Light receiving device

Abstract

To provide a light receiving device capable of providing a strong response to light in a wide wavelength range.SOLUTION: A light receiving device includes graphene having a light receiving portion, a main electrode that is electrically connected to the graphene, and has a source electrode and a drain electrode, the light receiving portion being located between the source electrode and the drain electrode, a gate electrode electrically connected to the light receiving portion of the graphene via capacitive coupling, a circuit unit that is electrically connected to the main electrode and the gate electrode, applies a voltage to the main electrode and the gate electrode, and measures a current flowing through the main electrode, and an ionic substance in contact with the light receiving portion of the graphene, which is either an anion having an acid dissociation constant of 3 or more or a cation having an acid dissociation constant of 11 or less.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] An embodiment of the present invention relates to a light receiving device. [Background technology]

[0002] When the Fermi level of graphene, a zero-gap material, is at the Dirac point, it can absorb light of all wavelengths, including infrared light, and is therefore expected to be used as a broadband light-receiving element. To improve light detection capabilities, a structure has been proposed in which fluorescent dyes or gold nanoparticles are layered on graphene. However, such a structure only responds to specific wavelengths because it depends on the excitation spectrum of the fluorescent dye or plasmon. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] “Synergistic Effects of Plasmonics and Electron Trapping in Graphene Short-Wave Infrared Photodetectors with Ultrahigh Responsivity”, Zefeng Chen, Xinming Li, Jiaqi Wang, Li Tao, Mingzhu Long, Shi-Jun Liang, Lay Kee Ang, Chester Shu, Hon Ki Tsang, Jian-Bin Xu, ACS Nano 2017 Jan 24;11(1):430-437. doi: 10.1021 / acsnano.6b06172. Epub 2017 Jan 12. Summary of the Invention [Problem to be solved by the invention]

[0004] An object of an embodiment of the present invention is to provide a light receiving device capable of providing a strong response to light in a wide wavelength range. [Means for solving the problem]

[0005] According to an embodiment of the present invention, a light-receiving device includes: graphene having a light-receiving portion; a main electrode electrically connected to the graphene, the main electrode having a source electrode and a drain electrode, the light-receiving portion being located between the source electrode and the drain electrode; a gate electrode electrically connected to the light-receiving portion of the graphene via capacitive coupling; a circuit unit electrically connected to the main electrode and the gate electrode, applying a voltage to the main electrode and the gate electrode and measuring a current flowing through the main electrode; and an ionic substance in contact with the light-receiving portion of the graphene, the ionic substance being either an anion having an acid dissociation constant of 3 or more or a cation having an acid dissociation constant of 11 or less. [Brief description of the drawings]

[0006] [Figure 1A] 1 is a schematic diagram of a light receiving device according to a first embodiment. [Figure 1B] FIG. 11 is a schematic diagram of a light receiving device according to a second embodiment. [Figure 2A] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 2B] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 2C] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 2D] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3A] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3B] 3B is a graph in which the drain current when light is irradiated and the drain current when light is off are plotted against the gate voltage in the measurement of FIG. 3A. [Figure 3C] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3D] 3D is a graph in which the drain current when light is applied and the drain current when light is off are plotted against the gate voltage in the measurement of FIG. 3C. [Figure 3E] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3F] 3B is a graph in which the drain current when light is applied and the drain current when light is off are plotted against the gate voltage in the measurement of FIG. 3E. [Figure 3G] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3H] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3I] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 3J] 13 is a graph showing the measurement results of drain current due to light irradiation. [Figure 4] 5A to 5C are diagrams for explaining the operation of the light receiving device according to the embodiment. [Diagram 5] 1(a) and 1(b) are schematic diagrams showing the relationship between the energy levels of graphene and citrate ions. [Figure 6] 1 is a graph showing the optical response of a graphene FET with attached DNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] Each embodiment will be described below with reference to the drawings. The drawings are schematic or conceptual, and the relationship between the thickness and width of each part, the size ratio between parts, etc. are not necessarily the same as those in reality. Even when the same part is shown, the dimensions and ratios of each part may be different depending on the drawing. Furthermore, the same reference numbers are used to refer to the same or similar elements.

[0008] 1A is a schematic diagram of a light receiving device 1 according to a first embodiment. The light receiving device 1 includes graphene 20, main electrodes 31 and 32, a gate electrode 91, a circuit section 60, and an ionic substance 100.

[0009] The graphene 20 has a light receiving portion 20A that is optically exposed so as to be able to receive light 80 from a light source 70. The graphene 20 is preferably a single-layer graphene. The graphene 20 is provided on a substrate 10 via an insulating film 40. For example, a silicon substrate can be used as the substrate 10. For example, a silicon oxide film can be used as the insulating film 40.

[0010] The main electrodes have a source electrode 31 and a drain electrode 32, and are electrically connected to the graphene 20. The source electrode 31 and the drain electrode 32 are located on the insulating film 40 and spaced apart from each other. A part of the source electrode 31 contacts the graphene 20, and a part of the drain electrode 32 contacts the graphene 20. A light receiving portion 20A of the graphene 20 is located between the source electrode 31 and the drain electrode 32.

