Endometrial cancer therapeutic agent, endometrial cancer treatment method, and use for treatment of endometrial cancer

Abstract

To provide a therapeutic agent and a treatment method for endometrial cancer.SOLUTION: A therapeutic agent for endometrial cancer comprises a ligand or an agonist for an androgen receptor as an active ingredient.SELECTED DRAWING: Figure 9

Description

[Technical field]

[0001] The present invention relates to a therapeutic agent for uterine body cancer, a therapeutic method for uterine body cancer, and use for the treatment of uterine body cancer. [Background technology]

[0002] Uterine cancer is a malignant tumor that occurs in the uterus, and is broadly classified into cervical cancer, which occurs in the mucosa of the cervix, and uterine cancer, which occurs in the mucosa of the uterine body. Uterine cancer, also called endometrial cancer, is classified into two types, type 1 and type 2, clinically, histopathologically, and molecular biologically. Type 1 is the most common histological type, endometrioid carcinoma, and is thought to develop in an early stage under an environment of estrogen excess without the antagonistic effect of progesterone (called unopposed estrogen), through the addition of DNA mismatch repair gene dysfunction and mutations in the tumor suppressor gene PTEN and the proto-oncogene KRAS, which lead to endometrial hyperplasia, a precancerous lesion, and then endometrial carcinoma. On the other hand, serous carcinoma, which is the representative histological type of type 2, is not accompanied by endometrial hyperplasia, and the mutations of p53, which are frequently observed in the early stage, induce endometrial intraepithelial carcinoma (EIC) in the atrophic endometrium, causing cancer.

[0003] Patent Document 1 broadly discloses that the expression of FOXP4, a member of the forkhead box (Fox) transcription factor family, can be widely used as a predictor of the onset, metastasis, and recurrence of uterine cancer. In particular, the Examples of Patent Document 1 show that, as a result of verifying the expression of FOXP4 in uterine cancer, cases of high FOXP4 expression among uterine endometrioid cancer patients are significantly more likely to have lymph node metastasis and postoperative recurrence than cases of low FOXP4 expression. Patent Document 1 also discloses that the expression of FOXP4 protein has been identified as an independent predictor of lymph node metastasis and postoperative recurrence of uterine endometrioid cancer. Furthermore, Patent Document 1 examines the relationship between the disease-free survival rate after hysterectomy in uterine endometrioid cancer patients and FOXP4 expression in patients, suggesting that FOXP4 is a factor that induces malignant progression. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Patent Publication No. 2020-071205 Summary of the Invention [Problem to be solved by the invention]

[0005] As mentioned above, even though FOXP4 expression has been found in endometrial cancer and FOXP4 has been identified as a predictor of lymph node metastasis and postoperative recurrence, it is difficult to specifically suppress the expression of the Foxp4 gene, which is a nuclear transcription factor, and no drugs that inhibit the FOXP4 protein are known.

[0006] Therefore, an object of the present invention is to clarify the mechanism by which uterine body cancer progresses by targeting FOXP4 protein, and to provide therapeutic agents and methods for uterine body cancer based on these findings. [Means for solving the problem]

[0007] In order to achieve the above-mentioned object, the present inventors conducted extensive research and discovered that the formation of a complex between the androgen receptor and androgen reduces the expression of FOXP4 and inhibits the proliferation of uterine cancer cells, thereby completing the present invention.

[0008] [1] A therapeutic agent for uterine cancer, which contains as an active ingredient a ligand or agonist for the androgen receptor. [2] The therapeutic agent for uterine body cancer according to [1], wherein the agonist is dihydrotestosterone. [3] The therapeutic agent for uterine body cancer according to [1], characterized in that the target of treatment is uterine endometrioid cancer. [4] A method for treating uterine body cancer, comprising administering a ligand or agonist for the androgen receptor to a patient with uterine body cancer. [5] The method for treating uterine body cancer according to [4], wherein the agonist is dihydrotestosterone. [6] The method for treating uterine body cancer according to [4], characterized in that the target of treatment is uterine endometrioid cancer. [7] A ligand or agonist for the androgen receptor for use in the treatment of endometrial cancer. [8] The ligand or agonist according to [7], which is dihydrotestosterone. [9] The ligand or agonist according to [7], characterized in that it is used to treat endometrioid cancer. Effect of the Invention

