Regulatable expression systems

Abstract

To provide compositions comprising minigenes comprising splice modulator binding sequences, for regulatable gene expression, and systems and methods of use thereof.SOLUTION: Provided is a nucleic acid molecule comprising a minigene linked to a transgene encoding a protein of interest, wherein the minigene comprises: a. a first exon; b. a first intron; c. a second exon; d. a second intron; and e. a third exon; wherein the second exon comprises a splice modulator binding sequence and wherein, in the presence of a splice modulator, the second exon is included in an mRNA product of the nucleic acid, and in the absence of the splice modulator, the second exon is not included in an mRNA product of the nucleic acid.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing which has been submitted electronically in ASCII format, the entirety of which is as follows: The ASCII created on July 22, 2020 is incorporated herein by reference. The copy is named PAT058643-WO-PCT_SL.txt and is sized is 108,491 bytes.

[0002] Compositions containing minigenes for regulatable gene expression, as well as systems and methods of use thereof, are disclosed herein. Disclosed in the specification. [Background technology]

[0003] Introducing genetic material (e.g., heterologous nucleic acid) into target cells to increase expression of a desired gene product Gene therapy approaches to deliver viruses to infected hosts may support this therapeutic goal. highly efficient in nucleic acid delivery to specific cell types while evading immune surveillance by Robbins et al., (1998) Pharmacol .Ther.,80(1):35-47. These properties make viruses suitable for gene therapy. Retroviruses, adenoviruses, and adenoviruses are attractive delivery vehicles or vectors for Several types of viruses, including parasite-associated viruses (AAVs) and herpes simplex viruses, It has been modified in the laboratory for use in gene therapy applications. Lunstrom et al. l.,(2018)Diseases,6(2):42. In particular, adeno-associated virus (A Vectors derived from AV) have been shown to: (i) target a variety of non-dividing and dividing cells, including muscle fibers and neurons; (ii) capable of infecting (transmitting) any cell type; (ii) lacking viral structural genes; thereby suppressing natural host cell responses to viral infection, such as interferon-mediated responses. (iii) wild-type viruses have not been associated with human pathology; iv) replication-deficient AAV, in contrast to wild-type AAV, which is able to integrate into the host cell genome V vectors generally persist as episomes, making them ideal for insertional gene mutations or oncogenes. (v) In contrast to other vector systems, AAV vectors does not induce a significant immune response (see ii), and therefore is suitable for long-term administration of, e.g., therapeutic heterologous nucleic acids. Effectively bind genetic material to allow expression (if those gene products are not rejected) Wold et al., (2013) Curr. Gene Ther., 13(6):421-33;Lee et al.,(2017)Genes Dis. ,4(2):43-63.

[0004] AAV is a member of the Parvoviridae family. The AAV genome is typically approximately 4.7 Kilobase (kb) and nonstructural Rep (replication) and structural Cap (capsid) proteins A linear single-stranded DNA fragment containing two major open reading frames encoding proteins. Two cis-acting inverted terminal repeat (ITR) sequences are located in the AAV coding region. These are typically approximately 145 nucleotides in length and are involved in the initiation of DNA replication. A palindromic sequence that can fold into a hairpin structure that functions as a primer upon initiation. In addition to their role in DNA replication, ITR sequences also play a role in viral integration, rescue from the host genome, and encapsulation of viral nucleic acids into mature virions Muzyczka et al. (1992) Curr.Top.Micro.Immunol.,158:97-129.

[0005] Many proteins are important scientific research tools or drugs for preventing or treating disease. Viral vectors such as AAV have been developed to transduce various cell types and These proteins are desirable for their ability to deliver heterologous nucleic acids encoding these proteins to a variety of target tissue types. However, various side effects can occur during protein expression, ranging from loss of efficacy to severe toxicity. The expression level of a therapeutic protein that may be involved in the treatment of a disease can be modulated, e.g. Modulating the timing or location of expression and / or levels of therapeutic proteins to increase efficacy It is desirable to develop strategies to increase the risk of side effects and / or reduce them. Summary of the Invention [Means for solving the problem]

[0006] Thus, the present disclosure provides, in part, a method for turning on or off expression of a protein of interest. In addition, minigene nucleotide sequences useful for controlling protein expression using small molecules are available. The present disclosure provides vectors, recombinant viruses and vectors containing such minigene sequences. and pharmaceutical compositions are also provided and contemplated for their use in methods of modulating gene expression.

[0007] In a first embodiment, a minigene linked to a transgene encoding a protein of interest is Nucleic acid molecules are provided that include a minigene, wherein the minigene comprises a first exon; a first intro a second exon; a second intron; and a third exon, The second sequence comprises a splice regulator binding sequence, and in the presence of a splice regulator, The splice regulator is included in the mRNA product of the nucleic acid, and in the absence of the splice regulator, The second exon is not included in the mRNA product of the nucleic acid.

[0008] In an embodiment, the third exon is a splice regulator of the nucleic acid produced in the absence of the splice regulator. In-frame in the mRNA product and produced in the presence of a splice regulator Contains a stop codon that is not in frame in the mRNA product of the nucleic acid.

[0009] In an embodiment, the second exon is a splice regulator of the nucleic acid produced in the presence of the splice regulator. Contains a stop codon that is in frame in the mRNA product.

[0010] In an embodiment, the first and third exons do not contain a start codon. In some embodiments, the second exon includes the start codon.

[0011] In any of the foregoing aspects and embodiments, the nucleic acid comprises a minigene and a transgene. It contains a sequence encoding a protease cleavage site located between the gene.

[0012] In embodiments, the protease cleavage site is cleavable by a mammalian protease. will be done.

[0013] In embodiments, the mammalian protease is furin, PCSK1, PCSK5, PCSK6, PCSK7, cathepsin B, granzyme B, factor XA, enterokinase genenase, sortase, precision protease protease, thrombin, TEV protease, or elastase 1.

[0014] In an embodiment of any of the foregoing aspects and embodiments, the protease cleavage site is R X(K / R)R consensus motif, RXXX[KR]R consensus motif, RR X consensus motif, RNRR (SEQ ID NO: 39), IEPDX consensus motif (SEQ ID NO: 35), Glu / Asp-Gly-Arg, Asp-Asp-Asp -Asp-Lys (SEQ ID NO: 36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37), LPXTG / A consensus motif, Leu-Glu-Val-P he-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-G ly-Ser (SEQ ID NO: 40), ENLYFQG (SEQ ID NO: 41) and [A GSV]-x (SEQ ID NO: 42) In an embodiment, the cleavage site is cleaved by furin. In this form, the protease cleavage site cleaved by furin is RNRR (sequence No. 39); RTKR (SEQ ID NO: 43); GTGAEDPRPSRKRRSLGDVG( SEQ ID NO: 45); GTGAEDPRPSRKRR (SEQ ID NO: 47); LQWLEQQVA KRRTKR (SEQ ID NO: 49); GTGAEDPRPSRKRRSLGG (SEQ ID NO: 51 );GTGAEDPRPSRKRRSLG (SEQ ID NO: 53);SLNLTESHNSRK KR (SEQ ID NO: 55); or CKINGYPKRGRKRR (SEQ ID NO: 57). In an embodiment, the protease cleavage site cleaved by furin is RNRR (sequence In an embodiment, the sequence encoding the protease cleavage site comprises C It comprises, for example consists of, GCAACCGCCGC (SEQ ID NO: 19).

[0015] In embodiments including any of the foregoing aspects and embodiments, the nucleic acid is introduced into a minigene. and optionally a sequence encoding a self-cleaving peptide located between the transgene and the The self-cleaving peptide is 1, 2, 3, 4, 5, 6, 7, 8 from the N-terminus of the protein of interest. In an embodiment, the self-cleaving peptide optionally cleaves within 9 or 10 amino acids. The peptides can be selected from T2A peptide, P2A peptide, E2A peptide, and F2A peptide. and the like. Examples of suitable T2A peptides include, for example, T2A peptides, such as self-cleaving peptides. comprises EGRGSLLTCGDVEENPGP (SEQ ID NO: 61), and optionally The self-cleaving peptide is (GSG)EGRGSLLTCGDVEENPGP (SEQ ID NO: 59 ) is included.

[0016] In embodiments including any of the foregoing aspects and embodiments, the splice regulator binding sequence The string is located at the 3' end of the second exon.

[0017] In embodiments including any of the foregoing aspects and embodiments, the splice regulator binding sequence The string comprises, e.g., consists of, AGA, and the splice regulator is 5-(1H-pyra (2,2,6,6-tetramethylpiperidin-4-yl)-2-(6-((2,2,6,6-tetramethylpiperidin-4-yl) The compound is (3-amino-2-methyl-1,3-dihydroxypyridazin-3-yl)phenol (LMI070).

[0018] In embodiments including any of the foregoing aspects and embodiments, the second exon comprises: CCTTGCTATCCCTGTCTTCTGTAGCTATTCTGAAACCATC AACAAAGGAGCACACCATTCCATCAGCAAAAGA (SEQ ID NO: 1) ; GTAATTAGCTGAGAAGGAAGATCTGAAGGTTTAACGAGAG AGGGCGAGAGATACAAAATATCTGCTAGGAGA (SEQ ID NO: 2); GGATTGTTTGTATTCCTGCCAATGATTTGTGAGACAGTCT GTTCCCCACATCCTCGTCAACAGA (SEQ ID NO: 3); CTTTCTGACATCTTAACGAGGCAATACAGAGAGACGAATT TTCATCAGTTTGTTCAGGGAGACACATATAACAAAAGA Column number 4); ATCCATACATACTTAATGCTGAAATGTGAAGGGCTGAGAA AAAAGAAAAGA (SEQ ID NO: 5); AATTGGAAACATCGAGGGAAAATGGGCTTTTTATTATTAA AACAAAACCTCAGTATTATCACTTAGAAACCTGAAATTGA ACTCCAAAAGCCAAAGA (SEQ ID NO: 6); AAGAATGTTCCTTTTGTGAAGAATGACTTAAGGAAGATTC ATGATGACTGAGTGTGCCCGTGTGGAACTTTAGGACATAG ATGCACTCCTACAGA (SEQ ID NO: 7); TTGTCCTTCACTCCGTACTCCAGTTGGCCAAGCATAGGTC GCATGCCAGGGTCAAGGAGACTAAGGGAGA (SEQ ID NO: 8); GACATACAGACATGGCAGCCCCTAGCATGTGTATCCTAAG A (SEQ ID NO: 9); ACATACAGACATGGCAGCCCCTAGCATGTGTATCCTAAGA (SEQ ID NO: 10); [ka] , and A fragment or variant of any of (a) to (k), 90%, at least 95%, at least 96%, at least 97%, at least 98% or is a fragment or variant with at least 99% identity The nucleic acid sequence may comprise, for example consist of, a sequence selected from:

[0019] In embodiments including any of the foregoing aspects and embodiments, the second exon is SN and optionally, the sequence is derived from an exon of SNX7. It comes from Son.

[0020] In embodiments including any of the foregoing aspects and embodiments, the second exon comprises: [ka] ; a fragment of SEQ ID NO: 16; or A variant of SEQ ID NO: 16 or a variant thereof that is at least 90%, at least 95%, or at least 96%, at least 97%, at least 98%, or at least 99% identity The fragment comprises, for example consists of,

[0021] In embodiments including any of the foregoing aspects and embodiments, the second exon comprises: [ka] ; A fragment of SEQ ID NO: 98; or A variant of SEQ ID NO: 98 or a variant thereof, which is at least 90%, at least 95%, or at least 96%, at least 97%, at least 98%, or at least 99% identity The fragment comprises, for example consists of,

[0022] In embodiments including any of the foregoing aspects and embodiments, the second exon is 3n -1 nucleotide, where n is an integer.

[0023] In embodiments including any of the foregoing aspects and embodiments, the first exon comprises: one or more, e.g., three, GAA repeats (SEQ ID NO: 69) (e.g., GAAGAAGAA (SEQ ID NO: 69)); a Kozak sequence (e.g., a Kozak sequence comprising GCCACC (SEQ ID NO: 70)); or Both (a) and (b) Includes.

[0024] In embodiments including any of the foregoing aspects and embodiments, the first exon comprises: GAAGAAGAAGATATCAAGTTAGCATTTACAGATTTGGCTG AGGAGAAGAACAG (SEQ ID NO: 96); a fragment of SEQ ID NO: 96; or A variant of SEQ ID NO: 96 or a variant thereof that is at least 90%, at least 95%, or at least 96%, at least 97%, at least 98%, or at least 99% identity The fragment comprises, for example consists of,

[0025] In embodiments including any of the foregoing aspects and embodiments, the first intron comprises: GTAATTAGTGTTGTTTGATATTGCTTCATTTTAAAGTTAT TTGCTCATTTAGCATTTGATATTGCTTTCTATTGATTGTC CTAACTACTCCTCTTTCCTCTCCCTTCTCCATTTTTGAAG (SEQ ID NO: 97); a fragment of SEQ ID NO: 97; or A variant of SEQ ID NO: 97 or a variant thereof that is at least 90%, at least 95%, or at least 96%, at least 97%, at least 98%, or at least 99% identity The fragment comprises, for example consists of,

[0026] In embodiments including any of the foregoing aspects and embodiments, the minigene comprises: Removal or mutation of all but a single start codon, e.g., the ATG start codon ; All latent regions except those at the ends of the first, second and third exons Removing or mutating potential splice donor and splice acceptor sequences It has been modified to do the following.

[0027] In an embodiment, the minigene contains a single start codon located within the first exon. In an embodiment, the minigene has a single initiation codon located within the second exon. Having a don.

[0028] In embodiments including any of the foregoing aspects and embodiments, the minigene comprises 2000 Less than, Less than 1900, Less than 1800, Less than 1700, Less than 1600, Less than 1500, 14 Less than 00, less than 1300, less than 1200, less than 1100 or less than 1000, less than 900, It contains less than 800, less than 700, less than 600, less than 500 nucleotides.

[0029] In embodiments including any of the foregoing aspects and embodiments, the minigene comprises about 250 0 to about 500 nucleotides, for example, about 2000 to about 600 nucleotides, for example, about 150 0 to about 700 nucleotides, for example, about 1200 to about 800 nucleotides, about 1100 to about 900 nucleotides, about 800 to about 500 nucleotides, about 800 to about 600 nucleotides Includes do.

[0030] In embodiments including any of the foregoing aspects and embodiments, the minigene is 71 or SEQ ID NO: 94 or at least 90, 91, 92, 93, 94, 9 a sequence having 5, 96, 97, 98 or 99% identity or a functional fragment thereof comprises, for example consists of,

[0031] In one embodiment, a transgene encoding a protein of interest is provided, comprising: (a) a transgene encoding a protein of interest; and (b) SEQ ID NO: 71 or SEQ ID NO: 94 or at least 90, 91, 92, 93, 94, 9 a sequence having 5, 96, 97, 98 or 99% identity or a functional fragment thereof and a minigene comprising, e.g., consisting of,

[0032] In embodiments including any of the foregoing aspects and embodiments, the nucleic acid molecule is furin A sequence encoding a cleavage site, comprising SEQ ID NO: 19, and a sequence encoding a self-cleaving peptide. and a sequence comprising SEQ ID NO: 20, and optionally a mini- The gene may be located 5' to the sequence encoding the furin cleavage site (e.g., (immediately 5' to the sequence encoding 5' side of the sequence encoding the self-cleaving peptide (e.g., The sequence encoding the self-cleaving peptide is located at the 5' end of the transgene. It is located 5' (eg, immediately 5' to the transgene).

[0033] In embodiments including any of the foregoing aspects and embodiments, the nucleic acid molecule is a minigene and a promoter operably linked to the transgene, and optionally The promoter is located 5' to the minigene.

[0034] In embodiments including any of the foregoing aspects and embodiments, the promoter is promoter, CBA promoter, PGK promoter or synapsin promoter or any promoter that does not contain an intron.

[0035] In embodiments, including any of the foregoing aspects and embodiments, the nucleic acid molecule is It further includes elements.

[0036] In embodiments including any of the foregoing aspects and embodiments, a post-transcriptional regulatory element ( PRE) is a virulent strain of hepatitis B (HPRE), bats (BPRE), ground squirrels (GSPRE), and hogs. Arctic ground squirrels (ASPRE), ducks (DPRE), chimpanzees (CPRE) and cormorants PRE derived from primate monkeys (WMPRE) or woodchucks (WPRE) Optionally, the post-transcriptional regulatory element is located 3' to the transgene.

[0037] In embodiments, including any of the foregoing aspects and embodiments, the post-transcriptional regulatory element , SEQ ID NO: 72, SEQ ID NO: 73 or SEQ ID NO: 88.

[0038] In embodiments including any of the foregoing aspects and embodiments, the nucleic acid molecule is Optionally, the polyA further comprises a polynucleotide sequence corresponding to the 3′ end of the transgene. ' is placed to the side.

[0039] In embodiments, including any of the foregoing aspects and embodiments, the polyA signal is 40 polyA, human growth hormone (HGH) polyA, or bovine growth hormone (BGH) polyA , beta globin polyA, alpha globin polyA, ovalbumin polyA, kappa light chain Poly A and synthetic poly A.

[0040] In embodiments including any of the foregoing aspects and embodiments, the polyA is SEQ ID NO:22 comprises, for example consists of,

[0041] In another aspect, a vector comprising a nucleic acid according to any one of the preceding aspects and embodiments In embodiments, the vector is a DNA vector, optionally In an embodiment, the vector is a bicircular vector, optionally a plasmid. It may be double-stranded or single-stranded, for example double-stranded.

[0042] In an embodiment, the vector is a viral vector. The vectors include adeno-associated virus (AAV) vectors, chimeric AAV vectors, and adenovirus vectors. Viral vectors, retroviral vectors, lentiviral vectors, DNA viruses vector, herpes simplex virus vector, baculovirus vector, or any of them In an embodiment, the viral vector is a recombinant AAV The vector is optionally a self-complementary AAV (scAAV) vector. In the present invention, the viral vector is a recombinant AAV vector, optionally a single-stranded AAV (s In embodiments, the recombinant AAV vector is a sAAV (sAAV) vector. and optionally, the ITRs are AAV2 ITRs. Optionally, the AAV vector comprises two ITRs, and optionally two ITRs. includes SEQ ID NO: 12 and SEQ ID NO: 23.

[0043] In embodiments including any of the above aspects and embodiments, the vector may, for example, From to 3', Optionally modified to include a deletion of a terminal resolution site, optionally including SEQ ID NO: 12 ITRs, optionally AAV2 ITRs; A promoter, optionally a JeT promoter comprising or consisting of SEQ ID NO: 13 -; A nucleic acid molecule according to any one of embodiments 1 to 28; Optionally, a polyA signal comprising or consisting of SEQ ID NO: 22; and Optionally, an ITR comprising or consisting of SEQ ID NO: 23, optionally an AAV2 ITR Includes.

[0044] In one aspect, a recombinant virus comprising a nucleic acid or vector of any of the preceding aspects and embodiments. In an embodiment, the recombinant virus is an adeno-associated virus. AAV, chimeric AAV, adenovirus, retrovirus, lentivirus, D NA virus, herpes simplex virus, baculovirus, or any mutant thereof In an embodiment, the virus is AAV. AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAV11, AAV12, AAVrh8, AAVr h10, AAVrh36, AAVrh37, AAV-DJ, AAV-DJ / 8, AAV. Anc80, AAV.Anc80L65, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB and AAV-PHP AAV serotypes or variants thereof, e.g., combinations of capsids from multiple AAV serotypes. In embodiments, the AAV comprises one or more of the AAV9 capsid serotype or a combination thereof. and any mutant or derivative thereof. In an embodiment, the virus is, for example, are encoded by or correspond to SEQ ID NO: 74, SEQ ID NO: 75 and SEQ ID NO: 76, respectively. AAV9 caps comprising the amino acid sequences of SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, respectively. In an embodiment, the AAV comprises self-associated proteins VP1, VP2, and VP3. In embodiments, the AAV comprises a complementary AAV (scAAV) vector. (ssAAV) vectors.

[0045] In another aspect, a nucleic acid molecule, vector or composition according to any one of the preceding aspects and embodiments. Provided herein are cells containing the recombinant virus. In embodiments, the cells are human cells. In an embodiment, the cell is a neuron or an astrocyte.

[0046] In one aspect, a cell comprising a cell of any of the preceding cell aspects and embodiments is provided herein. wherein if the cells contain a splice regulator, e.g., LMI070, the protein of interest is expressed. The expression level of a protein is the level of the protein of interest when the cell does not contain the splice regulator. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or more times higher than the expression level is 100 times greater than the expression when the cell does not contain the splice regulator. The level is not detectable.

[0047] In one aspect, a cell comprising a cell of any of the preceding cell aspects and embodiments is provided herein. wherein if the cell does not contain a splice regulator, e.g., LMI070, the desired The expression level of the protein is determined by the expression level of the protein of interest when the cell contains the splice regulator. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or more times higher than the expression level is 100 times greater, and optionally, the expression level when the cell contains the splice regulator. The rule cannot be detected.

[0048] In one aspect, provided herein is a method for conditionally expressing a protein of interest, comprising: The method may include the nucleic acid molecule, vector, or recombinant virus of any of the previous aspects and embodiments.

[0033] In one embodiment, an expression system (e.g., a cell, e.g., a cell of any one of the preceding aspects and embodiments) is spun down. contacting the tissue with a tissue modulating agent, e.g., LMI070; In the presence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. The expression level of the protein of interest is increased relative to the expression level in the absence of the inhibitor, e.g., 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, or 100 times greater; and In the absence of the splice regulator, expression of the protein of interest is suppressed by splice regulation. the expression level of the protein of interest in the presence of the agent is substantially reduced, e.g., 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times smaller.

[0049] In one aspect, provided herein is a method for conditionally expressing a protein of interest, comprising: The method may include the nucleic acid molecule, vector, or recombinant virus of any of the previous aspects and embodiments.

[0033] In one embodiment, an expression system (e.g., a cell, e.g., a cell of any one of the preceding aspects and embodiments) is spun down. contacting the tissue with a tissue modulating agent, e.g., LMI070; In the absence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. The expression level of the protein of interest in the presence of a modulator is increased, e.g., 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, or 100 times greater; and In the presence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. is substantially reduced relative to the expression level of the protein of interest in the absence of, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times smaller.

[0050] In one aspect, the nucleic acid molecule, vector, recombinant virus of any of the preceding aspects and embodiments is Pharmaceutical compositions comprising the virus or cells are provided herein.

[0051] In one aspect, provided herein is a method of treating a subject in need of gene therapy, comprising: The method comprises the step of: In an embodiment, the method comprises administering cells or pharmaceutical compositions to said subject. Expression level of the protein of interest relative to the expression level of the protein of interest in the absence of the regulator at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or more is an amount of a splice regulator, e.g., LMI, effective to cause a 100-fold increase or decrease. 070 to the subject.

[0052] In one aspect, the nucleic acid molecule, vector, recombinant virus of any of the preceding aspects and embodiments. Kits are provided herein that include a gene, cell, or pharmaceutical composition and a splice regulator. .

[0053] In one embodiment, for use in a method for conditionally expressing a protein of interest, The nucleic acid molecule, vector, recombinant virus, cell or medicament of any of the preceding aspects and embodiments. A composition is provided herein, the method comprising the steps of any one of aspects 1-2 and 4-36. an acid molecule, a vector according to any one of embodiments 37 to 45, or a vector according to any one of embodiments 46 to 52 An expression system comprising a recombinant virus (e.g., a cell, e.g., a cell of any one of embodiments 53 to 57). contacting the cells with a splice regulator, e.g., LMI070; In the presence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. The expression level of the protein of interest is increased relative to the expression level in the absence of the inhibitor, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, or 100 times greater; and In the absence of the splice regulator, expression of the protein of interest is suppressed by splice regulation. The expression level of the protein of interest in the presence of the agent is substantially reduced, e.g., at least at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times smaller.

[0054] In one embodiment, for use in a method for conditionally expressing a protein of interest, The nucleic acid molecule, vector, recombinant virus, cell or A pharmaceutical composition is provided herein, and the method comprises administering to a subject a pharmaceutical composition comprising: the nucleic acid molecule of any one of embodiments 37 to 45 or the vector of any one of embodiments 46 to 52. An expression system (e.g., a cell, e.g., any one of embodiments 53 to 57) comprising one or more recombinant viruses. contacting the cells of the present invention with a splice regulator, e.g., LMI070; In the absence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. The expression level of the protein of interest in the presence of a modulator is increased, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, or 100 times greater; and In the presence of the splice regulator, expression of the protein of interest is inhibited by the splice regulator. The expression level of the protein of interest is substantially reduced relative to the level in the absence of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times smaller.

[0055] In one embodiment, for use in a method of treating a subject in need of gene therapy, The nucleic acid molecule, vector, recombinant virus, cell or medicament of any of the preceding aspects and embodiments. Compositions are provided herein.