[0011] The gate electrode 91 is electrically connected to the light receiving portion 20A of the graphene 20 via capacitive coupling by the insulating film 40. In this example, the gate electrode 91 has a substrate 10 that supports the graphene 20, and a conductive film 50 provided on the lower surface (back surface) of the substrate 10. The substrate 10 is conductive. The conductive film 50 may be made of, for example, a laminated film of titanium, nickel, and gold. The use of such a conductive film 50 provides ohmic contact with the substrate 10 made of silicon, and also provides excellent adhesion. The insulating film 40 is located between the gate electrode 91 and the graphene 20, and functions as a gate insulating film.

[0012] The circuit unit 60 is electrically connected to the source electrode 31, the drain electrode 32, and the gate electrode 91. The circuit unit 60 has a power supply 61 that applies a voltage to the source electrode 31 and the drain electrode 32, a variable power supply 63 that applies a voltage to the source electrode 31 and the gate electrode 91, and a current measuring unit 62 that measures the drain current flowing between the source electrode 31 and the drain electrode 32.

[0013] A drain current flows through the graphene 20 because a potential difference is applied between the source electrode 31 and the drain electrode 32 via the power source 61. Here, since the graphene 20 has a field effect transistor (FET) characteristic, the magnitude of the drain current is determined by the potential difference with the gate electrode 91 applied from the power source 63. Here, when the light receiving unit 20A is irradiated with light 80 from the light source 70, photoexcitation occurs in the graphene 20. At least one of excited electrons and holes generated by the photoexcitation causes charge transfer between the ionic material 100 and the ionic material 100, causing a change in the electrostatic potential of the ionic material 100. Since the ionic material 100 is capacitively coupled with the graphene 20, the change in the electrostatic potential of the ionic material 100 is added as a bias to the gate voltage from the gate electrode 91, and the net gate voltage applied to the graphene 20 changes abruptly. Here, since the graphene 20 has a FET characteristic, the drain current also changes abruptly. This series of changes in the drain current are measured by the current measuring unit 62 that measures the drain current.

[0014] The circuit unit 60 has a gate wiring 64 that electrically connects the source electrode 31 and the gate electrode 91. A variable power supply (gate voltage application device) 63 is connected to the gate wiring 64. The gate wiring 64 is connected to a conductive film 50, and the gate wiring 64 and the gate electrode 91 are in ohmic contact with each other through the conductive film 50. A gate voltage is applied from the gate electrode 91 to the graphene 20. The Fermi level of the graphene 20 is modulated by controlling the gate voltage.

[0015] The ionic substance 100 is located in the light receiving portion 20A of the graphene 20 and is in contact with the light receiving portion 20A. The acid dissociation constant of the ionic substance 100 is 3 or more and 11 or less. The light receiving device 1 includes the ionic substance 100 which is either an anion with an acid dissociation constant of 3 or more or a cation with an acid dissociation constant of 11 or less. The ionic substance is citric acid, phosphoric acid, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), trishydroxymethylaminomethane (Tris), nucleic acid, an amino group, or an ethylenediamine derivative.

[0016] 1B is a schematic diagram of a light receiving device 2 according to a second embodiment. The light receiving device 2 also includes graphene 20, a source electrode 31, a drain electrode 32, a gate electrode 92, a circuit unit 60, and an ionic substance 100, similar to the light receiving device 1 according to the first embodiment.

[0017] The gate electrode 92 in the light receiving device 2 is provided on the substrate 10 via the insulating film 40, and is electrically connected to the gate wiring 64. An ionic liquid 101 is located in a recess of the insulating film 40 formed on the lower surface of the graphene 20, and the ionic liquid 101 contacts the lower surface of the light receiving section 20A. The ionic liquid 101 contacts the gate electrode 92 on the insulating film 40. The gate electrode 92 is electrically connected to the light receiving section 20A of the graphene 20 via the ionic liquid 101. However, since the ionic liquid 101 creates an electric double layer at the contact portion with the light receiving section 20A, more precisely, the ionic liquid 101 and the light receiving section 20A are electrically connected via capacitive coupling due to the electric double layer.

[0018] The ionic liquid 101 contains chloride ions, and the gate electrode 92 is a silver / silver chloride electrode having silver chloride on its surface. The silver / silver chloride electrode (gate electrode 92) is in contact with the ionic liquid 101 containing chloride ions, and an oxidation-reduction reaction occurs, thereby applying an electric potential to the ionic liquid 101. The electric potential of the ionic liquid 101 is controlled to a constant potential difference with respect to the electric potential of the silver / silver chloride electrode (gate electrode 92) according to the Nernst equation. The oxidation-reduction reaction with silver chloride (AgCl) (AgCl + e -→ Ag + Cl - ) in ionic liquid 101. - ) moves between the ionic liquid 101 and the surface of the silver / silver chloride electrode (gate electrode 92) until the potential of the ionic liquid 101 becomes stable.