[0009] The present invention provides a novel therapeutic agent and method for treating uterine body cancer that targets FOXP4, which is highly expressed in uterine body cancer, and a ligand or agonist for androgen receptor for use in treating uterine body cancer. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 is a characteristic diagram showing the postoperative disease-free survival rate of uterine endometrioid cancer patients according to the expression level of androgen receptor. [Diagram 2] FIG. 1 is a characteristic diagram showing the results of measuring DHT contained in serum samples from patients with uterine endometrioid cancer (Grades 1 to 3). [Diagram 3] FIG. 1 is a characteristic diagram showing the results of measuring DHT contained in serum samples from patients with uterine endometrioid cancer who have not had a recurrence and those who have had a recurrence. [Figure 4] FIG. 1 is a characteristic diagram showing the results of Western blotting to confirm the expression of androgen receptor in human uterine body cancer cells (HEC50B, HEC59, HEC108, HEC265). [Diagram 5] FIG. 1 is a characteristic diagram showing the results of confirming the expression of androgen receptor by Western blotting in a cell line (AR_HEC50B) prepared by introducing AR into HEC50B. [Figure 6] FIG. 1 is a characteristic diagram showing the results of measuring cell proliferation by WST-1 assay when DHT is administered to AR_HEC50B cells. [Figure 7] FIG. 1 is a characteristic diagram showing the results of measuring the wound-healing ability of AR_HEC50B cells by scratch assay when DHT was administered to the cells. [Figure 8] FIG. 1 is a characteristic diagram showing the results of measuring the colony-forming ability of AR_HEC50B cells when DHT was administered thereto, by a colony-forming assay. [Figure 9] FIG. 1 is a characteristic diagram showing the results of measuring tumor formation when AR_HEC50B cells were subcutaneously transplanted into ovariectomized nude mice. [Figure 10] FIG. 1 is a characteristic diagram showing the results of confirming the expression of androgen receptor by immunohistochemical staining when DHT was administered to a mouse model spontaneously developing uterine endometrial cancer after ovariectomy. [Figure 11] FIG. 1 is a characteristic diagram showing the results of confirming the expression of FOXP4 in human endometrial cancer cells, HEC50B, HEC108, HEC59, and HEC265, by Western blotting. [Figure 12] FIG. 1 is a characteristic diagram showing the results of confirming the expression of the FOXP4 gene by real-time PCR and Western blotting when DHT was administered to AR_HEC50B cells. [Figure 13] FIG. 1 is a characteristic diagram showing the results of confirming the expression of FOXP4 by immunohistochemical staining in Pten-PRcre mice that spontaneously develop endometrial cancer. [Figure 14] FIG. 1 is a characteristic diagram showing the results of confirming by PCR that the target region was deleted in a mutant in which the AR-DHT-binding region in FOXP4 was deleted. [Figure 15] FIG. 1 is a characteristic diagram showing the results of confirming, by real-time PCR, the expression of the FOXP4 gene when DHT was administered in a mutant in which the AR-DHT-binding region in FOXP4 was deleted. [Figure 16]FIG. 1 is a characteristic diagram showing the results of confirming the expression of the FOXP4 gene by real-time PCR and Western blotting in a cell line in which FOXP4 was introduced into the human endometrial cancer cell line HEC59. [Figure 17] FIG. 1 is a characteristic diagram showing the results of measuring the cell proliferation ability of FOXP4(+) HEC59 cells and HEC59 cells by WST-1 assay. [Figure 18] FIG. 1 is a characteristic diagram showing the results of measuring the colony-forming ability of FOXP4(+) HEC59 cells and HEC59 cells by colony formation assay. [Figure 19] FIG. 1 is a characteristic diagram showing the results of observing tumor formation in a xenograft model prepared by subcutaneously transplanting FOXP4(+) HEC59 cells or HEC59 cells into nude mice. [Figure 20] FIG. 1 is a characteristic diagram showing the results of confirming FOXP4 expression by Western blotting in a cell line created by overexpressing mouse FOXP4 in mouse endometrial cancer cells. [Figure 21] FIG. 1 is a characteristic diagram showing the results of observing tumor formation in an allograft model in which a cell line in which mouse FOXP4 is overexpressed is transplanted into mouse endometrial cancer cells. [Figure 22] FIG. 2 is a characteristic diagram showing the results of confirming the expression of FOXP4 gene by real-time PCR and Western blotting when the FOXP4 gene was knocked down using shRNA2 to 4 in the human endometrioid cancer cell line HEC50B. [Diagram 23] FIG. 1 is a characteristic diagram showing the results of measuring the cell proliferation ability by WST-1 assay for the human endometrioid cancer cell line HEC50B in which the FOXP4 gene was knocked down using shRNA2 to 4. [Figure 24] FIG. 1 is a characteristic diagram showing the results of measuring the wound-healing ability by scratch assay for the human endometrioid cancer cell line HEC50B in which the FOXP4 gene was knocked down using shRNA2 to 4. [Diagram 25]FIG. 1 is a characteristic diagram showing the results of measuring the colony-forming ability by colony formation assay for the human endometrioid cancer cell line HEC50B in which the FOXP4 gene was knocked down using shRNA2 to 4. [Figure 26] This is a characteristic diagram showing the results of observing tumor formation in a xenograft model in which the human endometrial cancer cell line HEC50B, in which the FOXP4 gene was knocked down using shRNA2 to 4, was subcutaneously transplanted into nude mice. [Figure 27] FIG. 1 is a characteristic diagram showing the results of Western blotting to confirm the expression of FOXP4 gene in mouse endometrial cancer cell lines prepared by knocking down mouse FOXP4 with two types of shRNA. [Figure 28] This is a characteristic diagram showing the results of observing tumor formation in an allograft model prepared by subcutaneously implanting a mouse endometrial cancer cell line in which mouse FOXP4 was knocked down with shRNA into C57BL / 6 mice. [Figure 29] FIG. 1 is a characteristic diagram showing postoperative disease-free survival rates of endometrioid cancer patients according to FOXP4 expression level. [Diagram 30] FIG. 1 is a characteristic diagram showing the postoperative disease-free survival rate of endometrioid cancer patients according to FOXP4 expression and androgen receptor expression. [Diagram 31] This is a characteristic diagram plotting the presence or absence of postoperative recurrence in uterine endometrioid cancer patients and the expression levels of FOXP4 and AR as a correlation diagram. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The uterine body cancer treatment agent according to the present invention contains as an active ingredient a ligand or agonist for androgen receptor. Uterine body cancer is also called endometrial cancer, and includes the most frequent endometrioid cancer, serous cancer, clear cell carcinoma, mucinous cancer, squamous cell carcinoma, mixed cancer, and undifferentiated cancer. In particular, endometrioid cancer is classified into endometrioid cancer (uterine endometrioid cancer) that shows a morphology similar to normal endometrial glands, and endometrioid cancer (endometrioid cancer accompanied by differentiation into squamous epithelium) that shows a benign or malignant morphology and is locally observed. In addition, uterine endometrioid cancer is classified into grades 1 to 3 according to the morphology of the adenocarcinoma component. Grade 1 is when solid proliferation accounts for 5% or less of the adenocarcinoma component, Grade 2 is when solid proliferation accounts for 6-50% of the adenocarcinoma component or when the proportion of solid proliferation is 5% or less but with significantly strong cellular atypia, and Grade 3 is when solid proliferation accounts for more than 50% or when the proportion of solid proliferation is 6-50% but with significantly strong cellular atypia.

