune response (e.g., elicits strong and durable neutralizing antibody titers), such as an mRNA encoding an antigen, e.g., CMV glycoprotein gB and / or pentameric complex (PC).

[0569] 53. The highly active ADAS of paragraph 50, wherein the RNA is a small non-coding RNA, such as an shRNA, an ASO, a tRNA, or a combination thereof.

[0570] 54. A highly active ADAS according to any one of paragraphs 50 to 53, wherein the RNA is stabilized by the addition of a tRNA scaffold, for example a stem-loop structure.

[0571] 55. The ADAS of any one of paragraphs 65 to 70, wherein the RNA has a stability, for example in the ADAS plasm, greater than about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 1000000.

[0572] 56. The high activity ASAS of any one of the preceding paragraphs, wherein the high activity ADAS does not degrade cargo.

[0573] 57. The highly active ADAS of paragraph 42 or 43, wherein the cargo comprises a gene editing system.

[0574] 58. The highly active ADAS of paragraph 58, wherein the cargo is DNA, such as a plasmid, or circular RNA, optionally the DNA or circular RNA comprising a protein coding sequence.

[0575] 59. The high activity ADAS of any one of the preceding paragraphs, wherein the ADAS is a double membrane ADAS.

[0576] 60. The highly active ADAS of paragraph 59, wherein the double membrane ADAS further comprises a bacterial secretion apparatus.

[0577] 61. The highly active ADAS of paragraph 60, wherein the bacterial secretion apparatus is selected from a T3SS, a T4SS, a T3 / 4SS, or a T6SS, and optionally the T3SS, T4SS, T3 / 4SS, or T6SS has an attenuated or non-functional effector that does not affect the fitness of the target cell.

[0578] 62. The highly active ADAS of any one of paragraphs 59 to 61, derived from a bacterial parent strain, wherein the parent strain is a plant bacterium, such as a plant commensal (e.g., B. Subtilis or Pseudomonas putida) or a plant pathogen (e.g., Xanthomonas sp. or Psuedomonas syringae), or a commensal human bacterium (e.g., E. coli, Staphylococcus sp., Bifidobacterium sp., Micrococcus sp., Lactobacillus sp., or Actinomyces sp.) or a pathogenic human bacterium (e.g., Escherichia coli, A highly active ADAS selected from a human bacterium, such as Salmonella typhimurium, Salmonella flexneri, Yersinia enterolitica, Helicobacter pylori, or an extremophile microorganism, including functionalized derivatives of any of the foregoing, including functional cassettes, such as functional cassettes that induce the bacterium to one or more of: secrete antimicrobials, digest plastics, secrete insecticides, survive extreme environments, make nanoparticles, integrate into other organisms, respond to the environment, and produce a reporter signal.

[0579] 63. The highly active ADAS of any one of the preceding paragraphs, derived from a parent strain selected from E. coli, Agrobacterium, Rhizobium, Pseudomonas, Xanthomonas, Anaplasma, Helicobacter, Serratia, Vibrio, Salmonella, or Shigella.

[0580] 64. A highly active ADAS according to any one of the preceding paragraphs, derived from a parent strain engineered or induced to overexpress ATP synthase.

[0581] 65. The highly active ADAS of paragraph 64, wherein the ADAS comprises an ATP synthase that is heterologous to the parent strain.

[0582] 66. The highly active ADAS of paragraph 64 or 65, wherein the parent strain is modified to express a functional FoF1 ATP synthase.

[0583] 67. A highly active ADAS of any one of the preceding paragraphs obtained from a parent strain cultured under conditions selected from an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1-5% O2, 5-10% O2, 10-15% O2, 25-30% O2), a low pH (about: 4.5, 5.0, 5.5, 6.0, 6.5), or a combination thereof.