[0056] In one aspect, the nucleic acid molecule, vector, recombinant virus of any of the preceding aspects and embodiments. A cell, a pharmaceutical composition or a nucleus for use according to any one of aspects 64 to 66. Provided herein are acids, vectors, recombinant viruses, cells, or pharmaceutical compositions, wherein The transgene is a gene encoding a genome editing system protein (e.g., Cas9 protein, zinc finger protein, etc.). RNA-guided nucleases such as RNA nucleases or TALENs), antibodies or antibodies Fragments or therapeutic proteins (e.g., progranulin, SMN, MeCP2, Selected from CLN2, CLN3, CLN4, CLN5, CLN6, CLN7, CLN8 It encodes a protein that [Brief explanation of the drawings]

[0057] [Figure 1-1] Figure 1: Figure 1A illustrates the concept of a splice regulator-mediated "on switch." In the on switch system, exon C contains a premature termination (stop) codon that is in frame with the coding sequence initiated by the start codon located in exon A when exon B is excluded. When a splice regulator such as LMI070 is included, the transcript now includes the frameshifted exon B, thereby restoring an uninterrupted open reading frame that leads to transgene expression. Figure 1B illustrates the concept of a splice regulator-mediated "off switch." In the off switch system, exon A is spliced ​​into exon C, leading to transgene expression. When a splice regulator such as LMI070 is present, exon B, which contains a premature termination (stop) codon, is included, resulting in translation termination. [Figure 1-2] (As mentioned above.) [Figure 2-1]Figure 2: Design of AAV vector harboring SNX7 minigene-based switch. Figure 2A shows the design of a splice regulator (LMI070) exon target binding site on chromosome:GRCh37:1:99204216:99204359:1 (AGTTTGCAAAGGAAGGAAAGGAGCAGAGACTTGAATGAGCAGAAAATCATTTCAGGGCCTGTTCTCTATGTCCTTGCTATCCCTGTCTTCTGTAGCTATTCTGAAACCATCAACAAAGGAGCACACCATTCCATCAGCAAAAGA (SEQ ID NO: 80)), as well as a splice regulator (LMI070) exon target binding site on chromosome:GRCh37:1:99203793:99203946:1 (CTTCCAGAGGAGATTGGAAAACTTGAAGATAAAGTGGAATGTGC 1 shows a schematic diagram of the SNX7 locus, including intronic sequence downstream of exon 8 at TAATAATGCCCTGAAAGCAGATTGGGAGAGATGGAAACAAAATATGCAAAATGATATCAAGTTAGCATTTACAGATATGGCTGAGGAGAATATCCATTATTATGAACAG (SEQ ID NO: 99)) and 21,251 nucleotides upstream of exon 9 at chromosome GRCh37:1:99225610:99225687:1 (TGCCTTGCTACGTGGGAGTCATTCCTTACATCACAGACCAACCTTCACTTGGAAGAAGCCTCTGAAGATAAACCTTAA (SEQ ID NO: 100)). Figure 2B shows the construction of a non-naturally occurring SNX7 minigene using exon 8 (referred to as exon A), a 270-nucleotide intron (AB), an exon containing a splice regulator (e.g., LMI070) binding site at its 3' end (referred to as exon B), a 407-nucleotide intron fragment (truncated from 21,251 nt; BC), and exon 9 (referred to as exon C).To improve the performance of the minigene, 1) a Kozak consensus sequence and ATG codon (GCCACCATG) was inserted at position 65 of exon A; 2) all other ATG sequences in the minigene were replaced with TTG; 3) TA at position 20 of exon A was replaced with AG to create the sequence GAAGAAGAA (SEQ ID NO: 69); 4) 1 nt was removed from exon B to create a frameshift in the ORF (number of nucleotides = 3n-1); 5) T was inserted at position 4 of exon C to create a frameshift in the ORF and obtain multiple stop codons; 6) TAC at position 9 of exon C was changed to TAA to create a premature stop codon; 7) CAG at position 34 of exon C was changed to ACC to mutate a possible cryptic splice site; 8) CTCT at position 60 of exon C was changed to TAGC to create Nhe Further modifications were made, including creating a 1) 1 restriction site; and 9) the TAA at the end of exon C was removed to create a continuous ORF. Figure 2C shows the construction of an scAAV vector containing the SNX7 minigene on-switch. The scAAV was generated by combining the AAV2 ITR containing the trs deletion, followed by the JeT promoter, followed by the SNX7 minigene (see Figure 2B above), followed by the coding sequence for a furin cleavage site (RNRR (SEQ ID NO: 39)) added to the end of exon C, followed by the coding sequence for the T2A peptide, followed by the transgene sequence (here, the coding sequence for EGFP without the first ATG), followed by the SV40 late polyadenylation signal, followed by the AAV2 ITR. [Figure 2-2] (As mentioned above.) [Figure 2-3] (As mentioned above.) [Figure 3-1] Figure 3: Regulation of GFP expression using an SNX7 minigene-based on-switch (Figure 3A) and off-switch (Figure 3B) and mRNA expression products in the absence of a splice regulator ("without LMI070") and in the presence of a splice regulator ("plus LMI070"). The figures disclose SEQ ID NOs: 108-111, respectively, in order of appearance. [Figure 3-2] (As mentioned above.) [Figure 4-1]Figure 4: Regulation of GFP expression by the SNX7 switch in HEK293 cells. Figure 4A shows GFP expression in HEK293 cells transfected with pSNX7-GFP (a vector containing an on-switch) at various concentrations of a splice regulator (LMI070). Figure 4B plots GFP expression measured by mean fluorescence intensity as a function of LMI070 concentration. Figure 4C plots quantification of mRNA transcripts containing exon B or with direct splicing from exon A to exon C at various concentrations of the splice regulator. [Figure 4-2] (As mentioned above.) [Figure 4-3] (As mentioned above.) [Figure 5-1] Figure 5: Regulation of GFP expression by the SNX7 switch in rat cortical neurons. Figure 5A shows the GFP expression levels of primary rat neurons transfected with pSNX7-GFP (a vector containing an on-switch) at various concentrations of a splice regulator (LMI070). Figure 5B plots the quantification of mRNA transcripts containing exon B or direct splicing from exon A to exon C at various concentrations of the splice regulator in rat cortical neurons. [Figure 5-2] (As mentioned above.) [Figure 6-1] Figure 6: AAV vector containing a human progranulin (PRGN) transgene under the control of the SNX7 on-switch. Figure 6A shows a schematic diagram of an ssAAV vector containing 1) a neuron-specific promoter (human synapsin promoter) and containing an SNX7 on-switch minigene. Figure 6B shows hPRGN expression in primary rat neurons transfected with the vector described in Figure 6A (Syn_SNX) in the presence or absence of a splice regulator, compared to hPRGN expression levels from a vector without an SNX7-based switch ("Syn"). Figure 6C shows mRNA expression levels of mRNAs containing exon B and mRNAs with direct splicing from exon A to exon C in the presence and absence of a splice regulator. [Figure 6-2] (As mentioned above.) [Figure 6-3] (As mentioned above.) [Figure 7-1] Figure 7: Figure 7A shows the study design for a time-course in vivo study of an AAV vector containing the SNX7 switch (version 1). Single-stranded AAV9 containing an hPGRN expression cassette under the control of the synapsin promoter with the SNX7 switch was injected intravenously in P0 neonatal mice. Four weeks later, mice were orally administered 30 mg / kg of LMI070 and sacrificed at different time points starting 24 hours after administration. Figure 7B demonstrates that oral administration of LMI070 turns on transgene expression in the mouse brain in a time-dependent manner in mice previously administered the AAV vector described in Figure 7A. The graph shows TR-FRET measurements of hPGRN expression in the brain at the indicated times after LMI070 delivery. [Figure 7-2] (As mentioned above.) [Figure 8-1] Figure 8: Figure 8A shows the study design for a dose-response in vivo study of an AAV vector containing the SNX7 switch (version 1). Single-stranded AAV9 containing an hPGRN expression cassette under the control of the synapsin promoter with the SNX7 switch was injected intravenously into P0 neonatal mice. Four weeks later, mice were orally administered different doses of LMI070 and sacrificed at different time points starting 12 hours after administration. Figure 8B demonstrates that oral administration of LMI070 dose-dependently turns on transgene expression in the mouse brain in mice previously administered the AAV vector described in Figure 8A. The graph shows TR-FRET measurements of hPGRN expression in the brain at the indicated doses of LMI070 and at the indicated times after LMI070 delivery. [Figure 8-2] (As mentioned above.) [Figure 9] 1 shows a comparison of the first version of the SNX7 minigene with a modified SNX7 minigene (version 2) that has reduced size and peptide expression in the absence of LMI070. The figure discloses SEQ ID NOs: 108 and 112-113, respectively, in order of appearance. [Figure 10]Figure 1 shows that the modified SNX7 minigene (version 2) is more sensitive in response to LMI070 than the previous version of the SNX7 minigene. DETAILED DESCRIPTION OF THE INVENTION

[0058] The disclosed compositions and methods are made in conjunction with the accompanying drawings, which form a part of this disclosure. This can be more readily understood by reference to the following detailed description.

[0059] Throughout this specification, the description refers to compositions and methods of using the compositions. If a patent discloses or claims features or embodiments relating to a composition, such features or embodiments The embodiments are equally applicable to methods or uses of the compositions. If a feature or embodiment relating to a method of using a composition is disclosed or claimed, such A feature or embodiment is equally applicable to a composition. Where a range of values ​​is expressed, it The ranges include embodiments using any specific value within the range. References to values ​​include every single value within that range. All ranges are inclusive of their endpoints. When values ​​are expressed as approximations, the antecedent "about" may be used. It will be understood that specific values ​​form alternative embodiments. A reference to includes at least that particular value unless the context clearly dictates otherwise. The use of "or" means "and / or" unless the specific context of its use dictates otherwise. All references cited herein are incorporated by reference for any purpose. In the event of a conflict between the reference and this specification, the specification will control. Therefore, the specific features of the disclosed compositions and methods disclosed herein in connection with separate embodiments are not intended to be limiting. It is to be understood that certain features may be provided in combination in a single embodiment. Conversely, for the sake of brevity, the disclosed compositions may be disclosed in the context of a single embodiment. The various features of the method may be provided separately or in any subcombination.

[0060] definition As used herein, the singular forms "a," "an," and "the" are used interchangeably. " includes the plural unless the context clearly dictates otherwise. Used in numerical and range contexts When used, the terms "about" or "approximately" are understood to be within the meaning of the teachings contained herein by those of ordinary skill in the art. As is apparent from the illustration, the values ​​described may be adjusted to suit the intended purpose of the embodiment. In some embodiments, the term "approximately" refers to a value or range that is close to or near a given value or range. Approximately means plus or minus 10% of the value.

[0061] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein; Refers to a polymeric form of nucleotides of any length. They consist of one or more ribonucleic acids. Thus, the term may include single-stranded, double-stranded, or deoxyribonucleotides. Stranded or multistranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or purine and pyrimidine bases or other natural, chemically or biochemically modified, Non-natural or derivatized nucleotide bases, such as locked nucleic acids (LNA), peptides, Examples of suitable nucleic acids include, but are not limited to, polynucleotides (PNAs).

[0062] The terms "peptide," "polypeptide," and "protein" are used interchangeably. refers to a compound composed of amino acid residues covalently linked by peptide bonds. A protein or peptide typically contains at least two amino acids or amino acid variants. However, there is no limit to the maximum number of amino acids that can make up a protein or peptide sequence. A peptide contains two or more amino acids or variants joined together by a peptide bond. These terms include, for example, any peptide or protein that is derived from a biological biologically active fragments, substantially homologous polypeptides, oligopeptides, and homodimers , heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins Polypeptides include natural peptides, recombinant peptides, and their derivatives. Combinations included.

[0063] The terms "sequence identity" and "sequence homology" are used interchangeably herein; When used in reference to a polynucleotide or polypeptide, the polynucleotide of the polypeptide When two sequences of a nucleic acid are compared or aligned, the amino acid sequences that are identical and in the same relative positions are Sequence identity refers to the percentage of residues or amino acids that are identical. Sequence identity can be determined in several different ways. For example, sequences can be synthesized using a variety of methods and computer programs (e.g., Aligned using BLAST, T-COFFEE, MUSCLE, MAFFT, etc. For example, Altschul et al. (1990) J. Mol. Biol. .,215:403-10.

[0064] The term "isolated" with respect to nucleic acids or proteins discussed herein means that the nucleic acid or protein is naturally A nucleic acid or protein that has been separated from one or more components normally found associated with it in the environment. Separation refers to the separation of a protein from a larger nucleic acid (e.g., from a gene or chromosome) or , including removal from other proteins or molecules in contact with the nucleic acid or protein. The term encompasses, but does not require, complete isolation.

[0065] As used herein, an isolated nucleic acid comprising a "heterologous nucleic acid sequence" refers to a nucleic acid that is not present in its natural context. In the present invention, the isolated nucleic acid is usually found operably linked to one or more other components of the isolated nucleic acid. refers to an isolated nucleic acid that contains a portion that is not expressed (i.e., a heterologous nucleic acid portion). The nucleic acid may be isolated from other components of the nucleic acid (e.g., promoter) as they are naturally occurring or Other components of the isolated nucleic acid (e.g., the promoter) may be present in a cell, bacterial cell, virus, or Operatively linked to heterologous nucleic acid not naturally found in an organism, such as a cell, bacterial cell, or In some embodiments, the nucleic acid sequence may include a nucleic acid sequence not originally found in the virus or organism. As used herein, a "transgene" refers to a nucleic acid that is naturally occurring in a host. is a molecule of interest (e.g., a therapeutic protein, A nucleic acid sequence encoding a target gene (e.g., a reporter protein or a therapeutic RNA molecule). In some embodiments, the heterologous nucleic acid sequence encodes a human protein. In the above, the heterologous nucleic acid sequence encodes an RNA sequence, for example, an shRNA.

[0066] A DNA sequence or DNA polynucleotide sequence that "encodes" a particular RNA is called an RNA A DNA polynucleotide is a sequence of DNA that can be transcribed into a protein. The DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or RNA that is not translated into protein (e.g., tRNA, rRNA, or guide RNA; "non- It can encode a DNA sequence or a DNA fragment (also called "coding RNA" or "ncRNA"). A polynucleotide sequence may also "encode" a particular polypeptide or protein sequence. For example, DNA can directly encode mRNA, which can be translated into a polypeptide or protein sequence. A "protein coding sequence" or a sequence that encodes a specific protein or polypeptide. The sequence, when placed under the control of appropriate regulatory sequences, can be used to produce mRNA in vitro or in vivo. A can be transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide. The boundaries of a coding sequence are the initiation codon at the 5'-terminus (N-terminus) and the 3'-terminus. The coding sequence may be determined by a translation termination nonsense codon at the C-terminus. cDNA from mRNA of organisms or eukaryotes, genome from DNA of prokaryotes or eukaryotes These sequences may include, but are not limited to, human DNA sequences and synthetic nucleic acids. It is usually located 3' to the coding sequence.

[0067] As used herein, the term "promoter" or "promoter sequence" downstream (3' direction) coding or of a non-coding sequence, operably linked coding or non-coding sequence capable of promoting transcription (e.g., capable of causing detectable levels of transcription) and / or detectable levels of transcription above those provided in the absence of a promoter. In some embodiments, the promoter is a DNA regulatory sequence that can increase transcription. The promoter sequence is bounded at its 3' end by the transcription start site and The minimum number of salts required to elongate and initiate transcription at levels detectable above background. In some embodiments, the promoter sequence comprises a transcription initiation site. It may contain a transcription site as well as a protein binding domain involved in the binding of RNA polymerase. In addition to sequences sufficient to initiate transcription, promoters contain other regulatory sequences involved in the regulation of transcription. It may also include sequences of elements (eg, enhancers, Kozak sequences, and introns). A variety of promoters, including inducible and constitutive promoters, may be used to produce the present invention. In some embodiments, such as the vectors disclosed herein, Examples of promoters known in the art that can be used in viral vectors include: CMV promoter, CBA promoter, smCBA promoter and immunoglobulin promoters derived from genes, SV40 or other tissue-specific genes (e.g., RLBP 1, RPE, VMD2). Additionally, known regulatory elements can be mixed and matched to Standard techniques are known in the art for generating functional promoters by Promoter fragments, e.g., detectable levels above background Those that retain at least the minimum number of bases or elements to initiate transcription at It is possible.

[0068] In some embodiments, the promoter is a constitutively active promoter (i.e., promoters that drive constitutive expression in any cell type and / or under any conditions. In other embodiments, the promoter may be associated with a particular tissue, e.g. It can be a promoter that is constitutively active in neurons, cardiac cells, etc. In this state, the promoter is an inducible promoter (i.e., its activity is regulated by an external stimulus, e.g., promoters controlled by a particular temperature, compound, or the presence of a protein. In some embodiments, the promoter is selected from the physical context in which the promoter is found. Spatially restricted promoters that can drive activity or not depending on the context Non-limiting examples of spatially restricted promoters include tissue-specific promoters. In some embodiments, promoters include promoters, cell type specific promoters, and the like. The promoter is a temporally restricted promoter that drives expression depending on the temporal context in which it is found. For example, a temporally restricted promoter can be a promoter that is expressed during embryonic development. They may drive expression only at specific stages or in specific stages of a biological process. Non-limiting examples of promoters include the mouse hair follicle cycle promoter.

[0069] In some embodiments, the promoter is They are tissue-specific, driving expression only in specific subsets of cells, e.g. Tissue-specific promoters include neuron-specific promoters, adipocyte-specific promoters, and promoter, cardiomyocyte-specific promoter, smooth muscle-specific promoter, photoreceptor-specific promoter Neuron-specific promoters include, but are not limited to, For example, in the periphery, when administered directly to the central nervous system (CNS), or in vitro, ex vivo When delivered to neural cells, including in vivo or in vivo, compared to expression in non-neuronal cells, In neurons, operably linked heterologous nucleic acids, e.g., proteins or peptides of interest, refers to a promoter that preferentially drives or regulates the expression of a gene encoding a gene or shRNA. vinegar.

[0070] The terms "DNA regulatory sequence," "control element," and "regulatory element" are used interchangeably herein. The term "element" refers to a non-coding sequence (e.g., a short hairpin RNA) or a coding sequence. provide and / or regulate transcription of a sequence (e.g., PGRN) and / or encode a polypeptide Regulating peptide translation: promoters, enhancers, silencers, polyadenylation Refers to transcriptional and translational control sequences such as signals, terminators, and proteolytic signals .

[0071] The terms "polyadenylation (polyA) signal sequence" and "polyadenylation sequence" , a sequence for transcription termination and addition of a homopolymeric adenosine chain to the 3' end of an RNA transcript. A polyadenylation signal refers to a regulatory element that provides a signal to terminate a gene. AAUAAA sequence or other non-standard sequence) and optionally adjacent auxiliary elements. nucleotides (e.g., GU-rich elements) and / or those involved in efficient cleavage and polyadenylation. The polyadenylation sequence may contain other elements that contribute to the synthesis of mRNA by polyadenylation. A particular poly A signal sequence may comprise a series of adenosines attached to the 3' end of the sequence In some embodiments, the poly(A) signal may include the poly(A) signal of SEQ ID NO: 22 or SEQ ID NO: 89. Thus, the DNA regulatory sequences or control elements are tissue-specific regulatory sequences.

[0072] The term "post-transcriptional regulatory element" ("PRE") refers to a gene that, once transcribed into mRNA, It refers to one or more regulatory elements that regulate gene expression at the level of the RNA transcript. Examples of such post-transcriptional regulatory elements include microRNA binding sites, RNA-binding proteins, and The nucleic acid molecules and vectors disclosed herein may include sequences encoding binding sites, etc. Examples of post-transcriptional regulatory elements that can be used in conjunction with the woodchuck hepatitis post-transcriptional regulatory element include Exemplary Ps include the hepatitis post-transcriptional regulatory element (WPRE), and the hepatitis post-transcriptional regulatory element (HPRE). The RE may also include the PRE disclosed as SEQ ID NO: 88. Examples of PREs include the PRE disclosed as SEQ ID NO: 7 2 or the PRE disclosed as SEQ ID NO: 73.

[0073] The term "intron" refers to a polypeptide transcript (e.g., a portion of a polypeptide) expressed from a nucleic acid. does not encode one or more amino acids of a protein (e.g., an open reading frame) Introns refer to nucleic acid sequences within a genome. Intron sequences can be transcribed from DNA into RNA (i.e., (i.e., pre-mRNA) before the protein is expressed from the mature mRNA, e.g., For example, it can be removed by splicing.

[0074] The term "exon" refers to a transcript (e.g., a protein of interest) expressed from a nucleic acid. a nucleic acid sequence encoding one or more amino acids of, e.g., refers to a nucleic acid sequence. An exon sequence can be transcribed from DNA into RNA (i.e., pre-mRNA). A), and the mature mRNA that is translated into a polypeptide (i.e., the RNA protease). It may be present in a cleaved form (e.g., after splicing).

[0075] As used herein, a process performed "in vitro" refers to a process carried out in a normal biological Processes carried out outside the environment, e.g., in test tubes, flasks, petri dishes, artificial media A process carried out "in vivo" refers to a process carried out within an organism or cell. refers to studies performed in cell culture or mice. Studies conducted in or on tissues from organisms in external environments, e.g., altering natural conditions, Minimally, and under more controlled conditions than may be possible in, for example, in vivo experiments. Or refers to research that allows for the manipulation of tissues.

[0076] For example, the term "natural" as used herein applies to a nucleic acid, polypeptide, cell, or organism. The term "naturally occurring" or "unmodified" refers to something found in nature. A polypeptide or polynucleotide sequence present in an organism (such as a virus) is a sequence that is present in that organism. A naturally occurring substance is a substance that is present in a living organism or is isolated from one or more components of an organism.

[0077] In some embodiments, a "vector" is a vector that can be used to express a vector in a host cell, e.g., a plasmid, a phage, Cells, tissues and / or organisms such as transposons, cosmids, chromosomes, viruses, virions The nucleic acid of interest can be expressed within a larger nucleic acid sequence or construct suitable for delivery to a subject. , any genetic element (e.g., DNA) containing a nucleic acid of interest (e.g., a transgene) For example, a vector can contain an insert (e.g., a nucleic acid sequence to be expressed). A transgene encoding a gene or an open reading frame of that gene is included. heterologous nucleic acid) and one or more additional elements, such as the minigenes and and / or may contain elements suitable for delivering or controlling the expression of the insert. is capable of replication and / or expression, for example, when associated with the appropriate regulatory elements. It may be possible for the cells to transfer genetic information between cells. In embodiments, the vector is a vector suitable for expression in a host cell, such as an AAV vector. In some embodiments, the vector can be, for example, a cell or a biosensor. The plasmid may be suitable for expression and / or replication in a reactor. In embodiments, a heterologous nucleic acid sequence, e.g., a protein of interest, shRNA, in a target cell is expressed. Vectors specifically designed for the expression of transgenes encoding, for example, These may be referred to as vectors, and generally have a promoter sequence that drives expression of the transgene. In some forms, vectors, such as transcription vectors, are capable of being transcribed but not translated. They may be replicated in the target cell but not expressed. A transcription vector can be used to amplify the insert.

[0078] The term "expression vector" refers to a vector that contains a nucleotide sequence operably linked to be expressed. An expression vector refers to a vector containing a polynucleotide that includes an expression control sequence. It is combined with other elements for expression supplied by the host cell or in an in vitro expression system. Together, they may contain sufficient cis-acting elements for expression. For example, cosmids, plasmids (e.g., naked or contained in liposomes) and recombinant Viruses incorporating the polynucleotide (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses).

[0079] The term "plasmid" refers to an intact "receptor" that allows a plasmid to replicate within a host cell. A plasmid is a non-chromosomal (and typically double-stranded) DNA sequence that contains a "precon." When a plasmid is placed in a unicellular organism, the DNA of the plasmid As a result, the characteristics of the organism are changed or transformed. For example, tetracycline resistance ( Plasmids carrying the gene for TcR induce tetracycline-sensitive cells The viral vectors disclosed herein convert the cells to be resistant to tetracycline. An exemplary plasmid useful in some embodiments of the present invention includes SEQ ID NO: 92. can be.

[0080] As used herein, the term "recombinant virus" refers to a virus that is capable of expressing a transgene or other heterologous gene. Non-wild-type and / or artificially produced recombinant viruses (e.g., parvovirus) containing seed nucleic acids Recombinant viruses include viruses, adenoviruses, lentiviruses, and adeno-associated viruses. The virus may be a recombinant virus packaged within a viral (e.g., AAV) capsid. viral genomes (including, for example, minigenes and transgenes described herein) A particular type of recombinant virus is the "recombinant adeno-associated virus" or "rAAV." The recombinant viral genome packaged in the viral capsid can be used as a viral In some embodiments, the recombinant virus disclosed herein may be a vector. The vectors include viral vectors (e.g., vectors that contain minigenes and transgenes of interest, e.g., the present invention). Examples of viral vectors include adeno-associated viruses (AA). V) Vectors, chimeric AAV vectors, adenovirus vectors, retrovirus vectors -, lentiviral vector, DNA viral vector, herpes simplex viral vector , baculovirus vectors or their variants or derivatives. It will not be done.

[0081] In another embodiment, the term "transfection" refers to the transfer of exogenous DNA to a cell. The transfer of foreign DNA by cells such that, when introduced into their membranes, the cells are "transfected" Used to refer to uptake. For example, Graham et al., (1973) Virology,52:456;Sambrook et al.,(1989)Mo lecular Cloning,a laboratory manual,Cold Spring Harbor Laboratories,New York;Dav is et al.,(1986)Basic Methods in Molecule ar Biology,Elsevier;Chu et al.,(1981)Gen See, e.g., 13:197. Using such techniques, one or more exogenous DNA The portion can be introduced into a suitable host cell. The term "introduction" is used to refer to the uptake of foreign DNA by a cell, and is provided by a virus or viral vector, so that the exogenous DNA is not introduced into the cell. Once introduced into the membrane, the cell is "transformed." The term "transformation" is used to refer to the uptake of foreign DNA by bacterial cells.

[0082] As used herein, the term "cell line" refers to a continuous or long-term in vitro A clonal population refers to a population of cells capable of clonal growth and division. In certain circumstances, such a clonal population Spontaneous or induced changes in the karyotype may occur during storage or transfer of the Cells derived from the cell line being examined may not be exactly identical to the ancestral cells or cultures. and the cell lines mentioned contain such mutants.

[0083] The term "operably linked" refers to two or more polynucleotides (e.g., DNA) A) refers to the functional relationship between segments. Typically, this term refers to the relationship between a transcriptional regulatory sequence and a transcribed sequence. For example, a promoter or enhancer sequence may be associated with, e.g., if it stimulates or modulates transcription of a coding sequence in an appropriate host cell or other expression system , operably linked to the coding sequence. Generally, a promoter operably linked to the sequence - The transcriptional regulatory sequence may be adjacent to the sequence or separated by a short spacer sequence. However, some transcription factors, such as enhancers, are Transcriptional regulatory sequences need not be physically contiguous, but may be adjacent to the coding sequence whose transcription is enhanced. It is not necessary for the devices to be arranged in a specific order.

[0084] As used herein, the term "AAV vector" includes AAV-1, AAV- 2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8 or A adeno-associated virus serotypes, including but not limited to AV-9 viral vectors AAV vector refers to a vector derived from or containing one or more nucleic acid sequences derived from The target may be, for example, a whole or partial fragment thereof, while retaining functional flanking inverted terminal repeat ("ITR") sequences. One or more AAV wild-type genes, with portions, e.g., the rep and / or cap genes, deleted In some embodiments, the AAV vector may comprise, for example, one or more AAV It can be packaged in a protein shell or capsid, which contains capsid proteins. , which may provide a vehicle for delivery of the vector nucleic acid to the nucleus of the target cell. In embodiments, the AAV vector contains one or more AAV ITR sequences (e.g., AAV 2 ITR sequences). In some embodiments, the AAV vector comprises one or more AAV ITR sequences (e.g., AAV2 ITR sequences), but additional viral nucleic acid sequences In some embodiments, the AAV vector components (e.g., ITRs) rAAV capsid is derived from a virus of a different serotype (e.g., AAV vectors The AAV vector may contain ITRs from AAV2, and may be packaged in an AAV9 capsid. (Embodiments of these vector constructs are described, for example, in WO 2014 / 014994. 9 / 094253 (PCT / US Patent Application Publication No. 2018 / 058744 No. 6,299,499, which is incorporated herein by reference in its entirety.

