Method for producing minus-strand RNA viral vector and produced negative-strand RNA viral vector
Patent Information
- Application Number
- JP2025014649
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-06-30
- Filing Date
- 2025-01-31
- Publication Date
- 2025-07-02
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the production of negative single-stranded RNA virus vectors, it is difficult to effectively inhibit the activity of protein kinase R (PKR), thereby limiting the production of virus vectors.
By expressing and providing PKR inhibitors in packaging cells, such as PKR inhibitor viral factors, human nc886, human p58, NS5A, etc., packaging cells are allowed to express genomic RNA of negative single-stranded RNA viruses, thereby increasing the production of viral vectors.
Effectively inhibit the activity of PKR, improve the production volume and infection titer of negative single-strand RNA virus vectors, and improve the recombination efficiency and infectivity of virus vectors.
Smart Images

Figure 00000066_0000 
Figure 00000066_0001 
Figure 00000067_0000
Abstract
Description
[Technical field]
[0001] The present invention relates to a method for producing a minus-strand RNA viral vector and the produced minus-strand RNA viral vector. [Background technology]
[0002] Negative-strand RNA viral vectors, such as Sendai virus vectors, can be useful for gene transfer or cytokine induction. Negative-strand RNA viral vectors, such as Sendai virus vectors, can be advantageously produced in packaging cells by producing them from cDNA (Patent Document 1).
[0003] E3L of vaccinia virus is a double-stranded RNA binding protein, and it has been reported that it promotes interferon resistance and intracellular proliferation (Non-Patent Document 1). It has been disclosed that in the production of poxvirus or vaccinia virus, protein kinase R (PKR) is inhibited using K3L, E3L, VAI RNA, EBER, σ3, TRBP, or a combination thereof, and that PKR is a double-stranded RNA binding protein (Patent Document 2). It has been disclosed that C8L and K3L are pseudosubstrates of protein kinase R (PKR) (Non-Patent Document 2). It has been suggested that NS5A or NS5A(1-148) may inhibit antiviral activity against HCV (Non-Patent Document 3). A method for producing viruses using VAI RNA has been disclosed (Patent Document 3). [Prior art documents] [Patent documents]
[0004] [Patent Document 1] WO2005 / 071092 [Patent Document 2] WO98 / 040500 [Patent Document 3] WO95 / 011983 [Non-patent literature]
[0005] [Non-Patent Document 1] T. Shors, et al., Virology, 239: 269-276, 1997 [Non-Patent Document 2] MK Kobayashi et al., Virology, 276: 424-434, 2000 [Non-Patent Document 3] T. Taguchi et al., J. Gen. Virol., 85: 959-969, 2004 Summary of the Invention
[0006] The present invention provides a method for producing a minus-strand RNA viral vector and the produced minus-strand RNA viral vector.
[0007] The present inventors have discovered that, in a method for producing a minus-strand RNA virus, a PKR-inhibiting factor (e.g., a PKR-inhibiting viral factor, human nc886, human p58 IPK They found that expressing the genomic RNA of a negative-strand RNA virus in packaging cells in the presence of NS5A, NS6A, or NS7A, or a combination of these, to form a negative-strand RNA virus increased the amount of virus produced in the packaging cells.
[0008] According to the present invention, for example, the following inventions can be provided. (1) A method for producing a minus-strand RNA virus or a viral vector, comprising: A protein kinase R (PKR) inhibitory agent operably linked to a regulatory sequence (e.g., a PKR-inhibiting viral agent, human nc886, human p58 IPK expressing the factor from a gene encoding NS5A, NS6A, or NS7A, or a combination thereof, and providing the factor to a packaging cell; expressing the genomic RNA of a minus-strand RNA virus or viral vector in a packaging cell, and forming a minus-strand RNA virus or viral vector in the presence of the factor {for example, expressing the genomic RNA of a minus-strand RNA virus or viral vector in a packaging cell in the presence of a PKR-inhibitory factor, for example, a PKR-inhibitory viral factor, and forming a minus-strand RNA virus or viral vector, wherein the genomic RNA and the PKR-inhibitory factor can be expressed preferably using the DNA described in (13) below}; Recovering the formed negative strand RNA virus or viral vector; Including, Preferably, the relationship between said virus or viral vector and said PKR-inhibiting factor is heterologous and / or the relationship between said regulatory sequence and said PKR-inhibiting factor is heterologous. method. (2) The method according to (1) above, wherein the minus-strand RNA virus or viral vector is a Sendai virus vector. (3) The PKR inhibitory factor is VAI RNA of adenovirus, EBER of EB virus, human nc886, TAR of HIV virus, or 2A of poliovirus. pro , vaccinia virus E3L, reovirus δ3, influenza virus NS1, human p58 IPK The method according to (1) or (2) above, wherein the antigen is one or more selected from the group consisting of NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus, and ICP34.5 of herpes simplex virus, and their orthologues. (4) The method according to any one of (1) to (3) above, wherein a minus-strand RNA virus or a viral vector is produced in the absence of a helper virus. (5) The method according to any one of (1) to (4) above, wherein the genomic RNA further comprises a gene encoding a PKR-inhibitory factor operably linked to a regulatory sequence. (6) The method according to any one of (1) to (5) above, wherein the packaging cell has a genomic DNA having a gene encoding a PKR-inhibitory factor operably linked to a regulatory sequence. (7) The method according to any one of (1) to (6) above, wherein the packaging cells are Vero cells or LLC-MK2 cells. (8) The method according to any one of (1) to (7) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain any other cells. (9) An RNA genome of a minus-strand RNA virus or viral vector which contains, in an expressible manner, a gene encoding any one or more PKR-inhibitory factors. (10) A minus-strand RNA virus or viral vector comprising the RNA genome described in (9) above. (11) The minus-strand RNA virus or viral vector according to (10) above, further comprising a gene of interest. (12) A composition comprising the minus-strand RNA virus or viral vector described in (10) or (11) above. (13) A DNA encoding the RNA genome described in (9) above. (14) A gene expression vector comprising the DNA according to (13) above operably linked to a regulatory sequence.
[0009] (15) The composition according to (12) above, wherein the infectious titer is 1×10 5 CIU / mL or more. (16) The composition according to (12), wherein the infectious titer is 1×10 6 CIU / mL or more. (17) The composition according to (12), wherein the infectious titer is 1×10 7 CIU / mL or more. (18) The method according to any one of (1) to (8) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31. (19) The minus-strand RNA virus or viral vector according to any one of (9) to (11) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31. (20) The composition according to (12) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31. (21) The DNA according to (13) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31. (22) The gene expression vector according to (14) above, wherein the PKR inhibitory factor has a sequence as set forth in any one of SEQ ID NOs: 4 to 31.
[0010] (23) The method according to any one of (1) to (8) above, wherein expressing the factor is carried out by introducing a plasmid vector having a gene encoding the factor operably linked to a first control sequence into a packaging cell. (24) The method according to any one of (1) to (8) above, wherein expressing the genomic RNA is carried out by introducing a plasmid vector having a gene encoding the genomic RNA operably linked to a second control sequence into a packaging cell. (25) Expressing the factor is carried out by introducing into a packaging cell a plasmid vector having a gene encoding the factor operably linked to a first control sequence; and The method according to any one of (1) to (8) above, wherein expressing the genomic RNA is carried out by introducing into a packaging cell a plasmid vector having a gene encoding the genomic RNA operably linked to a second control sequence. (26) The method according to any of (1) to (8) above, wherein forming a minus-strand RNA virus or viral vector comprises introducing into a packaging cell a plasmid having a gene encoding a viral genomic RNA operably linked to a second control sequence, and a plasmid having a gene encoding a viral component operably linked to a third control sequence, and expressing the genomic RNA and the viral component in the cell. (27) The method according to (26) above, wherein the third control sequence is an EF1α promoter and the viral components include either or both of an N protein and an L protein. (28) The method according to (26) above, wherein the third control sequence is an EF1α promoter and the viral components are one or more, or all, selected from the group consisting of an N protein, a P protein and an L protein. (29) The method according to (28) above, wherein the packaging cells are Vero cells. (30) The method according to (26) above, wherein the third control sequence is an EF1α promoter and the viral component includes either or both of a P protein and an L protein. (31) The method according to (26) above, wherein the third control sequence is an EF1α promoter and the viral component is an L protein. (32) The method according to (30) above, wherein the packaging cells are LLC-MK2 cells. (33) The method according to (31) above, wherein the packaging cells are LLC-MK2 cells.
[0011] (34) A PKR inhibitor is (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L; (ii) K3L and The method according to any of the above, comprising: (35) A PKR inhibitor is (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L; (iii) Y3 and The method according to any of the above, comprising: (36) The method according to (34) above, wherein the PKR inhibitory factor further comprises VAI. (37) The method according to (35) above, wherein the PKR inhibitory factor further comprises VAI. (38) Any of the above methods, wherein the PKR inhibitory factor comprises VAI, and VAI is a molecule having the sequence set forth in SEQ ID NO: 17. (39) Any of the above methods, wherein the PKR inhibitory factor comprises VAI and is a molecule having the sequence set forth in SEQ ID NO: 19. (40) Any of the above methods, wherein the PKR inhibitory factor is a molecule having a sequence set forth in any of SEQ ID NOs: 18, 21 to 26. (41) Any of the above methods, wherein the PKR inhibitory factor comprises nc886. (42) Any of the above methods, wherein the PKR inhibitory agent is a molecule having the sequence set forth in SEQ ID NO: 13 or 14.
[0012] (43) The method described in (5) above, wherein the genomic RNA has a gene encoding a target protein, the PKR inhibitory factor is VAI or an RNA molecule having a sequence set forth in any one of SEQ ID NOs: 17 to 26, and VAI is contained in the 3'UTR of the gene encoding the target protein. (44) The method according to any one of (43) above, wherein the packaging cell has genomic DNA having a gene encoding a PKR-inhibitory factor operably linked to a regulatory sequence. (45) The method according to (44) or (45) above, wherein the packaging cells are Vero cells or LLC-MK2 cells. (46) The method according to any one of (44) to (46) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain any other cells.
[0013] (47) The RNA genome according to (9) above, comprising a gene encoding a target protein, wherein the PKR inhibitory factor is VAI or an RNA molecule having a sequence set forth in any one of SEQ ID NOs: 17 to 26, and the RNA molecule having the sequence set forth in any one of SEQ ID NOs: 17 to 26 is contained in the 3'UTR of the gene encoding the target protein. (48) A minus-strand RNA virus or viral vector comprising the RNA genome described in (47) above.
[0014] (49) A method for producing a minus-strand RNA virus or a viral vector, comprising the steps of: expressing said factor from a gene encoding NS5A operably linked to a regulatory sequence and providing said factor to a packaging cell; allowing a packaging cell to express genomic RNA of a minus-strand RNA virus or viral vector in the presence of NS5A to form a minus-strand RNA virus or viral vector; Recovering the formed negative strand RNA virus or viral vector; Including, the relationship between said virus or viral vector and said NS5A is heterologous, and / or the relationship between said regulatory sequence and said NS5A is heterologous; method. (50) A method for producing a minus-strand RNA virus or a viral vector, comprising the steps of: providing a packaging cell with a PKR inhibitory factor expressed from a gene encoding the factor operably linked to a regulatory sequence, wherein the PKR inhibitory factor is selected from the group consisting of human nc886 (VTRNA2-1) and human p58 IPK Either or both of allowing a packaging cell to express genomic RNA of a minus-strand RNA virus or viral vector in the presence of the PKR-inhibitory factor to form a minus-strand RNA virus or viral vector; Recovering the formed negative strand RNA virus or viral vector; Including, wherein the relationship between the regulatory sequence and the PKR inhibitory factor may be heterologous; method. (51) The method according to (49) or (50) above, wherein the minus-strand RNA virus or viral vector is a Sendai virus vector. (52) The method according to any one of (49) to (51) above, wherein the genomic RNA further comprises a gene encoding a PKR-inhibitory factor operably linked to a regulatory sequence. (53) The method according to any one of (49) to (52) above, wherein the packaging cell has genomic DNA having a gene encoding a PKR-inhibitory factor operably linked to a regulatory sequence. (54) The method according to any one of (49) to (53) above, wherein the packaging cells are Vero cells or LLC-MK2 cells. (55) The method according to any one of (49) to (54) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain any other cells. (56) An RNA genome of a minus-strand RNA virus or viral vector, which comprises, in an expressible manner, a gene encoding any one or more PKR-inhibitory factors. (57) A minus-strand RNA virus or viral vector comprising the RNA genome described in (56) above. (58) The minus-strand RNA virus or viral vector according to (57) above, further comprising a gene of interest. (59) A composition comprising the minus-strand RNA virus or viral vector described in (57) or (58) above. (60) A DNA encoding the RNA genome described in (56) above. (61) A gene expression vector comprising the DNA according to (60) above operably linked to a control sequence.