[0012] The uterine body cancer therapeutic agent according to the present invention can be used to treat all of the above-mentioned uterine body cancers. In particular, the uterine body cancer therapeutic agent according to the present invention is preferably used to treat endometrial cancer. Thus, the uterine body cancer therapeutic agent according to the present invention has an effect of improving and treating uterine body cancer. Therefore, the uterine body cancer therapeutic agent according to the present invention can be used as a pharmaceutical composition for treating uterine body cancer.

[0013] That is, according to the present invention, it is possible to provide a pharmaceutical composition for treating uterine body cancer, which contains as an active ingredient a ligand or agonist for the androgen receptor.

[0014] Incidentally, JP 2020-071205 A discloses that among patients with uterine endometrioid carcinoma, cases with high FOXP4 expression have a significantly higher incidence of lymph node metastasis and postoperative recurrence than cases with low FOXP4 expression, that FOXP4 protein expression has been identified as an independent predictor of lymph node metastasis and postoperative recurrence in uterine endometrioid carcinoma, and that FOXP4 is a factor that induces malignant progression in uterine endometrioid carcinoma.

[0015] Information on the amino acid sequence of human FOXP4 protein can be obtained from the database managed by the National Center for Biotechnology Information (NCBI) under GenBank: AAH52803. Similarly, the nucleotide sequence of the gene encoding human FOXP4 protein can be obtained under Gene ID: 116113. Information on the amino acid sequence of FOXP4 protein in non-human mammals and the nucleotide sequence of the gene encoding it can also be obtained in a similar manner.

[0016] The therapeutic agent for uterine body cancer according to the present invention can suppress the expression of FOXP4 gene, which is deeply involved in uterine body cancer. That is, the therapeutic agent for uterine body cancer according to the present invention has an action effect of suppressing the expression of FOXP4 gene in uterine body cancer lesions and promoting the differentiation of highly undifferentiated immature cells.

[0017] (Ligand or agonist for androgen receptor) One aspect of the present invention is a therapeutic agent for uterine cancer, the active ingredient of which is a ligand or agonist for androgen receptor. Examples of the ligand for androgen receptor include testosterone and dihydrotestosterone. The agonist for androgen receptor is a substance that interacts with the androgen receptor and exhibits the same function as testosterone and dihydrotestosterone. The agonist for androgen receptor can be a substance generally known as an androgen receptor agonist.

[0018] Androgen receptor agonists include anabolic steroids, methenolone, methenolone enanthate, methenolone acetate, prasterone, prasterone sulfate sodium hydrate, nandrolone, nandrolone decanoate, nandrolone phenylpropionate, nandrolone cyclohexylpropionate, nandrolone furylpropionate, nandrolone cyclotate, nandrolone laurate, boldenone, boldenone undecylenate, methandriol, methandriol dipropionate, trenbolone, trenbolone acetate, clostebol, clostebol acetate, methandienone, stanozolol, oxandrolone, Examples of such agents include oxymetholone, ethylnandrol, mestanolone, androstanolone, oxaborone cypionate, borandiol dipropionate, bolasterone, borenol, bormantalate, norbolethone, quinbolone, stenbolone acetate, norethandrolone, fluoxymesterone, methyltestosterone, testosterone cypionate, testosterone enanthate, testosterone propionate, testosterone ketolaurate, testosterone phenylacetate, testosterone undecanoate, testosterone decanoate, testosterone phenylpropionate, mesterolone, danazol, mibolerone and nisterim acetate.

[0019] The agonist for the androgen receptor is not limited to the specific androgen receptor agonist described above, and organic compounds (amino acids, polypeptides or derivatives thereof, low molecular weight compounds, sugars, high molecular weight compounds, etc.), inorganic compounds, etc. can be used. Such substances may be either natural or non-natural substances. Furthermore, such substances may be single compounds, but may also be compound libraries, expression products of gene libraries, cell extracts, cell culture supernatants, fermentation microbial products, marine organism extracts, plant extracts, etc.

[0020] Here, whether a certain substance has an agonistic effect on the androgen receptor can be confirmed based on, for example, the binding activity to the androgen receptor and whether the complex with the androgen receptor enhances the expression of androgen responsive genes. In addition, whether a certain substance having an agonistic effect on the androgen receptor has a therapeutic effect on uterine body cancer can be confirmed by contacting the substance with a human uterine body cancer cell line expressing the androgen receptor, measuring the proliferation of the cell line, and comparing it with the proliferation when the substance is not applied. In addition, the therapeutic effect on uterine body cancer can be confirmed by culturing a human uterine body cancer cell line expressing the androgen receptor until it becomes confluent, and comparing the wound healing ability with and without the substance by scratch assay. In addition, the therapeutic effect on uterine body cancer can also be confirmed by subcutaneously transplanting a human uterine body cancer cell line expressing the androgen receptor into ovariectomized nude mice and comparing the tumor formation with and without the substance.