[0085] In some embodiments, "scAAV" refers to a self-complementary adeno-associated virus (sAAV). At least a portion of the vector of scAAV (e.g., a small portion of the coding region) scAAV is called "self-complementary" because at least some of the fragments form intramolecular double-stranded DNA. In some embodiments, the rAAV is a scAAV. In this study, viral vectors were engineered from naturally occurring adeno-associated viruses (AAVs). These vectors are used to provide scAAVs for use in gene therapy. Embodiments of the products and methods for preparing and purifying them are described, for example, in the entirety of this application, which is incorporated by reference. WO 2019 / 094253 (PCT / USA) incorporated herein by reference Patent application publication no. 2018 / 058744.

[0086] In some embodiments, "ssAAV" refers to a single-stranded adeno-associated virus (ssAAAV). V). At least a portion of the ssAAV vector (e.g., at least a portion of the coding region) ssAAV is called "single-stranded" because most of the DNA is single-stranded. In some embodiments, the rAAV is a ssAAV. Vectors are engineered from naturally occurring adeno-associated viruses (AAVs) and used in gene therapy. The present invention provides ssAAVs for use in

[0087] As used herein, "virus" or "virion" refers to, for example, a viral vector. For example, alone or in combination with one or more additional components, such as one or more viral capsids. For example, an AAV virus refers to a virus particle that contains, for example, an AAV capsid. It may comprise a linear, single-stranded AAV nucleic acid genome associated with a protein coat.

[0088] In some embodiments, "virus," "virion," "AAV virus," "recombinant AAV virion," "rAAV virion," "AAV vector particle," "complete capillary The terms "particle," "intact particle," and the like refer to an infectious, replication-defective virus, e.g., a single-stranded virus. or a viral vector flanked on both sides by AAV ITRs, rAAV refers to a virus containing an AAV protein shell that encapsidates the virion sequence. The vector may contain one or more plasmids specifying sequences, e.g., AAV vectors, either alone or in combination (e.g., AAV helper functions and accessory functions (e.g., on the same or additional plasmids) and producing the protein in a suitable host cell containing the protein in combination with a nucleic acid encoding the protein (e.g., a ribonucleotide fragment). In some embodiments, the host cell is transfected with AAV for subsequent gene delivery. The vector (containing the recombinant nucleotide sequence of interest) is packaged into infectious recombinant virion particles. The AAV polypeptides that provide the desired binding are then encoded. .

[0089] The term "inverted terminal repeat" or "ITR" refers to the nucleotide sequence of an antibody that binds to an antibody molecule, such as an antibody that binds to an antibody molecule ... ) and / or recombinant adeno-associated viral vectors (rAAV), It refers to a series of nucleotide sequences that can form a homeotropic structure. t al.,(2001)Fields Virology,Chapter 29,L ippincott Williams & Wilkins. Recombinant AAV vectors include: These sequences may play a functional role in genome packaging and second strand synthesis. do.

[0090] The term "host cell" refers to a cell that contains an exogenous nucleic acid of interest, e.g., one or more microorganisms, yeast cells, This refers to cells, including insect cells or mammalian cells. For example, the host cell may contain an AAV helper Constructs, AAV vectors, plasmids, accessory function vectors and / or other transfectants The term includes the progeny of the original cell that was transfected. The progeny of a single parent cell may differ in morphology or genomics due to natural, accidental, or deliberate mutation. Or the entire DNA complement may not necessarily be completely identical to the original parent.

[0091] The term "AAV helper functions" refers to the functions of AAV gene products (e.g., AAV gene products) that are involved in productive AAV replication. AAV-derived code that can be expressed to provide a For example, AAV helper functions include the major AAV open reading frame. The Rep expression product may include, inter alia, Recognition, binding, and nicking of the AAV origin of DNA replication; DNA helicase activity; and AA It has been shown to have many functions, including regulating transcription from V (or other heterologous) promoters. The Cap expression product provides the necessary packaging functions. Transfection of AAV functions missing from AAV vectors using AAV helper functions can be complemented.

[0092] The term "AAV helper construct" generally refers to an AAV vector that has been deleted from an AAV vector. a nucleic acid comprising a nucleotide sequence that provides or encodes a protein or nucleic acid that provides a V function refers to a vector for delivery of a molecule, e.g., a nucleotide sequence of interest, to a target cell or tissue. AAV helper constructs are used to complement missing AAV functions for AAV replication. Commonly used to provide transient expression of AAV rep and / or cap genes for Typically, the helper construct lacks the AAV ITRs and does not replicate or package itself. AAV helper constructs can be plasmids, phages, transposons, and cos The vector may be in the form of a mide, virus, or virion. Many commonly used plasmids, such as pAAV / Ad and plM29+45, AAV helper constructs have been disclosed, e.g., Samulski et al., ( 1989) J. Virol.,63:3822-3828;McCarty et al. ., (1991) J. Virol., 65:2936-2945. Rep Many other vectors encoding Cap and / or Cap expression products have been disclosed, for example: See U.S. Patent Nos. 5,139,941 and 6,376,237 Embodiments of these vector constructs and methods for preparing and purifying them are described in, e.g., , International Publication No. WO 2019 / 094253, which is incorporated herein by reference in its entirety. The patent application is provided in the patent brochure (PCT / US Patent Application Publication No. 2018 / 058744). do.

[0093] A "minigene," as the term is used herein, is a gene encoding multiple introns and exons. and at least one splice regulator binding site. In this case, the presence or absence of a splice regulator during expression from a heterologous nucleic acid sequence determines the maturation of the mRNA. Minigenes are described more fully herein.

[0094] A "splice regulator" binds to a splice regulator binding site and binds to a pre-mRNA molecule, e.g. For example, to regulate the splicing of pre-mRNA molecules produced from the nucleic acid molecules described herein. In embodiments, the splice regulator is a molecule that modifies the end of a mature mRNA molecule. In another embodiment, the splice regulator increases the inclusion of the chthon in the mature mRNA. Reduces inclusion of exons in the molecule.

[0095] A "splice regulator binding sequence" is a nucleic acid sequence recognized by a splice regulator. This term refers to the sequence found in pre-mRNA and the DNA from which the pre-mRNA is produced. It should be understood that the present invention includes both sequences found in the supramolecular structure. The splice regulator is a compound described herein, e.g., LMI070, The binding site comprises the sequence AGA. In embodiments, the splice regulator binding site comprises, for example, For example, it is placed at or near the 3' end of an exon of the minigene described herein.

[0096] "Pre-mRNA" is a protein that has not undergone further processing, e.g., splicing. of RNA produced by transcription of DNA (e.g., of a nucleic acid molecule described herein). The first form is the pre-mRNA, which contains both introns and exons. The pre-mRNA molecule is further processed, for example through splicing, to produce a "mature" The resulting product forms "RNA" or "mRNA."

[0097] The nucleic acid sequences, minigenes, vectors and methods disclosed herein are directed to minigenes and pre- Regulatable expression systems containing minigenes, such minigenes for controlling transgene expression, Use of splice regulators in combination with genes and expression systems, other uses and combinations thereof For example, (1) driving expression of the transgene sequence in the presence of a splice regulator to induce splicing those that decrease expression of the transgene sequence in the absence of the splice-regulating agent (on switch); and (2) driving expression of the transgene sequence in the absence of a splice regulator, thereby inhibiting splice regulation. It is also related to a gene that reduces the expression of the transgene sequence in the presence of a modulator (off switch). For example, the nucleic acid sequences, vectors, and methods disclosed herein can be used to transduce human leukemia in a splice regulator-dependent manner. The gene may drive expression of PGRN or other therapeutic protein sequences.

[0098] nucleic acid molecule 1. The transgene is operably linked to a minigene, e.g., as described herein. a nucleic acid molecule containing a transgene encoding a molecule of interest (e.g., a protein of interest) Disclosed herein are:

[0099] Minigene The nucleic acid molecules and other aspects disclosed herein include minigenes. The minigene is shown in Figure 1A (on switch) and Figure 1B (off switch). A nucleic acid sequence containing an intron and an exon and at least one splice regulator binding site. Disclosed herein are minigenes that are sequences. In embodiments, the minigenes are The minigenes described herein are operably linked to one or more splices. used in conjunction with a gene regulator to regulate the expression of a molecule of interest from a transgene associated with a minigene. To control (e.g., turn on or off).

[0100] In one embodiment, the minigene comprises: first exon; first intron; second exon a second intron; and a third exon, wherein the second exon is a splice-integrated exon. and in the presence of a splice regulator, the second exon is linked to the m of the nucleic acid. in the RNA product, and in the absence of the splice regulator, the second exon , not contained in the mRNA product of the nucleic acid.

[0101] In one embodiment, the third exon of the minigene is produced in the absence of a splice regulator. in-frame in the mRNA product of the nucleic acid and in the presence of a splice regulator The nucleic acid produced contains a stop codon that is not in frame in the mRNA product. Thus, in the absence of a splice regulator, exons containing, for example, in-frame stop codons A molecule of interest placed downstream of the minigene for premature termination of translation by inclusion of Splice regulation while reducing translation of the coding sequence (e.g., protein of interest) In the presence of the agent, the stop codon is out of frame, resulting in increased translation of the molecule of interest. Thus, such embodiments may be used in which the presence of a splice regulator "turns on" expression of the molecule of interest. Because they increase (e.g., increase) the expression of a gene, they are referred to herein as "on-switch" minigenes.

[0102] In another embodiment, the second exon is a nucleic acid sequence produced in the presence of a splice regulator. It contains a stop codon that is in-frame in the mRNA product of the gene. In the presence of a transcription regulator, an exon containing a stop codon is included in the transcript, and the downstream Decreased translation of sequences encoding molecules of interest (e.g., proteins of interest) placed in On the other hand, in the absence of splice regulators, exons containing stop codons are not present in mRNA. Thus, such an embodiment is advantageous in that it does not involve the use of splice regulators, resulting in increased expression of the molecule of interest. The presence of "turns off" (e.g., reduces) the expression of a molecule of interest, and therefore It is called an "off switch" minigene.

[0103] Without being bound by theory, as used herein, a vector is defined as a vector having limited coding capacity. They can have power (i.e., in order to be functional, their size can be limited) Therefore, less than 2000, less than 1900, less than 1800, less than 1700 , less than 1600, less than 1500, less than 1400, less than 1300, less than 1200, 1100 Less than, less than 1000, less than 900, less than 800, less than 700, less than 600 or less than 500 Minigenes containing from about 2500 to about 500 nucleotides are contemplated herein. nucleotides, for example, about 2000 to about 600 nucleotides, for example, about 1500 to about 700 nucleotides nucleotides, for example, about 1200 to about 800 nucleotides, for example, about 1100 to about 900 nucleotides Minigenes containing nucleotides are also contemplated herein. A minigene having such a length can be included in a vector containing a transgene, and the resulting vector The vector is, for example, of an appropriate size to function in the host cell. Thus, the sequences of the minigene are of human origin or are derived from sequences of human origin. Reference sequences of human origin identified as containing a sequence-modulating agent binding sequence are included within the long sequences contemplated herein. If the sequence is longer than 100 kJ, such a sequence may be deleted, for example, by deleting intron or exon sequences. This can be shortened by, for example,

[0104] In embodiments, the minigenes described herein may be further modified. The modifications are designed to improve one or more properties of the minigene. Sequences derived from the genome sequence can be included in a minigene and further modified to include one or more starter sequences. Mutate or remove codons (e.g., ATG sequences); Remove or mutate splice acceptor or splice donor sequences; one or more , for example, 2, 3, 4, 5 or 6 GAA repeats (SEQ ID NO: 101) For example, GAAGAAGAA: including SEQ ID NO: 69); Kozak sequences (e.g., GCC ACC: Kozak sequence of SEQ ID NO: 70); or any combination of modifications thereof can be carried out.

[0105] Splice regulator binding sequences An embodiment of the present invention is a recombinant protein comprising at least one exon containing a splice regulator binding sequence. In one embodiment, the splice regulator binding sequence is located in an exon of the minigene. In one embodiment, the splice regulator binding sequence is located at or near the 3' end of Located at the 3' end of the exon of the minigene. The sites are derived from sequences in the human genome. The methods described herein are, for example, and used to identify splice regulator binding sites recognized by splice regulators. Table 1 below shows the splice regulator binding sites (e.g., sequences) at the 3' end of the exon. Exemplary sequences of exons containing such splice regulator binding sites are listed below. The sequence is recognized by the splice regulators described herein, such as LMI070. 2 shows the design of the minigene derived from SNX7.

[0106] [Table 1]

[0107] SEQ ID NO: 80 is located between exons 8 and 9 of the snx7 locus containing SEQ ID NO: 1. The full-length genomic sequence (144 nt) of the potential exon containing the splice regulator binding site was be. [ka]

[0108] SEQ ID NO: 16 is derived from SEQ ID NO: 80 and modified to create a frameshift in the ORF. The gene has been modified to remove the start codon to avoid leakage of expression. [ka]

[0109] In an embodiment, the minigene is any of SEQ ID NO: 1 to SEQ ID NO: 10 or SEQ ID NO: 80. In an embodiment, the exon sequence from one of the exons, e.g., the second exon sequence, is The exons of the minigene, for example the second exon, are SEQ ID NO: 1 to SEQ ID NO: 10 or SEQ ID NO: In some embodiments, the present invention The minigenes described herein are SEQ ID NO: 1 or at least 90%, 95%, 90% or 95% of the sequences thereto. a sequence having 7%, 98% or 99% identity; or a sequence having 7%, 98% or 99% identity to the nucleotide sequence of SEQ ID NO: 1 At least 50%, at least 60%, at least 70%, at least 80%, at least or a fragment of SEQ ID NO: 1 that contains 90%, 95%, 97%, 98% or 99% of the sequence. or an exon consisting thereof, e.g., the second exon. The minigenes described herein are those having a sequence similar to SEQ ID NO:2 or at least 90%, 95%, or 97%, 98% or 99% identity; or a sequence having the nucleotide sequence of SEQ ID NO: 2. At least 50%, at least 60%, at least 70%, at least 80%, A fragment of SEQ ID NO: 2 comprising at least 90%, 95%, 97%, 98% or 99% of In some embodiments, the exon comprises or consists of an exon, such as a second exon. In the present specification, the minigene is a sequence similar to SEQ ID NO: 3 or at least 90% similar thereto. a sequence having 95%, 97%, 98% or 99% identity; or a sequence having 95%, 97%, 98% or 99% identity to the sequence of SEQ ID NO: 3 At least 50%, at least 60%, at least 70%, at least 80% of the nucleotides %, at least 90%, 95%, 97%, 98% or 99% of a fragment of SEQ ID NO: 3 In some embodiments, the exon comprises or consists of an exon, such as a second exon. In some embodiments, the minigenes described herein may comprise at least one sequence similar to SEQ ID NO: 4 or a sequence similar to SEQ ID NO: 5. a sequence with 90%, 95%, 97%, 98% or 99% identity; or SEQ ID NO: At least 50%, at least 60%, at least 70%, at least SEQ ID NO: 4, which contains at least 80%, at least 90%, 95%, 97%, 98% or 99% of the exons, such as the second exon, that comprise or consist of a fragment of In some embodiments, the minigene described herein comprises SEQ ID NO: 5 or a sequence similar to SEQ ID NO: 6. a sequence having at least 90%, 95%, 97%, 98% or 99% identity; or at least 50%, at least 60%, at least 70% of the nucleotides of SEQ ID NO: 5 , including at least 80%, at least 90%, 95%, 97%, 98% or 99% An exon comprising or consisting of a fragment of SEQ ID NO: 5, e.g., the second exon In some embodiments, the minigene described herein comprises SEQ ID NO:6 or its equivalent. have at least 90%, 95%, 97%, 98% or 99% identity to or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 95%, 97%, 98% or 9 9% of the exon, e.g., the second exon, comprising or consisting of a fragment of SEQ ID NO: 6 In some embodiments, the minigenes described herein comprise exons of SEQ ID NO: No. 7 or at least 90%, 95%, 97%, 98% or 99% identical thereto or a sequence having at least 50%, at least 60%, or %, at least 70%, at least 80%, at least 90%, 95%, 97%, 98% or 99% of an exon comprising or consisting of a fragment of SEQ ID NO: 7, e.g. For example, the second exon. In some embodiments, the minigenes described herein is SEQ ID NO: 8 or at least 90%, 95%, 97%, 98% or 99% of the sequence a sequence having at least 9% identity to SEQ ID NO: 8; or a sequence having at least 50%, at least At least 60%, at least 70%, at least 80%, at least 90%, 95%, 97% %, 98% or 99% of the fragment of SEQ ID NO: 8 In some embodiments, the present invention includes a second exon, such as a nucleotide sequence of the first exon, a nucleotide sequence of the second exon, or a nucleotide sequence of the second exon. The minigene is SEQ ID NO: 9 or at least 90%, 95%, 97%, 98% or a sequence having 99% identity; or a sequence having at least 5 of the nucleotides of SEQ ID NO: 9 0%, at least 60%, at least 70%, at least 80%, at least 90%, 9 or a fragment of SEQ ID NO: 9 comprising 5%, 97%, 98% or 99% of the sequence In some embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising the steps of: The minigene described herein is SEQ ID NO: 10 or at least 90%, 95%, 96%, or 100% identical thereto. a sequence having 7%, 98% or 99% identity; or the nucleotide sequence of SEQ ID NO: 10 At least 50%, at least 60%, at least 70%, at least 80%, Fragments of SEQ ID NO: 10 comprising 90%, 95%, 97%, 98% or 99% of In some embodiments, the exon comprises or consists of an exon, such as a second exon. In the minigene described herein, the sequence of SEQ ID NO: 80 or at least 9 sequences thereto a sequence with 0%, 95%, 97%, 98% or 99% identity; or SEQ ID NO:8 At least 50%, at least 60%, at least 70%, at least SEQ ID NO: 8, which contains at least 80%, at least 90%, 95%, 97%, 98% or 99% of the exons, such as the second exon, that comprise or consist of a fragment of exon 0. In some embodiments, the minigene described herein comprises SEQ ID NO: 16 or a counterpart thereof. a sequence having at least 90%, 95%, 97%, 98% or 99% identity to the sequence; Alternatively, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, 95%, 97%, 98% or 99% an exon comprising or consisting of a fragment of SEQ ID NO: 16, including the second exon In an embodiment, the second exon consists of SEQ ID NO: 16.

[0110] In some embodiments, the second exon is selected from the group consisting of 3n-1 nucleotides. where n is any integer, resulting in the inclusion of a second exon in the mRNA. , resulting in a frameshift to an mRNA that does not contain the second exon.

[0111] Splice regulators "Splice regulators," as the term is used herein, are agents that inhibit alternative splicing. In an exemplary embodiment, a splice regulator refers to a compound that can mediate Modulating (e.g., increasing) the inclusion of an exon in the mRNA product. In some embodiments, the splice regulator comprises a splice regulator binding sequence (e.g., the sequence AGA, For example, by binding to the sequence AGA at the 3' end of the modified exon, mRNA production Modulate (e.g., increase) exon inclusion in a gene.

[0112] In an embodiment of the invention, the splice regulator is a compound described herein. In embodiments of the splice regulator, the splice regulator has the formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein A' is a C1-C4 alkyl and wherein: Two C1-C4 alkyl groups combine with the atoms to which they are attached to form 5-6 oxo, oxime and hydroxy, halo C1-C4 alkyl, dihalo C 1-C4 alkyl, trihalo C1-C4 alkyl, C1-C4 alkoxy, C1-C4 alkyl Alkoxy-C3~C7 cycloalkyl, halo C1~C4 alkoxy, dihalo C1~C4 alkyl Alkoxy, trihalo C1-C4 alkoxy, hydroxy, cyano, halogen, amino, C1-C4 alkylamino, heteroaryl, hydroxy-substituted C1 ~C4 alkyl and aryl, amino, -C(O)NHC1~C4 alkyl-heteroaryl -NHC(O)-C1-C4 alkyl-heteroaryl, C1-C4 alkylC( O)NH-heteroaryl, C1-C4 alkylNHC(O)-heteroaryl, 3-7 5- to 7-membered cycloalkyl, 5- to 7-membered cycloalkenyl, or S, O, and N C1-C4 alkoxy groups substituted with 5-, 6-, or 9-membered heterocyclic rings containing 1 or 2 heteroatoms and substituted with 0 or 1 substituents selected from 5, koxy, having 6 or 9 ring atoms and 1, 2 or 3 ring heteroatoms selected from N, O and S; , oxo, hydroxy, nitro, halogen, C1-C4 alkyl, C1-C4 alkenyl , C1-C4 alkoxy, C3-C7 cycloalkyl, C1-C4 alkyl-OH, tri HaloC1-C4 alkyl, mono- and di-C1-C4 alkylamino, -C(O)NH2 , -NH2, -NO2, hydroxy C1-C4 alkylamino, hydroxy C1-C4 alkyl alkyl, 4- to 7-membered heterocyclic C1-C4 alkyl, amino C1-C4 alkyl and mono- and di-C1-C4 alkylamino C1-C4 alkyl is substituted with two substituents; or A' is a 6-membered ring having 1 to 3 ring nitrogen atoms. heteroaryl, wherein the 6-membered heteroaryl is phenyl or 5 or 6 and 1 or 2 ring heteroatoms independently selected from N, O, and S. Heteroaryl substituted with C1-C4 alkyl, mono- and di-C1-C4 alkyl amino, hydroxy C1-C4 alkylamino, hydroxy C1-C4 alkyl, amino C 1-C4 alkyl and mono- and di-C1-C4 alkylamino C1-C4 alkyl or A' is substituted with 0, 1 or 2 substituents independently selected from 9 to 1 0 ring atoms and 1, 2, or 3 ring heteroatoms independently selected from N, O, or S and bicyclic heteroaryl having the formula: , halogen, hydroxy, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl Quinyl, C1-C4 alkoxy and hydroxy, C1-C4 alkoxy, amino, mono -C1-C4 alkylamino and C1-C4 alkylamino substituted with di-C1-C4 alkylamino substituted with 0, 1 or 2 substituents independently selected from alkoxy; B is a group of the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are independently selected from hydrogen and fluorine; or R and R3 may combine to form 0 or 1 further rings selected from N, O or S. R1 and R3 combine to form a 5- or 6-membered fused heterocyclic ring having a hetero atom; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R4, together with the carbon atoms to which they are attached, form a spiro group; Forms a cyclic C3-C6 cycloalkyl; X is CRA’ R B’ , NR7 or bond R7 is hydrogen or C1-C4 alkyl; R A’ and R B’ is hydrogen and C1 to C 4 alkyl, or R A’ and R B’ are combined to form a bivalent and Z is CR8 or N; when Z is N, X is a bond. R8 is hydrogen or combines with R6 to form a double bond; or B is the formula: [ka] where Y is C or O, and when Y is O, R 11 and R 12 Both is absent; p and q are independently selected from the group consisting of 0, 1, and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R 14 teeth , hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino, or moiety. substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1-C4 alkyl R is alkyl, amino, or mono- and di-C1-C4 alkylamino; 12 is hydrogen or C 1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C1 A saturated azacyclic ring having 4 to 7 ring atoms, optionally substituted with a C4 alkyl group. or R 11 and R 12are combined to form 1 to 3 C1 to C4 alkyl groups forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with

[0113] In an embodiment of the second splice regulator, the splice regulator is or a pharmaceutically acceptable salt thereof, wherein A' is [ka] [ka] [ka] [ka] [ka] is selected from.

[0114] In a third splice regulator embodiment, the splice regulator has the formula (II): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is N or CR a and ;R a is hydrogen or C1-C4 alkyl; R b is hydrogen, C1-C4 alkyl, C 1-C4 alkoxy, hydroxy, cyano, halogen, trihaloC1-C4 alkyl or trihaloC1-C4alkoxy; R c and R d are each independently hydrogen, C1 ~C4 alkyl, C1~C4 alkoxy, hydroxy, trihalo C1~C4 alkyl, A is a halogen atom having 1 to 3 ring nitrogen atoms; wherein the six-membered heteroaryl is oxo, C1- C4 alkyl, mono- and di-C1-C4 alkylamino, hydroxy C1-C4 alkyl hydroxy C1-C4 alkyl, amino C1-C4 alkyl and mono- and 0, 1 or 2 independently selected from di-C1-C4 alkylamino C1-C4 alkyl or A is substituted with 1 to 3 substituents independently selected from N, O and S. 5-membered heteroaryl having 1 ring heteroatom, C1-C4 alkyl, hydroxyl Sil, mono- and di-C1-C4 alkylamino, hydroxy C1-C4 alkylamino , hydroxy C1-C4 alkyl, amino C1-C4 alkyl and mono- and di-C1 0, 1 or 2 substituents independently selected from C1-C4 alkylamino C1-C4 alkyl or A and R c together with the atoms to which they are attached, Halogen, hydroxy, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkyl Nyl, C1-C4 alkoxy and hydroxy, C1-C4 alkoxy, amino, mono- C1-C4 alkylamino and C1-C4 alkylamino substituted with di-C1-C4 alkylamino forming a 6-membered aryl having 0, 1 or 2 substituents independently selected from alkoxy; B is a compound of the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are independently selected from hydrogen and fluorine; or R and R3 may combine to form 0 or 1 further rings selected from N, O or S. R1 and R3 combine to form a 5- or 6-membered fused heterocyclic ring having a hetero atom; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R4, together with the carbon atoms to which they are attached, form a spiro group; Forms a cyclic C3-C6 cycloalkyl; X is CR A’ R B’ , NR7 or bond R7 is hydrogen or C1-C4 alkyl; R A’ and R B’ is hydrogen and C1 to C 4 alkyl, or R A’ and R B’ are combined to form a bivalent and Z is CR8 or N; when Z is N, X is a bond. R8 is hydrogen or combines with R6 to form a double bond; or B is the formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0115] In a fourth splice regulator embodiment, the splice regulator is a third splice regulator. A compound according to the present invention or a pharmaceutically acceptable salt thereof, wherein A is 1 to 3 a 6-membered heteroaryl having a ring nitrogen atom, wherein the 6-membered heteroaryl is an oxyalkyl group; xo, C1-C4 alkyl, mono- and di-C1-C4 alkylamino, hydroxyC1 ~C4 alkylamino, hydroxy C1~C4 alkyl, amino C1~C4 alkyl and and independently selected from mono- and di-C1-C4 alkylaminoC1-C4 alkyl It is substituted with 0, 1 or 2 substituents.

[0116] In a fifth splice regulator embodiment, the splice regulator is a third or fourth splice regulator. a compound according to any one of the aspects of the present invention or a pharmaceutically acceptable salt thereof, So, A is, [ka] is selected from.