[0015] (71) A gene expression vector (preferably a plasmid) of the RNA genome, comprising a control sequence (preferably a promoter sequence), a first DNA, and a second DNA in this order, the first DNA encodes an RNA genome of an RNA virus; the second DNA encodes a protein kinase R (PKR)-inhibitory factor (e.g., a PKR-inhibitory viral factor (preferably VAI RNA, EBER, nc886, and TAR, and orthologues thereof)); A gene expression vector which forms a continuous region containing a first DNA and a second DNA, said region being operably linked to a control sequence, thereby causing the first DNA and the second DNA to be transcribed into a single RNA. (72) The gene expression vector according to (71) above, wherein the protein kinase R (PKR) inhibitory factor is VAI. (73) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA. (74) The gene expression vector according to (72) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA. (75) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA. (76) The gene expression vector according to (72) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA. (77) The gene expression vector according to (73) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA. (78) The gene expression vector according to (74) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA. (79) Any of the above-mentioned inventions, wherein the VAI RNA may have a sequence which is a part of SEQ ID NO: 19, 20, and 23 to 26 and includes the nucleotide sequence set forth in SEQ ID NO: 17. (80) Any of the above-mentioned inventions, wherein the VAI RNA has (i) a VAI RNA corresponding to a sequence which is a part of SEQ ID NOs: 19, 20, and 23 to 26 and includes a nucleotide sequence set forth in SEQ ID NO: 17, and (ii) a sequence which includes either or both of the 5' sequence and the 3' sequence of the VAI RNA. [Brief description of the drawings]
[0016] [Figure 1A] Figure 1A shows the secondary structure of VAI RNA. The 74th base is indicated by an arrow. [Figure 1B] FIG. 1B shows the sequence containing the VAI RNA and its mutated sequences. [Diagram 2] FIG. 2 shows the results of an experiment confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of VAI. [Diagram 3] FIG. 3 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. [Figure 4] FIG. 4 shows the results of an experiment confirming the reconstitution efficiency of a minus-strand RNA viral vector produced in the presence or absence of nc886. [Diagram 5] FIG. 5 shows the results of an experiment confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a PKR-inhibitory viral factor. [Figure 6] FIG. 6 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. [Figure 7] FIG. 7 shows the results of an experiment confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a fusion sequence of a PKR inhibitor. [Figure 8] FIG. 8 shows the results of an experiment in which expression promoters were compared in LLC-MK2-F cells to confirm the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a PKR inhibitor. [Figure 9]FIG. 9 shows the results of an experiment in which expression promoters were compared in Vero-F cells to confirm the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a PKR inhibitor. [Figure 10] FIG. 10 shows the results of an experiment confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of multiple PKR inhibitors. [Figure 11] FIG. 11 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. [Figure 12] FIG. 12 shows the results of an experiment confirming the reconstitution efficiency of minus-strand RNA viral vectors produced with or without a PKR inhibitor incorporated into the viral genome. [Figure 13] FIG. 13 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. [Figure 14] FIG. 14 shows the results of confirming the reconstitution efficiency of a minus-strand RNA viral vector using VAI RNA extended at the 5' and 3' ends. [Figure 15] FIG. 15 shows the introduction of a hammerhead ribozyme between the T7 promoter and DNA encoding the SeV genome and its effect on the reconstitution efficiency of SeV using packaging cells that constitutively express a PKR inhibitor. [Figure 16] FIG. 16 shows the effect of introducing a hammerhead ribozyme between the T7 promoter and DNA encoding the SeV genome, and of introducing an HDV ribozyme between DNA encoding the SeV genome and VAI RNA, on the efficiency of SeV reconstitution. [Figure 17] FIG. 17 shows the results of a PCR experiment demonstrating that the HDV ribozyme self-cleaves VAI RNA from the SeV genome. [Figure 18] FIG. 18 shows the effect of introduction of VAI(330 bp)74c into a plasmid for SeV reconstitution on the efficiency of SeV reconstitution. [Figure 19]FIG. 19 shows the effect of introducing VAI(330 bp)74c into a SeV reconstitution plasmid and using it in combination with E3Y3 on the efficiency of SeV reconstitution. [Figure 20] FIG. 20 shows the effect of introducing VAI(330 bp)74c into a SeV reconstitution plasmid and using it in combination with E3Y3 on the infectious titer of SeV. [Figure 21A] FIG. 21A shows maps of the pCAG-SeV and pEF1-SeV constructs used in the experiment. [Figure 21B] FIG. 21B shows the reconstitution efficiency of pCAG-SeV and pEF1-SeV. [Figure 22] FIG. 22 shows the effect of VAI RNA on the reconstitution efficiency of mumps virus (MuV; family Paramyxoviridae, genus Rubulavirus). [Figure 23] FIG. 23 shows the effect of VAI RNA on the reconstitution efficiency of measles virus (MeV; family Paramyxoviridae, genus Morbillivirus). [Figure 24] FIG. 24 shows the effect of E3Y3 on the reconstitution efficiency of vesicular stomatitis virus (VSV; family Rhabdoviridae, genus Vesiculovirus). [Diagram 25] FIG. 25 shows the reconstitution efficiency of SeV, MeV, and MuV using heterologous RNA polymerases. [Figure 26] FIG. 26 shows the reconstitution efficiency of VSV with heterologous RNA polymerases. [Figure 27A] FIG. 27A shows a map of the p3vLPNP construct used in the experiment. [Figure 27B] FIG. 27B shows the results of reconstitution of SeV using pCAG-SeV or pEF1-SeV and p3vLPNP. Detailed Description of the Invention
[0017] In this specification, the term "negative strand RNA virus vector" refers to a recombinant virus obtained by modifying a virus having a negative strand RNA as its genome (i.e., a negative strand RNA virus) for the purpose of introducing a target gene. Examples of negative strand RNA viruses include Orthomyxoviridae (orthomyxoviruses such as influenza virus), Paramyxoviridae (paramyxoviruses such as Morbillivirus), Rhabdoviridae (rhabdoviruses such as rabies virus), Filoviridae (filoviruses such as Ebola and Marburg virus), and Bunyaviridae (bunyaviruses such as Hantavirus). Examples of paramyxoviruses include viruses of the Orthoparamyxovirinae subfamily. Examples of viruses of the Orthoparamyxovirinae subfamily include viruses of the Respirovirus genus, for example, Sendai virus.
[0018] As used herein, "protein kinase R" (PKR) is a protein kinase that is activated by double-stranded RNA. In humans, PKR is encoded by the EIF2AK2 gene. PKR contains an N-terminal double-stranded RNA binding domain and a C-terminal kinase domain. The kinase domain has an apoptosis-inducing function. PKR dimerizes by binding to double-stranded RNA, and subsequently activates by causing autophosphorylation. Activated PKR phosphorylates eukaryotic translation initiation factor eIF2α. Phosphorylation of eIF2α inhibits intracellular mRNA translation. Activated PKR can also induce apoptosis in cells to prevent the spread of viruses. Some viruses have factors that oppose PKR (i.e., PKR-inhibiting viral factors). For example, some viruses produce decoy RNA that binds to PKR and prevents its activation. Examples of decoy RNA include VAI RNA of adenovirus (e.g., having the sequence set forth in SEQ ID NO: 17), EBER of EB virus (e.g., having the sequence set forth in SEQ ID NO: 4), and TAR of HIV (e.g., having the sequence set forth in SEQ ID NO: 5). As a molecule that induces degradation of PKR, 2A of poliovirus is pro(e.g., having the sequence set forth in SEQ ID NO:6) is known. For RNA factors, a terminator (e.g., T7 terminator for T7 polymerase) may be linked to the 3' end of the nucleotide encoding the RNA. Factors that mask viral double-stranded RNA to prevent activation of PKR include E3L of vaccinia virus (e.g., having the sequence set forth in SEQ ID NO:7), σ3 of reovirus (e.g., having the sequence set forth in SEQ ID NO:8), Us11 of herpes simplex virus (e.g., having the sequence set forth in SEQ ID NO:29), and NS1 of influenza virus (e.g., having the sequence set forth in SEQ ID NO:28). Pseudosubstrates include K3L of vaccinia virus (e.g., having the sequence set forth in SEQ ID NO:10) and Tat of HIV (e.g., having the sequence set forth in SEQ ID NO:11). Molecules that induce dephosphorylation of substrates include ICP34.5 of herpes simplex virus (e.g., having the sequence set forth in SEQ ID NO:12). These factors are PKR-inhibitory viral factors. These factors may be natural.
[0019] As used herein, "nc886" is a non-coding RNA, also referred to as VTRNA2-1, CBL3, and hvg-5. nc886 functions as a direct inhibitor of PKR. nc886 may have, for example, the sequence set forth in SEQ ID NO: 13. As used herein, "p58 IPK p58 is a cytoplasmic protein that acts as an inhibitor of PKR. IPK For example, human p58 IPK For example, it may have the sequence of SEQ ID NO: 9. These factors may be naturally occurring.
[0020] In the present specification, "NS5A" refers to a nonstructural protein possessed by hepatitis C virus (HCV). NS5A is a phosphorylated protein, and is considered to be essential for genome replication of HCV. In addition, NS5A (e.g., having the sequence set forth in SEQ ID NO: 15) can inhibit antiviral activity against HCV and encephalomyocardial virus (see Medical Journal of Kobe University, 2003, 64(1 / 2):7-15). NS5A may be deleted on its C-terminus (e.g., from the 149th amino acid onward). For example, NS5A may be NS5A(1-148) (e.g., having the sequence set forth in SEQ ID NO: 16) having amino acids 1-148. These factors may be natural types.
[0021] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 17, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 17 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 17, or (iv) a fragment thereof, and The nucleic acid may have a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). According to the examples described below, the virus reconstitution rate is improved by inhibiting PKR in packaging cells. Therefore, the PKR to be inhibited is preferably that of the animal species from which the packaging cells are derived. For example, Vero cells are derived from African green monkeys, and LLC-MK2 cells are derived from rhesus monkeys. Therefore, in these cells, it is preferable to inhibit PKR of African green monkeys and rhesus monkeys, respectively.
[0022] In a preferred embodiment, the VAI RNA may have a sequence on the 5' side of the VAI RNA added to its 5' end. In a preferred embodiment, the VAI RNA may extend on the 5' side to include the adjacent region on the 5' side. Examples of sequences added to the 5' end include the sequences at positions 1 to 84 of SEQ ID NOs: 19, 20, and 23 to 26, or a part thereof that is contiguous with the VAI RNA. For example, the VAI RNA may have the nucleotide sequence set forth in SEQ ID NO: 34.
[0023] In a preferred embodiment, the VAI RNA may have a sequence on the 3' side of the VAI RNA added to its 3' end. In a preferred embodiment, the VAI RNA may extend on the 3' side to include the 3' adjacent region. Examples of sequences added to the 3' end include the sequences at positions 265 to 330 of SEQ ID NOs: 19, 20, and 23 to 26, or a part thereof that is contiguous with the VAI RNA. For example, the VAI RNA may have the nucleotide sequence set forth in SEQ ID NO: 35.
