Method, reagent, and kit for evaluating onset risk of age-related macular degeneration

Abstract

To provide a method for evaluating the risk of onset of AMD with improved sensitivity and accuracy over existing techniques, and reagents and kits usable for the same.SOLUTION: The single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids in a sample extracted from a subject are detected, and the risk of AMD onset in the subject is evaluated based on the combination of the detected alleles of rs10490924 and rs800292.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method, a reagent and a kit for evaluating the risk of developing age-related macular degeneration. [Background technology]

[0002] Age-related macular degeneration (AMD) is a neurodegenerative disease caused by aging, smoking, heredity, and other factors, which causes degeneration and angiogenesis in the macular area at the center of the retina of the fundus, resulting in symptoms such as decreased vision, central scotoma, and metamorphopsia. The number of AMD patients is increasing year by year. A representative treatment for AMD is, for example, administration of VEGF inhibitors, but VEGF inhibitors are expensive and require continuous administration, which places a large economic and physical burden on patients. It is also known that excessive drug administration can cause retinal atrophy and lead to decreased vision. Daily intake of antioxidant vitamins such as vitamin C, E, β-carotene, lutein, and zeaxanthin, trace minerals, and ω-3 polyunsaturated fatty acids such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) is said to be effective in preventing the progression of AMD (Non-Patent Document 1).

[0003] It has been reported that single nucleotide polymorphisms (SNPs) of multiple genes are involved in the onset of AMD. Patent Documents 1 and 2 disclose multiple SNPs as markers for evaluating susceptibility to AMD. Reagents for detecting these SNPs in nucleic acids purified from samples are also commercially available. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Special Publication No. 2008-545438 [Patent Document 2] JP 2011-135838 A [Non-patent literature]

[0005] [Non-Patent Document 1] Shin Ishida, Preventive Medicine for Age-Related Macular Degeneration, Academic Trends, Vol. 17, No. 12, pp. 12_80-12_85 (December 2012) Summary of the Invention [Problem to be solved by the invention]

[0006] As mentioned above, several SNPs related to AMD susceptibility, i.e., risk of onset, are known, and reagents capable of detecting each of them alone are already commercially available. It is expected that more sensitive and accurate risk assessment can be achieved by detecting multiple SNPs that are closely related to AMD risk, rather than using the detection results of each SNP alone. However, there has been no clear demonstration to date of SNP combinations that are actually highly related to AMD risk, especially in Asians.

[0007] An object of the present invention is to provide a method for assessing the risk of developing AMD with higher sensitivity and accuracy than conventional methods by combining the detection results of multiple SNPs, as well as reagents and kits that can be used for this method. [Means for solving the problem]

[0008] The present invention provides the following: [1] A method for assessing a subject's risk of developing AMD, comprising: detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in a nucleic acid in a sample removed from the subject; and an evaluation step of evaluating the subject's risk of developing AMD based on the detected combination of alleles of rs10490924 and rs800292; The method includes: [2] the detection step includes simultaneously amplifying and detecting, in the same system, a nucleic acid region containing the SNPs of rs10490924 and rs800292 in a nucleic acid in a sample taken from the subject; The method according to [1], wherein the detection step uses a first nucleic acid probe and a second nucleic acid probe which hybridize to a region containing a G allele and a T allele of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe which hybridize to a region containing an A allele and a G allele of rs800292, respectively, and which have the following characteristics 1) to 3): 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region. [3] The method according to [2], wherein the detection step involves multiplex PCR using a first primer set for amplifying the ARMS2 gene or a fragment thereof comprising rs10490924, and a second primer set for amplifying the complement factor H (CFH) gene or a fragment thereof comprising rs800292. [4] The method according to [2] or [3], wherein the artificial nucleic acid is a locked nucleic acid (LNA). [5] The method according to [4], wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe and the fourth nucleic acid probe is LNA. [6] The method according to any one of [1] to [5], wherein the sample is a blood sample, saliva, an oral mucosal scraping, a tissue sample or another body fluid sample. [7] The method according to any of [1] to [6], wherein the sample is saliva or oral mucosa scraping, does not include a nucleic acid purification step, and includes a step of amplifying and detecting multiple SNPs including rs10490924 and rs800292. [8] A reagent or kit for assessing a subject's risk of developing AMD, a first primer set for amplifying the ARMS2 gene or a fragment thereof comprising rs10490924; a second primer set for amplifying the CFH gene or a fragment thereof comprising rs800292; and A first nucleic acid probe and a second nucleic acid probe which hybridize to a region containing a G allele and a T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe which hybridize to a region containing an A allele and a G allele of rs800292, respectively, having the following characteristics 1) to 3): 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) has a fluorophore at one end region and a quencher at the other end region; A reagent or kit comprising: [9] The reagent or kit according to [8], wherein the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe and the fourth nucleic acid probe are contained in the same container and are applicable to multiplex PCR.

[10] The reagent or kit according to [8] or [9], wherein the artificial nucleic acid is LNA.

[11] The reagent or kit according to any one of [8] to

[10] , which is used to detect the SNPs of rs800292 and rs10490924 in a nucleic acid in a sample taken from a subject.