[0117] In a sixth splice regulator embodiment, the splice regulator is a third splice regulator. or a pharmaceutically acceptable salt thereof, wherein A is N, O, and and S is a 5-membered heteroaryl having 1 to 3 ring heteroatoms independently selected from , C1-C4 alkyl, hydroxyl, mono- and di-C1-C4 alkylamino, hydroxy C1-C4 alkylamino, hydroxy C1-C4 alkyl, amino C1-C4 alkyl alkyl and mono- and di-C1-C4 alkylaminoC1-C4 alkyl, It is substituted with 0, 1 or 2 selected substituents.

[0118] In a seventh splice regulator embodiment, the splice regulator is a splice regulator of the third or sixth splice. a compound according to any one of the aspects of the present invention or a pharmaceutically acceptable salt thereof, So, A is, [ka] is selected from.

[0119] In an eighth embodiment of the splice regulator, the splice regulator is a splice regulator comprising: or a pharmaceutically acceptable salt thereof, and B is the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are hydrogen; or R and R3 are substituted with and 5 or 6-membered rings having 0 or 1 additional ring heteroatom selected from N, O or S. R1 and R3 combine to form a C1-C3 alkylene group; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R 4, in combination with the carbon atoms to which they are attached, form a spirocyclic C3-C6 cycloalkoxy group. X is CR A’ R B’ , O, NR7 or a bond; R A’ and R B’ teeth, independently selected from hydrogen and C1-C4 alkyl, or R A’ and R B’ is a combination together form a divalent C2-C5 alkylene group; Z is CR8 or N; Z is In the case of N, X is a bond; R8 is hydrogen or in combination with R6 is a double bond. Form.

[0120] In a ninth embodiment of the splice regulator, the splice regulator is or a pharmaceutically acceptable salt thereof, and B is the formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0121] In a tenth splice regulator embodiment, the splice regulator has formula (III): [ka] or a pharmaceutically acceptable salt thereof, wherein R b is hydrogen or hydroxy and;R c is hydrogen or halogen; R d is a halogen.

[0122] In an eleventh splice regulator embodiment, the splice regulator has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein R b The hydroxyl, meth methoxy, trifluoromethyl or trifluoromethoxy.

[0123] In a twelfth splice regulator embodiment, the splice regulator has the formula (V): [ka] or a pharmaceutically acceptable salt thereof, wherein R b The hydroxyl, meth R is oxy, trifluoromethyl or trifluoromethoxy; e is hydrogen, hydroxy Or methoxy.

[0124] In a thirteenth embodiment of the splice regulator, the splice regulator is any one of the third to ninth or first A compound according to any one of the first to twelfth embodiments of the splice regulator or a pharmaceutically acceptable salt thereof. wherein Y is N.

[0125] In a fourteenth embodiment of the splice regulator, the splice regulator is any one of the third to ninth or first A compound according to any one of the first to twelfth embodiments of the splice regulator or a pharmaceutically acceptable salt thereof. wherein Y is CH.

[0126] In a fifteenth embodiment of the splice regulator, the splice regulator is any one of the first to eighth or first A compound according to any one of the embodiments of the splice regulators of paragraphs 0 to 14, or a pharmaceutically acceptable salt thereof. where B is a salt [ka] wherein Z is NH or N(Me).

[0127] In a sixteenth embodiment of the splice regulator, the splice regulator is one of the first to eighth or first A compound according to any one of the embodiments of the splice regulators of paragraphs 0 to 15, or a pharmaceutically acceptable salt thereof. where B is a salt [ka] is.

[0128] In a seventeenth embodiment of the splice regulator, the splice regulator is any one of the first to seventh or ninth splice regulators. a compound according to any one of the fourteenth to thirteenth embodiments of the splice regulator or a pharmaceutically acceptable salt thereof where B is a salt [ka] is selected from.

[0129] In an eighteenth embodiment of the splice regulator, the splice regulator is any one of the first to seventh or ninth splice regulators. A compound according to any one of the fourteenth to seventeenth embodiments of the splice regulator or a pharmaceutical composition thereof and a commercially acceptable salt thereof, wherein B is [ka] is.

[0130] In a nineteenth splice regulator embodiment, the splice regulator has formula (VI): [ka] or a pharmaceutically acceptable salt thereof, wherein A is a compound having 9 or 10 ring atoms and bicyclic heteroaryl or polycyclic heteroaryl having 1 or 2 ring N atoms and 0 or 1 O atom wherein the bicyclic heteroaryl or heterocycle is -C(O)NH, -C(O )O-C1-C4 alkyl, aryl, oxo, cyano, halogen, hydroxy, C1- C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, heterocyclyl, heteroaryl, heterocyclyl C1-C 4 alkyl, C1-C4 alkylaryl, C1-C4 alkylheterocyclyl, C1- C4 alkyl heteroaryl, C1-C4 alkoxyaryl, C1-C4 alkoxyheteroaryl Heterocycyl, C1-C4 alkoxyheteroaryl, hydroxy, C1-C4 alkoxy Substituted with hydroxy, amino, mono-C1-C4 alkylamino and di-C1-C4 alkylamino 0, 1, 2, 3, 4 or 5 substitutions independently selected from C1-C4 alkoxy B is substituted with a group of the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are independently selected from hydrogen and fluorine; or R and R3 may combine to form 0 or 1 further rings selected from N, O or S. R1 and R3 combine to form a 5- or 6-membered fused heterocyclic ring having a hetero atom; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R4, together with the carbon atoms to which they are attached, form a spiro group; Forms a cyclic C3-C6 cycloalkyl; X is CR A R B, O, NR7 or a bond R7 is hydrogen or C1-C4 alkyl; R A and R B is hydrogen and C1 to C4 alkyl or R A and R B combine to form divalent C2~ forming a C5 alkylene group; Z is CR8 or N; when Z is N, X is a bond R8 is hydrogen or combines with R6 to form a double bond; or B is formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0131] In a twentieth splice regulator embodiment, the splice regulator has formula (VII): [ka] or a pharmaceutically acceptable salt thereof, wherein A is a compound having 10 ring atoms and 1 or a bicyclic heteroaryl having two ring N atoms, wherein the bicyclic heteroaryl The group is oxo, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene. C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy hydroxy, C1-C4 alkoxy, amino, mono-C1-C4 aryl C1-C4 alkoxy substituted with alkylamino and di-C1-C4 alkylamino is substituted with 0, 1 or 2 independently selected substituents; B is a group of the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are independently selected from hydrogen and fluorine; or R and R3 may combine to form 0 or 1 further rings selected from N, O or S. R1 and R3 combine to form a 5- or 6-membered fused heterocyclic ring having a hetero atom; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R4, together with the carbon atoms to which they are attached, form a spiro group; Forms a cyclic C3-C6 cycloalkyl; X is CR A R B , O, NR7 or a bond R7 is hydrogen or C1-C4 alkyl; R A and R B is hydrogen and C1 to C4 alkyl or R A and R B combine to form divalent C2~ forming a C5 alkylene group; Z is CR8 or N; when Z is N, X is a bond R8 is hydrogen or combines with R6 to form a double bond; or B is formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0132] In a twenty-first embodiment of the splice regulator, the splice regulator is A compound according to any one of the splice regulator embodiments or a pharmaceutically acceptable salt thereof. where A is [ka] wherein u and v are each independently 0, 1, 2, or 3; R a Reach BiR b are each independently cyano, halogen, hydroxy, C1-C4 alkyl, C 2-C4 alkenyl, C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cyclo Alkyl, heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1 ~C4 alkylaryl, C1~C4 alkylheterocyclyl, C1~C4 alkylhetero C1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C 1-C4 alkoxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, C1-C4 alkylamino and C1-C4 alkylamino substituted with mono-C1-C4 alkylamino C4 alkoxy.

[0133] In a twenty-second embodiment of the splice regulator, the splice regulator comprises any one of the nineteenth to twenty-first splices. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where A is [ka] wherein u and v are each independently 0, 1, 2, or 3; R a Reach BiR b are each independently cyano, halogen, hydroxy, C1-C4 alkyl, C 2-C4 alkenyl, C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cyclo Alkyl, heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1 ~C4 alkylaryl, C1~C4 alkylheterocyclyl, C1~C4 alkylhetero C1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C 1-C4 alkoxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, C1-C4 alkylamino and C1-C4 alkylamino substituted with mono-C1-C4 alkylamino C4 alkoxy.

[0134] In another embodiment of the splice regulator, any of the nineteenth to twenty-second embodiments of the splice regulator and a compound according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein A is an aryl group selected from the group consisting of aryl, aryl, aryl, aryl ... The hydroxyl group is substituted at the hydroxyl position.

[0135] In a 23rd embodiment of the splice regulator, the splice regulator is a splice regulator selected from the group consisting of the 19th to 22nd splice regulators. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where A is [ka] is selected from.

[0136] In a twenty-fourth embodiment of the splice regulator, the splice regulator comprises any one of the nineteenth to twenty-third splice regulators. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where A has a single N atom.

[0137] In a twenty-fifth splice regulator embodiment, the splice regulator has formula (VIII): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0138] In a twenty-sixth splice regulator embodiment, the splice regulator has formula (IX): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R dare each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0139] In a twenty-seventh splice regulator embodiment, the splice regulator has the formula (X): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0140] In a twenty-eighth splice regulator embodiment, the splice regulator has formula (XI): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0141] In a twenty-ninth embodiment of the splice regulator, the splice regulator has formula (XII): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0142] In a thirtieth splice regulator embodiment, the splice regulator has formula (XIII): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0143] In a thirty-first splice regulator embodiment, the splice regulator has formula (XIV): [ka] or a pharmaceutically acceptable salt thereof, wherein R c and R d are each unique In particular, hydrogen, cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkene C2-C4 alkynyl, C1-C4 alkoxy, C3-C7 cycloalkyl, Heterocyclyl, heteroaryl, heterocyclyl C1-C4 alkyl, C1-C4 alkyl Aryl, C1-C4 alkylheterocyclyl, C1-C4 alkylheteroaryl, C 1-C4 alkoxyaryl, C1-C4 alkoxyheterocyclyl, C1-C4 alkoxy oxyheteroaryl and hydroxy, C1-C4 alkoxy, amino, mono-C1-C C1-C4 alkoxy substituted with 4 alkylamino and di-C1-C4 alkylamino is selected from.

[0144] In a thirty-second embodiment of the splice regulator, the splice regulator is a splice regulator selected from the group consisting of the nineteenth to thirty-first splices. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where B is the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are hydrogen; or R and R3 are substituted with and 5 or 6-membered rings having 0 or 1 additional ring heteroatom selected from N, O or S. R1 and R3 combine to form a C1-C3 alkylene group; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R 4, in combination with the carbon atoms to which they are attached, form a spirocyclic C3-C6 cycloalkoxy group. X is CR A R B , O, NR7 or a bond; R A and R B is hydrogen and independently selected from C1-C4 alkyl, or R A and R B are combined, forming a divalent C2-C5 alkylene group; Z is CR8 or N; when Z is N, X is a bond; R8 is hydrogen or combines with R6 to form a double bond.

[0145] In a thirty-third embodiment of the splice regulator, the splice regulator is any one of the nineteenth to thirty-second splice regulators. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where B is the formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0146] In a thirty-fourth embodiment of the splice regulator, the splice regulator is any one of the nineteenth to thirty-third splice regulators. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where B is [ka] wherein X is O or N(Me) or NH; R 17 is water It is hydrogen or methyl.

[0147] In a thirty-fifth embodiment of the splice regulator, the splice regulator comprises any one of the nineteenth to thirty-fourth splices. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where B is [ka] is.

[0148] In a thirty-sixth embodiment of the splice regulator, the splice regulator is any one of the nineteenth to thirty-fifth splices. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where X is —O—.

[0149] In a thirty-seventh embodiment of the splice regulator, the splice regulator is any one of the nineteenth to thirty-sixth splice regulators. A compound according to any one of the embodiments of the price regulator or a pharmaceutically acceptable salt thereof. , where X is N(Me).

[0150] In a thirty-eighth splice regulator embodiment, the splice regulator has formula (XV): [ka] or a pharmaceutically acceptable salt thereof, wherein A is a C1-C4 alkyl or 2-hydroxyphenyl substituted with 0, 1, 2 or 3 substituents independently selected from where two C1-C4 alkyl groups are combined with the atoms to which they are attached to form Thus, oxo, oxime, hydroxy, halo C1-C4 alkyl, which can form a 5- or 6-membered ring, dihalo C1-C4 alkyl, trihalo C1-C4 alkyl, C1-C4 alkoxy, C1-C4 alkoxy-C3-C7 cycloalkyl, halo C1-C4 alkoxy, dihalo C1-C4 alkoxy, trihalo C1-C4 alkoxy, hydroxy, cyano, halogen , amino, mono- and di-C1-C4 alkylamino, heteroaryl, hydroxy Substituted C1-C4 alkyl, aryl, amino, -C(O)NHC1-C4 alkyl- Heteroaryl, -NHC(O)-C1-C4 alkyl-heteroaryl, C1-C4 alkyl C(O)NH-heteroaryl, C1-C4 alkylNHC(O)-heteroaryl cycloalkyl, 3- to 7-membered cycloalkyl, 5- to 7-membered cycloalkenyl, or independently of S, O, and N C1 substituted with a 5-, 6- or 9-membered heterocycle containing 1 or 2 heteroatoms selected from substituted with 0 or 1 substituent selected from C to C alkoxy, wherein The ring may have 5, 6 or 9 ring atoms, 1, 2 or 3 ring hetero atoms selected from N, O and S. It has atoms such as oxo, hydroxy, nitro, halogen, C1-C4 alkyl, C1-C4 Alkenyl, C1-C4 alkoxy, C3-C7 cycloalkyl, C1-C4 alkyl- OH, trihaloC1-C4 alkyl, mono- and di-C1-C4 alkylamino, -C( O) NH2, -NH2, -NO2, hydroxy C1-C4 alkylamino, hydroxy C 1-C4 alkyl, 4-7 membered heterocyclic C1-C4 alkyl, amino C1-C4 alkyl, and and mono- and di-C1-C4 alkylaminoC1-C4 alkyl or A is hydroxy at the 3-position and optionally substituted with 0, 1 or 2 substituents substituted by hydroxy, cyano, halogen, C1-C4 alkyl, C2-C4 alkoxy and aryl, C1-C5 alkoxy, and methyl methyl ether. 2-naphthyl, wherein alkoxy is unsubstituted or hydroxy, C 1-C4 alkoxy, amino, N(H)C(O)C1-C4 alkyl, N(H)C(O) 2C1-C4 alkyl, alkylene 4-7 membered heterocycle, 4-7 membered heterocycle and mono- and di- -C1-C4 alkylamino; A is a 6-membered heterocyclic group having 1 to 3 ring nitrogen atoms; and 6-membered heteroaryl, wherein the 6-membered heteroaryl is phenyl or 5 or 6 ring atoms, a heteroatom having one or two ring heteroatoms independently selected from N, O and S; aryl substituted with C1-C4 alkyl, mono- and di-C1-C4 alkylamino No, hydroxy C1-C4 alkylamino, hydroxy C1-C4 alkyl, amino C1 -C4 alkyl and mono- and di-C1-C4 alkylaminoC1-C4 alkyl or A is substituted with 0, 1, or 2 independently selected substituents; or A is substituted with 9 to 10 and 1, 2 or 3 ring heteroatoms independently selected from N, O or S. and bicyclic heteroaryl, wherein the bicyclic heteroaryl is selected from the group consisting of cyano, halogen, Hydroxy, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C1 ~C4 alkoxy and hydroxy, C1~C4 alkoxy, amino, mono-C1~C4 C1-C4 alkoxy substituted with alkylamino and di-C1-C4 alkylamino or A is substituted with 0, 1 or 2 substituents independently selected from: 13 ring atoms and 1, 2, or 3 ring heteroatoms independently selected from N, O, or S wherein the tricyclic heteroaryl is selected from the group consisting of cyano, halo, Genoyl, hydroxy, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl , C1-C4 alkoxy and hydroxy, C1-C4 alkoxy, amino, mono-C1 substituted with C1-C4 alkylamino, di-C1-C4 alkylamino and heteroaryl substituted with 0, 1, or 2 substituents independently selected from C1-C4 alkoxy; wherein the heteroaryl has 5, 6 or 9 ring atoms, 1 selected from N, O and S; Two or three ring heteroatoms, oxo, hydroxy, nitro, halogen, C1-C4 Alkyl, C1-C4 alkenyl, C1-C4 alkoxy, C3-C7 cycloalkyl, C1-C4 alkyl-OH, trihalo C1-C4 alkyl, mono- and di-C1-C4 alkyl Alkylamino, -C(O)NH2, -NH2, -NO2, hydroxy C1-C4 alkyl Amino, hydroxy C1-C4 alkyl, 4- to 7-membered heterocyclic C1-C4 alkyl, amino C1-C4 alkyl and mono- and di-C1-C4 alkylamino C1-C4 alkyl B is substituted with 0, 1 or 2 substituents independently selected from the formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are independently selected from hydrogen and fluorine; or R and R3 may combine to form 0 or 1 further rings selected from N, O or S. R1 and R3 combine to form a 5- or 6-membered fused heterocyclic ring having a hetero atom; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R4, together with the carbon atoms to which they are attached, form a spiro group; Forms a cyclic C3-C6 cycloalkyl; X is CR A R B , O, NR7 or a bond R7 is hydrogen or C1-C4 alkyl; R A and R B is hydrogen and C1 to C4 alkyl or R A and R B combine to form divalent C2~ forming a C5 alkylene group; Z is CR8 or N; when Z is N, X is a bond R8 is hydrogen or combines with R6 to form a double bond; or B is formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11 is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0151] In a thirty-ninth embodiment of the splice regulator, the splice regulator is A compound according to the embodiment of the present invention or a pharmaceutically acceptable salt thereof, wherein A is 1 to 3 a 6-membered heteroaryl having 1 to 6 ring nitrogen atoms, wherein the 6-membered heteroaryl is phenyl or 5 or 6 ring atoms, one or more independently selected from N, O and S is substituted with heteroaryl having two ring heteroatoms, C1-C4 alkyl, mono- and di-C1-C4 alkylamino, hydroxy-C1-C4 alkylamino, hydroxy C1-C4 alkyl, amino C1-C4 alkyl and mono- and di-C1-C4 alkyl substituted with 0, 1 or 2 substituents independently selected from: alkylamino; C1-C4 alkyl; or A is 9 to 10 ring atoms and is independently selected from N, O, or S; Bicyclic heteroaryl having 2 or 3 ring heteroatoms, wherein The group includes cyano, halogen, hydroxy, C1-C4 alkyl, C2-C4 alkenyl, C 2-C4 alkynyl, C1-C4 alkoxy and hydroxy, C1-C4 alkoxy, Substituted with amino, mono-C1-C4 alkylamino and di-C1-C4 alkylamino and substituted with 0, 1, or 2 substituents independently selected from C1-C4 alkoxy. do.

[0152] In a fortieth splice regulator embodiment, the splice regulator modifies the thirty-eighth splice A compound according to the embodiment of the present invention or a pharmaceutically acceptable salt thereof, wherein A is C1 to C4 alkyl, halo C1-C4 alkyl, C1-C4 alkoxy, hydroxy, cyano, Halogen, amino, mono- and di-C1-C4 alkylamino, heteroaryl and hydroxyl 0, 1, 2 independently selected from C1-C4 alkyl substituted with hydroxy or amino or 2-hydroxyphenyl substituted with 3 substituents, wherein heteroaryl has 5 or 6 ring atoms and 1 or 2 ring heteroatoms selected from N, O and S , C1-C4 alkyl, mono- and di-C1-C4 alkylamino, hydroxy C1-C 4-alkylamino, hydroxy C1-C4 alkyl, 4- to 7-membered heterocyclic C1-C4 alkyl , amino C1-C4 alkyl and mono- and di-C1-C4 alkylamino C1-C4 and substituted with 0, 1, or 2 substituents independently selected from alkyl.

[0153] In a forty-first embodiment of the splice regulator, the splice regulator modifies the thirty-eighth splice A compound according to the embodiment of the present invention or a pharmaceutically acceptable salt thereof, wherein A is Optionally substituted with hydroxy, hydroxy, cyano, halogen, C1-C4 alkoxy alkyl, C2-C4 alkenyl, C1-C4 alkoxy; 2-naphthyl further substituted with a substituent, wherein the alkoxy is unsubstituted. or hydroxy, C1-C4 alkoxy, amino, N(H)C(O)C1-C4 alkyl C1-C4 alkyl, 4- to 7-membered heterocycles and mono- and di-C1 ~ Substituted with C4 alkylamino.

[0154] In a forty-second embodiment of the splice regulator, the splice regulator comprises any one of the thirty-eighth to forty-first splices. A compound according to the invention or a pharmaceutically acceptable salt thereof, wherein B is ,formula: [ka] wherein m, n, and p are independently selected from 0 or 1; R, R, R, R3 and R4 are independently selected from the group consisting of hydrogen, C1-C4 alkyl, wherein: Alkyl is optionally hydroxy, amino or mono- and di-C1-C4 alkyl. R5 and R6 are hydrogen; or R and R3 are substituted with and 5 or 6-membered rings having 0 or 1 additional ring heteroatom selected from N, O or S. R1 and R3 combine to form a C1-C3 alkylene group; R1 and R5 combine to form a C1-C3 alkylene group; R3 and R 4, in combination with the carbon atoms to which they are attached, form a spirocyclic C3-C6 cycloalkoxy group. X is CR A R B , O, NR7 or a bond; R A and R B is hydrogen and independently selected from C1-C4 alkyl, or R A and R B are combined, forming a divalent C2-C5 alkylene group; Z is CR8 or N; when Z is N, X is a bond; R8 is hydrogen or combines with R6 to form a double bond.

[0155] In a forty-third embodiment of the splice regulator, the splice regulator comprises any one of the thirty-eighth to forty-first splices. A compound according to the invention or a pharmaceutically acceptable salt thereof, wherein B is ,formula: [ka] wherein p and q are independently selected from the group consisting of 0, 1 and 2; R9 and R 13 are independently selected from hydrogen and C1-C4 alkyl; R 10 and R1 4 is hydrogen, amino, mono- and di-C1-C4 alkylamino and C1-C4 alkyl wherein alkyl is optionally selected from hydroxy, amino or is substituted with mono- and di-C1-C4 alkylamino; R 11is hydrogen, C1 to C4 alkyl alkyl, amino or mono- and di-C1-C4 alkylamino; R 12 is hydrogen or is C1-C4 alkyl; or R9 and R 11 are combined to form 1 to 3 C A saturated azacycle having 4 to 7 ring atoms, optionally substituted with a 1 to C4 alkyl group. or R 11 and R 12 are combined to form 1 to 3 C1 to C4 alkyl groups. It forms a saturated azacycle having 4 to 7 ring atoms, optionally substituted with an alkyl group.

[0156] In a forty-fourth splice regulator embodiment, the splice regulator has formula (XVI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 15 is hydrogen, hydroxyl , C1-C4 alkoxy, where alkoxy is optionally hydroxy, It is substituted with methoxy, amino, mono and dimethylamino or morpholine.

[0157] In a forty-fifth splice regulator embodiment, the splice regulator has formula (XVII): [ka] or a pharmaceutically acceptable salt thereof, wherein R 16 is one ring nitrogen atom and a 5-membered heterocyclic ring having 0 or 1 additional ring heteroatom selected from N, O, or S. heteroaryl, where heteroaryl is optionally C1-C4 alkyl; It has been replaced.

[0158] In a forty-sixth embodiment of the splice regulator, the splice regulator is any one of the thirty-eighth to forty-first and 44 and 45 splice regulator embodiments, wherein B is [ka] wherein X is O or N(Me); R 17 is hydrogen or methyl It's chill.

[0159] In a forty-seventh embodiment of the splice regulator, the splice regulator is any one of the thirty-eighth to forty-second and 44 to 45 splice regulator compounds according to the embodiment, wherein X is -O-. do.

[0160] In a forty-eighth embodiment of the splice regulator, the splice regulator is any one of the thirty-eighth to forty-second embodiments. A compound according to any of the 44th to 45th embodiments of the splice regulator, wherein B is [ka] is.

[0161] In a forty-ninth embodiment of the splice regulator, the splice regulator comprises any one of the forty-fifth to forty-eighth splice regulators. A compound according to an embodiment of the price regulator, wherein R 16 teeth, [ka] is.

[0162] In a fiftieth splice regulator embodiment, the splice regulator has formula (XVIII): [ka] or a pharmaceutically acceptable salt thereof, wherein X is —O— or [ka] R' is oxo, hydroxy, nitro, halogen, C1-C4 alkyl, C1- C4 alkenyl, C1-C4 alkoxy, C3-C7 cycloalkyl, C1-C4 alkyl -OH, trihaloC1-C4 alkyl, mono- and di-C1-C4 alkylamino, - C(O)NH2, -NH2, -NO2, hydroxyC1-C4 alkylamino, hydroxy 4-7 membered heterocyclic C1-C4 alkyl, amino C1-C4 alkyl and mono- and di-C1-C4 alkylaminoC1-C4 alkyl , 5-membered heteroaryl optionally substituted with 1 or 2 groups.

[0163] In certain embodiments, the splice regulator has the structure [ka] 5-(1H-pyrazol-4-yl)-2-(6-((2,2,6,6-tetramethyl-2-pyrazole) Methylpiperidin-4-yl)oxy)pyridazin-3-yl)phenol (LMI07 0; branapram) or a pharmaceutically acceptable salt thereof.

[0164] In certain embodiments, the splice regulator is splice regulator 2, wherein: The compound has the following structure: [ka] 7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)- 3-amino)pyridazin-3-yl)isoquinolin-6-ol or a pharmaceutically acceptable salt thereof is.

[0165] Additional splice regulators and splice regulator bonds bound by those regulators The combination sequences are described, for example, in U.S. Patent Application Publication No. 2012 / 0083495, WO 2014 / 013900, and WO 2014 / 013900. Pamphlet No. 2014 / 028459, Pamphlet No. 2015 / 017589 , International Publication No. 2014 / 116845, International Publication No. 2017 / 100 Pamphlet No. 726, Pamphlet No. 2018 / 098446, Pamphlet No. Pamphlet No. 2018 / 226622, Pamphlet No. 2019 / 005993 , International Publication No. 2019 / 005980 and International Publication No. 2019028 No. 440, the contents of which are incorporated herein by reference in their entirety. In rare cases, the splice regulators and splice regulator binding sequences described herein may be used in combination with other splice regulators. Use in the described methods, minigenes, and other aspects and embodiments are contemplated.