[0024] In a preferred embodiment, the VAI RNA may have a sequence on the 5' side of the VAI RNA added to its 5' end and a sequence on the 3' side of the VAI RNA added to its 3' end. In a preferred embodiment, the VAI RNA may extend to the 5' and 3' sides to include the 5' and 3' flanking regions, respectively. Examples of sequences added to the 5' end include the sequences of positions 1 to 84 of SEQ ID NOs: 19, 20, and 23 to 26, or a portion thereof that is contiguous with the VAI RNA. Examples of sequences added to the 3' end include the sequences of positions 265 to 330 of SEQ ID NOs: 19, 20, and 23 to 26, or a portion thereof that is contiguous with the VAI RNA.
[0025] In a preferred embodiment, the VAI RNA may have a sequence that is a part of SEQ ID NOs: 19, 20, and 23 to 26 and corresponds to a sequence containing the nucleotide sequence set forth in SEQ ID NO: 17, and includes (i) the VAI RNA and (ii) either or both of the 5'-side sequence and the 3'-side sequence of the VAI RNA. For example, the VAI RNA may have a sequence that is a part of SEQ ID NOs: 19, 20, and 23 to 26 and includes the nucleotide sequence set forth in SEQ ID NO: 17.
[0026] In one embodiment, the EBER may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 4, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 4 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 4, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0027] In one embodiment, the TAR may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:5, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:5 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:5, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0028] In one embodiment, 2A pro(i) may be a peptide comprising the sequence set forth in SEQ ID NO: 6, (ii) may be a peptide consisting of the sequence set forth in SEQ ID NO: 6 in which 1, 2, 3, 4, or 5 amino acids have been deleted, substituted, inserted, and / or added, or (iii) may be a peptide comprising a sequence having an identity of 90% or more or 95% or more to the sequence set forth in SEQ ID NO: 6, or (iv) may be a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0029] In one embodiment, E3L may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 7, (ii) a peptide consisting of the sequence set forth in SEQ ID NO: 7 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 7, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0030] In one embodiment, σ3 may be (i) a peptide comprising the sequence set forth in SEQ ID NO:8, (ii) a peptide consisting of the sequence set forth in SEQ ID NO:8 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:8, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0031] In one embodiment, p58 IPK(i) may be a peptide comprising the sequence set forth in SEQ ID NO: 9, (ii) may be a peptide consisting of the sequence set forth in SEQ ID NO: 9 in which 1, 2, 3, 4, or 5 amino acids have been deleted, substituted, inserted, and / or added, or (iii) may be a peptide comprising a sequence having an identity of 90% or more or 95% or more to the sequence set forth in SEQ ID NO: 9, or (iv) may be a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0032] In one embodiment, K3L may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 10, (ii) a peptide consisting of the sequence set forth in SEQ ID NO: 10 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 10, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0033] In one embodiment, Tat may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 11, (ii) a peptide consisting of the sequence set forth in SEQ ID NO: 11 with 1, 2, 3, 4 or 5 amino acids deleted, substituted, inserted and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 11, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0034] In one embodiment, ICP34.5 may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 12, (ii) a peptide consisting of the sequence set forth in SEQ ID NO: 12 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 12, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0035] In one embodiment, nc886 may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 13, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 13 with 1, 2, 3, 4, or 5 nucleic acids deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 13, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0036] In one embodiment, nc886 may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 14, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 14 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 14, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0037] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 18, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 18 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 18, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0038] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 19, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO: 19 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 19, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0039] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:20, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:20 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:20, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0040] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:21, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:21 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:21, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0041] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:22, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:22 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:22, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0042] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:23, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:23 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:23, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0043] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:24, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:24 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:24, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0044] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:25, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:25 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:25, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0045] In one embodiment, the VAI RNA may be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:26, (ii) a nucleic acid consisting of the sequence set forth in SEQ ID NO:26 in which 1, 2, 3, 4, or 5 nucleic acids have been deleted, substituted, inserted, and / or added, or (iii) a nucleic acid comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:26, or (iv) a fragment thereof, and The nucleic acid may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0046] In one aspect, NS1 may be (i) a peptide comprising the sequence set forth in SEQ ID NO:28, (ii) a peptide consisting of the sequence set forth in SEQ ID NO:28 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:28, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0047] In one embodiment, Us11 may be (i) a peptide comprising the sequence set forth in SEQ ID NO:29, (ii) a peptide consisting of the sequence set forth in SEQ ID NO:29 with 1, 2, 3, 4, or 5 amino acids deleted, substituted, inserted, and / or added, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:29, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0048] In one embodiment, E3K3 may be a fusion sequence of a part or all of E3L (e.g., the C-terminal 107 amino acid sequence of E3L) and a part or all of K3, preferably a fusion sequence of a part of E3L (more preferably, the C-terminal 107 amino acid sequence of E3L) and K3, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). In one embodiment, E3K3 may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 30, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence set forth in SEQ ID NO: 30, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 30, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0049] In one embodiment, E3Y3 may be a fusion sequence of a part or all of E3L (e.g., the C-terminal 107 amino acid sequence of E3L) and a part or all of Y3, preferably a fusion sequence of a part of E3L (more preferably, the C-terminal 107 amino acid sequence of E3L) and Y3, and may be a peptide having a function of inhibiting PKR (e.g., PKR such as human PKR and monkey PKR). In one embodiment, E3Y3 may be (i) a peptide comprising the sequence set forth in SEQ ID NO: 31, (ii) a peptide consisting of a sequence in which 1, 2, 3, 4, or 5 amino acids are deleted, substituted, inserted, and / or added in the sequence set forth in SEQ ID NO: 31, or (iii) a peptide comprising a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 31, or (iv) a fragment thereof, and The peptide may have the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).
[0050] In the present specification, a "packaging cell" refers to a cell that produces a viral vector. In general, in order to improve safety, the viral genome of a viral vector is engineered so that one or more factors selected from the group consisting of proliferation, replication, and spread (including infection of other cells) are destroyed and the viral genome cannot proliferate, replicate, or spread after cell infection. However, when producing a viral vector, in order to enable proliferation, replication, and spread, the viral vector is produced while the disrupted factors are supplemented in the packaging cell. For this reason, in order to produce a viral vector, the packaging cell expresses a part of the disrupted viral factor so that the amount of virus production is restored by complementing the disrupted viral factor. The packaging cell may stably retain such a factor in the genome, or may retain it temporarily. In either case, during virus production, the complemented viral factor is supplied to the packaging cell. As an example, a Sendai virus vector is classically obtained by producing a Sendai virus having a genome lacking the F gene using a packaging cell that supplies the F gene. The supplied F gene is activated in the presence of trypsin, but an F gene (F5R) that is activated by furin, which is universally present in cells, has also been developed, improving the convenience of virus production (see, for example, WO2005 / 071085A). In recent years, a technology for producing Sendai virus from cDNA has been developed. For example, a vector has been produced that is designed to further improve safety for medical application to humans, using the attenuated Z strain as a basic structure. For example, a technology has been developed to delete one or more of the F, HN, and M genes from the viral genome to eliminate the transmissibility of the virus. For example, an F gene-deleted viral genome is preferably used. The viral genome is operably linked to a control sequence (for example, a T7 promoter), and the production of the viral genome can be driven by the control sequence. This allows the Sendai virus genome to be produced from cDNA in the packaging cell.When a T7 promoter is used as a control sequence (e.g., the first, second, or third control sequence), the T7 RNA polymerase can be supplied by a helper virus such as vaccinia virus. In the packaging cell, N, P, F, and L operably linked to a control sequence that drives transcription by RNA polymerase (e.g., polII) are expressed, thereby supplying viral particle components to form viral particles in the packaging cell. For example, LLC-MK2 cells derived from monkey kidney are used as packaging cells. This results in viral particles that can infect cells once but cannot be propagated to other cells thereafter. The viral particles can be concentrated and / or purified as necessary before use. When a foreign gene is incorporated into the virus, a viral-specific control sequence is introduced as necessary to enable transcription by RNA-dependent RNA polymerase.
[0051] According to the present invention, a method for producing negative strand RNA virus or negative strand RNA virus vector is provided.Negative strand RNA virus includes Orthomyxoviridae (orthomyxovirus such as influenza virus), Paramyxoviridae (paramyxovirus such as Morbillivirus), Rhabdoviridae (rhabdovirus such as rabies virus), Filoviridae (filovirus such as Ebola and Marburg virus), and Bunyaviridae (bunyavirus such as Hantavirus).Preferably, negative strand RNA virus is a virus of Paramyxoviridae, preferably paramyxovirus, and preferably Sendai virus.
[0052] As used herein, the term "control sequence" refers to a sequence that has the activity of driving a gene operably linked thereto and transcribing RNA from the gene. The control sequence is, for example, a promoter. Examples of promoters include class I promoters (which can be used to transcribe rRNA precursors), class II promoters (which are composed of a core promoter and an upstream promoter element and can be used to transcribe mRNA), and class III promoters (which are further broadly classified into types I, II, and III).
[0053] In one embodiment, a negative-strand RNA virus vector has a disrupted (e.g., deleted) factor on its genome related to the proliferation or infection of a negative-strand RNA virus into a cell, and has a reduced proliferation or infection ability or no substantial infection ability in cells other than packaging cells. As described above, such a vector is conferred the initial ability to infect cells by producing it under conditions in which the disrupted proliferation or infection factor is supplied to the packaging cell. As a result, the vector obtained from the packaging cell has the infectious ability, but the vector that subsequently infects a cell other than the packaging cell cannot produce any more infectious particles, thereby improving the safety of the vector.
[0054] In one aspect, the method of the invention comprises: (A) expressing a protein kinase R (PKR)-inhibitory factor from a gene encoding the factor operably linked to a first control sequence and providing the factor to a packaging cell.
[0055] The first control sequence may be a promoter capable of transcribing RNA, for example, mRNA, and various pol II promoters may be used. Examples of pol II promoters include, but are not limited to, CMV promoter, EF1 promoter (EF1α promoter), SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, CAG promoter, and CBh promoter. Examples of promoters capable of transcribing RNA include promoters that drive bacteriophage-derived RNA polymerase, such as T7 promoter, T3 promoter, and SP6 promoter, as well as pol III promoters, such as U6 promoter. For circular DNA, the T7 promoter may be preferred, and for linear DNA, the SP6 promoter may be preferred. The promoter may also be an inducible promoter. These promoters may be preferably used for transcription of RNA-based factors. An inducible promoter is a promoter that can induce expression of a polynucleotide functionally linked to the promoter only in the presence of an inducer that drives the promoter. Examples of inducible promoters include promoters that induce gene expression by heating, such as heat shock promoters. In addition, the inducible promoter may be a promoter whose inducer is a drug. Examples of such drug-inducible promoters include Cumate operator sequences, λ operator sequences (e.g., 12×λOp), tetracycline-based inducible promoters, and the like. Examples of tetracycline-based inducible promoters include promoters that drive gene expression in the presence of tetracycline or its derivatives (e.g., doxycycline), or reverse tetracycline-controlled transactivator (rtTA). Examples of tetracycline-based inducible promoters include the TRE3G promoter.
[0056] Some viruses have PKR-inhibitory viral factors to counter PKR. In the present invention, the PKR-inhibitory viral factors naturally possessed by such viruses can be used as the PKR-inhibitory viral factors. Therefore, the species from which the viral genome and the PKR-inhibitory viral factors originate may be the same species, but are preferably different species.