[0019] FIG. 2A shows the drain current response (change in drain current with respect to when no light is irradiated) when the light receiving section 20A is irradiated with light using graphene to which no ionic substance is attached. The light receiving section 20A is irradiated with light having wavelengths of 450 nm, 550 nm, 650 nm, 750 nm, and 850 nm along the time axis (horizontal axis). The light receiving section 20A is irradiated with light of each wavelength during the period shown in gray (or shaded) in FIG. 2A and in FIGS. 2B to 2D, 3A, 3C, 3E, 3G to 3J, and 6 described later. It can be seen from the measurement result in FIG. 2A that no change is observed in the drain current at any wavelength.

[0020] FIG. 2B shows the drain current response when light is irradiated to the light receiving section 20A using graphene to which citric acid is attached as an ionic substance having an acid dissociation constant of 1 to 13. The light receiving section 20A in a dry atmosphere was irradiated with light having wavelengths of 400 nm, 450 nm, 500 nm, 550 nm, 572 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, and 900 nm. The measurement results in FIG. 2B show that the drain current changes for all wavelengths of light.

[0021] Figure 2C shows the drain current response when the graphene with citric acid attached was sealed together with water and irradiated with 650 nm light. It can be seen that the drain current response gradually increases. This is a phenomenon that accompanies an increase in humidity in the sealed container, and it can be seen that the drain current response to the light irradiation (hereinafter referred to as the photoresponse) is amplified by humidification.

[0022] FIG. 2D shows the drain current response (photoresponse) when the light receiving section 20A is irradiated with light of various wavelengths while keeping the sealed state of FIG. 2C. Light of wavelengths of 650 nm, 750 nm, 850 nm, 550 nm, 450 nm, 400 nm, 500 nm, 600 nm, 700 nm, 800 nm, 900 nm, 572 nm, and 650 nm was irradiated to the light receiving section 20A along the time axis (horizontal axis). It can be seen from the measurement result of FIG. 2D that the drain current responds greatly to light of any wavelength. Note that citric acid, which is an anionic molecule, can be used as an ionic substance with an acid dissociation constant of 3 to 11. Citric acid is known to undergo three stages of acid dissociation, and the acid dissociation constants of each stage are 3.09, 4.75, and 6.41.

[0023] The attachment of citric acid was performed by dropping a gold nanoparticle solution containing citric acid as a stabilizer (100 nm citric acid dispersion / CytoDiagnostics) and drying it. Therefore, in addition to citric acid, gold nanoparticles are also attached, but it has been found that there are almost no gold nanoparticles attached by prior observation with a scanning electron microscope. After the gold nanoparticle solution was dropped, the water-soluble citric acid was washed away by pure water replacement, and although a small amount of gold nanoparticles remained, similar to the case without washing, no photoresponse was observed, whereas a photoresponse was observed when citric acid (citric acid monohydrate, Fujifilm Wako Pure Chemical Industries, Ltd.) was dropped as an aqueous solution and dried, indicating that citric acid substantially contributes to the photoresponse. Hereinafter, a sample to which citric acid was attached using citric acid-stabilized gold nanoparticles is referred to as graphene to which citric acid is attached.

[0024] 3A to 3D show the results of measuring the photoresponse of graphene to which citric acid is attached as an ionic substance while changing the gate voltage (FIGS. 3A and 3C), and the drain currents obtained at that time when irradiated with light and when extinguished with light are plotted against the gate voltage (FIGS. 3B and 3D). FIG. 3B shows the drain currents obtained in the measurement of FIG. 3A when irradiated with light and when extinguished with light plotted against the gate voltage. FIG. 3D shows the drain currents obtained in the measurement of FIG. 3C when irradiated with light and when extinguished with light plotted against the gate voltage. It can be seen that both the drain currents when irradiated with light and the drain currents when extinguished with light show a V-shaped change (transfer curve) with respect to the gate voltage, and have typical graphene FET characteristics. In addition, the V-shaped transfer curve shifts horizontally (i.e., the gate voltage changes in the direction of offset) between when irradiated with light and when extinguished with light, and it can be seen that the Fermi level of the graphene FET is modulated depending on the presence or absence of light irradiation. Here, the Fermi level modulation by light irradiation is in the direction of positive charge injection in Figures 3A and 3B, and in the direction of negative charge injection in Figures 3C and 3D. Even the same graphene with citric acid attached is modulated in both the positive and negative directions, and the reason for this will be described later.

[0025] Figures 3E and 3F show the results of measuring the photoresponse of graphene with HEPES attached as an ionic substance while changing the gate voltage (Figure 3E), and the drain current obtained during light irradiation and during extinction plotted against the gate voltage (Figure 3F). As in the previous example, the Fermi level is modulated, and it can be seen that this is in the direction of negative charge injection. HEPES is a zwitterion with an anionic sulfonic acid group and a cationic tertiary amino group, and the acid dissociation constants are 3 and 7.5, respectively. HEPES was attached by dripping 1 mol / L HEPES buffer (pH 7.3 / Dojindo Laboratories, Ltd.) and drying.