[0166] Cutting site In one embodiment, the nucleic acid molecule of the invention comprises one or more sequences encoding a cleavage site, This involves extracting a minigene from the sequence encoded by the transgene (e.g., a protein of interest). A gene encoding a sequence (e.g., all or substantially all of the sequence) is cut. In one embodiment, the cleavage site is an autocleavage site, a protease cleavage site or The cleavage site can be any combination thereof. A level sufficient to cleave the sequence encoded by one or more exons of the minigene Any desired gene is expressed in the cells of interest (either by recombinant expression or endogenous expression). The polypeptides of the present invention can be designed to be cleaved by any site-specific protease. In important embodiments, the protease cleavage site is located in a cell associated with expression of the protein of interest. Compartments that naturally (or engineered) accommodate proteases In other words, intracellular transport of the protease is selected to enhance the cellular transport of the protein of interest. It should overlap or partially overlap with intravesicular transport. For example, if the protein of interest If it is on the cell surface, an enzyme that cleaves it can be added exogenously to the cell.

[0167] If your protein of interest resides in or transits the endosomal / lysosomal system In this way, protease cleavage sites of enzymes present in these compartments can be used. Such protease / consensus motifs include, for example: Furin:RX(K / R)R consensus motif 1 Furin: RNRR (SEQ ID NO: 39) PCSK1:RX(K / R)R consensus motif PCSK5:RX(K / R)R consensus motif PCSK6:RX(K / R)R consensus motif PCSK7:RXXX[KR]R consensus motif Cathepsin B:RRX Granzyme B: IEPDX (SEQ ID NO: 35) Factor XA: Ile-Glu / Asp-Gly-Arg Enterokinase: Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36) Genenase: Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37) Sortase: LPXTG / A PreScission protease: Leu-Glu-Val-Phe-Gln-Gl y-Pro (SEQ ID NO: 38) Thrombin: Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40) TEV protease: ENLYFQG (SEQ ID NO: 41) Elastase 1 [AGSV]-x (SEQ ID NO: 42)

[0168] In some embodiments, the nucleic acids described herein encode a furin cleavage site. In some embodiments, the nucleic acids described herein comprise sequences that encode the sequences listed in Table 20. In some embodiments, the furin cleavage site is a sequence encoding any one of the listed furin cleavage sites. In some embodiments, the furin cleavage site is SEQ ID NO: 39. The nucleic acids described herein encode a furin cleavage site comprising or consisting of SEQ ID NO: 39. For example, the sequence encoding the cleavage site comprises SEQ ID NO: 19 or It consists of that.

[0169] In some embodiments, the nucleic acids described herein include RNRR (SEQ ID NO: 39 ) or at least 90%, 95%, 97%, 98% or 99% identical thereto RTKR (SEQ ID NO: 43) or at least 90%, 95%, Sequences with 97%, 98% or 99% identity: GTGAEDPRPSRKRRS LGDVG (SEQ ID NO: 45) or at least 90%, 95%, 97%, 98% or more thereof % or 99% identity to the sequence: GTGAEDPRPSRKRR (SEQ ID NO: 47 ) or at least 90%, 95%, 97%, 98% or 99% identical thereto LQWLEQQVAKRRTKR (SEQ ID NO: 49) or a sequence having at least a sequence having at least 90%, 95%, 97%, 98% or 99% identity with GTGA EDPRPSRKRRSLGG (SEQ ID NO: 51) or at least 90%, 9 A sequence having 5%, 97%, 98% or 99% identity: GTGAEDPRPSRK RRSLG (SEQ ID NO: 53) or at least 90%, 95%, 97%, 98% or more thereof % or 99% identity; SLNLTESHNSRKKR (SEQ ID NO: 55 ) or at least 90%, 95%, 97%, 98% or 99% identical thereto or a sequence having the sequence CKINGYPKRGRKRR (SEQ ID NO: 57) or a sequence having a sequence Selected from sequences with at least 90%, 95%, 97%, 98% or 99% identity The furin cleavage site is encoded by a sequence encoding the furin cleavage site.

[0170] In some embodiments, the nucleic acids described herein include RNRR (SEQ ID NO: 39 RTKR (SEQ ID NO: 43); GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 45);GTGAEDPRPSRKRR (SEQ ID NO: 47);LQWLEQQVAKRRT KR (SEQ ID NO: 49); GTGAEDPRPSRKRRSLGG (SEQ ID NO: 51); GT GAEDPRPSRKRRSLG (SEQ ID NO: 53); SLNLTESHNSRKKR (SEQ ID NO: 54) 55); and CKINGYPKRGRKRR (SEQ ID NO: 57). It contains a sequence encoding a phosphodiesterase cleavage site.

[0171] In some embodiments, the nucleic acids described herein are selected from the group consisting of RNRR (SEQ ID NO: 39) and a sequence encoding a furin cleavage site selected from the group consisting of: Some embodiments include sequences with 95%, 97%, 98%, or 99% identity. In some embodiments, the nucleic acids described herein have a sequence similar to SEQ ID NO: 19 or at least 90% similar thereto. , 95%, 97%, 98% or 99% identity. In one embodiment, the nucleic acids described herein comprise SEQ ID NO:19.

[0172] In some embodiments, the nucleic acids described herein are GTGAEDPRPSR KRRSLGDVG (SEQ ID NO: 45) or at least 90%, 95%, 97% %, 98% or 99% identity; or GTGAEDPRPSRKRR ( SEQ ID NO: 47) or at least 90%, 95%, 97%, 98% or 99% thereto It contains a sequence encoding a furin cleavage site selected from sequences with 9% identity. In some embodiments, the nucleic acid described herein is SEQ ID NO: 46 or SEQ ID NO: 48 or at least 90%, 95%, 97%, 98% or 99% identical thereto It includes sequences having the following properties:

[0173] In some embodiments, the nucleic acid described herein is GTGAEDPRPSRKR RSLGDVG (SEQ ID NO: 45) or GTGAEDPRPSRKRR (SEQ ID NO: 47) In some embodiments, the furin cleavage site is selected from the group consisting of: The nucleic acids described herein include SEQ ID NO:46 or SEQ ID NO:48.

[0174] In some embodiments, the nucleic acids described herein are GTGAEDPRPSR It contains a sequence encoding the furin cleavage site of KRRSLGDVG (SEQ ID NO: 45).

[0175] [Table 2]

[0176] In some embodiments, minigenes and transgenes, e.g., as described herein, The nucleic acid sequence containing the molecule may be a peptide cleavage site (e.g., a self-cleaving peptide or an intracellular protease). In embodiments, the peptide cleavage enzyme may include one or more sequences encoding a peptide cleavage enzyme (substrate for the enzyme). The sequence encoding the self-cleaving peptide is placed between the minigene and the transgene. Examples of cleavage site sequences include the following, where the GSG residues in parentheses are optionally do.

[0177] [Table 3]

[0178] In some embodiments, the nucleic acid molecule comprises a protease cleavage site, such as a furin cleavage site. A sequence encoding the cleavage site and a self-cleaving peptide, e.g., a 2A peptide, e.g., a T2A peptide. In an embodiment, the nucleic acid comprises a sequence encoding a 2A coding sequence. The sequence further comprises a sequence encoding a furin cleavage site on the 5' side of the sequence. The phospho-cleavage site comprises or consists of SEQ ID NO: 39, and the T2A sequence comprises SEQ ID NO: 59. or comprising or consisting of SEQ ID NO: 61. In an embodiment, the furin cleavage site The coding sequence is or includes SEQ ID NO: 19 and encodes a peptide cleavage site. The sequence is or comprises SEQ ID NO: 20 or SEQ ID NO: 62. The sequence encoding the 2A sequence is located at 10, 9, 8, 7, 6, 5, 4, and 3 of the minigene upon cleavage. , 2 or less than 1 amino acid, furin cleavage site and / or 2A peptide in the protein of interest Immediately 5' of the transgene (e.g., the sequence encoding the protein of interest) so that it remains intact. is placed to the side.

[0179] promoter All cells in an animal or human body contain the same DNA, but different cells in different tissues On the one hand, they express a common set of genes, and on the other hand, they vary depending on the tissue type and developmental stage. Without being bound by theory, introns are expressed in a set of genes that vary depending on the Any promoter not containing Nucleic acid molecules) can be used in various aspects and embodiments described herein. Exemplary promoters that can be used include the cytomegalovirus (CMV) promoter, CAG promoter, SV40 promoter, JeT promoter, PGK promoter and including, but not limited to, the CBA promoter In embodiments, the promoter is active in multiple cell types. In embodiments, the promoter is specific to one cell type (e.g., cell-specific) or to a specific target cell type (e.g., a target cell type), e.g., a target cell type. In cell types (e.g., tissue-specific) of one tissue, such as central nervous tissue (e.g., brain tissue) In an embodiment, the promoter is neuron-specific. Examples of neuron-specific promoters that can be used in the various aspects and embodiments described include Vectors and other vectors are used to drive expression of the operably linked minigenes and transgenes. Isolated or synthetic neuron-specific promoters and functional fragments thereof for use in nucleic acids promoters derived from, for example, neuron-specific enolase (NSE) (e.g., E MBL HSENO2, see X51956); aromatic amino acid decarboxylation the AADC promoter; the neurofilament promoter (e.g., GenB ank HUMNFL, see L04147); synapsin promoter (e.g. See GenBank HUMSYNIB, M55301 for an example; thy-1 promoter promoter (e.g., Chen et al., (1987) Cell, 51:7-19 ;Llewellyn et al.(2010)Nat.Med.,16(10):1 161-1166); serotonin receptor promoters (e.g., GenB ank S62283); tyrosine hydroxylase promoter (TH ) (e.g., Oh et al., (2009) Gene Ther., 16:437; Sasaoka et al.,(1992)Mol.Brain Res.,16:2 74;Boundy et al.,(1998)J.Neurosci.,18:99 89; and Kaneda et al., (1991) Neuron, 6:583-59 4); the GnRH promoter (see, e.g., Radovick et al. ,(1991)Proc.Natl.Acad.Sci.USA,88:3402-34 06); the L7 promoter (see, e.g., Oberdick et al., (1990) Science, 248:223-226); DNMT pro motor (e.g., Bartge et al., (1988) Proc. Natl. A See cad. Sci. USA, 85:3648-3652); enkephalin Promoters (e.g., Comb et al., (1988) EMBO J., 17: 3793-3805); myelin basic protein (MBP) promoter -; Ca2+-calmodulin-dependent protein kinase II-alpha (CamKIM ) promoter (e.g., Mayford et al., (1996) Proc. Na tl.Acad.Sci.USA,93:13250; and Casanova et a l., (2001) Genesis, 31:37); CMV enhancer / platelet-derived growth factor-p promoter (e.g., Liu et al., (2004) Gene Ther., 11:52-60); In some embodiments, the minimal human synapsin 1 promoter (S YN) are used in part or in whole. Kugler et al., (2003) Gen e Ther.,10(4):337-47;Thiel et al,(1991)P roc.Natl.Acad.Sci.USA,88(8)3431-5;Castle et al.,(2016)Methods Mol.Biol.,1382:133 -49;McLean et al.,(2014)Neurosci.Lett.,5 76:73-78;Kugler et al.,(2003) Virology,31 1(1):89-95.

[0180] In some embodiments, the tissue or cell specific promoter is a promoter that specifically expresses a specific gene in a non-neuronal cell. in neural cells or tissues compared to those in which the operably linked minigene and / or or to provide higher expression of the transgene. Therefore, neuron-specific promoters function better in neurons than in non-neuronal cells. Constructed to provide higher expression of operably linked minigenes and / or transgenes Examples of neural cells or tissues include neurons and Schwann cells, glial cells, astrocytes, and Examples of non-neuronal cells include hepatocytes, cardiac muscle cells, red blood cells, epithelial cells, etc. These include, but are not limited to, operably linked minigenes and / or cells. Alternatively, higher levels of expression of the transgene may result from transcription of the minigene and / or transgene. In some embodiments, the number of RNA transcripts produced may be increased. The number of RNA transcripts produced can be measured by PCR. , the number of RNA transcripts produced can be measured by RT-PCR, e.g., qPCR In some embodiments, the number of RNA transcripts produced is determined by sequencing. In some embodiments, the number of RNA transcripts produced can be determined by single molecule fluorescence. It can be measured by in situ hybridization (FISH). In an embodiment, the number of RNA transcripts produced is determined by Northern blot analysis. If the minigene and / or transgene encodes a protein of interest, the Higher levels of expression of operably linked minigenes and / or transgenes may be achieved by alternative or may additionally include an increase in the amount of protein produced. The amount of protein produced was measured by enzyme-linked immunosorbent assay (ELISA). In some embodiments, the amount of protein produced can be determined by Western blot analysis. In some embodiments, the amount of protein produced can be measured by immunoassay. can be measured by immunostaining. In some embodiments, the protein produced The amount of protein was measured by time-resolved Förster resonance energy transfer (TR-FRET). In some embodiments, the amount of protein produced can be measured by immunohistochemistry (IHC). In some embodiments, the level of expression can be measured by these or measured by a number of other methods.

[0181] In aspects and embodiments, the promoter is a JeT promoter comprising SEQ ID NO: 13. In aspects and embodiments, the promoter is a human synaptic promoter comprising SEQ ID NO: 86. is a promoter.

[0182] Poly(A) signal sequence In various embodiments, the nucleic acids, vectors and other compositions disclosed herein are The polyadenylation signal sequence may contain one or more polyadenylation (polyA) signal sequences. The string may include a central sequence (e.g., AAUAAA) flanked by auxiliary sequence elements. Without being bound by theory, the sequence may signal the end of the transcript and may include a polyadenylation sequence. It serves as a site for the addition of a homopolymeric A sequence to the 3' end by a nucleotide polymerase. obtain.

[0183] SV40 polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA PolyA, beta globin polyA, alpha globin polyA, ovalbumin polyA, kappa PolyA known in the art, including but not limited to light chain polyA and synthetic polyA. A denylation signal sequence is contemplated. A polyA signal sequence is also contemplated for the nucleic acids disclosed herein. and other compositions. In some embodiments, the transgene or nucleic acid The polyA sequence in the nucleic acid sequence consists of SEQ ID NO: 22 or a functional fragment thereof. In this embodiment, the transgene or nucleic acid sequence is SEQ ID NO: 22 or a functional fragment thereof. A sequence having at least about 80, 85, 90, 95, 98, or 99% identity to the In some embodiments, the polyA sequence in the transgene or nucleic acid comprises SEQ ID NO: No. 22 or a functional fragment thereof. or 99% identical to the sequence of the transgene or nucleic acid. The polyA sequence in the sequence consists of SEQ ID NO: 89 or a functional fragment thereof. In an embodiment, the transgene or nucleic acid sequence is SEQ ID NO: 89 or a functional fragment thereof. a sequence having at least about 80, 85, 90, 95, 98, or 99% identity to In some embodiments, the polyA sequence in the transgene or nucleic acid comprises SEQ ID NO: 89 or a functional fragment thereof, consists of sequences with 99% identity.

[0184] Post-transcriptional regulatory elements In various embodiments, the nucleic acids, transgenes and other compositions disclosed herein are One or more post-transcriptional regulatory elements (PREs), e.g., those that enhance or otherwise regulate expression of the transgene. Without being bound by theory, PRE may enhance expression by allowing mRNA stability and 3' end formation, and / or PRE can promote the transport of unspliced ​​mRNA into the nucleocytoplasm. It may also contain binding sites for NA-binding proteins (RBPs) or microRNAs.

[0185] Exemplary PREs include Hepatitis B virus (HPRE), Bat virus (BPRE), , Ground squirrel virus (GSPRE), Arctic squirrel virus (ASPRE), Duck virus Rus (DPRE), Chimpanzee virus (CPRE), Woolly monkey virus (W These include PREs from the woodchuck virus (WPRE) or the MPRE. In some embodiments, the nucleic acid or transgene comprises a PRE. In certain embodiments, the PRE comprises an HPRE.

[0186] In some embodiments, a synthetic PRE is used. Exemplary sequences of synthetic PREs include: includes the sequence of HPRE-NOX SEQ ID NO: 88 or a fragment thereof. In embodiments, the PRE may be located downstream (or 3') of the promoter element. do.

[0187] Exemplary PREs include a PRE comprising, e.g., consisting of, or a flag thereof, SEQ ID NO: 72. Exemplary PREs include, but are not limited to, SEQ ID NO: 73. , for example, PREs consisting of them or fragments thereof, but are not limited thereto. . [ka]

[0188] Exemplary PREs include those described herein, such as SEQ ID NO: 88, SEQ ID NO: 72, or At least 85%, at least 90%, at least 91%, at least At least 92%, at least 93%, at least 94%, at least 95%, at least 96% %, at least 97%, at least 98% or at least 99% sequence identity It also includes PREs that contain or consist of sequences.

[0189] In some embodiments, the PRE is a sequence of a transgene or protein coding sequence. In some embodiments, the PRE may be located downstream (or 3') of a polyA sequence. In some embodiments, the PRE may be located upstream (or 5') of the transgene. It may be placed upstream (or 5') of the daughter sequence or protein coding sequence.

[0190] Transgene In various embodiments, the minigenes and other regulatory elements disclosed herein are These can be used to regulate the expression of an operably linked transgene. In embodiments, the transgene is an antibody or functional binding fragment, a receptor, an enzyme, etc. In some embodiments, the transgene encodes a protein. and the like. In some embodiments, multiple transgenes may be used (e.g., nucleic acids or The vector may encode multiple proteins or RNAs that provide a therapeutic benefit. Examples of methods for increasing the levels of these functional polypeptides or nucleic acids in cells include, for example, In the nucleic acids or vectors disclosed herein, for example, AAV viral vectors, This includes transfection or transduction of a nucleic acid sequence encoding a target polypeptide. .

[0191] i. Protein In various embodiments, the minigenes and other regulatory elements disclosed herein are , modulating expression of a polypeptide (e.g., in the presence or absence of a splice regulator, Without being bound by theory, the polypeptide The increased levels of peptides are associated with the expression of polypeptides that are reduced or absent in the tissues of the subject patient. Without being bound by theory, for example, Controlling the timing or location of expression, for example, by application or withdrawal of splice regulators. The aim is to protect such therapeutic proteins by ensuring expression only when it is desired. The efficacy and / or safety of the minigene-regulated gene described herein may be improved. Exemplary polypeptides that can be used include superoxide dismutase, aromatic acid decarboxylase, adrylase (AADC), survival motor neuron (SMN) protein, progranulin ( PRGN), Cas9 protein, zinc finger nuclease or TALEN) or MeCP2, CLN2, CLN3, CLN4, CLN5, CLN6, CLN7 and CLN 8 or a therapeutic protein selected from the group consisting of a therapeutic protein for spinocerebellar ataxia (SCA) (optionally SC Proteins associated with SCA1, SCA2, or any of SCA1, SCA2, SCA3, SCA4, SCA5, SCA6, SCA7, SCA8, SCA9, SCA10, SCA11, SCA12, SCA13, SCA14, SCA15, SCA16, SCA17, SCA18, SCA19 ...20, SCA21, SCA22, S stomach.

[0192] In various embodiments, the minigenes and other regulatory elements disclosed herein are , can be used to regulate the expression of progranulin (PGRN). Although not a direct result of the study, increased levels of functional PRGN polypeptide in neurons For example, it may provide a therapeutic effect in the treatment of FTD. However, PGRN is typically expressed in humans as a ubiquitously expressed 88 kDa secreted glycoprotein. It is encoded by the human granulin gene (GRN). Exemplary nucleic acids encoding rogranulin proteins include those listed by RefSeqGene as: NG_007886.1 and NM_002087.3 as defined in the NCBI reference sequence Contains columns defined by NC_000017.11 and NC_000017.10 Exemplary progranulin polypeptide sequences include NP_002078.1. In some embodiments, the Progranulin polypeptide is A highly conserved sequence of rare 12 cysteinyl motifs (SEQ ID NO: 102) connected by It contains seven tandemly repeated granulin-like domains.

[0193] In some embodiments, peptide fragments of PGRN and their encoding peptides are Nucleic acids that are PGRN-specific are included within the term PGRN to the extent that they retain one or more functions of PGRN. Cleavage of PGRN to form granulin (GRN) or epithelin is included. The fragments of PGRN used herein can produce proteins with different functions. In some embodiments, the nucleic acids, vectors disclosed herein are outside the meaning of the term "antibody." The target or other composition may contain a transgene sequence encoding a human protein. In some embodiments, the transgene sequence encodes PGRN. wherein the transgene sequence encodes the human progranulin (hPGRN) protein. In some embodiments, the transgene sequence is codon-optimal for the hPGRN protein. In some embodiments, the transgene sequence encodes a modified version of SEQ ID NO: 87 sequences or functional fragments thereof, e.g., those provided by intact PGRN. Fragments that are capable of providing a detectable change in one or more functions of the target gene include fragments that are capable of providing a detectable change in one or more functions of the target gene. In some embodiments, the transgene sequence has at least 99 amino acids relative to SEQ ID NO:87. %, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85 %, 80%, 75% or 70% sequence identity (or any percentage in between). In some embodiments, the hPG encoded by the transgene The RN comprises the amino acid sequence of SEQ ID NO: 87. In some embodiments, the heterologous nucleic acid sequence hPGRN encoded by the sequence contains at least 9 amino acid sequences comprising the amino acid sequence of SEQ ID NO:81. 9%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 8 Includes sequences with 5%, 80%, 75% or 70% sequence identity.

[0194] [Table 4]

[0195] ii.RNA In various embodiments, the isolated nucleic acids, vectors and other compositions disclosed herein are The composition encodes a sequence that provides a neural tissue-specific therapeutic effect without the need for protein translation. In some embodiments, the promoters disclosed herein may include transgene sequences. Promoters, silencers, regulatory elements and other nucleic acid elements are or to regulate neuron-specific expression of RNA. In some embodiments, the transgene sequence encodes a ribonucleic acid that provides a specific therapeutic function. In some embodiments, the transgene sequence encodes an siRNA. In some embodiments, the transgene sequence encodes an shRNA. In some embodiments, the transgene sequence encodes a miRNA. The daughter sequence encodes a tRNA.

[0196] iii.Antibodies In various embodiments, the promoters, silencers and other The regulatory element regulates neural tissue or neuron-specific expression of the antibody or fragment thereof. For example, in some embodiments, the transgene sequence may be In some embodiments, the transgene sequence encodes an antibody fragment. In some embodiments, the derivative encodes a vector, e.g., one that retains antigen binding ability. The transgene sequence encodes the light chain of the antibody. The sequence encodes the heavy chain of the antibody. In some embodiments, the transgene sequence comprises V H In some embodiments, the transgene sequence encodes V L Code the In some embodiments, the transgene sequence is V H In some embodiments, In some embodiments, the transgene sequence encodes a Fab. The gene sequence encodes an scFv. In some embodiments, the transgene sequence is , encodes an enzyme with neuron-specific function.

[0197] iii. Multiple ingredients In various embodiments, the promoters, silencers and other The regulatory elements are used to regulate neural tissue or neuron-specific expression of multiple transgenes. In some embodiments, the transgene sequence may be used to express RNA and polypeptides. In some embodiments, the transgene sequence encodes both a CRIS peptide and a CRIS peptide. In some embodiments, the transgene sequence encodes a component of the PR / Cas system. encodes the Cas9 protein. In some embodiments, the transgene sequence is , encoding the Cpf1 protein. In some embodiments, the transgene sequence is In some embodiments, the transfection encodes a CRISPR RNA (crRNA). The gene encodes a transactivating crRNA (tracRNA).

[0198] In some embodiments, the nucleic acids, vectors, or other compositions disclosed herein , a minigene (e.g., as described herein), hPGRN, PRE, and polyA sequence. The transgene sequence encoding the signal sequence (e.g., in 5' to 3' order) In some embodiments, the nucleic acid, vector, or other composition comprises, from 5' to 3': The promoter, minigene, and protease cleavage site (e.g., furin cleavage site) are included. a sequence encoding a self-cleaving peptide (e.g., T2A peptide), a sequence encoding a human PG The transgene sequence contains the RN-encoding sequence, PRE, and polyA signal sequence. In embodiments, the nucleic acid, vector, or other composition comprises, from 5' to 3', a promoter, A minigene comprising SEQ ID NO: 16 (e.g., a minigene comprising or containing SEQ ID NO: 71 or SEQ ID NO: 94) a minigene comprising the furin cleavage site comprising or consisting of SEQ ID NO: 19 The self-cleaving T2A peptide encoding the sequence SEQ ID NO: 20 is encoded by a transgene encoding a sequence encoding PRGN (e.g., SEQ ID NO: 87); a transgene encoding SEQ ID NO: 88 and a polyA sequence (e.g., a polyA sequence comprising or consisting of SEQ ID NO: 89). ) is included.

[0199] In any of the foregoing aspects and embodiments, contemplated nucleic acid sequences include DNA, RNA, or modified versions thereof. Modified nucleic acids are polynucleotide chains. backbones, such as peptide nucleic acids (PNAs), morpholinos, locked nucleic acids (LNAs), glycosaminoglycans, Naturally occurring nucleic acids can be modified to Gol Nucleic Acid (GNA) and Threose Nucleic Acid (TNA). Modified nucleic acids may also include analogs in which the four nucleobases are modified. In some embodiments, the nucleic acid is a PNA. In some embodiments, the nucleic acid is a morpholino. In embodiments, the nucleic acid is in single-stranded form. In some embodiments, the nucleic acid is in a double-stranded form. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. It is Do.

[0200] viral vectors The nucleic acids discussed herein (e.g., minigenes, transgenes, promoters, PREs, Vectors containing other nucleic acid components such as poly(A) and poly(A), as well as combinations thereof, are also described herein. In some embodiments, the vector delivers a transgene to a target cell. and / or serve to increase the expression of the transgene in the target cell. In various embodiments, the vector can be used in combination with a splice regulator. proteins, antibodies or functional binding fragments, enzymes, etc., and / or nucleic acids, e.g. Regulate expression of shRNA, siRNA, gRNA, etc. for use with CRISPR, etc. It can be used to

[0201] For example, the vector may be linked to a transgene encoding a therapeutic protein and / or RNA. The vector may contain an "on-switch" minigene linked to it, which upon addition of a splice regulator, activates the introduced gene. In another embodiment, the vector increases expression of a therapeutic protein and / or gene. or an "off switch" minigene linked to a transgene encoding an RNA, Upon addition of a splice regulator, expression of the transgene is reduced. In this case, the vector contains at least one open read sequence of the insert (e.g., transgene sequence). DNA or RNA (or A vector can contain any of a number of sequences (e.g., a mixture of these). A vector is a molecule that serves to transfer genetic information to another cell. The vector may be used for cloning, for example, as a cloning vector or a plasmid. The vectors can be used for other purposes, such as cell infection, for example, in human neuronal cells. For specific purposes, they may also be used to drive expression, e.g., therapeutic protein and / or RNA expression. In some embodiments, vectors containing the nucleic acids disclosed herein can be specifically designed. Vectors are contemplated. The vectors may be DNA vectors, circular vectors or plasmids. In some embodiments, the vector is double-stranded. The vector is single stranded.