[0021] Pharmaceutical Composition The content of the active ingredient contained in the pharmaceutical composition for treating uterine body cancer according to the present invention is not particularly limited. In general, the content varies depending on the type of active ingredient, the dosage form, and the type of solvent and carrier, which are other components described later. Therefore, it may be appropriately determined taking into account each condition. It is sufficient that an effective amount of the active ingredient is contained in a single application amount of the pharmaceutical composition for treating uterine body cancer. However, when it is necessary to administer a large amount of the pharmaceutical composition for treating uterine body cancer to a subject in order to obtain the pharmacological effect of the active ingredient, it can be administered in several divided doses to reduce the burden on the subject. In this case, the amount of the active ingredient may be an effective amount in total. The "effective amount" refers to an amount necessary to exert the function of the active ingredient and an amount that gives little or no harmful side effects to the subject to which it is applied. This effective amount may vary depending on various conditions such as the information of the subject, the application route, and the number of applications. Therefore, when the pharmaceutical composition for treating uterine body cancer is used as a medicine, the content of the active ingredient is ultimately determined by the judgment of a doctor or pharmacist.

[0022] As used herein, the term "subject" refers to an object to which the pharmaceutical composition for treating uterine body cancer is applied. For example, it is a cell (including cultured cell), a tissue, an organ, or an individual. In the case of an individual, it is preferably a human individual, and in this case, it is particularly referred to as a "subject". A subject who has developed uterine body cancer, i.e., a uterine body cancer patient, is particularly preferred.

[0023] In this specification, "subject information" refers to various information related to the characteristics and condition of a subject. For example, when the subject is a human individual, information includes age, weight, sex, general health condition, presence or absence of disease, progression or severity of disease, drug sensitivity, presence or absence of concomitant drugs, and resistance to treatment.

[0024] The pharmaceutical composition for treating uterine cancer according to the present invention may contain a pharma- ceutical acceptable solvent as necessary. The term "pharma-ceutical acceptable solvent" refers to a solvent commonly used in the field of formulation technology. Examples of the solvent include water or an aqueous solution, or an organic solvent. Examples of the aqueous solution include physiological saline, an isotonic solution containing glucose or other auxiliary agents, a phosphate buffer, and a sodium acetate buffer. Examples of the auxiliary agents include D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other low-concentration nonionic surfactants, polyoxyethylene sorbitan fatty acid esters, etc. Examples of the organic solvent include ethanol.

[0025] The pharmaceutical composition for treating uterine cancer of the present invention may contain a pharma- ceutical acceptable carrier as necessary. The term "pharma-ceutical acceptable carrier" refers to additives that are commonly used in the field of formulation technology. Examples of such additives include excipients, binders, disintegrants, fillers, emulsifiers, flow additive regulators, lubricants, human serum albumin, etc.

[0026] Excipients include, for example, sugars such as monosaccharides, disaccharides, cyclodextrins and polysaccharides, metallic salts, citric acid, tartaric acid, glycine, polyethylene glycol, pluronics, kaolin, silicic acid, or combinations thereof.

[0027] Binders include, for example, starch paste using vegetable starch, pectin, xanthan gum, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, paraffin, polyvinylpyrrolidone, or combinations thereof.

[0028] Disintegrants include, for example, the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium bicarbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearate monoglyceride, or salts thereof.

[0029] Examples of fillers include petrolatum, the aforementioned sugars and / or calcium phosphate.

[0030] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.

[0031] Examples of flow regulators and lubricants include silicates, talc, stearates or polyethylene glycol.

[0032] In addition to the above, if necessary, the composition may appropriately contain solubilizers, suspending agents, diluents, dispersing agents, surfactants, soothing agents, stabilizers, absorption promoters, bulking agents, moisturizing agents, humectants, adsorbents, flavorings, deodorants, disintegration inhibitors, coating agents, colorants, preservatives, antiseptics, antioxidants, fragrances, flavorings, sweeteners, buffers, isotonicity agents, and the like that are commonly used in pharmaceutical compositions.

[0033] Carriers are used to avoid or suppress decomposition of the active ingredient by enzymes and the like in the subject, as well as to facilitate formulation and administration methods and maintain the dosage form and pharmacological efficacy, and may be used appropriately as needed.

[0034] The dosage form of the pharmaceutical composition for treating uterine cancer according to the present invention is not particularly limited. It may be in any form that delivers the active ingredient to the target site without inactivating it in the body of the subject. The specific dosage form varies depending on the application method described below. The application method can be broadly divided into parenteral administration and oral administration, so the dosage form may be selected to suit each administration method.

[0035] For example, if the administration method is parenteral administration, the preferred dosage form is a liquid that can be administered directly to the target site or systemically via the circulatory system. The pharmaceutical composition for treating uterine cancer according to the present invention is preferably a vaginal preparation. A good example of a liquid preparation is an injection. The injection can be formulated by appropriately combining the solvent, the excipient, emulsifier, suspending agent, surfactant, stabilizer, pH regulator, etc., and mixing them in a unit dose form required for generally accepted pharmaceutical practice.

[0036] If the method of administration is oral administration, preferred dosage forms include solid agents (including tablets, capsules, drops, and lozenges), granules, powders, powders, and liquid agents (including oral waters, emulsions, and syrups). If the agent is a solid agent, it can be made into a dosage form with a coating known in the art, such as sugar-coated tablets, gelatin-coated tablets, enteric-coated tablets, film-coated tablets, double tablets, and multi-layer tablets, as necessary. EXAMPLES

[0037] The present invention will be specifically described with reference to the following examples, but the present invention is not limited to these examples.