[0026] FIG. 3G shows the results of measuring the photoresponse of graphene to which phosphoric acid is attached as an ionic substance at a gate voltage of 0 mV. The drain current rises with the first light irradiation, and drops to the initial current value when the light is turned off. Since the graphene FET is presumed to be in a hole conduction state at a gate voltage of 0 mV, the response to the first light irradiation is presumed to be positive charge injection. Next, when light is irradiated for the second or subsequent times, the drain current rises for an instant, and then immediately drops to below the initial current value. Even when the light is turned off, the drain current rises for an instant above the initial current value, and then immediately drops to the initial current value. That is, positive charge injection occurs momentarily when the light is turned on and off, but is stable in a negative charge injection state during light irradiation. In addition, the drain current rise state is maintained when the light is turned off around 700 seconds. That is, the positive charge injection state is maintained. In the citric acid-attached graphene shown in FIG. 3A to FIG. 3D, it was suggested that both positive charge injection and negative charge injection may exist, but here it was suggested that positive charge injection and negative charge injection may also co-occur. Like citric acid, phosphoric acid also has three stages of acid dissociation, with the respective acid dissociation constants being 2.12, 7.21, and 12.67. Phosphoric acid was attached by dropping 0.1 mol / L sodium phosphate buffer (pH 7.0 / FUJIFILM Wako Pure Chemical Industries, Ltd.) and drying.

[0027] Figures 3H and 3I show the drain current response when the graphene FET in an aqueous solution is irradiated with light. Figure 3H shows the measurement results for a HEPES aqueous solution, and Figure 3I shows the measurement results for a sodium chloride aqueous solution. A gate voltage was applied to the graphene FET through the aqueous solution using a silver / silver chloride electrode inserted in the aqueous solution. The gate voltage was 450 mV in Figure 3H and 550 mV in Figure 3I, both voltages at which the graphene FET is in a hole conduction state. As shown in Figure 3H, in the case of HEPES, light irradiation causes a decrease in the drain current, i.e., a photoresponse in the direction of negative charge injection. However, the magnitude of the response is attenuated compared to the response in the gas phase described above. On the other hand, as shown in Figure 3I, no photoresponse is observed in the case of sodium chloride. Here, the sodium, which is the cation of sodium chloride, has an acid dissociation constant of 13 when considered as the acid dissociation constant of sodium hydroxide, and the chlorine, which is the anion, has an acid dissociation constant of -3.7 when considered as the acid dissociation constant of hydrochloric acid. Such cations with extremely large acid dissociation constants and anions with extremely small acid dissociation constants are in an extremely stable acid dissociation state. The reason why such ions are not involved in photoresponses will be explained later.

[0028] Figure 3J shows the photoresponse of a graphene FET in which a cyclic arginine oligomer is bound to a zwitterionic oligomer containing equal amounts of glutamic acid and lysine. Irradiation with 620 nm LED light causes an increase in the drain current, i.e., positive charge injection. Here, positive charge injection is thought to occur with anions with an acid dissociation constant of more than 6, i.e., anions with an extremely unstable acid dissociation state, or cations, as described below. Considering that the acid dissociation constant of the anion glutamic acid is 4.25, and that the anion in the HEPES solution used for the solid-phase treatment (treatment to attach ionic substances to graphene) is a sulfonic acid group with an acid dissociation constant of 3, the photoresponse is presumed to be caused by either the cation lysine (acid dissociation constant 10.53) or arginine (acid dissociation constant 12.48). However, arginine is a strong base with an acid dissociation constant almost equal to that of calcium hydroxide (acid dissociation constant 12.7), and considering that its acid dissociated state is extremely stable, it is presumed that the photoresponse is caused by acid-dissociated lysine.

[0029] Here, the zwitterionic oligomer containing equal amounts of glutamic acid and lysine was a scaffold peptide having the amino acid sequence ECKEKCEKECKEKCEKECKEKCEKECK from the N-terminus to the C-terminus. The scaffold peptide aqueous solution was mixed with three times the molar amount of pyrenylmaleimide to modify approximately half of the thiol groups of the cysteines in the scaffold peptide with pyrene, and the scaffold peptide was attached to the graphene surface using π-π interactions. Then, a TMEA (tris(2-maleimidoethyl)amine, Thermo Fisher Scientific) solution was dropped to modify approximately half of the remaining thiol groups in the scaffold peptide with maleimide, and a peptide having the peptide sequence CGGGRRRRRRRRRRRRRRRRRRRR from the N-terminus to the C-terminus and cyclized at the N-terminus and C-terminus by peptide bonds was bonded.

