Method for target specific RNA transcription of DNA sequences

Abstract

To provide methods for identifying somatic mobile genetic elements in tumors.SOLUTION: Provided is a method including: (i) directing insertion of CAS9 and a guide RNA comprising the target nucleic acid sequence, and the target nucleic acid sequence into a genomic DNA sample obtained from a cell derived from a tumor, the target nucleic acid sequence comprising a promoter for a sequence of the somatic mobile element in the genomic DNA sample from the cell derived from a tumor; (ii) transcribing a nucleic acid sequence downstream of the promoter with an RNA polymerase to produce an RNA transcript; (iii) reverse transcribing the RNA transcript to produce a cDNA; and (iv) sequencing the cDNA, the RNA transcript being one kilobase or more in length.SELECTED DRAWING: Figure 5

Description

[Technical field]

[0001] <Related Applications> This application claims the benefit of U.S. Provisional Patent Application No. 62 / 294,875, filed February 12, 2016, the contents of which are incorporated by reference in their entirety. [Background technology]

[0002] The disclosure herein relates to the field of molecular biology, such as the amplification and identification of nucleic acid sequences that are flanked by repetitive sequences in a nucleic acid sample.

[0003] PCR, or a variation of the PCR technique together with hybrid capture, is the predominant method of targeted sequencing. Despite being widely used, both have limitations for long-read sequencers. Hybrid capture uses short RNA or DNA probes with biotin to hybridize to target DNA and "pull down" the sequence of interest. For long target sequences, this method is inefficient because many oligonucleotide probes are required and the process frequently results in physical shearing of long DNA molecules during the pull-down process. Such shortcomings limit the read length of adjacent sequencers using single-molecule techniques.

[0004] Long-range PCR is used as an alternative but also brings difficulties. Long-range PCR is difficult to multiplex. Frequently, the need for opposing PCR primers on opposing strands outside the target region eliminates the ability to detect large chromosomal events such as translocations. In addition, the clonal amplification of PCR limits the sensitivity to detect low-frequency somatic alterations in heterogeneous samples such as tumors, and can propagate polymerase errors such as point mutations or translocations from early cycles of the reaction. Furthermore, long-range PCR sometimes exhibits template switching that creates errors in the amplification products. Summary of the Invention

[0005] Advances in genome sequencing technology have greatly increased our understanding of human genetic variation and its contribution to disease. Short-read DNA sequencing technologies (Illumina, Thermo Fisher, Qiagen) generate billions of short reads that result in routine identification of single nucleotide polymorphisms and small insertions and deletions. These short-read sequencing technologies have not demonstrated the sensitivity to detect more complex changes such as large chromosomal rearrangements, translocations, and mobile element rearrangements. Long-read sequencing technologies (Pacific Biosciences, Oxford Nanopore) have demonstrated the ability to generate single molecule read lengths in excess of 10,000 base pairs, but do not have the capacity to sequence and assemble the complete human genome. The targeting strategies disclosed herein take advantage of these longer read lengths.

[0006] Here, we describe long-range target-specific amplification, where only the original template is amplified, resulting in an increase in the copy of the original target sequence relative to the sample DNA sequence. The amplified product is derived directly from the sample template, not from the synthesized amplification intermediate or from a previously synthesized copy of the sample template. As a result, the synthesized copy does not incorporate errors from previous synthesis reactions. This dramatically reduces the possibility that initial errors can be differentially amplified during the reaction. Since the synthesis product does not serve as a template, any errors in synthesis are independently derived and will likely not be consistent from one molecule to the next. Thus, by comparing the synthesized products, errors in synthesis can be easily identified and sample sequences can be more easily derived.

[0007] The disclosed subject matter is summarized in part in the recitation of the claims that accompany this disclosure.

[0008] Provided herein are methods for determining sequences flanking a region of a known sequence of a nucleic acid molecule. Some such methods include a) attaching a nucleic acid fragment comprising a promoter sequence at the known region of the nucleic acid molecule; b) contacting the nucleic acid fragment with an RNA polymerase directed by the promoter; and c) synthesizing a plurality of RNA molecules; where a consensus sequence of the plurality of RNA molecules represents a sequence flanking the known region of the nucleic acid molecule. Optionally, the consensus sequence is at least 10 kilobases in length. Sometimes, the method includes treating the nucleic acid molecule with DNase after synthesis of the plurality of RNA molecules. Alternatively or in combination, the method includes reverse transcribing the plurality of RNA molecules. Sometimes, the method includes determining the nucleic acid sequence of the plurality of RNA molecules. Optionally, the consensus sequence of the plurality of RNA molecules comprises a sequence of a molecule synthesized directly from the nucleic acid molecule. Alternatively or in combination, the attaching step includes inserting a nucleic acid fragment comprising a promoter sequence at the known region of the nucleic acid molecule. Optionally, the attaching step includes inserting a nucleic acid fragment comprising a promoter sequence at the region of the known sequence of the nucleic acid molecule. Optionally, the attaching step includes sequence-specific cleavage at the region of the known sequence of the nucleic acid molecule. Alternatively or in combination, the attaching step includes contacting the known region of the nucleic acid molecule with a CRISPR nucleic acid protein complex. Optionally, the CRISPR nucleic acid protein complex includes a guide RNA comprising SEQ ID NO:3. Optionally, the attaching step includes ligating a nucleic acid fragment comprising a promoter sequence. Sometimes, the nucleic acid fragment comprising a promoter sequence includes a viral promoter. Optionally, the viral promoter binds viral RNA polymerase and is at least one promoter selected from the list consisting of T7, T3, T7lac, SP6, pL, CMV, SV40, and CaMV35S. Alternatively or in combination, the nucleic acid fragment comprising a promoter sequence includes a bacterial promoter. Optionally, the bacterial promoter binds bacterial RNA polymerase and is at least one promoter selected from the list consisting of araBAD, trp, lac, and Ptac.Sometimes, the nucleic acid fragment comprising a promoter sequence comprises a eukaryotic promoter. Optionally, the eukaryotic promoter binds a eukaryotic RNA polymerase and is at least one promoter selected from the list consisting of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Alternatively or in combination, the eukaryotic promoter is at least one promoter selected from the list consisting of an RNA pol I promoter, an RNA pol II promoter, and an RNA pol III promoter. Optionally, the known region of the nucleic acid molecule comprises a repetitive element. In some cases, the repetitive element comprises a mobile insertion element. Sometimes, the repetitive element comprises at least one of a LINE element, a SINE element, an Alu repeat, a transposon, a retrotransposon, a centromeric repeat, and a telomeric repeat. Alternatively or in combination, the LINE element comprises SEQ ID NO:1.

[0009] In an additional embodiment, a method is provided for determining sequences flanking a plurality of loci of an element in a nucleic acid sample, the method comprising: a) inserting a nucleic acid comprising a promoter into the element; b) generating a plurality of nucleic acid molecules oriented by the promoter; and c) determining the sequence of the plurality of nucleic acid molecules, where the nucleic acid molecules are synthesized directly from the nucleic acid sample, and the plurality of nucleic acid molecules span sequences flanking the loci. Optionally, the nucleic acid molecules comprise RNA. Optionally, the nucleic acid molecules are not capable of stimulating nucleic acid synthesis. Sometimes, the nucleic acid sample comprises cancer cell nucleic acid. Optionally, the nucleic acid sample comprises a single nuclear genome. Frequently, the nucleic acid sample is obtained from a single cell. Optionally, the method comprises treating the nucleic acid sample with DNase after synthesis of the plurality of RNA molecules. Sometimes, the method comprises reverse transcribing the plurality of RNA molecules. Optionally, the plurality of nucleic acid molecules are RNA molecules. Sometimes, the consensus sequence of the plurality of RNA molecules comprises the sequence of the molecules synthesized directly from the nucleic acid molecules. Optionally, the attaching comprises inserting a nucleic acid fragment comprising a promoter sequence at a known region of the nucleic acid molecule. Optionally, the attaching step includes inserting a nucleic acid fragment comprising a promoter sequence at the known region of the nucleic acid molecule. Sometimes, the attaching step includes sequence-specific cleavage of the known region of the nucleic acid molecule. Optionally, the attaching step includes contacting the known region of the nucleic acid molecule with a CRISPR nucleic acid protein complex. Optionally, the CRISPR nucleic acid protein complex includes a guide RNA comprising SEQ ID NO:3. Sometimes, the attaching step includes ligating a nucleic acid fragment comprising a promoter sequence. Optionally, the nucleic acid fragment comprising a promoter sequence includes a viral promoter. The viral promoter is variously at least one promoter selected from the list consisting of T7, T3, T7lac, SP6, pL, CMV, SV40, and CaMV35S. Sometimes, the nucleic acid fragment comprising a promoter sequence includes a bacterial promoter. Optionally, the bacterial promoter is at least one promoter selected from the list consisting of araBAD, trp, lac, and Ptac. Optionally, the nucleic acid fragment comprising a promoter sequence includes a eukaryotic promoter.For example, sometimes the eukaryotic promoter is at least one promoter selected from the list consisting of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Optionally, the eukaryotic promoter is at least one promoter selected from the list consisting of RNA pol I promoter, RNA pol II promoter, and RNA pol III promoter. Sometimes, the known region of the nucleic acid molecule comprises a repetitive element. Some repetitive elements comprise mobile insertion elements. In some cases, the repetitive element comprises at least one of a LINE element, a SINE element, an Alu repeat, a transposon, a retrotransposon, a centromeric repeat, and a telomeric repeat. Optionally, the LINE element comprises SEQ ID NO:1.

[0010] Also provided herein, in some embodiments, is a nucleic acid library comprising nucleic acids encoding sequences adjacent to the boundaries of repeated mobile elements in a nucleic acid sample over at least 90% of the boundaries. Sometimes, mismatches between library members and nucleic acid samples are independently derived. Optionally, at least 50% of the boundaries of the repeated elements are present in at least 100 copies. Optionally, library members are derived directly from nucleic acid samples. Alternatively or in combination, library members are not clonally amplified prior to sequencing. Optionally, nucleic acid samples are derived from single cells. Sometimes, nucleic acid libraries are reverse transcribed from RNA intermediates. Optionally, nucleic acid libraries include RNA. Optionally, nucleic acid library members include promoter sequences. Optionally, the RNA promoter sequence comprises at least one of T7, T3, T7lac, SP6, pL, CMV, SV40, CaMV35S, araBAD, trp, lac, Ptac, EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Optionally, at least one border flanking represents a deficiency in a gene associated with at least one of cell cycle regulation, DNA repair, and growth regulation. Optionally, the nucleic acid library comprises nucleic acids encoding sequences flanking the borders across at least 95% of the boundaries of the mobile elements repeated in the nucleic acid sample. Optionally, the nucleic acid library comprises nucleic acids encoding sequences flanking the borders across at least 99% of the boundaries of the mobile elements repeated in the nucleic acid sample. Alternatively or in combination, at least 50% of the nucleic acids of the library members are located on the nucleic acid within 20 kb of the boundary of the mobile element. In some cases, at least 75% of the nucleic acids of the library members are located on the nucleic acid within 20 kb of the boundary of the mobile element proximate to the boundary of the mobile element. Optionally, at least 90% of the nucleic acids of the library members are located on the nucleic acid within 20 kb of the boundary of the mobile element.Sometimes, at least 50% of the nucleic acids of the library members are located on the nucleic acid within 10 kb of the boundary of the mobile element. Sometimes, at least 75% of the nucleic acids of the library members are located on the nucleic acid within 10 kb of the boundary of the mobile element adjacent to the boundary of the mobile element. Sometimes, at least 90% of the nucleic acids of the library members are located on the nucleic acid within 10 kb of the boundary of the mobile element. Optionally, at least 50% of the nucleic acids of the library members are located on the nucleic acid within 5 kb of the boundary of the mobile element. Sometimes, at least 75% of the nucleic acids of the library members are located on the nucleic acid within 5 kb of the boundary of the mobile element adjacent to the boundary of the mobile element. Sometimes, at least 90% of the nucleic acids of the library members are located on the nucleic acid within 5 kb of the boundary of the mobile element. Optionally, at least 50% of the nucleic acids of the library members are located on the nucleic acid within 1 kb of the boundary of the mobile element. Optionally, at least 75% of the nucleic acids of the library members are located on the nucleic acid within 1 kb of the boundary of the mobile element proximate to the boundary of the mobile element. Optionally, at least 90% of the nucleic acids of the library members are located on the nucleic acid within 1 kb of the boundary of the mobile element. Sometimes, the average fragment length is about 500 bases. Optionally, the average fragment length is about 1000 bases. Optionally, the intermediate fragment length is about 500 bases. Optionally, the intermediate fragment length is about 1000 bases.

[0011] In further embodiments, a composition is provided that includes a target sequence and a promoter, where the target sequence includes a nucleic acid sequence that directs the insertion of the composition into one or more specific positions in the nucleic acid sequence, and the promoter includes a nucleic acid sequence that directs the synthesis of a nucleic acid from a sample sequence adjacent to the insertion of the promoter. Optionally, the target sequence includes a nucleic acid sequence that is homologous to a specific position. Sometimes, the target sequence includes a nucleic acid sequence that base pairs to a specific position. In some cases, the target sequence includes a nucleic acid sequence that hybridizes to a specific position. In some cases, the target sequence includes at least one of a clustered regularly interspaced short palindromic repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. In some cases, the CRISPR sequence includes a guide RNA with a sequence that includes SEQ ID NO:3. Frequently, the promoter includes at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. In some cases, the bacterial promoter includes at least one of araBAD, trp, lac, and Ptac. Sometimes, the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. Eukaryotic promoters frequently comprise at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Optionally, the particular location in the nucleic acid sequence comprises a low complexity nucleic acid sequence. Frequently, the particular location in the nucleic acid sequence comprises a repetitive nucleic acid sequence. Optionally, the low complexity nucleic acid sequence or the repetitive nucleic acid sequence comprises at least one of a trinucleotide repeat, a tandem repeat, and a human leukocyte antigen gene. In some cases, the particular location in the nucleic acid sequence comprises a mobile genetic element. Optionally, the mobile genetic element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an intracisternal A particle (IAP), an ETn, a virus, and fragments thereof.Retrotransposons frequently comprise at least one of a transposable element, a LINE, a SINE, and fragments thereof. Optionally, the LINE comprises SEQ ID NO:1. Alternatively or in combination, the virus comprises a retrovirus or a fragment thereof. Sometimes, the nucleic acid synthesis comprises at least one of RNA transcription and DNA synthesis.

[0012] Also provided herein is a method for determining a nucleic acid sequence adjacent to a nucleic acid sequence of interest, the method comprising: (a) inserting a target nucleic acid sequence, comprising a target sequence and a promoter, into one or more specific positions in the nucleic acid sequence of interest; (b) directing the synthesis of nucleic acid from the promoter; and (c) sequencing the synthesized nucleic acid. Some target sequences comprise at least one of a clustered regularly interspaced short palindromic repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. Optionally, the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. In some cases, the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. Optionally, the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. Optionally, the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. Optionally, the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. In some cases, the sequence of interest comprises a low complexity nucleic acid sequence. The sequence of interest frequently comprises a repetitive nucleic acid sequence. Optionally, the sequence of interest comprises at least one of a trinucleotide repeat, a tandem repeat, and a human leukocyte antigen gene. Alternatively or in combination, the sequence of interest comprises a mobile genetic element. Optionally, the mobile genetic element comprises a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an intracisternal A particle (IAP), an ETn, a virus, or a fragment thereof. Sometimes, the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and a fragment thereof. Optionally, the LINE comprises SEQ ID NO:1. The virus frequently comprises at least one of a retrovirus and a fragment thereof.Optionally, the nucleic acid synthesis includes at least one of RNA transcription and DNA synthesis. Optionally, the RNA transcription includes the use of an RNA polymerase. Optionally, the RNA polymerase includes at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and single subunit RNA polymerase. Optionally, the DNA synthesis includes the use of a DNA polymerase. Optionally, the DNA polymerase includes at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. Optionally, the nucleic acid synthesis requires a primer. Frequently, the synthesized nucleic acid is synthesized directly from the nucleic acid sequence of interest. Optionally, the nucleic acid is synthesized without the introduction of mutations. Optionally, the mutation is at least one of a point mutation, a deletion, an insertion, and a chimera. Optionally, the synthesized nucleic acid comprises DNA. Optionally, the synthesized nucleic acid comprises cDNA. Optionally, the synthesized nucleic acid is treated with RNase. Sometimes, the synthesized nucleic acid comprises RNA. Optionally, the synthesized nucleic acid is treated with DNase. Optionally, the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing, single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. Optionally, the method detects the mutation in the subject. Optionally, the method detects the mutation in a tissue sample obtained from the subject. The tissue sample frequently comprises at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue.

[0013] In an additional embodiment, the present disclosure provides a method for mapping the site of insertion of a DNA element in a nucleic acid sample of a subject, the method comprising: i) inserting a target nucleic acid sequence comprising a target sequence and a promoter by contacting genomic DNA with the target sequence and one or more reagents sufficient to insert the target sequence into the DNA element; ii) creating an amplified nucleic acid directly from the genomic DNA by contacting the inserted target sequence with one or more enzymes that catalyze nucleic acid synthesis from the promoter, thereby creating an amplified nucleic acid; iii) sequencing the amplified nucleic acid. Optionally, the target sequence comprises at least one of a clustered regularly interspaced short palindromic repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. Sometimes, the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. Optionally, the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. Optionally, the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. Alternatively or in combination, the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. Optionally, the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Sometimes, the DNA element comprises a low complexity nucleic acid sequence. Optionally, the DNA element comprises a repetitive nucleic acid sequence. Optionally, the DNA element comprises at least one of a trinucleotide repeat and a tandem repeat. Optionally, the DNA element comprises a mobile genetic element. Optionally, the mobile genetic element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an intracisternal A particle (IAP), an ETn, a virus, and fragments thereof.Optionally, the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. Optionally, the LINE comprises SEQ ID NO:1. Optionally, the virus comprises a retrovirus or a fragment thereof. Sometimes, the enzyme comprises an RNA polymerase. In some cases, the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and single subunit RNA polymerase. Optionally, the enzyme comprises a DNA polymerase. Alternatively or in combination, the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. Sometimes, nucleic acid synthesis requires a primer. Optionally, the synthesized nucleic acid is directly synthesized from a nucleic acid sequence of interest. Optionally, the nucleic acid is synthesized without introducing mutations. Optionally, the mutations are at least one of point mutations, deletions, insertions, and chimeras. Optionally, the synthesized nucleic acid is DNA. Alternatively, the synthesized nucleic acid is cDNA. Optionally, the synthesized nucleic acid is treated with RNase. Optionally, the synthesized nucleic acid comprises RNA. Optionally, the synthesized nucleic acid is treated with DNase. Optionally, the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing, single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. Optionally, the method detects a mutation in the subject. Alternatively or in combination, the method detects a mutation in a tissue sample obtained from the subject. Optionally, the tissue sample includes at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue.

