Improved heterotrophic production methods for microbial biomass and bioproducts

Abstract

To provide a product comprising astaxanthin produced by a method of culturing a microalgal cell that produces astaxanthin.SOLUTION: Provided is a product comprising astaxanthin produced by a method comprising: (1) providing a culture medium comprising carbon derived from an organic acid; (2) providing a microalgal cell that produces astaxanthin, wherein the microalgal cell is a motile cell that exhibits rapid growth, resists encystment under stress, and represents a novel phenotype of heterotrophic motile cells under nutrient-limited conditions, and wherein the microalgal cell is a facultative heterotroph classified in the genus Haematococcus; (3) culturing the microalgal cell in the dark to produce a culture from the microalgal cell; wherein the culture medium comprises urea as a primary nitrogen source; and wherein synthesis of astaxanthin in the microalgal cell occurs in the presence of carbon derived from the organic acid, under conditions in which one or more nutrients selected from sulfate, phosphate, nitrate, and urea are depleted in the culture medium.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to an improved fermentation process for producing biomass and bioproducts from microorganisms. In one embodiment, the present invention relates to a method for producing a cell that does not require light induction and cell differentiation, e.g. For extended accelerated growth to higher cell densities and production of useful compounds, The present invention relates to a fermentation method that employs heterotrophic cultivation of heterotrophic microorganisms. The object is selected for use in the methods or other aspects of the invention described herein and They can be naturally mutated or genetically engineered. [Background technology]

[0002] Affordable, natural, safe and effective products that protect the environment while impacting its long-term health. Global consumer demand for effective products is increasing. substitute for unsustainable or problematic products or ingredients currently used in the market Isoprenoids are another large class of compounds that comprise ingredients in such products. Recombinant technology and the isoprenoid pathway include, but are not limited to, pigments, Terpenes, gums, vitamins, fragrances, flavorings, solvents, steroids / sterols, hormones / Various applications such as growth regulators, feed additives, nutritional compounds, lubricant additives and even pesticides These then produce a number of commercially useful target compounds for use in food and beverages, fragrances, and feed. , cosmetics, as well as chemicals, neutraceuticals, pharmaceuticals and other industrial Used in products for industrial applications.

[0003] One such isoprenoid is used as an antioxidant, anti-inflammatory and coloring agent. Carotenoids are a class of naturally occurring pigmented compounds that act as antioxidants in the body. The orange-red pigment astaxanthin is a major source of carotenoids. (3,3'-dihydroxy-b,b'-carotene-4,4'-dione) has been used in many therapeutic applications. Astaxanthin is considered to be the most effective carotenoid available for application. The global market for applications is expected to grow from 280 metric tons in 2014 to More than 670 metric tons. The poor availability and high price of natural astaxanthin The results showed that approximately 97% of commercially available astaxanthin is synthetic (referred to as E161J). Chemically synthesized astaxanthin is not esterified and therefore is not easily oxidized. However, its esterified form found naturally in microalgae is It is stable and exhibits higher bioavailability and efficacy. Synthetic astaxanthin: It is widely used in fish and animal feed, human nutritional supplements, medical applications and cosmetics. It is used to some extent in cosmetics and skin care. It is used to produce a pink flesh color and Promoting the growth of farmed salmonids (salmon and trout), sea bream, and other animals It is used as a feed additive to improve the digestibility of lactic acid bacteria. It costs about one-third to one-sixth as much. However, it uses petroleum-based dyes to color food. The practice of using synthetic chemicals has been challenged. For this reason, the U.S. Food and Drug Administration The agency is requiring retailers to label farmed salmon and trout as "colored." There are.

[0004] There is a need for lower-cost natural alternatives to the use of synthetic colours. Yeast (Xanthophyllomyces dendrolaus) dendrorhous) is a eukaryotic microalgae-like organism, but its aerobic fermentation Therefore, it is not identical to, and more likely than, the predominant and preferred forms found in microalgae and wild salmon. Astaxanthin is a chemically inferior form of the 3R,3'R isomer, which is free and unesterified. Regarding the latter, typically more than 95% of the total astaxanthin is 3S, It is in the form of mono- and diesters as the 3'S isomer. The selling price of astaxanthin is much lower than that of microalgae astaxanthin, but it is chemically synthesized. Disadvantages: While red yeast has a fast growth rate, it is relatively It has a low pigment content, resulting in low yields and unsustainably high production costs. bring about.

[0005] In recent years, the fermentation production target for red yeast-derived astaxanthin has been set at 120 hours. Within the cycle time between the two, certain criteria are: 2 mg / L of calorie per hour tenoid productivity; 60 g / L harvest density; and 4 mg / g (0.4%) dry weight When the astaxanthin yield is met, it is cost-competitive with synthetic astaxanthin. Using this framework as an example, other species such as microalgae were modeled. Competitive strategies for fermentor-based heterotrophic production of microbial astaxanthin In order to set standards, productivity standards may be adjusted relative to one another, and differences in value may also be considered. The present invention is further tailored for the production of various carotenoid precursors and related isoprenoid molecules. Economic and sustainability calculations may also be made on the glucose used for red yeast. In some cases, this may be a factor in the use of organic acids rather than terpenes.

[0006] To date, all industrial production of astaxanthin derived from microalgae has been carried out using raceway culture. In submerged cultures in tanks / ponds and photobioreactors, Chlamydomonas albicans To cultivate a unique type of microalgae from Haematococcus of the order Monadales Depending on the method, it can be performed outdoors or indoors, either in sunlight or under artificial lighting. The most common industrial species is Haematococcus purpurea. The algae that is the richest source of carotenoids is Haematococcus pluvialis. It is a good source of astaxanthin, usually containing up to 3% or even 5% of its dry weight. Produced as cysts (Lorenz and Cysewski, 2000; U.S. Patent No. 6,022,701) It originates from acetyl CoA and produces isopentenyl pyrophosphate (IPP) and phytoene. beta-carotene, canthal, which become pigment precursors and ultimately astaxanthin Other carotenoids such as xanthin and lutein are also present. providing a cocktail of beneficial, healthful molecules not available in synthetic astaxanthin. .

[0007] Another problem is the current production of astaxanthin from Haematococcus. However, there are challenges in limiting supplies. The shortage of natural pigments is driving up prices. As a result, synthetic astaxanthin is becoming increasingly popular in the high volume aquaculture and animal feed sectors. While astaxanthin from microalgae has been used as a food coloring agent, It is the primary source of food for human applications such as food supplements and cosmetics. Even if natural algae astaxanthin could compete with synthetic products on price, it would cost about 300 tons The volume of feed that can be fitted with pigment is 10,000 times that which can be produced by photosynthesis today. tonnes of algal biomass (assuming 3% pigment content) will be produced for extraction. Need.

[0008] One of the challenges in astaxanthin production is the lack of green trophic macro-independent cells. Red immobile spores (haematocysts) from vegetative macrozooids Haematococcus requires cell differentiation into aematocysts. Astaxanthin is involved in the complex life cycle of Astaxanthin. The basal Astaxanthin is responsible for approximately 10 pg / cell of the vegetative stage. During the encystment process, the cyst content increased to approximately 30 pg / cell, resulting in a brown to red adenoma. Formation of flagellated, nonmotile immature cysts followed by mature cysts containing approximately 613 pg / cell This process is involved in the induction of cyst formation and the accumulation of astaxanthin. This requires a long period of time and is the only way to prepare batches of submerged cultures, including those for red yeast. The total cycle time used for fed-batch industrial fermentation is typically 7-10 days (168 ~240 hours).

[0009] WO 2003027267 describes two stages: Stage 1, during which a green motile biflagellate stage in which cells are capable of photoautotrophic growth; and stage 2, Meanwhile, under unfavorable conditions, these cells lose their motility and become abundant. Cyst-forming bacteria with synthesis of astaxanthin and other carotenoids Cultivating Haematococcus pluvialis through the adult stage By using the light-dependent process to produce astaxanthin-rich biomass, Unfavorable conditions include intense light, nutrient depletion, or changes in temperature, pH, or These are one or more of the changes in salinity that cause the organism to form cysts as a defense response. The process described in WO 2003027267 is an open process. The pond system used in U.S. Pat. Nos. 6,022,701 and 5,882,849 Through the use of photobioreactors in various configurations and photobioreactor-pond combinations, The paper teaches a similar light-dependent two-step process that can be achieved by using a single photocatalytic reaction. No. 701 describes the use of nutrient-rich media for vegetative growth under light, followed by To induce accumulation of astaxanthin in the presence of inorganic carbon (carbon dioxide) and light. It further teaches the use of a nutrient-depleted medium.

[0010] Such processes depend on light for photosynthesis to grow biomass. and by culturing green motile plants prior to harvesting astaxanthin-rich biomass therefrom. By relying on a two-step culture process to convert cells into red cysts, Generally, light is provided by sunlight, so it is not affected by weather, seasonality, or growth patterns. Rainy days, light-reducing pollution, and geographic location all contribute to variable productivity and decline. This also promotes increased productivity. Biomass decay or loss due to protozoan predation also contributes to This results in reduced productivity. In some cases, sunlight may be replaced by artificial lighting, but sufficient surface area for light exposure and suitable Culture handling is still required and the green and red phases for astaxanthin production are not obtained. The two-stage culture method involves complex culture procedures, and even the cyst formation stage alone requires a large amount of time before harvesting. It takes many days, usually 7-10 days, to complete the full production and harvest cycle. This adds a significant amount of time beyond the biomass growth phase. These cysts are thick and solid. Due to their thick cell walls, they are indigestible and difficult to extract, formulate products or ensure bioavailability. The tissue must be broken open or crushed to access the pigment.

[0011] Examples of two-step production methods are not unique to Haematococcus. For example, the related taxon Chlamydomonas, described in U.S. Pat. No. 8,206,721. mydomonas, Chloromonas, and Chlamydocapsa Cultures of various types of algae, such as those from The subsequent harvesting of cells at the second or red stage which have differentiated into cysts or spores. To achieve this, a two-step culture process is carried out.

[0012] Advantageously, some species of microalgae use carbon dioxide as a carbon growth source during photosynthesis. In the dark, the carbon source is replaced by some other carbon source dissolved in the nutrient medium. It has been shown to be a facultative heterotroph for cultivation. Aerobic fermentation of heterotrophic algae is Similar fermentation tanks and procedures are commonly found for other microorganisms in industrial fermentation facilities. In general, the use of fermentation processes is much more productive, and more efficient than other soil processes. Reduced land footprint to avoid competing land uses, control of contaminants, and control of genetically modified organisms management, less water use to meet high production volumes, and year-round production in any climate This can give fermentation a significant advantage over photosynthetic (phototrophic) production. It is considered the most economical and scalable method of algae production.

[0013] Nevertheless, some microalgae can exhibit heterotrophic properties on a small laboratory scale. However, most of the heterotrophic algae production requires development in order to be economically viable. The methods of production are not routine. Among green algae, the genus Chlorellales Several species of yeast have been successfully transferred to industrial scale production using dark fermentation. reported that hexoses and pentoses were used as fixed carbon sources in heterotrophic cultures under dark conditions. One example is Chlorella, which is cultivated using a microbial organism that provides the primary fixed carbon source at a given time. Organic acids, when supplied in addition to sugars in the medium, can help induce pigment formation. For example, Chlorella zofingiensis ensis, pyruvate, citrate and malate at concentrations above 10 mM The addition of 1,2-dichlorophenylalanine to glucose-based culture media inhibited the production of astaxanthin and other secondary carotenoids. In contrast, members of the order Chlamydomonadales stimulated the biosynthesis of amides. Bacteria are generally unable to utilize hexoses and pentoses as their primary fixed carbon source and are unable to produce Industrial scale production by fermentation alone has not yet been achieved.

[0014] Unlike the Chlorella mentioned above, Chlamydomonadales has a vegetative growth phase. It can be shortened quickly and encystment can occur later, hindering industrial production. Sensitive to environmental and physical conditions. For heterotrophic cultivation of this group of microalgae There are many further obstacles.

[0015] U.S. Patent Application Publication No. 20080038774 discloses a method for the preparation of Haematococcus pluvialis (Ha This paper presents a two-stage heterotrophic culture method in the dark for Ematococcus pluvialis. Vegetative growth was performed at 100 ml in medium supplemented with sodium acetate and soybean powder or peptone. In stationary (unstirred) cultures in L flasks, the The cells were grown at 20 °C for 8 days at high temperature until they reached 80 pg / cell. Induced with high sodium acetate introduced at high salinity and high incubation temperature of 30 °C This is followed by a period of encystment with increased astaxanthin production. The process for production is similar to a phototrophic pond or photobioreactor, and involves the production of astaxanthin. The astaxanthin accumulation phase was very long, and the astaxanthin content was higher than that normally observed in light-induced cysts. The differentiation process required two morphological steps, which only a small proportion of Disadvantageously, this process requires no agitation, which is not adjusted to the fermenter. It is a process.

[0016] U.S. Patent Application Publication No. 20150252391 discloses a method for the treatment of Haematococcus pluvialis (Ha A two-stage culture for Ematococcus pluvialis, using sodium acetate and sodium nitrate. Supplemented with sodium nitrate, calcium nitrate, potassium nitrate, and optional plant growth regulators Heterotrophic conditions in dark on a medium containing The first stage is vegetative cell growth, with negligible biomass growth for the first time (5-7 days). 2. Illumination of diluted cultures followed by nutrient depletion during the encystment period of 5–7 days The paper teaches the induction of cysts and astaxanthin accumulation using light induction by Advantageously, this process for astaxanthin production involves two morphological steps: requires cell differentiation; the combination of phases is very long, and contains 2.25% astaxanthin 400 hours (16.7 days) plus at least 72 hours to produce biomass with Disadvantageously, this process requires time (3 days) for the culture to dislodge from the growth vessel. For photoinduction of algae cells, the cells must be transferred to a light induction device. Even more disadvantageous is the long cycle time, which includes a lag period of 5-7 days. .

[0017] Similarly, several combinations of light and dark condition stages are described in U.S. Patent Application Publication No. 2015023280. In No. 2, nitrogen limitation or nutritional restriction caused cyst formation due to pigment accumulation under dark conditions. Disadvantageously, this process is taught in one of its phases: the use of two vegetative phases (light and dark), dependent on photosynthesis or the use of light in one; Dependence on nutrient formation; Inhibition of sustained growth in sodium acetate; Due to nutrient phase and nutrition The use of separate physical devices or facilities for the separation of the growth and encysting phases and the system This requires further growth restriction by the use of N restriction for nucleation.

[0018] Another obstacle to heterotrophic cultivation of Haematococcus is the very long delay. It has a low specific growth rate of 0.21 / day to 0.24 / day with a stagnant phase. The red color of the biomass is due to cell growth in the dark, followed by high salt stress in the dark. or 1.85% astaxanthin content; After 8 days of photoinduction at elevated temperatures from 22-25°C to 28-30°C, It requires cell differentiation in a two-step process consisting of encystment and carotenogenesis. A further obstacle is the lack of methods known in the art to support higher density cultures in heterotrophic fermentation. The need for high mixing and oxygenation rates is well known. For members of the order Chlamydomonadales, a fluid that causes flagellum loss and cell destruction High sensitivity to shear is a major concern in non-flask bioreactors, i.e. fermentors. It is problematic to achieve high cell concentrations using EP 2878676 (US Pat. No. 5,333,626). As described in Japanese Patent Application Publication No. 20150252391, A very low agitation speed for heterotrophic conditions is reported as 40 rpm, which is the rate at which the heterotrophic stage is terminated. Instead, light induction occurs and only after the cells have differentiated into more resistant cysts is the incubation time at 100 rpm. or below 200 rpm. Unfortunately, the low biomass growth makes this an industrial This makes it difficult to realize in practical applications.

[0019] The sustained growth inhibition in sodium acetate was due to the sodium acetate as fixed carbon. When grown heterotrophically, various Chlamydomonadales, Chlamydomonas It was also a problem for Chlamydomonas reinhardtii. Although high specific growth rates were observed, near complete growth in dilution cultures and after 40 h was not observed. Long inhibition is useful for commercial fermentation cycles of one week and for large-scale bioreactors with desirable, higher culture densities. This work is a major obstacle to accumulating mass and bioproducts. The dilutions were performed at 0.05 g / L and 1 g / L final densities, respectively, and new At higher, commercially relevant cell densities, the addition of extra medium to the culture was necessary. As is known in the field, this leads to inhibitory salinity levels and even earlier cessation of vegetative growth. The amount of sodium acetate per volume of culture was increased to provide sufficient carbon to support large-scale production. Demand for Umm will increase dramatically.