[0030] From the measurement results of FIG. 2A to FIG. 3J, a photoresponse is expressed in citric acid, which is a polyvalent anion with acid dissociation constants of 3.09, 4.75, and 6.41, HEPES, which is a zwitterion with acid dissociation constants of 3 and 7.5, phosphate, which is a polyvalent anion with acid dissociation constants of 2.12, 7.21, and 12.67, and lysine, which is a cation with an acid dissociation constant of 10.53, and a photoresponse is not expressed in sodium ions, which are cations with an acid dissociation constant of 13, or chloride ions, which are anions with an acid dissociation constant of -3.7. In addition, when a photoresponse is expressed, no wavelength dependency of the irradiated light is observed. That is, according to this embodiment, a strong response to light in a wide wavelength range can be exhibited by positioning an ionic substance with an acid dissociation constant of 3 to 11 in contact with the surface of graphene.

[0031] The reason for this will be explained below with reference to FIG. 4(a) to FIG. 4(d). FIG. 4(a) to FIG. 4(d) show the partial density of states of graphene calculated by performing first-principles calculation based on density functional theory for a composite model of graphene and citric acid. FIG. 4(e) to FIG. 4(h) show the partial density of states of citric acid calculated by first-principles calculation. The composite model of graphene and citric acid used in the density of states calculation was determined in advance by calculating the molecular structure of citric acid and its positional relationship with graphene using first-principles molecular dynamics calculation. FIG. 4(e) shows the case where the valence of citric acid is zero, FIG. 4(f) shows the case where the valence of citric acid is -1, FIG. 4(g) shows the case where the valence of citric acid is -2, and FIG. 4(h) shows the case where the valence of citric acid is -3. Figure 4(a) shows the partial density of states of graphene corresponding to Figure 4(e), Figure 4(b) shows the partial density of states of graphene corresponding to Figure 4(f), Figure 4(c) shows the partial density of states of graphene corresponding to Figure 4(g), and Figure 4(d) shows the partial density of states of graphene corresponding to Figure 4(h). Note that the Fermi level of graphene can be controlled by changing the gate voltage, and since the gate voltage was varied around the Dirac point in the experiment using actual citric acid, the Fermi levels in Figures 4(a), 4(b), 4(c), and 4(d) are each set to coincide with the Dirac point.

[0032] When graphene is irradiated with light having a wavelength of 650 nm, electrons are excited as indicated by the arrows in Figures 4(a) to 4(d).

[0033] In the case of citric acid not dissociated with acid in Figure 4(e), both the HOMO (Highest Occupied Molecular Orbital) and LUMO (Lowest Unoccupied Molecular Orbital) are far away from the Fermi level. In addition, it can be seen that the energy level at which photoexcitation occurs on the graphene side is in a range where there is no orbital level between the HOMO and LUMO on the citric acid side. In this state, photoexcitation on the graphene side has no effect on citric acid. In addition, the band gap between the HOMO and LUMO of citric acid is sufficiently large compared to the energy of visible light, so photoexcitation does not occur in citric acid even when it is irradiated with visible light.

[0034] On the other hand, in the case of the acid-dissociated citrate ion shown in FIG. 4(f) to FIG. 4(h), the HOMO exists near the Fermi level. In the case of the citrate ion dissociated into monovalent ions shown in FIG. 4(f) and divalent ions shown in FIG. 4(g), the HOMO level is just below the Fermi level. In the case of the citrate ion dissociated into trivalent ions shown in FIG. 4(h), the HOMO level exists across the Fermi level. That is, it can be seen that the HOMO level of the trivalent citrate ion is in a state where electrons are partially occupied. The reason why the acid-dissociated citrate ion has a HOMO level near the Fermi level will be described later.

[0035] Next, with reference to FIG. 4(c) and FIG. 4(g), the mechanism by which negative charge injection occurs in a graphene FET upon light irradiation in the presence of divalent acid-dissociated citrate ions will be described. (1) When light is irradiated, photoexcitation occurs on the graphene side. Figure 4(c) shows the state of photoexcitation when light with a wavelength of 650 nm is irradiated. (2) The energy level of the holes left in graphene by photoexcitation is lower than the energy level of the HOMO filled with electrons on the citrate ion side, so electrons move from the HOMO of the citrate ion to the holes in graphene. (3) After the electron transfer, a hole remains in the HOMO of the citrate ion, which is at a lower energy level than the excited electron on the graphene side. As a result, the excited electron on the graphene side transfers to the HOMO of the citrate ion, compensating for the change in the number of electrons caused by (2) above. (4) Of the above reactions (2) and (3), the main reaction (2) prevails, so the citrate ion loses electrons and becomes positively charged. (5) Because the citrate ion and graphene are capacitively coupled, the charge change on the citrate ion side causes electrostatic induction, inducing a negative charge on the graphene side. Note that although the explanation here is given using divalent acid-dissociated citrate ions, the monovalent acid-dissociated citrate ion also has a HOMO just below the Fermi level, and so the same optical response as above can occur.