[0014] Further provided herein is a method for sequencing a region in a repetitive genome, the method comprising: i) inserting a target nucleic acid sequence comprising a target sequence and a promoter by contacting genomic DNA with the target sequence and one or more reagents sufficient to insert the target sequence into the repetitive genome region; ii) creating an amplified nucleic acid directly from the genomic DNA by contacting the inserted target sequence with one or more enzymes that catalyze nucleic acid synthesis from the promoter, thereby creating an amplified nucleic acid; iii) sequencing the amplified nucleic acid. Optionally, the target sequence comprises at least one of a clustered regularly interspaced short palindromic repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. Optionally, the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. Optionally, the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. Frequently, the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. Optionally, the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. The eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. Optionally, the repetitive genomic region comprises a low complexity nucleic acid sequence. Optionally, the repetitive genomic region comprises a repetitive nucleic acid sequence. Optionally, the repetitive genomic region comprises at least one of trinucleotide repeats and tandem repeats. Sometimes, the repetitive genomic region comprises a mobile genetic element. Optionally, the mobile genetic element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an intracisternal A particle (IAP), an ETn, a virus, and fragments thereof.Optionally, the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. Optionally, the LINE comprises SEQ ID NO:1. Optionally, the virus comprises a retrovirus or a fragment thereof. Optionally, the enzyme comprises an RNA polymerase. Optionally, the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and a single subunit RNA polymerase. Optionally, the enzyme comprises a DNA polymerase. Optionally, the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. Optionally, the nucleic acid synthesis requires a primer. The synthesized nucleic acid is frequently synthesized directly from a nucleic acid sequence of interest. Optionally, the nucleic acid is synthesized without introducing mutations. Optionally, the mutation is at least one of a point mutation, a deletion, an insertion, and a chimera. Optionally, the synthesized nucleic acid is DNA, such as a genome or cDNA. Optionally, the synthesized nucleic acid is treated with RNase. Optionally, the synthesized nucleic acid comprises RNA. Optionally, the synthesized nucleic acid is treated with DNase. Optionally, the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing, single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. Optionally, the method detects a mutation in the subject. Alternatively or in combination, the method detects a mutation in a tissue sample obtained from the subject. Optionally, the tissue sample comprises at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue. [Brief description of the drawings]

[0015] Reference is made to the following detailed description that illustrates embodiments in which the principles of the invention are utilized and to the accompanying drawings in which: [Figure 1] A typical human LINE1 (L1.4) repetitive element DNA sequence (SEQ ID NO:1) is shown. [Diagram 2] A typical consensus sequence of L1HA: the diagnostic sequence at the 3' end of the LINE-1 element (SEQ ID NO:2) is shown. [Diagram 3] An exemplary guide RNA sequence (SEQ ID NO:3) is shown. [Figure 4] A typical Alu-Y sequence (SEQ ID NO:4) is shown. [Diagram 5] 1 shows CRISPR-directed insertion of target-specific T7 promoter sequences. [Figure 6] 1 shows in vitro transcription of target DNA to generate amplified RNA copies of the target template. [Figure 7] The T7 promoters specifically inserted upstream and downstream of the target sequence are shown. [Figure 8] 1 shows alternative donor DNA constructs. [Figure 9] 1 shows the results of linear amplification of genomic sequences flanking the inserted T7 RNA polymerase site in the samples. [Figure 10] 1 shows the results of size selection of in vitro transcribed RNA. [Figure 11] The results of size exclusion of in vitro transcribed RNA are shown on an agarose gel. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] The methods disclosed herein include nucleic acid editing techniques (CRISPR, TALENS, zinc finger, transposase, and other methods known to those skilled in the art) to insert bacterial or bacteriophage promoters (such as T7, T3, or SP6, but a wide range of promoters are compatible with the disclosure herein and the list herein is not intended to be comprehensive) capable of DNA-directed RNA transcription. Following transcription of the RNA molecules from the inserted promoter, there is an effective linear amplification of the adjacent sequences in the form of a collection of RNA molecules derived directly from the sample as a template. The RNA molecules are converted into DNA sequencing libraries of either short or long reads by any number of methods.

[0017] Using CRISPR as an exemplary embodiment, the method includes first designing a sequence-specific guide RNA molecule that targets a conserved and locally unique sequence upstream of a sequence of interest. Preferably, the specific guide RNA molecule binds to a nucleic acid sequence that is unique to a repeat element and may occur multiple times in a sample, such as a genomic sample, where each occurrence corresponds to an occurrence of the repeat element. Optionally, the specific guide RNA molecule binds to a nucleic acid sequence that is unique to a specific genomic region to be sequenced. The sequence-specific molecule is added to a mixture of high molecular weight sample DNA, i.e., a donor DNA molecule that contains the components of the CRISPR / CAS system (when using CRISPR technology) and a T7 promoter sequence. In some cases, the CRISPR / CAS molecule is assembled with its associated nucleic acid before being contacted with the sample.

[0018] After insertion of an RNA promoter, such as a T7 promoter, into a specific genomic locus by CAS, a compatible RNA polymerase, such as T7 polymerase, is added to the sample along with the necessary ribonucleotides and buffer. In vitro transcription is used to generate approximately 1,000-fold amplification of the target DNA sequence through an RNA intermediate. The RNA generated from the in vitro transcription is then used as a template for DNA library generation, such as by synthetic fragmentation and conversion to a short read sequence library. Alternatively, the RNA generated from the in vitro transcription reaction is poly-A tailed or polyadenylated, and then reverse transcribed using an oligo-dT primer and reverse transcriptase to generate a full-length reverse transcribed DNA copy of the RNA template. Adapters are optionally ligated in this step for subsequent sequencing of the full-length reverse transcribed DNA molecule using single molecule sequencing technology.

[0019] The objective of some of the methods described herein is to generate long targeted templates suitable for long-read sequencing. High molecular weight sample DNA, such as genomic DNA, is first obtained from a source (e.g., blood, serum, cells, cell cultures, saliva, tumors, hair, skin, epithelial tissue, urine, stool, amniotic fluid, sputum, cerebrospinal fluid, mucus). Standard DNA purification techniques are optionally used to isolate high molecular weight sample DNA. Subsequent reactions frequently occur outside of cells, but in some embodiments, cellular material may remain in the reaction chamber. Live bacteria are not used in compatible reactions in many embodiments. Alternatively, the targeted template is in the genome of live bacteria. The sample DNA in the methods herein is obtained from any organism. Alternatively, the sample DNA is synthetic. Methods for preparing high molecular weight sample DNA are routine and known in the art. In some cases, the sample DNA includes genomic DNA. The sample DNA comprising genomic DNA is optionally selected from eukaryotic genome, prokaryotic genome, eubacterium genome, archaeal genome, viral genome, or synthetic nucleic acid source. In some cases, the sample is a tumor cell or a circulating cancer cell. Alternatively, the sample DNA comprises cell-free DNA, plasmid DNA, viral DNA, synthetic DNA, or other high molecular weight DNA sample obtained from a subject.

[0020] Guide RNAs are designed with target-specific motifs in several ways. The target may be adjacent to or within a gene of interest, adjacent to or within a promoter of interest, or within a gene, exon, intron, or intergenic region. Guide RNAs use sequences with reverse complementarity to the sample in their sequence to bind to sample DNA, which may be perfect or incomplete reverse complementarity. Guide RNAs may be designed to target multiple locations within or flanking the target sequence with insertion of a nucleic acid encoding a donor sequence, at either end of the target sequence, or in either or both orientations for insertion of the donor sequence. The guide RNA design is upstream of a photospacer adjacent motif or PAM sequence, which consists of a NGG nucleotide sequence. Some CAS9 mutants eliminate the need for a PAM sequence adjacent to the target sequence of the guide RNA molecule, and in some cases, there is no PAM sequence present herein. A single guide RNA is used. Alternatively, multiple guide RNAs are designed and used simultaneously in a single reaction. In exemplary embodiments, guide RNA target sequences are designed to be spaced apart across the target sequence.Guide RNA is designed to be in opposite orientation along double-stranded target DNA molecule.Optionally, guide RNA is designed to be on opposite strands of double-stranded target DNA molecule.The method may also insert multiple T7 donor sequences into target genomic DNA locus of subject.

[0021] The donor sequence includes amplification sites, possibly specifically promoter sites for T7 polymerase. T3 polymerase and SP6 promoter sequences are alternative donor sequences, although other sequences are available to those skilled in the art. Alternatively, other DNA-dependent RNA polymerase promoters are used. In an exemplary embodiment, the T7 promoter is used. A suitable T7 promoter sequence is 5'-TAATACGACTCACTATAG-3' (SEQ ID NO:5), with T7 transcription starting with a 3'G. RNA transcription occurs 5'-3', producing RNA molecules also in the 5'-3' orientation, making them useful templates for reverse transcription and conversion to cDNA. RNA polymerase has a very low error rate, with 0.5x10^-4 or 1 misincorporation for every 10-30 kb of transcription. RNA copies are produced only from double-stranded template DNA molecules. RNA polymerase fragment lengths range from hundreds of base pairs to multiple kilobases, with a maximum transcript length of 30 kilobases reported (T7 ribomax, Promega). Magnesium is required in buffers for RNA polymerase amplification.

[0022] Incubation times vary depending on the promoter and polymerase used. When using T7 polymerase, incubation times vary from a few minutes to 2 hours. Longer incubation times typically result in better yields and overall performance. The resulting RNA from the in vitro transcription reaction is purified or separated from the DNA sample, optionally via DNA degradation using a DNAse or endonuclease.

[0023] Alternatively, the DNA sample remains undegraded. Optionally, the RNA fragments are of a selected size. Downstream processing of the RNA template generated from the in vitro transcription reaction is optionally fragmented via mild magnesium treatment, physical or enzymatic means. The short RNA fragments are optionally converted into a sequencer library via standard small RNA library preparation techniques. Alternatively, the long RNA molecules are polyadenylated via polyA polymerase. The polyadenylated long RNA molecules are reverse transcribed via standard techniques known in the art. Reverse transcriptases such as SuperScript™ can be combined with oligo(d)T primers to efficiently generate full-length cDNA from long polyA-tailed RNA molecules. RNA is optionally removed from the reverse transcribed DNA output through digestion of the RNA. The single-stranded full-length reverse transcribed DNA molecules can then be converted into long-read sequencer libraries via standard adapter ligation reactions.

[0024] Modifications at multiple steps in the reaction consistent with the disclosure herein are contemplated. In some modifications, the donor DNA molecule in the CRISPR / CAS reaction optionally includes a primer site for second strand cDNA synthesis (in addition to the T7 promoter sequence). In these embodiments, the guide RNA plus the CRISPR / CAS system creates a double-stranded break at the target site upstream of the PAM sequence. The donor DNA molecule then includes a T7 promoter with a downstream universal primer site. For example, in some instances, the universal primer sequence is a sequencing primer complement for the sequencer platform of choice. The donor molecule assembly in the CRISPR / CAS reaction includes 5'-T7 promoter-universal primer sequence-3'. In vitro transcription with T7 polymerase starts at the 3'G of the T7 promoter sequence and transcribes the universal primer sequence downstream and through the target DNA sequence. After addition of polyA, reverse transcription primed with oligo(d)T transcribes through the universal primer sequence to create the first strand cDNA. Second strand cDNA synthesis is achieved by primer extension using a primer that is the reverse complement of the universal primer sequence. The final construct of the cDNA molecules that enter the NGS library conversion is therefore 5'-universal primer-target DNA-polyA-3'.

[0025] In an alternative method contemplated herein, the CRISPR / CAS system creates a double-stranded break at the target site. The double-stranded break is treated and manipulated with an exonuclease that creates a single-stranded DNA sticky end at the cut site to which an adapter with complementary sequence and a transcription promoter anneal. The annealed adapter is ligated to the sample DNA to create a promoter-target DNA hybrid that is ready for in vitro transcription of the sample DNA. In this alternative method, two levels of specificity are introduced in the targeted double-stranded DNA break specific to the CRISPR / CAS sequence and in the annealing of the adapter to the exonuclease that created the sticky end. Optionally, the adapter is a hairpin that includes a portion that folds back on itself and a second portion with a sequence complementary to the targeted sequence. Hairpin adapters can have advantages such as improved ligation efficiency and kinetics.

[0026] Addition of molecular barcodes upstream of the T7 promoter sequence (and optional universal primer sequence) in the donor DNA molecule is sometimes utilized. The donor DNA sequence in this example is constructed as 5'-T7 promoter-universal primer-N-mer-3'. In some cases, PCR amplification is required to increase the amount of material for sequencer library generation, and addition of molecular barcodes allows for the identification of unique molecules from clonally amplified long PCR products. For single-cell applications using massively parallel compartmentalization via microdroplets or microfluidic technology, the molecular barcodes are optionally replaced with compartment-specific barcodes. This allows for bulk processing of all cells in a sample after CRISPR / CAS target insertion, and allows for unique identification of sequenced molecules from a given single cell.

[0027] The techniques presented herein frequently allow for targeted amplification of nucleic acid sequences flanking multiple repeats. Thus, the overall distribution of insertion sites throughout a nucleic acid sample, such as a genome, can be determined. Specifically, the selection of genomic mobile elements determines multiple regions into which the mobile elements are inserted, including up to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100% of the total number of insertion sites for the repetitive elements of interest in the genome. In some cases, some of these insertion sites are amplified 10x, 100x, 1000x, 10000x, 100000x, 1000000x, or even more. The fraction amplified to this level optionally includes up to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100% of the total number of insertion sites.

[0028] Thus, through the implementation of the methods and use of the compositions disclosed herein, the overall insertion pattern for mobile repeat elements across the entire genome of a cell or cell population of interest, such as a cancer cell or cancer cell population, can be determined. Furthermore, through the high level of amplification achieved, single cells or very small cell populations can be tested. Finally, since the amplification is often a linear amplification generated directly from the sample template, rather than the product of exponential amplification using PCR, the amplification is performed without any concomitant proliferation of errors, such as point mutations or translocations that occur following the library generation process. Errors may occur, but they are easily recognized because they are likely to be largely unique to a single product. Furthermore, because amplification occurs through an RNA intermediate, there is no risk of the synthetic product annealing to the sample or another amplified product and priming further extension, a phenomenon that is difficult to distinguish from a translocation event in the sample itself.

[0029] Use of the methods and compositions disclosed herein allows for determining the sequence at any target site in the genome, including DNA sequences of average complexity as well as repetitive elements, such as mRNA coding sequences. Thus, the methods herein are not limited to sequencing repetitive and low complexity genomic regions, but can be applied to any desired location in the genome.

[0030] Practice of the methods disclosed herein results in libraries that are highly amplified, highly representative of the total distribution of mobile element sites, and highly resistant to error propagation during the synthesis process.

[0031] Methods, compositions, and kits for producing multi-insert nucleic acids are provided. These methods, compositions, and kits find use in many applications, such as whole genome sequencing. These and other objects, advantages, and features of the present invention will become apparent to those of skill in the art after reading the details of the compositions and methods as more fully described below.

[0032] <Targeted insertion of tag> Disclosed herein is a method of obtaining a sequence from a desired genetic location by inserting a tag into the desired genetic location. In some cases, the tag is inserted into the desired genetic location using gene targeting techniques, such as CRISPR, TALENS, zinc finger, transposase, and other methods known to those skilled in the art. The tag is designed to include a sequence that allows amplification from the desired genetic location. The tag is selected depending on the desired method of amplification. In some cases, the desired genetic location is amplified by transcription. When the desired genetic location is amplified by transcription, the tag is designed to include a promoter sequence, for example, a bacteriophage promoter, such as T7, T3, SP6, or other bacteriophage promoter. The promoter sequence is in some cases a viral promoter, such as pL, CMV, SV40, CaMV35S, or other viral promoter. In some cases, it is desirable to use a mammalian promoter such as EF1a, PGK1, Ubc, beta actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, U6, or other mammalian promoter. In some cases, the promoter is an RNA polymerase I promoter. In some cases, the promoter is an RNA polymerase II promoter. In some cases, the promoter is an RNA polymerase III promoter. In some cases, the promoter is an RNA polymerase IV promoter. In some cases, the promoter is an RNA polymerase V promoter. In some cases, the promoter is a single subunit RNA polymerase promoter.