[0020] In these earlier cases, heterotrophic Haematococcus or Cladophora The carbon sources metabolized by Chlamydomonas are similar to those of the more common heterotrophic microorganisms. Algae prefer sodium acetate over glucose as a fixed carbon source. This is because nitrates, generally Among the many nitrogen sources recently tested, including urea, the photosynthetic Haematococcus pluvialis Combined with sodium nitrate, it provided the best growth of Haematococcus pluvialis. Some freshwater species may experience high sodium and other nutrient-related problems due to the accumulation of sodium in the culture broth. The inability to grow at high salt levels limits the production of sufficient biomass for practical mass cultivation. It interferes with Haematococcus and other Chlamydomonads. In the case of B. ales, as mentioned above, cyst formation is induced by arresting cell proliferation, resulting in Disadvantageously, sodium nitrate for salt reduction would reduce the biomass produced. The interruption of thorium at appropriate levels induces sporulation by nutrient-depleted broth. Wax.

[0021] Nutrient limitation, especially nitrogen depletion, alters the baseline that exists in green vegetative cells of green algae. This is a general and effective means of inducing pigment accumulation beyond that of human ovarian cancer. No. 120264195 is a study on nitrogen depletion for Chlamydomonadales. One major obstacle to its use is that it stops vegetative growth and requires additional steps to protect it from harsh environmental conditions. Spores and cysts such as immobile spores and zygospores with their hard outer wall for the formation of Disadvantageously, this may result in premature growth via nitrogen starvation. Shutdown limits the productivity of a culture system that has a certain desired minimum production cycle time.

[0022] In summary, the long lag phase, slow growth rate, prevention of vegetative growth, and induction of immature encystment are key features of the microbial community. sensitivity to various factors, a long encystment period for astaxanthin accumulation, and The obstacle to the formation of glycerol itself is the use of glycerol in typical industrial production cycles that use nutrient dependency. Haematococcus truncatus with higher astaxanthin content than red yeast (Phaffia) for use in food This effectively negates any benefits to Haematococcus cells. This means that the heterotrophic production method can be phototrophic or photoinduced in the absence of light. This results in a lower yield of astaxanthin in heterotrophic biomass compared to that available from other sources. Further exacerbating these problems, as is known in the art, Cysts are extracted or digested as part of the diet compared to non-rigid cells which remain motile This means that it will become more difficult.

[0023] Theoretically, from a commercial standpoint, the cells of microorganisms used in heterotrophic mass cultures The type is the one that exhibits the highest specific growth rate and the highest growth rate per unit time and culture volume under the optimized conditions. or should have a preferred compositional content. Haematococcus and Microalgae of the order Chlamydomonadales, including Chlamydomonas The improvement of any cell or cell line of this kind produces sufficient biomass and production capacity within 120 hours. For heterotrophic production over the shortest possible time, suitable for a compact fermentation cycle such as that of ikuru. This has not been done due to accumulation of target compounds that would otherwise be produced in cells selected for heterotrophic production. The strains would be economically advantageous for increasing productivity and reducing costs. Additionally, the improvement of cell lines with altered levels of target compounds is influenced by weather, climate, season and geography. It is desirable to optimize efficient industrial heterotrophic fermentation that does not depend on The compounds are terpenes, carotenoids and their isoprenoid precursors, as well as derivatives of the precursors. This includes, but is not limited to, conductors.

[0024] Methods for improving cell lines include mutagenesis and selection of individual colonies on agar plates. Traditional methods for the preparation of carotenoids are well known in the art. Biosynthesis inhibitors, norflurazon, diphenylamine and nicotine, or mixtures thereof The use of mutagenized photoautotrophic algae of the Chlorophyceae class is described in U.S. Pat. No. 8,443,333. No. 04,468 is a compound that inhibits norflurazon and Haematococcus pluvialis. s pluvialis), and U.S. Patent No. 8,911,966 describes the use of H. pluvialis. and nicotine selection. The use of mutagenized populations has disadvantages. because mutagenesis is random and does not result in other unintended or deleterious effects. This is because the pigment may affect the organism in other aspects besides pigment accumulation. These include, but are not limited to, speed, asexual reproduction, and temperature sensitivity.

[0025] Another method used interchangeably is flow cytometry (FCM) or fluorescence activated cell FACS is a method for separating carotenogenic yeast, red yeast (Phaffia), and organisms that do not have chlorophyll. It was also shown to be useful for the selection of cell lines that overproduce astaxanthin. However, due to interfering autofluorescence from chlorophyll, Haematococcus pluvialis uvialis) was unsuccessful.

[0026] Yet another method for improving cell lines employs genetic engineering. This involves recombinant Chlamydomonas Chlamydomonas, Haematococcus and Dunaliella Many examples, including those of Chlamydomonadales, are suitable for the method. do.

[0027] This can be achieved, for example, by culturing recombinant cells transformed with the introduction of a carbon transporter. Hexose HUP1 transporter in Chlamydomonas reinhardtii inhardtii strain Stm6Glc4 insertion resulted in enhanced biosynthesis with exogenous glucose supply. The strain still grew heterotrophically limited in the dark, effectively linking the process to hydrogen production. Cell growth and glucose as a carbon source in C. reinhardtii This indicates that it cannot be used in place of acetate.

[0028] This phenotype and the improved ability of the strain to grow heterotrophically on organic acids are provided by the present invention. Combination with the process can be powerful due to improved specific productivity. Summary of the Invention

[0029] A method for synthesizing a product of interest is provided, the method comprising: providing a culture medium comprising an organic acid as a fixed carbon source; Providing microalgae cells that produce a product of interest, the microalgae cells Sexually heterotrophic organisms, steps and ; The microalgae cells are cultured in a culture medium under dark conditions to produce a microalgae culture from the microalgae cells. and Before the microalgal cells in the microalgae culture undergo cell differentiation, the cells are removed from the microalgae culture. isolating; Purifying the product of interest from the microalgae culture. Includes.

[0030] The products of interest can be microalgal biomass, pigments, terpenes, recombinant molecules, biogas, or The compound can be, but is not limited to, a cyclic alkyl group or a precursor thereof.

[0031] The methods of culturing facultative heterotrophic organisms under heterotrophic conditions described herein include the steps of: This provides both vigorous growth of the cells and a higher rate of synthesis of the desired product. In this state, microalgal biomass accumulates by cell division with a specific growth rate of more than 0.24 / day. The culture is continued for at least the first 96 hours. In one embodiment, the product of interest is a pigment. and can be produced at a specific productivity rate of greater than 0.063 mg / L per hour.

[0032] The culture step was performed without microalgae cells undergoing cell differentiation for less than one week. In certain embodiments, the microalgae cells are from the order Chlamydomonas. lamydomonadales, and for example, microalgae cells belong to the genus Haematococcus species. ccus spp., Chlamydomonas spp., Chloromonas spp. oromonas spp., Dunaliella spp., or Chlamydocapsa spp. The species may be, but is not limited to, Chlamydocapsa spp.

[0033] In one embodiment, the microalgae cells are grown using a method to support the growth of the microalgae cells. It is co-cultured with a second cell that uses a different fixed carbon source compared to the supporting organic acid.

[0034] In another embodiment, the microalgae cells are fed the same organic acid fixing carbon to support their growth. The cells are co-cultured with a second cell using a different source.

[0035] In further embodiments, the microalgae cells lack chlorophyll, are non-photosynthetic, or is amastigotous.

[0036] Further embodiments provide methods for identifying and isolating microalgae cells suitable for the synthesis of a product of interest. This method: Cultivating the microalgae strain under at least partial heterotrophic conditions to produce microalgae cells. and Microalgae strains from which microalgae cells are produced when grown under heterotrophic conditions identifying non-mutagenized microalgal cells having comparatively favorable characteristics, The identifying step is carried out using a fluorescence activated cell sorting technique and / or a phototaxis reaction. To be, steps and; Isolating non-mutagenized microalgal cells having desired characteristics. Includes.

[0037] In one embodiment, the culturing step includes, for at least a portion of the culturing step, mixing. A favorable feature is the increased synthesis of the desired product by the microalgae cells. Examples of such flagella include, but are not limited to, the absence of flagella in microalgal cells. [Brief description of the drawings]

[0038] [Figure 1] Flow diagram outlining an overall method for improved heterotrophic production of a microbial product. The major components in the process are highlighted. Microalgal cells (10) along with organic acids as a fixed carbon source (20) are provided to the culture medium in a fermenter (30) for heterotrophic growth in dark conditions, and product formation is obtained in the fermenter (30) without relying on exposure to light or transfer to a second vessel, and without relying on cell differentiation, resulting in an output of an algal product (40). The output can be further processed as desired. [Diagram 2]Left: Isoprenoid accumulation curves of selected microalgal isolates. Vegetative macroautotrophic (motile, biflagellated) cells can accumulate high levels of the pigmented isoprenoid, astaxanthin, in just a few days. If allowed to differentiate into hematocysts, they could accumulate larger amounts of the product. Top right: Red motile flagellated macroautotrophic cells and populations with accumulated pigment in heterotrophic culture. Bottom right: Typical red immobile aflagellate hematocysts in phototrophic culture. Enlarged cell size explains the increase in cell mass due to the cessation of cell division. Commercial producers must employ a stress of light conditions exceeding at least 7-10 days to obtain cysts. [Diagram 3] Examples of changing pigment profiles 3 days after induction of carotenogenesis showing the relative amount of each carotenoid among the total carotenoids. A: SO4 depletion. B: Urea depletion; carotenoid profile also resembles excess ammonium accumulation. C: Addition of 45 mM NaCl. [Figure 4] Accumulation of heterotrophic biomass over time during vegetative growth on organic acid with an initial biomass of 0.2 g / L for various specific growth rates according to the method of the invention. A: Specific growth rates of 0.77 / day (square line, from steps described in Example 5) and 1.0 / day (triangle line, from steps described in Example 6) according to the method of the invention compared to 0.24 / day (diamond line, highest value reported in the prior art). B: Fold difference in biomass accumulation over time by vegetative growth using the method of the invention compared to the growth rates of the prior art. Small changes in specific growth rate have an enormous effect on cell density. Specific growth rate values ​​from 0.24 / day to 0.77 / day represent a 3.2-fold increase in specific growth rate; at 96 hours, the yield is 8.1-fold higher cell density. Specific growth rate values ​​from 0.24 / day to 1.0 / day represent a 4.2-fold increase in specific growth rate; at 96 hours, the yield is 20.75-fold higher cell density. [Diagram 5] An example of a plasmid vector, K588, used in the present invention for double-stranded RNA expression in Chlamydomonas reinhardtii KAS1402, which is suitable for fast heterotrophic growth. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] As used herein, the singular forms "a," "an," and "the" are used interchangeably. "The" can include the plural unless the context clearly indicates otherwise. It is further intended that the terms "including," "includes," "having," " "having," "has," "with," or variations thereof To the extent used in either the detailed description and / or claims: It is intended to be as inclusive as the term "comprising." The phrase (and any grammatical variants thereof) "comprising", "comprise "s)", "comprise", "consist essentially of", "consist essentially of", "consist "Becoming" and "consisting of" can be used interchangeably.

[0040] The terms "about" or "approximately" refer to an acceptable range for a particular value as determined by one of ordinary skill in the art. It means that it is within the margin of error, which is how the value is measured or determined. That is, it depends in part on the limitations of the measurement system. Specific values ​​are described in the application and claims. where applicable, unless otherwise specified, this means within the acceptable margin of error for that specific value. The term "about" should be presumed to mean any particular embodiment. In the context of compositions containing amounts, these compositions are within the range of 0 to 10% of that value. Contains the stated amounts of ingredients with variation (error range) (X±10%).

[0041] In this disclosure, ranges are used to avoid having to redundantly recite each individual value within the range. In order to avoid this, the shorthand notation is used. Any suitable value within a range may be expressed as the upper limit of the range, as appropriate. For example, a range of 0.1 to 1.0 can be selected as 0.1 and the extreme values ​​of 1.0 as well as 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, Intermediate values ​​of 0.8, 0.9, and 0.2-0.5, 0.2-0.8, 0.7-1.0, etc. The ranges used herein represent all intermediate ranges encompassed within the range of 0.1 to 1.0, such as When used, combinations and subcombinations of ranges (e.g., subranges within the disclosed ranges) are included. ), specific embodiments therein are expressly intended to be included.

[0042] The term "photoautotroph" refers to an organism that produces its own food from inorganic substances using light as an energy source. Examples of photoautotrophs are green plants and photosynthetic bacteria. Some examples include:

[0043] The term "facultative" refers to the state of being capable of a particular lifestyle, but not limited to that lifestyle. For example, facultative anaerobes are organisms that can produce aerobic gas by aerobic respiration when oxygen is present. They can synthesize TP, but in the absence of oxygen, they can undergo fermentation or anaerobic respiration. do.

[0044] The term "facultative heterotrophs" refers to organisms that survive when light energy is insufficient or absent. In addition, they may utilize organic compounds for growth and / or maintenance and / or survival. The term refers to facultative heterotrophs and organisms that have lost the ability to carry out photosynthesis. They either lose their trophic potential or acquire a defect that makes them unable to grow as phototrophs. Dark-resistant plants can be genetically engineered for nutrient conversion or for the use of preferred carbon sources. The term also includes progeny thereof which can be grown in a culture medium.

[0045] Some representatives that can grow in the dark in the presence of acetate as a carbon source The facultative heterotrophs are Chlamydomonas reinhardtii and C. disosmos. Chlamydomonas includes, but is not limited to, , Chlamydomonas Resource Center (http: / / www.chalamy collection.org / ) and species and strains listed in Algaebase. Examples of such cases include:

[0046] Chlamydomonas nivalis is a red / orange pigmented A general term for Chlamydomonas and Chloromonas. The term "Chloromonas" refers to the order Chlamydomonadales and It also refers to a related taxon in the Chlamydomonadaceae family. Various species available in the culture collection include Chloromonas rosae )UTEX SNO4, Chloromonas brevispina UTE XB SNO103, and Chloromonas tughillensis )UTEX SNO92.

[0047] The term "Chlamydocapsa" refers to the order Chlamydomonadales. ) and also refers to related taxa in the family Palmellopsis (Palmellopsidaceae). Various species available in the culture collection include Chlamydocapsa sp. C CCryo 101-99, IBMT Culture Collection; C. ampla (Gloe Gloeocystis gigas (UTEX 291); C. maxima (C. maxima) (UTEX 166); and C. lobata (CCAP9 / 1).

[0048] The term "Dunaliella" is available in many recognized collections. In the order Chlamydomonadales, in the family Dunaliellaceae This refers to yet another related taxon in the genus Acanthurus (Tran et al., 2013).

[0049] The term "pure culture" means that only a single species, variety, or strain of an organism is present and all cultures It refers to the state of a culture that is free from all other living organisms.

[0050] As used herein, the term "biomass" refers to living or non-living matter. Refers to the collection of biological materials and their derivatives, both natural and processed, and more Therefore, the terms "microalgal biomass" and "algal "Biomass" refers to the material produced by the growth and / or reproduction of microalgae cells.

[0051] "Biomass production" or "biomass accumulation" is the total number of cells of an organism present in culture. Biomass refers to the increase in mass or weight over time. Biomass is typically defined as the mass of cells; It consists of extracellular material, such as that which may be secreted or released by cells; It may also be processed such that portions are removed leaving a residual biomass.

[0052] Biomass accumulation in the vegetative cell stage prior to differentiation into cysts is thought to be related to the differentiation of cysts into cysts. This differs from post-transplant biomass accumulation, in which some or all of the cell population stops dividing. The cell size increases.

[0053] The term "specific growth rate" refers to a quantitative measure of population increase per unit time. To facilitate comparison across studies and across time periods, it is important to specify which growth phase a measure encompasses. Must be limited.

[0054] Also called the "logarithmic" phase or "logarithmic growth" phase or "active growth," this phase occurs before cell differentiation. The specific growth rate measured during active cell division is called "stationary" and individual cells stop dividing. However, measurements were taken during the "non-vegetative growth" encystment phase, during which the population can expand and increase. It is different from the original.

[0055] Fed-batch fermentation is when one or more nutrients are fed into a bioreactor during cultivation. This refers to fermentation in which the product is removed from the bioreactor and the product remains in the bioreactor until the end of the fermentation run. In the fed-batch fermentation run, some of the volatile or gaseous products may be removed.

[0056] A "product of interest" is a substance synthesized by a cell. Examples of products of interest include: These include, but are not limited to, proteins, lipids, hydrocarbons, biogas, volatile materials, sugars, Examples of such compounds include amino acids, isoprenoids, terpenes, or precursors thereof. Substances can be synthesized constitutively by organisms throughout their growth, and the amount of a substance in culture The synthesis of such substances may simply increase with increasing numbers of organisms. in response to conditions or other environmental factors, e.g., nitrogen starvation or elevated ammonium levels. Can be induced.

[0057] The amount of product of interest that accumulates over time relative to the culture volume and relative to the original volume This is considered "product accumulation" which can be measured by specific productivity.