[0038] [method] Measurement of serum dihydrotestosterone (DHT) levels DHT levels in serum collected from subjects were measured using a commercially available ELISA kit (Abnova, Dihydrotestosterone ELISA kit).

[0039] Immunostaining (human tissue) Human tissues were fixed in formalin, then paraffin-blocked, and 4 μm sections were prepared. After deparaffinization, antigen retrieval was performed at 121°C for 15 minutes using citrate buffer of pH 6 or pH 9. After incubation with 3% H2O2 for 10 minutes at room temperature, blocking was performed with animal serum matched to each antibody for 10 minutes at room temperature. After overnight incubation at 4°C with the primary antibody, the tissues were incubated with biotin-labeled IgG (secondary antibody) for 30 minutes at room temperature, and then with avidin-biotin complex (VECSTATIN ABC kit; Vector Laboratories, Burlingame, USA) for 30 minutes at room temperature. Diaminobenzidine (Liquid DAB+ Substrate Chromogen System; Dako, Carpinteria, USA) was used for color reaction. After hematoxylin staining, the tissues were dehydrated and mounted with Marinol. The antibodies used in this example are summarized in Table 1. In Table 1, AR represents an antibody against the androgen receptor, FOXP4 represents an antibody against FOXP4, a member of the forkhead box (Fox) transcription factor family, and Ki67 represents an antibody against Ki-67 protein (MKI67), a cell proliferation marker (proliferative cell marker).

[0040] [Table 1]

[0041] Immunostaining (mouse tissue) Mouse tissues were fixed in formalin, then paraffin-blocked, and 5 μm sections were prepared. After deparaffinization, antigen retrieval was performed at 121°C for 5 minutes using citrate buffer of pH 6. After incubation with 3% H2O2 for 10 minutes at room temperature, the tissues were blocked with saturated casein for 1 hour at room temperature. After incubation with the primary antibody overnight at 4°C, the tissues were incubated with biotin-labeled IgG (secondary antibody, Jackson ImmunoResearch, USA) for 40 minutes at room temperature, and then with avidin-biotin complex (Jackson ImmunoResearch, USA) for 20 minutes at room temperature. Diaminobenzidine (DAB tablet; Fujifilm Wako Pure Chemical Industries, Ltd. 040-27001, Japan) was used for the color reaction. After hematoxylin staining, the tissues were dehydrated and mounted with Paramount. The antibodies used in this example are summarized in Table 2. In Table 2, AR represents an antibody against the androgen receptor, CK8 represents an antibody against cytokeratin 8, FOXP4 represents an antibody against FOXP4, a member of the forkhead box (Fox) transcription factor family, and Ki67 represents an antibody against Ki-67 protein (MKI67), a cell proliferation marker (proliferative cell marker).

[0042] [Table 2]

[0043] RNA extraction, reverse transcription RNA was extracted using the RNeasy Mini Kit (QIAGEN) or Trizol (ThermoFisher). After treatment with DNase, reverse transcription was performed using SuperScript II (Invitrogen).

[0044] qPCR Quantitative PCR (qPCR) of the FOXP4 gene was performed using Brilliant III Ultra-Fast SYBR, Green QPCR Master Mix (Agilent). GAPDH was used as the housekeeping gene. qPCR was performed for 40 cycles using the primer set shown in Table 3, and 2-ΔΔCt was used for analysis.

[0045] [Table 3]

[0046] Western Blotting First, a protein lysate was prepared using Ripa buffer, a buffer for protein extraction containing a surfactant. After electrophoresis of proteins on a 6-12% SDS-PAGE gel, the proteins were transferred to a PVDF membrane and blocked with 10% skim milk at room temperature for 60 minutes. The membrane was incubated overnight at 4°C with a primary antibody diluted to an optimal concentration with 1% skim milk / TBST, and then incubated with a secondary antibody diluted to an optimal concentration with 1% skim milk / TBST at room temperature for 60 minutes. Coloring was performed using ECL Western Blotting Analysis. The antibodies used in this example are summarized in Table 4. In Table 4, AR indicates an antibody against the androgen receptor, FOXP4 indicates an antibody against FOXP4, which is one of the forkhead box (Fox) transcription factor family, and β-actin indicates an antibody against β-actin, an endogenous control.

[0047] [Table 4]

[0048] ·Cell culture The human uterine cancer cell lines used were HEC50B, HEC59, HEC265, and HE108, the human prostate cancer cell line LNCaP, and the mouse uterine cancer cell line PPP268. Each cell line was maintained in a 5% CO2, 37°C incubator. The human uterine cancer cell lines were used in E-MEM with L-Glutamine and Phenol Red (FUJIFILM) supplemented with 10% Fetal Bovine Serum. When using DHT, D-MEM / Ham's F-12 with L-Glutamine and Sodium Pyruvate (FUJIFILM) supplemented with 5% Charcoal Stripped Fetal Bovine Serum was used. PPP268 was used in DMEM / Ham's F12 with L-Glutamine and Phenol Red (FUJIFILM) supplemented with 10% Fetal Bovine Serum. For LNCaP, RPMI1640 (Nacalai Tesque, Inc.) was used with 5% Fetal Bovine Serum added.

[0049] The cell lines overexpressing AR were established by transfecting a plasmid carrying hAR downstream of the CAG promoter into human cell lines and treating them with puromycin for one week. The cell lines overexpressing FOXP4 were established by transfecting a plasmid carrying hFOXP4 downstream of the CAG promoter into human cell lines and a plasmid carrying mFOXP4 into mouse cell lines and treating them with puromycin for one week.