[0202] In some embodiments, the vector is a viral vector. In this embodiment, the vector is used to deliver the transgene sequence to neural cells or tissues. Examples of viruses used in vectors include retroviruses, Adenoviruses, lentiviruses, adeno-associated viruses and other hybrid viruses In some embodiments, the viral vector includes, but is not limited to, , adeno-associated virus (AAV) vector, chimeric AAV vector, adenovirus vector vectors, retroviral vectors, lentiviral vectors, DNA viral vectors, single vectors Pure herpes virus vectors, baculovirus vectors, or any mutants thereof Many are derivatives.

[0203] Without being bound by theory, the viral vectors disclosed herein Bacteria can insert their genome into the host cells they infect to deliver their nucleic acid sequences to the host. The introduced viral genome may be episomal, random, or targeted. In one embodiment, the vector is capable of integrating into the host cell chromosome at a site where it can be introduced. A viral vector used to deliver gene sequences into cells. Examples of viruses that can be used include retroviruses, adenoviruses, lentiviruses, and adenoviruses. These include, but are not limited to, viral associates and other hybrid viruses. nock et al.,(2011)Methods Mol.Biol.,737: 1-25. Lentiviruses are able to integrate significant amounts of viral DNA into host cells. It is a genus of retroviruses that can be used to deliver genes, making it an efficient method of gene delivery. The gene transfers genetic material that is not integrated into the host cell's chromosomes, destroying the host cell. In some embodiments, the viral vector is an adeno-associated Viral (AAV) vectors, chimeric AAV vectors, adenovirus vectors, retrovirus vectors Viral vectors, lentiviral vectors, DNA viral vectors, herpes simplex virus vector, baculovirus vector, or any mutant or derivative thereof. be.

[0204] In some embodiments, the vector containing the transgene is an adeno-associated virus (A In some embodiments, the vector is a recombinant vector. The rAAV genome contains a polypeptide (h or a mutant protein encoding a polypeptide (including, but not limited to, a PGRN polypeptide) siRNA, shRNA, and antigens directed against proteins or their gene regulatory sequences A minigene encoding sense and / or miRNA and one flanking the transgene sequence The minigene and transgene sequences may comprise one or more AAV ITRs. It contains a sequence encoding one or more protease cleavage sites or one or more self-cleaving peptides. The peptides may be linked by sequences encoding the peptides, or combinations thereof. Thus, the vector may contain other transcription control elements, such as those disclosed herein, e.g., A promoter, enhancer, or promoter sequence that is functional in the target cell to drive expression of the gene sequence. The transgene sequence further comprises a sensor, PRE and / or polyA sequence. It may also contain intron sequences which facilitate processing of the RNA transcript when expressed.

[0205] In various embodiments, the AAV vector, e.g., rAAV vector, is a self-complementary AAV vector. As used herein, "self-complementary" refers to a self-recombinant AAV vector. The coding region may contain intramolecular double-stranded sequences, e.g., in one or more inverted terminal repeats (ITRs). Without being bound by theory, this means that the plate is designed to form a However, because the typical AAV genome is a single-stranded DNA template, The rapid step often involves second strand synthesis. Ferrari et al. (1996 )J. Virology,70(5):3227-34;Fisher et al,( 1996) J. Virology, 70(1):520-32. However, the scAAV genome In the case of the scAAV, upon infection, the two complementary halves of the scAAV associate to produce the second strand of the vector. A single double-stranded DNA (dsD) is ready for replication and transcription rather than waiting for mediated synthesis. In some embodiments, the rAAV disclosed herein can form a nucleotide (NA) unit. The vector is an scAAV vector, which provides faster and / or increased expression.

[0206] In some embodiments, the rAAV vectors disclosed herein comprise one or more AAV vectors lacking the AAV rep and / or cap genes (e.g., all of them). can be prepared by transfecting nucleic acid sequences (e.g., DNA) from any suitable AAV serotype (e.g., its IT Suitable AAV serotypes include AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV-17, AAV-18, AAV-19, AAV-19, V-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAVrh8, AAVrh10, AAV. Anc80, AAV.Anc80L65, AAV-DJ and AAV-DJ / 8, AAVr h37, AAV-DJ, AAV-DJ / 8, AAV-PHP.B, AAV-PHP.B2 , AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB and AAV-PH For example, AAV vectors, such as scAA The V vector can include nucleic acid sequences from AAV2, such as ITR sequences from AAV2. AAV vectors, such as scAAV vectors, can also contain nucleic acids from multiple serotypes. The nucleotide sequences of the genomes of AV serotypes are known in the art. The complete genome of AAV is available under GenBank accession number NC_002077. The whole genome of 2 is available under GenBank accession numbers NC 001401 and Srivas tava et al., Virol., 45:555-564 (1983) ;The complete genome of AAV3 is available under GenBank accession number NC_1829; The complete AAV4 genome is available under GenBank accession number NC_001829. ;The AAV5 genome is provided under GenBank accession number AF085716; The complete AAV-6 genome is available under GenBank accession number NC_001862. At least a portion of the AAV7 and AAV8 genomes are available from GenBank accessions. The AAV9 genome is available from Gao et al., J. Virol., 78:6381-6388 (2004) ;AAV10 genome is Williams, (2006) Mol. Ther., 13(1) :67-76; the AAV11 genome is provided by Mori et al., (2004)V irology,330(2):375-383.

[0207] In some embodiments, functional inverted terminal repeat (ITR) sequences are provided, e.g., in AAV It can be used to support virion rescue, replication and packaging. Thus, the AAV vectors disclosed herein regulate viral replication and packaging in cis. The ITRs may include sequences that provide transcriptional regulation (e.g., functional ITRs). The sequence may be, but need not be, a peptide sequence, and the sequence must be functional for rescue, replication, and patching. The caging may be modified, for example, by the insertion, deletion, or substitution of nucleotides. ITRs are available for AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, and AA V-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV- Any AAV serum from which recombinant viruses can be derived, including, but not limited to, 11 The nucleotide sequences of the genomes of AAV serotypes are publicly available in the art. For example, the complete genome of AAV-1 is available under GenBank accession number NC_ The complete AAV-2 genome is available under GenBank accession number 002077. NC 001401 and Srivastava et al., Virol., 45:5 55-564 {1983); the entire AAV-3 genome is available at GenBank accession no. The complete AAV-4 genome is available under accession number NC_1829; The AAV-5 genome is available at GenBank accession number NC_001829. The entire AAV-6 genome is available from GenBas nk accession number NC_001862; AAV-7 and AAV-8 genomes At least a portion of the genome is identified by GenBank accession numbers AX753246 and AX753247, respectively. and AX753249; the AAV-9 genome was provided by Gao et al., (200 4) J. Virol., 78:6381-6388; the AAV-10 genome is provided in Williams, (2006) Mol. Ther., 13(1):67-76 The AAV-11 genome is described in Mori et al. (2004) Virology, 330(2):375-383. In one embodiment, the vector is an AAV It is an AAV-9 vector with ITRs derived from -2.

[0208] In some embodiments, the rAAV vectors disclosed herein comprise one or more ITRs, e.g., two ITRs, one encoding a transgene (e.g., hPGRN) and / or one upstream of another nucleic acid element discussed above, and one downstream. In some embodiments, the vectors disclosed herein, e.g., in scAAV vectors, The nucleic acid may be a promoter, a minigene, a transgene, a post-transcriptional regulatory element, and / or a polynucleotide. A first ITR located 5' and a second ITR located 3' to A, e.g. For example, an ITR can independently select elements 1, 2, 3, 4, 5, 6, 7, 8, and 9 of another element. 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 50, 10 0, 150, 200, 250 nucleotides 5' and / or 3' of the ITR sequence. It can be wild-type or, for example, as long as it retains one or more functions of the wild-type ITRs. In some embodiments, the wild-type ITRs may contain one or more mutations. In some embodiments, the presently disclosed The resulting scAAV may contain two ITR sequences, both of which may be wild-type, mutant, or modified. In some embodiments, at least one ITR sequence is an AAV ITR sequence. The R sequence is a wild-type, mutant, or modified AAV ITR sequence. In this embodiment, the two ITR sequences may both be wild-type, mutant, or modified AAV ITR sequences. In some embodiments, the "left" or 5'-ITR is a self-complementary genomic DNA sequence. and the "right" or 3'-ITR is a modified AAV ITR sequence that allows for the production of The wild-type AAV ITR sequence. In some embodiments, the "right" or 3'-ITR sequence is R is a modified AAV ITR sequence that allows for the production of a self-complementary genome, and or the 5'-ITR is a wild-type AAV ITR sequence. The ITR sequences may be wild-type, mutant, or modified AAV2 ITR sequences. In one embodiment, at least one ITR sequence is a wild-type, mutant, or modified A In some embodiments, the two ITR sequences are both In some embodiments, the AAV2 ITR sequences are wild-type, mutant, or modified AAV2 ITR sequences. The "left" or 5'-ITR is a modified AAV2 that allows for the production of self-complementary genomes. ITR sequence, and the "right" or 3'-ITR is the wild-type AAV2 ITR sequence. In some embodiments, the "right" or 3'-ITR allows for the production of self-complementary genomes. The "left" or 5'-ITR is a modified AAV2 ITR sequence that enhances AAV2 transcriptional activity. Exemplary sequences that can be used for one or more ITRs are provided herein. In some embodiments, the AAV vector comprises SEQ ID NO: 12 and SEQ ID NO: 23. In some embodiments, the AAV vector comprises SEQ ID NO: 85 and SEQ ID NO: 23. Including No. 90. International Publication No. 2019 / 094253 (PCT / U.S. Patent Publication) An embodiment of the AAV ITR provided in Published Application No. 2018 / 058744 includes: Any AAV IT disclosed herein, which is incorporated by reference in its entirety, It can also be used for R.

[0209] In various embodiments, the vectors disclosed herein are In some embodiments, the nucleic acid sequence encoding the PGRN may include a minigene and a nucleic acid sequence encoding the PGRN. Addition of a splice regulator increases the expression of functional PRGN polypeptide in target cells. In another embodiment, the addition of a splice regulator results in functional regulation of the target cell. In some embodiments, the vector reduces the expression of the PRGN polypeptide. In some embodiments, the vector is a transgene encoding hPGRN. The vector containing the vector is AAV or derived from AAV. In various embodiments, the vector is an rAAV. AAV vectors, such as rAAV vectors, containing transgenes encoding RNs are The rAAV genome contains one nucleotide sequence flanking the transgene sequence encoding hPGRN. The transgene sequence may comprise one or more AAV ITRs, such as those disclosed herein. Transcriptional control elements, e.g., those that function in target cells to drive expression of transgene sequences. operably linked to a promoter, enhancer, PRE and / or polyA sequence that is functional It can be done.

[0210] In some embodiments, the rAAV vector comprises one or more (e.g., all) A AAV vectors lack the AAV rep and / or cap genes. It may contain (e.g., in its ITRs) nucleic acid sequences (e.g., DNA) from an AV serotype. The relevant AAV serotypes include AAV-1, AAV-2, AAV-3, and AAV-4. , AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and A For example, AAV vectors, such as sc AAV vectors include nucleic acid sequences from AAV-2, such as ITR sequences from AAV-2. AAV vectors, such as scAAV vectors, may also contain nucleic acids from multiple serotypes. GenBank accession numbers NC 001401 and Srivastava et al.,Virol.,45:555-564{1983);GenBank a Accession number NC_1829; GenBank accession number NC_00182 9;GenBank accession number AF085716;GenBank accession Accession number NC_001862; GenBank accession number AX753246 and A X753249;Gao et al.,J.Virol.,78:6381-6388 (2004);Williams,(2006)Mol.Ther.,13(1):67 -76; and Mori et al., (2004) Virology, 330(2): 375-383.

[0211] In some embodiments, a transgene encoding the hPGRN disclosed herein A functional inverted terminal repeat (ITR) sequence in a viral vector containing the gene may be, for example, AA It can be used to support the rescue, replication and packaging of V virions. Thus, the AAV vectors disclosed herein regulate viral replication and packaging in cis. The ITRs may include sequences that provide transcriptional regulation (e.g., functional ITRs). The sequence does not have to be a nucleotide sequence, but rather provides functional rescue, replication, and packaging. The ITRs may be altered, for example, by the insertion, deletion, or substitution of nucleotides, so long as they are AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV- 6, AAV-7, AAV-8, AAV-9, AAV-10, and AAV-11, from any AAV serotype from which recombinant viruses can be derived, including but not limited to: GenBank accession number NC_002077; GenBank accession number Session No. NC 001401 and Srivastava et al., Virol .,45:555-564{1983);GenBank accession number NC_18 29;GenBank accession number NC_001829;GenBank accession Accession number AF085716;GenBank accession number NC_001862; GenBank accession numbers AX753246 and AX753249, respectively;G ao et al.,(2004)J.Virol.,78:6381-6388;Wi lliams, (2006) Mol. Ther., 13(1):67-76; and Mor i et al., (2004) Virology, 330(2):375-383. one In embodiments, the vector is an AAV-9 vector with ITRs from AAV-2. be.

[0212] In some embodiments, the AAV viral vector comprises the sequence of SEQ ID NO: 91. In some embodiments, the AAV viral vector comprises the sequence of SEQ ID NO: 11. In each of these embodiments, the transgene sequence may be, for example, any of the sequences described herein. As such, sequences encoding alternative molecules of interest can be substituted.

[0213] In some embodiments, the vectors or nucleic acid sequences disclosed herein are cloned. In such an embodiment, the vector is In some embodiments, the vector may contain other components that facilitate replication or maintenance of the vector. In some embodiments, the vector further comprises a selectable marker for clonal selection. In the present invention, the selectable marker in the vector is a prokaryotic or eukaryotic antibiotic resistance gene. In some embodiments, the selectable marker in the vector is a kanamycin resistance gene. In some embodiments, the selectable marker in the vector is an ampicillin gene. In some embodiments, the vector comprises a puromycin resistance gene. In some embodiments, the selectable marker in the vector further comprises a hybridization gene. In some embodiments, the vector (e.g., a phenothiazine or phenothiazine) comprises a thromycin resistance gene. mid) comprises the nucleic acid sequence of SEQ ID NO:92.

[0214] Exemplary AAV vector sequence containing a minigene and transgene encoding EGFP: [ka]

[0215] Tables 2 and 3 show exemplary sequences of nucleic acids, vectors and minigenes.

[0216] [Table 5]

[0217] [Table 6]

[0218] [Table 7]

[0219] [Table 8]

[0220] [Table 9]

[0221] [Table 10]

[0222] [Table 11]

[0223]

Table 12

[0224]

Table 13

[0225]

Table 14

[0226]

Table 15

[0227] Table 16

[0228]

Table 17

[0229]

Table 18

[0230]

Table 19

[0231] Table 20

[0232] Table 21

[0233] [Table 22]

[0234] [Table 23]

[0235] [Table 24]

[0236] In various embodiments, the minigenes or vectors disclosed herein are spliced The level of a functional polypeptide, e.g., hPGRN, is increased in response to the presence or absence of a phosphodiesterase inhibitor. In some embodiments, the compounds disclosed herein can be used to increase the levels of The vectors shown show a significant increase in expression of the same vector in the absence of a splice regulator. In some embodiments, the expression of the transgene sequence is higher in the presence of a splice regulator. In the method, the level of expression of the molecule of interest in the presence of a splice regulator is referred to as a splice regulator. greater than the expression level of the molecule of interest in the absence of the agent, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times larger. In some embodiments, the level of expression of the molecule of interest in the absence of a splice regulator The level of expression of the molecule of interest is greater than the level of expression in the presence of the splice regulator, e.g., 2, 3 , 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 In some embodiments, the increase in expression of the transgene sequence is greater than 100 times. In some embodiments, the expression of a gene is measured by an increase in the number of RNA transcripts of the gene sequence. In some embodiments, increased expression of the transgene sequence is measured by PCR. In some cases, increased expression of the transgene sequence is measured by RT-PCR. In an embodiment, the increase in expression of the transgene sequence is measured by qPCR. In some embodiments, the increased expression of the transgene sequence is measured by qRT-PCR. In some embodiments, increased expression of the transgene sequence can be determined by sequencing. In some embodiments, increased expression of the transgene sequence is measured using Northern blot analysis. In some embodiments, the expression of the transgene sequence is measured by lot analysis. Increases measured by single molecule fluorescence in situ hybridization (FISH) In some embodiments, increased expression of the transgene sequence is It is measured by an increase in the amount of the protein encoded by the gene. In morphology, increased expression of the transgene sequence can be measured by enzyme-linked immunosorbent assay (ELISA). In some embodiments, increased expression of the transgene sequence is measured by In some embodiments, the transgene sequence is determined by Eastern blot analysis. Increased expression of the gene is measured by immunostaining. Increased expression of the gene sequence may be measured by several of the methods listed above. In some embodiments, the increased expression of the transgene sequence is due to an increase in the expression of an mRNA comprising the second exon. In some embodiments, the increased expression of the transgene sequence is measured by the amount of A. is determined by the amount of mRNA containing the direct first to third exon splice. The results are measured by incorporating either an on-switch minigene or an off-switch minigene. Exemplary polynucleotides produced from vectors containing the splice regulators in the presence or absence of splice regulators are shown. The peptides are shown in Figure 3 (in each case, cleavage of the protease cleavage site and / or before the self-cleaving peptide sequence).

[0237] Recombinant viruses In various embodiments, the nucleic acids and vectors discussed herein are recombinant viruses. A recombinant virus can be present in one or more viral particles, such as a virus particle. A variety of different virus types, such as retroviruses, Adenovirus, lentivirus, AAV, murine leukemia virus, etc. may be used. Without being bound by theory, it is believed that the delivery may be from a retrovirus, such as a lentivirus. Vectors allow for long-term stable integration of the transgene and its transmission to daughter cells. Therefore, it may provide long-term gene transfer and may also provide low immunogenicity. Retroviruses include gammaretroviruses. Exemplary gammaretroviral vectors include: The targets are murine leukemia virus (MLV), spleen-limited focus-forming virus (SFFV), and bone marrow This includes the multiplying sarcoma virus (MPSV) and vectors derived therefrom. Viral vectors are described, for example, in Tobias Maetzig et al., "Gam maretroviral Vectors: Biology, Technology and Application”Viruses.2011 Jun;3(6):67 In some embodiments, the virus is a virus as disclosed herein. In some embodiments, the adenovirus is a recombinant adenovirus comprising the nucleic acid or vector. The virus is a recombinant AAV comprising a nucleic acid or vector disclosed herein.

[0238] In some embodiments, the nucleic acids or vectors disclosed herein are recombinant viruses. In some embodiments, the present invention is for use in the manufacture of a drug. The disclosed nucleic acids or vectors are for use in producing rAAV. Thus, in various embodiments, viral compositions (also called virions), e.g., rAAV virus compositions containing the above-disclosed viral vectors or nucleic acids are also disclosed herein. In some embodiments, the recombinant virus is an adeno-associated virus (AA V) or any variant or derivative thereof. The virus is a chimeric AAV or any variant or derivative thereof. In some embodiments, the recombinant virus is an adenovirus or any mutant or derivative thereof. In some embodiments, the recombinant virus is a retrovirus or any of its In some embodiments, the recombinant virus is a mutant or derivative of In some embodiments, the virus is a virion or any mutant or derivative thereof. A recombinant virus is a DNA virus or any mutant or derivative thereof. In some embodiments, the recombinant virus is a herpes simplex virus or any variant thereof. or a derivative thereof. In some embodiments, the recombinant virus is a baculovirus. The compound is a genus of the present invention, such as genus thrombus or any mutant or derivative thereof.

[0239] In some embodiments, the AAV disclosed herein comprises one or more AAV carriers. The AAV capsid protein may comprise an AAV serotype AAV-1. , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV -8, AAV-9, AAV-10, AAV-11, AAV-12, AAVrh8, AAV fh10, AAV-DJ, AAV-DJ / 8, AAV-PHP.B, AAV-PHP.B 2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB and AAV-P Any AAV from which a recombinant virus can be derived, including, but not limited to, HP.S. In some embodiments, one or more capsids in an AAV may be from one serotype. The capsid protein is from AAV-9. Without being bound by theory, Typically, in AAV, three capsid proteins, VP1, VP2, and VP3, are present. The polypeptide sequences of the capsid proteins are known in the art. These are known in the art and can be derived from the genome of AAV. It can be used as an exemplary capsid in an AAV virus composition. The complete AAV-1 genome is available under GenBank accession number NC_002077 The complete AAV-2 genome is available under GenBank accession numbers NC 001401 and and Srivastava et al., Virol.,45:555-564{198 3) and the entire AAV-3 genome is available under GenBank accession number NC_18 The complete AAV-4 genome is available under GenBank accession number NC_00 1829; the AAV-5 genome is available under GenBank accession number AF08 The entire AAV-6 genome is available under GenBank accession number NC_ 001862; at least a portion of the AAV-7 and AAV-8 genomes are provided in These are available under GenBank accession numbers AX753246 and AX753249. AAV-9 genome is from Gao et al., J. Virol., 78:6381-63 88 (2004); the AAV-10 genome is provided by Williams, (2006) M Ther., 13(1):67-76; the AAV-11 genome is provided by Mori et al., (2004) Virology, 330(2):375-383. Capsid proteins AAV-PHP.B, AAV-PHP.B2, AAV-P HP.B3, AAV-PHP.A, AAV-PHP.eB or AAV-PHP.S is D everman et al.,(2016)Nat.Biotech.,34:204 -209 and Chan et al., (2017) Nat. Neurosci., 20 In some embodiments, the recombinant virus is one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAV11, AAV12, AAVrh8, AAVr h10, AAV-DJ, AAV-DJ / 8, AAV-PHP.B, AAV-PHP.B2 , AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB or AAV- An AAV comprising the PHP.S capsid serotype or a functional variant thereof. In some forms, recombinant viruses contain a combination of capsids from multiple AAV serotypes. It is an AAV containing

[0240] In some embodiments, the AAV compositions disclosed herein contain viral DNA. Directs replication (rep), encapsidation / packaging, and host cell chromosomal integration In some embodiments, the ITRs comprise one or more cis-acting sequences that However, one or more of these sequences may be present in trans rather than cis, e.g., during viral production in a host cell. They may also be present on separate plasmids during the construction process. Typically, three AAV promoters are present. The targets (designated p5, p19, and p40 by their relative map positions) were wild-type Two AAV internal open reading frames encoding the viral rep and cap genes In some embodiments, these promoters and / or or one or more of the open reading frames are included in the AAV vectors disclosed herein. and / or present in cis in the AAV virion or in the AAV viral production process In the host cell that produces the virus, for example, they are present on separate plasmids. The rep promoters (p5 and p19) contain a single AAV intron (nucleotide 2 107 and 2227), coupled with differential splicing, four rep genes were isolated from the rep gene. p proteins (rep78, rep68, rep52 and rep40) The rep protein possesses multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is typically expressed from the p40 promoter and produces three capsids. Encodes proteins VP1, VP2, and VP3. The .sinus translation initiation site is responsible for the production of three related capsid proteins. One consensus polyadenylation site is present at map position 95 of the AAV genome. The life cycle and genetics of AV are reviewed in Muzyczka, (1992) Curr. Top ics Microbiol.Imm.,158:97-129.

[0241] In some embodiments, the AAV capsids used in the AAVs disclosed herein are The side proteins VP1, VP2, and VP3 are encoded by or are the sequences Includes. VP1 nucleic acid (SEQ ID NO:74): [ka] VP2 nucleic acid (SEQ ID NO:75): [ka] VP3 nucleic acid (SEQ ID NO:76): [ka] VP1 protein (SEQ ID NO: 77): [ka] VP2 protein (SEQ ID NO: 78): [ka] VP3 protein (SEQ ID NO: 79): [ka]

[0242] In one embodiment, the recombinant virus is of the AAV9 capsid serotype or any variant thereof. In some embodiments, the recombinant virus is an AAV, including variants or derivatives. contains the AAV9 capsid proteins VP1, VP2, and VP3. In some embodiments, the recombinant virus is a scAAV.

[0243] In some embodiments, the recombinant virus expresses functional polypeptides in a particular cell type. In some embodiments, the present invention can be used to increase the level of a peptide. The viruses disclosed in this document are specifically identified as being different from the expression of the same virus in different tissue types. In some embodiments, the expression of the transgene sequence in the tissue type is higher. The virus inhibits the expression of neural tissues compared with the expression of the same virus in non-neural tissues, body fluids, or cells. In some embodiments, the expression of the transgene sequence in the tissue, body fluid, or cell is higher. In this context, the vectors disclosed herein are similar to the same vectors in the absence of splice regulators. show higher expression of the transgene sequence in the presence of a splice regulator compared to expression in the absence of a splice regulator In some embodiments, the target gene is expressed from the recombinant virus in the presence of a splice regulator. The level of expression of the target molecule from the recombinant virus in the absence of the splice regulator is The expression level of the molecule is greater than, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times greater. In this case, the level of expression of the molecule of interest from the recombinant virus in the absence of a splice regulator is The level of expression of the molecule of interest from the recombinant virus in the presence of a splice regulator is Large, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60 , 70, 80, 90, or 100 times larger. In some embodiments, the transgene sequence Increased expression is measured by an increase in the number of RNA transcripts of the transgene sequence. In some embodiments, the increase in expression of the transgene sequence is measured by PCR. In some embodiments, the increased expression of the transgene sequence is measured by RT-PCR. In some embodiments, increased expression of the transgene sequence is determined by qPCR. In some embodiments, increased expression of the transgene sequence is measured by qRT-PCR. In some embodiments, the increased expression of the transgene sequence is measured by PCR. is measured by sequencing. In some embodiments, the expression of the transgene sequence The increase in expression is measured by Northern blot analysis. Increased expression of the transgene sequence was confirmed by single molecule fluorescence in situ hybridization (F In some embodiments, increased expression of the transgene sequence is measured by ISH. The increase is measured by the increase in the amount of protein encoded by the transgene produced. In some embodiments, increased expression of the transgene sequence is achieved by enzyme-linked immunosorbent assay (ELISA). In some embodiments, the transgene sequence is measured by an ELISA assay. Increased expression of the gene is measured by Western blot analysis. In some embodiments, increased expression of the transgene sequence is measured by immunostaining. In some embodiments, increased expression of the transgene sequence can be achieved by more than one of the methods listed above. In some embodiments, increased expression of the transgene sequence is measured by a second In some embodiments, the amount of exon-containing mRNA is measured by the amount of exon-containing mRNA. Increased expression of gene sequences involves direct first- to third-exon splicing. It is measured by the amount of mRNA that contains the on-switch minigene or off-switch minigene. Produced from a vector incorporating either of the vectors in the presence or absence of a splice regulator. Exemplary polypeptides obtained are shown in Figure 3 (in each case, protease cleavage). (before the cleavage site and / or self-cleaving peptide sequence) If a polypeptide contains a self-cleaving peptide sequence, the sequence indicates that the protein of interest is a mini- Without heterologous sequences derived from the gene or cleavage sequence (or 1, 2, 3, 4, 5, 6, 7, 8, It is contemplated that the amino acid sequence may be truncated to produce less than 9 or 10 amino acids.