[0058] The term "Chlamydomonadales" was formerly used to refer to the order Chlamydomonadales and Dunaliella. Includes taxa that were previously placed in the order Dunaliellales, such as Chlamydomonas The order of green algae is represented by the Chlamydomonadales (Lewis and McCourt, 2004). Members of the family Lamydomonadales have different cells for vegetative, stationary and sexual reproduction. It has a life cycle with a type.

[0059] The term "Haematococcus" refers to bacteria that generally live in fresh water or are more commonly found in water. Recently, it has been isolated from harsh saline environments ( Chekanov et al., 2014 ) and is known to be a species of H. pluvialis ( H . pluvialis and H. lacustris, as well as public and private strain collections. Algaebase (World Wide Website: algaeb A group of unicellular microalgae represented by those listed in the National Agricultural Standards (see ase.org / ). Haematococcus is a member of the Eukaryote domain, Chlorophyta kingdom, and Chlorophyta kingdom. Phylum or division, Chlorophyceae, Order Chlamydomonadales and is a genus of microalgae classified in the Haematococcaceae family. do.

[0060] The term "Chlamydomonas" refers to the organisms in the domain Eukarya, kingdom Chlorophyta, and kingdom Chlorophyta. In the division or phylum Plantae, the class Chlorophyceae, and the family Chlamydomonadaceae This refers to the genus of microalgae that it is classified under.

[0061] The terms "conditions favorable for cell division" or "conditions favorable for vegetative growth" are used in industrially produced orchids. However, the lag time is about 60 to 168 hours, preferably 144, 120 Or it refers to conditions in which cells divide at a pace that is completed in less than 96 hours.

[0062] The term "cytodifferentiation" or "differentiation of cells" refers to the various morphological changes that occur during asexual reproduction, i.e. This refers to the transformation of vegetative cells into cyst cells. Also called zoospores or macro-independent cells. "Veterinary" cells are biflagellated, motile, and may be ovoid, ellipsoidal, ellipsoid-rod, or They are nearly spherical cells surrounded by a wall. "Cyst" cells (also called "cysts") are spherical, immotile, lack flagella, and "Mature stem cells" are immotile, stationary cells that lack flagella and have a heavy, resistant cell wall. These can be "immature cysts" which develop into "cells" or "immobile spores". The release of cells or micro-cells allows them to develop into vegetative cells.

[0063] The term "co-culture" and variations thereof, such as "co-cultivating," refers to culturing organisms in the same fermenter or refers to the presence of two or more types of cells in a bioreactor. The cells may be microorganisms such as microalgae, or may be cultured together with different cell types. The culture conditions may be for the growth and / or proliferation of two or more cell types. of two or more cell types while promoting or maintaining the remaining cell growth It may be to promote the growth and / or reproduction of one or a subset of species.

[0064] The terms "cultured" or "culture" or "culturing" refer to the intended culture conditions. The use of the method allows the determination of the growth (cell size, cell content, and / or increased cell activity) and / or proliferation (increased cell number through mitosis). Refers to intentional development.

[0065] The combination of both growth and reproduction may be referred to as propagation. Examples of intended conditions include The method includes, but is not limited to, the cultivation of a defined medium (such as pH, ionic strength, and carbon source). The specific temperature, oxygen, and The term refers to the natural growth of organisms, such as in nature or of living organisms. "Microorganisms" does not refer to the growth of microorganisms without other intentional introduction or human intervention.

[0066] The term "fermenter" or "bioreactor" or "fermentation vessel" or "fermentation A "tank" is a container in which cells are cultivated, optionally in liquid suspension. This means a closed or partially closed container in which the organism is cultured. The disclosed fermentor or bioreactor includes a device in which the cells being cultured are exposed to light. A closed container that allows the cells to be cultured without exposure to light or Non-limiting embodiments include a partially sealed or sealed container. The term "port" in the context of a vessel that is a microreactor or bioreactor is used to A port is an opening in a container that allows the inflow or outflow of materials such as blood and cells. It is usually connected to piping leading from a fermenter or bioreactor.

[0067] The term "fermenter" refers to an organism that causes fermentation.

[0068] The term "fixed carbon source" refers to any carbon source that is used as a source of carbon and / or energy by an organism. Typically, a fixed carbon source is a compound that can be grown at ambient temperature and It exists in solid or liquid form at pressure.

[0069] The term "organic acid" refers to one or more molecules that are organic compounds that have acidic properties. The most common organic acids are carboxylic acids. "Carboxylic acids" are commonly used in algae fermentation. It contains a different carboxyl group than the sugar carbohydrates used, such as glucose. , a two-carbon carboxylic acid commonly used in chemical manufacturing, CH3COOH. The organic salt, sodium acetate, CH3COONa, is the trihydrate sodium salt of acetic acid. Pionic acid (propanoic acid) is a carboxylic acid with the chemical formula CH3CH2COOH. The anion CH3CH2COO- and salts and esters of propionic acid are These acids are known as esters (or propanoates). Other such acids include: These include, but are not limited to, citric acid, fumaric acid, glycolic acid, lactic acid, malic acid, pyruvate, Examples include carboxylic acid and succinic acid.

[0070] "Sugar acids" and "chlorogenic acids" are also organic acids, including, but not limited to, glucuronic acid. uronic acid, galacturonic acid and other uronic acids, as well as lignocellulosic derivatives. The organic acid may be used alone or in combination with other organic acids such as ferulic acid, which has a carboxylic acid functional group. may be used in combinations such as those that occur naturally in lignocellulosic derivatives. do.

[0071] The terms "heterotrophic conditions" and "heterotrophic fermentation" and "heterotrophic cultivation in the dark" are used interchangeably. "Heterotrophic dark culture" or "dark culture" refers to culture on at least one fixed carbon substrate. It refers to the presence of raw materials and the absence of light during fermentation.

[0072] The term "isoprenoid" or "terpenoid" or "terpene" or "isoprenoid" "Derivatives of isoprenoids" refers to derivatives of isoprenoids that have any number of 5-carbon isoprene units. Any molecule derived from the plant, including, but not limited to, monoterpenoids and camellia. These include compounds that are derivatives of rotenoids, such as xanthophylls. The prenoid pathway is involved in the regulation of pigments, terpenes, vitamins, fragrances, flavors, solvents, steroids, and Many of these additives include, but are not limited to, hormones, lubricants, additives and pesticides. These compounds are used in the manufacture of food and beverage products. Foods, fragrances, feed, cosmetics, and raw materials for chemicals, dietary supplements, and medicines Used in.

[0073] The term "carotenoid" refers to a compound consisting of a polyene backbone condensed from five-carbon isoprene units. "Carotenoid" refers to a compound that is acyclic, or mono- (monocyclic) or bicyclic. and may be terminated with any number of cyclic end groups (bicyclic). The term "carotenoid" refers to It may contain both carotenes and xanthophylls.

[0074] "Carotene" refers to hydrocarbon carotenoids. "Xanthophylls" refers to oxygenated carotenoids. The pyrophosphate and phosphate group modifications of isoprene derivatives include monophosphates. Terpenes, diterpenes, triterpenes, or sesquiterpenes, among others. These include, but are not limited to, oxidation or cyclization to provide acyclic, monocyclic and bicyclic terpenes. Can be obtained.

[0075] The term "conditions favorable for carotenogenesis" or "carotenogenic trigger" refers to the condition in which cells are able to produce carotenogenesis. These conditions, either alone or in combination, are intended to mean conditions that result in the accumulation of tenoids. The conditions can occur in a variety of ways and can be substituted for each other. They may be naturally occurring or may be exogenously occurring and cultured or provided. The conditions may be chemical, biological, or a combination thereof. and physical.

[0076] The term "microorganism" refers to microscopic single-celled organisms, including but not limited to, microorganisms. Microorganisms that can be used for fermentation according to the present invention are not limited to these. However, mutants selected for specific characteristics, natural strains, or naturally occurring Genetically engineered variants of the strain are included.

[0077] The term "microalgae" refers to eukaryotic microorganisms that contain chloroplasts and are optionally photosynthetic. Microalgae are prokaryotic microorganisms that may be photosynthetic or metasynthetic. Obligate photoautotrophs that do not metabolize fixed carbon sources for energy but cannot metabolize fixed carbon sources for energy These include obligate or facultative heterotrophs that can metabolize food and fixed carbon sources. However, as obligate heterotrophic microalgae, they have lost the ability to be photosynthetic. Microalgae may or may not have chloroplasts or chloroplast remnants. The cells can be divided to generate a population of cells, allowing for scale-up or maximum production. Production to produce biomass, a process that can be continued indefinitely until viability is achieved. You can enter the period.

[0078] The term "recombinant" as used in reference to a cell, nucleic acid, protein, or vector, that the cell, nucleic acid, protein or vector has been modified from its natural state; For example, a recombinant cell can be a cell that expresses an exogenous nucleic acid or protein or a naturally occurring nucleic acid or protein. The invention relates to a method for the preparation of a cell or organism that includes a protein modification or is modified in such a manner. It is derived from microorganisms.

[0079] In the context of selected strains or lineages of a species, the term "robust" or "robus "Laboratory culture" refers to a process in which the desired phenotype and, in particular, heterotrophic growth is achieved by culturing a strain that is equal to or greater than the original strain. It refers to an algal population that contains large growth characteristics. Maintaining robust growth characteristics is essential for the growth of Using mutagenesis and chemical selection to obtain mutants with increased pigment content. This can be very problematic when

[0080] In some embodiments of the present invention, the loxotropic acid is produced in a manner that increases the yield of pigments or other products. Mutations to generate mutants that retain robust growth characteristics under heterotrophic conditions De novo selection and selected subpopulations resulting from induction-independent methods are used.

[0081] Until now, sustained, rapid fermentation has been achieved in a time frame that is short enough to fit into a typical commercial fermentation cycle. Providing genotrophic cell growth is achieved by facultatively dependent organisms that use organic acids as their sole source of fixed carbon. It has been recognized as a crucial factor for nutritional microorganisms.

[0082] A preferred embodiment of the present invention is a method for the preparation of a baculovirus from cells of the order Chlamydomonadales. A method for producing biomass or a method for producing Chlamydomonadales ) cells.

[0083] In certain embodiments, the present invention relates to spore-forming Chlamydomonadales. s) or in the dark, which results in the cessation of vegetative growth and thereby limits product formation. Similar morphological or physiological responses to nutrient depletion or elevated salt during fermentation culture. The method is provided for use with other concentration-sensitive microorganisms.

[0084] Advantageously, the method of the present invention does not require organic acids for heterotrophy, but preferentially Therefore, high levels of ammonium or ammonium nitrate can be used for rapid vegetative growth. Various cell types, which may include different microalgae species, can mitigate the accumulation of other metabolites. It further enables co-culture with

[0085] In a preferred embodiment, the present invention provides an improved, cost-effective method for the production of heterotrophic fermentation in the dark. In certain embodiments, the present invention relates to a method for the preparation of a strain of Chlamydomonada The present invention provides for the use of cells belonging to the genus Bacillus subtilis (Les) and other organic acid-requiring microbial cells.

[0086] In a preferred embodiment, the method of the present invention provides for the heterotrophic cells to grow for a period of time suitable for industrial production. The object is to achieve a certain specific growth rate even when the The methods of the invention can be carried out using commercially available equipment.

[0087] In certain embodiments, the present invention provides an isoprenoid or a derivative of an isoprenoid, and Chlamydomonas albicans, which provide heterotrophic fermentation for industrial production of biohydrogen. The present invention provides a method for producing isoprenoids by the method of the present invention. Examples include, but are not limited to, pigmented isoprenoids, colorless phytoene, or These include isoprenoid derivatives that can be produced by interrupting or redirecting carbon flux. do.

[0088] In a preferred embodiment, the cells of the invention have a higher production of biomass, pigment or isoprenoceptor. In another embodiment, the present invention provides for faster production, such as ide production, on a commercial scale. Cells exhibiting biogas production and recombinant molecule production that are efficient and economical under fermentation conditions. To provide cells that function in a targeted manner.

[0089] In certain embodiments, heterotrophic cells of Chlamydomonadales The cells are provided in a manner that, when cultured according to the methods disclosed herein, do not undergo cell differentiation. They accumulate pigments in the vegetative phase without any need for mevalonate, indicating an active native non-mevalonate MEP pathway. When supplied with a non-limiting organic acid, the cells provided by the present invention are capable of photosynthesis. benefits from the lack of interference from the carbon dioxide and the carbon flux through the pathway to the added sink. In certain embodiments, the cells provided by the present invention are A non-photosynthetic heterotrophic cell belonging to the order Chlamydomonadales that lacks chlorophyll It is.

[0090] In some embodiments, the present invention provides a facultative strain having an altered isoprenoid profile. Heterotrophic biomass from heterotrophic Chlamydomonadales cells. In certain embodiments, the methods of the present invention are provided to enable the creation of: At high growth rates, fermenters can be grown for relatively short periods of time that are relevant for industrial applications. Biomass can be produced.

[0091] To engineer heterotrophic cells for modified isoprenoid production, A variety of strategies are available for generating recombinant cells for peptide synthesis can be employed.

[0092] The cells and methods of the invention described herein include: 1) providing a high specific growth rate during the generation period; 2) Using organic acids to manage salt toxicity, allowing for the extension of conditions favorable for vegetative growth. year; 3) using urea to further manage salt toxicity; 4) eliminating the requirement for cell differentiation, resulting in accumulation of product; 5) accumulates high product yields in the absence of light; 6) accumulate high product yields in the absence of nutrient depletion; 7) The method provides improved strains and cells for high yield, high quality and reliable fermentation. Adopt stocks.

[0093] Heterotrophic microalgae, either extracted or biomass, are used in animal feed, human nutrition and Nutritional supplements, personal care, colours, flavours or fragrances, bioenergy , for crop protection, or for chemical modification before or after product formation.

[0094] Using the method of the present invention, it is possible to obtain isoprecipitates mediated by Chlamydomonadales. Large-scale fermentation for the production of proline, carotenoids, biogas and other products The numerous and important benefits to be gained from algae cultivation in the do.

[0095] The improved methods of the invention described herein provide uninhibited growth, , longer periods such as 120 hours or more and at higher cell densities are possible.

[0096] The method of the present invention reduces the need for dilution of the culture and the need for sodium acetate to supply carbon. Avoiding demands. Both of these "demands" cause salt accumulation and growth inhibition. In certain embodiments, the present invention provides a method for preventing the development of It utilizes organic acids as the main source of carbon throughout the fermentation process and nitrate as the nitrogen source. To avoid over-concentration and to minimize the addition of salt, in some embodiments, urine In certain embodiments, organic nitrogens are used, including but not limited to nitrogen. , the culture medium lacks nitrate as a nitrogen source and contains urea.

[0097] In some embodiments, increasing the culture pH allows for the addition of a carbon source without introducing extra salt into the culture medium. This is counterbalanced by the fed-batch addition of all organic acids. In this case, the medium lacks salts of organic acids that are used in the medium as fixed carbon sources.

[0098] Advantageously, the method of the present invention provides a method for culturing cereals that is more efficient than cultures cultivated by currently used methods. In the case of about 110% to about 150%, or up to about 250% or more of the pigment or The yield of precursor content is provided.

[0099] In some embodiments, the present invention relates to the use of indoor fermentation vessels for heterotrophy as described herein. For indoor fermentation, phototrophically and outdoors in large volume for strains cultivated. A new solution for safety is proposed, the use of fermentation tanks, especially those located indoors, is provided. The use of tanks can simplify regulatory approval for industrial-scale production of recombinant products. do.

[0100] In certain embodiments, the methods provided herein include, but are not limited to, Haematococcus spp., e.g. H. pluvialis ; Chlamydomonas spp., e.g. Chlamydomonas reinhardtii monas reinhardtii); or Dunaliella spp. The present invention can be used for the expression of recombinant proteins by culturing

[0101] The use of monocultures in industrial applications is the norm, especially for fermentation. In nature, community ecology has been observed, and photosynthetic algae in raceway pond culture tanks The conditions for heterotrophic fermentation strongly discourage the introduction of faster growing bacteria. It is possible, but not impossible, to prevent their undesirable dominance while allowing the target microalgae to dominate. The introduction of a eukaryote with a similar cell division frequency may be beneficial.

[0102] In some embodiments of the invention, when it is necessary to modify the population dynamics in a co-culture, In one embodiment, a eukaryotic organism that requires alternative, reserved or available carbon or nitrogen sources is provided. Thus, one embodiment of the present invention is a strain of Chlamydomonadales A method of co-cultivating a cell with a second microorganism is provided.

[0103] Thus, certain embodiments of the present invention relate to Chlamydomonadales. The cells belonging to the trophic group were cultured to produce sufficient biomass and target compounds in the trophic group for the shortest period of time. Provides nutritional accumulation.

[0104] In preferred embodiments, the lag phase is effectively minimized or eliminated. In this embodiment, the specific growth rate is 0.6 / day or more and increases to 1.1 / day or more, Long enough to provide a long-lasting effect, for more than about 24 hours, more than about 48 hours, or more than about 72 hours will be done.