[12] The reagent or kit according to

[11] , wherein the sample is a blood sample, saliva, oral mucosal scraping, tissue sample or other body fluid sample.

[13] The reagent or kit according to any one of

[10] to

[12] , wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe is LNA. Effect of the Invention

[0009] According to the present invention, it is possible to provide a method, a reagent, and a kit that are capable of evaluating the risk of developing AMD with higher sensitivity and accuracy than conventional methods. [Brief description of the drawings]

[0010] [Figure 1] 1 is a correspondence table showing the relationship between the base length and the number of LNAs of the first nucleic acid probe of the present invention and the practical applicability. [Diagram 2] 1 is a correspondence table showing the relationship between the base length and the number of LNAs of the second nucleic acid probe of the present invention and the practical applicability. [Diagram 3] 1 is a correspondence table showing the relationship between the base length and the number of LNAs of the third nucleic acid probe of the present invention and the practical applicability. [Figure 4] 1 is a correspondence table showing the relationship between the base length and the number of LNAs of the fourth nucleic acid probe of the present invention and the practical applicability. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] 1.Definition The terms used herein are defined as follows. In this specification, "%" indicating concentration refers to "% by weight" unless otherwise specified. In this specification, "subject" refers to a human unless otherwise specified. In this specification, "sample" taken from a subject includes all samples containing nucleic acid that allows genomic analysis of the subject. The term "nucleic acid" used herein generally includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), but in this specification, unless otherwise specified, refers to DNA.

[0012] In this specification, "age-related macular degeneration (AMD)" refers to late AMD unless otherwise specified. In a broad sense, AMD is broadly divided into early, intermediate, and late stages, and AMD that requires treatment with a VEGF inhibitor is late AMD. In addition, in this specification, "risk of developing AMD" refers to the risk of developing late AMD unless otherwise specified, and includes not only the risk of developing AMD requiring treatment (late AMD) in subjects who have not yet developed AMD, but also the risk of progression to late AMD in patients with early or intermediate AMD, the risk of recurrence in patients with late AMD who have been in remission through treatment, and the risk of development in the other eye of patients with late AMD who have developed only one eye.

[0013] In this specification, a "reagent" refers to a single component, and may be in the form of a single composition stored in a single container. In this specification, a "kit" refers to a multiple component, and may be in the form of multiple compositions stored separately in multiple containers. Hereinafter, unless otherwise required, "reagent" and "kit" will also be referred to as "reagent, etc."

[0014] In this specification, a single nucleotide polymorphism (SNP) is a mutation in which only one nucleotide differs between individuals of the same species, and there are major alleles that exist in many individuals and minor alleles that exist in a small number of individuals. Since human chromosomes are usually diploid, there are two alleles for one SNP. Therefore, there are individuals with major / major or minor / minor homozygotes and individuals with major / minor heterozygotes.

[0015] The rs number is a globally recognized SNP ID assigned by the US National Center for Biotechnology Information (NCBI) to identify variants in the human genome.

[0016] As used herein, "rs10190924" refers to a SNP present at position 122454932 of human chromosome 10 (reference genome GRCh38.p14). rs10190924 is present at position 280 of the base sequence of human AMD susceptibility locus 2 (ARMS2 gene) (SEQ ID NO: 2 (NCBI Reference Sequence: NG_011725.1, Gene ID: 387715)), which corresponds to an amino acid substitution at position 69 (A69S) of the amino acid sequence of age-related maculopathy susceptibility protein 2 (SEQ ID NO: 5).

[0017] In this specification, "rs800292" refers to a SNP present at 196673103 of human chromosome 1 (reference genome GRCh38.p14). rs800292 is present at 21226 of the gene encoding human complement factor H (CFH) (NCBI Reference Sequence: NG_007259.1, GeneID:3075). The nucleotide sequence from 20226 to 22225 of the CFH gene is shown in SEQ ID NO:4. The amino acid sequence of the CFH protein (UniProtKB / Swiss-Prot: P08603.4) is shown in SEQ ID NO:6. The SNP of rs800292 corresponds to the amino acid substitution at 62nd position of the amino acid sequence of SEQ ID NO:6 (I62V).

[0018] 2. Methods for assessing the risk of developing AMD 2-1. Overview The first embodiment of the present invention is a method for evaluating the risk of developing AMD in a subject. The method of this embodiment is characterized by including a detection step of detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acid in a sample taken from the subject; and an evaluation step of evaluating the risk of developing AMD in the subject from the combination of the detected alleles of rs10490924 and rs800292. The risk of developing AMD is generally comprehensively determined by a medical professional (doctor) based on medical history, family history, various clinical findings, etc., but the method of this embodiment provides an index that assists in the determination.