[0057] Protein kinase R (PKR) inhibitory factors include, for example, decoy RNAs that bind to PKR. Decoy RNAs include, for example, VAI RNA, EBER, nc886, and TAR, and their orthologues. In a preferred embodiment, the decoy RNA may be VAI RNA and its orthologues, particularly from adenovirus. In a preferred embodiment, the decoy RNA may be EBER and its orthologues, particularly from Epstein-Barr (EB) virus. In a preferred embodiment, the decoy RNA may be nc886 and its orthologues, particularly from human. In a preferred embodiment, the decoy RNA may be TAR and its orthologues, particularly from human immunodeficiency virus (HIV). These factors can be preferably used in the present invention.
[0058] The VAI can have the sequence set forth in SEQ ID NO: 17. The VAI may further include sequences preceding and following the VAI on the adenovirus genome. Thus, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 19. The VAI may further include VAII. For example, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 21. The VAI may have one or more mutations selected from the group consisting of substitution, deletion, insertion, and addition. For example, the PKR-inhibitory viral agent may have a sequence having a substitution at the base of VAI corresponding to the 74th base in the sequence set forth in SEQ ID NO: 17. The substitution at the 74th base in the sequence set forth in SEQ ID NO: 17 may be any of G, A, and C, but is preferably C. In a preferred embodiment, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 18 or 20. In a preferred embodiment, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 22 or 23. For example, a PKR-inhibiting viral agent may have a sequence having a substitution at a base in VAI corresponding to base 191 in the sequence set forth in SEQ ID NO: 19. In a preferred embodiment, a PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO: 24. In certain preferred embodiments, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 25. In certain preferred embodiments, the PKR-inhibitory viral agent may have the sequence set forth in SEQ ID NO: 26.
[0059] In one embodiment, nc886 may have the sequence of SEQ ID NO: 13. nc886 may further include sequences before and after VAI. nc886 may further include sequences before and after VAI and have the sequence set forth in SEQ ID NO: 14.
[0060] Protein kinase R (PKR) inhibitors also include molecules that induce the degradation of PKR. Examples of molecules that induce the degradation of PKR include 2A proand its orthologues. In a preferred embodiment, the molecule that induces degradation of PKR is 2A pro and its orthologues, particularly from poliovirus. These factors can be preferably used in the present invention.
[0061] Protein kinase R (PKR) inhibitory factors also include factors that mask viral double-stranded RNA. Factors that mask viral double-stranded RNA can mask viral double-stranded RNA to prevent activation of PKR. Factors that mask viral double-stranded RNA include, for example, E3L, σ3, Us11, and NS1, and their orthologues. In a preferred embodiment, the factor that masks viral double-stranded RNA can be E3L and its orthologues, particularly from vaccinia virus. In a preferred embodiment, the factor that masks viral double-stranded RNA can be σ3 and its orthologues, particularly from reovirus. In a preferred embodiment, the factor that masks viral double-stranded RNA can be Us11 and its orthologues, particularly from herpes simplex virus (HSV). In a preferred embodiment, the factor that masks viral double-stranded RNA can be NS1 and its orthologues, particularly from influenza virus. These factors can be preferably used in the present invention.
[0062] Protein kinase R (PKR) inhibitors also include factors that inhibit the dimerization of PKR. Factors that inhibit the dimerization of PKR include, for example, p58 IPK and NS5A and their orthologues. In a preferred embodiment, the factor that inhibits PKR dimerization is p58 IPK and its orthologues, particularly derived from humans. In a preferred embodiment, the factor that inhibits the dimerization of PKR may be NS5A and its orthologues, particularly derived from hepatitis C virus (HCV). These factors can be preferably used in the present invention. NS5A may be deleted on its C-terminus (e.g., from the 149th amino acid onward). For example, NS5A may be NS5A(1-148) having the 1st to 148th amino acids.
[0063] Protein kinase R (PKR) inhibitory factor also includes PKR pseudosubstrate.Pseudosubstrate includes, for example, K3L and Tat and their orthologues.In a preferred embodiment, pseudosubstrate can be K3L and its orthologue, particularly from vaccinia virus.In a preferred subject, pseudosubstrate is Tat and its orthologue, particularly from HIV.These factors can be preferably used in the present invention.
[0064] Protein kinase R (PKR) inhibitory factors also include molecules that induce dephosphorylation of substrates. Molecules that induce dephosphorylation of substrates include, for example, ICP34.5 and its orthologues. In a preferred embodiment, the molecules that induce dephosphorylation of substrates are ICP34.5 and its orthologues derived from herpes simplex virus (HSV). These factors can be preferably used in the present invention.
[0065] In one embodiment, the protein kinase R (PKR) inhibitory agent is selected from the group consisting of adenovirus VAI RNA, EB virus EBER, human nc886, HIV virus TAR, and poliovirus 2A. pro , vaccinia virus E3L, reovirus δ3, influenza virus NS1, human p58 IPK , NS5A of hepatitis C virus, K3L of vaccinia virus, Tat of HIV virus, Us11 of herpes simplex virus, and ICP34.5 of herpes simplex virus, and orthologues thereof.
[0066] The protein kinase R (PKR) inhibitory factor may in some embodiments be stably integrated into the genome of the packaging cell. Expression may be driven by a first control sequence. The first control sequence may be a constitutive or inducible promoter.
[0067] The protein kinase R (PKR) inhibitory factor may, in some embodiments, be transiently introduced into the packaging cell. For example, the protein kinase R (PKR) inhibitory factor may be carried on a plasmid DNA. The plasmid DNA may be introduced into the cell using techniques well known to those of skill in the art, thereby allowing the protein kinase R (PKR) inhibitory factor to be expressed in the cell from the plasmid DNA. Expression may be driven by a first control sequence. The first control sequence may be a constitutive or inducible promoter.
[0068] In one embodiment, the packaging cells may be, for example, Vero cells or LLC-MK2 cells. In one embodiment, the packaging cells may be a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells. In one embodiment, no cells other than the packaging cells are used for virus production. In one embodiment, the packaging cells express the F gene. In one preferred embodiment, the packaging cells constitutively express the F gene. In one preferred embodiment, the F protein may be activated by trypsin. In one preferred embodiment, the F protein may be F5R. In one preferred embodiment, a composition for reconstituting SeV is provided, comprising Vero cells or LLC-MK2 cells. Reconstitution refers to supplying components of a virus or a virus vector to packaging cells to form a virus or a virus vector. Reconstitution of SeV may be performed as described herein.
[0069] According to the present invention, there is provided a method for producing a minus-strand RNA virus or a minus-strand RNA viral vector, comprising the steps of: (B) expressing the genomic RNA of a minus-strand RNA virus or viral vector in a packaging cell and forming a minus-strand RNA virus or viral vector in the presence of the factor {e.g., expressing the genomic RNA of a minus-strand RNA virus or a minus-strand RNA viral vector in a packaging cell in the presence of a PKR-inhibitory factor, e.g., a PKR-inhibitory viral factor, and forming a minus-strand RNA virus or a minus-strand RNA viral vector} A method is provided that includes:
[0070] The genomic RNA of a minus-strand RNA virus or a minus-strand RNA virus vector can be expressed, for example, from a gene expression vector having a DNA encoding the genomic RNA operably linked to a second control sequence. The gene expression vector can be, for example, any vector that expresses the genomic RNA at least transiently in a cell, and in a preferred example, it can be a plasmid vector. The genomic RNA may have the following mutations in the P protein: 511F, the M protein: 69E, 116A, and 183S, the HN protein: 262T, 264R, and 461E, and the L protein: 1197S and 1796E, in order to minimize the cytotoxicity of the vector (see, for example, WO2003 / 025570). When the genomic RNA is produced in a cell, it is complexed with other components of the virus particle (e.g., F, N, P, L) supplied to the packaging cell to form a virus or a virus vector (virus particle). In this case, the presence of a protein kinase R (PKR) inhibitor, NS5A, or nc886, or equivalents thereof, in the cells increases the production of viral particles. The packaging cells can be cultured under suitable conditions. The gene encoding the viral genome can be driven by a T7 promoter. In this case, the packaging cells can be supplied with T7 polymerase. The gene encoding the viral genome can be driven by a CAG promoter or an EF1 promoter.
[0071] In some embodiments, the packaging cells can be further supplied with SeV components (e.g., N, P, and L, and their equivalents) to promote the formation of SeV in the packaging cells. The SeV components can be supplied, for example, by introducing a plasmid vector into the packaging cells.
[0072] In some embodiments, the genes encoding the components of the virus particle (e.g., N, P, L) are each operably linked to a third control sequence. In some embodiments, the genes encoding the components of the virus particle (e.g., F, N, P, L), each operably linked to a third control sequence, are integrated on a plasmid. In some embodiments, the third control sequence can be a CAG promoter (e.g., having a sequence as set forth in SEQ ID NO:2). In some embodiments, at least one or all of the third control sequences can be a non-CAG promoter, for example, an EF1α promoter (e.g., having a sequence as set forth in SEQ ID NO:1). In some preferred embodiments, the genes encoding the components of the virus particle (e.g., N, P, L) are carried on one or more gene expression vectors (preferably plasmids). In this case, these components may be operably linked to one control sequence or to multiple control sequences. The control sequence can be, for example, a CAG or EF1 promoter.
[0073] In one embodiment of the present invention, a method for producing a negative-strand RNA virus or a negative-strand RNA viral vector includes the steps of: (C) Recovering the formed negative-strand RNA virus or negative-strand RNA viral vector. Further includes:
[0074] The virus particles formed in the cells can be appropriately collected. The virus particles formed in the cells can be released outside the cells. Therefore, the virus particles can be collected from the culture medium. The collected virus particles can be appropriately purified and / or concentrated. In this way, an isolated virus vector, a purified virus vector, or a concentrated virus vector is provided. The obtained virus vector can be appropriately stored. For example, the storage can be performed in a deep freezer (e.g., about -80°C), a freezer (e.g., about -20°C), or a refrigerator (about 4°C). The storage can also be performed in liquid nitrogen. The virus vector is subjected to titer measurement (potency measurement) as necessary. The virus titer can be determined by a method well known to those skilled in the art.
[0075] In one embodiment, the infectious titer of the negative-strand RNA virus or negative-strand RNA viral vector obtained by the method of the present invention is 1×10 5 CIU / mL or more, 2×10 5 CIU / mL or more, 3×10 5 CIU / mL or more, 4×10 5 CIU / mL or more, 5×10 5 CIU / mL or more, 6×10 5 CIU / mL or more, 7×10 5 CIU / mL or more, 8×10 5 CIU / mL or more, 9×10 5 CIU / mL or more, 1×10 6 CIU / mL or more, 2×10 6 CIU / mL or more, 3×10 6 CIU / mL or more, 4×10 6 CIU / mL or more, 5×10 6 CIU / mL or more, 6×10 6 CIU / mL or more, 7×10 6 CIU / mL or more, 8×10 6 CIU / mL or more, 9×10 6 CIU / mL or more, 1×10 7 CIU / mL or more, 2×10 7 CIU / mL or more, 3×10 7CIU / mL or more, 4×10 7 CIU / mL or greater or 5×10 7 May be CIU / mL or higher.
[0076] In one embodiment of the present invention, the relationship between the species from which the virus or viral vector is derived and the species from which the PKR inhibitory agent is derived may be heterologous. In this embodiment, the relationship between the species from which the first regulatory sequence is derived and the PKR inhibitory agent may be homologous.
[0077] In one embodiment of the present invention, the relationship between the species from which the first regulatory sequence and the PKR inhibitory agent originate may be heterologous. In this embodiment, the relationship between the species from which the virus or viral vector originates and the species from which the PKR inhibitory agent originates may be homologous.
[0078] In one aspect of the present invention, the relationship between the species from which the virus or viral vector is derived and the species from which the PKR inhibitory agent is derived may be heterologous, and the relationship between the species from which the first regulatory sequence is derived and the PKR inhibitory agent may be heterologous.