[0105] In a particular embodiment, the specific productivity (qp) for the dye is about 1.4 mg / hr. In another embodiment, the total fermentation The cycle time is about 72 hours, about 96 hours, or about 120 hours, or about 144 hours. or for any duration falling within the range of 24 hours to 144 hours; or An economically justified duration.

[0106] In another embodiment, the present invention relates to the use of organic acids instead of organic salts such as sodium acetate. and thus, the heterotrophic fermentation of microorganisms that require organic acids as their fixed carbon source. In some embodiments, the use of sodium acetate avoids the salt toxicity found in microbial Minimized or eliminated by substitution of alternative fixed carbon sources for metabolism and growth by the Therefore, the fixed carbon source used in the method of the present invention is not limited to these. Fixed carbon sources include, but are not limited to, carboxylic acids, sugar acids, or chlorogenic acids. Examples include acetic acid, succinic acid, citric acid, fumaric acid, glycolic acid, malic acid, and pyruvate. In one particular embodiment, the carboxylic acid may be selected from the group consisting of carboxylic acids, glucuronic acid, galacturonic acid, and propionic acid. In the form of microbial biomass, the organic acids used as fixed carbon sources are derived from lignocellulosic biomass. Additional examples of fixed carbon sources will be known to those of skill in the art, and such embodiments are within the scope of the present invention. is within the range.

[0107] The fixed carbon sources may be used alone or in combination. In particular embodiments, The sodium nitrate in the culture medium is replaced with a complex nitrogen source before or during the culture. Representative complex nitrogen sources that may be useful in the present invention include, but are not limited to, urinary Examples of casein include casein itself and hydrolyzed casein.

[0108] In certain embodiments, nitrate is used as the nitrogen source in more salt-tolerant strains. or in amounts with a complex nitrogen source, or a combination of nitrates and a complex nitrogen source. .

[0109] In some embodiments, the culture medium contains sodium acetate. It can be used alone or in combination with at least one other fixed carbon source. At least one other carbon source is acetate.

[0110] In some embodiments, all of the sodium acetate and at least one other fixed carbon source All of these are provided to the microorganisms at the start of fermentation.

[0111] In another embodiment, sodium acetate is provided at the beginning of the fermentation process and is added at least once. Other fixed carbon sources are added at a given rate over the course of the fermentation or at a pH set point. For example, in one embodiment, the at least one other fixed carbon is provided at a rate induced by the The source is provided when the pH of the fermentation medium reaches about 7.5 or about 8.5.

[0112] In some embodiments, the sodium acetate is administered in combination with at least one other fixed at least one other fixed carbon source is provided at the end of the first period in the absence of a carbon source; The microorganism is cultured in the presence of at least one other fixed carbon source for a second period of time. will be done.

[0113] In certain embodiments, the present invention provides a method for the accumulation of a product of interest during heterotrophic fermentation. Methods are provided that do not require cell differentiation. For example, in certain embodiments, macro-independent The cells remain motile and biflagellated without encysting, whereas carotenoids These compounds accumulate amides, isoprenoids, or terpenoids.

[0114] In a further embodiment, the methods of the invention allow for accumulation of high product yields in the absence of light. In certain embodiments, the conditions in the fermenter are such that the microorganisms generally grow during cultivation. Any organism that does not photosynthesize and can be photoinduced by deliberate or appropriate exposure to light. It's as if there's no operational phase.

[0115] In certain embodiments, the present invention provides a method for the storage of high product yields in the absence of nutrient depletion. For example, in certain embodiments, macro-independent cells can grow in the absence of nutrient depletion. In the presence of β-lactams, they accumulate carotenoids, remain motile and biflagellate, and undergo cyst formation. No.

[0116] In yet a further embodiment, the present invention relates to a heterotrophic co-culture with at least one other microorganism. In a preferred embodiment, the mutualism between the two microalgae strains provides high levels of nutrients. Ammonium (NH4 + , NH3) accumulation or otherwise in the cell fraction of one strain. It is believed that other metabolites that may inhibit cleavage are attenuated by the other strain.

[0117] In certain embodiments, the co-culture or co-cultivation comprises: Co-cultivation is used as a strategy to promote the growth of a target species. In particular embodiments, co-cultivation is Strains that require organic acids as their fixed carbon source for heterotrophy and for heterotrophy They do not require organic acids to function, and can accumulate ethanol, lactate, or other substances under conditions of low oxygen or ammonium. or may preferentially utilize other metabolites, including, but not limited to, formate. It is a cross between different strains.

[0118] The present invention also provides high yields of carotenoids and isoprenoid precursors for biomass. To produce and cultivate microorganisms suitable for heterotrophically producing the compounds or derivatives thereof, and the above-mentioned microorganisms or the above-mentioned carotenoids and isoprenoid precursors or their derivatives. The present invention further relates to products containing the bodies.

[0119] The microorganisms of the invention can be selected or genetically engineered for use in the methods described herein. In some embodiments, Chlamydomonas that was previously only cultured photoautotrophically may be cultured. Heterotrophic fermentation of members of the order Chlamydomonadales is provided.

[0120] In a further embodiment, the present invention provides high productivity under heterotrophic fermentation in dark conditions. Improved strains are provided.

[0121] In some embodiments, the present invention provides heterotrophic cultivation of genetically engineered organisms.

[0122] In certain embodiments, the present invention provides heterotrophic fermentation of selected naturally occurring mutants. According to the method of the present invention, the selection of spontaneous mutants with high productivity is carried out by laser irradiation. Flow cytometry (FCM; used interchangeably with fluorescence-activated cell sorting, FACS) Using the methods of the present invention, it is possible to obtain a population with a higher pigment content than the original population. The ability of a subpopulation of algae with high levels of the target pigment to accumulate more rapidly than the parent population Based on the strength of the selection, the mutants can be selected and isolated using FCM. This can be used to select strains with superior temporal performance.

[0123] In a further embodiment, the present invention relates to a method for the synthesis of ribozymes at the level of the natural end compound further down the biosynthetic pathway. The present invention provides an isolated and selected subpopulation of algae that accumulates precursor compounds with reduced levels of nitrile. In a preferred embodiment, the compounds that accumulate include phytoene and phytofluene. In some embodiments, the compound is a colorless antioxidant, such as, but not limited to, These subpopulations are selected based on fluorescence differences using flow cytometry. As seen in cells with a chemically induced blockade of synthesis, such a subpopulation These colorless, high-value products are produced at levels similar to the levels of pigments that the species naturally accumulates. The method of the present invention allows for the recovery of improved cell lines with superior industrial performance. Provides directed selection performed at the correct stage for each species to increase yield In a further embodiment, indirect correlative selection using Nile Red or lipid stains. (correlative selection) is also provided.

[0124] In some embodiments, the mutants that lose chlorophyll and accumulate pigments are rapidly accumulated and highly accumulated. In other embodiments, cells or populations are utilized, Cells and populations were identified by lacking a phototactic response and no longer possessing flagella; Such cells are therefore non-motile but still vegetative. The advantage of this is that it is not subject to damage by the impeller like its flagellated counterpart. Because it’s not easy.

[0125] Isoprenoids of the present invention include, but are not limited to, astaxanthin. These include the colorless carotenoids / xanthophylls, or the colorless phytoene and phytofluene. can be done.

[0126] In some embodiments, the methods of the invention provide for the accumulation of specific targets through altered biosynthesis. In a preferred embodiment, these cells are efficiently cultured as genetically modified cells with high productivity. Targets of the enzyme include, but are not limited to, secondary metabolites such as lycopene or zeaxanthin. In a further preferred embodiment, these are the products of added synthase genes. / It is an isoprenoid obtained by expression of the enzyme.

[0127] The methods provided herein are easily manageable, provide faster crop cycle times, and are suitable for all year round cultivation. The production of the desired product can be easily achieved by culturing it in any terrain and economically. This allows the use of cells that can be obtained in yield.

[0128] Used in harvesting and further processing biomass to isolate products of interest. The methods used are well known in the art. For example, some harvesting methods include, but are not limited to: Not specified, but centrifugation for draining, flocculation and filtration, and volatile compounds and These include capturing and sparging or removal of headspace for biogas.

[0129] Some extraction methods useful in the present invention include, but are not limited to, extraction in an organic solvent. , in edible oils and with pressurized fluids and gases.

[0130] In certain embodiments, the heterotrophically produced biomass is derived directly or from animals. and as a mixture in fish feed. For example, astaxanthin-containing biomass is used for fish feed, and recombinant Chlamydomonas biomass is , used in poultry feed.

[0131] In other embodiments, isoprenoids are extracted. Astaxanthin is extracted as described in US Pat. No. 5,022,701. Numerous applications relating to the subject matter have been described in the art, e.g., Ambati et al. , 2014, Tables 4 and 5.

[0132] In a further embodiment of the present invention, improved cell culture under mixotrophic conditions is provided. In some embodiments, to increase the growth rate of cells beyond that under heterotrophic conditions, For example, in H. pluvialis, The specific growth rate under mixotrophic conditions was 2.5 times higher than that under heterotrophic conditions. In Chlamydomonas reinhardtii, the specific growth rate under mixotrophic conditions is This is 1.8 times higher than the specific growth rate under heterotrophic conditions.

[0133] Advantageously, the present invention, for example through reduced salt accumulation, extends the lifespan of the plant in mixotrophic systems. This provides prolonged log-phase growth, exceeding the already high levels seen under heterotrophic conditions. It may be particularly advantageous to increase pigment accumulation without cell differentiation beyond mixotrophic growth. An additional benefit of the 2019 study is that the cells produce oxygen when they fix CO2 using light, which reduces the time it takes for the culture to mature. It is easier to maintain dissolved oxygen levels in the medium.

[0134] In certain embodiments, the present invention relates to differentiation of cultured cells for the mass accumulation of a product of interest. To provide a fermentation method that does not require

[0135] In another embodiment, the present invention provides a dark field for measurably high specific growth rates and productivity rates. It also allows for significant biomass, carotenoid and biogas accumulation in short cycles. In a further embodiment, the present invention provides an even more productive dependency Providing new strains selected to produce trophic organisms for lowest operating costs Maximizes product levels. Simple process in the dark without the need for cell differentiation. A fermentation method and cells are described that provide higher yields by

[0136] The methods of the present invention provide a method for producing microalgae cells, e.g., genetically modified algae cells, that can be used for significant economic expansion. Cultivating algae in a reliable heterotrophic platform that transforms production for large scale production and

[0137] The method of the present invention comprises: 1) Faster production cycles; 2) simpler production logistics for the biomass or desired product; 3) reduced operating costs to compete with chemical synthesis; 4) More rapid industrial scale-up using equipment and infrastructure for microbial fermentation. Zhang and; 5) A year without problems related to indoor, outdoor or open driving, regardless of geographic location. Production during and; 6) Significantly increased inventory and access to larger markets; 7) Multiple species of GMP and regulatory compliance, including those used as hosts for recombinant molecules. Large-scale economic production under certain constraints to provide.

[0138] Establishing a pure culture and using a seed train with multiple passages before adding the final inoculum the design of the fermenter to prevent illumination of the microalgae, and the harvesting or partial Examples of general principles and methods for culturing heterotrophic algae, such as culturing to harvest, are available at See, for example, U.S. Pat. No. 8,333,636, which is incorporated herein by reference in its entirety. This is described in No. 278,090.

[0139] In a particular embodiment, the inoculum added to the fermenter is Chlamydomonadales in the dark for at least one passage before incubation. By culture or for multiple passages, e.g., 2nd, 3rd, 4th, or 5th passage It can be produced by prior incubation in the dark.

[0140] In certain embodiments, after culturing the microalgae in a fermenter under dark conditions for a period of time, All or a portion of the microalgae can be transferred to a further fermentation vessel, where the microalgae The microalgae can be cultured for a further period of time, with a further container to prevent exposure of the microalgae to light. In practice, it has been previously reported that it does not grow in dark fermentation conditions, but has mixotrophic properties. Members of the order Chlamydomonadales, such as the various red snow algae, are candidates for practicing the present invention.

[0141] Harvesting or separation, biomass processing, handling of raw biomass as product, cells Dissolution, product extraction, supercritical fluid processing, or other isolation and purification of the product are well known to those of skill in the art. Non-limiting examples of such techniques include, for example, Nos. 8,278,090 and 7,278,100, which are incorporated by reference. 329,789.

[0142] A non-limiting example of product recovery is the use of a fractional distillation column to separate different target compounds. Concentration, drying, powdering, grinding, or pulverization in preparation for extraction. Further non-limiting examples for use as biomass for food and fish feed include, for example, , U.S. Pat. No. 6,022,700, both of which are incorporated herein by reference. 1 and European Patent Application Publication No. 1,501,937. No. 20120171733, which is incorporated herein by reference, describes a method for the lysis of cells. Various means for doing so are described.

[0143] U.S. Patent Application Publication No. 200902144, which is incorporated herein by reference. No. 75 was developed to improve the extractability and bioavailability of natural astaxanthin. The soft cell wall of Haematococcus pluvialis was and soft wall mutant strains, as well as animal feed, human food supplements, and pharmaceuticals. It describes its use in medicines and foods.

[0144] The method of the present invention is based on a typical microbial growth curve or growth cycle using a fermenter. For example, using the methods of the present invention, an inoculum of cells can be introduced into a medium. This is followed by a lag period before cell growth or division begins. The lag period is followed by a steady increase in the growth rate. It increases and goes into the log phase or exponential phase. μ=ln / (X / X i ) / t, where X is is the final dry cell concentration, X i is defined as the initial cell dry concentration and t is the incubation time. The specific growth rate observed during this period is measured. With the addition of ATP, a slowdown in growth (cell division) follows the log phase. When growth stops, the cells enter the stationary phase. According to the method of the present invention, the specific productivity (qp) is calculated based on the lag, log and Measured over the entire time course of stationary phase until harvest; qp = (X) * (P) / t, in the formula, where X is the harvest dry weight, P is the percent product based on dry weight, and t is the culture It's time.

[0145] The method of the present invention provides for the measurement of relative dye content in individual cells by FCM. According to Akira, FCM isolates cells that have above-average pigment content compared to the original population. It has also been used to isolate cells with increased pigment content in newly created subpopulations. Furthermore, the method of the present invention can generate a population of vegetative cells, immature stem cells, and Using fluorescein diacetate (FDA) staining to differentiate between sarcoma and mature cysts FCM identifies and isolates cells that accumulate dye and remain motile, reproducing the original population. These can also be used to generate new cell subpopulations that accumulate dye more quickly than The methods are non-limiting and include the selection of various pigment characteristics for ultimate heterotrophic growth, e.g. Any cell type (motile or cytoplasmic) with high levels of astaxanthin, lycopene, and phytoene This method can be applied with slight modifications to select a target.

[0146] In certain embodiments of the present invention, the genetically engineered microorganisms are capable of producing biohydrogen, isoprene, Components produced by microorganisms with enhanced properties such as the production of endothelial or recombinant molecules. to modify the properties or proportions of, or to improve or provide de novo growth characteristics; For this reason, they are cultivated heterotrophically.

[0147] Haematococcus spp. (Sharon-Gojman et al., 2015), Dunaliella spp. (Feng et al., 2014) and Chlamydomonas spp. ydomonas spp.) (Lauersen et al., 2013; Scaife et al., 2015; Scranton et al., 2015) Genetic engineering is well documented and is incorporated herein by reference. The vector, cDNA and 3'UTR as well as other elements of the vector were isolated from natural sources. These fragments can be generated by cloning techniques (see, for example, Sambrook et al., 2001; and U.S. Pat. No. 4,683,202. Instead, The amides may be produced synthetically using known methods (e.g., Stemmer et al., (1995) ) for the insertion of selectable markers and reporter or transgenes. Restored mutants are also well known in the art. Certain useful algal culture conditions include The promoter is an inducible, e.g., in response to a stimulus such as ammonium or carbon dioxide. See, for example, U.S. Pat. No. 5,393,633, which is incorporated herein by reference, including its use for expression. As described in published application No. 20090317878.

[0148] Recombinant nucleic acid molecules or polynucleotides can be prepared by planting using any method known in the art. The polynucleotide may be introduced into the chloroplast or nucleus of a plant by a variety of methods well known in the art. The specific host cell to which the vector is introduced is determined, in part, based on the particular host cell. U.S. Patent Application Publication No. 20090317878, incorporated herein by reference, describes a method for producing a nucleic acid transgene. describes the use of intergenic IGS sequences in microalgae for expression. Engineered microorganisms, such as microalgae, can contain one, two or more exogenous genes, particularly When it is a transgenic plastid, it may include. Nos. 7,135,620 and 7,618,820, both of which are incorporated herein by reference. No. 19 describes chloroplast expression vectors and related methods.