[0050] FOXP4 knockdown in human cells was performed by expressing three types of anti-hFOXP4 shRNAs using lentivirus. In this example, the three types of anti-hFOXP4 shRNAs used were FOXP4-shRNA2-4: TRCN0000274833, TRCN0000274834, and TRCN0000274832 from MISSION. As a control, NC-shRNA: SHC202V was used. Lentivirus was purchased from Sigma-Aldrich.

[0051] In addition, FOXP4 knockdown in mouse cells was performed by designing two types of anti-mFOXP4 shRNA sequences and expressing them in cells using a plasmid. The two types of anti-mFOXP4 shRNA designed in this example are shRNA1: AAAAGCAGGAGAAGTAATGACAAATTTGGATCCAAATTTGTCATTACTTCTCCTGC (SEQ ID NO: 5) and shRNA2: AAAAGCTGACGCTAAATGAGATTTATTGGATCCAATAAATCTCATTTAGCGTCAGC (SEQ ID NO: 6). In addition, AAAAGCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC (SEQ ID NO: 7) was designed as a control. Both were established by treating with puromycin for one week. The 3.2 kbp coding region of FOXP4 was deleted by introducing the pX330-gRNA plasmid.

[0052] Cell proliferation assay (WST-1 assay) Cells were seeded in a 96-well plate so that they would be 30-40% confluent after 12-24 hours, and cultured in an environment of 5% CO2 and 37°C. 12-24 hours after seeding, the cells were confirmed to be 30-40% confluent, and Cell Proliferation Reagent WST-1 (Roche) was added at 10 μL / well and incubated at 37°C for 60 minutes. The absorbance of each well was then measured at 450 nm and 620 nm using a microplate reader. When DHT was administered, DHT or DMSO was added and the medium was replaced every 24 hours from the first absorbance measurement, and the absorbance was measured until the 96th hour. 96-well plates were prepared under the same conditions according to the number of measurements, and the absorbance was measured in the same manner.

[0053] Scratch assay Cells were seeded in a 24-well plate and cultured to reach 70% confluency after 12 to 24 hours. After confirming that the cells had reached 70% confluency after 12 to 24 hours, they were scratched using an SPL Scar Scratcher (SPL Lifescience). The cells were washed twice with PBS to remove detached cells, and photographed after adding medium. When DHT was administered, the medium was replaced every 24 hours after scratching by adding DHT or DMSO. After that, photographs were taken at scheduled intervals while replacing the medium as appropriate. The scratched area was measured using ImageJ and evaluated on the photographs.

[0054] Colony formation assay Bacto agar (Bacto Agar, BD) and Noble agar (Difco Agar Noble, BD) were prepared in advance. 1.25 g of Bacto agar was added to 25 mL of ultrapure water and dissolved by boiling in a microwave oven. 0.875 g of Noble agar was added to 25 mL of ultrapure water and dissolved in the same manner. After that, it was sterilized in an autoclave at 121°C for 20 minutes, and if it was to be used immediately, it was kept at 45°C. If it was not to be used immediately, it was stored at 4°C. The medium to be used was also kept at 45°C. The medium and the prepared Bacto agar were mixed in a ratio of 9:1 to make base agar, and 3 mL was added per well to a 6-well plate. The plate was left at room temperature for more than 30 minutes with the lid open to allow the agar to solidify. The air in the clean bench was turned off so that the gel would be flat. While the base agar was solidifying, the prepared cells were adjusted to 1000-3000 cells / 100μL per well and dropped onto the solidified base agar. Then, the medium and the adjusted noble agar were mixed in a ratio of 9:1 to prepare soft agar, which was poured at 2mL per well over the cells, and the plate was left in an air-tight clean bench with the lid open for 10 minutes to solidify the soft agar. After the agar solidified, it was incubated at 37℃ with 5% CO2, and photographed after 14 days. When DHT was administered or DMSO was administered as a control, the same procedure was followed except that DHT or DMSO was mixed when preparing the base agar and soft agar.

[0055] Xenograft and allograft models For xenotransplantation, 7-week-old Balb / c nu / nu females were allowed to acclimate to the cage for 1 week. One week after entering the cage, when the females were 8 weeks old, 1 × 10 human endometrial cancer cells were implanted. 8The cells were adjusted to 1 × 10 cells / mL and 100 μL per site was administered subcutaneously on both sides of the back of the mouse. For DHT administration, 6-week-old Balb / c nu / nu females were allowed to acclimate to the cage for 1 week, and 1 week after admission, and at 7 weeks of age, the ovaries were removed. At 8 weeks of age, 100 μL of human uterine cancer cells prepared in the same manner were administered subcutaneously on both sides of the back of the mouse. In addition, 1 cm silicon tubes filled with DHT or empty ones were inserted subcutaneously in the midline of the back as controls. For allografts, 7-week-old C57BL / 6 females were allowed to acclimate to the cage for 1 week. One week after admission, at 8 weeks of age, mouse uterine cancer cells were administered subcutaneously at 1 × 10 8 The solution was adjusted to cells / mL and 100μL was administered subcutaneously to each site on both sides of the back of the mouse. Isoflurane for animal experiments was used for anesthesia. The long and short diameters of the tumor were measured every 5 days. Tumor volume was calculated as 0.5 x short diameter x long diameter x long diameter. All samples were removed just before the tumors spontaneously disintegrated.