[0079] In one embodiment of the present invention, a gene encoding a PKR-inhibitory factor is integrated into the genome of a packaging cell. In one embodiment of the present invention, a gene encoding a PKR-inhibitory factor is integrated into a vector (e.g., a plasmid DNA) to be introduced into a packaging cell. The integration position may be before the N gene on the SeV genome, between the N gene and the P gene, between the P gene and the M gene, between the M gene and the HN gene, between the HN gene and the L gene, or after the L gene. When the factor is RNA, the integration position may be in the 3'UTR of a gene encoding a target protein. In general, the N gene may also be referred to as the NP gene.
[0080] In a preferred embodiment of the present invention, the gene encoding the PKR inhibitory factor is integrated into the RNA genome of a minus-strand RNA virus or a minus-strand RNA virus vector. In this embodiment, the gene encoding the PKR inhibitory factor may be further integrated into the genome of a packaging cell or into a vector (e.g., plasmid DNA) to be introduced into the packaging cell. Thus, in a preferred embodiment, the gene encoding the PKR inhibitory factor is integrated into the RNA genome of a minus-strand RNA virus or a minus-strand RNA virus vector, and further integrated into the genome of a packaging cell or into a vector (e.g., plasmid DNA) to be introduced into the packaging cell. By doing so, the PKR inhibitory factor is supplied from the packaging cell even while the number of genomes is small, and when the number of genomes increases, the PKR inhibitory factor is also supplied from the genome, so that the minus-strand RNA virus or the minus-strand RNA virus vector can be successfully multiplied. In addition, even after the obtained minus-strand RNA virus or the virus vector is infected into another cell (non-packaging cell), the PKR inhibitory factor is supplied from the viral genome, so that the virus or the virus vector can be successfully multiplied in the cell. This can have the effect of increasing the expression level of a target gene carried by a virus or viral vector, for example.
[0081] In one embodiment of the invention, viral particles are produced in the absence of a helper virus.
[0082] In one embodiment of the present invention, the virus or viral vector is a paramyxovirus or a paramyxovirus vector, and the RNA genome is an F gene-deficient RNA genome. In this embodiment, the first control sequence can be a CAG promoter or an EF1 promoter, for example, an EF1 promoter. Also in this embodiment, the second control sequence is a T7 promoter, and the T7 RNA polymerase can be produced by transcription and translation from a cell genome or a plasmid. In a preferred subject, the paramyxovirus is a Sendai virus. Also, in a preferred embodiment, the paramyxovirus vector is a Sendai virus vector.
[0083] In some embodiments, the paramyxovirus or paramyxovirus vector can express N, P, and L proteins. In some embodiments, the paramyxovirus or paramyxovirus vector does not express one, two, or three selected from the group consisting of F, HN, and M proteins. For example, the RNA genome lacks RNA encoding one, two, or three proteins selected from the group consisting of F, HN, and M proteins. In some preferred embodiments, the paramyxovirus or paramyxovirus vector does not express F protein.
[0084] In certain embodiments, a paramyxovirus or paramyxovirus vector has an RNA genome that expressibly comprises a V protein and / or a C protein.
[0085] According to the present invention, an RNA genome of a minus-strand RNA virus or a minus-strand RNA virus vector and a DNA encoding the RNA genome are provided. In one embodiment, the RNA genome contains a gene encoding one or more PKR-inhibitory factors (e.g., PKR-inhibitory viral factors) in an expressible manner. According to the present invention, a minus-strand RNA virus vector containing the above-mentioned RNA genome is also provided. The minus-strand RNA virus or the minus-strand RNA virus vector further has a virus particle encapsulating the RNA genome. Such a virus or virus vector can exhibit a stronger proliferation ability after cell infection. In a preferred embodiment, the minus-strand RNA virus is a paramyxovirus, more preferably a Sendai virus. In a preferred embodiment, the minus-strand RNA virus vector is a paramyxovirus vector, more preferably a Sendai virus vector. In one embodiment, the DNA encoding the RNA genome is operably linked to a second control sequence. In one embodiment, a gene expression vector is provided, comprising a DNA encoding the RNA genome operably linked to a second control sequence.
[0086] In a preferred embodiment, a gene expression vector for an RNA genome (particularly SeV genome), which contains a DNA encoding the genome, may contain a sequence of a self-cleaving ribozyme (e.g., hammerhead ribozyme or HDV ribozyme) adjacent to either or both of the upstream and downstream of the RNA genome. The gene expression vector may also be linked to a sequence of another factor (e.g., a PKR-inhibiting factor or a factor that promotes RNA amplification) via the sequence of the self-cleaving ribozyme (e.g., hammerhead ribozyme or HDV ribozyme), thereby transcribing the RNA genome and the sequence of the other factor into a series of RNA. With this configuration, after the RNA genome is transcribed, the RNA is cleaved at the sequence of the self-cleaving ribozyme (e.g., hammerhead ribozyme or HDV ribozyme), allowing the other factor to be removed, and RNA substantially consisting of the RNA genome can be obtained. For example, by linking a PKR-inhibiting factor or a factor that promotes RNA amplification as the sequence of the other factor, the other factor can be removed from the completed genome after the effect of the other factor is exerted to amplify the genome. For example, the other factor can be arranged on the 5' side of the RNA genome, and a hammerhead ribozyme sequence can be arranged between the other factor and the region encoding the RNA genome, or the other factor can be arranged on the 3' side of the RNA genome, and a HDV ribozyme sequence can be arranged between the region encoding the RNA genome and the other factor. More specifically, the gene expression vector containing the DNA encoding the RNA genome may be configured to contain, for example, a promoter (e.g., T7 promoter, CAG promoter, and EF1 promoter), a sequence of a first self-cleaving ribozyme (e.g., a 3' self-cleaving ribozyme, preferably a hammerhead ribozyme), a DNA encoding the RNA genome, a sequence of a second self-cleaving ribozyme (e.g., a 5' self-cleaving ribozyme, preferably a HDV ribozyme), and a sequence of the other factor in this order.In another preferred embodiment, the vector may be configured to include a promoter (e.g., T7 promoter, CAG promoter, and EF1 promoter), a sequence of other factors, a sequence of a first self-cleaving ribozyme (e.g., a 3' self-cleaving ribozyme, preferably a hammerhead ribozyme), a DNA encoding an RNA genome, and a sequence of a second self-cleaving ribozyme (e.g., a 5' self-cleaving ribozyme, preferably an HDV ribozyme) in this order. The self-cleaving ribozyme is merely shown as an example above, and the preferred embodiment is not limited thereto. In particular, when a self-cleaving ribozyme is used, the self-cleaving ribozyme can be arranged so that the number of bases in the RNA genome is 6n {wherein n is a natural number}. The gene expression vector may further include, for example, a terminator sequence (e.g., a T7 terminator sequence for T7 polymerase) downstream of the sequence of other factors. Various sequences of self-cleaving ribozymes (e.g., hammerhead ribozymes) are known. Examples of self-cleaving ribozymes include, but are not limited to, hammerhead ribozymes, hepatitis delta virus (HDV) ribozymes, twister ribozymes, twister-sister ribozymes, pistol ribozymes, hairpin ribozymes, and hatchet ribozymes. These self-cleaving ribozymes can be, for example, 5' self-cleaving ribozymes and / or 3' self-cleaving ribozymes. In particular, the sequence of Hh-Rbz (e.g., SEQ ID NO: 36) can be used as the 3' self-cleaving ribozyme, and the sequence of hepatitis delta virus ribozyme (HDV-Rbz) (e.g., SEQ ID NO: 37) can be used as the 5' self-cleaving ribozyme.
[0087] In a preferred embodiment, the gene expression vector expressing the component of an RNA virus may further include a PKR-inhibiting factor or a factor that promotes RNA amplification. The gene expression vector may link the sequence of another factor (e.g., a PKR-inhibiting factor or a factor that promotes RNA amplification) to the component via the sequence of the self-cleaving ribozyme (e.g., as described above, which may be, for example, a hammerhead ribozyme or HDV ribozyme), thereby transcribing the RNA genome and the sequence of the other factor into a series of RNA. Alternatively, in a preferred embodiment, the PKR-inhibiting factor or the factor that promotes RNA amplification may be independently carried on a plasmid.
[0088] According to the present invention, a combination is provided of a gene expression vector for the virus, which contains DNA encoding the RNA genome of the virus, and a vector for reconstituting the virus, which contains DNA encoding a component of the virus. The combination can be used to reconstitute particles of the virus in a cell by co-expressing the vectors in the cell. In one embodiment, a combination for use in reconstituting a virus particle is provided, which includes DNA encoding the RNA genome of the virus and DNA encoding a component of the virus, and these DNAs include DNA encoding factors sufficient to constitute a virus particle, and are carried on one or more gene expression vectors. The RNA genome and the DNA encoding the component of the virus are operably linked to a control sequence. The control sequence may be a promoter, and examples of the promoter include, but are not limited to, the T7 promoter, the CAG promoter, and the EF1 promoter.
[0089] The Sendai virus or Sendai virus vector may further have a gene of interest in its RNA genome. The gene of interest may be a gene that is to be introduced into a cell. The gene of interest may be expressed in the cell into which it is introduced, and may cause RNA or protein to be produced. The gene of interest is carried in the RNA genome in an expressible manner. The gene of interest may be a foreign gene. The term "foreign gene" is used to distinguish it from a gene endogenous to the cell into which it is introduced. EXAMPLES
[0090] Preparation of negative-strand RNA viral vectors We expressed negative-strand RNA viral vectors in viral packaging cells, and evaluated the effectiveness of PKR inhibitors on expression.
[0091] Sendai virus (SeV) was used as a minus-strand RNA viral vector. Sendai virus was introduced into F gene expressing cells using a plasmid mixture, and collected from the culture supernatant after 3 days. The plasmid mixture contained pSeV-EmGFP carrying the Sendai virus genome operably linked to the T7 promoter. The Sendai virus genome carried a gene encoding EmGFP so that genome proliferation could be detected by fluorescence. The Sendai virus genome had a deletion of the F gene.
[0092] (1) F gene expressing cells were prepared as follows. The SeV F gene (with Kozak sequence added and optimized for human codons) was loaded into pCAGGS-neo to construct pCAGGS-F-neo. The resulting plasmid was transfected into Vero cells or LLC-MK2 cells using ViaFect (Promega), and selected with 1-2 mg / mL G418 disulfate solution (Nacalai Tesque) to obtain F gene-expressing cells. The resulting cells are designated Vero-F and LLC-MK2-F.
[0093] (2) F gene-deficient SeV was constructed as follows. Based on the sequence information of SeV-Z strain in ACCESSION:AB855655 and the information of pSeV in J. General Virology (1997), 78, 2813-2820, pSeV / dF was constructed in which the F gene-deleted SeV genome was transcribed by the T7 promoter. To minimize the cytotoxicity of SeV-Z strain, the following amino acid mutations were added to pSeV / dF: P protein: 511F, M protein: 69E, 116A, and 183S, HN protein: 262T, 264R, and 461E, and L protein: 1197S and 1796E (see, for example, WO2003 / 025570). The obtained plasmid was named pSeV / TSdF. To evaluate SeV reconstitution, a GFP mutant, EmGFP, was used as the gene of interest (GOI). The GOI was placed in front of the N gene (hereafter indicated as "+"), followed by between the P and M genes (hereafter indicated as "PM"), between the M and HN genes (hereafter indicated as "MHN"), and between the HN and L genes (hereafter indicated as "HNL"), with the amount of gene expression decreasing in that order. The EmGFP gene was placed in front of the N gene of SeV, and pSeV+EmGFP / TSdF was mainly used.