[0244] In various embodiments, the target cells of the present disclosure can be any mammalian cell type. In some embodiments of the disclosure, the nucleic acids and vectors are used to detect and / or detect the expression of IL-1 in neural tissue or body fluids or cells. In some embodiments, the neural tissue is the brain. In some embodiments, the neural tissue is the frontal lobe of the brain. In some embodiments, the neural tissue is in the central nervous system. In some embodiments, the neural tissue is the spinal cord. are human neural cells. In some embodiments, the neural cells are neurons. In some embodiments, the neuronal cells are astrocytes. In some embodiments, the non-neural tissue is liver. In some embodiments, the non-neuronal body fluid is plasma. In some embodiments, the non-neuronal cells are stellate adipose tissue cells. In some embodiments, the non-neuronal cells are Kupffer cells. In some embodiments, the non-neuronal cells are liver endothelial cells. In some embodiments, the non-neuronal fluid is blood plasma. In some embodiments, the non-neuronal fluid is blood serum. In an embodiment, the non-neuronal body fluid is blood.

[0245] Methods for producing recombinant viruses In various embodiments, recombinant viruses containing neuron-specific promoters are produced. Also disclosed herein are methods for determining whether a nucleic acid sequence, e.g., AA Plasmids encoding V or other viral genomes are used to produce recombinant viruses. In some embodiments, the AAV rep gene and / or the AAV c gene are used. Nucleic acid sequences containing the ap gene, such as plasmids, are also useful in preparing AAV or other viruses. Nucleic acid sequences containing adenoviral helper function genes, such as plasmids, are also used herein. In some embodiments, AAV rep, AAV cap, and The nucleic acids encoding the adenoviral helper genes are arranged in the same structure, e.g., a single promoter. The nucleotides may be present in the plasmid or they may be present in separate structures. In the method, one or more plasmids are competent to encode a nucleic acid encoding an AAV vector. The vector is co-transfected into host cells, and the cells are cultured to produce recombinant virus. Optionally, the AAV viral genome and the AAV rep and / or cap genes are encoded. The loading plasmid is a helper virus for AAV (e.g., adenovirus, E1-deleted The virus is introduced into cells that are permissive for infection with the virus (e.g., adenovirus or herpesvirus). In some embodiments, the rAAV genome is transfected into the cell and then transformed into an AAV Assembled into infectious viral particles containing capsid proteins. The AAV genome, rep and cap genes, and helper virus functions are provided to the cell. Techniques for producing rAAV particles are known in the art and include, for example, electroporation. In some embodiments, the production of rAAV can involve single cell poration. The packaging cell comprises the following components present within the packaging cell: AAV vectors, AAV rep and rAAV vectors separate from (i.e., not contained in) and cap genes and helper virus functions. Pseudotyped rAAV can be generated using, e.g. , International Publication No. WO 01 / 83692, which is incorporated herein by reference in its entirety. In various embodiments, the AAV capsid protein is recombinant. Modifications of capsid proteins can be made to enhance delivery of the vector. This is commonly known in the art, e.g., U.S. Patent Application Publication No. 2005 / 0053922 No. 2009 / 0202490 (the disclosures of which are incorporated herein by reference in their entirety) (which is incorporated herein by reference in its entirety).

[0246] In various embodiments, the general principles of viral vector production are utilized to produce the The vectors and viruses shown can be produced, for example, rAAV. Carter, (1999 2)Curr.Opinions Biotech.,1533-539;Muzycz ka,(1992)Curr.Topics Microbial.Immunol., 158:97-129. Various approaches have been proposed by Ratschin et al., (198 4)Mol.Cell.Biol.,4:2072;Hennonat et al., (1984)Proc.Natl.Acad.Sci.USA,81:6466;Tra tschin et al.,(1985)Mol.Cell.Biol.,5:325 1;McLaughlin et al.,(1988)J.Virol.,62:19 63;Lebkowski et al.,(1988)Mol.Cell.Biol. ,7:349;Samulski et al.(1989)J.Virol.,63: 3822-3828; U.S. Patent No. 5,173,414; WO 95 / 133 No. 65 and corresponding U.S. Pat. No. 5,658,776; International Publication No. 5 / 13392; WO 96 / 17947; PCT / U.S. Patent No. 98 / 18600; International Publication No. 97 / 09441 (P CT / US Patent No. 96 / 14423; International Publication No. 97 / 08298 (PCT / US Patent No. 96 / 13872); WO 97 / 21825 Pamphlet (PCT / US Patent No. 96 / 20777); International Publication No. 97 / 06 Pamphlet No. 243 (PCT / French Patent No. 96 / 01064); International Publication No. Pamphlet No. 9 / 11764; Perrin et al., (1995) Vacci ne,13:1244-1250;Paul et al.,(1993)Hum.Ge ne Ther.,4:609-615;Clark et al.(1996)Gen e Therapy, 3:1124-1132; U.S. Patent No. 5,786,211 U.S. Patent No. 5,871,982; and U.S. Patent No. 6,258,595 The foregoing documents are incorporated herein by reference in their entirety, and in particular, Emphasis will be placed on the literature section related to AV production.

[0247] An exemplary method for producing packaging cells is to produce all the components necessary for the production of AAV particles. The goal is to generate cell lines that stably express AAV rep and cap genes. A plasmid (or plasmids) encoding the rAAV vector lacking the gene, rAA AAV rep and cap genes and neomycin resistance gene separate from V vectors The AAV genome is integrated into the cell genome by a GC tailing (S amulski et al.,(1982)Proc.Natl.Acad.Sci. USA, 79:2077-2081), synthetic phosphorylation products containing restriction endonuclease cleavage sites Carr adds (Laughlin et al., (1983) Gene, 23:65-7 3) or by direct blunt-end ligation (Senapathy et al. ,(1984) J. Biol. Chem., 259:4661-4666) The adenovirus is then introduced into the bacterial plasmid. The virus is infected with a helper virus such as a virion and / or a plasmid encoding the helper virus. The advantages of this method are that the cells are selectable and it is suitable for large-scale production of rAAV. Other examples of suitable methods include those using adenoviruses or baculoviruses rather than plasmids. Packaging rAAV vectors and / or rep and cap genes using rAAV Introduce into cells.

[0248] In some embodiments, the method for producing a recombinant virus comprises packaging the virus. In some embodiments, the nucleic acid is a plasmid. In this embodiment, the nucleic acid is inserted between the first and second AAV terminal repeats. In some embodiments, the transgene comprises a human protease. In some embodiments, the recombinant virus encodes human granulin (hPGRN). In some embodiments, the method for producing the nucleic acid includes providing one or more additional nucleic acids. wherein the one or more additional nucleic acids are an AAV rep gene and / or an AAV cap In some embodiments, the one or more additional nucleic acids comprise an AAV serotype 1 gene. , AAV serotype 2, AAV serotype 3, AAV serotype 4, AAV serotype 5, AAV serotype 6 , AAV rep gene derived from AAV serotype 7, AAV serotype 8 or AAV serotype 9 In some embodiments, the one or more additional nucleic acids include AAV serotype 1, AA V serotype 2, AAV serotype 3, AAV serotype 4, AAV serotype 5, AAV serotype 6, AA Contains the AAV cap gene from AAV serotype 7, AAV serotype 8, or AAV serotype 9 In some embodiments, the one or more additional nucleic acids are delivered to one or more adenoviruses. Contains the Luper functional gene.

[0249] In some embodiments, the nucleic acid is transfected into competent cells or packaging cells. Co-transfection methods are known in the art and include Transfection with pofectamine, electroporation, and polyethyleneimine Competent cells or packaging cells The H may be non-adherent cells cultured in suspension or adherent cells. Any suitable cell line, such as eLa cells, HEK293 cells, and PerC.6 cells (the homologous 293 line), may be used. Any suitable packaging cell line may be used. In one embodiment, the packaging cell line is In one embodiment, the packaging cells are human cells. In one embodiment, the packaging cells are insect cells. The caged cells are Sf9 cells. In some embodiments, the method comprises the steps of: and culturing the infected cells to produce the recombinant virus. The method includes recovering the recombinant virus. Methods include, for example, those described in U.S. Pat. No. 6,143,548 and U.S. Pat. No. 9,408,999. In some embodiments, the recombinant virus is used in the method disclosed in US Pat. No. 5,620,434. The protein is secreted into the cell culture medium and purified from the medium. The packaging cells are lysed and the contents purified to recover the recombinant virus. In some embodiments, the virus is removed from the packaging cells by filtration or centrifugation. In some embodiments, the virus is recovered by chromatography. The resulting product is then recovered from the packaging cells.

[0250] In various embodiments, cells comprising the nucleic acids disclosed herein, Cells containing the vectors or cells containing the viruses disclosed herein are disclosed herein. Cells containing the nucleic acids disclosed herein, cells containing the vectors disclosed herein Alternatively, the cells containing the viruses disclosed herein can be human cells. A cell containing a nucleic acid as disclosed herein, a cell containing a vector as disclosed herein, or a cell containing a vector as disclosed herein. The virus-containing cells may also be insect cells. Cells containing the nucleic acids disclosed herein, cells containing the vectors disclosed herein or cells containing the vectors disclosed herein The virus-containing cells disclosed therein are HEK293 cells. In some embodiments, cells containing the nucleic acids disclosed herein, cells containing the vectors disclosed herein, The cells containing or comprising the viruses disclosed herein are Sf9 cells.

[0251] In some embodiments, the method for producing a recombinant virus comprises transfecting an insect cell with the recombinant virus. In some embodiments, the method comprises infecting a gene encoding a gene encoding a nucleotide sequence as disclosed herein. The method includes transfecting insect cells with a baculovirus containing such nucleic acid. In some embodiments, the method includes: Insect cells are transfected with a baculovirus containing a nucleic acid containing the transgene sequence inserted into the In some embodiments, the method includes injecting one or more additional nucleic acids. Some implementations involve transfecting insect cells with a baculovirus containing In some embodiments, the one or more additional nucleic acids may be an AAV rep gene and / or an AAV c gene. In some embodiments, the one or more additional nucleic acids comprise an AAV serum. type 1, AAV serotype 2, AAV serotype 3, AAV serotype 4, AAV serotype 5, AAV serotype AAV rep genes derived from AAV serotype 6, AAV serotype 7, AAV serotype 8, or AAV serotype 9 In some embodiments, the one or more additional nucleic acids include genes encoding AAV serotype 1, AAV serotype 2, AAV serotype 3, AAV serotype 4, AAV serotype 5, AAV serotype 6, AAV cap genes derived from AAV serotype 7, AAV serotype 8, or AAV serotype 9.c In some embodiments, the one or more additional nucleic acids include one or more adenosines. In some embodiments, the insect cells contain recombinant virus helper function genes. In some embodiments, the virus is cultured under conditions suitable for producing the virus. In some embodiments, the virus is recovered from the insect cells by filtration or centrifugation. In some embodiments, the virus is recovered from the insect cells by centrifugation. It is recovered from insect cells by chromatography.

[0252] Pharmaceutical Composition In various embodiments, pharmaceutical compositions are disclosed. The pharmaceutical compositions comprise one or more of the nucleic acids, vectors and / or viruses disclosed herein. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

[0253] The nucleic acids, vectors and / or recombinant viruses (e.g., viral particles) according to the present disclosure may be: It can be formulated to prepare pharmaceutically useful compositions. Exemplary formulations include, for example: See, for example, U.S. Pat. No. 9,051,542 and U.S. Pat. No. 6,229,649, which are incorporated by reference in their entireties. Compositions of the present disclosure include those disclosed in US Pat. No. 6,703,237. The compound can be formulated for administration to a mammalian subject, e.g., a human. In embodiments, the delivery system is an intramuscular, intradermal, mucosal, subcutaneous, intravenous, intrathecal, injectable, It may be formulated for topical administration or in a portable device.

[0254] In some embodiments, when the delivery system is formulated as a solution or suspension, the delivery The system is in an acceptable carrier, such as an aqueous carrier. A variety of aqueous carriers are available, such as water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid, etc. may be used. The composition may be sterilized and / or sterile filtered. The resulting aqueous solution may be diluted for immediate use. It may be packaged or lyophilized. In some embodiments, lyophilization The preparation is combined with a sterile solution prior to administration.

[0255] In some embodiments, the composition, e.g., pharmaceutical composition, comprises a pH adjusting agent and a buffering agent, Tonicity adjusters, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, salt Potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate It may contain pharmaceutically acceptable auxiliary substances to approximate physiological conditions, such as amines, etc. In some embodiments, the pharmaceutical composition includes a preservative. Therefore, the pharmaceutical composition does not contain preservatives.

[0256] Methods of Use and Treatment Without being bound by theory, the nucleic acids and other embodiments described herein may be used to In a method for conditionally expressing a molecule (e.g., a protein), the method comprising: An expression system, such as a nucleic acid molecule described herein, a vector described herein, or a contacting cells containing the recombinant virus with a splice regulator, e.g., LMI070; a) in the presence of said splice regulator, expression of said protein of interest is increased expression level of the protein of interest relative to the level in the absence of the splice regulator; For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times larger; and b) in the absence of said splice regulator, expression of said protein of interest is spliced. The expression level of the protein of interest is substantially reduced relative to that in the presence of the expression-modulating agent, e.g. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50 or 100 times smaller.

[0257] In embodiments, the nucleic acids and other embodiments described herein are used to prepare a protein of interest. and in a method for expressing the nucleotides of the present invention, the method comprising the steps of: A cell comprising a nucleic acid molecule, a vector described herein, or a recombinant virus described herein. a) contacting said splice modulator with a splice modulator, e.g., LMI070; In the absence of a splice regulator, expression of the protein of interest is the expression level of said protein of interest is increased, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, or 100 times greater; and b) the splice regulator In the presence of the splice regulator, expression of the protein of interest is greater than in the absence of the splice regulator. The expression level of the protein is substantially reduced, e.g., , 9, 10, 20, 30, 50 or 100 times smaller.

[0258] In embodiments, a method of treating a subject in need of gene therapy is provided, said method comprising: The nucleic acid molecules described herein, the vectors described herein, the recombinant viruses described herein, In one embodiment, the method comprises administering to the subject a virus or a pharmaceutical composition described herein. In some embodiments, the method further comprises administering to the subject a splice regulator. Alternatively, the splice regulator may be administered periodically (e.g., separated by periods of no administration). In an embodiment, the method comprises the step of: The expression level of the protein of interest is at least 2, 3, 4, 5 , 6, 7, 8, 9, 10, 20, 30, 50 or 100 fold increase or decrease and administering to the subject an amount of a splice regulator, e.g., LMI070, effective to .

[0259] Without being bound by theory, neuron-specific proteins such as progranulin Mutations in genes encoding proteins may be associated with neurodegenerative diseases. Therefore, the nucleic acids, vectors and viruses disclosed herein are useful for detecting and treating neurodegenerative disorders, the loss of which is associated with neurodegenerative diseases. can be administered to increase neuron-specific expression of the associated wild-type gene. For example, administration can be used to increase levels of functional progranulin polypeptide. Co-treatment with splice regulators can regulate (modulate) expression levels. In some embodiments, the nucleic acids, vectors and / or viruses disclosed herein Administering a drug can treat, prevent, delay, or slow down a disease such as frontotemporal dementia. In some embodiments, the nucleic acids, vectors disclosed herein can be used to and viruses are used in conjunction with splice regulators to regulate transgene expression. can be.

[0260] As used herein, "frontotemporal dementia" (FTD) refers to dementia that occurs primarily in the frontal and temporal lobes of the brain. a diverse group of disorders (generally affecting areas related to personality, behavior, and language) FTD is typically caused by degeneration of the frontotemporal dementia region of the brain. In frontotemporal dementia, some of these lobes shrink (atrophy). Signs and symptoms include: It can vary depending on the part of the brain affected. The condition is accompanied by extreme changes in behavior and personality. These include increased inappropriate behavior, empathy, and other Loss of interpersonal skills, poor judgment and inhibitions, emotional stunting, repetitive compulsive behaviors, poor personal hygiene Decreased vitality, changes in eating habits, mainly overeating, oral exploration and inability to eat, drink, think or act The rarer subtypes of FTD include Parkinson's disease, It is characterized by movement problems similar to those associated with Parkinson's disease or amyotrophic lateral sclerosis. Mutations in certain genes may cause both FTD and amyotrophic lateral sclerosis (ALS) Since the discovery of ALS, FTD and ALS share a common neurodegenerative pathway and are part of a common spectrum. Recently, the progranulin gene (GRN) has been shown to be involved in the pathogenesis of leukemia. Mutations in hPGRN have been identified as the primary cause of FTD, with the majority of mutations affecting functional hPGRN This leads to loss of polypeptides. Babykumari et al., (201 7)Brain,140(12):3081-3104;Baker et al.,( 2006)Nature,442:916-19;Cruts et al.,(200 6)Nature,442:920-4 ;Gaweda-Walerych et a l,(2018)Neurobiol.Aging,72:186.e9-186.e1 2;Galimerti et al.,(2018)Expert Opin.The r.Targets,22(7):579-585;Wauters et al.,( 2018) Neurobiol.Aging, 67:84-94; and Mendez, ( 2018)Neuropsychiatr.Dis.Treat.,26:14:657 Methods for detecting mutations in PGRN include, for example, those described in International Publication No. 2008 / 0 This includes those disclosed in Brochure No. 19187.

[0261] In various embodiments, the nucleic acids, vectors and / or viruses disclosed herein are , a disorder caused by one or more mutations in the gene encoding progranulin In one embodiment, the term "treat" can be used in methods of treating The use of compositions comprising the nucleic acids, vectors, recombinant viruses or pharmaceutical compositions disclosed herein administering an effective dose or effective doses to an animal (including a human) in need thereof. Administration is prophylactic if the dose is administered prior to the onset of the disorder / disease. If the dose is administered after the onset of symptoms, the administration is therapeutic. In embodiments, an effective dose is: detectably alleviating (eliminating or mitigating) at least one symptom associated with the disorder / disease state being treated and slowing or preventing the progression of the disorder / disease state, and slowing or preventing the progression of the disorder / disease state. prolonging or preventing the progression of the disease, reducing the severity of the disease, bringing about remission (partial or complete) of the disease, and / or survival-prolonging dose. This term refers to a dose that provides complete treatment (i.e., cure) and In some embodiments, the efficacy of the method includes, but does not require, treatment and / or prevention. The dose is 1 x 10 per milliliter of virus disclosed herein. 10 ~1×10 1 5 In some embodiments, the effective dose comprises: 1 x 10 per milliliter of virus disclosed herein 6 ~1×10 10 Puller In some embodiments, an effective dose comprises a dose of 1000 pfu / ml of the antibody or antibody mixtures described herein. 1 x 10 per milliliter of virus disclosed in the book 6 ~1×10 9 transducing units ( Examples of conditions contemplated for treatment are described herein.

[0262] In some embodiments, the mutation in the gene encoding progranulin is a deletion mutation. In some embodiments, the mutation in the gene encoding progranulin is , a null mutation. In some embodiments, the gene encoding progranulin In some embodiments, the mutation is an indel. In some embodiments, the mutation in the gene is a loss-of-function mutation. In some embodiments, the mutation in the gene encoding the agonist is a knockout mutation. Mutations in the gene encoding progranulin inhibit the expression of the progranulin protein. In some embodiments, the present invention provides a method for the treatment of a rheumatoid arthritis, resulting in loss of expression and / or function. Patients requiring treatment with nucleic acids, vectors, and / or viruses should be screened for progranulomatosis prior to administration. In some embodiments, the gene is identified by screening for a cytochrome P450 gene mutation. In this method, screening involves obtaining a cell or tissue sample from a subject and identifying one or more of the cells in the sample. Sequence or genotype one or more loci to confirm the presence of a progranulin mutation In some embodiments, screening involves using saliva, blood and / or is performed on genetic material from samples such as (but not limited to) skin cells. It will be carried out.

[0263] In some embodiments, the treatment method comprises administering a therapeutically effective amount of a nucleic acid disclosed herein. and delivering the same to a subject in need thereof. by delivering a therapeutically effective amount of the vectors disclosed herein to a subject in need thereof. In some embodiments, the treatment method comprises administering a therapeutically effective amount of the compounds disclosed herein. and delivering the recombinant virus to a subject in need thereof. In the method of treatment, a therapeutically effective amount of the pharmaceutical composition disclosed herein is administered to a patient in need thereof. In some embodiments, the disorder is a neurodegenerative disorder. In some embodiments, the disorder is frontotemporal dementia. In some embodiments, the disorder is Alzheimer's disease. In some embodiments, the disorder is Parkinson's disease. In some embodiments, the disorder is amyotrophic lateral sclerosis (ALS).

[0264] In some embodiments, the nucleic acids, vectors, and recombinant viruses disclosed herein Alternatively, the pharmaceutical composition may comprise one or more mutations in the gene encoding progranulin, e.g. For example, it is caused by a mutation that results in the loss of expression and / or function of the progranulin protein. In some embodiments, the disorder is a neurodegenerative disorder. In some embodiments, the disorder is frontotemporal dementia. In some embodiments, the disorder is Alzheimer's disease. In some embodiments, the disorder is amyotrophic lateral sclerosis (ALS). do.

[0265] In some embodiments, the nucleic acids, vectors, and recombinant viruses disclosed herein or the pharmaceutical composition is used in the manufacture of a medicament for treating a subject in need thereof. In an embodiment, the subject has one or more mutations in the gene encoding progranulin. For example, by a mutation that results in loss of expression and / or function of the Progranulin protein. suffers from a disorder caused by

[0266] In various embodiments, the nucleic acids, vectors, recombinant viruses or The pharmaceutical composition can be administered to a subject in need thereof by intravenous administration, direct administration to the brain (e.g., intrathecal, intracranial) intravenous and / or intracerebroventricular administration), intranasal administration, intraaural administration, or intraocular administration, or any of these routes In some embodiments, the nucleic acid, vector, The recombinant virus or pharmaceutical composition is delivered by intrathecal administration. In the method, the nucleic acid, vector, recombinant virus or pharmaceutical composition is administered by intracerebral or intraventricular administration route. In some embodiments, the administered nucleic acid, vector, recombinant The virus or pharmaceutical composition is ultimately delivered to the host, either directly or via injection into another tissue or bodily fluid (e.g., blood). Upon administration to the brain, the transport of the compound to the brain, spinal cord, peripheral nervous system and / or CNS occurs.

[0267] Without being bound by theory, in some embodiments, the compounds disclosed herein The method involves inserting a non-functional polypeptide into a gene encoding a polypeptide, such as progranulin. Cells carrying mutations that give rise to peptides can be rescued. Methods for expressing molecules, such as proteins or ribonucleic acids (e.g., siRNAs), are described herein. The nucleic acids, viral vectors, viruses, or pharmaceutical compositions disclosed herein can be delivered to cells. In some embodiments, the cell is a neuronal cell. The cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the neural cells are neurons. In some embodiments, delivery is performed ex vivo. In some embodiments, delivery is by systemic administration. In some embodiments, delivery is by direct application to the target tissue. In some embodiments, the target tissue is the brain. In some embodiments, delivery is by injection into the brain. In some embodiments, delivery is by intrathecal administration. Without being bound by theory, the methods disclosed herein may be used to treat lipofuscin precipitation. Attention, activation of astrocytes and microglia, and / or mutations in the PGRN protein The present invention reduces inflammation in the brain of humans or mice, thus potentially benefiting subjects in need thereof. may provide benefits.

[0268] In various embodiments, the nucleic acids, vectors, viruses and pharmaceutical compositions disclosed herein The composition can be used to treat disorders such as FTD. Therefore, the nucleic acids, vectors, viruses and / or pharmaceutical compositions disclosed herein can be used to treat disorders, e.g. For example, it can be used in the manufacture of a medicament for treating FTD. In this study, the disorder is caused by one or more mutations in the gene encoding progranulin. In some embodiments, a mutation in the progranulin gene causes progranulocyte colony deficiency. Loss of expression of the progranulin protein occurs. Mutations in the ranulin gene result in loss of function of the progranulin protein. In some embodiments, the use is to administer to a subject in need thereof, for example, a method disclosed herein. vectors, viruses and / or pharmaceutical compositions containing a therapeutically effective amount of a vector encoding hPGRN; This includes delivering nucleic acids.

[0269] The nucleic acid molecules described herein, the vectors described herein, the recombinant viruses described herein a cell described herein or a pharmaceutical composition described herein, and a splice regulator. Also provided herein are kits comprising:

[0270] The present disclosure is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference. and Figures are incorporated herein by reference in their entirety for all purposes. [Example]

[0271] The following examples should be considered illustrative and not limiting the scope of the disclosure disclosed above. It is not something that can be done.

[0272] Example 1. Identification of splice regulator binding sites from the human genome. Normal human fibroblast cell line (HD1994) was cultured to express the active form (LMI070) and splice regulation The cells were treated with either an inactive analog (splice regulator 2) or an inactive analog (splice regulator 3) or DMSO for 24 hours. The compound doses below were used in both NSC34 and HD1994 cell lines. - LMI070 was tested at a concentration of (100nM) and at a high dose of (5uM) - Splice regulator 2 was tested at 750 nM - Splice regulator 3 was tested at 5uM DMSO-treated controls were included for both cell lines. Three biological replicates per group There was.

[0273] Total RNA was isolated using the Qiagen RNeasyMini isolation kit. A-Seq libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit. The samples were prepared using the Illumina HiSeq2500 platform. The sequence was determined using

[0274] Each sample was split into 2 × 76 base pairs (bp) in four different lanes belonging to the same flow cell. The quality of the generated reads was provided by the sequencing laboratory. FastQ file (DM00012.txt data release file) The Phred score was evaluated by running QC (version 0.10.1). The average per-base quality of the reads was calculated for each sample. (Average Phred score >28 at all base positions). As seen, a similar trend of decreasing quality was observed down to the 5' and 3' ends.