[0033] Tag containing CRISPR targeting sequences include, but are not limited to, the group consisting of: ACTAGAAAATCTAGAAGAAA (SEQ ID NO:5), TTGTAGTATAGTTTGAAGTC (SEQ ID NO:6), AAAACCCTAGAAGAAAACCT (SEQ ID NO:7), TCTTTAAGAATGTTGAATAT (SEQ ID NO:8), ACAGCCAATATCATACTGAA (SEQ ID NO:9), TCACATAGTCCCATATTTCT (SEQ ID NO:10), CTACAGTAACCAAAACAGCA (SEQ ID NO:11), AGCAACTTCAGCAAAGTCTC (SEQ ID NO:12), TGACTTCAAACTATACTACA (SEQ ID NO:13), TAAGCTTTTTGATGTGCTGC (SEQ ID NO:14), CCTCCCTAACTCATTTTATG (SEQ ID NO:15), GAAGCATTCCCTTTGAAAAC (SEQ ID NO:16), NO:16), ACCTGCTCCTGAATGACTAC(SEQ ID NO:17), TGAAGTTGCTTATCAGCTTA(SEQ ID NO:18), GAGTTCTGTAGATGTCTATT(SEQ ID NO:19), TATTCACAATAGCAAAGACT(SEQ ID NO:20), TTGTCTCTTTTGATCTTTGT(SEQ ID NO:21), TTGAACCAGCCTTGCATCCC(SEQ ID NO:22), AGGATTCCCTATTTAATAAA(SEQ ID NO:23), TTGCCCATTCAGTATGATAT(SEQ ID NO:24), GTTCTTTTAATTGTGATGTT(SEQ ID NO:25), AAGATCAAAAGAGACAAAGA(SEQ ID NO:26), TTCACTTATGAAGCTTAGTT(SEQ ID NO:27), AAACTAAGCTTCATAAGTGA(SEQ ID NO:28), AAAAATCCTCAATAAAATAC(SEQ ID NO:29), CATCTATTGAGATAATCATG(SEQ ID NO:30), CCCAGCACCATTTATTAAAT(SEQ IDNO:31)、TCCTGAATACAGCACACTGA(SEQ ID NO:32)、TGTCTTGTGCCAGTTTTCAA(SEQ ID NO:33)、TTTGATTTGCATTTCTCTGA(SEQ ID NO:34)、ATCCCTTTACCATTATGTAA(SEQ ID NO:35)、TGAGAGATTTTGTCACCACC(SEQ ID NO:36)、AATCTGACAATTATGTGTCT(SEQ ID NO:37)、CAGTTTCAGCTTTCTACATA(SEQ ID NO:38)、CATATGTAGAAAGCTGAAAC(SEQ ID NO:39)、AATATATATGCACCCAATAC(SEQ ID NO:40)、GATGGTAGTTTGTATTTCTG(SEQ ID NO:41)、AGTCTGTTTTATCAGAGACT(SEQ ID NO:42)、GCCAGTCTGTGTCTTTTAAT(SEQ ID NO:43)、CTTCCAACACTATGTTGAAT(SEQ ID NO:44)、AAACTACTTTAAAGTTCATA(SEQ ID NO:45)、AATGTGGCACATATACACCA(SEQ ID NO:46)、CACATTCAAAAGCTAGCAGA(SEQ ID NO:47)、CCCATCAGTGTGCTGTATTC(SEQ ID NO:48)、ATCTTTCCTGCTTTCTCTTG(SEQ ID NO:49)、CTAAGCCAAAAGAACAAAGC(SEQ ID NO:50)、TCATCCCTGGGATGCAAGGC(SEQ ID NO:51)、CTCTTTGAAGCAATTGTGAA(SEQ ID NO:52)、GCCCATGCCTATGTCCTGAA(SEQ ID NO:53)、TGCCTCCAGCTTTGTTCTTT(SEQ ID NO:54)、TTTTTCCTTCATTTCAACTT(SEQ ID NO:55)、AAACTACCATCAGAGTGAAC(SEQ ID NO:56)、AGGAAAACTAACAAACAGAA(SEQ ID NO:57)、TCAAAGAGAATAAAATACCT(SEQ ID NO:58)、AAATGCCCACAAGAGAAAGC(SEQ IDNO:59)、AATGACTTTCTTCACAGAAT(SEQ ID NO:60)、ATTCACCAAAGTTGAAATGA(SEQ ID NO:61)、AATTCTGTGAAGAAAGTCAT(SEQ ID NO:62)、ATTCCAATCAATAGAAAAG(SEQ ID NO:63)、ATTCCAATCAATAGAAAG(SEQ ID NO:63) NO:64)、CCAGCTAACATCATAATGAC(SEQ ID NO:65)、TGACCCAGCCATCCCATTAC(SEQ ID NO:66)、TACCATTCAGGACATAGGCA(SEQ ID NO:67)、CTGTTCTTTTACATTTGCTG(SEQ ID NO:68) NO:69)、GTTCTAGTTTGATTGCACTG(SEQ ID NO:70)、TTCCCTCTTTTTCTATTGAT(SEQ ID NO:71)、TTAAAAAGTCAGGAAACAAC(SEQ ID NO:72)、ACACAACATACCAGAATC(SEQ ID NO:73)、CACAACATACCAGAATC(SEQ ID NO:73) NO:74)、GTAAACTAGTTCAACCATTG(SEQ ID NO:75)、GTGCAATCAAACTAGAACTC(SEQ ID NO:76)、ACTCCTATTCAACATAGTGT(SEQ ID NO:77)、GCAGAGCTGAGTTCAATTCC(SEQ ID NO:78)、CACCAGCTCAACCATTG(SEQ ID NO:78) NO:79)、CCTTCACATCCCTTGTAAGT(SEQ ID NO:80)、TATCTCAATAGATGCAGAAA(SEQ ID NO:81)、TTAAGGCAGCCAGAGAAA(SEQ ID NO:82)、CTAAAAACTCTCAATAAATT(SEQ ID NO:83) NO:84)、GCTTATCCACCATGATCAAG(SEQ ID NO:85)、TGGAGAGGATGTGGAGAAAT(SEQ ID NO:86)、CTGCAGAGTGTTTTCCAACT(SEQ IDNO:87)、TCAGAGATTCAACTTCTTCC(SEQ ID NO:88)、TCTCTGAATAGACCAATAAC(SEQ ID NO:89)、GAATCTGGGTGCTCCTGTAT(SEQ ID NO:90)、CAAGTTGGAAAACACTCTGC(SEQ ID NO:91)、TAGATCCCATTTGTCAATTT(SEQ ID NO:92)、TGAAGCCCACTTGATCATGG(SEQ ID NO:93)、TCCAATTAAAAGACACAGAC(SEQ ID NO:94)、CAAAAGCCAAAATTGACAAA(SEQ ID NO:95)、GTATATACCCAGTAATGGGA(SEQ ID NO:96)、GAAATAAAGGGTATTCAATT(SEQ ID NO:97)、ACCCTCAGCTGCAGGTCTGT(SEQ ID NO:98)、CCAACTTACAAGGGATGTGA(SEQ ID NO:99)、ATTGAGAGTTTTTAGCATGA(SEQ ID NO:100)、TTTTTTGTTTTCCATTTGCT(SEQ ID NO:101)、TCTCTTCAAAGCTGTCAGAC(SEQ ID NO:102)、ATTCTTCCTACCCATGAGCA(SEQ ID NO:103)、AACACTTTTACACTGTTGGT(SEQ ID NO:104)、CTGTTTTTTCCCCATCTTTG(SEQ ID NO:105)、CAAACAACCCCATCAAAAAG(SEQ ID NO:106)、TTTCTAGTTCTAGATCCCTG(SEQ ID NO:107)、AGAACTTCCCCAATCTAGCA(SEQ ID NO:108)、TGTGAGATGGTATCTCATTG(SEQ ID NO:109)、TTTGAGTTCATTGTAGATTC(SEQ ID NO:110)、CCATGTTTAGTGCTTCCTTC(SEQ ID NO:111)、CAGTCTGAGATCAAACTGCA(SEQ ID NO:112)、TCAGTTTCCATGTAGTTGAG(SEQ ID NO:113)、TTAATCCAGTCTATCATTGT(SEQ ID NO:114)、GTCTAAAACACCAAAAGCAA(SEQ IDNO:115), TGCCCTAAAAGAGCTCCTGA (SEQ ID NO:116), TCACAGCCGAATTCTACCAG (SEQ ID NO:117), AATGTCCAACAATGATAGAC (SEQ ID NO:118), CTAGATTGGGGGAAGTTCTCC (SEQ ID NO:119), TTCTTTATTAGTCTTGCTAG (SEQ ID NO:120), CCTCATAAAATGAGTTAGGG (SEQ ID NO:121), GAAAAAATGCTCATCATCAC (SEQ ID NO:122), AAGAATCAATATCGTGAAAA (SEQ ID NO:123), GGTTTGCCAGTATTTTATTG (SEQ ID NO:124), CTTCTCGAGGAGTATCTTTG (SEQ ID NO:125), TTAATGATTGCCATTCTAAC (SEQ ID NO:126), GGTAACCCGACCTTTCTCTC (SEQ ID NO:127), AACAAAGCCTCCAAGAAATA (SEQ ID NO:128)、TAGCCCTTTGTCAGATGAGT(SEQ ID NO:129)、TAAACATGGAAAGGAACAAC(SEQ ID NO:130)、CTCCAACAGACCTGCAGCTG(SEQ ID NO:131)、GATGAGTTCATGTCCTTTGT(SEQ ID NO:132)、CAATCATGTCATCTGCAAAC(SEQ ID NO:133)、CTCTTTTAGGGCAGGCCTGG(SEQ ID NO:133) NO:134)、TTTTGCATCAATGTTCATCA(SEQ ID NO:135)、CATGAACTCATCATTTTTTA(SEQ ID NO:136)、ATTTTGGAATAGGTGTGGTG(SEQ ID NO:137)、AAGTTCTGGCCAGGGCAATC(SEQ ID NO:138)、AATTCGGCTGGAATCCATC(SEQ ID NO:139)、GTGGAGCCCACCACAGCTCA(SEQ ID NO:138) NO:140)、TTTCATCCATGTCCCTACAA(SEQ ID NO:141)、AAAACAGAGATATAGATCAA(SEQ IDNO:142, ATTGATCTATATCTCTGTTT(SEQ ID NO:143), TAAAATCAGAGCAGAACTGA(SEQ ID NO:144), AGTAGATAAAACCACAAAGA(SEQ ID NO:145), GAACTACAAACCACTGCTCA(SEQ ID NO:146), ATTGAATCTATAAATTACCT(SEQ ID NO:145). NO:147;AGTCAGTGTGGCGATTCCTC(SEQ ID NO:148), TGTCTGTGCCCTGCCCCCAG(SEQ ID NO:149),CGCCACACTGACTTCCACAA(SEQ ID NO:150),TAGTTTTCCTTCTAACAGAC(SEQ ID NO:151),AAATGTATATTCTGTTGATT(SEQ ID NO:151). NO:152)、 CTACTTTTGGTCTTTGATGA(SEQ ID NO:153)、AGACTCCCACACAATAATAA(SEQ ID NO:154)、GAAGCCCATCAGACTAACAG(SEQ ID NO:155)、GCCTCTGTAGGCTCCACCTC(SEQ ID NO:156)、TGGAGCCTACAGAGGCAGGC(SEQ ID NO:157)、TCCAAAATTGACCACATAGT(SEQ ID NO:158)、GATTTCTGCATTTCCATCTG(SEQ ID NO:159)、AACCTGAGAAAAACAAGCAA(SEQ ID NO:160)、TATTTCCTGAATTTGAATGT(SEQ ID NO:161)、GAACTCAGCTCTGCACCAAG(SEQ ID NO:162)、CAATACAGAGAAGTGCTTAA(SEQ ID NO:163)、CCCCATTGCTTGTTTTTCTC(SEQ ID NO:164)、TTACCAACCAAAAAGAGTCC(SEQ ID NO:165)、ATGCACACGTATGTTTATTG(SEQ ID NO:166)、CCTTTCAAAAAACCAGCTCC(SEQ ID NO:167)、AGACCAAATCTACGTCTGAT(SEQ ID NO:168)、CTTTAAGCACTTCTCTGTAT(SEQ ID NO:169)、AGTCTCCCATTATTATTGTG(SEQ ID NO:170)、ATACAAAAATTAATTCAAGA(SEQ ID NO:171)、GCAACCTACTCATCTGACAA(SEQ ID NO:172)、TAATGCCTAGGTTTTCTTCT(SEQ ID NO:173)、TGGTCTAAAATTCTCTTTTT(SEQ ID NO:174)、AGTCTCTTTGTAGGTCACTC(SEQ ID NO:175)、CTCTACAAGCCAGAAGAGAG(SEQ ID NO:176)、ACACCAATCAGACGTAGATT(SEQ ID NO:177)、GTGAAGAATGCAGAAGCCTC(SEQ ID NO:178)、CTTGAATTAATTTTTGTATA(SEQ ID NO:179)、TATTGCCTAGGTTTTCTTCT(SEQ IDNO:180)、GACAGCTTTGAAGAGAGCAG(SEQ ID NO:181)、AAAATTTTCTCCCATTCTGT(SEQ ID NO:182)、CCAGTTCCTCCTTGTACCTC(SEQ ID NO:183)、GGAAGAACATTCCATGCTCA(SEQ ID NO:184)、GAATGTATATTCTGTTGATT(SEQ ID NO:185)、ATCAGATAGTTGTAGATATG(SEQ ID NO:186)、TAAGATCAGAGCAGAACTGA(SEQ ID NO:187)、ATATTAACTTAAATGTAAA(SEQTT:8QTT ID NO: NO:189)、TTCAAAAAATCAATGAATCC(SEQ ID NO:190)、CACCCTCCCAAGACTAAACC(SEQ ID NO:191)、AGATTTTGGGCTGAGACAAT(SEQ ID NO:192)、CACTCTCCCAAGACTAAACCGTTTGCCTTA ID NO: NO:194)、TATGTATACATGTGCCATGC(SEQ ID NO:195)、CACTAGGGAGTGCCAGACAG(SEQ ID NO:196)、ATCATCCTGATACCAAAGCC(SEQ ID NO:197)、GTGTGTCTCTGCACGTGATTTT(TCAGTT9GCTAGT) NO:19 NO:199)、GATTTCTGCATTTCCAACTG(SEQ ID NO:200)、TCACTTTTATTTCCTTGAGCAG(SEQ ID NO:201)、TCACGTGCAGAGACACAT(SEQ ID NO:202)、CACTCCAGACCCTGTCTGCCAT(ATTGTA3 IDTAC) NO:2 NO:204)、CAGCATTTGCTTGTCTGTAA(SEQ ID NO:205)、GAGATCCGCTGTTAGTCTGA(SEQ ID NO:206)、CAGCATGATTTATAGTCCTT(SEQ IDNO:207)、CCCTACAAGCCAGAAGAGAG(SEQ ID NO:208)、ATACAAAAATCAATTCAAGA(SEQ ID NO:209)、ATTTAGCCCATTTACATTTA(SEQ ID NO:210)、TTTTTTGTTGTGTCTCTGCC(SEQ ID NO:211)、AGGGGTCAGGGACCCACTTG(SEQ ID NO:212)、TTTCTAGTTTATTTGCATAG(SEQ ID NO:213)、CTTGAATTGATTTTTGTATA(SEQ ID NO:214)、TGAATGTGTCCCAGAGATTC(SEQ ID NO:215)、AAAATTTTCTCCCATTTTGT(SEQ ID NO:216)、TGTTGTGTCTTTGTTCTCGT(SEQ ID NO:217)、AGCAAAGCCTCCAAGAAATA(SEQ ID NO:218)、AAGTTCTGGCCAGGGCAATT(SEQ ID NO:219)、ATTGAATCTGTAAATTACCT(SEQ ID NO:220)、AGACTCCCACACATTAATAA(SEQ ID NO:221)、CCATTCTCCCCATCACTTTC(SEQ ID NO:222)、GCTCTCTGTTTGTCTGTTAT(SEQ ID NO:223)、AGTCTCCCATTATTAATGTG(SEQ ID NO:224)、GTACAGATGGGTTTTTGGTG(SEQ ID NO:225)、TGCCTCCCAGTTAGGCTGCT(SEQ ID NO:226)、CCCACTCTCTTCTGGCTTGT(SEQ ID NO:227)、GCTGATGGAGCTGAAAACCA(SEQ ID NO:228)、ACTCCCTAGTGAGATGAACC(SEQ ID NO:229)、TTCAAAAAATTAATGAATCC(SEQ ID NO:230)、CACCTATGAGTGAGAATATG(SEQ ID NO:231)、ACATTCAAAGCAGTGTGTAG(SEQ ID NO:232)、AACATTCCATGCTCATGGGT(SEQ ID NO:233)、CTTCTCCTGCCTAATTGCCC(SEQ IDNO:234)、TTGTTTACCTAAGCAAGCC(SEQ ID NO:235)、TCTTTTATTTCATTGAGCAG(SEQ ID NO:236)、ACTGCTCAATGAAATAAAAG(SEQ ID NO:237)、CCTGAAAGTGATGGGGAGAA(SEQ NO:238). NO:243)、CTTTTCAAAAAACCAGCTCC(SEQ ID NO:244)、TTCACGTAGTTCTCGAGCCT(SEQ ID NO:245)、GAGCGCCTCTCCTCCTCCAA(SEQ ID NO:246)、TCAGATCTCCAGCTGCGTGCGA(SEQGAATCA7) ID:24 NO:248)、ATGAATGAAATGAAGCGAGA(SEQ ID NO:249)、CAGTTTCTTCCTAGTCTCGA(SEQ ID NO:250)、CACCGCATATTCTCACTCAT(SEQ ID NO:251)、CTCAAAACCGCTCAGCTACA(TTCAAAACCGCTCAGCTACA(TTCAAAACCGCTCAGCTACA) IDTCCCCA ID NO:24 NO:253)、TGTTGTGTCTTTGTTCTCAT(SEQ ID NO:254)、GATGCGATCAACTGGAAGAA(SEQ ID NO:255)、GTACCAGTACCATGCTGTTT(SEQ ID NO:256)、AAAAAACAGAGCAGAAAAAC(SEQ ID NO:257)、CTTTGGTATCAGGATGATGC(SEQ ID NO:258)、AAAAAACAGAACAGAAAAAC(SEQ ID NO:259)、GTGCTTTACTTCCAACTATG(SEQ ID NO:260)、TAGATAAAACCACAAAAGATG(SEQ ID NO:258)NO:261), TGACCCCCGAGCAGCCTAAC(SEQ ID NO:262), AATTTGGCATGTTTTTGCAG(SEQ ID NO:263), TAAAGAGGATACAAACAAA(SEQ ID NO:264), GCATTCAAAGCAGTGTGTAG(SEQ ID NO:264). NO:265), GAGGAACTGCGTTCCTTTGG(SEQ ID NO:266), TTTGACGAGCTGAGAGAAGA(SEQ ID NO:267), CTTTGGTATCAGAATGATGC(SEQ ID NO:268), ATTCTTCCTATCCATGAGCA(SEQ ID NO:268). NO:269), TCCCTTTCCTAGTCAAAGAA(SEQ ID NO:270), AAAACAGAGATATAGACCAA(SEQ ID NO:271), CTTCTCCTGCCTGATTGCCC(SEQ ID NO:272), TGGGAGTGACCCGATTTTCC(SEQ ID NO:273), ATGTAAAGACCATCGAGACT(SEQ ID NO:272). NO:274, CCATTCTCCCCGTCACTTTC(SEQ ID NO:275), TCACCATCATCAAAGACCAA(SEQ ID NO:276), ATTATTATACTTTAAGTTTT(SEQ ID NO:277), TCAATTTCAGAGCCTGTTAT(SEQ ID NO:278), GCTCTCTGTTTGTCTGTTGT(SEQ ID NO:277). NO:279;AACGAGACAGAAAGTCAACA(SEQ ID NO:280),CAGCATGATTTATAATCCTT(SEQ ID NO:281),GATCAAATTACTCTGAGCTA(SEQ ID NO:282),GATGCAATAAAAAATGATAA(SEQ ID NO:283),CTTTGGCTCTGTTTATATGC(SEQ ID NO:282). NO:284, TGTCACCCCTTTCTTTGACT(SEQ ID NO:285), GGTCAGGGACCCACTTGAGG(SEQ ID NO:286), CTCTGAGACAAAACTTCCAG(SEQ ID NO:287), CTGGCCTCATAAAATGAGTT(SEQ ID NO:286).NO:288), CTTCATCCATGTCCCTACAA(SEQ ID NO:289), CCTGAAAGTGACGGGGAGAA(SEQ ID NO:290), CACCTATGAGTGAGAACATG(SEQ ID NO:291), TATTTCCTGAATCTGAACGT(SEQ ID NO:292), AGGAGCCAAGATGGCCGAAT(SEQ ID NO:293), AAGAATCAATATCATGAAAA(SEQ ID NO:294), GCCATTGCCCAGGCTTGCTT(SEQ ID NO:295), CGCAGCTGGAGATCTGAGAA(SEQ ID NO:296), AATTGAACAATGAGATCACA(SEQ ID NO:297), CAATCATGTCGTCTGCAAAC(SEQ ID NO:298), AGACCGGAGCT <h2 style=";text-align:left;direction:ltr">GTTCCTATT(SEQ ID NO:299)、TATTTCCTGAATCTGAATGT(SEQ ID NO:300)、TGCCTTACAAGAGCTCCTGA(SEQ ID NO:301)、TTGGGAGAGTGTATGTGTCG(SEQ ID NO:302)、GGAAGGGGAACATCACACTC(SEQ ID NO:303)、TAAATGTGTCCCAGAGATTC(SEQ ID NO:304)、AGGTGTCAGTGTGCCCCTGC(SEQ ID NO:305)、TTAGGATTGACTTGGCGATG(SEQ ID NO:306)、TTCCAACAGACCTGCAGCTG(SEQ ID NO:307)、AACCTGACAAAAACAAGCAA(SEQ ID NO:308)、TATGTATACATGTGCCATGT(SEQ ID NO:309)、AACCTGACAAAAACAAGAAA(SEQ ID NO:310)、TTAATGATCGCCATTCTAAC(SEQ ID NO:311)、GTCCTTCGCCCACTTTTTGA(SEQ ID NO:312)、TCCAAAATTGACCACATACT(SEQ ID NO:313)、AGATTTTGGGCTGAGACGAT(SEQ ID NO:314)、TGAATGCGTCCCAGAGATTC(SEQ ID NO:315)、AGACTGGAGCTGTTCCTATT(SEQ ID NO:316)、ATACTATGCAGCCATAAAAA(SEQ ID NO:317)、GGGCAGACTGACACCTCACA(SEQ ID NO:318)、ATCCTTTGCCCACTTTTTGA(SEQ ID NO:319)、GGAAGGGGAATATCACACTC(SEQ ID NO:320)、ACGCAGTTCCTCACCAGCAA(SEQ ID NO:321)、AATGCTAGATGACGAGTTAG(SEQ ID NO:322)、GACAGCTTTGAAGAGAGTAG(SEQ ID NO:323)、GAGCTTTACTTCCAACTATG(SEQ ID NO:324)、CATGAACTCATCCTTTTTTTA(SEQ ID NO:325)、CTAACTCGTCATCTAGCATT(SEQ IDNO:326)、ATCCAGCTTTGTTCCGTTGC(SEQ ID NO:327)、AGTCTCTTTGTAGGTCTCTA(SEQ ID NO:328)、CCATGTTTAGCGCTTCCTTC(SEQ ID NO:329)、CCCCATTGCTTGTTTTTGTC(SEQ ID NO:330)、GAGCTTTACTTCCAAGTATG(SEQ ID NO:331)、GACGCAATAAAAAATGATAA(SEQ ID NO:332)、CTAGGTTGGGGAAGTTCTCC(SEQ ID NO:333)、ATCAGATGGTTGTAGATGTG(SEQ ID NO:334)、CCCCATTTCTTGTTTTTGTC(SEQ ID NO:335)、GGGCACACTGACACCTCACA(SEQ ID NO:336)、CTACCTTTGGTCTTTGATGA(SEQ ID NO:337)、GACTAAAACACCAAAAGCAA(SEQ ID NO:338)、TTTCTAGTTCTAGATCCTTG(SEQ ID NO:339)、GAAAAAATGCTCACCATCAC(SEQ ID NO:340)、TTAGGATTGACTTGGCAATG(SEQ ID NO:341)、TTTTGTCTCAGAGGAGTACC(SEQ ID NO:342)、ACATTTAAAGCAGTGTGTAG(SEQ ID NO:343)、CCAGCTCCTCCTTGTACCTC(SEQ ID NO:344)、CTCTTGTAAGGCAGGCCTGG(SEQ ID NO:345)、GAGATCTGCTGTTAGTCTGA(SEQ ID NO:346)、GAGATCAGCTGTTAGTCTGA(SEQ ID NO:347)、AGGGCTCTGTTCTGTTCCAT(SEQ ID NO:348)、AACGAGACAGAAAGTTAACA(SEQ ID NO:349)、CTAAGCAAAAAGAACAAAGC(SEQ ID NO:350)、TTTTTCCTTCATTTCAACCT(SEQ ID NO:351)、CCAGCTCCTCTTTGTACCTC(SEQ ID NO:352)、GTTCTAATTTGATTGCACTG(SEQ IDNO:353), AAGAATCAATATTGTGAAAA (SEQ ID NO:354), GTGCAATCAAATTAGAACTC (SEQ ID NO:355), AGCGTGAGCGACGCAGAAGA (SEQ ID NO:356), TTTGACGAGTTGAGAGAAGA (SEQ ID NO:357), CAAAAGACAAAATTGACAAA (SEQ ID NO:358), CATCATTCTGATACCAAAGC (SEQ ID NO:359), CAGCTTTGTTCTTTTTTGCTT (SEQ ID NO:360), TCTTTTGTTGCCATTGCTTT (SEQ ID NO:361), GACTGTTGTGGGGTGGGGGG (SEQ ID NO:362), GTGTGTCTCTGCATGTGAGA (SEQ ID NO:363), TATTTACCCAGTAGTCATTC (SEQ ID NO:364), TCACAGCCAAATTCTACCAG (SEQ ID NO:365), GTCTTCTGCGTCGCTCACGC (SEQ ID NO:366)、CTCAAAACCACTCAACTACA(SEQ ID NO:367)、TTTCTCTTGCCTGATTGCCC(SEQ ID NO:368)、ACAATTTCAGCTCCTGTTAT(SEQ ID NO:369)、AGTTTGCCAGTATTTTATTG(SEQ ID NO:370)、CTAAAAACTCTCAATAAACT(SEQ ID NO:371)、AGAACTTCCCCAACCTAGCA(SEQ ID NO:370) NO:372)、TTTCTAGTTTATTTGTGTAG(SEQ ID NO:373)、TTGGAGGGTGTATGTGTCC(SEQ ID NO:374)、CAATGCAGAGAAGTCCTTAA(SEQ ID NO:375)、ACCTACTCAAGCCTCAGCAA(SEQ ID NO:376)、TCACATGCAGAGACACACAT(SEQ ID NO:377)、GAGCACCTCTCTCCTCCAA(SEQ ID NO:376) NO:378)、TCCCTTTCCGAGTCAAAGAA(SEQ ID NO:379)、CGGCAGCGAGGCTGGGGGAG(SEQ IDNO:380)、GTCCAAAACACCAAAAGCAA(SEQ ID NO:381)、GCATTTTTTCATGTGTCTGT(SEQ ID NO:382)、CATCATCCTGATACCAAAGC(SEQ ID NO:383)、CCCAATTAAAAGACACAGAC(SEQ ID NO:384)、ACAATTTCAGATCCTGTTAT(SEQ ID NO:385)、TCACAGCTGAATTCTACCAG(SEQ ID NO:386)、TTACCAACCAAAAAAAGTCC(SEQ ID NO:387)、GTGTGTCTCTGCACATGAGA(SEQ ID NO:388)、GCCTCTGTAGACTCCACCTC(SEQ ID NO:389)、AGGTGTCAGTCTGCCCCTAC(SEQ ID NO:390)、ACTGACCTGCGCCCACTGTC(SEQ ID NO:391)、TCATGTGCAGAGACACACAT(SEQ ID NO:392)、GGTAACCTGACCTTTCTCTC(SEQ ID NO:393)、GCAATCTACTCATCTGACAA(SEQ ID NO:394)、CACCGCATGTTCTCACTCAT(SEQ ID NO:395)、TAGCAATCAGCGAGACTCCG(SEQ ID NO:396)、AAATGAAGGAAAAAATGTTA(SEQ ID NO:397)、ACAAAGAGAATAAAATACCT(SEQ ID NO:398)、TTAATCCAGTCTATCATTGA(SEQ ID NO:399)、GTAAATTAGTTCAACCATTG(SEQ ID NO:400)、AGGACCCTCCGAGCCAGGTG(SEQ ID NO:401)、CGTCACCCCTTTCTTTGACT(SEQ ID NO:402)、ATGAGTTCATGTCCTTTGTA(SEQ ID NO:403)、ACAATTTCAGAGCCTGTTAT(SEQ ID NO:404)、CCATTCTCCCTGTCACTTTC(SEQ ID NO:405)、GATCTGTCTAATATTGACAG(SEQ ID NO:406)、AATGTCCATCAATGATAGAC(SEQ IDNO:407)、CTCGGAGGGTCCTACGCCCA(SEQ ID NO:408)、TTTAAGTTCTTTGTAGATTC(SEQ ID NO:409)、CACCAGCAACAGAACAAAGC(SEQ ID NO:410)、TCATCTCACACCAGTTAGAA(SEQ ID NO:411)、AGACCAAATCTACATCTGAT(SEQ ID NO:412)、GAGATCCACTGTTAGTCTGA(SEQ ID NO:413)、TGACCCAGCAATCCCATTAC(SEQ ID NO:414)、ATCCAGCTTTGTTCCATTGC(SEQ ID NO:415)、GGAAGGGGAACATCACACAC(SEQ ID NO:416)、GCATTTTTTCATGTGTCTTT(SEQ ID NO:417)、CTCAAAACTGCTCAACTACA(SEQ ID NO:418)、TGCCTCCCAGTTAGGCTACT(SEQ ID NO:419)、TTTATTATACTTTAAGTTTT(SEQ ID NO:420)、CCTGATGGAGCTGAAAACCA(SEQ ID NO:421)、GTCCAGCTTTGTTCCATTGC(SEQ ID NO:422)、GTCCTTTGCCCACTTTTTGA(SEQ ID NO:423)、ACACCAATCAGATGTAGATT(SEQ ID NO:424)、CAGCTCCATCAGGTCCTTTA(SEQ ID NO:425)、GAGTGCCTCTCCTCCTCCAA(SEQ ID NO:426)、AGATTTTGGGCTGAGATGAT(SEQ ID NO:427)、AATTCAGCTGTGAATCCATC(SEQ ID NO:428)、TATTGGGTGCATATATATTT(SEQ ID NO:429)、CCTGAAAGTGACAGGGAGAA(SEQ ID NO:430)、AAAACAACCCCATCAAAAAG(SEQ ID NO:431)、TTAATGATCACCATTCTAAC(SEQ ID NO:432)、CTACCAACCAAAAAAAGTCC(SEQ ID NO:433)、CTGAAGAGTGTTTTCCAACT(SEQ IDNO:434)、CTTCTCAAGGAGTATCTTTG(SEQ ID NO:435)、CAGACTAACAGCTGATCTCT(SEQ ID NO:436)、CACCGTGCGCGAGCCGAAGC(SEQ ID NO:437)、CTTCATCCATGTCCCTGCAA(SEQ ID NO:438)、GGCAATGCCTCGCCCTGCTT(SEQ ID NO:439)、ATTGAATCTATAAATTACTT(SEQ ID NO:440)、CTCTTTGTAGCAATTGTGAA(SEQ ID NO:441)、CTTCTTGAGGAGTATCTTTG(SEQ ID NO:442)、TTTTTGCATCGATGTTCATC(SEQ ID NO:443)、CAGCTCCATCAGGTCATTTA(SEQ ID NO:444)、GAGTGAGAACATGCAGTGTT(S EQ ID NO:445)、AGTCAGGAAACAACAGATGC(SEQ ID NO:446)、CGATAGTTTGCTGAGAATGA(SEQ ID NO:447)、AATTTTCAGCTTTTCTGCTC(SEQ ID NO:448)、ATACCCAGTAATGGGATTGC(SEQ ID NO:449)、GAGGAGCTGCGTTCCTTTGG(SEQ ID NO:450)、AATTGAACAATGAGAACACT(SEQ ID NO:451)、AATGCTAAATGACGAGTTAA(SEQ ID NO:452)、TTTTTTGCTTTCCATTTGCT(SEQ ID NO:453)、ATGAATGAAATGAAGTGAGA(SEQ ID NO:454)、ATTCTCAGCAAACTATCGCA(SEQ ID NO:455)、CAAGTTGGAAAACACTCTTC(SEQ ID NO:456)、ATCATTCTGATACCAAAGCC(SEQ ID NO:457)、ACAACCTACTCATCTGACAA(SEQ ID NO:458)、TAGCATCAACATCAACAAAA(SEQ ID NO:459)、CAGTTTCTTCCTAGCCTTGA(SEQ ID NO:460)、AATTTGGCTGTGAATCCATC(SEQ ID NO:461)、TTTGTGGTTTTATCTACCTT(SEQ ID NO:462)、GCTGATGGAGCTGAAAGCCA(SEQ ID NO:463)、TTAACTCGTCATTTAGCATT(SEQ ID NO:464)、TGATAGTTTGCTGAGAATGA(SEQ ID NO:465)、GTTTTGCCAGTATTTTATTG(SEQ ID NO:466)、ATCCAGCTTTGTTCTGTTGC(SEQ ID NO:467)、AAGAACTTGCTTTATGAATC(SEQ ID NO:468)、CCTGACCCCTTGCGCTTCCC(SEQ ID NO:469)、TTGGGAGGGTGTATGTGTCG(SEQ ID NO:470)、CAGACTAACAGCAGATCTCT(SEQ ID NO:471)、TTGCTGCCTGATCCTTCCTC(SEQ IDNO:472), TCTAAAATTGACCACATAAT(SEQ ID NO:473), CTCAAAGCCGCTCAACTACA(SEQ ID NO:474), ATACAAAAAATTAACTCAAGA(SEQ ID NO:475), ACAGAGGCACCTGGAAAAT(SEQ ID NO:476), TCACCAACATCAAAGACCAA(SEQ ID NO:475). NO:477) GTCCAGCTTTGTTCCGTTGC(SEQ ID NO:478), ATACCCAGGCAAACAGGGTC(SEQ ID NO:479),CGCCACACTGTCTTCCACAA(SEQ ID NO:480),CTTCCAATACTATGTTGAAT(SEQ ID NO:481),AGCAGCCGGGAAGCTCGAAC(SEQ ID NO:480). NO:482, ACTCCTATTCAACATAGTAT(SEQ ID NO:483), GTGTTTTACTTCCAATTATG(SEQ ID NO:484), AAAGGGATCAATTCAACAAG(SEQ ID NO:485), AATGAGACAGAAAGTTAACA(SEQ ID NO:486), GACGGACGCACCTGGAAAAT(SEQ ID NO:487, CTTGAGTTAATTTTTGTATA(SEQ ID NO:488), AAAATTTTCTCCCATGTTGT(SEQ ID NO:489), GAAATCCTCCAATAAAATAC(SEQ ID NO:490), TTTCTCCTGCCTGATTGCCC(SEQ ID NO:491), ATATTAGCCCTTTGTCAGAT(SEQ ID NO:491). NO:492, GGTAACCCAACCTTTCTCTC(SEQ ID NO:493), AAACTATCATCAGAGTGAAC(SEQ ID NO:494), AAAACAGATATATAGACCAA(SEQ ID NO:495), TGCCTCACCTGGGAAGCGCA(SEQ ID NO:496), TGCCATTGCTTTTGGTGTTT(SEQ ID NO:497)、AGGAAGATCTACCAAGCCAA(SEQ ID NO:498)、TGCCTTTTTTTGTTTTCCAT(SEQ ID NO:498).NO:499), ATTCTCAGCAAACTATCACA(SEQ ID NO:500), CTGGACTTTTTTTGGTTGGT(SEQ ID NO:501), CAGTTTCTTCCTAGCCTCGA(SEQ ID NO:502), TAGGAACACTTTTACACTGT(SEQ ID NO:503),ACGAGACTATATCCCACACC(SEQ ID NO:504)、GAATATTGCGCTTTTCAGAC(SEQ ID NO:505), TTTGAGTTCTTTGTAGATTC(SEQ ID NO:506), ATGCACATGTATGTTTATTG(SEQ ID NO:507), TCAGGGATTCAACTTCTTCC(SEQ ID NO:506). NO:508), ATGCACACATATGTTTATTG(SEQ ID NO:509), GCAGGGCATAGCTGAACAAA(SEQ ID NO:510), TCAGATCTCCAGCTGCATGC(SEQ ID NO:511), AATAACAAGTTCTGAAATTG(SEQ ID NO:512), TGTGAGATGATATCTCATAG(SEQ ID NO:513, ATCATCCTGATACCAAAACC(SEQ ID NO:514), AGGCCTCTGTTCTGTTCCAT(SEQ ID NO:515), TGACCCCCGAGTAGCCTAAC(SEQ ID NO:516), GCCCACGCCTATGTCCTGAA(SEQ ID NO:516). NO:517), TCAATTTCAGAACTTGTTAT(SEQ ID NO:518), TACCATTCAGGACATAGGCG(SEQ ID NO:519), CACCACATGTTCTCACTCAT(SEQ ID NO:520), AGGACCCTCTGAGCCAGGTG(SEQ ID NO:521), CATAATTGTCAGATTCACCA(SEQ ID NO:522) and GAAGACCTTAAATGACCTGA(SEQ ID NO:523).