[0056] Pten-PRcre and Pten / AR-PRcre mice Female Ptenff / PRcre / +, Ptenff / ARff / PRcre / +, or Ptenff / PR+ / + (control) mice were ovariectomized at 6 weeks of age, and a 1 cm silicon tube filled with DHT or an empty tube was inserted subcutaneously as a control. The uteri were collected 30 days after ovariectomy.

[0057] [result] Androgen receptor (AR) and serum dihydrotestosterone (DHT) levels are associated with clinical outcome and histological grade in endometrioid carcinoma. In human clinical samples, we found that low expression of AR was associated with a decreased postoperative disease-free survival rate in patients with endometrioid cancer (Figure 1). In addition, in serum samples from endometrioid cancer patients, DHT levels were lower in Grade 3 patients compared to Grade 1 (Figure 2, Grade 1: n=38, Grade 2: n=29, Grade 3: n=4), and lower in patients with recurrence compared to patients without recurrence (Figure 3, in the figure, "w / o" means no recurrence, "w / " means recurrence. "w / o": n=63, "w / ": n=8). From the results shown in Figures 1 to 3, it became clear that serum DHT levels are associated with the progression of endometrioid cancer.

[0058] DHT-AR inhibits proliferation, wound healing, colony formation and tumor growth of AR-transfected human endometrioid carcinoma cells. AR expression was not detectable in some human endometrial cancer cells (HEC50B, HEC59, HEC108, and HEC265) (Fig. 4). Therefore, we created a cell line (AR_HEC50B) by introducing AR into HEC50B (Fig. 5).

[0059] As a result of cell proliferation measurement (WST-1 assay), administration of DHT to the prepared AR_HEC50B cells significantly reduced cell proliferation at 72 and 96 hours after administration (Figure 6). Furthermore, as a result of scratch assay, administration of DHT to AR_HEC50B cells delayed wound healing (Figures 7(A) and (B)). Figure 7(A) shows photographs taken immediately, 24 hours, and 48 hours after scratch treatment, and the scratched wound area is within the dashed line. Furthermore, Figure 7(B) shows the ratio of the area of ​​the wound area immediately after scratch treatment over time. Furthermore, as a result of colony formation assay, administration of DHT to the prepared AR_HEC50B cells reduced colony formation ability (Figures 8(A) and (B)). Figure 8(A) shows a photograph taken 14 days after the start of the assay, and Figure 8(B) shows the results of measuring the number of colonies. Furthermore, when the AR_HEC50B cells were subcutaneously transplanted into ovariectomized nude mice (xenograft model), tumor formation was suppressed by administration of DHT (Figures 9(A) and (B)). Figure 9(A) is a photograph taken 20 days after cell transplantation, and Figure 9(B) shows the results of measuring the tumor volume.

[0060] DHT-AR reduces cancer growth in Pten-PRcre mice, a spontaneous model of endometrial cancer. Pten-PRcre mice, which lack the Pten gene in the entire uterus, including the uterine epithelium and stroma, are known as a mouse model of spontaneous endometrioid cancer. Administration of DHT after ovariectomy to these Pten-PRcre mice reduced the growth of endometrioid cancer. In contrast, administration of DHT after ovariectomy to Pten / AR-PRcre mice, which lack both the Pten and AR genes, had no significant effect on endometrioid growth (Figure 10). These findings indicate that DHT suppresses the progression of endometrioid cancer via the AR system.

[0061] · FOXP4 is a downstream target of the DHT-AR pathway in endometrioid carcinoma. In Japanese Patent Application No. 2022-77615, it is disclosed that the downstream target of the DHT-AR pathway in cervical dysplasia cells is forkhead box transcription factor P4 (FOXP4). Therefore, when DHT was administered to AR_HEC50B cells and chip-sequencing was performed, it was revealed that AR-DHT binds to intron 1 of the hFOXP4 coding region (results not shown). In addition, FOXP4 was confirmed to be expressed in human uterine body cancer cells, HEC50B, HEC108 and HEC265 (Figure 11).

[0062] In addition, the expression of FOXP4 gene when DHT was administered to AR_HEC50B cells was confirmed by real-time PCR and Western blot. As a result, it was found that the expression of FOXP4 gene was decreased at the mRNA level and protein level by the administration of DHT (Figures 12(A) and (B)). Figure 12(A) shows the result of confirming the expression of FOXP4 gene at the mRNA level by real-time PCR, and Figure 12(B) shows the result of confirming the expression of FOXP4 gene at the protein level by Western blot.

[0063] Furthermore, FOXP4 was also expressed in the uterus of Pten-PRcre mice that spontaneously develop endometrioid carcinoma, but its expression was reduced by administration of DHT after ovariectomy (Figure 13). In contrast, in Pten / AR-PRcre mice lacking both the Pten and AR genes, no reduction in FOXP4 expression was observed even when DHT was administered after ovariectomy (Figure 13).

[0064] Furthermore, using the CRISPR-Cas9 system, we created mutants in which the 3.2 kbp in intron 1 of the hFOXP4 coding region, to which AR-DHT binds, was deleted in HEC50B and AR_HEC50B. PCR was performed using the genomic DNA of the created mutants, and it was confirmed that the target 3.2 kbp of the hFOXP4 coding region was deleted in the cells into which gRNA was introduced (Figure 14). We then confirmed the expression of the FOXP4 gene when DHT was administered to the created mutants by real-time PCR, and found that when the hFOXP4 coding region 3.2 kbp was deleted, FOXP4 expression did not decrease even when DHT was administered (Figure 15). This result indicates that AR-DHT directly binds to the hFOXP4 coding region and controls its expression.