[0036] Next, with reference to FIG. 4(d) and FIG. 4(h), a mechanism by which positive charge injection can occur in a graphene FET upon light irradiation in the presence of trivalent acid-dissociated citrate ions will be described. (1) When light is irradiated, photoexcitation occurs on the graphene side. Figure 4(d) shows the state of photoexcitation when light with a wavelength of 650 nm is irradiated. (2) The energy level of the excited electrons generated in graphene by photoexcitation is higher than the energy level of the HOMO of the citrate ion, which is only partially filled with electrons, so the excited electrons of graphene are transferred to the HOMO of the citrate ion. (3) On the other hand, since the energy level of the holes left on the graphene side by photoexcitation is lower than the energy level of the HOMO of the citrate ion, electrons also transfer from the HOMO of the citrate ion to the holes on the graphene side. (4) Here, (2) and (3) occur competitively, but when (2) prevails, the citrate ion becomes an electron acceptor and changes to a negative charge. (5) Because the citrate ions and graphene are capacitively coupled, the charge change on the citrate ion side causes electrostatic induction, inducing a positive charge on the graphene side.

[0037] As described above, the acid dissociation state of citric acid changes, so that when light is irradiated, the graphene can be injected with positive or negative charges. The acid dissociation constant for citric acid to change from divalent to trivalent is 6.41, which is almost neutral. In other words, citric acid can become divalent or trivalent due to the presence of a small amount of impurity ions. This is thought to be the reason why both photoresponses in the direction of positive charge injection and photoresponses in the direction of negative charge injection occur. In addition, phosphoric acid dissociates in multiple stages like citric acid, so it can be assumed that it will behave in the same way. Furthermore, when the pH is near the acid dissociation constant, ions with valences before and after it will be mixed. In such a case, it is expected that positive charge injection and negative charge injection due to light irradiation will occur competitively. It is assumed that the co-expression of positive charge injection and negative charge injection shown in Figure 3G was in such a state.

[0038] In addition, in the mechanism of the photoresponse, the excitation by light irradiation occurs on the graphene side of the zero-gap material, and citric acid is not directly affected by light irradiation. As a result, the photoresponse does not have wavelength dependence, and is not affected by the HOMO-LUMO band gap of citric acid.

[0039] Next, we will explain why the HOMO level of citric acid appears near the Fermi level of graphene when acid-dissociated citric acid is near graphene. First, the results of the density of states calculation for the graphene-citric acid composite system were subjected to charge density analysis using Mulliken charges to determine the number of electrons held by citric acid. From the results, the actual valence of the citrate ion coexisting with graphene and the number of changes from the state before the interaction with graphene, i.e., the number of charge transfers with graphene, were calculated. These results are shown in Table 1.

[0040] [Table 1]

[0041] As a result, it was found that after interaction with graphene, the monovalent citrate ion became 0.2 valence, the divalent citrate ion became monovalent, and the trivalent citrate ion became 1.3 valence. In other words, the number of electrons in the citrate ion of each valence was reduced from the initial state, indicating that electrons were transferred to graphene. It was also found that the number of electrons transferred increased as the valence increased from monovalent to trivalent.

[0042] Here, the monovalent and trivalent citrate ions all have their HOMO levels near the Fermi level of graphene. From the above results, it can be inferred that the initial state had more electrons, and therefore the HOMO energy level in the initial state was higher.

[0043] Figures 5(a) and 5(b) show the relationship between the energy levels of graphene and citrate ions. As mentioned above, citrate ions have a HOMO at an extremely high energy level in the initial state. Here, in an isolated molecule with a band gap between HOMO and LUMO, the Fermi level almost coincides with the HOMO level. Therefore, the Fermi level of a citrate ion in an isolated state is at a very high position, that is, it has a small work function. In other words, the citrate ion dissociated with acid has electron-donating properties. When graphene approaches this, electrons move from the citrate ion with a high Fermi level (HOMO level) to the graphene with a low Fermi level. The citrate ion that donates the electrons lowers its Fermi level (HOMO level) to be equal to the Fermi level of graphene. As a result, the HOMO level of the citrate ion interacting with graphene is located near the Fermi level of graphene. As shown in Table 1, as the valence of citric acid increases, the electron donating property also increases, so it can be inferred that the HOMO level in the initial state is at a higher energy level as the valence increases. Even after the interaction between the trivalent citrate ion and graphene, the HOMO is at an energy level slightly higher than the Fermi level of graphene and is in a partially occupied state, which is inferred to be because the HOMO level in the initial state was higher.

[0044] The above mechanism is due to the increase in the number of electrons held by citric acid through acid dissociation, which raises the energy level of its HOMO, so acid dissociation is a necessary condition. As shown in Figure 2C, the increase in photoresponse due to humidification is presumed to be due to the promotion of acid dissociation by humidification. In addition, the fact that the electron donating property increases due to acid dissociation means that the acid dissociation state is unstable, which is a characteristic of anions that form so-called weak acids (in other words, anions with large acid dissociation constants). Therefore, the above mechanism is presumed to be a mechanism that is generally expressed in anions with large acid dissociation constants other than citric acid. It is presumed that this is why photoresponse was also expressed in phosphoric acid and HEPES in the experimental results shown so far. On the other hand, the reason why photoresponse was not expressed in chloride ions that form strong acids is presumed to be because the dissociated state of chloride ions is extremely stable and does not have electron donating property. In fact, the acid dissociation constant of chloride ions is extremely small at -3.7.