[0034] Provided herein are methods of obtaining a sequence from a desired location, such as a LINE element. In some cases, the LINE element comprises a nucleotide polynucleotide comprising SEQ ID NO:1. In some cases, a portion of the LINE element is targeted, the portion having a sequence comprising SEQ ID NO:2. In some cases, the LINE element is targeted using a guide RNA having a sequence comprising SEQ ID NO:3.

[0035] Provided herein are methods for obtaining sequences flanking a desired position, such as an Alu element. In some cases, the Alu element comprises an Alu-Y element having a sequence comprising SEQ ID NO:4.

[0036] In some cases, the desired genomic location is amplified by a DNA polymerase, such as a strand-displacing DNA polymerase. In some cases, a DNA polymerase is used to amplify the desired genomic location. In some cases, the DNA polymerase requires that a primer sequence, such as a DNA primer or an RNA primer, be included in the tag.

[0037] The tag is inserted into the sample of genomic DNA by genome editing or gene targeting methods known in the art.In some cases, the tag is inserted into the genomic DNA of cells, such as cells isolated from patients or cultured cells.In some cases, the tag is inserted into the genomic DNA of cells isolated from cells or tissues, such as cells or tissue samples from patients.

[0038] Genome editing or gene targeting techniques are understood by those skilled in the art and include methods such as homologous recombination, clustered regularly interspaced short palindromic repeats (CRISPR), TAL effector nucleases (TALENS), zinc finger nucleases, transposons, and other methods. The result of any of these methods is the specific insertion of one or more nucleic acid tags, including at least one promoter sequence, into the genome.

[0039] In the methods described herein, the tag to be inserted into the desired genome location is a nucleic acid. Depending on the exact mechanism of genome targeting, the nucleic acid tag is RNA or DNA. In some cases, the nucleic acid tag is a RNA / DNA hybrid. The nucleic acid tag is prepared for gene targeting reaction by methods known to those skilled in the art. In some cases, the tag is synthesized by a nucleic acid synthesizer. In some cases, the tag is prepared by recombinant DNA technology. In some cases, the RNA nucleic acid tag is transcribed from a plasmid. Depending on the method of insertion, the sequence complementary to the desired genome location changes according to the method. In some cases, CRISPR requires the PAM sequence to be targeted, which must be located at the genome location.

[0040] In some cases, CRISPR is used to insert tagged nucleic acid sequences into specific locations in genomic DNA samples.CRISPR generally uses two components: guide RNA (gRNA) and non-specific CRISPR-associated endonuclease (Cas9).In some cases, CRISPR gRNA needs to modify the target sequence of about 20 nucleotides, which contains the scaffold sequence for Cas9 binding and the tag and genomic DNA sequence.

[0041] Also disclosed herein are methods that include inserting tagged nucleic acid sequences into CRISPR target sites in DNA samples. In these methods, CRISPR / CAS nuclease creates double-stranded breaks at target sites in genomes. Then, exonuclease is added to the reaction mixture that degrades one strand of the double-stranded break creating sticky ends with specific nucleic acid sequences. Alternatively, a second targeted CRISPR / CAS nuclease is used to create sticky ends instead of exonuclease. The tagged nucleic acid polynucleotide comprises a single-stranded nucleic acid having a portion that includes a transcription promoter, such as a T7 promoter, and a portion that includes a nucleic acid sequence that is complementary to the sticky end. Optionally, the tagged nucleic acid polynucleotide comprises a self-complementary portion that allows the tagged nucleic acid to form a hairpin.

[0042] <Linear amplification of nucleic acids> The method provided herein allows accurate and precise sequence information to be obtained from nucleic acid molecules with sequences known to those skilled in the art to be difficult to sequence.The method herein uses targeted nucleic acid sequences that are amplified in a linear manner directly from starting genomic DNA templates.As will be understood by those skilled in the art, genomic regions that are difficult to sequence have characteristics that are known to have increased replication error rates, such as insertions, deletions, and substitutions caused by DNA polymerases such as Taq polymerase.In amplification methods such as PCR, these errors are carried over with each round of amplification, creating amplification-specific sequencing errors that do not reflect the original template.

[0043] The methods disclosed herein include linear amplification, i.e., the generation of additional nucleic acid molecules identical to the original genomic DNA template, directly synthesized from the original template. In some cases, linear amplification is achieved using transcription, e.g., in vitro transcription of RNA from a specific genomic DNA location that is specifically tagged to contain a promoter sequence as described herein. Suitable RNA polymerases include, but are not limited to, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV. In some cases, RNA is transcribed by a single subunit RNA polymerase, RNA polymerase V. In some cases, the in vitro transcription reaction requires one or more ribonucleotides (ATP, GTP, UTP, and CTP) and a buffer suitable for RNA polymerase.

[0044] <Purification of linearly amplified nucleic acids> The methods disclosed herein provide for the purification of linear amplified nucleic acids from genomic DNA templates. In some cases, the purification method is an enzymatic method, whereby the genomic DNA template is digested using one or more DNases. Alternatively, the purification method is affinity-based purification, whereby the resulting amplified nucleic acids are labeled, and a reagent such as an antibody binds to the labeled amplified nucleic acids, and unbound genomic DNA templates are washed away from the bound amplified nucleic acids. The purification method is also considered to be a fluorescent-based sorting purification, whereby the fluorescently labeled amplified nucleic acids are sorted away from the unlabeled genomic DNA templates. Additional purification methods are included, whereby the amplified nucleic acids are purified from the amplification reaction after each round of amplification. In additional methods, the amplified nucleic acids are purified after the amplification reaction is completed.