[0019] 2-2. Detection process The present embodiment includes a detection step of detecting the SNPs rs10490924 and rs800292 in the nucleic acid in a sample taken from a subject. In the detection step, the method for detecting each SNP is not particularly limited, and for example, a known SNP detection method or a commercially available SNP detection reagent (e.g., TaqMan SNP Genotyping Assays (manufactured by Roche Diagnostics)) may be used. However, the following method is preferably used: The method comprises simultaneously amplifying and detecting, in the same system, nucleic acid regions containing the SNPs of rs10490924 and rs800292 in a nucleic acid in a sample taken from a subject; In the detection step, a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and the T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and the G allele of rs800292, respectively, having the following characteristics 1) to 3) are used. 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

[0020] 2-2-1. Sample The sample to be detected in the method of this embodiment is a sample taken from a human subject outside the body. Examples of the "sample" include blood (whole blood, blood cell components, etc.), saliva, oral mucosa scrapings, tissue samples, and other body fluid samples. In particular, blood samples (whole blood, blood cell components), saliva, and oral mucosa scrapings, which are likely to contain the genomic nucleic acid of the subject, can be preferably used. When using a blood sample, it is preferable to separate the blood sample into blood cell components and plasma components by centrifugation or the like, wash and dissolve the blood cell components, and then purify the nucleic acid. Nucleic acid purification from blood cell components can be performed using commercially available kits such as QIAamp DNA Blood Mini Kit (Qiagen), NucleoSpin (registered trademark) Blood (Takara Bio), and Blood Genomic DNA Isolation Mini Kit (Norgen). When using saliva or oral mucosa scrapings, lysis and nucleic acid purification may be performed in the same manner as for blood samples. However, since saliva and oral mucosa scrapings contain fewer types and amounts of components other than the target nucleic acid compared to blood cells, and in particular, contain a lower amount of nuclease, they can be subjected to the amplification and detection process without going through the lysis and purification process.

[0021] 2-2-2.Multiplex PCR In the method of the present embodiment, preferably, two regions on the genome are amplified simultaneously. The method for amplifying the target region may be any nucleic acid amplification method such as PCR, LAMP, or SDA. More specifically, the method is carried out using multiplex PCR. The components and detection conditions required for multiplex PCR are described below.

[0022] 2-2-2-1.Primer In the method of this embodiment, a primer set for amplifying a region containing rs10490924 (hereinafter, the first primer set) and a primer set for amplifying a region containing rs800292 (hereinafter, the second primer set) are used simultaneously in the same system. The first primer set is preferably a primer set for amplifying the ARMS2 gene (SEQ ID NO: 1 or 2) or a fragment thereof containing rs10490924. The second primer set is preferably a primer set for amplifying the CFH gene or a fragment thereof containing rs800292 (for example, SEQ ID NO: 3 or 4). The base sequences of the G allele (SEQ ID NO: 1) and T allele (SEQ ID NO: 2) of the ARMS2 gene, the A allele (SEQ ID NO: 3) and the G allele (SEQ ID NO: 4) of the CFH gene fragment are shown in Table 1. SEQ ID NO: 3 and SEQ ID NO: 4 show fragments of 20226 to 22225 of the CFH gene. The base sequences listed in Table 1 also include intron sequences. Table 2 also shows the amino acid sequence of age-related maculopathy susceptibility protein 2 (sequence number 5) and the amino acid sequence of CFH (sequence number 6).

[0023] [Table 1] TIFF2025042703000002.tif246160TIFF2025042703000003.tif247160TIFF2025042703000004.tif246160TIFF2025042703000005.tif39159

[0024] [Table 2]

[0025] The primer set for amplifying the ARMS2 gene or a fragment thereof is not particularly limited as long as it has a sequence capable of amplifying a region including rs10490924, but is preferably designed to amplify a region of about 40 to 1000 bases in length, for example. For example, the following primer set can be used. Forward primer: AAGCAGAGGAGGAGCAAACTGTC (SEQ ID NO: 7) Reverse primer: GGCTGGTTAAAATGCAAGCTG (SEQ ID NO: 8)

[0026] The primer set for amplifying the CFH gene or a fragment thereof is not particularly limited as long as it has a sequence that amplifies a region including rs800292, but it is preferable to design it so as to amplify a region of about 40 to 1000 bases in length. For example, the following primer set can be used. Forward primer: GCAATGAACTTCCTCCAAG (SEQ ID NO: 9) Reverse primer: GGATTAAGAGCAACCCATTC (SEQ ID NO: 10)

[0027] The above primer set may be bound to a labeling substance or may contain an artificial nucleic acid, so long as it does not inhibit nucleic acid amplification or interfere with the labeling of the nucleic acid probe described below.

[0028] 2-2-2-2. Nucleic acid probe In the method of this embodiment, preferably, four types of nucleic acid probes are used: a probe for detecting an ARMS2 G allele (also referred to herein as a "first nucleic acid probe"), a probe for detecting an ARMS2 T allele (also referred to herein as a "second nucleic acid probe"), a probe for detecting a CFH A allele (also referred to herein as a "third nucleic acid probe"), and a probe for detecting a CFH G allele (also referred to herein as a "fourth nucleic acid probe"). Each nucleic acid probe preferably has the following characteristics. 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region. The present inventors have found that by using a nucleic acid probe having the characteristics 1) to 3) in multiplex PCR, SNPs can be detected with high sensitivity and alleles can be identified with high accuracy. If the probe length is too short, the sensitivity decreases, and if it is too long, alleles cannot be identified with high accuracy. Moreover, if the artificial nucleic acid (specifically, an artificial nucleic acid having higher stability than normal) is used in a small amount or in a large amount, SNPs cannot be detected and identified with high accuracy.