[0094] (3) The plasmid for SeV reconstitution was prepared as follows. pCAGGS-NP, pCAGGS-P4C(-), pCAGGS-L, pCAGGS-F5R, and pCAGGS-T7 were constructed with reference to WO2005 / 071092, and this combination is referred to as "CAG." In addition, a Kozak sequence was added and optimized to human codons, and a set of plasmids for reconstruction, each of which has a promoter different from the above, was constructed: pCAGGS-NPco, pCAGGS-P4C(-)co, pCAGGS-Lco, pCAGGS-F5Rco, pCAGGS-T7co, pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pEF1-F5Rco, and pEF1-T7co. Furthermore, 430P, 849I, and 880Y mutations were introduced into T7 with reference to P2001-54387A, and 644Y and 667Y mutations were introduced with reference to P2003-61683A, and pCAGGS-T7mco and pEF1-T7mco carrying the resulting T7m sequence were constructed. The combination of pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco is denoted as "EFnpL." The combination of pEF1-NPco, pCAGGS-P4C(-)co, pCAGGS -Lco, pCAGGS-F5Rco, and pCAGGS-T7mco is denoted as EFnCAGpL. The combination of pCAGGS-NPco, pCAGGS-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco is designated as CAGnpEFL.
[0095] (4) A plasmid carrying a PKR inhibitor was constructed as follows. The sequence for evaluating non-coding RNA was carried in a pT7 plasmid with a T7 promoter and a T7 terminator, and pT7-VAI (180 bp; SEQ ID NO: 17), pT7-VAI74a (180 bp; SEQ ID NO: 18, V=A), pT7-VAI74c (180 bp; SEQ ID NO: 18, V=C), pT7-VAI74a (330 bp; SEQ ID NO: 26, M=A), pT7-VAI-VAII (478 bp; SEQ ID NO: 21), pT7-nc886 (108 bp; SEQ ID NO: 13), and pT7-nc886 (272 bp; SEQ ID NO: 14) were constructed. To destroy the BamHI recognition sequence in the apical stem of VAI (Figure 1), a sequence with a base substitution (T74A, T74C) at the 74th base of VAI was constructed. Similarly, to destroy the NheI recognition sequence on the 3' side of VAI, a sequence was constructed with a base substitution (G191C) at the 191st base (M=A in SEQ ID NO: 26). These base substitutions were designed with the expectation that they would not affect the secondary structure of the RNA and would not affect the function of VAI. As another PKR inhibitor, a pT7 plasmid carrying nc886 (108 bp) was constructed. To extend the sequence, nc886 (272 bp) was constructed with additional sequences before and after VAI (SEQ ID NO: 13, 14). As a control plasmid, pT7-IRES was constructed with an IRES sequence under the T7 promoter.
[0096] (5) A plasmid carrying a PKR inhibitor was constructed as follows. The sequence to be translated was basically added with a Kozak sequence and optimized to human codons. pCAGGS-E3L, pCAGGS-K3L, pCAGGS-Y3, pCAGGS-E3K3, pCAGGS-E3Y3, pCAGGS-NS1, pCAGGS-σ3, and pCAGGS-Us11 were constructed. E3L (SEQ ID NO: 7) and K3L (SEQ ID NO: 10) are sequences of vaccinia virus, Y3 (SEQ ID NO: 27) is the C-terminal 106 amino acid sequence of SeV C protein, NS1 (SEQ ID NO: 28) is the influenza virus sequence, σ3 (SEQ ID NO: 8) is the reovirus sequence, Us11 (SEQ ID NO: 29) is the HSV-1 sequence, E3K3 (SEQ ID NO: 30) is a fusion sequence of the C-terminal 107 amino acid sequence of E3L and K3L, and E3Y3 (SEQ ID NO: 31) is a fusion sequence of the C-terminal 107 amino acid sequence of E3L and Y3.
[0097] (6) Reconstitution of SeV in the presence or absence of PKR inhibitors The ratio of SeV reconstitution plasmid to transfection reagent was in accordance with WO 2005 / 071092. Specifically, the following weight amounts of plasmid and transfection reagent (TransIT-LT1 Reagent or ViaFect) were mixed to obtain a plasmid mix.
[0098] PKR inhibitor-free conditions: NP, P4C(-), F5R, T7: 0.5μg each L: 2μg pSeV: 5 μg Total plasmid: 9μg TransIT-LT1 Reagent or ViaFect: 15 μL
[0099] Conditions involving PKR inhibitors: NP, P4C(-), F5R, T7: 0.5μg each L: 2μg pSeV: 5 μg Plasmid carrying PKR inhibitor: 1μg Total plasmid: 10μg TransIT-LT1 Reagent or ViaFect: 16.5 μL
[0100] Unless otherwise specified below, the weight of the plasmid and the volume of the transfection reagent were mixed at a ratio of 9:15.
[0101] The plasmid and transfection reagent were mixed in 225 μL of OptiMEM, transfected into F gene expressing cells in 500 μL of medium (10% FBS / E-MEM) in a 12-well plate, and cultured at 37°C. The cells were cultured at 32°C from the day after transfection. The medium was replaced with serum-free medium (ITS-X / NEAA / E-MEM) containing 2.5 μg / mL trypsin every day. As an indicator of successful SeV reconstitution, EmGFP-positive cells were observed from the day after transfection (an increase in the number of EmGFP-positive cells indicates an improvement in SeV reconstitution efficiency), and the fluorescence intensity of the microplate was measured using a fluorescence microscope system ECLIPSE Ti2-E (Nikon) on the third day after transfection. The culture supernatant was collected on the third day after transfection, diluted 10- to 100,000-fold, and used to infect Vero cells seeded in a 96-well plate. The number of GFP-positive cells three days after infection was counted using ECLIPSE Ti2-E, and the infection titer was calculated.
[0102] (7) Reconstitution of SeV in the presence of VAI A cell population containing only LLC-MK2-F was used as the cell for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. VAI was used as the PKR inhibitor. pT7-VAI (180bp) and pT7-VAI-VAII (478bp) were used as the wild-type (wt) sequence of VAI, and pT7-VAI74a (180bp), pT7-VAI74c (180bp), and pT7-VAI74a (330bp) were used as the base substitution sequences. pT7-IRES was used as the control (Ctrl) plasmid for VAI. Unlike the control, EmGFP fluorescent positive cells were observed in the cells with VAI from the day after transfection. Comparing the EmGFP-derived fluorescence intensity from cells on day 3, the intensity was 18-fold higher than the control in the presence of VAI(180bp)wt, 34-fold higher than the control in the presence of VAI(180bp)74a, 53-fold higher than the control in the presence of VAI(180bp)74c, 63-fold higher than the control in the presence of VAI-VAII, and 146-fold higher than the control in the presence of VAI(330bp)74a, indicating that the number of EmGFP-positive cells was significantly increased by the use of VAI (Fig. 2). The infectious titers of the culture supernatants to Vero cells on day 3 after the start of SeV reconstitution were 68-fold higher than the control in the presence of VAI(180bp)wt, 139-fold higher than the control in the presence of VAI(180bp)74a, 282-fold higher than the control in the presence of VAI(180bp)74c, 476-fold higher than the control in the presence of VAI-VAII, and 1962-fold higher than the control in the presence of VAI(330bp)74a (Fig. 3). Thus, it is clear that VAI significantly enhances the reconstitution efficiency of SeV.
[0103] According to WO2005 / 071092, the recovery efficiency of SeV vectors is very low in LLC-MK2, and even when the recovered cells were inoculated into chicken eggs, SeV HA activity was not confirmed in LLC-MK2-derived cells. 2An infectious titer of about CIU / mL was shown (see Beaty, SM. et al., mSphere. 2, e00376-16 (2017)). In contrast, in this example, the infectious titer was 2 × 10 7 CIU / mL, and the infectious titer has increased significantly.
[0104] (8) Reconstitution of SeV in the presence of nc886 A cell population containing only LLC-MK2-F was used as the cell for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. pT7-nc886 (108 bp), pT7-nc886 (272 bp), and pT7-VAI74a (330 bp) were used as plasmids containing PKR inhibitors.
[0105] Comparing the EmGFP-derived fluorescence intensity from cells on day 3 after reconstitution, it was 17-fold higher than the control in the presence of nc886 (108 bp), 52-fold higher in the presence of nc886 (272 bp), and 381-fold higher in the presence of VAI (330 bp)74a (Fig. 4).
[0106] (9) Reconstitution of SeV in the presence of PKR-inhibitory viral factors A cell population containing only LLC-MK2-F or cells containing only Vero-F was used as the cells for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. As the PKR inhibitory plasmid, pT7-VAI74a (330 bp), pCAGGS-E3L, pCAGGS-K3L, pCAGGS-NS1, pCAGGS-σ3, pCAGGS-Us11, and pCAGGS-Y3 were used. The fluorescence intensity derived from EmGFP from the cells was measured 3 days after reconstitution. As shown in Figure 5, the fluorescence intensity derived from EmGFP from the cells increased in all test groups compared to the control. Compared to the control, VAI, E3L, σ3, and Us11 improved the SeV reconstitution efficiency in LLC-MK2-F cells by 100 times or more and improved the SeV reconstitution efficiency in VERO-F cells by 10 times or more (Figure 5). Furthermore, as shown in Figure 6, the infectious titers were increased in all test groups compared to the control. In titer measurements, VAI, E3L, σ3, and Us11 showed high values in both LLC-MK2-F and Vero-F cells (Figure 6).
[0107] (10) Reconstitution of SeV in the presence of fusion sequences A cell population containing only LLC-MK2-F or cells containing only Vero-F was used as the cells for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. As the PKR inhibitory plasmid, pCAGGS-E3L, pCAGGS-K3L, pCAGGS-E3K3, pCAGGS-E3Y3, or pCAGGS-Y3 was used. The fluorescence intensity derived from EmGFP from the cells on the third day after reconstitution was measured. As shown in FIG. 7, the fluorescence intensity derived from EmGFP from the cells increased in all test groups compared to the control. In addition, E3Y3 improved the SeV reconstitution efficiency compared to E3K3 (FIG. 7). In addition, when EFnpL was used as the plasmid for SeV reconstitution and the efficiency of SeV reconstitution was compared on day 3 after infection, E3Y3 was 3.5-fold higher than E3L in LLC-MK2-F cells and 6.8-fold higher than E3L in Vero-F cells.
[0108] (11) Reconstitution of SeV using cells constitutively expressing a PKR inhibitor Vero-F cells were transfected with pCAGGS-E3L-Hyg or pCAGGS-E3Y3-Hyg, and the cells were selected using 500 μg / mL hygromycin B (Nacalai Tesque) to obtain Vero-F-E3L and Vero-F-E3Y3 cells, which are stable lines constitutively expressing E3L and E3Y3, respectively. A combination of SeV reconstitution plasmids pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco, and pCAGGS-T7mco (EFnpL) and pSeV+EmGFP / TSdF were used in these cells. The fluorescence intensity derived from EmGFP from the cells 3 days after reconstitution was measured. A two-fold improvement in SeV reconstitution efficiency was observed in Vero-F-E3Y3 cells.
[0109] (12) Comparison of expression promoters To compare with conventional techniques, we investigated the combination of CAG promoter and EF1 promoter. LLC-MK2-F and Vero-F cells were used. pSeV+EmGFP / TSdF was used as pSeV. E3Y3 was used as PKR inhibitor. The effect of promoter differences on SeV reconstitution efficiency was examined using the following combinations: CAG, in which N, P, and L are all driven by the CAG promoter; EFnpL, in which N, P, and L are all driven by the EF1α promoter; EFnCAGpL, in which N is driven by the EF1α promoter and P and L are driven by the CAG promoter; and CAGnpEFL, in which N and P are driven by the CAG promoter and L is driven by the EF1α promoter. The fluorescence intensity derived from EmGFP from cells 3 days after reconstitution was measured.
[0110] As a result, in LLC-MK2 cells, as shown in Figure 8, codon optimization of the plasmid used for SeV reconstitution alone did not result in sufficient improvement in SeV reconstitution efficiency (see CAG in the absence of the PKR inhibitor E3Y3). In contrast, in the presence of E3Y3, SeV reconstitution was observed with sufficient efficiency when driven by either promoter. In the presence of the PKR inhibitor E3Y3, in a system in which N and P were expressed by the CAG promoter and L was expressed by the EF1a promoter, the SeV reconstitution efficiency was improved 271-fold compared to CAG (conventional plasmid).