[0045] The methods disclosed herein provide an amplified nucleic acid that is RNA. In cases where it is desirable to have a DNA sample for downstream processing in the method, one or more reverse transcriptases are used to make DNA copies from the RNA. Optionally, the RNA is polyadenylated before treatment with reverse transcriptase. Alternatively, the reverse transcriptase uses oligothymidine to prime the reverse transcriptase reaction. It is also contemplated that the reverse transcriptase uses a gene-specific primer to prime the reverse transcriptase reaction. Optionally, the reverse transcriptase uses a random hexamer primer to prime the reverse transcriptase reaction. It is also contemplated that the reverse transcriptase uses a buffer and deoxyribonucleotides.

[0046] <Border-adjacent libraries and sequence databases> Disclosed herein are nucleic acid libraries that contain molecules that contain the edges or boundaries of a mobile element and genomic sequences or sequences of other non-mobile elements that flank the mobile element, paired in a nucleic acid molecule such that the library member molecules have both the mobile element boundary and the sequences that flank the mobile element to identify the location of the mobile element within a genome or other nucleic acid source.

[0047] As discussed elsewhere in this disclosure, libraries consistent with this disclosure include molecules generated by repeated linear amplification of products directly from sample templates. Thus, such libraries do not suffer from differential amplification artifacts resulting from chain reaction-based amplification methods that involve early rounds of amplification to generate products that are used as templates in subsequent amplification reactions, resulting in early amplification errors propagating to later products. With linear amplification, particularly but not exclusively with RNA intermediaries, the amplification products are uniquely and unambiguously derived directly from the template. Because the amplification products do not serve as templates for the chain reaction amplification of library generation, errors in the generation of a particular amplification product do not propagate in subsequent reactions. Amplification errors do occur, but are unrelated to each other, individually rare, and easily recognized by comparison with related amplification products of the same template.

[0048] Often, libraries according to the present disclosure are derived from genomic DNA, although other nucleic acid sources are contemplated. Libraries according to the present disclosure often share common elements that are enriched for the mobile element boundaries and sequences adjacent to the boundaries, containing molecules relative to the genome or other nucleic acid sample from which the library is derived. That is, relative to the genome sample, a greater number of nucleic acid molecules contain both the mobile element boundaries and sequences adjacent to the boundaries, or a greater proportion of the total sequences in the library are adjacent to the mobile element boundaries.

[0049] The libraries herein include at least 100, 200, 500, 1,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, or more than 1,000,000 nucleic acid molecules. Some libraries disclosed herein include at least 10x, 20x, 50x, 100x, 200x, 500x, 1,000x, 2,000x, 5,000x, 10,000x, 20,000x, 50,000x, 100,000x, or more than 100,000x of chromosomes in a haploid complement of chromosomes of a nucleic acid sample.

[0050] In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99%, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the library constructs comprise both the mobile element boundary and sequences adjacent to the boundary.

[0051] A "sequence adjacent to a mobile element boundary" is variously understood to refer to a sequence in which the mobile element boundary is located less than 20kb, 15kb, 10kb, 9kb, 8kb, 7kb, 6kb, 5kb, 4kb, 3kb, 2kb, 1kb, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, or less than 100 bases (measured at a given base position) from the sequence.

[0052] In libraries consistent with the present disclosure, sequences adjacent to mobile element boundaries represent a greater proportion of the total sequences in the library than the relevant sample, such as the genomic sample, from which the library is generated. In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99% or more, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the library constructs comprise sequences adjacent to mobile element boundaries.

[0053] Also disclosed herein are nucleic acid libraries comprising molecules that contain the edges or borders of a repetitive region and sequences of genomic or other non-repetitive regions adjacent to the repetitive region, paired in a nucleic acid molecule such that the library member molecules have both the borders of the repetitive region and sequences adjacent to the repetitive region to identify the location of the repetitive region within a genome or other nucleic acid source.

[0054] Often, libraries according to the present disclosure are derived from genomic DNA, but other nucleic acid sources are also contemplated.Libraries according to the present disclosure often share common elements that are enriched for repeat region boundaries and sequences adjacent to the boundaries, containing molecules relative to the genome or other nucleic acid sample from which the library is derived.That is, relative to the genome sample, a greater number of nucleic acid molecules contain both repeat region boundaries and sequences adjacent to the boundaries, or a greater proportion of the total sequences of the library are adjacent to the repeat region boundaries.

[0055] In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99%, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the library constructs contain both the repeat region boundaries and sequences adjacent to the boundaries.

[0056] A "sequence adjacent to a repeat region boundary" is variously understood to refer to a sequence in which the repeat region boundary is located less than 20 kb, 15 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, or less than 100 bases (measured at a given base position) from the sequence.

[0057] In libraries consistent with the present disclosure, sequences adjacent to repeat region boundaries represent a greater proportion of the total sequences in the library than the relevant sample, such as the genomic sample, from which the library is generated. In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99% or more, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the library constructs comprise sequences adjacent to repeat region boundaries.

[0058] Libraries consistent with this disclosure include fragments that include both the repeat region boundaries and sequences adjacent to the boundaries, and that span at least 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or more. Some libraries consistent with the present disclosure include a plurality of fragments that include both the repeat region boundaries and sequences adjacent to the boundaries, such that the plurality of fragments exhibits an average fragment size of 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or greater. Some libraries consistent with the present disclosure include a plurality of fragments that include both the repeat region boundaries and sequences adjacent to the boundaries, such that the plurality of fragments exhibits a median fragment size of 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or greater.

[0059] Libraries as disclosed herein include RNA or DNA. Some libraries are generated from RNA transcription directed by an RNA polymerase promoter that is inserted, for example, selectively inserted, into a mobile element or other repeat region in a nucleic acid sample, such as a genomic DNA sample. Some libraries include molecules generated from this transcription, including RNA polymerase promoter sequences, repeat regions, such as mobile element sequences, and molecules that optionally include sequences adjacent to the mobile element or other repeat region, such as adjacent genomic sequences. Some libraries include RNA generated from RNA transcription directed by an inserted RNA polymerase promoter. Alternatively, many libraries include DNA generated by reverse transcription of a population of RNA molecules generated as described above.

[0060] A library as disclosed herein is generated from a template such as a genomic nucleic acid sample and reflects the genomic sequence adjacent to the repetitive region in the sample. In some embodiments, the repetitive element comprises a mobile element such as an Alu repeat or a transposon that is observed to rearrange to various positions throughout the genome. This rearrangement or transposition is often specific to the cell or cell population in the organism from which the genomic sample is derived. Alternatively, the library reflects the genomic sequence adjacent to the selected region of the genome. The library is derived from a sample, such as a genomic DNA sample from a cell population such as a tumor cell or a healthy cell. In some cases, the library is generated from genomic DNA derived from a single cell.

[0061] In particular, some mobile element insertion or transposition events are often associated with lineage-specific cellular defects, such as cell cycle or cell proliferation regulatory defects associated with cancer cell lines. To facilitate the identification of mobile element insertion events associated with cancer, libraries are generated from templates, such as genomic nucleic acid samples obtained from cancer or tumor cells or tissues, either alone or in combination with the generation of libraries from non-cancerous cells or tissues.

[0062] Libraries consistent with the present disclosure are optionally sequenced to determine sequences adjacent to repeats or repeat regions, such as mobile element boundaries or repeat adjacent sequences of repeat loci, such as HLA loci. Alternatively, libraries consistent with the present disclosure are optionally sequenced to determine sequences adjacent to selected genomic regions. Library constructs are sequenced using any sequencing approach disclosed elsewhere herein or otherwise known to one of skill in the art, such as shotgun sequencing, next generation sequencing by synthesis approaches, long molecule sequencing, such as PacBio, BioNano, or Oxford Nanopore sequencing.

[0063] The sequence databases created herein include nucleic acid sequences of libraries consistent with the present disclosure or implementation of methods consistent with the present disclosure. In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99%, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the database constructs contain both mobile element sequences and repeat elements, such as sequences adjacent to the boundaries.

[0064] In databases consistent with this disclosure, sequences adjacent to mobile element boundaries represent a greater percentage of total sequences in the library than the relevant sample, such as the genomic sample, from which the library is generated. In some cases, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more than 99%, such as 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, about 100%, or 100%, of the library constructs comprise sequences adjacent to repeat elements, such as mobile element boundaries.

[0065] Databases consistent with this disclosure include sequences that include both repeat region boundaries and sequences adjacent to the boundaries, and that span at least 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or more. Some databases consistent with the present disclosure include a plurality of sequences that include both repeat region boundaries and sequences adjacent to the boundaries, such that the plurality of sequences exhibits an average sequence length of 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or greater. Some databases consistent with the present disclosure include a plurality of sequences that include both repeat region boundaries and sequences adjacent to the boundaries, such that the plurality of sequences exhibits a median sequence length of 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000 bases or greater.

[0066] Databases as disclosed herein are in some cases fully sequenced, such that database entries contain end-to-end sequence information for the library molecules from which they are generated. Alternatively, in some cases, some or all of the database entries contain paired reads, whereby one member of the paired read contains a repeat element sequence, such as a mobile element sequence, and another member of the paired read contains a repeat-adjacent sequence, such that in some cases mobile element boundary positions are inferred without actually sequencing across the mobile element boundaries.

[0067] <Sequencing of Linearly Amplified Nucleic Acid> The method disclosed herein optionally includes sequencing the linearly amplified nucleic acid, such as the nucleic acid generated according to the production of the library as disclosed herein. In some cases, the method includes annealing the oligonucleotide required for sequencing to the linearly amplified nucleic acid. In some cases, the sequencing includes ligating the oligonucleotide required for sequencing to the linearly amplified nucleic acid. In some cases, the method includes utilizing an adaptor sequence or a portion thereof to sequence the linearly amplified nucleic acid.

[0068] Various methods of nucleic acid sequencing are well known and described in the art. The methods disclosed herein are consistent with a wide range of sequencing techniques.

[0069] Determination of the sequence of linearly amplified nucleic acids may be accomplished using techniques including, but not limited to, ion detection technology, DNA nanoball technology, nanopore-based sequencing technology, sequencing by hybridization (SBH), sequencing by ligation (SBL), quantitative incremental fluorescent nucleotide addition sequencing (QIFNAS), stepwise ligation and cleavage, fluorescence resonance energy transfer (FRET), and the like. It is believed that sequencing will be performed using a sequencing method selected from a variety of sequencing methods, including molecular beacons, TaqMan reporter probe digestion, pyrosequencing, fluorescent in situ sequencing (FISSEQ), FISSEQ beads, wobble sequencing, multiplex sequencing, polymerized colony (POLONY) sequencing; nanogrid rolling circle sequencing (ROLONY), allele-specific oligo ligation assays (e.g., oligo ligation assay (OLA), single template molecule OLA and rolling circle amplification (RCA) readout using ligated linear probes, single template molecule OLA and rolling circle amplification (RCA) readout using ligated padlock probes, and / or ligated circular padlock probes), and the like. Optionally, high throughput sequencing methods are utilized, such as cyclic array sequencing using platforms such as Roche 454, Illumina Solexa, ABI-SOLiD, ION Torrents, Complete Genomics, Pacific Bioscience, Helicos, and Polonator platforms.

[0070] The determination of the sequence of the linearly amplified nucleic acid may be optionally performed by next-generation sequencing (NGS) methods. NGS is applied to genome sequencing, genome resequencing, transcriptome analysis (RNA-Seq), DNA-protein interaction (ChIP-sequencing), and epigenome characterization. The contemplated methods disclosed herein include, but are not limited to, NGS methods selected from massively parallel signature sequencing (MPSS), Polony sequencing, 454 pyrosequencing, Ion Torrent semiconductor sequencing, Heliscope single molecule sequencing, single molecule real-time (SMRT) sequencing, and microfluidic Sanger sequencing.

[0071] <Mapping of genomic elements> The method disclosed herein may optionally comprise using the sequence obtained from the method provided herein to map genomic elements, such as mobile genetic elements.Alternatively, the method comprises inserting tags, such as nucleic acid tags, including promoters, such as T7 promoters, into genomic elements using genome DNA editing techniques, such as CRISPR. The RNA molecule is transcribed from the inserted tag, which allows linear amplification of RNA with the same sequence as the DNA adjacent to the genomic element. The sequence obtained from the linearly amplified nucleic acid allows finding the corresponding position in the genome by comparing the obtained sequence with the sequence available in the reference genome, for example the human genome sequence, thereby mapping the insertion of the genomic element. Optionally, the insertion of the genomic element is mapped to the coding sequence of the gene. Alternatively, the insertion of the genomic element is mapped to the intron of the gene. It is also conceivable that the insertion of the genomic element is mapped to the promoter or enhancer sequence of the gene. Optionally, the insertion of the genomic element is mapped to the 5' or 3' untranslated region of the gene.

[0072] Insertion of a genomic element, e.g., a mobile genetic element, near or into a gene, e.g., into a coding sequence, in an intron, into a promoter or enhancer, or into a 5' or 3' untranslated region, often causes disruption of the function of the gene. Disruption of gene function by insertion of a genetic element, e.g., a mobile genetic element, can occur by any one of a number of mechanisms known to those skilled in the art. Often, gene function is disrupted by insertion into a coding sequence, thereby disrupting or otherwise altering the amino acid sequence of the gene. Alternatively, gene function is disrupted by insertion into an intron or into a 5' or 3' untranslated region, thereby affecting gene expression downstream of transcription, e.g., RNA splicing, RNA transport, and RNA translation. Optionally, gene function is disrupted by insertion into a promoter or enhancer element, thereby affecting the assembly of gene regulatory proteins onto the chromatin and transcription of the gene.

[0073] The insertion of a genomic element and the resulting disruption of the function of one or more genes often causes disease. Optionally, the disease is cancer. Alternatively, the disease is aging. It is contemplated herein that mapping the insertion of a genomic element can inform medical personnel information, such as diagnostic information, that helps medical personnel make decisions regarding the treatment of an individual. Optionally, mapping the insertion of a genetic element can provide a diagnosis for cancer. Alternatively, mapping the insertion of a genomic element can provide a diagnosis for aging.

[0074] In some cases, the present specification provides a method for diagnosing cancer in a subject, the method includes the steps of obtaining a sample from a subject, isolating genomic DNA from the sample, contacting the genomic DNA with a composition that inserts a tag polynucleotide containing a T7 promoter into the genomic element of the genomic DNA sample, carrying out in vitro transcription with T7 RNA polymerase to obtain a linear amplified RNA sample from the genomic DNA, treating the sample with DNase to remove genomic DNA from the sample, polyadenylation and reverse transcription of the RNA sample to obtain cDNA, treating the sample with RNaseH to remove RNA from the sample, and subjecting the resulting cDNA sample to DNA sequencing using next-generation sequencing methods, resulting in sequences adjacent to the genomic element.The sequences adjacent to the genomic element are searched in bioinformatics databases such as BLAST to determine the position of insertion of the genomic element and therefore to determine the identity of the gene near the insertion.

[0075] Sequencing Challenging Genomic Regions Provided herein is a method for sequencing the region of genome that reveals the difficulty or problem of sequencing using conventional sequencing methods, that is, difficult to sequence polynucleotide.In some cases, the difficulty of sequencing polynucleotide comprises low complexity polynucleotide, repeat polynucleotide, di-nucleotide repeat polynucleotide, tri-nucleotide repeat polynucleotide, GC-rich polynucleotide, polynucleotide with secondary structure, polynucleotide with 5'-YGN1-2AR motif, and combinations thereof.In some cases, the difficulty of sequencing polynucleotide comprises trinucleotide repeat, such as CAG repeat, CGG repeat, GCC repeat, GAA repeat, or CTG repeat. In some cases, the difficulty in sequencing the polynucleotide involves genes that are difficult to sequence, such as HLA genes, including the HLA-A gene, the HLA-B gene, the HLA-C gene, the HLA-E gene, the HLA-F gene, the HLA-G gene, the HLA-DP gene, the HLA-DQ gene, or the HLA-DR gene.

[0076] In some cases, obtaining the sequence of a gene that is difficult to sequence, such as an HLA gene, allows medical personnel to obtain the patient's genotype at that genomic locus, e.g., HLA genotype, HLA type. In some cases, the HLA type is useful for determining compatibility for organ or tissue transplantation, e.g., bone marrow transplantation, heart transplantation, lung transplantation, liver transplantation, kidney transplantation, pancreas transplantation, intestine transplantation, thymus transplantation, cornea transplantation, skin transplantation, heart valve transplantation, nerve transplantation, or vein transplantation.

[0077] Alternatively, the nucleic acid molecules that present a problem for sequencing include CYP2D6 genes and their homologs.In addition, the VDJ regions of immunoglobulin genes present a problem for sequencing.The methods herein are useful for sequencing these genes and genomic regions.

[0078] <Definition> A partial list of relevant definitions follows:

[0079] An "amplified nucleic acid" or "amplified polynucleotide" includes a nucleic acid or polynucleotide molecule whose amount has been increased by an in vitro performed nucleic acid amplification or replication method compared to its starting amount. For example, an amplified nucleic acid can optionally amplify DNA in an exponential manner in some cases (e.g., 2 times in n cycles). n Amplified nucleic acids can alternatively result from linear amplification, where the amount of amplified nucleic acid increases linearly over time, which in some cases produces products synthesized directly from the sample.

[0080] "Amplification product" refers to the product resulting from an amplification reaction, such as the polymerase chain reaction or linear amplification.

[0081] An "amplicon" is a polynucleotide or nucleic acid that is the source and / or product of a natural or artificial amplification or replication event.

[0082] The term "biological sample" or "sample" generally refers to a sample or part separated from a biological entity. A biological sample may in some cases represent the nature of a whole biological entity, examples of which include, but are not limited to, bodily fluids, dissociated tumor specimens, cultured cells, and combinations thereof. A biological sample may be obtained from one or more individuals. One or more biological samples may be obtained from the same individual. In one non-limiting example, a first sample is obtained from the individual's blood and a second sample is obtained from the individual's tumor biopsy specimen. Examples of biological samples include, but are not limited to, blood, serum, plasma, nasal swabs or nasopharyngeal washes, saliva, urine, gastric fluid, spinal fluid, tears, stool, mucus, sweat, earwax, oil, glandular secretions, cerebrospinal fluid, tissue, semen, vaginal fluid, interstitial fluid, including interstitial fluid from tumor tissue, eye fluid, spinal fluid, throat swabs, breath, hair, fingernails, skin, biopsy specimens, placental fluid, amniotic fluid, umbilical cord blood, emphatic fluids, cavity fluids, sputum, pus, bacterial flora, meconium, breast milk, and / or other secretions. In some cases, blood samples contain circulating tumor cells, or cell-free DNA, such as tumor DNA or fetal DNA. Samples include nasopharyngeal washes. Examples of tissue samples from a subject include, but are not limited to, connective tissue, muscle tissue, nerve tissue, epithelial tissue, cartilage, cancer or tumor samples, or bone. Samples are obtained from humans or animals. The sample may be obtained from a mammal, including a vertebrate such as a mouse, monkey, human, farm animal, sport animal, or pet. The sample may be obtained from a living or dead subject. The sample may be obtained fresh from the subject or may have undergone some form of prior processing, storage, or transportation.

[0083] Nucleic acid sample as used herein refers to the nucleic acid sample whose sequence information is determined.In some cases, nucleic acid sample is extracted from the above biological sample.Alternatively, in some cases, nucleic acid sample is artificially synthesized, synthetic, or de novo synthesized.In some cases, DNA sample is genomic, while in other cases, DNA sample is derived from reverse transcribed RNA sample.