[0029] Each nucleic acid probe preferably has a site that binds to the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a nucleic acid sequence of 3 to 14 mers on both sides of the SNP binding site. The nucleic acid probe preferably has a fluorophore in one terminal region and a quencher in the other terminal region. Examples of the fluorophore include fluorescent dyes such as FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. As the quencher, a fluorescent dye that emits fluorescence with a wavelength that interferes with the fluorescence wavelength emitted from the fluorophore is used. This allows the signal of the fluorophore to be maintained in an interfered state when the fluorophore and the quencher are in close proximity to each other. As the quencher, a fluorescent dye that emits fluorescence with a wavelength that interferes with the fluorescence wavelength emitted from the fluorophore is used. This allows the signal of the fluorophore to be maintained in an interfered state when the fluorophore and the quencher are in close proximity to each other. For example, when the fluorophore is ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, or SY-21 is used, and when the fluorophore is FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, or TQ2 is used. The types of fluorophore and quencher are not particularly limited as long as the above relationship is satisfied, and any known fluorophore can be used. However, when using four types of probes as in the method of this embodiment, it is necessary to select fluorescent dyes so that the fluorescent signal of each fluorophore does not interfere with the fluorescent signal of the other fluorophore and the fluorescent wavelengths do not overlap. The quencher bound to the nucleic acid probe does not need to be only one at the terminal region, and may be additionally bound to regions other than the terminal region.

[0030] When a probe having a fluorophore or quencher at each end region is placed in a PCR reaction system, it is degraded by the endonuclease activity of DNA polymerase during nucleic acid amplification, which causes the distance between the fluorophore and quencher bound to the probe to increase, making the fluorescent signal from the fluorophore detectable. Such a probe is also called a TaqMan (registered trademark) probe in the art.

[0031] In this embodiment, the length of the nucleic acid probe is preferably 8 to 29 mer, particularly preferably 12 to 25 mer, and further preferably 14 to 20 mer.

[0032] The nucleic acid probe used in the method of the present embodiment preferably has 1 to 12, particularly 2 to 10, and further preferably 3 to 7, of its constituent nucleic acids being artificial nucleic acids. The artificial nucleic acid is preferably one that is more stable (e.g., has high nuclease resistance) than normal nucleic acids and has high binding affinity to the target nucleic acid. Examples of such artificial nucleic acids include locked nucleic acids (LNA), 2'-fluorinated nucleic acids, 2'-ethoxyethyl (MOE) nucleic acids, 2'-OMe nucleic acids, and peptide nucleic acids. Preferably, the artificial nucleic acid is LNA.

[0033] In the nucleic acid probe, at least one of the bases adjacent to the SNP binding site is preferably LNA. Furthermore, the SNP binding site is preferably LNA. Other artificial nucleic acids (preferably LNA) are preferably arranged at regular intervals.

[0034] 1 to 4 show the detection results of each target nucleic acid under various conditions in which the length of the nucleic acid probe and the number of LNAs were changed when multiplex PCR was performed using samples containing four types of template DNA fragments, namely, G allele type and T allele type of the ARMS gene, and A allele type and G allele type of the CFH gene. The conditions indicated by "◯" are conditions under which the target allele can be identified.

[0035] Fig. 1 shows the conditions for the ARMS2 G allele detection probe (first nucleic acid probe) and the detection results of the ARMS2 G allele. Fig. 1 shows that the ARMS2 G allele detection probe preferably has a probe length of 8 to 21 mer and contains 1 to 10 LNAs. The first nucleic acid probe can be, for example, a nucleic acid probe having the following sequence: CAGCTGCTAAAA (SEQ ID NO:11) CCAGCTGCTAAAATC (SEQ ID NO:12) TCCCAGCTGCTAAAATCC (SEQ ID NO: 13)

[0036] The first nucleic acid probe may have the base sequence of SEQ ID NO: 11, of which 4 to 9 bases are LNA. The first nucleic acid probe may have, for example, the following structure. CAG+C+T+G+CTAAAA CAG+C+T+G+C+TAAAA CAG+C+T+G+C+T+AAAA CAG+C+T+G+C+T+A+AAA CA+G+C+T+G+C+T+A+AAA C+A+G+C+T+G+C+T+A+AAA The "+" above indicates the LNA part.

[0037] The first nucleic acid probe that can be used has the base sequence of SEQ ID NO: 12, of which 3 to 7 bases are LNA. The first nucleic acid probe can have, for example, the following structure. CCAGCT+G+CTAAA+TC CCAGC+T+G+CTAAAA+TC CCA+GC+T+G+CTAAA+TC CCA+GC+T+G+CTAA+AA+TC CCA+GC+T+G+C+TAA+AA+TC The "+" above indicates the LNA part.

[0038] The first nucleic acid probe has the base sequence of SEQ ID NO: 13, of which 1 to 3 bases are LNA. The first nucleic acid probe can have, for example, the following structure. TCCCAGCT+GCTAAAATCC TCCC+AGCT+GCTAAAA+TCC TCCCAGCT+GCTA+AAATCC The "+" above indicates the LNA part.