[0584] 68. Arginine (e.g., knockout of argA, strains JW2786-1 and NK5992, etc.), cysteine ​​knockout of cysE (strains JW3582-2 and JM15, etc.), glutamine, e.g., knockout of glnA (strains JW3841-1 and M5004, etc.), glycine, e.g., knockout of glyA (strains JW2535-1 and AT2457, etc.), histidine, e.g., knockout of hisB (strains JW2004-1 and SB3930, etc.), isoleucine, e.g., knockout of ilvA (strains JW3745-2 and AB1255, etc.), leucine, e.g., knockout of leuB (strains JW5807-2 and CV514, etc.), lysine, e.g., knockout of lysA (such as strains JW2806-1 and KL334); methionine, e.g., knockout of metA (such as strains JW3973-1 and DL41); phenylalanine, e.g., knockout of pheA (such as strains JW2580-1 and KA197); proline, e.g., knockout of proA (such as strains JW0233-2 and NK5525); serine, e.g., knockout of serA (such as strains JW2880-1 and JC158); threonine, e.g., knockout of thrC (strains JW0003-2 and Gif 41), tryptophan, e.g., knockout of trpC (strains JW1254-2 and CAG18455), tyrosine, e.g., knockout of tyrA (strains JW2581-1 and N3087), valine / isoleucine / leucine, e.g., knockout of ilvd (strains JW5605-1 and CAG18431).

[0585] 69. The highly active ADAS of any one of the preceding paragraphs made from bacterial cells, wherein the parent strain is a plant bacterium such as a plant commensal (e.g., B. Subtilis or Pseudomonas putida) or a plant pathogen (e.g., Xanthomonas sp. or Psuedomonas syringae) or a commensal human bacterium (e.g., E. coli, Staphylococcus sp., Bifidobacterium sp., Micrococcus sp., Lactobacillus sp., or Actinomyces sp.) or a pathogenic human bacterium (e.g., Escherichia coli, A highly active ADAS selected from a human bacterium, such as Salmonella typhimurium, Salmonella flexneri, Yersinia enterolitica, Helicobacter pylori, or an extremophile microorganism, including functionalized derivatives of any of the foregoing, including functional cassettes, such as functional cassettes that induce the bacterium to one or more of: secrete antimicrobials, digest plastics, secrete insecticides, survive extreme environments, make nanoparticles, integrate into other organisms, respond to the environment, and produce a reporter signal.

[0586] 70. A highly active ADAS according to any of the preceding paragraphs, comprising a modified membrane.

[0587] 71. The highly active ADAS of paragraph 70, wherein the membrane is modified so as to make it less immunogenic or immunostimulatory in plants or animals.

[0588] 72. The highly active ADAS of paragraph 71, produced from a parent strain, wherein the immunostimulatory capacity of the parent strain has been reduced or eliminated by post-production treatment with detergents, enzymes, or functionalization with PEG.

[0589] 73. A highly active ADAS according to paragraph 71, produced from a parent strain, which is membrane modified through knockout of the LPS synthesis pathway of the parent strain, for example by knocking out msbB and / or purI.

[0590] 74. A highly active ADAS of paragraph 71, produced from a parent strain that produces cell wall-deficient particles upon exposure to hyperosmotic conditions.

[0591] 75. A composition comprising the highly active ADAS of any one of the preceding paragraphs.

[0592] 76. A composition comprising an ADAS, wherein at least about:80, 81, 82, 83, 84, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9%, or more, of the ADAS contains a bacterial secretion apparatus.

[0593] 77. The composition of paragraph 76, wherein the bacterial secretion apparatus is one of a T3SS, a T4SS, a T3 / 4SS, or a T6SS.

[0594] 78. A composition of ADAS comprising T3SS, wherein the ADAS comprises an average T3SS film density greater than 1 per about: 40,000, 35,000, 30,000, 25,000, 19,600, 15,000, 10,000, or 5,000 nm2.

[0595] 79. The composition of paragraph 78, wherein the ADAS is derived from a S. Typhimurium or E. coli parent strain.

[0596] 80. A composition of ADAS comprising T3SS, wherein the ADAS comprises an average T3SS film density greater than 1 in about: 300,000, 250,000, 200,000, 150,000, 100,000, 50,000, 20,000, 10,000, 5,000 nm2.

[0597] 81. The composition of paragraph 80, wherein the ADAS is derived from an Agrobacterium tumefaciens parent strain.