[0084] "Body fluid" generally describes a fluid or secretion originating from the body of a subject. In some cases, the body fluid is a mixture of more than one type of body fluid mixed together. Some non-limiting examples of body fluids include, but are not limited to, blood, urine, bone marrow, cerebrospinal fluid, pleural fluid, lymphatic fluid, amniotic fluid, peritoneal fluid, sputum, or combinations thereof.

[0085] "Complementary" or "complementarity", or in some cases more precisely "reverse complementarity", refers to nucleic acid molecules related by base pairing. Complementary nucleotides are generally A and T (or A and U), or C and G (or G and U). Functionally, two single-stranded RNA or DNA molecules are complementary when they form a double-stranded molecule by hydrogen bond-mediated base pairing. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and with appropriate nucleotide insertions or deletions, pair with at least about 90% to about 95% or more complementarity, and more preferably about 98% to about 100% complementarity, and even more preferably 100% complementarity. Alternatively, substantial complementarity exists when an RNA or DNA strand hybridizes to its complement under selective hybridization conditions. Selective hybridization conditions may or may not include, but are not limited to, stringent hybridization conditions. Hybridization temperatures are generally determined by the melting temperature (T m ) at least about 2° C. to about 6° C. lower.

[0086] "Barcode" or "molecular barcode" includes a substance for labeling. Barcodes label molecules such as nucleic acids or polypeptides. The substance for labeling is associated with information. Barcodes in some cases are referred to as sequence identifiers (e.g., sequence-based barcodes or sequence indexes). In some cases, barcodes include specific nucleotide sequences. Barcodes are used as identifiers. Barcodes are alternatively different size molecules or different end points of the same molecule. Barcodes include specific sequences within molecules and different end sequences. For example, a molecule that is amplified from the same primer and has 25 nucleotide positions is different from a molecule that is amplified and has 27 nucleotide positions. Additional positions of a 27-mer sequence are optionally considered barcodes. Barcodes are alternatively incorporated into polynucleotides. Barcodes are incorporated into polynucleotides in some cases by a number of methods. Some non-limiting methods of incorporating barcodes include molecular biology methods. Some non-limiting examples of molecular biology methods that incorporate barcodes are primer (e.g., primer extension of the tail), probe (i.e., extension to a probe by ligation), or ligation (i.e., ligation of a known sequence to the molecule) methods. In some cases, the barcode is biotinylated. Biotinylated barcodes are optionally used as a means of purification. Purification of biotinylated molecules is achieved by methods including, but not limited to, immunoprecipitation. In some cases, biotin is added at the target site and the sample DNA is sheared or otherwise cleaved, for example, by an endonuclease, to generate a sample sequence that is optionally at least 10 kilobases in length.

[0087] The barcode may be variously incorporated into any region of the guide RNA or polynucleotide. In some cases, the region into which the barcode is incorporated is known. Alternatively, the region is not known. The barcode may be added at a position along the guide RNA. In some cases, the barcode may be added to the 5' end of the guide RNA. Alternatively, the barcode may be added to the 3' end of the guide RNA. In some cases, the barcode may be added between the 5' and 3' ends of the guide RNA. The barcode may be added along with one or more other known sequences. One non-limiting example is the addition of a barcode with a sequence adapter.

[0088] The barcode is considered to be associated with information. Some non-limiting examples of the types of information that the barcode is associated with include: the source of the sample; the orientation of the sample; the area or container in which the sample was processed; adjacent polynucleotides; or combinations thereof.

[0089] In some cases, barcodes are made from combinations of sequences (different from combinatorial barcodes) and are used to identify different template molecules or single strands from which the molecular labels and copies of the samples or genomic coordinates and strands are derived. In some cases, the sample identifier, genomic coordinates, and specific labels for each biomolecule are amplified together. Barcode, synthetic code, or label information is derived from the sequence composition of the code (allowing for error or error correction), the length of the code, the orientation of the code, the position of the code within the molecule, and in combination with other natural or synthetic codes.

[0090] In some cases, the incorporation of a barcode into a nucleic acid molecule indicates that the nucleic acid was present in a given sample at a given time period. In some cases, contiguous adjacent nucleic acid sequences that share a common barcode or a common pair of barcodes are inferred to be derived from a common molecule, particularly when the sample is diluted below the average of the haploid genome by 2x, 1.5x, 1x, 0.7x, 0.5x, or 0.3x prior to the introduction of the barcode.

[0091] The barcode is considered herein to be added prior to storage of the sample. When the stored sample is sequenced, the barcode is sequenced along with the remainder of the polynucleotide. The barcode is optionally used to associate the sequenced fragment with the source of the sample.

[0092] Barcodes are alternatively used to identify the strandedness of a sample. In some cases, one or more barcodes are used together. Two or more barcodes are alternatively adjacent to each other, non-adjacent, or a combination thereof. Adapter orientation is often used to determine twist. For example, if the "A" adapter is always 5'-3' in the first primer extension reaction, then reads starting from the A adapter are assumed to be compliment to the originally primed strand.

[0093] Barcodes are contemplated herein for use in combinatorial labeling.

[0094] As used herein, standard single-letter amino acid residue abbreviations, as known in the art, are used to refer to the twenty amino acids involved in cellular ribosome-facilitated polypeptide synthesis.

[0095] "Combinatorial labeling" is a method herein in which two or more barcodes are used to label a molecule. The two or more barcodes label a polynucleotide. Each barcode is associated with information, in some cases alone. Alternatively, a combination of barcodes is associated with information together. In some cases, a combination of barcodes is used together to determine in randomly amplified molecules that the amplification occurred from the original sample template, rather than a synthetic copy of the sample template. In some cases, the length of one barcode combined with the sequence of another barcode is used to label a polynucleotide. In some cases, the length of one barcode combined with the orientation of another barcode is used to label a polynucleotide. In other cases, the sequence of one barcode is used with the orientation of another barcode to label a polynucleotide. In some cases, the sequence of the first and second barcodes combined with the distance between nucleotides is used to label or identify a polynucleotide. In some cases, the sequences of the first and second barcodes in combination with the inter-nucleotide distance and inter-nucleotide identity are used to label or identify a polynucleotide.

[0096] "Degenerate" refers to a nucleic acid or a region of a nucleic acid that is composed of random bases. The terms "degenerate" or "random" are used interchangeably when referring to a nucleic acid sequence (e.g., "degenerate primer" or "random primer" or "degenerate probe" or "random probe"). A degenerate region is of variable length. In some cases, a degenerate region includes some portion of the entire nucleic acid (e.g., semi-degenerate primer). Alternatively, a degenerate region includes the entire nucleic acid (e.g., "degenerate primer"). A degenerate nucleic acid mixture, or a semi-degenerate nucleic acid mixture, is composed of all possible base pair combinations, less than all possible base pair combinations, or some combinations of base pairs, a few combinations of base pairs, or a single base pair combination. A degenerate primer mixture, or a semi-degenerate primer mixture, includes a mixture of similar but non-identical primers.

[0097] "Double stranded" refers to two polynucleotide strands that are annealed by complementary base pairing, such as in reverse complementary orientation, in some cases.

[0098] "Known oligonucleotide sequence" or "known oligonucleotide" or "known sequence" refers to a known polynucleotide sequence. In some cases, the known oligonucleotide sequence corresponds to a designed oligonucleotide, e.g., a universal primer for next generation sequencing platforms (e.g., Illumina, 454), a probe, an adapter, a tag, a primer, a molecular barcode sequence, an identifier. The known sequence optionally includes a portion of a primer. The known oligonucleotide sequence, in some cases, is not actually known to a particular user, but is structurally known, e.g., by being stored as computer-available data. The known sequence is optionally a trade secret that is not actually known or a secret to one or more users, but is known to an entity that designed a particular component, kit, device, or software of an experiment that the user is using.

[0099] A "library" refers to a collection of nucleic acids in some cases. A library optionally contains one or more target fragments. In some cases, the target fragments include amplified nucleic acids. In other cases, the target fragments include non-amplified nucleic acids. A library optionally contains nucleic acids with one or more known oligonucleotide sequences added to the 3' end, the 5' end, or both the 3' and 5' ends. A library is optionally prepared such that the fragments contain known oligonucleotide sequences that identify the source of the library (e.g., a molecular identifier barcode that identifies the patient or DNA source). In some cases, two or more libraries are pooled to create a library pool. Libraries are optionally generated using other kits and techniques, such as transposon-mediated labeling, or "tagmentation" as known in the art. Kits are commercially available. One non-limiting example of a kit is the Illumina NEXTERA kit (Illumina, San Diego, CA).

[0100] "Locus specific" or "loci specific" refers, in some cases, to one or more loci that correspond to a position in a nucleic acid molecule (e.g., a location in a chromosome or genome). In some cases, the locus is associated with a genotype. In some cases, the locus is directly isolated and enriched from a sample, for example, based on hybridization and / or other sequence-based techniques, or alternatively, selectively amplified using the sample as a template prior to detection of the sequence. In some cases, the locus is selected based on variation in DNA levels between individuals, specificity for a particular chromosome, CG content and / or required amplification conditions of the selected locus, or other characteristics that will be apparent to one of skill in the art upon reading this disclosure. A locus optionally refers to a specific genomic coordinate or position in a genome as indicated by a reference sequence for that genome.

[0101] A "long nucleic acid" refers, in some cases, to a polynucleotide that is longer than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 kilobases.

[0102] The term "melting temperature" or "T m " generally refers to the temperature at which a population of double-stranded nucleic acid molecules is half-dissociated into single strands. m The equation for calculating T is well known in the art. m One equation that gives a quick estimate of the value is: T m =81.5+16.6(log 10[Na + ])0.41(%[G+C])-675 / n-1.0m, When a nucleic acid is in an aqueous solution having a cation concentration of 0.5M or less, the (G+C) content is between 30% and 70%, n is the number of bases, and m is the percentage of base pair mismatches (see, e.g., Sambrook J et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press (2001)). Other criteria include more sophisticated calculations, which include the T m For the calculation of takes into account sequence features in addition to structural features.

[0103] "Nucleotide" refers to a base-sugar-phosphate combination. Nucleotides are the monomeric units of nucleic acid sequences (e.g., DNA and RNA). The term nucleotide includes, for example, naturally occurring and non-naturally occurring ribonucleoside triphosphates ATP, TTP, UTP, CTG, GTP, and ITP, and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [aS]dATP, 7-deaza-dGTP, and 7-deaza-dATP, and nucleotide derivatives that, for example, confer nuclease resistance to nucleic acid molecules that contain them. The term nucleotide as used herein also refers to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrative examples of dideoxyribonucleoside triphosphates include, for example, ddATP, ddCTP, ddGTP, ddITP, ddUTP, and ddTTP.

[0104] "Polymerase" refers to an enzyme that links individual nucleotides together into a chain, using another strand as a template.

[0105] "Polymerase chain reaction" or "PCR" refers to a technique for replicating a specific number of selected DNA in vitro, even in the presence of excess non-specific DNA. A primer is added to the selected DNA, where it initiates copies of the selected DNA using nucleotides and typically Taq polymerase or the like. By cycling the temperature, the selected DNA is repeatedly denatured and copied. A single copy of the selected DNA is amplified to obtain thousands, millions, or billions of copies, in some cases, even if mixed with other random DNA. Polymerase chain reaction is used to detect and measure very small amounts of DNA and to create customized numbers of DNA.

[0106] The term "polynucleotide" or "nucleic acid" includes, but is not limited to, various DNA, RNA molecules, derivatives or combinations thereof. These include species such as dNTPs, ddNTPs, DNA, RNA, peptide nucleic acids, cDNA, dsDNA, ssDNA, plasmid DNA, cosmid DNA, chromosomal DNA, genomic DNA, viral DNA, bacterial DNA, mtDNA (mitochondrial DNA), mRNA, rRNA, tRNA, nRNA, siRNA, snRNA, snoRNA, scaRNA, microRNA, dsRNA, ribozymes, riboswitches and viral RNA.

[0107] "Primer" generally refers to an oligonucleotide used to prime, for example, nucleotide extension, ligation, and / or synthesis, such as in the synthesis step of a polymerase chain reaction or in primer extension techniques used in certain sequencing reactions. Primers are alternatively used in hybridization techniques as a means to provide a locus complementarity to a capture oligonucleotide for detection of a specific nucleic acid region.

[0108] "Primer extension product" refers to the product resulting from a primer extension reaction using a contiguous polynucleotide as a template and a primer that is complementary or partially complementary to the contiguous sequence.

[0109] "Sequencing," "sequence determination," and the like generally refer to all biochemical methods that can be used to determine the order of nucleotide bases in a nucleic acid.

[0110] "Contig" refers to a nucleotide sequence constructed from two or more constituent nucleotide sequences that share common or overlapping regions of sequence homology. For example, the nucleotide sequences of two or more nucleic acid fragments are compared and aligned to identify common or overlapping sequences. If common or overlapping sequences exist between two or more nucleic acid fragments, the sequences (and thus their corresponding nucleic acid fragments) are constructed into a single contiguous nucleotide sequence.

[0111] The term "biotin," as used herein, is intended to refer to biotin (5-[(3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl]pentanoic acid) and all biotin derivatives and analogs. Such derivatives and analogs are substances that form a complex with the biotin-binding pocket of native or modified streptavidin or avidin. Such compounds include, for example, affinity peptides of iminobiotin, desthiobiotin, and streptavidin, as well as biotin-.epsilon.-N-lysine, biocytin hydrazide, amino or sulfhydryl derivatives of 2-iminobiotin and biotinyl-ε-aminocaproic acid-N-hydroxysuccinimide ester, sulfo-succinimido-iminobiotin, biotin bromoacetyl hydrazide, p-diazobenzoyl biocytin, 3-(N-maleimidopropionyl) biocytin. "Streptavidin" refers to a protein or peptide that binds to biotin, including, but not limited to, native egg white avidin, recombinant avidin, deglycosylated forms of avidin, bacterial streptavidin, recombinant streptavidin, truncated streptavidin, and / or derivatives thereof.

[0112] "Subject" as used herein refers to a currently living organism or a once living or real organism that is a source of nucleic acid and, in some cases, has a genome that replicates at will. The methods, kits, and / or compositions of the present disclosure are considered herein to be applied to one or more unicellular or multicellular subjects, including, but not limited to, microorganisms such as bacteria and yeast; and animals, including, but not limited to, humans; laboratory animals, such as mice, rats, monkeys, and chimpanzees; domestic animals, such as dogs and cats, and agricultural animals, such as cows, horses, pigs, sheep, and goats. The methods of the present disclosure are, in some cases, applied to pathogens or infectious agents, such as viruses or virus particles, or one or more cells infected by one or more viruses. In some cases, the subject is a fully synthetic organism.

[0113] A "support" is understood herein to be a solid, semi-solid, bead, or surface. A support is optionally mobile or fixed in solution.

[0114] The term "unique identifier" includes, but is not limited to, a molecular barcode, or a percentage of a nucleic acid in a mixture, such as dUTP.

[0115] "Repetitive sequences" as used herein refer to sequences that do not uniquely map to a single location in a nucleic acid sequence dataset. Some repetitive sequences are optionally conceptualized as integer or fractional multiples of a given size and exact or approximate repeat unit of sequence.

[0116] A "palindrome" or "palindromic sequence" as used herein refers to a nucleic acid sequence that is the same whether leading 5' (five prime) to 3' (three prime) on one strand forming a double helix or 5' to 3' on the complementary strand.

[0117] "Inverted sequence" as used herein refers to a sequence that is the reverse or inverse complement of another sequence. A sequence is inverted if, upon rotation of the molecule found at 180 degrees (conceptually), the sequence read in the same direction is the same sequence.

[0118] "Haplotype" as used herein refers to a set of specific alleles in a cluster of closely linked genes on a chromosome that are likely to be inherited together.

[0119] A "subhaplotype" as used herein refers to a subset of genes or a portion of a haplotype.

[0120] The term "about" as used herein in connection with numbers refers to the number plus or minus 10%.

[0121] As used herein, the term "comprise" is inclusive, to indicate that in the context of at least one element, other unrecited elements may be included.

[0122] As used herein, a repeat or repeat region refers to a discrete genomic or other nucleic acid segment that is locally recurrent at a given locus or dispersed throughout a nucleic acid sample, such as a genomic sample. Exemplary repeat segments include regions within the HLA locus, cyp2d6, VDJ regions, and mobile elements such as Alu repeats and LINE elements.

[0123] Before the methods, compositions, and kits of the present invention are described in more detail, it should be understood that the present invention is not limited to the specific methods, compositions, or kits described, which may, of course, vary. It should also be understood that the terms used herein are merely for the purpose of describing certain embodiments, and are not intended to be limiting, since the scope of the present invention is limited only by the appended claims as interpreted herein. Examples are set forth to provide those skilled in the art with a more complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as the invention, nor are the following experiments intended to represent all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.), but some experimental error and deviation should be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees Celsius, and pressure is near atmospheric pressure.

[0124] Where a range of values ​​is provided, it is understood that, between the upper and lower limits of that range, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, each intervening value is specifically disclosed. Each smaller range between a stated or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges are independently included or excluded in the range, and each range in which either or both of the upper and lower limits are included in the smaller range, or neither, is also encompassed within the invention, subject to the specifically excluded upper and lower limits in the stated range. When a stated range includes one or both of the upper and lower limits, ranges excluding either or both of those included upper and lower limits are also encompassed within the invention.

[0125] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Although any methods or materials similar or equivalent to those described herein can be optionally used in the practice or testing of the present invention, possible and preferred methods and materials are described herein. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials associated with the publications cited. It will be understood that the present disclosure supersedes any disclosure of the incorporated publications to the extent of any conflict.

[0126] As will be apparent to one of ordinary skill in the art upon review of this disclosure, each of the individual embodiments described and illustrated herein has separate components and features which may be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0127] As used in this specification and the appended claims, the singular forms "a," "an," and "the" are understood to include the plural forms unless the context clearly indicates otherwise. Thus, for example, a reference to "a cell" includes a plurality of such cells, and a reference to "the peptide" includes a reference to one or more peptides and equivalents thereof, such as polypeptides known to those skilled in the art.

[0128] Looking at the diagram, we see the following:

[0129] Figure 1 shows the DNA sequence (SEQ ID NO:1) of a typical human LINE1 (L1.4) repeat element. The 5'-3' of the PAM sequence in Figure 1 is highlighted.

[0130] Figure 2 shows a typical consensus sequence of L1HA: diagnostic sequence at the 3' end of a LINE-1 element (SEQ ID NO:2). The PAM sequence is highlighted. Complementary sequence of an example guide RNA BOLD.

[0131] FIG. 3 shows an exemplary guide RNA sequence (SEQ ID NO:3).

[0132] Figure 4 shows a typical Alu-Y sequence (SEQ ID NO:4). The PAM sequence is highlighted in this figure.

[0133] Figure 5 shows a typical CRISPR induces insertion of a target-specific T7 promoter sequence. The polymeric double-stranded genomic DNA is bound to the CRISPR / CAS components, including a target-specific guide RNA, a CAS9 protein, a donor DNA (containing a T7 promoter), and a ligase. This figure shows that the T7 promoter is specifically inserted into the target DNA base sequence.

[0134] Figure 6 shows a typical in vitro transcription of target DNA to generate amplified RNA copies of the target template. The RNA molecules are optionally fragmented and converted into short-read sequencer libraries, or polyA is formed at the ends and reverse transcribed into full-length cDNA. This figure shows that full-length cDNA molecules are converted into long-read sequencer libraries.