[0039] Fig. 2 shows the conditions for the ARMS2 T allele detection probe (second nucleic acid probe) and the detection results of the ARMS2 T allele. Fig. 2 shows that the ARMS2 T allele detection probe preferably has a probe length of 10 to 22 mer and contains 1 to 12 LNAs. The second nucleic acid probe can be, for example, a nucleic acid probe having the following sequence: CAGCTTCTAAAA (SEQ ID NO:14) CCAGCTTCTAAAATC (SEQ ID NO: 15) TCCCAGCTTCTAAAATCC (SEQ ID NO: 16)

[0040] The second nucleic acid probe that can be used has the base sequence of SEQ ID NO: 14, of which 6 to 12 bases are LNA. The second nucleic acid probe can have, for example, the following structure. CAG+C+T+T+C+T+AAAA CA+GC+T+T+C+T+AA+AA +CA+GC+T+T+C+T+AA+AA +CA+G+C+T+T+C+T+AA+AA +CA+G+C+T+T+C+T+A+A+AA +C+A+G+C+T+T+C+T+A+A+AA +C+A+G+C+T+T+C+T+A+A+A+A The "+" above indicates the LNA part.

[0041] The second nucleic acid probe that can be used has the base sequence of SEQ ID NO: 15, of which 4 to 9 bases are LNA. The second nucleic acid probe can have, for example, the following structure. CCAG+CT+T+CTAAA+TC CCAG+C+T+T+CTAAA+TC CCAG+C+T+T+CTAA+AA+TC CCA+G+C+T+T+CTAA+AA+TC CCA+G+C+T+T+C+TAA+AA+TC CC+AG+C+T+T+C+T+AA+AAT+C The "+" above indicates the LNA part.

[0042] The second nucleic acid probe that can be used has the base sequence of SEQ ID NO: 16, in which 1 to 5 bases are LNA. The second nucleic acid probe can have, for example, the following structure. TCCCAGCT+TCTAAAATCC TCCCAGCT+T+CTAAAATCC TCCCAGC+T+T+CTAAAATCC TCCCAGC+T+T+CTAAA+ATCC TCC+CAGC+T+T+CTAAA+ATCC The "+" above indicates the LNA part.

[0043] Fig. 3 shows the conditions for the CFH A allele detection probe (third nucleic acid probe) and the results of CFH A allele detection. Fig. 3 shows that the CFH A allele detection probe preferably has a probe length of 12 to 25 mer and contains 3 to 12 LNAs. The third nucleic acid probe can be, for example, a nucleic acid probe having the following sequence: ATTATTATATTTCCA (SEQ ID NO:17) ACCATTATTATATTTCCA (SEQ ID NO:18) CATACCATTATTATATTTCCAAGAG (SEQ ID NO: 19)

[0044] The third nucleic acid probe may have the base sequence of SEQ ID NO: 17, with 10 to 12 of these bases being LNA. The third nucleic acid probe may have, for example, the following structure. AT+T+A+T+T+A+T+A+T+T+TCCA AT+T+A+T+T+A+T+A+T+T+T+CCA A+T+T+A+T+T+A+T+A+T+A+T+T+T+CCA The "+" above indicates the LNA part.

[0045] The third nucleic acid probe may have the base sequence of SEQ ID NO: 18, of which 6 to 10 bases are LNA. The third nucleic acid probe may have, for example, the following structure. ACCA+TTAT+T+A+T+ATT+TCCA ACCA+TT+AT+T+A+T+ATT+TCCA ACCA+TT+AT+T+A+T+ATT+TC+CA ACCAT+T+A+T+T+A+T+A+T+TTCCA ACCAT+T+A+T+T+A+T+A+T+T+TCCA The "+" above indicates the LNA part.

[0046] The third nucleic acid probe may have the base sequence of SEQ ID NO: 19, of which 3 to 4 bases are LNA. The third nucleic acid probe may have, for example, the following structure. CATACCATTA+TTA+TATT+TCCAAGAG CATACCATTAT+T+A+T+ATT+TCCAAGAG The "+" above indicates the LNA part.

[0047] Fig. 4 shows the conditions for the CFH G allele detection probe (fourth nucleic acid probe) and the results of CFH G allele detection. Fig. 4 shows that the CFH G allele detection probe preferably has a probe length of 11 to 29 mer and contains 1 to 12 LNAs. The fourth nucleic acid probe can be, for example, a nucleic acid probe having the following sequence: ATTATTACATTTCCA (SEQ ID NO: 20) CCATTATTACATTTCCAAG (SEQ ID NO: 21) CATACCATTATTACATTTCCAAGAG (SEQ ID NO:22)

[0048] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 20, of which 7 to 12 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure. ATTA+T+T+A+C+A+T+TTCCA ATT+A+T+T+A+C+A+T+TTCCA ATT+A+T+T+A+C+A+T+T+TCCA ATT+A+T+T+A+C+A+T+T+T+CCA AT+T+A+T+T+A+C+A+T+T+T+CCA A+T+T+A+T+T+A+C+A+T+T+T+CCA The "+" above indicates the LNA part.

[0049] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 21, of which 4 to 9 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure. CCAT+TATT+C+ATTTCCA+AG CCAT+TATT+A+C+ATTTCCA+AG CCA+T+TATT+A+C+ATTTCCA+AG CCA+T+TATT+A+C+ATTT+CCA+AG CCA+T+TA+TT+A+C+ATTT+CCA+AG CCA+T+TA+TT+A+C+AT+TT+CCA+AG The "+" above indicates the LNA part.