[0275] A total of 847 million 76 base pair (bp) paired-end reads were analyzed using TopHat (2.0. 3) was used to identify the human (Homo sapiens) genome (hg19), human RefS eq (Pruitt et al., 2007) transcript (Release 59, May 2013 It was mapped on the 3rd.

[0276] TopHat (2.0.3) alignment to the human genome (hg19) was performed using 15 was calculated separately for each of the replicates. To increase the power to detect exons, Before assembly of transcripts by Cufflinks (2.1.1), five conditions (DMSO, 5 uM LMI070, 100 nM LMI070, 750 nM splice regulators 2 and 5 Three alignment files (bam files) for each of the splice regulators in uM After the transcripts were assembled, exon coordinates were extracted from the transcript gtf files. Exons from alternate chromosomes and chromosome M were excluded, and strand information was ignored. 273,866 predicted exons were obtained. Exons that do not intersect with the nucleotide sequence (May 3, 2013) are unannotated sequences in the event. Rice is considered a candidate. This results in 19,474 candidates. Therefore, duplicated exons are included in the full set of all RefSeq exons plus the first one. This resulted in 9474 candidates being merged, resulting in 229665 non-overlapping exons. The set considers all possible exon-exon junctions within each RefSeq gene. The joint database was compiled using R (2.15.2) scripts and bedtools ( 2.15.0). The first mate of each read end pair was then added to the database. The sequences were mapped to the base. Supported by at least one junction alignment. Only unannotated exons that are matched by RefSeq genes were retained. Candidates that are not bound to the gene are removed, leaving 10,898 final candidates. The sequences of these candidates were extracted from hg19 using bedtools. To do this, a separate Cufflinks construction is calculated for each replicate, and each candidate is Furthermore, alignment against the junction database was used. This information was used to determine the number of junctions that skip new exons. Furthermore, the read coverage of 10898 candidates was used to estimate the proportion of Top Hat alignment (bam file) for each replicate using bedtools The original fastq files were stored in STAR(0 20201) and aligned to the human genome (hg38). 8 candidate exons lifted over into hg38 using the UCSC genome browser tool Seven candidates could not be lifted. The remaining junctions detected by STAR The final 10 candidates for validation were mapped to 10,891 candidates, providing an alternative source of junction counts. The complement (listed in Table 1) was found in the human SMA RNA sequence dataset as follows: Selected from 0898 unannotated putative exons: 1) splice regulator 3 and STAR aggregate junction count and TopHat exon coverage = 0 for all DMSO and STAR samples (non-leaky); 2) STAR aggregate junction counts for LMI070 and splice regulator 2; TopHat exon range >60 (dynamic region); 3) exon length <100 bp (feasible and the presence of a 3'-terminal AGA / GTAAG (splice regulator binding site) to acknowledge).

[0277] Example 2. Construction of a mini gene switch. With the design concept in mind (Figures 1A and 1B), a specific minigene on-switch was designed as shown in Example 1. It was designed using the SNX7 gene sequence identified in 1. Figure 2A shows the chromosome:GRCh 37:1:99204216:99204359:1 [ka] Splice regulator (LMI070) exon target binding site and chromosome: GRCh3 7:1:99203793:99203946:1 [ka] Intron sequence downstream of exon 8 and GRCh37:1:9922561 on chromosome 1 0:99225687:1(TGCCTTGCTACGTGGGAGTCATTCCTT ACATCACAGACCAACCTTCACTTGGAAGAAGCCTCTGAAG ATAAACCTTAA (SEQ ID NO: 100)) and 21,251 nucleotides upstream of exon 9. 1 shows a schematic diagram of the SNX7 locus identified in Example 1, including the nucleotide sequences. Use exon 8 (called exon A), exon 8 and splice regulator binding site The 270-nucleotide intron located between the identified potential exons (AB) exon, containing a splice regulator (e.g., LMI070) binding site at its 3' end exon B) and the 407 nucleotides between the cryptic exon and exon 9. intron fragment (truncated from 21,251 nt; BC) and exon 9 (exon A non-naturally occurring SNX7 minigene was constructed using the gene encoding the SNX7 gene (called 'SNX7'). 1) (Figure 2). To improve the performance of the minigene, we used 1) Kozak consensus 2) a sequence and an ATG codon (GCCACCATG) inserted at position 65 of exon A; 2) all other ATG sequences in the gene are replaced with TTG; 3) TA at position 20 of exon A with AG to create the sequence GAAGAAGAA (SEQ ID NO: 69); 4) replacing To create a base shift (number of nucleotides = 3n-1), 1 nt is added from exon B. 5) Insertion of T at position 4 of exon C to create a frameshift in the ORF, resulting in multiple 6) TAC at position 9 of exon C creates a premature stop codon. 7) CAG at position 34 of exon C was changed to ACC, resulting in a possible 8) mutating CTCT at position 60 of exon C to TAGC; and 9) the TAA at the end of exon C is inserted into the Further modifications were made to the sequence, such as removing F to create F. The extension technique was used to insert the vector into the scAAV. The scAAV contains a trs deletion. AAV2 ITRs, followed by the JeT promoter, followed by the SNX7 minigene (see Figure 2B). (see references), followed by a furin cleavage site (RNRR) added to the end of exon C (sequence The coding sequence of column number 39) is followed by the coding sequence of the T2A peptide, followed by the transgene sequence. sequence (here, the coding sequence of EGFP without the first ATG), followed by SV40 late promoter The recombinant AAV2 ITRs were generated by combining the AAV2 ITRs with the AAV2 ITRs and the AAV2 ITRs (see Figure 2C). Figure 3 shows the predicted mRNA expression of scAAV in the presence or absence of splice regulators. RNA products are shown.

[0278] Example 3. In vitro performance of the On switch in HEK293 cells. HEK293 cells were maintained in complete DMEM medium and the day before transfection, Cells were seeded in 24-well plates at a density of 100,000 cells per well. Infectamine 2000 (Invitrogen) was used according to the manufacturer's protocol. Each well was transfected with 2 μg of pJSNX-GFP plasmid DNA using The transfection medium was replaced with complete DMEM after 4 hours. Dilute the initial 1 mM stock of LMI070 in DMEM to 1 / 1,000 to 1 / 500,000. The control cells were diluted to achieve a concentration of 2 nM to 1 uM when added to the cells 24 hours later. The cells received 0.1% DMSO. GFP expression was monitored by transfection using a fluorescent microscope. The expression of GFP was assessed 48 hours after treatment. No GFP expression was observed in control DMSO-treated cells. For quantitative analysis of GFP expression, cells were trypsinized and incubated with a SONY S Analysis was performed by FACS using an H-800 flow cytometer. Relative measurement of GFP expression. The mean fluorescence intensity was used for the analysis. Control DMSO-treated cells showed no detectable GFP expression. whereas a dose-dependent increase in GFP expression was observed in LMI070-treated samples (Fig. 4B). For RNA splicing analysis, Trizol (I) was used according to the manufacturer's protocol. Total RNA was extracted from cells using a PCR kit (Invitrogen). cDNA was extracted using qRT-PCR. Superscript III Strand 1 Supermix for CR (Invitrogen) The inclusion of exon B was confirmed by the use of primer GCG specific for exon C. GTTGCGAGGTTTATCT (SEQ ID NO: 104) and CTCTTGCTAAGTG Compared to total transgene mRNA amplified by GGAGTCATT (SEQ ID NO: 105) CAACAAAGGAGCACACCATTC (SEQ ID NO: 103) and GCGGT TGCGAGGTTTATCT (SEQ ID NO: 104) primer pair. The amount of exon B-exon C was assessed using qPCR. Inclusion of exon B in treated cells increased expression by 75-fold compared to DMSO-treated cells. Constitutively spliced ​​RNase A (RNase B) is regulated by RNase B (Fig. 4C). The amount of A (i.e., exon A-exon C) is GTGCTAATAATGCCCTGA AAGC (SEQ ID NO: 106) and CCACTTAGCAAGAGCACTGT (SEQ ID NO: 107) primer pair. 1 μM LMI070-treated cells were compared with control D showed 60-fold lower exon A-exon C splicing compared to MSO-treated cells.

[0279] Example 4. Regulation of GFP expression by the SNX7 switch in rat cortical neurons. Primary rat neurons were prepared from dissected rat embryonic cortex digested with papain and cultured for 24 h. in complete Neurobasal medium on well poly-D-lysine plates (Corning) The cells were cultured at a density of 150,000 cells / well for 7 days. Before adding the DNA-liposome cocktail, half of the medium was replaced with fresh medium. Except for washing three times with optiMEM, Lipofectamine 2000 (In Vitrogen) according to the manufacturer's protocol to deliver 2µg of pJS to each well. NX-GFP plasmid DNA was transfected. After 4 hours, the conditioned medium was replaced with 50% fresh complete Neurobasal medium. The next day, dilute a 1 mM stock of LMI070 in DMSO to 1 / 1,000 to 1 / 5 in DMEM. The control cells were diluted to 0.0001 to achieve a concentration of 2 nM to 1 μm when added to the cells. The cells received 0.1% DMSO. GFP expression was monitored by transfection using a fluorescent microscope. The cells were evaluated 6 days after the injection. No GFP expression was observed in the control DMSO-treated cells ( For RNA splicing analysis, Trizol ( Total RNA was extracted from cells using a PCR kit (Invitrogen). Superscript III first-strand supermix for PCR (Invitrogen) The inclusion of exon B was confirmed by the use of exon C-specific primer GC GGTTGCGAGGTTTATCT (SEQ ID NO: 104) and CTCTTGCTAAGT Compared to the total transgene mRNA amplified by GGGAGTCATT (SEQ ID NO: 105). CAACAAAGGAGCACACCATTC (SEQ ID NO: 103) and GCGG TTGCGAGGTTTATCT (SEQ ID NO: 104) The amount of exon B-exon C was assessed using qPCR. Inclusion of exon B in treated cells increased expression by over 100-fold compared to DMSO-treated cells. Constitutively spliced The amount of RNA (i.e., exon A-exon C) expressed as GTGCTAATAATGC CCTGAAAGC (SEQ ID NO: 106) and CCACTTAGCAAGAGCACTGT (SEQ ID NO: 107) primer pair. 500 nM LMI070 treatment Cells showed 30-fold lower exon A-exon C splicing compared to control DMSO-treated cells. showed the results.

[0280] Example 5. Human progranulin in rat cortical neurons by SNX7 switch Regulatable expression of. Primary rat neurons were prepared from dissected rat embryonic cortex digested with papain and cultured for 24 h. in complete Neurobasal medium on well poly-D-lysine plates (Corning) The cells were cultured at a density of 150,000 cells / well for 7 days. Before adding the DNA-liposome cocktail, half of the medium was replaced with fresh medium. Except for washing three times with optiMEM, Lipofectamine 2000 (In Add 2µg of pSy to each well using Vitrogen (Protein Biosystems) according to the manufacturer's protocol. n-snx7-PGRN (Figure 6A) or the control pSyn-P, which does not contain the snx7 minigene. The GRN plasmid was transfected. The transfection medium was then The conditioned medium was replaced with fresh complete neurobasal medium containing 0% DMS. A 1 mM stock of LMI070 in 0 was diluted 1 / 10,000 in DMEM and added to the cells. A concentration of 100 nM was achieved when the cells were added. Control cells received 0.01% DMSO. hPGRN expression was measured using a TR-FRET assay 6 days after transfection. In cells transfected with pSyn-snx7-PGRN, hPGRN expression was significantly reduced. Expression was induced by LMI070 more than 30-fold compared to DMSO-treated controls (Figure 1). 6B). For RNA splicing analysis, Trizol (I) was used according to the manufacturer's protocol. Total RNA was extracted from cells using a PCR kit (Invitrogen). cDNA was extracted using qRT-PCR. Superscript III Strand 1 Supermix for CR (Invitrogen) The inclusion of exon B was confirmed by the use of primer GCG specific for exon C. GTTGCGAGGTTTATCT (SEQ ID NO: 104) and CTCTTGCTAAGTG Compared to total transgene mRNA amplified by GGAGTCATT (SEQ ID NO: 105) CAACAAAGGAGCACACCATTC (SEQ ID NO: 103) and GCGGT TGCGAGGTTTATCT (SEQ ID NO: 104) primer pair. The amount of exon B-exon C junction was assessed using qPCR. Inclusion of exon B in pSyn-snx7-PGRN transfected cells resulted in was upregulated over 150-fold compared to DMSO-treated cells. Constitutively spliced ​​RNA (i.e., exon The amount of exon A (exon C) was GTGCTAATAATGCCCTGAAAGC (SEQ ID NO: 1 06) and CCACTTAGCAAGAGCACTGT (SEQ ID NO: 107) primer pair LMI070-treated cells showed significantly higher pSy levels compared to DMSO-treated cells. 10-fold lower exon A- in cells transfected with n-snx7-PGRN Exon C splicing was demonstrated.

[0281] Example 6. Mini-cells to reduce size and eliminate peptide expression in the absence of LMI070 Genetic modification The SNX7 minigene reduces the overall size and expression of peptides in the absence of LMI070. It was further modified to eliminate expression. In particular, the region adjacent to the 3' splice site was maintained. During this process, exon A was shortened from 109 nt to 53 nt, resulting in exon A of It has the sequence of SEQ ID NO: 96. The first end is removed while maintaining the splice site and branch point. The first intron was shortened from 150 nt to 120 nt. The resulting first intron is SEQ ID NO: 9 The first version of the SNX7 minigene has the sequence of exon A. The region containing exon B of the SNX7 minigene was deleted, and the new version contained exon B TC to GG. The start codon was constructed by changing the codon from By switching the start codon to exon B, the presence of LMI070 Protein expression occurs only under these conditions. This sequence was found to contain essential cis elements. The second intron was kept the same. The sequence of version 2) is shown in SEQ ID NO: 94. Figure 9 shows the sequence of the previous version of the SNX7 minigene. Overview of the new version (version 2) of the minigene compared to the previous version (version 1) The figure is shown.

[0282] The modified SNX7 minigene (version 2) was generated using molecular cloning techniques. The modified SNX7 minigene (version 2) was inserted into an scAAV vector. The sequence of the vector containing the vector is shown in SEQ ID NO: 95. HEK293 cells were cultured in complete DMEM medium. maintained at a density of 100,000 cells per well the day before transfection. The cells were seeded onto a 24-well plate using Lipofectamine 2000 (Invitrogen). SNX7 Switch version 1 was installed using the rogue rogue (rogue) according to the manufacturer's protocol. Plasmid DL180 containing DNA or plasmid DL182 containing SNX7 version 2 2 μg of each transfectant was transfected into each well. The transfection medium was then removed after 4 hours. The initial 1 mM stock of LMI070 in DMSO was replaced with complete DMEM. When diluted to 1 / 1,000 to 1 / 500,000 with HCl and added to cells after 24 hours, Concentrations ranging from 100 nm to 1 μM were achieved. Control cells received 0.1% DMSO. Expression was assessed 48 hours after transfection using a fluorescent microscope. ,The modified SNX7 minigene (version 2) is more sensitive than the previous version. This indicates that...

[0283] Example 7. Oral administration of LMI070 increases transgene expression in the mouse brain in a time-dependent manner. Turn on h under the control of the synapsin promoter with the SNX7 switch (version 1) PGRN-encoding ssAAV9 viral vector was produced in HEK293 cells and expressed in Io Dixanol-purified. 2e10vg of AAV vector in 2uL was transfected with C57Bl / 6 fresh medium. At 4 weeks of age, newborn mice were injected ICV with 30 mg / kg LMI07 at P0. 0 or vehicle control was administered orally via stomach tube. Four to six mice per group were administered at specific time points. After transcardial perfusion with PBS, the posterior half of the left hemisphere was The TR-FRET assay was performed using a 100-kDa hybridization tube containing 1000 kDa hybridization vectors expressed from AAV vectors. The results showed that the amount of PGRN in the brain was 24 hours after LMI070 administration. The results show rapid and transient induction of hPGRN expression in the IL-16 / ... Expression returned to untreated levels 4 days after LMI070 administration (Fig. 7B).

[0284] Example 8. LMI070 turns on transgene expression in vivo in a dose-dependent manner h under the control of the synapsin promoter with the SNX7 switch (version 1) PGRN-encoding ssAAV9 viral vector was produced in HEK293 cells and expressed in Io Dixanol-purified AAV vector (2e10vg) was transfected into 2uL of FVB neonatal mice. At 4 weeks of age, mice were injected ICV with 3, 10, or 30 mg / kg LMI 070 or vehicle control was orally administered by stomach tube. Six to seven mice per group were assigned to a specific After transcardial perfusion with PBS, the posterior half of the left hemisphere was The TR-FRET assay was performed using a lysed tube. Human cortical samples were used to measure the physiological levels of PGRN. The results showed that the transgenic showed rapid (12 hours after LMI070 administration) accumulation of hPGRN, which persisted for 24 hours. The transgene expression showed a dose-response to LMI070 administration. .

Claims

1. A nucleic acid molecule comprising a minigene linked to a transgene encoding a target protein, wherein the minigene is a. The first exon; b. The first intron; c. The second exon; d. Second intron; and e. The third exon The second exon includes a splice modifier binding sequence, and in the presence of the splice modifier, the second exon is included in the mRNA product of the nucleic acid, and in the absence of the splice modifier, the second exon is not included in the mRNA product of the nucleic acid. A nucleic acid molecule comprising a third exon which is in-frame in the mRNA product of the nucleic acid produced in the absence of the splice modifier, and which is not in-frame in the mRNA product of the nucleic acid produced in the presence of the splice modifier.

2. A nucleic acid molecule comprising a minigene linked to a transgene encoding a target protein, wherein the minigene is a. The first exon; b. The first intron; c. The second exon; d. Second intron; and e. The third exon The second exon includes a splice modifier binding sequence, and in the presence of the splice modifier, the second exon is included in the mRNA product of the nucleic acid, and in the absence of the splice modifier, the second exon is not included in the mRNA product of the nucleic acid. The second exon is a nucleic acid molecule comprising a stop codon that is in-frame in the mRNA product of the nucleic acid produced in the presence of the splice modifier.

3. A nucleic acid molecule comprising a minigene linked to a transgene encoding a target protein, wherein the minigene is a. The first exon; b. The first intron; c. The second exon; d. Second intron; and e. The third exon The second exon includes a splice modifier binding sequence, and in the presence of the splice modifier, the second exon is included in the mRNA product of the nucleic acid, and in the absence of the splice modifier, the second exon is not included in the mRNA product of the nucleic acid. A nucleic acid molecule in which the first and third exons do not contain a start codon, and the second exon contains a start codon.

4. A nucleic acid molecule according to any one of claims 1 to 3, A nucleic acid molecule comprising a sequence encoding a protease cleavage site positioned between the minigene and the introduced gene.

5. A nucleic acid molecule according to claim 4, A nucleic acid molecule in which the protease cleavage site is cleaved by a mammalian protease selected from the group consisting of furin, PCSK1, PCSK5, PCSK6, PCSK7, cathepsin B, granzyme B, factor XA, enterokinase, genenase, saltase, precision protease, thrombin, TEV protease, or elastase 1.

6. A nucleic acid molecule according to claim 4 or claim 5, The aforementioned protease cleavage sites are the RX(K / R)R consensus motif, the RXXX[KR]R consensus motif, the RRX consensus motif, RNRR (SEQ ID NO: 39), the I-E-P-D-X consensus motif (SEQ ID NO: 35), Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36), and Pro-Gly-Ala-Ala-His-T. A nucleic acid molecule comprising a polypeptide having a cleavage motif selected from the group consisting of yr (SEQ ID NO: 37), LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40), E-N-L-Y-F-Q-G (SEQ ID NO: 41), and [AGSV]-x (SEQ ID NO: 42).

7. A nucleic acid molecule according to any one of claims 4 to 6, The sequence encoding the protease cleavage site is a nucleic acid molecule containing CGCAACCGCGC (SEQ ID NO: 19).

8. A nucleic acid molecule according to any one of claims 1 to 7, A nucleic acid molecule comprising a sequence encoding a self-cleaving peptide positioned between the minigene and the introduced gene.

9. A nucleic acid molecule according to claim 8, The self-cleaving peptide is a nucleic acid molecule containing the T2A peptide.

10. The nucleic acid molecule according to any one of claims 1 to 9, wherein the splice modifier binding sequence is located at the 3' end of the second exon.

11. The nucleic acid molecule according to any one of claims 1 to 10, wherein the splice modifier binding sequence comprises AGA, and the splice modifier is 5-(1H-pyrazole-4-yl)-2-(6-((2,2,6,6-tetramethylpiperidine-4-yl)oxy)pyridazin-3-yl)phenol (LMI070).

12. The second exon is a. CCTTGCTATTCCCTGTCTGTAGCTATTCTGAAACCATCAACAAAGGAGCACACCATTCCATCAGCCAAAAGA (Sequence ID 1); b. GTAATTAGCCTGAGAAGGAAGATCTGAAGGTTTTAACGAGAGAAGGGGCGAGAGAATACAAAAAATCTGCCTAGGAGA (Sequence No. 2); c. GGATTTGTTTGTATTCCTGCCAATGATTGTGAGAACAGTCCTGTTCCCCAACATCCTCGTCAACAGA (Sequence No. 3); d. CTTTCTGACATCTTAACGAGGCAATACAGAGAGACGAATTTTCATCAGTTTGTTCACAGGGGAGAACACATATACAAAAAGA (Sequence ID 4); e. ATCCATACATACTTAATGCTGAAATGTGAAGGGCTGAGAAAAAAAGAAAAGA (Sequence ID 5); f. AATTGGAAACATCGAGGGGAAAAAATGGGGCTTTTTTTATTAAAAACAAACCTCCAGTTATTATCAACTTAGAAAAACCTGAAAAAACTCCCAAAAAGCCCAAAAGA (Sequence ID 6); g. AAGAATGTTCCTTTGTGAAGAATGACTTAAGGAAGATTCATGATGACTGAGTGTGCCCGTGTGGAACTTTAGGACATAGATGCACTCCTACAGA (SEQ ID NO: 7); h. TTGTCCTTCACTCCGTACTCCAGTTGGCCAAGCATAGGTCGCATGCCAGGGTCAAGGAGACTAAGGGAGA (SEQ ID NO: 8); i. GACATACAGACATGGCAGCCCCCTAGCCATGTGTTACCTAAGA (Sequence No. 9); j. ACATACAGACATGGGCAGCCCCCTAGCATGTGTTACCTAAGA (Sequence No. 10); k. 【Chemistry 1】 , and l. A fragment or variant of any of (a) to (k) that has at least 90% identity with respect to it. A nucleic acid molecule according to any one of claims 1 to 11, comprising a sequence selected from.

13. A nucleic acid molecule according to any one of claims 1 to 12, The second exon is a nucleic acid molecule comprising a sequence derived from an exon of SNX7 or a latent exon of SNX7.

14. A nucleic acid molecule according to any one of claims 1 to 13, The aforementioned second exon is, i. 【Chemistry 2】 ； ii. Fragment of sequence number 16; or iii. A variant sequence or fragment thereof of sequence number 16, which has at least 90% identity with respect to it. Nucleic acid molecules, including those mentioned above.

15. A nucleic acid molecule according to any one of claims 1 to 13, The aforementioned second exon is, i. 【Transformation 3】 ； ii. Fragment of sequence number 98; or iii. A variant sequence or fragment thereof of sequence number 98, which has at least 90% identity with respect to it. Nucleic acid molecules, including those mentioned above.

16. The first exon is a. One or more GAA repeats; b. Kossack sequence; or c. Both (a) and (b) A nucleic acid molecule according to any one of claims 1 to 15, comprising:

17. The minigene is, i. Remove or mutate all codons except a single start codon; ii. Removing or mutating all potential splice donor and splice acceptor sequences other than those at the terminals of the first, second, and third exons. A nucleic acid molecule according to any one of claims 1 to 16, modified to perform the following actions.

18. A nucleic acid molecule according to any one of claims 1 and 3 to 17, The minigene is a nucleic acid molecule containing sequence number 71 or sequence number 94, or a fragment thereof having at least 90% identity thereto.

19. A nucleic acid molecule according to claim 18, The nucleic acid molecule further comprises a sequence encoding a furin cleavage site, which includes sequence number 19, and a sequence encoding a self-cleaving peptide, which includes sequence number 20.

20. A nucleic acid molecule according to any one of claims 1 to 19, A nucleic acid molecule further comprising a promoter operably linked to the minigene and the transgene, wherein the promoter is intron-free.

21. A nucleic acid molecule according to claim 20, The promoter is a nucleic acid molecule located at the 5' end of the minigene.

22. A nucleic acid molecule according to any one of claims 1 to 21, A nucleic acid molecule further containing post-transcriptional regulatory elements.

23. A nucleic acid molecule according to any one of claims 1 to 22, A nucleic acid molecule further containing a polyadenylation signal (polyA).

24. A nucleic acid molecule according to any one of claims 1 to 23, The aforementioned polyA is a nucleic acid molecule positioned on the 3' side of the introduced gene.

25. A vector, A vector comprising a nucleic acid molecule according to any one of claims 1 to 24.

26. The vector according to claim 25, The vector is an adeno-associated virus (AAV) vector, a chimeric AAV vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, a DNA virus vector, a herpes simplex virus vector, a baculovirus vector, or any variant or derivative thereof.

27. ​​A recombinant virus comprising a nucleic acid molecule according to any one of claims 1 to 24 or a vector according to claim 25 or 26, The recombinant virus is an adeno-associated virus (AAV), a chimeric AAV, an adenovirus, a retrovirus, a lentivirus, a DNA virus, a herpes simplex virus, a baculovirus, or any variant or derivative thereof.

28. A cell comprising a nucleic acid molecule according to any one of claims 1 to 24, a vector according to claim 25 or 26, or a recombinant virus according to claim 27.

29. A method for conditionally expressing a target protein, comprising contacting an expression system comprising a nucleic acid molecule according to any one of claims 1 or 3 to 24, a vector according to claim 25 or 26, or a recombinant virus according to claim 27, with a splice modifier. i. In the presence of the splice modifier, the expression of the target protein increases compared to the expression level of the target protein in the absence of the splice modifier; and ii. A method wherein, in the absence of the splice modifier, the expression of the target protein is reduced compared to the expression level of the target protein in the presence of the splice modifier.

30. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 24, a vector according to claim 25 or 26, a recombinant virus according to claim 27, or a cell according to claim 28, A pharmaceutical composition comprising a splice modifier that is effective in causing at least a twofold increase or decrease in the expression of the target protein compared to the expression level of the target protein in the absence of the splice modifier.

31. A nucleic acid molecule according to any one of claims 1 to 24, a vector according to claim 25 or 26, a recombinant virus according to claim 27, a cell according to claim 28, or a pharmaceutical composition according to claim 30, for use in gene therapy.

Images