[0135] Figure 7 shows a typical T7 promoter specifically inserted upstream and downstream of the target sequence. In vitro transcription occurs over 10 kb in both directions covering the target locus.

[0136] Figure 8 shows alternative donor DNA constructs. These constructs can include promoter sequences, such as the T7 promoter, adapter / primer complementary sequences, and random sequences.

[0137] Figure 9 shows the results of linear amplification of genomic sequences flanking the inserted T7 RNA polymerase site in the samples. Results are shown for the two enzymes treated for 2, 4, 6, or 12 hours on 1 ng of template diluted to 2 ng / uL. In each result, the Y-axis shows fluorescence units ranging from 0.0 up to 1.0, or in some cases 2.0. The X-axis represents the length of the library construct in nucleotides on a logarithmic scale labeled 25 ntm 500 nt and 4000 nt. The results show that libraries with median size components between 500 bases and 2 kb are generated mechanically through linear amplification guided by an RNA promoter inserted in the sample nucleic acid. In vitro transcription was performed in four separate intervals using MEGAscript and the AmpliScribe T7 RNA polymerase kit. Reactions were performed at 2, 4, 6, or 12 hour intervals. 1 ng of DNA was used per reaction. Reactions were incubated with DNAse for 1 hour after transcription. RNA was quantified using the Qubit High Sensitivity RNA Assay kit. RNA analysis was performed using a High Sensitivity Pico mRNA Bioanalyzer.

[0138] Turning to Figure 10, we see the following: Bioanalyzer traces for size-selected RNA in vitro transcribed samples are presented. The X-axis shows the length in nucleotides [nt] on a logarithmic scale with 25, 500 and 4000 nucleotides shown. The Y-axis shows fluorescence units [FU] ranging from 0-20 with 10 intervals (top and middle rows); 0-40 with 20 intervals (middle row right), or 0-4 with 2 intervals (bottom row left), or 0-3 with 1 interval (bottom row right). Results are shown for Ampliscribe and MEGAscript RNA polymerases. Samples were diluted to 2ng / uL and processed on day 2. Results show that in vitro transcribed samples are easily size-selected to eliminate smaller components.

[0139] Turning to Figure 11, the RNA from Figure 10 is seen run on a denaturing agarose gel. The hierarchy on the right shows sizes of 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6 and 9 kb. Sample lanes from left to right are MEGAscript control, MEGAscript 17nt exclusion, MEGAscript 200nt exclusion, MEGAscript 65C incubation + 17nt exclusion, followed by Ampliscribe control, Ampliscribe 17nt exclusion, Ampliscribe 200nt exclusion, and Ampliscribe 65C incubation + 17nt exclusion. The results show that the in vitro transcribed samples are easily size selected to exclude smaller components.

[0140] <Partial List of Numbered Embodiments> The disclosure herein is further defined with respect to the following partial list of numbered embodiments: 1. A method for determining a sequence adjacent to a region of a known sequence of a nucleic acid molecule, the method comprising: a) attaching a nucleic acid fragment comprising a promoter sequence to the known region of the nucleic acid molecule; b) contacting the nucleic acid fragment with an NA polymerase directed by the promoter; and c) synthesizing a plurality of RNA molecules; wherein a consensus sequence of the plurality of RNA molecules represents a sequence adjacent to the known region of the nucleic acid molecule. 2. The method of embodiment 1, wherein the consensus sequence is at least 10 kilobases in length. 3. The method of any one of embodiments 1 or 2, comprising treating the nucleic acid molecule with DNase after synthesis of the plurality of RNA molecules. 4. The method of any one of embodiments 1-3, comprising reverse transcribing the plurality of RNA molecules. 5. The method of any one of embodiments 1-4, comprising determining the nucleic acid sequence of the plurality of RNA molecules. 6. The method of any one of embodiments 1-5, wherein the consensus sequence of the plurality of RNA molecules comprises a sequence of a molecule directly synthesized from the nucleic acid molecule. 7. The method of any one of embodiments 1 to 6, wherein the attaching step comprises inserting a nucleic acid fragment comprising a promoter sequence into a known region of the nucleic acid molecule. 8. The method of any one of embodiments 1 to 7, wherein the attaching step comprises inserting a nucleic acid fragment comprising a promoter sequence into a region of known sequence of the nucleic acid molecule. 9. The method of any one of embodiments 1 to 8, wherein the attaching step comprises sequence-specific cleavage of a region of known sequence of the nucleic acid molecule. 10. The method of any one of embodiments 1 to 9, wherein the attaching step comprises contacting a CRISPR nucleic acid protein complex with a known region of the nucleic acid molecule. 11. The method of embodiment 10, wherein the CRISPR nucleic acid protein complex comprises a guide RNA comprising SEQ ID NO:3. 12. The method of any one of embodiments 1 to 11, wherein the attaching step comprises ligating a nucleic acid fragment comprising a promoter sequence. 13. The method of any one of embodiments 1 to 12, wherein the nucleic acid fragment comprising a promoter sequence comprises a viral promoter.14. The method of embodiment 13, wherein the viral promoter binds a viral RNA polymerase and is at least one promoter selected from the list consisting of T7, T3, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 15. The method of any one of embodiments 1-12, wherein the nucleic acid fragment comprising the promoter sequence comprises a bacterial promoter. 16. The method of embodiment 15, wherein the bacterial promoter binds a bacterial RNA polymerase and is at least one promoter selected from the list consisting of araBAD, trp, lac, and Ptac. 17. The method of any one of embodiments 1-12, wherein the nucleic acid fragment comprising the promoter sequence comprises a eukaryotic promoter. 18. The method of embodiment 17, wherein the eukaryotic promoter binds a eukaryotic RNA polymerase and is at least one promoter selected from the list consisting of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 19. The method of embodiment 17, wherein the eukaryotic promoter is at least one promoter selected from the list consisting of an RNA pol I promoter, an RNA pol II promoter, and an RNA pol III promoter. 20. The method of any one of embodiments 1 to 19, wherein the known region of the nucleic acid molecule comprises a repetitive element. 21. The method of embodiment 20, wherein the repetitive element comprises a mobile insertion element. 22. The method of embodiment 20, wherein the repetitive element comprises at least one of a LINE element, a SINE element, an Alu repeat, a transposon, a retrotransposon, a centromeric repeat, and a telomeric repeat. 23. The method of embodiment 20, wherein the LINE element comprises SEQ ID NO: 1. 24. A method of determining a plurality of sequences flanking a locus in a nucleic acid sample, the method comprising the steps of a) inserting a nucleic acid comprising a promoter into the element, b) generating a plurality of nucleic acid molecules directed by the promoter, and c) determining the sequence of the plurality of nucleic acid molecules, wherein the nucleic acid molecules are synthesized directly from the nucleic acid sample, and wherein the plurality of nucleic acid molecules spans the sequences flanking the locus.25. The method of embodiment 24, wherein the nucleic acid molecule comprises RNA. 26. The method of embodiment 24, wherein the nucleic acid molecule is not capable of stimulating nucleic acid synthesis. 27. The method of embodiment 24, wherein the nucleic acid sample comprises cancer cell nucleic acid. 28. The method of embodiment 24, wherein the nucleic acid sample comprises a single nuclear genome. 29. The method of embodiment 24, wherein the nucleic acid sample is obtained from a single cell. 30. The method of embodiment 24, comprising treating the nucleic acid sample using DNase after synthesis of the plurality of RNA molecules. 31. The method of embodiment 24, comprising reverse transcribing the plurality of RNA molecules. 32. The method of embodiment 24, wherein the plurality of nucleic acid molecules comprises RNA molecules. 33. The method of embodiment 24, wherein the consensus sequence of the plurality of RNA molecules comprises a sequence of a molecule directly synthesized from the nucleic acid molecule. 34. The method of embodiment 24, wherein the attaching step comprises inserting a nucleic acid fragment comprising a promoter sequence into a known region of the nucleic acid molecule. 35. The method of embodiment 24, wherein the attaching step comprises inserting a nucleic acid fragment comprising a promoter sequence into a known region of the nucleic acid molecule. 36. The method of embodiment 24, wherein the attaching step comprises sequence-specific cleavage of the known region of the nucleic acid molecule. 37. The method of embodiment 24, wherein the attaching step comprises contacting the known region of the nucleic acid molecule with a CRISPR nucleic acid protein complex. 38. The method of embodiment 24, wherein the CRISPR nucleic acid protein complex comprises a guide RNA comprising SEQ ID NO:3. 39. The method of embodiment 24, wherein the attaching step comprises ligating a nucleic acid fragment comprising a promoter sequence. 40. The method of embodiment 24, wherein the nucleic acid fragment comprising a promoter sequence comprises a viral promoter. 41. The method of embodiment 40, wherein the viral promoter is at least one promoter selected from the list consisting of T7, T3, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 42. The method of embodiment 24, wherein the nucleic acid fragment comprising a promoter sequence comprises a bacterial promoter. 43. The method of embodiment 42, wherein the bacterial promoter is at least one promoter selected from the list consisting of araBAD, trp, lac, and Ptac. 44. The method of embodiment 24, wherein the nucleic acid fragment comprising a promoter sequence comprises a eukaryotic promoter.45. The method of embodiment 44, wherein the eukaryotic promoter is at least one promoter selected from the list consisting of EF1a, PGK1, Ubc, beta actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 46. The method of embodiment 44, wherein the eukaryotic promoter is at least one promoter selected from the list consisting of RNA pol I promoter, RNA pol II promoter, and RNA pol III promoter. 47. The method of embodiment 24, wherein the known region of the nucleic acid molecule comprises a repetitive element. 48. The method of embodiment 47, wherein the repetitive element comprises a mobile insertion element. 49. The method of embodiment 47, wherein the repetitive element comprises at least one of a LINE element, a SINE element, an Alu repeat, a transposon, a retrotransposon, a centromeric repeat, and a telomeric repeat. 50. The method of embodiment 47, wherein the LINE element comprises SEQ ID NO:1. 51. A nucleic acid library comprising nucleic acids encoding border flanking sequences for at least 90% of the boundaries of repetitive mobile elements in a nucleic acid sample. 52. The nucleic acid library of embodiment 51, wherein mismatches between library members and nucleic acid samples are independently extracted. 53. The nucleic acid library of embodiment 51, wherein at least 50% of the boundaries of said repetitive elements are present in at least 100 copies. 54. The nucleic acid library of embodiment 51, wherein library members are directly extracted from the nucleic acid sample. 55. The nucleic acid library of embodiment 51, wherein library members are not clonally amplified prior to sequencing. 56. The nucleic acid library of embodiment 51, wherein the nucleic acid sample is derived from a single cell. 57. The nucleic acid library of embodiment 51, wherein the nucleic acid library is reverse transcribed from an RNA intermediate. 58. The nucleic acid library of embodiment 51, wherein the nucleic acid library comprises RNA. 59. The nucleic acid library of embodiment 51, wherein the nucleic acid library members comprise promoter sequences.60. The nucleic acid library of embodiment 59, wherein the RNA promoter sequence comprises at least one of T7, T3, T7lac, SP6, pL, CMV, SV40, CaMV35S, araBAD, trp, lac, Ptac, EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 61. The nucleic acid library of embodiment 51, wherein at least one border flanking sequence is indicative of a defect in a gene involved in at least one of cell cycle regulation, DNA repair, and growth regulation. 62. The nucleic acid library of embodiment 51, wherein the nucleic acid library comprises nucleic acids encoding border flanking sequences for at least 95% of the boundaries of the repeat mobile elements in the nucleic acid sample. 63. The nucleic acid library of embodiment 62, wherein the nucleic acid library comprises nucleic acids encoding border flanking sequences for at least 99% of the boundaries of the repeat mobile elements in the nucleic acid sample. 64. The nucleic acid library of embodiment 51, wherein at least 50% of the library component nucleic acids are located in the nucleic acid within 20 kb of the boundary of the mobile element. 65. The nucleic acid library of embodiment 51, wherein at least 75% of the library component nucleic acids are located in the nucleic acid adjacent to the boundary of the mobile element within 20 kb of the boundary of the mobile element. 66. The nucleic acid library of embodiment 51, wherein at least 90% of the library component nucleic acids are located in the nucleic acid within 20 kb of the boundary of the mobile element. 67. The nucleic acid library of embodiment 51, wherein at least 50% of the library component nucleic acids are located in the nucleic acid within 10 kb of the boundary of the mobile element. 68. The nucleic acid library of embodiment 51, wherein at least 75% of the library component nucleic acids are located in the nucleic acid adjacent to the boundary of the mobile element within 10 kb of the boundary of the mobile element. 69. The nucleic acid library of embodiment 51, wherein at least 90% of the library component nucleic acids are located in the nucleic acid within 10 kb of the boundary of the mobile element. 70. The nucleic acid library of embodiment 51, wherein at least 50% of the library component nucleic acids are located within 5 kb of the nucleic acid of a boundary of the mobile element.71. The nucleic acid library of embodiment 51, wherein at least 75% of the library component nucleic acids are located in the nucleic acid adjacent to the boundary of the mobile element, within 5 kb of the boundary of the mobile element. 72. The nucleic acid library of embodiment 51, wherein at least 90% of the library component nucleic acids are located in the nucleic acid within 5 kb of the boundary of the mobile element. 73. The nucleic acid library of embodiment 51, wherein at least 50% of the library component nucleic acids are located in the nucleic acid within 1 kb of the boundary of the mobile element. 74. The nucleic acid library of embodiment 51, wherein at least 75% of the library component nucleic acids are located in the nucleic acid adjacent to the boundary of the mobile element, within 1 kb of the boundary of the mobile element. 75. The nucleic acid library of embodiment 51, wherein at least 90% of the library component nucleic acids are located in the nucleic acid within 1 kb of the boundary of the mobile element. 76. The nucleic acid library of any one of embodiments 51 to 75, wherein the average fragment length is about 500 bases. 77. The average fragment length is about 1000 bases, according to embodiment 51. 78. The nucleic acid library of any one of embodiments 51-75, wherein the median fragment length is about 500 bases. 79. The nucleic acid library of any one of embodiments 51-75, wherein the median fragment length is about 1000 bases. 80. A composition comprising a targeting sequence and a promoter, wherein the targeting sequence comprises a nucleic acid sequence that directs insertion of the composition into one or more specific positions within the nucleic acid sequence, and the promoter comprises a nucleic acid sequence that directs nucleic acid synthesis from a sample sequence adjacent to the insertion of the promoter. 81. The composition of embodiment 80, wherein the targeting sequence comprises a nucleic acid sequence that corresponds to the specific positions. 82. The composition of embodiment 80, wherein the targeting sequence comprises a nucleic acid sequence that base pairs with the specific positions. 83. The composition of embodiment 80, wherein the targeting sequence comprises a nucleic acid sequence that hybridizes to the specific positions. 84. The composition of any one of embodiments 80-83, wherein the targeting sequence comprises at least one of a clustered regularly interspaced short interspaced repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. 85. The composition of embodiment 84, wherein the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. 86. The composition of any one of embodiments 80-85, wherein the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. 87. The composition of embodiment 86, wherein the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. 88. The composition of embodiment 86, wherein the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 89. The composition of embodiment 86, wherein the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, ALB, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 90. The composition of any one of embodiments 80-89, wherein the specific position in the nucleic acid sequence comprises a low complexity nucleic acid sequence. 91. The composition of any one of embodiments 80-90, wherein the specific position in the nucleic acid sequence comprises a repetitive nucleic acid sequence.92. The composition of any one of embodiments 80-91, wherein the low complexity nucleic acid sequence or the repetitive nucleic acid sequence comprises at least one of a tri-nucleotide repeat, a tandem repeat, and a human leukocyte antigen gene. 93. The composition of any one of embodiments 80-91, wherein the specific location in the nucleic acid sequence comprises a mobile genetic element. 94. The composition of embodiment 93, wherein the mobile element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an IAP (intracisternal A particle), an ETn, a virus, and fragments thereof. 95. The composition of embodiment 94, wherein the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. 96. The composition of embodiment 94, wherein the LINE comprises SEQ ID NO:1. 97. The composition of embodiment 94, wherein the virus comprises a retrovirus or a fragment thereof. 98. The composition of any one of embodiments 80-97, wherein the nucleic acid synthesis comprises at least one of RNA transcription and DNA synthesis. 99. A method for determining nucleic acid sequences adjacent to a nucleic acid sequence of interest, the method comprising: (a) inserting a target nucleic acid sequence, comprising a target sequence and a promoter, at one or more specific locations within the nucleic acid sequence of interest, (b) directing nucleic acid synthesis from the promoter, and (c) sequencing the synthesized nucleic acid. 100. The method of embodiment 99, wherein the target sequence comprises at least one of a clustered regularly interspaced short random repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. 101. The composition of embodiment 100, wherein the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. 102. The method of any one of embodiments 99-101, wherein the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. 103. The method of embodiment 102, wherein the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac.104. The method of embodiment 102, wherein the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 105. The method of embodiment 102, wherein the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 106. The method of any one of embodiments 99-105, wherein the sequence of interest comprises a low complexity nucleic acid sequence. 107. The method of any one of embodiments 99-106, wherein the sequence of interest comprises a repetitive nucleic acid sequence. 108. The method of any one of embodiments 99-107, wherein the sequence of interest comprises at least one of a tri-nucleotide repeat, a tandem repeat, and a human leukocyte antigen gene. 109. The method of any one of embodiments 99 to 108, wherein the sequence of interest comprises a mobile genetic element. 110. The method of embodiment 109, wherein the mobile genetic element comprises a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an IAP (intracisternal A particle), an ETn, a virus, and fragments thereof. 111. The method of embodiment 110, wherein the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. 112. The method of embodiment 111, wherein the LINE comprises SEQ ID NO:1. 113. The method of embodiment 110, wherein the virus comprises at least one of a retrovirus and fragments thereof. 114. The method of any one of embodiments 99 to 113, wherein the nucleic acid synthesis comprises at least one of RNA transcription and DNA synthesis. 115. The method of embodiment 114, wherein the RNA transcription comprises the use of an RNA polymerase. 116. The method of embodiment 115, wherein the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and a single subunit RNA polymerase.117. The method of any one of embodiments 99-114, wherein the DNA synthesis comprises the use of a DNA polymerase. 118. The method of embodiment 117, wherein the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. 119. The method of any one of embodiments 99-118, wherein the nucleic acid synthesis requires a primer. 120. The method of any one of embodiments 99-119, wherein the synthesized nucleic acid is synthesized directly from the nucleic acid sequence of interest. 121. The method of any one of embodiments 99-120, wherein the nucleic acid is synthesized without the introduction of mutations. 122. The method of embodiment 121, wherein the mutation is at least one of point mutations, deletions, insertions, and chimeras. 123. The method of any one of embodiments 99-122, wherein the synthesized nucleic acid comprises DNA. 124. The method of any one of embodiments 99-122, wherein the synthesized nucleic acid comprises cDNA. 125. The method of embodiment 123 or embodiment 124, wherein the synthesized nucleic acid is treated with ribonuclease. 126. The method of any one of embodiments 99-122, wherein the synthesized nucleic acid comprises aRNA. 127. The method of embodiment 126, wherein the synthesized nucleic acid is treated with DNase. 128. The method of any one of embodiments 99-127, wherein the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing (MPSS), single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. 129. The method of any one of embodiments 99-128, wherein the method detects mutations in the subject. 130. The method of any one of embodiments 99-128, wherein the method detects mutations in a tissue sample obtained from the subject. 131. The method of embodiment 130, wherein the tissue sample comprises at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue.132. A method for mapping an insertion site of a DNA element in a nucleic acid sample from a subject, comprising: i) inserting a target nucleic acid sequence comprising a target sequence and a promoter by contacting genomic DNA with the target sequence and one or more reagents sufficient to insert the target sequence into the DNA element; ii) generating an amplified nucleic acid directly from the genomic DNA by contacting the inserted target sequence with one or more enzymes that catalyze nucleic acid synthesis from the promoter, thereby generating an amplified nucleic acid; iii) sequencing the amplified nucleic acid. 133. The method of embodiment 132, wherein the target sequence comprises at least one of a clustered regularly interspaced short random repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, or a TAL effector nuclease (TALEN) sequence. 134. The composition of embodiment 133, wherein the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. 135. The method of any one of embodiments 132-134, wherein the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. 136. The method of embodiment 135, wherein the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. 137. The method of embodiment 135, wherein the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 138. The method of embodiment 135, wherein the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 139. The method of any one of embodiments 132-138, wherein the DNA element comprises a low complexity nucleic acid sequence. 140. The method of any one of embodiments 132-139, wherein the DNA element comprises a repeated nucleic acid sequence. 141. The method of any one of embodiments 132-140, wherein the DNA element comprises at least one of a tri-nucleotide repeat and a tandem repeat. 142. The method of any one of embodiments 132-141, wherein the DNA element comprises a mobile genetic element.143. The method of embodiment 142, wherein the mobile element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an IAP (intracisternal A particle), an ETn, a virus, and fragments thereof. 144. The method of embodiment 143, wherein the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. 145. The method of embodiment 144, wherein the LINE comprises SEQ ID NO:1. 146. The virus is a retrovirus or a 147. The method of any one of embodiments 132 to 146, wherein the enzyme comprises an RNA polymerase. 148. The method of embodiment 147, wherein the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and single subunit RNA polymerase. 149. The method of any one of embodiments 132 to 148, wherein the enzyme is a DNA polymerase. 150. The method of embodiment 149, wherein the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. 151. The method of any one of embodiments 132 to 150, wherein the nucleic acid synthesis requires a primer. 152. The method of any one of embodiments 132 to 151, wherein the synthesized nucleic acid is synthesized directly from the nucleic acid sequence of interest. 153. The method of any one of embodiments 132 to 152, wherein the nucleic acid is synthesized without the introduction of mutations. 154. The method of embodiment 153, wherein the mutation is at least one of a point mutation, a deletion, an insertion and a chimera. 155. The method of any one of embodiments 132 to 154, wherein the synthesized nucleic acid is DNA. 156. The method of any one of embodiments 132 to 154, wherein the synthesized nucleic acid is cDNA. 157. The method of embodiment 155, wherein the synthesized nucleic acid is treated with RNase. 158. The method of any one of embodiments 132 to 154, wherein the synthesized nucleic acid is RNA. 159. The method of embodiment 158, wherein the synthesized nucleic acid is treated with DNase. 160. The method of any one of embodiments 132-159, wherein the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing (MPSS), single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. 161. The method of any one of embodiments 132-160, wherein the method detects mutations in the subject.162. The method of any one of embodiments 132-160, wherein the method detects mutations in a tissue sample obtained from the subject. 163. The method of embodiment 162, wherein the tissue sample comprises at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue. 164. A method for sequencing a repetitive genomic region, comprising: i) inserting a target nucleic acid sequence comprising a target sequence and a promoter by contacting the genomic DNA with the target sequence and one or more reagents sufficient to insert the target sequence into the repetitive genomic region; ii) generating an amplified nucleic acid directly from the genomic DNA by contacting the inserted target sequence with one or more enzymes that catalyze nucleic acid synthesis from the promoter, thereby generating an amplified nucleic acid; iii) sequencing the amplified nucleic acid. 165. The method of embodiment 164, wherein the targeting sequence comprises at least one of a clustered regularly interspaced short interspaced repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence. 166. The composition of embodiment 165, wherein the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:3. 167. The method of any one of embodiments 164-166, wherein the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter. 168. The method of embodiment 167, wherein the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac. 169. The method of embodiment 167, wherein the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S. 170. The method of embodiment 167, wherein the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6. 171. The method of any one of embodiments 164-170, wherein the repetitive genomic region comprises a low complexity nucleic acid sequence. 172. The method of any one of embodiments 164-171, wherein the repetitive genomic region comprises a repetitive nucleic acid sequence.173. The method of any one of embodiments 164-172, wherein the repetitive genomic region comprises at least one of a tri-nucleotide repeat and a tandem repeat. 174. The method of any one of embodiments 164-173, wherein the repetitive genomic region comprises a mobile genetic element. 175. The method of embodiment 174, wherein the mobile element comprises at least one of a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an IAP (intracisternal A particle), an ETn, a virus, and fragments thereof. 176. The method of embodiment 175, wherein the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof. 177. The method of embodiment 176, wherein the LINE comprises SEQ ID NO:1. 178. The method of embodiment 175, wherein the virus comprises a retrovirus or fragments thereof. 179. The method of any one of embodiments 164 to 178, wherein the enzyme comprises an RNA polymerase. 180. The method of embodiment 179, wherein the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and single subunit RNA polymerase. 181. The method of any one of embodiments 164 to 178, wherein the enzyme comprises a DNA polymerase. 182. The method of embodiment 181, wherein the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase. 183. The method of any one of embodiments 164 to 182, wherein the nucleic acid synthesis requires a primer. 184. The method of any one of embodiments 164 to 183, wherein the synthesized nucleic acid is synthesized directly from the nucleic acid sequence of interest. 185. The method of any one of embodiments 164 to 184, wherein the nucleic acid is synthesized without the introduction of mutations. 186. The method of embodiment 185, wherein the mutations are at least one of point mutations, deletions, insertions and chimeras.187. The method of any one of embodiments 164-186, wherein the synthesized nucleic acid is DNA. 188. The method of any one of embodiments 164-186, wherein the synthesized nucleic acid is cDNA. 189. The method of embodiment 187 or embodiment 188, wherein the synthesized nucleic acid is treated with RNase. 190. The method of any one of embodiments 164-186, wherein the synthesized nucleic acid is a RNA. 191. The method of embodiment 190, wherein the synthesized nucleic acid is treated with DNase. 192. The method of any one of embodiments 164-191, wherein the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing (MPSS), single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation. 193. The method of any one of embodiments 164-192, wherein the method detects mutations in the subject. 194. The method of any one of embodiments 164-192, wherein the method detects mutations in a tissue sample obtained from the subject. 195. The method of embodiment 194, wherein the tissue sample comprises at least one of a tumor, blood, saliva, sputum, skin, and epithelial tissue.