[0050] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 22, in which 1 to 5 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure. CATACCATTATTATTA+CATTTCCAAGAG CATACCATTATA+CATT+TCCAAGAG CATACCA+TTATTA+CATT+TCCAAGAG C+ATACCA+TTATTA+CATT+TCCAAGAG C+ATACCA+TTAT+TA+CATT+TCCAAGAG The "+" above indicates the LNA part.

[0051] 2-2-2-3.Other ingredients In addition to the above primers and nucleic acid probes, the multiplex PCR system contains components used in normal PCR. Specifically, these include DNA polymerase, deoxyribonucleotide triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), and pH buffers. If necessary, KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, UNG, and the like may also be included.

[0052] 2-2-2-4. PCR conditions In the method of this embodiment, preferably, SNP is detected using the primer set and the nucleic acid probe. More preferably, SNP is detected using multiplex PCR. In multiplex PCR, in order to detect the G allele and T allele of rs10490924 and the A allele and G allele of rs800292 in one system, preferably, the following components are present in one system: - Sample (pretreated sample if pretreated) -The two primer sets (first primer set, second primer set) - the four types of nucleic acid probes (the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe); -DNA polymerase (if the nucleic acid to be detected is RNA, use a DNA polymerase with reverse transcription activity) -dNTPs (dATP, dTTP or dUTP, dGTP and dCTP) -Divalent metal ions (e.g. magnesium ions) -pH buffer (e.g. Tris-EDTA buffer) -Others, e.g., KCl, UNG (if dUTP is used)

[0053] The equipment used for multiplex PCR is not particularly limited, and any known thermal cycler for real-time PCR can be used. For example, CronoSTAR96 (Clontech), LightCycler (registered trademark) 96 (Roche Diagnostics), CFX Opus (registered trademark) 96 Real-time PCR System (Bio-Rad), QuantStudio (registered trademark) 5 Real-time PCR System (Thermo Fisher Scientific), etc. can be used. The temperature setting of the thermal cycler can be appropriately set according to a conventional method within the range of denaturation temperature 90 to 99°C and annealing temperature 50 to 70°C. The number of temperature cycles can be appropriately set to about 30 to 50 cycles. The presence or absence of the G allele and T allele of rs10490924 and the A allele and G allele of rs800292 in a sample can be detected by multiplex PCR.

[0054] 2-3.Evaluation process The method of this embodiment includes an evaluation step of evaluating the risk of developing AMD in a subject from the detected alleles of rs10490924 and rs800292. As described in the Examples of this specification, the present inventors detected and analyzed the alleles of rs10490924 and rs800292 in 1576 AMD patients and 1656 cataract patients. As a result, it was found that the risk of developing AMD increases in the order of the alleles of rs10490924 / rs800292, TT / GG, TT / AG, GT / GG, TT / AA, GG / GG, GT / AG, GT / AA, GG / AG, and GG / AA. The method of this embodiment can provide an indicator by evaluating the subject's risk of developing AMD by a medical professional, with the following evaluation results: TT / GG and TT / AG alleles indicate a very high risk of development, TT / AA and GT / GG alleles indicate a high risk of development, GT / AG and GG / GG alleles indicate a medium risk of development, and GT / AA, GG / AG and GG / AA alleles indicate a low risk of development.

[0055] 2-4.Other processes The method of this embodiment may include other steps in addition to the detection step and evaluation step. As other steps, a sample pretreatment step may be included. In the case of blood, tissue, and other samples, since they contain many components other than nucleic acids, such as proteins and lipids, it is desirable to extract and purify nucleic acids from the sample as a pretreatment. The method for extracting nucleic acids is not particularly limited, and any known method may be used. For example, the phenol-chloroform method, spin column method, alkali extraction method, ion exchange column method, magnetic bead method, and the like are known.

[0056] When the sample is saliva or oral mucosa scraping, the above extraction and purification steps may be omitted. In this case, dilution with a buffer solution (e.g., Tris-EDTA buffer solution) may be performed as a pretreatment.

[0057] If the nucleic acid to be detected in the sample is DNA, the sample after pretreatment can be amplified and detected, but if the nucleic acid is RNA, a reverse transcription step must be performed before amplification and detection. The form of the reverse transcription reaction is not particularly limited, but usually, in the same system as the amplification and detection, a reverse transcriptase (e.g., M-MLV Reverse Transcriptase, AMV Reverse Transcriptase, etc.) or a DNA polymerase with reverse transcription activity (e.g., Tth polymerase) is used, and the RNA is reacted at a temperature of about 37 to 72°C for several minutes to 10 minutes before the amplification and detection cycle to obtain cDNA complementary to the RNA.

[0058] In order to prevent carryover contamination of PCR products, uracil DNA glycosylase (UNG) may be added to the above amplification and detection system. In this case, dUTP is used instead of dTTP as dNTP, and an UNG reaction step is inserted before the amplification and detection cycle (before the reverse transcription reaction if reverse transcription is performed). The UNG reaction step can be performed at a temperature of about 37°C for several minutes to 10 minutes. The UNG reaction can degrade PCR products that have been contaminated by carryover into the sample before the amplification and detection step. UNG is then inactivated by heating to the denaturation temperature, so it does not degrade the newly generated target PCR product.