[0149] As such, methods for synthesizing the desired products are described herein. Here's how to do it: providing a culture medium comprising an organic acid as a fixed carbon source; Providing microalgae cells that produce a product of interest, the microalgae cells Sexually heterotrophic organisms, steps and ; The microalgae cells are cultured in a culture medium under dark conditions to produce a microalgae culture from the microalgae cells. and Before the cells in the microalgae culture undergo cell differentiation, the microalgae cells are isolated from the microalgae culture. A step of releasing; Purifying the product of interest from the microalgae culture. Includes.

[0150] The desired products may include microalgae cells, pigments, terpenes, recombinant molecules, biogas, or Examples of suitable biomass include, but are not limited to, microalgae biomass, including algal biomass or its precursors. Pigments include carotenoids, isoprenoids, or precursors thereof, such as astaxanthin. Lutein, lycopene, zeaxanthin, canthaxanthin, beta-carotene, These may include, but are not limited to, phytofluene, or phytoene.

[0151] Terpenes or their precursors include pinene, limonene, or geranylgeranylpyrrolidone. These may include, but are not limited to, phosphoric acid.

[0152] The recombinant molecule of interest may include a heterologous protein, or a dsRNA, or It may be sRNA.

[0153] In a preferred embodiment, the methods described herein involve the production of pigments in facultative heterotrophic algal cells. A specific productivity of at least 0.063 mg / L per hour when used to synthesize The dye is produced at a rate of 100%.

[0154] The methods described herein also provide for longer term vegetative growth in microalgae cells, e.g. Between 4 days and 1 week, specifically 48, 72, 96, 120 or 144 hours of vegetative growth The method of the present invention provides, for example, 48, 72, 96, 1 Cultivation for 20 or 144 hours provided heterotrophic growth and synthesis of the product of interest. The steps are carried out under fed-batch fermentation.

[0155] As described above, conventional methods are used to synthesize a product of interest during cell differentiation under nutrient-deprived conditions. Unlike conventional methods, the method of the present invention allows the production of the desired product through vegetative growth of the culture under nutrient-rich conditions. The synthesis of the product is provided.

[0156] In addition, the target product was synthesized during cell differentiation under nutrient deprivation and terrestrial lamp conditions. Unlike conventional methods, in which the nutrient depletion conditions are used to grow the culture, the method of the present invention is carried out through vegetative growth of the culture under nutrient depletion conditions. , providing for the synthesis of a desired product without the need for light.

[0157] The method of the present invention is produced in a closed culture system to eliminate contaminants, Thus, the present invention provides algae having high quality suitable for a variety of novel animal and human uses. The closed fermentation system also allows for higher densities and faster growth rates in a short time of just a few days. In a preferred embodiment of the present invention, the algae are The species are harvested before encystment and are produced in the dark and under nutrient-rich conditions. Typical compositional analysis involves the identification of encysted differentiated cells or pigmented cells that are photobleached due to pigmentation. This is substantially different from cells that have been subjected to stress.

[0158] In certain embodiments, the methods of the present invention provide nutritional or other benefits for animal and human use. The high protein and low ash composition of the biomass for a product that provides color benefits. A substantially new profile of pigmented biomass (with vitamins and minerals) While acting as a feed colorant or pigment supplement, these nutritional benefits are The composition of the composition is comparable to that provided by the fish-derived ingredients delivered to the body. The compositions produced using the methods of the invention may also be used as food replacement beverages or carotenoid supplements. It is also attractive for nutritional supplements to be delivered as additives.

[0159] In some embodiments, these algae are grown in a controlled environment to eliminate contaminants and to reach high densities in a short period of time. In a closed culture system, the algae culture of the present invention is produced in a nutrient state in order to produce Nutrition can be used to inoculate photobioreactors or raceway culture tanks with seeds. Therefore, as part of the seed train or production cycle, solar radiation or artificial lighting To be illuminated.

[0160] In certain embodiments, the methods of the present invention provide for the production of pigmented biomass by virtue of its composition. This biomass provides a qualitatively new profile, e.g., carotenoid-containing lye. These compounds are attractive as personal care and cosmetic ingredients delivered as salts or extracts. do.

[0161] In certain embodiments of the invention, the culture medium contains urea as the primary source of nitrogen.

[0162] The steps of isolating and purifying the desired product may include drying, grinding, lysing or extracting the microalgae cells. The method may include one or more steps of extraction.

[0163] Also provided herein is a method for identifying a microalgae cell suitable for synthesizing a product of interest, This method is a method for isolating: a. Cultivating a microalgae strain under at least partial heterotrophic conditions to produce microalgae cells. and b. A microalgal fungus from which microalgal cells are produced when grown under heterotrophic conditions The step of identifying non-mutagenized microalgal cells having favorable characteristics compared to the strain. and identifying the cells using fluorescence activated cell sorting techniques and / or phototaxis reactions. The steps to be performed are; c. isolating non-mutagenized microalgal cells having the desired characteristics; Includes.

[0164] The cultivation steps are carried out under mixotrophic conditions, at least for part of the cultivation steps. It can be done.

[0165] In many embodiments of the present invention, the microalgae cells of the product of interest are subjected to a step of identifying the cells. Increased synthesis by chlorophyll or the absence of flagella in microalgal cells, lack of chlorophyll or non-photosynthetic transformation A variety of features may be pursued, including but not limited to variants.

[0166] Thus, the present invention provides cells that have desirable characteristics compared to the parent microalgae culture. do. EXAMPLES

[0167] The following examples are provided to describe the invention in more detail. These examples are , serve as examples and are not intended to limit the invention.

[0168] [Example 1] Establishment of heterotrophic strains and cultures This example describes a novel heterotrophic cell type that is cultured under conditions favorable for vegetative growth and the present It is intended to produce a product using the method of the invention. cus cells were isolated from environmental samples or collected at the University of Texas (Austin, Tex., USA). UTEX250 obtained from the Culture Collection of Algae The cells were obtained from a bacterial culture collection such as the phototrophic Haematococcus pluvialis (Haem may include isolates with higher salt tolerance, such as strain BMI of C. atococcus pluvialis ( Cells can also be obtained from commercial-scale photosynthetic cultures. In the case of germinating cysts or spores, they are fractionated and contain green motile cells. This occurs under conditions favorable for generating motile cells, producing a culture that can be cultured with an inverted microscope. This is useful for identifying the life cycle stage (vegetative, immature cyst, cyst). To reduce the initial contaminant load, the culture was centrifuged at 200 g for 1 min to remove algae and Selectively pellets heavy cells, including contaminants. Immediately after centrifugation, remove the medium and The medium was replaced with bacterial culture medium, centrifuged at 1000 g for 1 minute, and the motile cells were then drawn toward the light source at the top of the centrifuge tube. The motile cells are collected and transferred to a new tube, and the supernatant is free of any non-target organisms. Centrifugation is repeated until only a few organisms remain. This reduced-contamination culture is then Antibiotics (ampicillin 50 mg / L and cefotaxime) were used to further reduce the bacterial load. The samples were treated with 250 mg / L sucralose (250 mg / L) for 24-48 hours, then diluted and analyzed using FCM. A single target cell was cultured in 200 μL of basal growth medium known in the art, e.g., containing the same antibiotics. 96 ml of Gilead F / 2 medium (fresh water amended with nitrate substituted with urea) Sorting into well plates.

[0169] Next, the method for strain selection is carried out. Phototrophic conditions: 20 μE light at 25°C. Incubate the 96-well plate for 1 week under 5% CO; add 10 μL of the culture to 20 mM sodium acetate. 200 μL of the above F / 2 basal medium ( The acetate-containing culture was again placed under 20 μE light ( Mixotrophically incubate for 1 week and identify pure cultures using an inverted microscope. Pure cultures (10 μL) were incubated in the dark with 20 mM sodium acetate and 0.16 g / L yeast extract. Transfer the explant to 200 μL of the above-mentioned F / 2 basal medium (without antibiotics) supplemented with other After confirming that there are no living organisms, the culture is adapted to heterotrophic conditions. After the culture is made into a pure culture, Weekly selections were performed for several weeks in 5 mL volumes in 50 mL flasks to allow for very low nutrient conditions. The purpose of this study is to specifically select for novel phenotypes of heterotrophic motile cell types in a given condition. Motile cell types are isolated from the cysts based on their ability to be phototactic when placed on the cysts. The cytotype expresses its mutants over many generations under heterotrophic conditions with robust growth. The current type is maintained and a new strain number is assigned. The resulting population is Improved fungal infections characterized by rapidly growing, motile cells that are highly resistant to encystation under For other Chlamydomonadales, see Chlamydomonas (C hlamydomonas and Chloromonas cells can be cultured as known in the art. Isolate Chlamydomonas Resource C from environmental samples Enter strains such as CC-125 or 137c, or UTEX SNO4. These are available as the original cell type or are heterotrophically adapted. In the generation of non-mutagenized variants suitable for favorable performance in See Example 13); or trophic transformation, such as for Dunaliella. As a recombinant cell type for the The cells of Chlamydocapsa, which have only been cultivated nutrient-wise (U.S. Pat. App. (No. 20100316720) are CCCryo101-99, IBMT Culture Collection, etc. The strain was obtained from the same place as the original strain, and grown as a pure culture at a pH of 5.5 and at 14 to 15°C in the corresponding culture medium ( 3N-BBM) to adapt to the above heterotrophic conditions.

[0170] [Example 2] Media composition and temperature for heterotrophic growth The medium components that result in the greatest increase in growth have been identified for a variety of species. The study was initially carried out at the flask level using the starting basal medium and acetate as a fixed carbon source. The frequent (hourly) manual addition of acetic acid is too labor intensive and requires 24-hour It is expected that H. pluvialis will require constant care. vialis) Using KAS1601 as an example, the use of urea as a nitrogen source is A temperature of 28°C resulted in a 40% increase in growth compared to 25°C, and a temperature of 28°C resulted in a 57% increase compared to 25°C. This resulted in an overall 2.2-fold increase in OD750 after the same time point before the onset of stationary phase. In particular, the preferred nitrogen sources were sodium acetate 1.6 g / L at 25°C, yeast Extract 0.16 g / L, Nitrogen 1.76 mM (Urea 0.88 mM or KNO3 1.76 mM M), magnesium sulfate heptahydrate 0.05 g / L, calcium chloride dihydrate 0.05 g / L L, potassium phosphate 0.02g / L, iron-EDTA 0.01g / L, ferric chloride hexahydrate 0. 0.063g / L, Tetrasodium EDTA 22mg / L, Cobalt Sulfate 0.3mg / L, Sulfur Manganese sulfate 6mg / L, zinc sulfate 0.8mg / L, copper sulfate 0.2mg / L, molybdic acid Ammonium 0.7mg / L, boric acid 0.4mg / L, thiamine hydrochloride 0.4mg / L, A baseline medium consisting of 2 μg / L iotin and 2 μg / L vitamin B12 Determine the OD750 reading using nutrient flask growth medium. On the second day, there is no difference in OD750 between urea and KNO3 growth media, but by the fourth day, the urea The culture using KNO3 has a 40% higher OD750 than the KNO3 culture. The preferred temperature is The growth rate is determined using the preferred nitrogen source (urea) at 25°C, 28°C and 31°C. Under these conditions, which are directly related to the adaptation, motile cells grow at 31°C. To monitor growth, take OD750 readings using a spectrophotometer. Visually, there is no difference between cultures grown at 25°C and 28°C, but by day 5, the 28°C cultures had 2 It has a 57% higher OD750 than the culture at 5°C. It is a medium suitable for heterotrophic growth of other strains. Similar methods for determining the composition of the bacteria are performed as known in the art. lamydomonas) at the same temperature, sodium acetate 1.6g / L, sodium acetate 0 0.4 g / L and the preferred nitrogen source (urea) determined above was replaced in the flasks. Other media components are tested using standard multivariate growth studies as known in the art. This allows for a wide range of useful carbon sources, which can be modified, removed, or added. The organic acids include the use of one type or more of lignocellulosic derivatives. There may be more than one type, possibly combined.

[0171] [Example 3] Heterotrophic medium composition and pigment production by macroindependent cells. This example employs strains selected for preferred growth under heterotrophic conditions. Haematococcus pluvialis (Haematococcus pluvialis) was used as an example to describe the pluvialis) KAS1601 was used to culture nine 500 mL bottles of H. pluvialis (H. pluv Heterotrophic cultures of A. ialis were grown in 1 L flasks at 25°C for 0 min at early growth phase in batch culture. The cell density has an OD750 of .15 and increases to an OD750 of approximately 0.6 during the late growth phase. The time from when the growth phase begins to when the plant enters the stationary phase is measured by 100r. The flask growth medium was 0.16 g / L yeast extract, 0.11 g / L urea, and L, magnesium sulfate heptahydrate 0.05g / L, calcium chloride dihydrate 0.05g / L , Potassium phosphate 0.02g / L, Iron-EDTA 0.01g / L, Ferrous chloride hexahydrate 0.0 063g / L, Tetrasodium EDTA 22mg / L, Cobalt Sulfate 0.3mg / L, Sulfuric Acid Manganese 6mg / L, zinc sulfate 0.8mg / L, copper sulfate 0.2mg / L, molybdate Ammonium 0.7mg / L, Boric Acid 0.4mg / L, Thiamine Hydrochloride 0.4mg / L, Bio In addition, the flask medium consisted of 2 μg / L of vitamin B12, 2 μg / L. 2.78 g / L Tris base with 1.15 mL / L acetic acid or low density To allow for hassle-free growth of flask cultures, we first diluted 1.6% sodium acetate. The culture may be concentrated by centrifugation at 3000 g for 5 min. Microalgae cells (Figures 1-10) were added to the first bioreactor at 0.2 g / L. At mass density, 14 L fermentation vessels (New Brunswick BioFlo3000; 3 L of fermenter heterotrophic growth medium (Tris base 0.7 g / L and and an initial acetic acid of 0.29 mL / L or, optionally, a single dose of sodium acetate of 0.4 g / L The 3 L fermentation culture was transferred to a flask (same as heterotrophic medium) fed with 3 L of broth at a flow rate of 3 L / min. The pH was maintained at 7.8 with injected air and a pitched blade impeller at 100-150 rpm. Incubate at 28°C with constant gas exchange. BioCommand Sof tware, peristaltic pump and head plate ports were used to achieve a pump speed of 5%. Fedback including pH-triggered addition of 10% acetic acid (FIG. 1, embodiment 20) delivered by The pH was maintained at 7.8-7.3 throughout the duration of the fermentation, and the nitrogen and phosphorus (in mM b.w.) concentrations were adjusted. Pump at 10% pump speed frequently (every 4-2 hours) throughout the fermentation. Supply nitrogen and phosphorus levels close to the starting concentrations of the fermenter heterotrophic growth medium. The remaining nutrients from the medium (except for yeast extract) were removed by peristalsis at 10% speed. The pump is used to supply air once every 24 hours of fermentation. The amount of air injected into the vessel is 4L / min. Maximum, maintain dissolved oxygen above 30% by increasing agitation to 300 rpm Cells from a 10 L volume of non-triggered cells were cultured in a 90 L volume (Eppendorf Bio 10L of culture in a Flo 610 fermenter + 80L of fermenter heterotrophic medium It can be used for direct seeding. For a 90L culture, the injecting air is 50-100LPM and and pitched blade agitation up to 350 rpm. The resulting biomass (from the initial 0.2 g / L to 6 g / L) was then measured using a lag time of 10 min. First, a 120-h period was observed, including an extended log phase of 96 h with a high specific growth rate of 0.7 / day. The use of these components is in keeping with current practice due to the physiology of rapidly growing cells. The pH shift from nitrogen metabolism is more advantageous than the conventional method, and the addition of organic acids and doubling the carbon source are effective. This is done by adding salt to balance the culture pH without adding extra salt to the medium. Samples (10 mL) were collected every 24 h for dry weight analysis to determine the specific growth rate and algae abundance. The pigment content of the product is determined (FIG. 1, embodiment 40). A 10 mL sample is immediately diluted with 300 mL of water. The cells were centrifuged at 0 g for 5 min, the supernatant was removed, and the cell pellet was frozen at -80°C and lyophilized. The dry weight was determined by grinding with 50 μL of acetone per mg of biomass. Extract the pigment from the freeze-dried biomass at room temperature for 5 min. Using a spectrophotometer (Bi The absorbance of the clarified extract is read at 476 nm using a fluoroRad Smart Spec. The following formula [A 476 / 217] × [extraction volume (mL)] × [dilution factor] to obtain the total dye (mg) was calculated, where 217 is the extinction coefficient of astaxanthin in acetone. Percent pigment is calculated from mg of pigment per mg of biomass equivalent in the extract. At 96 h, the biomass was 2.1 g with a pigment content of 1.5% in red macro-independent cells. / L (Figure 2-top right); on a volumetric basis, this is equivalent to 31.5 mg / L. This is a significantly higher rate than the 0.063 mg / L per hour reported by Hata et al. (2001). This corresponds to a product formation (qp) of 0.33 mg / L per hour. detectable in 24 hours compared to 0.21 / day (0.009 / hour) in Over a 72-hour period, with no significant lag phase, the specific growth rate was 0.68 / day (0.028 / hour). In particular, the high ratios over extended durations are due to cell division rather than cell expansion. The significant improvement in growth rate over heterotrophic production systems is shown in Figure 4. Similar specific growth rates and and cell lines with higher endogenous pigment content lost 2.3% of the pigment content per hour. The method of the present invention results in higher qp values, resulting in a rate of 0.5 mg / L. Productivity is determined by cell type selection or adaptation, co-cultivation, fermenter seeding and manipulation, and Further increases are possible by other means as illustrated.