[0045] Although the above is explained for anions that form weak acids, it is presumed that a similar phenomenon occurs with cations that form weak bases. In this case, the cation releases electrons by acid dissociation, and the state becomes somewhat unstable, that is, an electron-accepting state. In the electron-accepting state, the LUMO is at a low energy level, and the Fermi level is near the even lower HOMO level. Here, if the LUMO level of the cation is lower than or close to the Fermi level of graphene, an electron is donated from graphene to the LUMO of the cation, raising the Fermi level of the cation, which was much lower than the Fermi level of graphene, so that the two coincide. At this time, the LUMO is partially occupied by electrons and is located near the Fermi level. When light is irradiated in this state, the excited electrons generated by photoexcitation on the graphene side are higher than the partially occupied LUMO level, so that electrons move from graphene to the cation. As the cations change to a negative charge, a positive charge is induced on the graphene through capacitive coupling with the graphene. In Figure 3J, the positive charge injection is presumably due to the photoresponse of the above mechanism occurring in lysine, a cation with an acid dissociation constant of 10.53.

[0046] A similar photoresponse can also be observed with trishydroxymethylaminomethane (Tris), a cation with an acid dissociation constant of 8.06 (25°C), and ethylenediamine derivatives, which are cations that undergo acid dissociation in multiple stages. Examples of ethylenediamine derivatives include ethylenediamine with acid dissociation constants of 4.42 and 9.21, diethylenetriamine with acid dissociation constants of 4.42, 9.21, and 10.02, and triethylenetetraamine with acid dissociation constants of 3.32, 6.67, 9.2, and 9.92. Nucleic acids are also weak bases with acid dissociation constants of adenine 4.4, cytosine 4.6, guanine 2.9, and thymine 0.8, and show a similar photoresponse.

[0047] Figure 6 shows the optical response of a graphene FET with DNA attached. Here, the DNA was attached by dropping an aqueous solution of DNA having the base sequence GACAAGGAAAATCCTTCAATGAAGTGGGTC from the 5' end to the 3' end, the 5' end of which was thiol-modified, and drying it.

[0048] From the above, a graphene FET with an ionic substance with an acid dissociation constant of 3 or more and 11 or less attached exhibits a change in the drain current due to its Fermi level modulation by light irradiation. More precisely, a graphene FET with either an anion with an acid dissociation constant of 3 or more or a cation with an acid dissociation constant of 11 or less attached exhibits a change in the drain current due to its Fermi level modulation by light irradiation.

[0049] Furthermore, the phenomenon that occurs as a result of the direct action of light irradiation is photoexcitation in the zero-gap material graphene, and light irradiation does not have a direct effect on ionic substances. Therefore, a strong response to light in a wide range of wavelengths is possible, independent of a specific wavelength. Based on the above-mentioned mechanism, if the Fermi level of graphene is adjusted to the Dirac point by controlling the gate voltage applied to graphene, it can also respond to infrared rays. In other words, the gate voltage is set to a voltage at which the electrical resistance between the source electrode 31 and the drain electrode 32 is maximized.

[0050] In addition, the density of ionic substances in contact with graphene is 0.3 particles / nm 2 Almost no optical response was observed when the density of ionic substances in contact with graphene was 0.6 particles / nm 2 More than 1 piece / nm 2 A photoresponse was observed in the following cases.

[0051] The acid dissociation of ionic substances is promoted by humidification, and therefore it was confirmed that by humidifying the light receiving section 20A of the graphene 20, the optical response can be amplified compared to when it is not humidified.

[0052] For example, the light receiving section 20A can be placed in a humid space by sealing the light receiving section 20A in a container in a humid atmosphere.

[0053] For example, a mechanism for exposing the light receiving section 20A to a humid atmosphere may be provided.

[0054] For example, the light receiving section 20A may be placed in an electrolyte solution.

[0055] For example, the ionic substance 100 may be in contact with the light receiving section 20A together with the hydrophilic substance.

[0056] A method for manufacturing the light receiving device 1 shown in FIG. 1A may include the following steps.

[0057] Graphene is formed on Cu foil by CCVD (Carbon Chemical Vapor Deposition). This graphene is transferred to the surface of a silicon wafer having a conductive film 50 formed on the back side and a silicon oxide film formed on the front side, and patterned. After this, a conductive film constituting a source electrode 31, a drain electrode 32, wiring, etc. is formed on the front side of the wafer, and patterned. After the graphene surface is hydrophilized, an aqueous solution containing a desired ionic substance is dropped onto the graphene surface, and dried, so that the ionic substance is positioned on the graphene surface. In the hydrophilization treatment of the graphene surface, for example, an aqueous solution of pyrene-modified PEG (polyethylene glycol) or pyrene-modified zwitterion is dropped onto the graphene surface, and the surface is left for 30 minutes or more, and then washed.