[0111] In addition, in Vero cells, as shown in Figure 9, in the presence of the PKR inhibitor E3Y3, the reconstitution efficiency was improved for all promoters. However, when N, P, and L were expressed using the EF1 promoter, the SeV reconstitution efficiency was improved 48-fold compared to CAG (a conventional plasmid).
[0112] (13) Reconstitution of SeV in the presence of a combination of PKR inhibitors A cell population containing only LLC-MK2-F or a cell population containing only Vero-F was used as the cells for reconstituting SeV. pSeV+EmGFP / TSdF was used as pSeV. VAI and E3Y3 were used as PKR inhibitors. CAGnpEFL was used as the plasmid for SeV reconstitution for LLC-MK2-F, and CAGnpEFL and EFnpL were used for Vero-F. As a result, as shown in FIG. 10, by combining the PKR inhibitor, the SeV reconstitution efficiency was improved by more than 1000 times compared to the control without the PKR inhibitor.
[0113] Furthermore, as shown in Figure 11, the infectious titer of the culture supernatant 3 days after the start of SeV reconstitution was increased by 16,857-fold in the LLC-MK2-F cell reconstitution system and by 7,460-fold in the VERO-F cell reconstitution system, compared to the control in the absence of a PKR inhibitor.
[0114] (14) Reconstitution of SeV carrying a PKR inhibitor The SeV reconstitution efficiency was evaluated for SeV carrying a gene encoding a PKR inhibitor. A cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstitution. pSeV(PM)EmGFP / TSdF, pSeV(PM)EmGFP-VAI74a / TSdF (carrying VAI(180bp)74a), and pSeV(PM)EmGFP-VAI74aL / TSdF (carrying VAI(330bp)74a) were used as pSeV. EmGFP-VAI74a had the sequence shown in SEQ ID NO:32. EmGFP-VAI74aL had the sequence shown in SEQ ID NO:33.
[0115] The results are shown in Figures 12 and 13. As shown in Figure 12, compared with the reconstitution efficiency of the control (EmGFP), the reconstitution efficiency of SeV carrying VAI (180 bp) 74a was improved 3-fold, and that of SeV carrying VAI (330 bp) 74a was improved 16-fold. Furthermore, as shown in Figure 13, the infectious titer of the culture supernatant 3 days after the start of SeV reconstitution was 3-fold and 66-fold higher for SeV carrying VAI (180 bp) 74a and SeV carrying VAI (330 bp) 74a, respectively, compared with the reconstitution efficiency of the control (EmGFP).
[0116] (14-2) Effect of 5' or 3' addition of the sequence to VAI(180bp)74c A cell population containing only LLC-MK2-F was used as the cell for reconstituting SeV. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. pT7-VAI(180bp)74c, pT7-VAI(264bp)74c3p, pT7-VAI(246bp)74c5p, and pT7-VAI(330bp)74c were used as plasmids containing PKR inhibitors. VAI(264bp)74c3p (SEQ ID NO: 34) is a product in which an 84-mer is added to the 3' side of VAI to the 3' side of VAI(180bp)74c. In addition, VAI(246bp)74c5p (SEQ ID NO: 35) is a product in which an 86-mer is added to the 5' side of VAI to the 5' side of VAI(180bp)74c.
[0117] Comparing the EmGFP-derived fluorescence intensity from cells 3 days after reconstitution with that in the presence of pT7-VAI(180bp)74c, pT7-VAI(264bp)74c3p was 2.1-fold, pT7-VAI(246bp)74c5p was 6.8-fold, and pT7-VAI(330bp)74c was 15.7-fold, as shown in Figure 14. This suggests that the 5'-side sequence of VAI contributes more strongly to improving the reconstitution efficiency.
[0118] (15)Effect of EBER1 integration on viral replication A cell population containing only LLC-MK2-F was used as the cell for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used for pSeV. pT7-EBER (337 bp) was used as the plasmid containing the PKR inhibitor. In this plasmid, the sequences before and after VAI were introduced before and after EBER1. Comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, it was 3.8 times higher in the presence of EBER1 (337 bp) than in the control.
[0119] (16)Effect of NS5A148 integration on viral replication
[0120] A cell population containing only LLC-MK2-F was used as the cell for SeV reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV+EmGFP / TSdF was used as pSeV. pCAGGS-NS5A148 was used as the plasmid containing the PKR inhibitor. This plasmid produces NS5A148 having the amino acid sequence set forth in SEQ ID NO: 16. Comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, it was 7.3 times higher than the control in the presence of NS5A148.
[0121] (17) Introduction of hammerhead ribozyme sequence As cells for reconstituting SeV, a cell population containing only Vero-F or a cell population containing only cloned Vero-F-E3Y3 was used. CAGnpEFL was used as the plasmid for SeV reconstitution. pSeV was pSeV+EmGFP / TSdF or pSeV+EmGFP / TSdF(Hh) having a hammerhead ribozyme sequence (SEQ ID NO: 36) under the T7 promoter sequence. When comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, no EmGFP-positive cells were observed in Vero-F cells using pSeV+EmGFP / TSdF (control: Ctrl), whereas EmGFP-positive cells were observed in Vero-F-E3Y3 cells. As shown in FIG. 15, the fluorescence intensity of EmGFP was 37.7 times higher in Vero-F-E3Y3 cells using pSeV+EmGFP / TSdF(Hh) than in Vero-F cells.
[0122] Further experiments were carried out. A vector was prepared in which a hammerhead ribozyme (Hh-Rbz) sequence was placed between the T7 promoter of the plasmid transcribing the SeV genome and the region encoding the SeV genome (pSeV / TSdF(Hh)). The Hh-Rbz had the sequence set forth in SEQ ID NO: 36. Furthermore, a vector was prepared in which an HDV ribozyme (HDV-Rbz) sequence was placed immediately below the region encoding the SeV genome, and VAI (330 bp) 74c was placed downstream of that (pSeV / TSdF(Hv)). The HDV-Rbz had the sequence set forth in SEQ ID NO: 37. A T7 terminator (SEQ ID NO: 38) was placed downstream of VAI (330 bp) 74c. As a result, when the SeV genome is transcribed, only the SeV genome portion is excised by the action of the hammerhead ribozyme and HDV ribozyme, and other factors such as VAI are removed from the SeV genome. A cell population containing only LLC-MK2-F was used. The plasmid used for SeV reconstitution was CAGnpEFL. For pSeV, pSeV+EmGFP / TSdF (control), pSeV+EmGFP / TSdF(Hh), and pSeV+EmGFP / TSdF(Hv) were used. Comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, as shown in FIG. 16, pSeV+EmGFP / TSdF(Hh) was 52.5 times that of the control, and pSeV+EmGFP / TSdF(Hv) was 506.7 times.
[0123] Using the following primer set (L primer) that amplifies the L gene of the SeV genome and a primer set (Hv primer) that amplifies VAI(330bp)74c, we examined whether VAI(330bp)74c was incorporated into the obtained SeV genome. Forward primer for amplifying the L gene: TGGGTCATTCCCTGACCAGA (SEQ ID NO: 39) Reverse primer for amplifying the L gene: CAGCTTCGATCGTTCTGCAC (SEQ ID NO: 40) Forward primer for VAI amplification: ATCGAGCCTTATGACAGC (SEQ ID NO: 41) Reverse primer for VAI amplification: GATACCCTTGCGAATTTATCCACC (SEQ ID NO: 42)
[0124] The SeV genome transcribed as described above was recovered from Vero cells, and cDNA was synthesized. KOD One PCR Master Mix -Blue- (Toyobo) was used as the PCR enzyme. As shown in FIG. 17, the primer set (L primer) for amplifying the L gene amplified a part of the L gene in the plasmid (pSeV) carrying the gene encoding SeV, and also amplified a part of the L gene in the SeV genome as expected. In contrast, the Hv primer did not amplify VAI(330bp)74c in the SeV genome. This suggests that after the SeV genome was transcribed from the plasmid, VAI(330bp)74c was cleaved from the SeV genome by the HDV ribozyme and lost. Even in this case, it is clear that the effect of improving the SeV reconstitution efficiency is exerted, as shown in FIG. 16.
[0125] (18) Introduction of VAI(330bp)74c into SeV reconstitution plasmid The above (17) described the introduction of VAI(330bp)74c into a plasmid carrying a gene encoding the SeV genome. In this example, VAI(330bp)74c was introduced into a plasmid expressing components of SeV particles for reconstituting SeV. Specifically, a reconstitution experiment was carried out as follows.
[0126] VAI(330bp)74c was added to the reconstitution plasmids such as pCAGGS and pEF1, which express NP, P, L, T7, and F5R, respectively, to obtain the reconstitution plasmids carrying VAI(330bp)74c (referred to as "pCAGGSv" and "pEFv", respectively). pCAGGSv-NPco, pCAGGSv-P4C(-)co, pEFv-Lco, pCAGGSv-T7mco, and pCAGGSv-F5Rco, as well as this combination, are referred to as vCAGnpEFL. A cell population containing only LLC-MK2-F was used as the cell for reconstitution. vCAGnpEFL was used as the plasmid for SeV reconstitution. CAG was used as the control. pSeV+EmGFP / TSdF was used as pSeV. When comparing the fluorescence intensity derived from EmGFP from the cells on day 3 after reconstitution, as shown in FIG. 18, vCAGnpEFL-mix was 43-fold higher than the control.
[0127] (19) Introduction of VAI(330bp)74c into SeV reconstitution plasmid Experiments were performed under the conditions described above (18) but with the additional introduction of E3Y3. As pSeV, pSeV+EmGFP / TSdF (control) and pSeV+EmGFP / TSdF (Hv) were used. Comparing the EmGFP-derived fluorescence intensity from cells 3 days after reconstitution, as shown in FIG. 19, Hv+vCAGnpEFL-mix+E3Y3 was 2,836-fold higher than the control. Comparing the infectious titers of the obtained culture supernatants, as shown in FIG. 20, Hv+vCAGnpEFL-mix+E3Y3 was 29,925-fold higher than the control. Note that SeV could be reconstituted even without the use of F5R and E3Y3.
[0128] (20) Other vector configurations SeV genome plasmids driven by the CAG promoter or EF1 promoter in addition to the T7 promoter were constructed (see FIG. 21A). The SeV genome plasmid with the CAG promoter is designated as pCAGGS-SeV, and the SeV genome plasmid with the EF1 promoter is designated as pEF1-SeV. A cell population containing only LLC-MK2-F was used as the cells for reconstitution. CAGnpEFL was used as the plasmid for SeV reconstitution. As the SeV genome plasmid, pSeV+EmGFP / TSdF(Hv), pCAG-SeV+EmGFP / TSdF(Hv), or pEF1-SeV+EmGFP / TSdF(Hv) were used. Comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, as shown in FIG. 21B, pCAG-SeV was 1.44 times that of the control (pSeV), and pEF1-SeV was 1.6 times.
[0129] (21) Reconstitution experiment of paramyxoviruses other than SeV (MuV) A cell population containing only LLC-MK2 was used as the cell for reconstituting mumps virus (MuV; family Paramyxoviridae, genus Rubulavirus). MuV-mix was used as the plasmid for MuV reconstitution. MuV-mix contained the following plasmids: pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L, and pCAGGS-T7mco. pMuV+EmGFP / mini was used as pMuV. pT7-VAI(330bp)74c was used as the plasmid containing the PKR inhibitor. The reference sequence of the MuV genome was the sequence registered at Accession:KY295913. The MuV minigenome was created by deleting all the sequences between the leader and trailer sequences from the above reference sequence.
[0130] In summary, the following plasmids were used in the reconstruction of MuV: pMuV+EmGFP / mini pCAGGS-MuV-N pCAGGS-MuV-P pCAGGS-MuV-L pCAGGS-T7mco
[0131] When the fluorescence intensity derived from EmGFP of MuV-reconstituted cells 3 days after reconstitution was compared with that of the control, it was 184-fold higher in the presence of VAI(330bp)74c, as shown in FIG.