[0598] 82. A composition of ADAS, wherein at least about: 80, 81, 82, 83, 84, 85, 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% or more of the ADAS comprises a bacterial secretion apparatus including T3, T4, T3 / 4SS, T6SS, and optionally one or more of an exogenous carbohydrate, a phosphate-producing synthase, a light-responsive protein, an intracellular internalization protein, an enzyme, a functional cargo, an organism-specific effector, a fusion protein.

[0599] 83. The composition of any one of paragraphs 75 to 82, wherein the ADAS is a high activity ADAS.

[0600] 84. The composition of any one of paragraphs 75-83, formulated for IP, IV, IM, oral, topical (cream, gel, ointment, transdermal patch), aerosol, or spray administration.

[0601] 85. The composition of any one of paragraphs 75 to 84, which is a liquid formulation or a lyophilized formulation.

[0602] 86. A method of making any one of the ADASs of paragraphs 1 to 74, comprising culturing a stain under conditions that promote ADAS formation, and recovering the ADAS, optionally further comprising the step of isolating the ADAS from any remaining stain cells or other contaminants.

[0603] 87. The method of paragraph 86, comprising using a single-, double-, triple-, or quadruple-auxotrophic parent strain, wherein the parent strain further comprises a plasmid expressing ftsZ.

[0604] 88. The method of paragraph 86, comprising transforming the parent strain with an inducible DNase system, such as exoI (NCBI GeneID: 946529) and sbcD (NCBI GeneID: 945049) nucleases, or I-CeuI (e.g., Swissprot: P32761.1) nuclease.

[0605] 89. The method of paragraph 88, comprising using a single, double, triple, or quadruple auxotroph and having a complementing gene on a plasmid encoding an inducible nuclease.

[0606] 90. The method of paragraph 86, wherein the parent strain is cultured under conditions selected from an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1-5% O2, 5-10% O2, 10-15% O2, 25-30% O2), a low pH (4.5-6.5), or a combination thereof.

[0607] 91. The method of paragraph 86, wherein the parent strain lacks flagella and undesired secretion apparatus, and optionally the flagella and undesired secretion apparatus are removed using λ Red recombineering.

[0608] 92. The method of paragraph 86, wherein flagellar regulatory components are excised from the parent strain genome by insertion of a plasmid containing a CRISPR domain targeting flagellar regulatory genes, such as flhD and flhC.

[0609] 93. A method for making a highly active ADAS in which an ADAS containing a plasmid containing a rhodopsin-encoding gene is cultured in the presence of light.

[0610] 94. The method of paragraph 93, wherein the rhodopsin is proteorhodopsin from SAR86 uncultured bacteria having the amino acid sequence of GenBank Accession No. AAS73014.1, and optionally the culture is supplemented with retinal.

[0611] 95. The method of paragraph 93 or 94, wherein the rhodopsin is a proteorhodopsin and the plasmid further contains a gene for synthesizing retinal (such a plasmid is the pACYC-RDS plasmid from Kim et al., Microb Cell Fact, 2012).

[0612] 96. The method of any one of paragraphs 86 to 95, wherein the parent strain contains a nucleic acid sequence encoding a nanobody that is in turn expressed on the membrane of the ADAS.

[0613] 97. The method of any one of paragraphs 86 to 95, wherein the parent strain contains a nucleic acid sequence encoding one or more bacterial secretion apparatus operons.

[0614] 98. The method of any one of paragraphs 86 to 97, wherein the parent strain comprises a cargo.

[0615] 99. The method of any one of paragraphs 86 to 97, wherein the parent strain contains a nucleic acid sequence encoding a set of genes that synthesize a small molecule cargo.

[0616] 100. An ADAS created by any one of the methods set forth in paragraphs 86 to 99.

[0617] 101. A method for regulating a condition in an animal cell, comprising providing access to the animal cell to an effective amount of an ADAS or composition of any one of the preceding paragraphs.

[0618] 102. The method of paragraph 101, wherein the ADAS or composition is provided with access to animal cells in vivo in an animal, such as a mammal, such as a human.