[0172] As ammonium concentration increases (above 2.5 mM), urea and phosphate become excessive. The cells turn red even when the fixed carbon source is not limiting. This process occurs during the production cycle. As the kinetics of astaxanthin formation persist for several days (e.g., for astaxanthin product formation data, see Figure 2 (See diagram on the left) and select a preferred duration for the production cycle while still achieving product formation. It is understood that the method can be optimized for each cell type in order to select for H. purpura. Somewhat more like cells of H. pluvialis strain BMI (Chekanov et al., 2014). This also applies to cell types that may have higher salt tolerance and are photosynthetic and Achieving growth well above the 0.095 / day reported under astaxanthin formation. For such cell types, both urea and nitrates can be used. Another method for this is to increase the temperature by programming the fermentor. However, this is not limited to the above and is known in the art. This may ultimately be desirable for some applications. For example, cysts are more easily pelleted than vegetative cells. This specification provides a method for the preparation of a granular material that can be used for extended periods of time. cyst formation and other conditions that may be acceptable for certain production schedules. The desired qualities of the pigments heterotrophically produced by the method of the present invention that are acceptable for industrial applications are: , and has been shown by HPLC to be chemically equivalent to the product produced by photosynthesis.

[0173] Microalgae cultures are grown to high densities in a short period of time to exclude contaminants and while in a vegetative state. These algae cultures are produced in a closed culture system to achieve Illuminated by solar radiation or artificial lighting as part of the seed train or production cycle Also, it serves to efficiently inoculate photobioreactors or raceway culture vessels. A 200 L fermentation culture with a cell density of 10 g / L was performed according to the method of the present invention. The center is capable of delivering 0.2 g / L of cells to 10,000 raceway culture vessels. Many variations are possible according to the method of the present invention. The product produced is then used in conventional microalgae production systems in high density. The method of the present invention reduces the land footprint and reduces the experience of conventional production. It also helps to eliminate common contaminants and predators that may be present in the water.

[0174] [Example 4] Improved heterotrophic medium composition and biosynthesis by Chlamydomonas cells Mass Production Six 1 L cultures in 2 L flasks were grown in flask heterotrophic medium as described in Example 3. The culture was concentrated as in Example 3 and grown in a 14 L fermenter (Eppendo (Flask heterotrophy in rf-New Brunswick BioFlo 3000) The same medium as above, but initially supply 0.25 g / L sodium acetate. -Mentor heterotrophic growth medium was incubated at an initial biomass density of 0.05 g / L. The fermentation culture was run at 100-250 rpm with 5 L / min of inlet air and a pitched blade impeller. The mixture is incubated at 28°C with gas exchange provided by ethanol at pH 7.8. The fermentation culture was maintained with nutrients and organic acids as fixed carbon sources as described in Example 3. Growth curves were generated and the concentration of the nutrient medium was measured using methods well known in the art. To measure the levels of urea, phosphate, and ammonium, samples (10 mL) were diluted in 24 mL of water. The samples were collected every 8 hours. 1.7 / day (0.07 / hr) over 72 hours to reach .25g / L biomass This is a biosynthetic phenotype that achieves a specific growth rate of only about 1.4 g / L before growth cessation. The previous highest rate for a duration of only 40 hours with mass yield of 1.7 / day (0.07 / day) The significantly higher yields with almost double the fermentation duration compared to the conventional method (Zhang et al., 1999). This approximately 1.4 g / L biomass was the result of the growth rate and prolonged accelerated growth due to salt toxicity. Long-term inhibition, resulting in only a short duration in specific growth rate and low cell density, at least Both require 2.8 g / L or 34 mM sodium acetate. The Chlamydomonas culture was then transferred to a 100 L bioreactor and grown for 4 Maintain a specific growth rate of at least 1.0 / day for 120 days (production cycle: 120 hours) An initial cell density of 0.2 g / L was used to increase dissolved oxygen as needed. For H. pluvialis in Example 3 with a vessel pressure of 5 psi, When grown under the conditions described in this study, it produced a final cell density of over 20-30 g / L. and demonstrate extended periods of high rates of active cell division without growth inhibition. A similar process can be carried out with adjustments of temperature and media components as known in the art. Applies to Chlamydocapsa and Chloromonas.

[0175] [Example 5] Scenedesmus obliquus is used, H. pluvialis (H. Ammonium regulation in co-cultures of P. pluvialis. A 2.5 L volume of H. pluvialis KAS1601 was cultured as described in Example 3. S. obliquus was grown in heterotrophic flasks at 1 liter. KAS1003 was treated with a non-organic acid carbon source (glucose 3.6 g / L) and an alternative nitrogen source (ammonia chloride). Heterotrophic flask medium as described in Example 3 with 0.09 g / L ammonium The cultures were centrifuged as described in Example 3 and supplemented with 3.6 g / L glucose. A 3 L volume of H. pluvialis (H. pneumoniae) was cultured in a heterotrophic fermentation medium as described in Example 3 supplemented with 100 ml of ethyl 1,0 ... luvialis and S. obliquus. S. obliquus was encapsulated in alginate or porous beads as known in the art. The 3L sample was then filled with 100 ml of water to allow for end-point removal using filtration, magnetic force or other means. The fermentation culture was maintained as described in Example 3. Samples were taken at 24-hour intervals to determine bioavailability. The ammonium dry weight was obtained and the ammonium concentration was measured. At 96 hours, the ammonium concentration was , H. pluvialis from Example 3, despite reaching only 1.4 mM ammonium. In a 3L fermentation culture of H. alis (H. pluvialis), 45 mM ammonium was observed. The 3 L fermentation yielded a specific growth rate of 0.77 / day (0.032 / hr). The microbial activity was approximately 99% higher than that which would occur naturally in an open pond containing a mixture of microorganisms. % or more of H. pluvialis biomass. Adjustment of co-culture parameters such as administration of glucose as a source of To reach different target growth rates and productivity for carotenogenesis triggers in rice 0.2 g / L of H. pluvialis with appropriate ammonium control is possible. alis biomass-initiated fermentation cultures had a specific growth rate of 0.77 / day in 120 hours and Experience an extended log phase of at least 96 hours with a biomass yield of 4.3 g / L 1 g / L of H. pluvialis biomass with proper ammonium control. The fermentation culture started with ethanol produced a specific growth rate of 0.77 / day and a batch growth rate of 22 g / L in 120 hours. The final 48 hours were spent on ammonia. During the first 24 hours (72-96 hours), the biomass is in the logarithmic phase. During the second 24 h (96–120 h), aspartate still accumulated at the same specific growth rate. Taxanthin accumulated to 1.5% of the dry weight of motile cells. This is in comparison to Hata et al. (2001), who showed a significantly lower yield of 0.063 mg / L per hour. All yielded a fairly good pigment qp of 5.5 mg / L per hour. The high growth rate is only sustained for a short time because cell division stops during pigment production. Unlike the conventional techniques, the method of the present invention can be extended for many days, including more than 7 days, if desired. In this example, S. obliquus is However, as is known in the art for many such cell types, fixation is still possible without the use of organic acids. As long as it prefers a carbon source and consumes ammonium preferentially as a nitrogen source, it is suitable for heterotrophic growth. It is understood that astaxanthin or other pigments may be interchangeable in different microbial cell types. Among the production or oil-producing cell types, a choice is made between the Scenedesmus ( Scenedesmus, Chlorella, Monoraphidium, Rhodo Other species of Rhodotorula (red yeast) and Phaeodactylum Many different diatoms, such as the genus Cyclotella and the genus Thraustoides, Thraustochytrids and thraustochytrid-like The biomass from the co-culture can be increased by increasing the cell ratio, especially when the cell ratio is favorably manipulated. In this way, a valuable product from one organism can contribute to complement that of a second organism. For example, diatoms contain fucoxanthin, such as Scenedesmus obliquus. obliquus contains water-soluble carotenoproteins and is a thraustochytrid. ytrids) contain DHA fatty acid.

[0176] [Example 6] Chlamydomonas reinhardtii is used to treat H. pluvialis. Ammonium regulation in co-cultures of Pseudomonas lis and conditions favourable for carotene production 3L of H. pluvialis KAS1601 was placed in a heterotrophic condition as described in Example 3. C. reinhardtii KAS was grown in a culture flask medium. 1001 was grown in heterotrophic flask medium as described in Example 3. The cultures were incubated for 5 Heterotrophic flasks as described in Example 3 with between 1 mM and 20 mM sodium acetate Co-cultivation of H. pluvialis and C. reinhardtii in medium The fermentation cultures of 3 L were maintained as described in Example 3. Samples were mixed for 24 h. Samples were taken at intervals to obtain biomass dry weight and measure ammonium concentration. During the fermentation, the ammonium concentration was effectively kept below 1 mM, whereas in Example 1 H. A monoculture of H. pluvialis reaches 45 mM ammonium. The L fermentation yielded a specific growth rate of 0.90 / day (0.038 / hr) over 96 hours. The final biomass was approximately 100% of that which can occur naturally in an open pond containing a mixture of microorganisms. The fermentation system consisted of 99% H. pluvialis biomass. Co-culture parameters such as administration of typical cell types to the system or rpm and oxygen loading Such adjustment of operating parameters resulted in approximately 2.5 mM for H. pluvialis. Reaching different target growth rates and productivity for ammonium carotenogenesis triggers The inventors have demonstrated that microalgae cultures produce 0.063 mg / L of chloroform per hour. We observed that the enzyme produced astaxanthin at specific productivity rates far exceeding those reported in , i.e., the inventors found that 15 g / L of biomass at 1.5% astaxanthin 1.0 mg / L per hour, preferably higher, 1.875 mg / L per hour At 15 g / L biomass at 3% astaxanthin, the results were even higher. 3.75 mg / L per hour was obtained over a 5-day period; in particular, this was due to the This is 30 to 60 times higher than 0.063 mg / L per hour (Hata, 2001).

[0177] Additional endogenous or exogenous triggers can be used to induce the production of products through vegetative growth of the culture in complete darkness. Due to isoprenoid production, they are considered to be "carotene-friendly." These conditions can be referred to as "suitable conditions" and are described, for example, in FIG. 3 and Example 9. Favourable conditions provide for ammonium accumulation, but any reference to ammonium However, it is understood that other conditions favorable for carotene production can be substituted. The conditions favorable for carotene production in are excess ammonium (>2.5 mM), phosphate Salt depletion, sulfate depletion, urea depletion, NaCl or osmolality contributions greater than 2.6 g / L Other contributing factors include lactate above 3g / L, a temperature increase of 2 degrees Celsius above the growth temperature, or The conditions include, in particular, conditions in the isoprenoid pathway. Additional feeding of precursor compounds that affect the carbon flux in the reaction can be included. However, these advantageous conditions can be achieved using the method of claim 1, which is not limited to Examples 5 and 6. Under these conditions, cell division does not stop and the cells grow into green staphylococci (green algae) measuring 10-12 microns in length (excluding the flagella). They remain the same size as macro-independent cells or even slightly smaller, are motile, and They maintain a flagellum and have an unlimited supply of organic acids.

[0178] [Example 7] Having altered isoprenoid production in mutant or genetically engineered organisms Heterotrophic cells This example illustrates the synthesis of phytoene, geranylgeranyl pyrophosphate, phytofluene and other Modification of upstream accumulating pigments or pigment precursors as well as other sinks such as terpenes Such heterotrophically grown cells are described herein as having a heterotrophic expression. For example, phytoene (colorless) and phytofluene ( Pigmented) has exceptional value in UV absorption in cosmetics. Heterotrophic cells, including those with chlorophyll, stop or slow flux to the original endpoint dye. This allows the development of novel methods for generating cells and cell lines with high levels of phytoene (or other compounds). This makes it an ideal starting material for further processing by mutagenesis or genetic engineering. 5 mL of H. pluvialis in heterotrophic flask medium as in The heterotrophic vegetative culture was incubated with CL-1000U when it reached an OD750 of 0.15. V Crosslinker (254 nm UV-C light) was applied for 1 minute until 50% cell death occurred. Mutagenesis was performed using a dark environment without shaking, at a distance of 13 cm from the light source. After 120 hours of recovery at room temperature, sufficient ammonia was released to initiate carotene formation. The cells were centrifuged and 4 mL of medium was removed. Immediately before filtering the cells through a 50 μm membrane, DAPI (4',6-diamidinopropyl ether) was added to the The cells were incubated with 1 μg / mL of 2-phenylindole (1 μg / mL). Using this method, cells that do not produce astaxanthin or other colored pigments were isolated. When using a light source with high autofluorescence at 530 nm and low autofluorescence at 695 nm, Isolation and selection were carried out based on the fluorescence analysis. For quantification of phytoene content, Isolates were grown in flask heterotrophic medium of Example 3 to a volume of 5 mL for 120 hours. Lyophilized and ground biomass was analyzed using 1 mL of acetone per mg of biomass. Phytoene was extracted from the sucrose. Phytoene content analysis from the same mutant isolate was performed The vegetative grow out and carotenogenic cyst formation cycle In the process of isolating phytoene-accumulating mutants, Differentially accumulate compounds other than astaxanthin (as in normal wild type) in The cells that produce it contain lutein, lycopene, beta-carotene, canthaxanthin, or phytoplankton. or more novel and related types that can be identified based on different autofluorescence properties. GPG accumulated geranylgeranyl pyrophosphate. By virtue of being nourished, the heterotrophic cells express an alternative phenotype that has no deleterious growth effects. This is particularly beneficial for phytoene mutants. This example demonstrates the properties of lutein. The present invention also applies to the use of chlorophyll-deficient phenotypes, including those that lack chlorophyll, as known in the art. The heterotrophic biomass was confirmed by HPLC. of accumulated precursors for the introduction of exogenous enzymes or for use in chemical modifications. These cells can be used as targets for isolation of phytoene desaturase knockout or knockdown, or knockout or knockout of lycopene cyclase and downstream genes Mutagenized or genetically engineered to affect enzymes in the biosynthetic pathway, such as down The origin of the material may be in the form of

[0179] Similarly, added isoprenoids or terpenes such as for pinene and limonene Heterotrophic recombinant cells containing synthases are numerous and well known in the art and can be optimized. Isoprenoid synthase, or modified geranylgeranyl pyrophosphate or Together with other precursors known in the field, it was first indirectly synthesized using the FCM-based steps described above. It is possible to select these molecules because the switch to these molecules will reduce the absorption of the original carotene. induced a detectable reduction in IL-1, IL-2, and IL-3 receptors (Wang et al., 2015), both of which were significantly lower than wild-type or untreated controls. This is because it can reduce autofluorescence at 530 nm compared to illumination. While some have functions in consumer products, others have bio-enriched compounds, such as limonene as a fuel additive. Limonene synthase expression in nucleoheterotrophic Chlamydia spp. The recombinant Chlamydomonas cells were prepared using the method described in U.S. Patent Application Publication No. 2009031787. or limonene synthase, plastid for insertion into rDNA IGS according to No. 8 GeneArt® Chlamyd Containing Targeting and Expression Elements omonas Engineering Kit(Thermo Fisher Sci Vectors modified using methods understood by those of skill in the art for use with In particular, limonene was found to be Limonene is volatilized from the microalgae into the headspace of the liquid culture for release. Plastid heterotrophic Chlamydomonas cell recombinants were prepared using methods known in the art. or recombinant Chlamydomonas chloroplasts as described in Example 12. The homologue of limonene synthase from spearmint (Mentha spicta) was used to Similarly, nuclear or plastid-mediated expression of limonene was The recombinant Haematococcus cells were prepared by Alonso-Gutierrez et al. 2013 (on plastids), or Sharon-Gojman, 2015 (on nuclei and plastids) (a) and selected using the FCM selection described in the example above. These were then subjected to fermentation culture to obtain a ratio of 0.7 or more per day for 72 hours according to the above example. Achieved high speed.