[0059] The method of the present embodiment can assess the risk of developing AMD in a subject, and can take appropriate measures, such as taking preventive measures before the onset of AMD, in subjects who are assessed to have a high risk of developing AMD. In addition, the method can be used as an index for determining the frequency of follow-up observation in subjects who have no history of AMD, subjects who have developed AMD and are in remission, and subjects who have developed AMD in only one eye.

[0060] 3. Reagents or kits for assessing the risk of developing AMD A second embodiment of the present invention is a reagent or kit for evaluating the risk of developing AMD in a subject. The reagent or kit of this embodiment is characterized by comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof containing rs10490924; a first primer set for amplifying the CFH gene or a fragment thereof containing rs800292; and a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, having the following characteristics 1) to 3). 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

[0061] The reagent or kit (reagent, etc.) of this embodiment is preferably a reagent, etc. that is applied to multiplex PCR in which rs800292 and rs10490924 are simultaneously amplified and detected in the same system. In the reagent, etc. of this embodiment, the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe may be stored separately in multiple containers, but are preferably stored in the same container. By storing the primer set and the nucleic acid probe in the same container as one composition, the complicated process of quantifying and mixing each primer set and nucleic acid probe can be omitted.

[0062] The reagent etc. of this embodiment includes a primer set (first primer set) for amplifying a region containing rs10490924, and a primer set (second primer set) for amplifying a region containing rs800292. The first primer set is preferably a primer set for amplifying the ARMS2 gene (SEQ ID NO: 1 or 2) or a fragment thereof containing rs10490924. The second primer set is preferably a primer set for amplifying the CFH gene (SEQ ID NO: 3 or 4) or a fragment thereof containing rs800292.

[0063] The first primer set is not particularly limited, but for example, the following primer set can be used. Forward primer: AAGCAGAGGAGGAGCAAACTGTC (SEQ ID NO: 7) Reverse primer: GGCTGGTTAAAATGCAAGCTG (SEQ ID NO: 8) The second primer set is not particularly limited, but for example, the following primer set can be used. Forward primer: GCAATGAACTTCCTCCAAG (SEQ ID NO: 9) Reverse primer: GGATTAAGAGCAACCCATTC (SEQ ID NO: 10)

[0064] The reagent etc. of this embodiment includes at least four types of nucleic acid probes: a probe for detecting an ARMS2 G allele (first nucleic acid probe), a probe for detecting an ARMS2 T allele (second nucleic acid probe), a probe for detecting a CFH A allele (third nucleic acid probe), and a probe for detecting a CFH G allele (fourth nucleic acid probe). Each nucleic acid probe has the following characteristics. 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

[0065] Each nucleic acid probe preferably has a site that binds to the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a 3-14 mer nucleic acid sequence on both sides of the SNP binding site. The nucleic acid probe has a fluorophore at one end region and a quencher at the other end region. Examples of the fluorophore include fluorescent dyes such as FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. As the quencher, a fluorescent dye that emits fluorescence with a wavelength that interferes with the fluorescence wavelength emitted from the fluorophore is used. For example, when the fluorophore is ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, SY-21, etc. are used, and when the fluorophore is FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, TQ2, etc. are used. The types of fluorophores and quenchers are not particularly limited as long as the above relationship is satisfied, and any known types can be used.

[0066] In the reagent etc. of this embodiment, the length of the nucleic acid probe is 8 to 29 mer, preferably 12 to 25 mer, and more preferably 14 to 20 mer.

[0067] In the present embodiment, the nucleic acid probe has 1 to 12, preferably 2 to 10, more preferably 3 to 7, of its constituent nucleic acids being artificial nucleic acids. Examples of such artificial nucleic acids include locked nucleic acid (LNA), 2'-fluorinated nucleic acid, 2'-ethoxyethyl (MOE) nucleic acid, 2'-OMe nucleic acid, and peptide nucleic acid. Preferably, the artificial nucleic acid is LNA.

[0068] In the nucleic acid probe, at least one of the bases adjacent to the SNP binding site is preferably LNA. Furthermore, the SNP binding site is preferably LNA. Other artificial nucleic acids (preferably LNA) are preferably arranged at regular intervals.

[0069] The reagents and the like of this embodiment are used to detect the SNPs of rs800292 and rs10490924 in the nucleic acid in a sample taken from a subject, and the kit of this embodiment may contain a reagent solution and the like for pretreating the sample taken from the subject before nucleic acid amplification. The sample is a sample taken from a human subject outside the body, and examples of the sample include blood (whole blood, blood cell components, etc.) samples, saliva, oral mucosa scrapings, tissue samples, and other body fluid samples. When using a blood sample, it is preferable to purify the nucleic acid according to a conventional method. On the other hand, when using saliva or oral mucosa scrapings, it is possible to subject them to the amplification and detection process without going through the dissolution and purification process.

[0070] The reagents and the like of this embodiment may contain other components necessary for multiplex PCR, such as DNA polymerase, deoxyribonucleotide triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), pH buffers, KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, UNG, and the like.