[0619] 103. The method of paragraph 102, wherein the animal cells are exposed to the bacteria in a healthy animal.

[0620] 104. The method of paragraph 103, wherein the animal cell is a lung epithelium, an immune cell, a skin cell, an oral epithelium cell, an intestinal epithelium cell, a reproductive epithelium cell, or a urinary tract cell.

[0621] 105. The method of paragraph 104, wherein the animal cell is an intestinal epithelial cell, such as an intestinal epithelial cell from a human subject with inflammatory bowel disease, such as Crohn's disease or colitis.

[0622] 106. The method of pa...

Claims

1. 1. A method for producing a composition comprising a plurality of highly active non-chromosomal dynamic activation systems (ADAS), said composition being substantially free of viable bacterial cells, said method comprising: (a) producing, providing, or obtaining a plurality of parental bacteria that exhibit a reduced level or activity of a cell division topology specificity factor, wherein said reduction comprises reduced expression of minE, minC, and minD polypeptides; (b) exposing the parent bacterium to conditions permissive for the formation of minicells; and (c) separating the minicells from the parent bacteria, thereby producing a composition comprising a plurality of ADASs that is substantially free of viable bacterial cells. A method comprising:

2. 2. The method of claim 1, wherein the ATP concentration of the ADAS increases after 12 hours of incubation at 37°C.

3. The method of claim 1 , wherein the parent bacterium has a deletion of the minCDE operon.

4. The parent bacterium is selected from the group consisting of Escherichia, Acinetobacter, Agrobacterium, Anabaena, Aquifex, Azoarcus, Azotobacter, Bordetella, Bradyrhizobium, Brucella, Buchnera, Burkholderia, and the like. lderia), Candidatus, Chromobacterium, Crocosphaera, Dechloromonas, Desulfitobacterium, Desulfotalea, Erwinia, Francisella, Fusobacterium, Gloeobacter er), Gluconobacter, Helicobacter, Legionella, Magnetospirillum, Mesorhizobium, Methylococcus, Neisseria, Nitrosomonas, Nostoc, Photobacterium, Photorhabdus habdus), Polaromonas, Prochlorococcus, Pseudomonas, Psychobacter, Ralstonia, Rubrivivax, Salmonella, Shewanella, Shigella, Sinorhizobium, Synechococcus,The genus Synechocystis, Thermosynechococcus, Thermotoga, Thermus, Thiobacillus, Trichodesmium, Vibrio, Wigglesworthia, Wolinella, Xanthomonas, Xylella, Yersinia, Bacillus 2. The method of claim 1, wherein the bacterium is a bacterium of the genus Clostridium, Deinococcus, Exiguobacterium, Geobacillus, Lactobacillus, Moorella, Oceanobacillus, Symbiobacterium, or Thermoanaerobacter.

5. The method of claim 1 , wherein the ADAS comprises a cargo.

6. 6. The method of claim 5, wherein the cargo comprises at least one of a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulatory agent, a carbohydrate, a lipid, an organic particle, an inorganic particle, a ribonucleoprotein complex (RNP), a growth factor, an antibacterial protein, an antifungal protein, an insecticide protein, a chemotherapeutic agent, or an immunomodulatory agent.

7. The method of claim 6 , wherein the nucleic acid is DNA, RNA, or a plasmid.

8. The method of claim 5 , wherein the cargo is expressed within the ADAS.

9. The method of claim 5 , wherein the cargo is encapsulated in the ADAS.

10. 10. A method of treating a plant in need thereof, comprising contacting the plant or its pest with an effective amount of a composition produced by the method of any one of claims 1 to 9.

11. A method of treating an animal, excluding humans, in need thereof, comprising contacting the animal with an effective amount of a composition prepared by the method of any one of claims 1 to 9.

12. A method of treating an animal pathogen comprising contacting the animal pathogen with an effective amount of a composition produced by the method of any one of claims 1 to 9.

13. 10. A pharmaceutical composition comprising a composition produced by the method of any one of claims 1 to 9 and formulated into a pharmaceutical composition suitable for delivery to a human subject, wherein the pharmaceutical composition is delivered to a human subject.

Images