[0180] [Example 8] Single heterotrophic cells with ammonium tolerance or carotenogenesis induction accompanied by rapid pigment accumulation To separate Any carotenogenic trigger or combination of triggers prepares cells for flow sorting As an example of using excess ammonium, 5 mL of a vegetative culture of H. pluvialis in heterotrophic flask medium was cultured in a 20-well plate. By accumulating ammonium in the growth medium, for example to 2.5 mM or more, carotene After 8 to 48 hours of ammonium stress, the carotene was induced to form carotene. Motile cells with elevated chloroplast content were analyzed by FACS Aria flow cytometry. Isolate by flow cytometry using a sorter to ensure isolation of motile cells. To identify motile cells (DAPI positive) and cysts, DAPI was added to the differentiation medium. (DAPI negative); DAPI positive cells with low autofluorescence from 695 nm were identified DAPI-positive cells have low levels of chlorophyll and high autofluorescence from 530 nm. Beta-carotene was elevated (a surrogate for final astaxanthin accumulation). Using the method, single cell isolation from 96-well plates was performed in 5 mL as per Example 3. vol. 100 and transferred to carotenogenic conditions for astaxanthin content quantification. The freeze-dried and ground biomass was analyzed using 1 mL of acetone per mg of biomass. Astaxanthin was extracted from trout. Astaxanthin content analysis from the same isolate was performed. Different vegetative growth and carotenogenesis cycles were also performed to ensure reproducibility. Extending the period of ammonium stress beyond 48 hours was particularly effective in preventing the formation of ammonium-stressed plants. Even after prolonged exposure to the conditions, the carotenoids were not immediately differentiated and cyst-formed. One or more chromosomes that accumulate and generate a subpopulation that remains motile as macroindependent cells Cells selected by this method are colorless or have no astaxanthin. The accumulation of various pigments, including not only santin but also precursors or other isoprenoids, was observed. It may have properties.

[0181] The first pigment accumulation phenotype for cells selected under specific conditions for carotene production , appear to be highly hereditary or specific to these particular conditions. The environmental response of genotype x was to have a 10% increase in astaxanthin content compared to the original population. Sulfate-starved responsive cells were treated with urea starvation as a different condition for the induction of carotenogenesis. It appears to be a strong one that doesn't show the same response below. For example, it favors carotene production. After sulfate depletion as a suitable condition, carotenoid-rich heterotrophic cells with rapid pigment accumulation were generated. The method for isolating H. pluvialis was as follows: 5 mL of a vegetative culture of H. pluvialis was cultured by transferring the cells to growth medium lacking sulfate. This induces the formation of carotenoids. Afterwards, motile cells with increased carotenoid content (reduced chlorophyll) were selected and cultured. The carotenoid profile was analyzed by HPLC. The percentage of dye present (Figure 3) was determined and each trigger and combination of triggers was used to determine the different colors. This may result in a rotenoid profile.

[0182] [Example 9] Uses of algae products Many feed, food, nutraceutical, pharmaceutical, cosmetic and crop protection applications, as well as Many other applications require the use of intact biomass or extracted components. There are many different methods. Some non- Limited examples are provided herein. For example, astaxanthin-containing The products can be extracted or retained in the whole biomass, or can be used for animal feed, human For nutritional and dietary supplements, personal care and cosmetics, and colorants It is a residue in processed biomass, such as defatted food, that is used. The general composition of Haematococcus algal biomass or food is the general carotenoid It consists of carbohydrates, fatty acids, proteins, carbohydrates, and minerals. atococcus, the astaxanthin is approximately 70% (16:0, 18:1 and 18:2) : 2 fatty acid-linked monoesters, 25% diesters and 5% free pigment. This esterified composition is consistent with that of crustacean shellfish, which are the natural dietary source of salmonid fish. It is similar to astaxanthin and is easily metabolized. At 1.5% astaxanthin content, 5.33 kg of Haematococcus algae biomass or food was added to this To achieve an astaxanthin concentration of 80 ppm, typical of those approved for feed colorants per ton of feed. Protein and other fractions of intact biomass are , especially not by artificial astaxanthin (which is chemically synthesized and unsustainable). The relative abundance of the thin-walled algae produced by the method of the present invention provides additional feed value. Fragility can affect digestibility and nutrient availability to affect the health and growth of juvenile fish. The ease of cell destruction, together with the associated benefits known in the art that may be entitle In terms of length, they are more beneficial than the alternative thick-walled immobile spores.

[0183] The pigment extract from the method of the present invention is phototrophically produced as practiced in the industry. They are handled, processed and used in the same way as pigment extracts from materials that have been treated with ethanol. Extraction, supercritical fluid extraction, and pressurized liquid extraction are key applications for the personal care and cosmetic ingredients industries. It is acceptable practice to grow plants photosynthetically and accumulate carotenoids in light. Extracts from the induced Haematococcus biomass were overwhelmingly It is widely known that carotenoids consist exclusively of astaxanthin (approximately 85% to 99% of the total carotenoids). It is known that Haematococcus can be grown heterotrophically using the method of the present invention. Extracts of pigmented biomass from A. s) yielded a predominantly astaxanthin profile. A unique blend of diverse natural and useful colors that not only provide a cosmetic effect but also have personal care properties. Several such novel mixtures are shown in Figure 3, which are non-limiting examples. Calculated depletion kinetics due to cell growth and nutrient consumption during the course of a production run. More endogenous, potentially heterotrophic sulfate depletion (Figure 3A) is e.g. lutein provides a rich and astaxanthin-rich carotenoid composition, Taxanthin can make up half of the total amount of carotenoids; carotene and lutein make up half of the total amount of carotenoids. astaxanthin constitutes more than half (57%) of the total. This is due to lutein (high levels of vitamin C from solar radiation or artificial light from the screens of electronic devices). Filtration of blue light (including visible blue light) and UV damage, Astaxanthin provides additional protection against oxidative stress and inflammation. A novel extract of is currently being tested individually to benefit retinal health in the eye as well as skin pigmentation. They serve to deliver the compound being consumed or applied. Natural fusion may occur when a second cell type, e.g., a cell with a somewhat different wavelength (approximately 42 for lutein) 0-520 nm for fucoxanthin, 380-480 nm for fucoxanthin) Diatoms naturally containing fucoxanthin and diadinoxanthin for light protection These have been found to be of value in skin care and feed applications. Canthaxanthin (up to 5%), a carotenoid present in the pigment mixture, may also be present. This is possible (Figure 3).

[0184] The adaptive pigment profile of heterotrophic cells that do not differentiate into immobile cysts is observed in urea starvation ( 3B) or ammonium accumulation, phosphate depletion, or Employing the kinetics calculated for an exogenously applied osmotic stress (Figure 3C), This allows the algal products to be modified or customized for other uses. Typically, the extracted resin is either significantly oily, such as from urea stress, or sulfate stress. It may be relatively oily, such as by tress, and contains phytosterols. The oleoresin produced by extraction of algal biomass was composed of C16:0 (29%), C18: 1ω9 (20%), C18:1ω7 (3.5%; said to support skin health contains omega-7 fatty acids that promote beneficial skin cell autophagy, and C18:2ω6 (21%; (including linoleic acid, which has been reported to induce It contains fatty acids consisting of 0:4ω6 + C20:5ω3 (1.5%).

[0185] An example of a cosmetic ingredient produced by the method of the present invention is Haematococcus P AstaFusion (C), which has the INCI name luvialis Extract The AS registration number is 1174756-78-5. The extracted resin is astaxanthin. and carotene, lutein / zeaxanthin, and canthaxanthin and trace amounts in natural amber. By combining carotenoids, it is possible to obtain the high levels of astaxanthin that are not found in the current algal astaxanthin raw materials on the market. It is an orange blend that is not colored.

[0186] Color fusions can act synergistically to provide a number of broader personal care health benefits. For example: For example, ethanol has been shown to be effective as a blue light filter in topical skin care products. AstaFusion resin is extracted from biomass and contains the main components lutein + carotene (also The final inclusion rate of lutein in butylene glycol, squalane or oil is The resin is easily dissolved and dispersed at 0.005 to 0.05%. For example, 1% aluminum 50-60% algae in 40% squalane by volume preserved by phatocopherol Produces oleoresin, or 30% algal oleoresin in 70% vegetable oil. For purposes of data collection, photoprotective activity values ​​are calculated using the Minolta Chro It can be determined by measuring the redness of the skin surface with the ma Meter. In skin serums, creams and oils that In order to achieve the in vivo effect, the inclusion rate is based on astaxanthin. , and preferably from about 1.5 to 3 μg / ml of astaxanthin (5 to 10 μM). It is calculated that the concentration ranges from about 6 μg / ml, and even more preferably from about 30 μg / ml (about 50 μM). For example, AstaFusion can deliver 4.8 μg of asta per 1.0 mL reaction. Haematococcus pluvialis K containing taxanthin About 35% collagenase inhibition from the dried ethanol extract of AS1601 demonstrated ability.

[0187] As another example, as is known in the art, A preliminary study using Illumina HT-12 gene chips to identify genes involved in Based on a comprehensive transcriptome-wide microarray study, AstaFusion The target of further research after treatment with is dermal matrix degrading gelatinase (MMP- 2 and MMP-9) expression through the activity of the TFP12 gene; Activates the key regulatory transcription factor p53 / TP53 via high expression of IRF1 and IRF1 and protect cells from oxidative stress by decreasing TXNIP gene expression. It may include the capability for improved protection.

[0188] Skin elasticity, skin hydration, skin surface lipid levels, skin lipid peroxidation, and the appearance of wrinkles Other effects, including but not limited to, can also be measured as known in the art. It has been shown to have effects on free radical quenching, antioxidant capacity, autophagy, DNA protection, Telomere support, and anti-inflammatory effects as well as NO, TNF-α, PGE2, COX Cytokine regulatory assays include, but are not limited to, the production of 2 and the like. These can be measured in laboratory tests including, but not limited to,

[0189] Astaxanthin and other antioxidants and and anti-inflammatory pigments for skin support, joint health, UV protection and sports performance. Recovery, Robust Immune Function, Anti-Aging, Increased Energy, Cognitive Health, and for nootropic and cardiovascular support. Supercritically extracted AstaFusion resin is dispersed in safflower edible oil. Alternatively, as known in the art, In this process, the ingredients are formulated into beadlets and powders. These are used in margarine, edible oils and Snacks, beverages, soups, sauces and dressings, cereals, and confectionery forms Used to fortify and color foods and supplements that can be Oral doses of 80 μM or less are known to have beneficial effects on facial wrinkles. Proven human nutritional supplements may be included in pet foods or pet treats. As another example for use as a cosmetic ingredient, The entire heterotrophically grown pigmented biomass of Chlamydocapsa was Dissolved in the presence of glycerol or phospholipid carriers or treated with maltodextrose. to generate bioactive materials for skin care formulations.

[0190] [Example 10] Chlamydomonas, Chlamydocapsa and Chlamydomonas Transgenic heterotrophic pigmented cells from Chloromonas This example illustrates the development of Chlamydomonas reinhardtii, which produces pigment at a desired growth rate without cell division. Chlamydomonas, Chlamydocapsa and Chloromonas In one manifestation using C. reinhardtii, Beta-carotene ketolase and carotenoids from H. pluvialis Hydroxylase was synthesized using CO as described in U.S. Patent Application Publication No. 20090317878. 2 promoter for inducible expression and H. pluvialis (H. p Optional endogenous control elements derived from Chlamydomonas reinhardtii or Chlamydomonas reinhardtii The vector was cloned into a plasmid containing the ribozyme. As described in ,392, the use of IPP isomerase and the mevalonate pathway is Increase reinhardtii production. Transform the plasmid into the nucleus of C. reinhardtii. The transgenic lines were selected as known in the art. The strains were screened for heterotrophic growth as described in Example 8 and Example 4, respectively. Hydrogen by-product was produced during the last few hours of fermentation using the method described in Example 11. In another manifestation, it is usually nutrient depletion and highlighter (Chlamydomonas order). by undergoing cell division after exposure to the mydomonadales (a two-step process) Increased accumulation of pigments, Chlamydomonas, Chlamydocapsa sa) or Chloromonas cells were cultured as described in Example 3. , pigmented vegetative cells were obtained in the absence of light, nutrient deprivation and cell division.

[0191] [Example 11] H. pluvialis modified to produce biohydrogen products Transgenic heterotrophic cells This example demonstrates the ability of the cytochrome P450 to form cytochrome P450 complexes, either as a stand-alone product or as a by-product of pigments or other accumulating compounds. This article describes biogas as a product. Hydase A1 and A2 (HYDA1 and HYDA2) (HYDEF as konamidrin The auxiliary proteins HYDE, HYDF, and HYD were fused in C. reinhardtii. G and the respective endogenous control elements (or optional ammonium The vector was cloned with a chromosome-inducible promoter as known in the art. As known, the plasmid was transformed into the nucleus of H. pluvialis (Shar To select the preferred strains as described in Example 8, genetic The transgenic lines were screened for pigment content and heterotrophic growth. After sufficient pigmented biomass containing the inner starch of the bell is produced, the by-product (biohydrogen) ) and mRNA levels of the introduced gene were screened under oxygen-free conditions (anaerobic fermentation). The duration of H2 evolution was determined by the amount of starch catabolism catabolized by hydrogenase under dark fermentation conditions. When electrons are donated, they are proportional to the amount of hydrocarbons stored in the cell. Santin is dissolved (with stress from ethanol, lactate, or formate formed). This occurs because it accumulates in cells stressed by fermentation where oxygen decomposition is very low. This is a particularly advantageous process. Thus, during the last hours of fermentation, two fermentation batches can be mixed, if desired. Advantageously, the two compounds can be used to produce two different products, one of high value and one of low value. By extraction, this biomass converts the internally stored starch (by weight) into extracellular products. The wild type or genetically modified plants appear to have a higher pigment content because they have been genetically modified. Chlamydomonas species, as known in the art, have also been used to produce biogas. The method of the present invention can be used to obtain higher biomass yields on a volumetric basis, ... Together with ogas productivity, these Chlamydomonadales were previously This allows for higher biomass densities in a short period of time that would not be possible with salt inhibition in the culture. Approximately 0.96 mmol H2 / hr under anaerobic conditions from a 0.3 g / L biomass culture. The productivity rate in g dry weight was, for example, A significant improvement from 0.13 mmol H2 / L per hour in C. reinhardtii. It is good to deliver hydrogen up to 4.13mmolH2 / L per hour on a volumetric basis at 0.135g / hour. L is generated at a calculated low cell density.

[0192] [Example 12] Heterotrophic cells engineered to produce a recombinant product of interest This example demonstrates that the method of the present invention can be used to culture cereals with favorable growth rates and specific productivity. The present invention relates to a method for producing recombinant products using fed-batch fermentation with heterotrophic cells. In addition to the molecules already exemplified (such as pigments, terpenes, biohydrogen), Such recombinant cells are capable of producing a heterologous RNA (including dsRNA) or a heterologous protein of interest. Such recombinant cells can be genetically engineered as known in the art and used in aquaculture and These include oral therapy in animal husbandry, crop protection, disease control and health promotion, and flavors and fragrances. It has applications in many fields, including but not limited to (Somchai et al., 2016 ; Cerutti et al., 2011; Machado et al., 2014; Kumar et al., 2013; Gimpel et al., 2015). In the specification, the plastid thaumatin in Chlamydomonas reinhardtii is About gene expression (Thaumatin is used for flavoring and flavor masking) The plastid expression is multifactorial, with the plastid being the most abundant protein, and with the plastid being the most abundant dsRNA. It is well known that plastids express complex proteins, and dsRNA is expressed by DICE. Defective in RNAi processing by the R / RISC complex. C. reinhardtii The atpB-deficient mutant of KAS1402 was transformed with the rps14 promoter-controlled Contains atpB and regulatory elements along with chloroplast codon-optimized thaumatin. Microprojectile bombardment using 0.6-micron gold particles coated with the vector K497 (1 Transformation was performed at 100 psi (target distance 6 cm) in a medium lacking a fixed carbon source. The transgenic lines were selected for photosynthesis by three rounds of single colony selection and growth on medium lacking acetate. After isolation in water (phototrophic), the transgenic lines were grown under heterotrophic growth conditions as in Example 3. Expression analysis was performed using primer 585:CTGCTATT according to the manufacturer's instructions. TCGACGACAGTG and 586:ACGAGAACTCCGCTAAAGTG Proceed with qRT-PCR using iScript™ One-Step R T-PCR Kit With SYBR® Green 170-8892 ) Thaumatin mRNA levels in transgenic lines were significantly higher than those of the chloroplast housekeeping gene , similar to Rpl14 levels, but no expression was observed in the wild type. During this time, recombinant protein was harvested at 0.1% at a cell density of 10 g / L per hour. 0.08 mg / L qp, and at higher harvest densities this translates to 0.08 mg / L per hour. In Chlamydomonas reinhardtii KAS1402, the For dsRNA expression, thaumatin was synthesized in an expression vector by GenScript. The nucleotide sequence was synthesized and shown in vector K588 (Figure 5) (adapted from Kumar et al., 2013). -HKT gene fragment is replaced with an inverted repeat construct of 789 bp sequence. As is known in the art, alternative vector constructions can be achieved by using opposing promoters. The selected colonies were analyzed using the method described in Example 3 and Example 4. and 4. The initial ratio for 72 h is greater than 0.7 per day. The growth rate demonstrated indicates suitability for scale-up to industrial manufacturing. 4, fed-batch generation was performed for a sustained specific growth rate of 1.0 / day over a 4-day period. The yeast was cultured in a 100 L reactor (Eppendorf BioFlo610). The cultivation is scaled up to 50 L. For analytical purposes and to establish kinetics, Centrifugation (WVO Designs Power Beast 3500rpm centrifugation) The biomass was drained and freeze-dried using a 12L Console 23 0-60 FreeZone LabConco Freeze Dryer Assembly).