[0065] Overexpression of FOXP4 promotes proliferation and colony formation of endometrial cancer cells and tumor growth. As shown in FIG. 11, a cell line was created by introducing FOXP4 into the human endometrial cancer cell line HEC59, which has very low FOXP4 expression. The expression of the FOXP4 gene in the created cell line was confirmed by real-time PCR and Western blot (FIGS. 16(A) and (B)). FIG. 16(A) shows the results of confirming the expression of the FOXP4 gene at the mRNA level by real-time PCR, and FIG. 16(B) shows the results of confirming the expression of the FOXP4 gene at the protein level by Western blot. Then, FOXP4(+)HEC59 cells were compared with HEC59 cells in a cell proliferation assay (WST-1 assay) and a colony formation assay. As a result, FOXP4(+)HEC59 cells had increased cell proliferation ability (FIG. 17) and increased colony formation ability (FIG. 18) compared with HEC59 cells with low FOXP4 gene expression.

[0066] Next, we created a xenograft model in which FOXP4(+)HEC59 cells and HEC59 cells were subcutaneously transplanted into nude mice, and observed tumor formation. As a result, tumor formation was promoted when FOXP4(+)HEC59 cells were transplanted compared to when HEC59 cells were transplanted (Figure 19).

[0067] Next, we created a cell line by overexpressing FOXP4 in mouse endometrioid cancer cells (cells lacking Pten and p53) established from C57BL / 6 mice (Figure 20). We created an allograft model in which the cell line and the original mouse endometrioid cancer cells were subcutaneously transplanted into C57BL / 6 mice, and observed tumor formation. As a result, tumor formation was promoted when mouse endometrioid cancer cells overexpressing FOXP4 were transplanted compared to when the original mouse endometrioid cancer cells were transplanted (Figures 21(A) and (B)).

[0068] ·Knockdown of FOXP4 inhibits wound healing, colony formation, and tumor growth in endometrioid cancer cells. The FOXP4 gene was knocked down in the human endometrioid cancer cell line HEC50B using three types of anti-hFOXP4 shRNA (shRNA2-4) (Figures 22(A) and (B)). Figure 22(A) shows the results of confirming the expression of the FOXP4 gene at the mRNA level by real-time PCR, and Figure 22(B) shows the results of confirming the expression of the FOXP4 gene at the protein level by Western blotting. As a result of cell proliferation measurement (WST-1 assay), the cell proliferation ability of the cell lines in which FOXP4 was knocked down using the three types of shRNA was comparable to that of the control (Figure 23).

[0069] On the other hand, the results of the scratch assay showed that the cell line in which FOXP4 was knocked down by three types of shRNA showed delayed wound healing compared to the control (Figures 24(A) and (B)). Figure 24(A) shows photographs taken immediately after scratching, 24 hours, and 48 hours after scratching, and the scratched wound area is within the dashed line. Figure 24(B) shows the ratio of the area of ​​the wound area immediately after scratching over time. Furthermore, the results of the colony formation assay showed that the cell line in which FOXP4 was knocked down by three types of shRNA showed reduced colony formation ability compared to the control (Figures 25(A) and (B)). Figure 25(A) shows a photograph taken 14 days after the start of the assay, and Figure 25(B) shows the results of measuring the number of colonies. Furthermore, when the cell lines in which hFOXP4 was knocked down by three types of shRNA were subcutaneously transplanted into nude mice (xenograft model), the tumor formation of the cell lines was significantly lower than that of the control (Figures 26(A) and (B)). Figure 26(A) is a photograph taken 20 days after cell transplantation, and Figure 26(B) shows the results of measuring the tumor volume.

[0070] In addition, mouse endometrioid cancer cells (cells lacking Pten and p53) established from C57BL / 6 mice were used to create cell lines in which mouse FOXP4 was knocked down with two types of shRNA (Figure 27). The cell lines created and a cell line in which shRNA against LacZ was introduced for comparison were subcutaneously transplanted into C57BL / 6 mice to create allograft models, and tumor formation was observed. As a result, tumor formation was suppressed when mouse endometrioid cancer cells in which FOXP4 was knocked down were transplanted compared to when mouse endometrioid cancer cells in which shRNA against LacZ was introduced as a control were transplanted (Figures 28(A) and (B)).

[0071] · AR and FOXP4 expression is associated with clinical outcome in endometrioid carcinoma. In human clinical samples, high FOXP4 expression was associated with a decreased postoperative disease-free survival rate in endometrioid cancer patients (Figure 29). In addition, when FOXP4 expression and AR expression were taken into consideration together, low AR expression and high FOXP4 expression were associated with the lowest postoperative disease-free survival rate in endometrioid cancer patients (Figure 30). In addition, a correlation diagram was plotted between the presence or absence of postoperative recurrence in endometrioid cancer patients and the expression levels of FOXP4 and AR, and the expression of FOXP4 was inversely correlated with the expression of AR (Figure 31).

[0072] [Summary of the Examples] The results of this experiment indicate that DHT attenuates FOXP4 expression in uterine cancer cells and inhibits the proliferation, migration, and growth of uterine cancer cells. These results indicate that AR ligand or agonist action can inhibit the onset and progression of endometrial cancer, that is, AR ligand or agonist may be effective as a preventive, therapeutic, or improving agent for uterine cancer.

Claims

1. A therapeutic agent for uterine cancer, the active ingredient of which is a ligand or agonist for the androgen receptor.

2. 2. The therapeutic agent for uterine body cancer according to claim 1, wherein the agonist is dihydrotestosterone.

3. 2. The therapeutic agent for uterine body cancer according to claim 1, characterized in that the therapeutic target is uterine endometrioid adenocarcinoma.

Images