[0058] A method for manufacturing the light receiving device 2 shown in FIG. 1B may include the following steps.

[0059] Graphene is formed on Cu foil by CCVD. This graphene is transferred to the surface of a silicon wafer having a conductive film 50 formed on the back side and a silicon oxide film formed on the front side, and patterned. Thereafter, a conductive film constituting the source electrode 31, the drain electrode 32, wiring, etc. is formed on the front side of the wafer, and patterned. A gate electrode 92 is formed on the front side of the wafer. The process of forming the gate electrode 92 may include a process of forming an Ag film, patterning it, and forming AgCl. When the surface of Ag is treated with 1,3-diaminopropanetetraacetic acid ferric ammonium salt monohydrate (PDTA·Fe(III)), the following reaction occurs to form AgCl. PDTA·Fe 3+ +Ag+NaCl→PDTA·Fe 2+ +AgCl+Na +After forming a protective film for the gate electrode 92, the silicon oxide film under the graphene is removed using buffered hydrofluoric acid to form a recess. After this, the protective film for the gate electrode is removed using an organic solvent. After this, supercritical cleaning and drying are performed. Here, the process from the buffered hydrofluoric acid treatment to the supercritical cleaning is a continuous process, and drying is prevented during the process. After that, the surface of the graphene is hydrophilized, and an aqueous solution containing a desired ionic substance is dropped onto the surface of the graphene, followed by supercritical cleaning and drying, so that the ionic substance is positioned on the surface of the graphene. Here, too, the process from the hydrophilization treatment to the supercritical cleaning is a continuous process, and drying is prevented during the process. Finally, the recess formed under the graphene is filled with an ionic liquid, and the ionic liquid in contact with the gate electrode is filled.

[0060] In graphene, photoexcitation does not occur when the light energy is less than twice the difference in energy levels between the Fermi level and the Dirac point, because the law of conservation of momentum does not hold. When the gate voltage is scanned to scan the Fermi level from an energy level lower than the Dirac point toward the Dirac point, photoexcitation occurs at the wavelength of the irradiated light. By scanning the gate voltage, it is possible to identify the wavelength of the irradiated light. If the wavelength of the light to be received is known, a photoresponse can be expressed by bringing the Fermi level close to the Dirac point within an energy range of 1 / 2 or less of the light energy of that wavelength. By applying a gate voltage, it is possible to move the Fermi level of graphene away from the Dirac point by 1 / 2 or more of the light energy, and to cut off light with a wavelength greater than the light energy.

[0061] Although some embodiments of the present invention have been described, these embodiments are presented as examples and are not intended to limit the scope of the invention. These novel embodiments can be implemented in various other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their modifications are included in the scope and spirit of the invention, and are included in the scope of the invention and its equivalents described in the claims. [Explanation of symbols]

[0062] Reference Signs List 1, 2... Light receiving device, 10... Substrate, 20... Graphene, 20A... Light receiving section, 31... Source electrode, 32... Drain electrode, 40... Insulating film, 50... Conductive film, 60... Circuit section, 70... Light source, 91, 92... Gate electrode, 100... Ionic substance, 101... Ionic liquid

Claims

1. Graphene having a light receiving portion; a main electrode electrically connected to the graphene, the main electrode having a source electrode and a drain electrode, the light receiving portion being located between the source electrode and the drain electrode; a gate electrode electrically connected to the light receiving portion of the graphene via capacitive coupling; a circuit section electrically connected to the main electrode and the gate electrode, applying a voltage to the main electrode and the gate electrode, and measuring a current flowing through the main electrode; an ionic substance in contact with the light receiving portion of the graphene, the ionic substance being either an anion having an acid dissociation constant of 3 or more or a cation having an acid dissociation constant of 11 or less; A light receiving device comprising:

2. The photodetector according to claim 1 , wherein the gate electrode comprises a substrate supporting the graphene.

3. The light-receiving device according to claim 1 , wherein the gate electrode is electrically connected to the light-receiving portion of the graphene via an ionic liquid.

4. The light receiving device according to claim 3 , wherein the ionic liquid is in contact with a lower surface of the light receiving portion.

5. The ionic liquid contains chloride ions, 5. The light-receiving device according to claim 3, wherein the gate electrode is a silver / silver chloride electrode.

6. 5. The light receiving device according to claim 1, wherein the light receiving section is located in a humidifying space.

7. 5. The light receiving device according to claim 1, further comprising a mechanism for exposing the light receiving portion to a humid atmosphere.

8. 5. The light-receiving device according to claim 1, wherein the light-receiving portion is located in an electrolyte solution.

9. 5. The light-receiving device according to claim 1, wherein the ionic substance is in contact with the light-receiving portion together with a hydrophilic substance.

10. The photodetector according to any one of claims 1 to 4, wherein the ionic substance is citric acid, phosphoric acid, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), trishydroxymethylaminomethane (Tris), nucleic acid, an amino group, or an ethylenediamine derivative.

Images