[0193] On a smaller scale, dsRNA expression and accumulation were measured using RNAasA-treated total RNA. Test by gel electrophoresis against standards. Density measurements are performed using Quantity One The initial dsRNA values ​​were calculated using Bio-Rad's dsRNA Genetics software. , 120 hours or more, compared with those reported in bacteria, i.e., 10 8 40 per cell 0ng (Kim et al., 2015); or transplastomic plants. reported for total cellular RNA of 0.05%–0.4% ( Zhang et al., 2015 ). It is believed that this was successful in the case of 0.5% of the 10g / L cell population at 120 hours. 0.05% recombinant RNA will yield a qp of 0.04 mg / L per hour. For example, higher starting cell densities with larger inoculum amounts (>0.2 g / L), >1.7 / day At higher specific growth rates and longer cycle times extending beyond 120 hours Improved culture conditions, including the time required for the treatment, are expected to increase the treatment yield by at least 15% above baseline. will be done.

[0194] Cells genetically modified using nuclear transgenes and inducible promoters are also included in the present invention. For example, the genetic modification of the rRNA locus makes it suitable for heterotrophic cultivation. Use of a nuclear vector containing an intergenic IGS spacer region plus promoter and flanking sequences The expression of the inserted sequence is enabled by the nuclear inducible promoter AMT1;2 5'UTR ( (U.S. Patent No. 9,487,790) is a low nitrate (<0.1 mM), high ammonium nitrate (<0.1 mM) To provide a transgene expression system in algae that is responsive to ammonium (7.5 mM) Using the method of the present invention, first, as in Example 3, for initial biomass accumulation. Chlamydomonas reinhardtii grown heterotrophically in a medium containing urea and lacking nitrate was maintained at 100°C. lamydomonas cells and cell cultures were incubated with elevated ammonium for the last 36 h of incubation. When the mice were provided with 50 mM DMSO (maintained at 7.5 mM), they experienced induced gene expression. Increased levels of dsRNA by nuclear expression using inducible Dicer repression This may be useful for strategies to express AMT1 in a nuclear context, or for other sequences suitable for nuclear expression. ;2Transgene transcription using the ammonium transporter gene promoter was It is strongly repressed in the presence of ammonium or nitrate and rapidly induced in their absence. Phase dsRNA values ​​were determined as known in the art. 8 4 per cell 0 ng nuclear transgenic algae (Somchai et al., 2016 year).

[0195] For scale-up purposes, bioavailability of the internal payload by any number of means - Biomass milling to promote lability was performed downstream prior to field application. It can be used as part of the processing of microalgae; bead milling or dry pithing. The fluorescein grinding is effective in cracking the cells. The half-life of sRNA was determined by agarose gel electrophoresis and staining with gel analysis software. The integrity of the dsRNA was monitored over time by quantification of the bands that were However, cell destruction occurs in water bodies or during feeding on plant parts. Exposure of larvae to algal encapsulated dsRNA is not necessary, and moist biomass is also available. Feeding larvae on leaves did not significantly affect weight gain or mortality after 7 days in a 50% water control. Larval weight, age and mortality (immobility) were determined using leaf discs and Whole plants are used for analysis (e.g., Zhang et al., 2015). Intact and crushed For cells, the concentration-response on larval health (μg equivalents per leaf or water volume) sRNA) for algal doses.

[0196] Generally regarded as safe and therefore suitable for promoting palatability in animal feed. or use of milk proteins in poultry feed to deliver appropriate levels of thaumatin. Other recombinant molecules that can be produced in the same way, such as for antibiotic supplementation to mosquitoes or have also developed dsRNA-based microalgal larvicides for controlling other insects and nematodes. The Chlamydomonas biomass can be titrated for delivery.

[0197] [Example 13] Heterotrophic cultivation of diverse phenotypes This example describes a novel heterotrophic cell type that is cultured under conditions that favor vegetative growth and the present The invention is directed to producing products using the methods of the invention. dtii) as an example, strain KAS1602 (derived from CC-125 or 137c) Mutants) were grown in heterotrophic flask medium as in Example 3. This cell type They are amastigotes, lack chlorophyll, and have a green appearance rather than that of vegetative cells (partly due to the presence of lutein / zeta. It is characterized by a yellow color (derived from axanthine). This occurs when light of 30 μE is applied. Cells were grown for one week in shake flasks and then cultured in stationary flasks (in the dark). ) Subculture in flask medium of Example 3 for 2 weeks under conditions conducive to heterotrophic growth, and then light The cells were isolated from flagellated cells based on their inability to be phototactic when a light source was provided at the top of the vessel. To isolate the cells, we derived them from a population of previously cryopreserved cells that were resuscitated under mixotrophic conditions. This was due to the robust growth under heterotrophic conditions, which allowed the phenotype to be maintained for many generations. This embodiment is described, for example, in the Chlamydomonas Resource Center. The mutant strain lts1-30mt- (CC-2359) obtained from r or as described in the art (e.g., McCarthy et al., 2004 for pigment mutants and The aberrant deletion of the phytoene synthase gene, as generated by Mutations can result in the absence of carotenoids, or in the absence of flagella, or in the absence of photosynthesis or flagella. UV light-induced and chemically induced chlamydids with other defects as mutants This example also relates to Chlamydomonas mutants. This also applies to algae that are genetically engineered to allow for growth. Facultative heterotrophs, including those for the conversion or utilization of preferred carbon feedstocks known in the art. The culture may include genetically engineered obligate phototrophs, including mutants, variants and Obligately heterotrophic or photosynthetic organisms, such as those achieved through genetic engineering, This includes, without limitation, weakened facultative heterotrophs. In fermentation, amastigotes are the cell types that Mechanical damage from the impeller (tilted blade or Rushton impeller) Higher rpm than 350 for improved gas exchange and nutrient mixing This is advantageous in that it allows the fermenter to be operated in dark conditions. The present invention benefits from the reduced metabolic burden by not producing unnecessary chlorophyll in the The resulting KAS1602 and mutant strains lacking green or other pigments Biomass of s1-30mt-(CC-2359) is suitable for use in cosmetics, animal feed, etc. desirable.

[0198] [Example 14] Mixotrophic medium composition and pigment production by macro-cells of H. pluvialis. Growth This example shows that heterotrophic growth was replaced by mixotrophic growth under 30 μE light. This is a modification of Example 3, which includes a nutrient medium containing organic acids and urea. The specific growth rate of H. pluvialis KAS1601 was 1.0 times that of the culture initiated at 0.05 g / L. The biomass reached 9.0 g / L in 96 hours, reaching 1.5 / day. The elemental content reaches 2.3%, which corresponds to a qp of 2.2 mg / L / h. The method of the present invention may include additional finishing steps, as known in the art (as discussed in the discussion). The steps may be implemented to obtain an algal product by applying a stress or The light or inducer may be used to increase product yield or have increased product content. can be fed to form cysts (e.g., for astaxanthin-rich cysts (See the bottom right of Figure 2.)

[0199] [Example 15] Coloring agent and nutrient supplement from non-encysting microalgae The new process provides high protein, low ash, and nutritious foods with vitamins and minerals. Chlamydomonas order, which provides new product compositions that provide nutritional, health or color benefits This study provides a substantially new profile of pigmented biomass from Chlamydomonadales. For feed additives for poultry and fish, these benefits are It is comparable to that provided by , but serves the purpose of providing pigmentation for coloring. For beverages or nutritional supplements that serve as substitutes for foods, the compositions serve the purpose of adding nutrients. Depending on the source of microalgae, the food composition may have different colorings that may be associated with it. The present invention can be a dietary source of carotenoids having any of the properties of a carotenoid supplement, or a beta carotenoid supplement. As in the case of Ten, this material is used as both a nutritional supplement and a color additive. The biomass grown as described above can be harvested from the fermenter and freeze-dried. Then, New Jersey Feed Lab (Trenton NJ) and others Run by the Association of Official Analytica Analyzed for its major components according to the methods of the AOAC Cheminsts. The unencysted biomass is then added to the feed formulation and and processed into a form suitable for coloring or food additives. The amount was essentially double that of encysted or light-induced cells, and Haematococcus Haematococcus spp. or Dunaliella spp. The total commercial pigmented biomass used in food or ingredients is 0.19-0. 24g / g DW protein compared to 0.4-0.5g / g DW protein ( Lorenz, 1999;GRAS Notice grn000356;GRAS Notice grn000276;Muhaemin and Kasw adji, 2010). The ash content was reduced from 0.16-0.18g / g DW ash to approximately 0.03-0.0 The DW ash content is reduced by about 50-80% to 9g / g. The new protein-containing composition has a higher overall nutritional value on a weight basis; Protein is currently priced at over $1,500 / ton, so on the one hand, color additives (i.e. In particular, it may be preferable to replace the algal protein that delivers the pigment (i.e., coloring agent) with the algal protein that delivers the pigment (i.e., coloring agent). This also represents the actual input cost to the feedstock (as remaining after astaxanthin extraction). Compared with defatted Haematococcus food derived from encysted biomass, It is advantageous to have a lower amount of fiber: from encysted biomass The defatted diet had roughly the same protein content with 0.4g / g DW protein. Astaxanthin has a similar but undesirably high amount of 0.4 g / g DW fiber. can comprise up to 80 mg per kg of salmon feed (Wrolstad and Culver, 2012). However, protein-rich fish meal can constitute 200 g / kg of diet (Hatl (En et al., 2013). At 80 mg astaxanthin per kg of feed, the pigment content was 0.7%. 11.4 g algae / kg feed with high protein content is required; this is a monetizable protein source. It contains 50% algal biomass as a substrate and provides a 3% fish meal replacement rate.

[0200] All referenced or cited herein, including all figures and tables, Patents, patent applications, provisional applications and publications are incorporated herein by reference to the extent they do not contradict the explicit teachings of this specification. All such references are hereby incorporated in their entirety.

[0201] The examples and embodiments described herein are for illustrative purposes only and should not be construed in any way as limiting the scope of the invention. Such modifications or variations will be suggested to those skilled in the art and are within the spirit and scope of this application and the appended claims. It should be understood that the present invention is within the scope of the present invention. Any element or limitation of any invention or embodiment thereof (individually or in any combination) may be any other elements or limitations of any other invention or inventions disclosed herein. and all such combinations are intended to be illustrative and not restrictive. is envisaged within the scope of the present invention.

[0202] [Table 1] JPEG2025041773000003.jpg233150JPEG2025041773000004.jpg232150JPEG2025041773000005.jpg232142 JPEG2025041773000006.jpg233146JPEG2025041773000007.jpg233145JPEG2025041773000008.jpg126148

[0203] Patents and Patent Application Publications 1. U.S. Patent No. 6,022,701 2. U.S. Patent No. 5,882,849 3. U.S. Patent No. 8,206,721 4. European Patent No. 1724357 (U.S. Patent Application Publication No. 20080038774) 5. European Patent No. 2878676 (U.S. Patent Application Publication No. 20150252391) 6. U.S. Patent Application Publication No. 20120264195 7. European Patent No. 1995325 8. U.S. Patent No. 8,404,468 9. U.S. Patent No. 8,911,966 10. U.S. Patent No. 8,278,090 11. U.S. Patent No. 7,329,789 12. European Patent Application No. 20030721175 13. U.S. Patent Application No. 20090214475 14. U.S. Patent Application Publication No. 20090317878 15. U.S. Patent Application Publication No. 20120171733 16. U.S. Patent No. 4,683,202 17. U.S. Patent Application Publication No. 20090317878 18. U.S. Patent No. 7,135,620 19. U.S. Patent No. 7,618,819 20. U.S. Patent No. 7,129,392 21. International Publication No. 2003027267 Brochure 22. U.S. Patent No. 9,487,790

Claims

1. The following method: (1) providing a culture medium that includes carbon derived from an organic acid; (2) providing microalgae cells that produce the product of interest, wherein the microalgal cells are rapidly growing motile cells that are highly resistant to encystment under stress, and are obtained by a process of selecting a novel phenotype of heterotrophic motile cells under very low nutrient conditions from microalgal cells classified as facultative heterotrophs and belonging to the genus Haematococcus; selecting novel phenotypes of heterotrophic motile cell types in said very low nutrient conditions by isolating said motile cell types from cysts based on their ability to be phototactic when a light source is placed over the container; (3) culturing the microalgae cells in the culture medium under dark conditions to form a product of interest in the microalgae cells and produce a microalgae culture from the microalgae cells, wherein the culture medium used to culture the microalgae cells to produce the microalgae culture comprises urea as a primary source of nitrogen; (4) isolating the microalgae cells from the microalgae culture within 120 hours after synthesis of the product of interest has occurred in the microalgae cells during incubation in the dark and before the cells in the microalgae culture undergo cellular differentiation into cysts; and (5) purifying the product of interest from the microalgae cells. Including, A product comprising astaxanthin produced by a method wherein synthesis of the product of interest in the microalgae cells occurs in a culture medium depleted of one or more nutrients selected from sulfate, phosphate, nitrate, and urea in the presence of carbon derived from organic acids.

2. 2. The product of claim 1, wherein the microalgae cells are facultative heterotrophs that have been made into obligate heterotrophs.

3. The following method: (1) providing a culture medium that includes carbon derived from an organic acid; (2) providing microalgae cells that produce the product of interest, wherein the microalgae cells are rapidly growing motile cells that are highly resistant to cyst formation under stress, and are obtained by a process of selecting a novel phenotype of heterotrophic motile cells under very low nutrient conditions from microalgae cells classified as facultative heterotrophs and belonging to the genus Haematococcus; selecting novel phenotypes of heterotrophic motile cell types in said very low nutrient conditions by isolating said motile cell types from cysts based on their ability to be phototactic when a light source is placed over the container; (3) culturing the microalgae cells in the culture medium under dark conditions to generate a microalgae culture from the microalgae cells; (4) isolating the microalgae cells from the microalgae culture within 120 hours and before the cells in the microalgae culture undergo cellular differentiation into cysts; and (5) concentrating, drying, powdering, or grinding the isolated cells; Including, the culture medium used to culture the microalgae cells to produce a microalgae culture comprises urea as a primary source of nitrogen; Synthesis of the product of interest in the microalgae cells occurs in a culture medium depleted of one or more nutrients selected from sulfate, phosphate, nitrate, and urea in the presence of carbon derived from organic acids; 2. Microalgal biomass containing astaxanthin produced from the method.

4. 2. The product of claim 1, wherein when synthesis of the target product in the microalgae cells is carried out in a culture medium depleted of one or more nutrients selected from sulfate, phosphate and urea, and in the presence of carbon derived from organic acids, the product comprises from 50% to 99% astaxanthin of total carotenoids.

5. The product described in claim 1, wherein the product further contains a fatty acid.

6. The product of claim 1, wherein the step of culturing in dark conditions to synthesize a desired product includes a culture medium containing one or more selected from phosphate-depleted, sulfate-depleted, and urea-depleted, and an excess of ammonium of greater than 2.5 mM.

7. The product of claim 1, wherein the step of culturing in the dark to synthesize the desired product is combined with one or more exogenous factors selected from the addition of an osmolality contributor greater than 2.6 g / L, the addition of 45 mM NaCl, the addition of lactic acid greater than 3 g / L, and an increase in temperature of 2 degrees Celsius above the growth temperature.

8. 2. The product of claim 1, wherein when synthesis of a target product in the microalgae cells occurs in a culture medium lacking one or more nutrients selected from sulfate, phosphate and urea and in the presence of carbon from organic acids, the product comprises fatty acids including C16:0, C18:1ω9, C18:1ω7, C18:2ω6, C18:3ω3 and C20:4ω6 + C20:5ω3.

9. 4. The biomass according to claim 3, wherein when synthesis of a target product occurs in microalgae cells in a culture medium depleted of one or more nutrients selected from sulfate, phosphate, and urea, and in the presence of carbon derived from organic acids, the biomass contains 0.7% or more total carotenoids, and the total carotenoids contain 50% or more and 99% or less astaxanthin of the total carotenoids.

10. 4. The biomass of claim 3, wherein the synthesis of the target product in the microalgal cells occurs in a medium depleted of one or more nutrients selected from sulfate, phosphate and urea, in the presence of carbon derived from organic acids, and the biomass contains fatty acids consisting only of C16:0, C18:1ω9, C18:1ω7, C18:2ω6, C18:3ω3 and C20:4ω6 + C20:5ω3.

Images