[0141] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates which may need to be independently confirmed. EXAMPLES

[0142] The following examples are given for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any manner. The examples, together with the methods described herein, are currently representative of preferred embodiments and are exemplary, but are not intended to limit the scope of the present invention. Those skilled in the art will find modifications therein and other uses that fall within the spirit of the present invention as defined by the scope of the claims.

[0143] Example 1: Target-specific amplification of HLA genes HLA regions are notoriously difficult to sequence with short-read sequencers. They are highly polymorphic and highly repetitive. A guide RNA designed upstream of the HLA-A gene promoter at example coordinates chr6:29,940,000-29,942,000 would have the potential to generate a T7-transcribed RNA product spanning the entire HLA gene in approximately 5 kb of sequence.

[0144] To sequence the HLA gene, a plasmid is designed to contain a target sequence from the HLA promoter into which a T7 promoter is inserted. The target sequence is selected to function most effectively with Cas9 in the CRISPR system. Once the plasmid containing the target sequence and the T7 promoter is designed and prepared, the guide RNA is transcribed, and the resulting guide RNA is incubated with a genomic DNA sample and isolated Cas9 enzyme. Alternatively, the guide RNA is synthesized or generated from a double-stranded linear template. The resulting product, a tagged genomic DNA sample with a T7 promoter inserted into the promoter region of the HLA-A gene, is then purified. The tagged genomic DNA sample is incubated with nucleotides and T7 RNA polymerase, which causes RNA transcription from the HLA-A gene. Each transcription is performed directly from the tagged genomic DNA sample and is free of defects such as insertions, deletions, or point mutations. The RNA sample is then purified from the tagged genomic DNA sample and polyadenylated. cDNA is made from the RNA sample and oligothymidines in a reverse transcriptase reaction. RNA is removed from the cDNA using RNase H, and the cDNA is used in a sequencing reaction to determine the sequence of the HLA-A gene with the highest possible accuracy in this method. The sequence of the HLA-A gene provides information about the subject from whom the genomic DNA sample was taken, thereby providing accurate HLA typing of the HLA-A gene.

[0145] Example 2: Identification of somatic mobile factors such as LINE-1 rearrangements in tumors LINE-1 rearrangements are estimated to rearrange genomic material once every 20 cell divisions. The mechanism behind the rearrangement may involve the copy-and-paste of genomic DNA sequences outside of the canonical LINE-1 element sequence and insert that sequence into a new location. Published examples of this "tag-along" genomic material are in some cases as much as 10 kilobases in length. Short read sequences do not have the ability to map these events because mapping-based assembly does not place short reads corresponding to the recombined genomic material in new locations that are inconsistent with the reference genome used for short read assembly. The ability to sequence through and into adjacent genomic sequences of flanking molecules greater than 10 kilobases in length has the ability to identify and quantify these events. Guide RNAs with target sequences complementary to conserved regions of human LINE-1 elements enable T7-based transcription from the conserved LINE-1 diagnostic sequence toward the flanking sequence. Comparison of tumor and product normal sequencing reveals somatic LINE-1 rearrangements with unparalleled accuracy. The multiple T7 insertions spanning the conserved LINE-1 element sequence, as well as along both the 3' and 5' ends, add to the ability to identify full-length somatic L1 rearrangements within tumors. It is estimated that 60% of tumors harbor somatic L1 events.

[0146] To map the site of LINE-1 rearrangement in tumors, a plasmid is constructed to contain a target sequence complementary to a sequence in the LINE-1 element and a T7 promoter. The target sequence is selected to function most effectively with Cas9 in the CRISPR system. A guide RNA is made from the plasmid, the guide RNA containing the target sequence, and the T7 promoter. The guide RNA is incubated with a genomic DNA sample from the tumor and isolated Cas9 enzyme. The resulting product, a tagged genomic DNA sample with the T7 promoter inserted into the targeted LINE-1 sequence, is purified. The tagged genomic DNA sample is incubated with nucleotides and T7 RNA polymerase, which causes RNA transcription from the LINE-1 element. Each transcription is performed directly from the tagged genomic DNA sample and is free of defects such as insertions, deletions, or point mutations. The RNA sample is then purified from the tagged genomic DNA sample and polyadenylated. cDNA is made from the RNA sample and oligothymidines in a reverse transcriptase reaction. The RNA is removed from the cDNA using RNase H, and the cDNA is used in a sequencing reaction to determine the sequence of genomic DNA adjacent to the LINE-1 element, thereby determining the location of the LINE-1 element. The location of the element and additional LINE-1 elements in a tumor sample provides the physician with diagnostic information, such as specific therapies that may be effective in treating the tumor.

[0147] Example 3: Determination of tri-nucleotide repeat length in Huntington's disease Huntington's disease is a neurodegenerative genetic disease that affects muscle coordination, cognitive abilities and behavior. Well-documented mutations in the Huntingtin gene are responsible for the disease, which is inherited in an autosomal dominant manner. The mutation is an expansion from one generation of a family to the next of a repeat expansion of the CAG trinucleotide found in the coding sequence of the gene. This CAG trinucleotide codes for the amino acid glutamine, and therefore the expansion of the CAG repeat leads to a polyglutamine expansion in the resulting protein. Obtaining the exact sequence of the expanded polynucleotide region is a challenge. It is desirable to determine the sequence and therefore the size of the repeat region, as the size of the repeat region influences the disease state of the patient.

[0148] To determine the size of the CAG repeat, a plasmid is constructed to contain a target sequence complementary to a sequence in the huntingtin gene and a T7 promoter. The target sequence is selected to function most effectively with Cas9 in the CRISPR system. A guide RNA is made from a plasmid, a guide RNA containing a target sequence, and a T7 promoter. The guide RNA is incubated with a genomic DNA sample from a tumor and an isolated Cas9 enzyme. The resulting product, a tagged genomic DNA sample with a T7 promoter inserted into the targeted huntingtin sequence, is purified. The tagged genomic DNA sample is incubated with nucleotides and T7 RNA polymerase, which causes RNA transcription from the huntingtin gene. Each transcription is performed directly from the tagged genomic DNA sample and is free of defects such as insertions, deletions, or point mutations. The RNA sample is then purified from the tagged genomic DNA sample and polyadenylated. cDNA is made from the RNA sample and oligothymidines in a reverse transcriptase reaction. RNA is removed from the cDNA using RNaseH, and the cDNA is used in a sequencing reaction to determine the sequence of the CAG repeats in the huntingtin gene. The number of CAG repeats in the huntingtin gene provides diagnostic information to physicians and patients regarding the expected severity of the disease.

[0149] Example 4: Using CRISPR / CAS to insert hairpin tags into a genome The Cyp2d6 gene is selected for sequencing using CRISPR / CAS to generate a double-stranded break at a target site in the genome at the gene's genomic locus. The double-stranded break is made sticky-ended by treating the DNA sample with an exonuclease that exposes one strand of the target site. The tagged nucleic acid includes a portion having a nucleic acid sequence complementary to the exposed strand, a T7 promoter, and a portion that is self-complementary and forms a hairpin shape. A DNA ligase ligates the nucleic acid to the target site, thereby incorporating a T7 promoter near the Cyp2d6 gene. The hairpin tag is effective to ligate the tag to the target site, and the site is ready for RNA transcription of the targeted Cyp2d6 gene. The tag allows the Cyp2d6 gene to be distinguished from Cyp2d6 pseudogenes and uniquely tagged for sequencing.

[0150] Example 5: Size selection of in vitro transcribed RNA In vitro transcription was performed on 1 ng DNA samples containing DNA inserted with a T7 promoter. Reactions were performed for 12 hours. Both MEGAscript T7 and AmpliScribe T7 were used to drive transcription. Reactions were incubated with DNAse for 1 hour after transcription. RNA was quantified using Qubit High Sensitivity RNA Assay kit. RNA analysis was performed using a High Sensitivity Pico mRNA Bioanalyzer.

[0151] Size exclusion included sub-17 nt size exclusion; incubation of sub-200 nt size exclusion for 10 minutes at 65° C. followed by sub-17 nt size exclusion; and a no-exclusion control. Products are run on formaldehyde (denaturing) agarose gels.

[0152] The results are shown in Table 1 below.

[0153] [Table 1]

[0154] The results are shown graphically in FIG.

[0155] Bead-based size selection was also performed. In vitro transcription was performed on 1 ng DNA sample containing DNA inserted with a T7 promoter. Reactions were performed for 12 hours. Both MEGAscript T7 and AmpliScribe T7 were used to drive transcription. Reactions were incubated with DNAse for 1 hour after transcription. Reactions were incubated at 0.5x, 0.6x, 0.8x, 1x, 2x, 3x and control (unselected) with a starting volume of 50uL and an RNA output of 2ng. RNA was quantified using Qubit High Sensitivity RNA Assay kit. RNA analysis was performed using a High Sensitivity Pico mRNA Bioanalyzer.

[0156] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous modifications, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be utilized in practicing the invention. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of the claims and their equivalents are covered thereby.

Claims

1. A method for determining a nucleic acid sequence adjacent to a nucleic acid sequence of interest, the method comprising: (a) inserting a target nucleic acid sequence, the target nucleic acid sequence comprising a target sequence and a promoter, at one or more specific locations in the nucleic acid sequence of interest, (b) directing synthesis of a nucleic acid from the promoter, and (c) sequencing the synthesized nucleic acid.

2. 2. The method of claim 1, wherein the target sequence comprises at least one of a clustered regularly interspaced short palindromic repeats (CRISPR) sequence, a zinc finger nuclease (ZFN) sequence, and a TAL effector nuclease (TALEN) sequence.

3. 3. The method of claim 2, wherein the CRISPR sequence comprises a guide RNA with a sequence comprising SEQ ID NO:

3.

4. 2. The method of claim 1, wherein the promoter comprises at least one of a bacterial promoter, a viral promoter, and a eukaryotic promoter.

5. 5. The method of claim 4, wherein the bacterial promoter comprises at least one of araBAD, trp, lac, and Ptac.

6. 5. The method of claim 4, wherein the viral promoter comprises at least one of T7, T7lac, SP6, pL, CMV, SV40, and CaMV35S.

7. 5. The method of claim 4, wherein the eukaryotic promoter comprises at least one of EF1a, PGK1, Ubc, beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, Ubi, H1, and U6.

8. 2. The method of claim 1, wherein the sequence of interest comprises a low complexity nucleic acid sequence.

9. The method of claim 1, wherein the sequence of interest comprises a repetitive nucleic acid sequence.

10. 2. The method of claim 1, wherein the sequence of interest comprises at least one of a trinucleotide repeat, a tandem repeat, and a human leukocyte antigen gene.

11. The method of claim 1, wherein the sequence of interest comprises a mobile genetic element.

12. 12. The method of claim 11, wherein the mobile genetic element comprises a transposon, a retrotransposon, a DNA transposon, an insertion sequence, a plasmid, a bacteriophage, a group II intron, a group I intron, an Alu element, an MIR element, an intracisternal A particle (IAP), an ETn, a virus, or a fragment thereof.

13. 13. The method of claim 12, wherein the retrotransposon comprises at least one of a transposable element, a LINE, a SINE, and fragments thereof.

14. 14. The method of claim 13, wherein LINE comprises SEQ ID NO:

1.

15. 13. The method of claim 12, wherein the virus comprises at least one of a retrovirus and a fragment thereof.

16. 2. The method of claim 1, wherein nucleic acid synthesis comprises at least one of RNA transcription and DNA synthesis.

17. 17. The method of claim 16, wherein RNA transcription comprises the use of an RNA polymerase.

18. 18. The method of claim 17, wherein the RNA polymerase comprises at least one of T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, and a single subunit RNA polymerase.

19. 2. The method of claim 1, wherein DNA synthesis involves the use of a DNA polymerase.

20. 20. The method of claim 19, wherein the DNA polymerase comprises at least one of T7 DNA polymerase, T3 DNA polymerase, SP6 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, Taq DNA polymerase, and Pfu DNA polymerase.

21. The method of claim 1, wherein nucleic acid synthesis requires a primer.

22. 2. The method of claim 1, wherein the synthetic nucleic acid is synthesized directly from a nucleic acid sequence of interest.

23. 2. The method of claim 1, wherein the nucleic acid is synthesized without the introduction of mutations.

24. 24. The method of claim 23, wherein the mutation is at least one of a point mutation, a deletion, an insertion, and a chimera.

25. 2. The method of claim 1, wherein the synthesized nucleic acid comprises DNA.

26. The method of claim 1, wherein the synthesized nucleic acid comprises cDNA.

27. 27. The method according to claim 25 or 26, wherein the synthesized nucleic acid is treated with RNase.

28. 2. The method of claim 1, wherein the synthesized nucleic acid is RNA.

29. 29. The method of claim 28, wherein the synthesized nucleic acid is treated with DNase.

30. 2. The method of claim 1, wherein the sequencing comprises at least one of Sanger sequencing, next generation sequencing, pyrosequencing, massively parallel signature sequencing, single molecule real-time sequencing, ion torrent sequencing, sequencing by synthesis, and sequencing by ligation.

31. The method of claim 1, wherein the method detects a mutation in a subject.

32. 10. The method of claim 1, wherein the method detects mutations in a tissue sample obtained from a subject.

33. 33. The method of claim 32, wherein the tissue sample comprises at least one of tumor, blood, saliva, sputum, skin, and epithelial tissue.

Images