[0071] Each component contained in the reagent etc. of this embodiment has the same composition as each component described in the section "2-2-2. Multiplex PCR" unless otherwise specified or unless otherwise contradicted. The reagent etc. of this embodiment can be applied to the method of the first embodiment of the present invention. EXAMPLES

[0072] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0073] Example 1: Detection of SNPs in patients with eye diseases (1) Sample pretreatment Nucleic acids were extracted and purified from whole blood samples collected from 1,514 AMD patients and 1,654 cataract patients using a QIAamp DNA Blood Mini Kit (Qiagen), and nucleic acid solutions derived from each sample were prepared.

[0074] (2) Preparation of primer-probe mix Two primer sets shown in Table 3, four types of nucleic acid probe sets shown in Table 4, and four types of nucleic acid probe sets shown in Table 5 were chemically synthesized and prepared into 50 μM solutions in 0.5×TE buffer, and then mixed in the ratio shown in Table 6 to prepare a primer-probe mix. The nucleic acid probe set used in the primer-probe mix was either the set shown in Table 4 or the set shown in Table 5.

[0075] [Table 3]

[0076] [Table 4]

[0077] [Table 5]

[0078] [Table 6]

[0079] (3) Multiplex PCR A PCR reaction solution was prepared by mixing 6 μL of a master mix containing a commercially available Taq-derived DNA polymerase, 5 μL of the primer-probe mix, 5 μL of each nucleic acid solution, and 9 μL of water (nuclease-free). A blank solution was also prepared by substituting water (nuclease-free) instead of the nucleic acid solution. The final concentration of the template DNA was 1000 copies / μL, the final concentration of the primer was 200 nM, and the seed concentration of the probe was 100 nM. The PCR reaction solution was set in a LightCycler96 (Roche Diagnostics) and heated at 95°C for 1 minute, after which 45 cycles of 95°C for 5 seconds and 58°C for 30 seconds were performed.

[0080] Table 7 shows the number of alleles in AMD patients (with AMD) and cataract patients (without AMD) detected by the above method. From the results shown in Table 7, the risk of AMD onset for each allele of rs10490924 and rs800292 was analyzed. It was revealed that when the risk of AMD onset for subjects with rs10490924 / rs800292 being GG / AA is set to 1, the odds of the risk of symptomatic AMD onset for other allele types are the values ​​shown in Table 8.

[0081] [Table 7]

[0082] [Table 8]

[0083] The above results demonstrate that the method of the present invention is capable of evaluating the risk of developing AMD with high sensitivity and accuracy.

Claims

1. 1. A method for assessing a subject's risk of developing age-related macular degeneration (AMD), comprising: detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in a nucleic acid in a sample removed from the subject; and An evaluation step of evaluating the subject's risk of developing AMD based on the detected combination of rs10490924 and rs800292 alleles; The method includes:

2. The detection step includes simultaneously amplifying and detecting, in the same system, a nucleic acid region including the SNPs rs10490924 and rs800292 in a nucleic acid in a sample taken from the subject; The method according to claim 1, wherein in the detection step, a first nucleic acid probe and a second nucleic acid probe which hybridize to a region containing the G allele and the T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe which hybridize to a region containing the A allele and the G allele of rs800292, respectively, are used, the first nucleic acid probe and the second nucleic acid probe having the following characteristics 1) to 3): 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

3. The method of claim 2, wherein the detection step comprises multiplex PCR using a first primer set for amplifying the ARMS2 gene or a fragment thereof comprising rs10490924, and a second primer set for amplifying the complement factor H (CFH) gene or a fragment thereof comprising rs800292.

4. The method of claim 2, wherein the artificial nucleic acid is a locked nucleic acid (LNA).

5. The method according to claim 4 , wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first, second, third and fourth nucleic acid probes is LNA.

6. 10. The method of claim 1, wherein the sample is a blood sample, saliva, an oral mucosal scraping, a tissue sample or other bodily fluid sample.

7. 2. The method of claim 1, wherein the sample is saliva or an oral mucosal scrape, does not include a nucleic acid purification step, and includes a step of amplifying and detecting multiple SNPs including rs10490924 and rs800292.

8. A reagent or kit for assessing a subject's risk of developing AMD, comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof comprising rs10490924; a second primer set for amplifying the CFH gene or a fragment thereof comprising rs800292; and A first nucleic acid probe and a second nucleic acid probe which hybridize to a region containing the G allele and the T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe which hybridize to a region containing the A allele and the G allele of rs800292, respectively, having the following characteristics 1) to 3): 1) The probe length is 8-29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) having a fluorophore at one end region and a quencher at the other end region; A reagent or kit comprising:

9. The reagent or kit according to claim 8 , wherein the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe are contained in the same container and are applicable to multiplex PCR.

10. The reagent or kit according to claim 8 , wherein the artificial nucleic acid is an LNA.

11. The reagent or kit according to claim 8, which is used to detect the SNPs rs800292 and rs10490924 in a nucleic acid in a sample taken from a subject.

12. 12. The reagent or kit of claim 11, wherein the sample is a blood sample, saliva, an oral mucosal scraping, a tissue sample or other body fluid sample.

13. The reagent or kit according to claim 10 , wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe is LNA.

Images