[0132] (22) Reconstitution experiment of paramyxoviruses other than SeV (MeV) A cell population containing only LLC-MK2 was used as the cell for reconstitution of measles virus (MeV; family Paramyxoviridae, genus Morbillivirus). MeV-mix was used as the plasmid for MeV reconstitution. MeV-mix contained the following plasmids: pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L, and pCAGGS-T7mco. pMeV+EmGFP / mini was used as pMeV. pT7-VAI(330bp)74c was used as the plasmid containing the PKR inhibitor. The reference sequence for MeV was the sequence registered in Accession:KY295921. The MeV minigenome was created by deleting all the sequences between the leader and trailer sequences from the above reference sequence.
[0133] In summary, the following plasmids were used in the reconstruction of MeV: pMeV+EmGFP / mini pCAGGS-MeV-N pCAGGS-MeV-P pCAGGS-MeV-L pCAGGS-T7mco pT7-VAI(330)74c
[0134] When the EmGFP-derived fluorescence intensity of MeV reconstituted from cells three days after reconstitution was compared with the control, as shown in Figure 23, the MeV reconstitution efficiency in the presence of VAI(330bp)74c was 120-fold higher than the control.
[0135] (23) Reconstitution experiment of paramyxovirus other than SeV (VSV) A cell population containing only LLC-MK2 was used for reconstitution of vesicular stomatitis virus (VSV; family Rhabdoviridae, genus Vesiculovirus). VSV-mix (containing pCAGGS-VSV-N, pCAGGS-VSV-P, pCAGGS-VSV-L, and pCAGGS-T7mco) was used for reconstitution of VSV. pVSV-ΔG-GFP-2.6 (Kerafast) was used as the VSV genome plasmid. pCAGGS-E3Y3 was used as the PKR inhibitor.
[0136] When comparing the EGFP-derived fluorescence intensity from the cells 7 days after reconstitution, as shown in FIG. 24, the fluorescence intensity was 5-fold higher when E3Y3 was used.
[0137] (24) Reconstitution of SeV, MeV, and MuV using heterologous RNA polymerases In the following, the plasmid mixture for SeV reconstruction, including pCAGGS-NPco(SeV), pCAGGS-P4C(-)co(SeV), pEF1-Lco(SeV), and pCAGGS-T7mco, is referred to as "SeV-mix." The plasmid mixture for MeV reconstruction, including pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L, and pCAGGS-T7mco, is referred to as "MeV-mix." The plasmid mixture for MuV reconstruction, including pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L, and pCAGGS-T7mco, is referred to as "MuV-mix."
[0138] The MeV genome plasmid used was pMeV+EmGFP / mini, which contains EmGFP in a MeV minigenome that does not express MeV's constituent proteins (N, P, M, F, H, L). The MuV genome plasmid used was pMuV+EmGFP / mini, which contains EmGFP in a MuV minigenome that does not express MuV's constituent proteins (N, P, M, F, SH, HN, L). The SeV genome plasmid used was pSeV+EmGFP / TSdF(Hv). The cells used for reconstitution of these were a cell population containing only LLC-MK2-F.
[0139] Comparing the fluorescence intensity derived from EmGFP from cells on the third day after reconstitution, as shown in FIG. 25, the SeV genome was reconstituted not only with SeV-mix, but also with heterologous polymerases such as MeV-mix and MuV-mix. Similarly, the MeV genome and MuV genome were reconstituted with heterologous polymerases. When comparing the fluorescence intensity of the SeV genome reconstituted with SeV-mix as 1, the fluorescence intensity was 0.68 when MeV-mix was used and 0.65 when MuV-mix was used (see FIG. 27). When comparing the fluorescence intensity of the MeV genome reconstituted with MeV-mix as 1, the fluorescence intensity was 0.31 when SeV-mix was used and 0.71 when MuV-mix was used (see FIG. 25). When comparing the fluorescence intensity of the MuV genome reconstituted with MuV-mix as 1, the fluorescence intensity was 1.22 when SeV-mix was used and 0.86 when MeV-mix was used (see FIG. 25).
[0140] (25) Construction of VSV using heterologous RNA polymerase A cell population containing only LLC-MK2 was used for VSV reconstitution. SeV-mix was used for VSV reconstitution. pVSV-ΔG-GFP-2.6 (Kerafast) was used as the VSV genome plasmid. pCAGGS-E3Y3 was used as the PKR inhibitor.
[0141] Comparing the EGFP-derived fluorescence intensity from the cells three days after reconstitution, as shown in Figure 26, it was confirmed that the VSV genome was reconstituted with SeV-mix, and when E3Y3 was additionally introduced into the cells, the fluorescence intensity was 47.5-fold higher than in the absence of E3Y3.
[0142] Furthermore, a plasmid (p3vLPNP) was constructed that expresses NP, P, and L from a single plasmid (see FIG. 27A). pSeV was driven by the CAG promoter (pCAG-SeV) or the EF1 promoter (pEF1-SeV), thereby avoiding the use of T7 polymerase. SeV was reconstituted in a cell population containing only LLC-MK2 in the same manner as above. The results are shown in FIG. 27B. As shown in FIG. 27B, EmGFP fluorescence was observed in both pCAG-SeV and pEF1-SeV 7 days after reconstitution, confirming that SeV had been reconstituted. However, when T7 polymerase was further supplied by the pCAGGS-T7mco plasmid, the efficiency of reconstitution was greatly improved.
[0143] Description of sequence listing SEQ ID NO: 1: Example of the sequence of the EF1α promoter SEQ ID NO: 2: Example of a CAG promoter sequence SEQ ID NO: 3: Example of the sequence of the gene encoding EmGFP SEQ ID NO: 4: EBER sequence of EB virus SEQ ID NO: 5: HIV TAR sequence SEQ ID NO:6: poliovirus 2A pro SEQ ID NO: 7: E3L of vaccinia virus SEQ ID NO: 8: σ3 of reovirus SEQ ID NO: 9: Human p58 IPK SEQ ID NO: 10: K3L of vaccinia virus SEQ ID NO: 11: Tat of HIV SEQ ID NO: 12: ICP34.5 of herpes simplex virus SEQ ID NO:13: nc866 Sequence number 14: Long version of nc866 SEQ ID NO: 15: NS5A SEQ ID NO: 16: NS5A (1-148) SEQ ID NO: 17: VAI (180mer) Sequence number 18:VAI(c.74U>V) SEQ ID NO: 19: VAI (330mer) Sequence number 20:VAI(330mer;c.74U>V) SEQ ID NO: 21: VAI-VAII Sequence number 22:VAI(180mer:c.74U>M) Sequence number 23:VAI(330mer:c.74U>M) SEQ ID NO: 24: VAI (330mer; c.191C>D) Sequence number 25: VAI (330mer; c.74U>V, c.191C>D) Sequence number 26: VAI (330mer; c.74U>M, c.191C>G) SEQ ID NO: 27: C-terminal 106 amino acids of the C protein of Sendai virus SEQ ID NO: 28: NS1 of influenza virus SEQ ID NO: 29: Us11 of herpes simplex virus SEQ ID NO: 30: Fusion protein E3K3 SEQ ID NO: 31: Fusion protein E3Y3 SEQ ID NO: 32: EmGFP-VAI (74U>A) SEQ ID NO: 33: EmGFP-VAI74aL (74U>A) SEQ ID NO: 34: VAI (264bp) 74c3p SEQ ID NO: 35: VAI (246bp) 74c5p SEQ ID NO: 36: An example of the sequence of Hh-Rbz SEQ ID NO: 37: An example of the sequence of HDV-Rbz SEQ ID NO: 38: An example of a T7 terminator sequence SEQ ID NO: 39: Forward primer for amplifying the L gene SEQ ID NO: 40: Reverse primer for amplifying the L gene SEQ ID NO: 41: Forward primer for VAI amplification SEQ ID NO: 42: Reverse primer for VAI amplification SEQUENCE LISTING <110> Regenerative Medicine iPS Gateway Center Co.,Ltd. <120> Method for producing negative-sense RNA virus vector and the produced netagive-sense RNA virus vector <130> PI67-9002WO <150> JP2021-108757 <151> 2021-06-30 <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 1179 <212> DNA <213> Artificial Sequence <220> <223> EF1alpha <400> 1 ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60 ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120 gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180 gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtaagtgcc 240 gtgtgtggtt cccgcgggcc tggcctcttt acgggttatg gcccttgcgt gccttgaatt 300 acttccacct ggctgcagta cgtgattctt gatcccgagc ttcgggttgg aagtgggtgg 360 gagagttcga ggccttgcgc ttaaggagcc ccttcgcctc gtgcttgagt tgaggcctgg 420 cctgggcgct ggggccgccg cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct 480 ttcgataagt ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg 540 caagatagtc ttgtaaatgc gggccaagat ctgcacactg gtatttcggt ttttggggcc 600 gcgggcggcg acggggcccg tgcgtcccag cgcacatgtt cggcgaggcg gggcctgcga 660 gcgcggccac cgagaatcgg acgggggtag tctcaagctg gccggcctgc tctggtgcct 720 ggcctcgcgc cgccgtgtat cgccccgccc tgggcggcaa ggctggcccg gtcggcacca 780 gttgcgtgag cggaaagatg gccgcttccc ggccctgctg cagggagctc aaaatggagg 840 acgcggcgct cgggagagcg ggcgggtgag tcacccacac aaaggaaaag ggcctttccg 900 tcctcagccg tcgcttcatg tgactccacg gagtaccggg cgccgtccag gcacctcgat 960 tagttctcga gcttttggag tacgtcgtct ttaggttggg gggaggggtt ttatgcgatg 1020 gagtttcccc acactgagtg ggtggagact gaagttaggc cagcttggca cttgatgtaa 1080 ttctccttgg aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca 1140 gtggttcaaa gtttttttct tccatttcag gtgtcgtga 1179 <210> 2 <211> 1676 <212> DNA <213> Artificial Sequence <220> <223> CAG promoter <400> 2 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 60 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 120 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 180 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 240 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 300 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 360 tagtcatcgc tattaccatg gtcgaggtga gccccacgtt ctgcttcact ctccccatct 420 cccccccctc cccaccccca attttgtatt tatttatttt ttaattattt tgtgcagcga 480 tgggggcggg gggggggggg gggcgcgcgc caggcggggc ggggcggggc gaggggcggg 540 gcggggcgag gcggagaggt gcggcggcag ccaatcagag cggcgcgctc cgaaagtttc 600 cttttatggc gaggcggcgg cggcggcggc cctataaaaa gcgaagcgcg cggcgggcgg 660 gagtcgctgc gcgctgcctt cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc 720 cccggctctg actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc 780 cgggctgtaa ttagcgcttg gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa 840 gccttgaggg gctccgggag ggccctttgt gcggggggag cggctcgggg ggtgcgtgcg 900 tgtgtgtgtg cgtggggagc gccgcgtgcg gctccgcgct gcccggcggc tgtgagcgct 960 gcgggcgcgg cgcggggctt tgtgcgctcc gcagtgtgcg cgaggggagc gcggccgggg 1020 gcggtgcccc gcggtgcggg gggggctgcg aggggaacaa aggctgcgtg cggggtgtgt 1080 gcgtgggggg gtgagcaggg ggtgtgggcg cgtcggtcgg gctgcaaccc cccctgcacc 1140 cccctccccg agttgctgag cacggcccgg cttcgggtgc ggggctccgt acggggcgtg 1200 gcgcggggct cgccgtgccg ggcggggggt ggcggcaggt gggggtgccg ggcggggcgg 1260 ggccgcctcg ggccggggag ggctcggggg aggggcgcgg cggcccccgg agcgccggcg 1320 gctgtcgagg cgcggcgagc cgcagccatt gccttttatg gtaatcgtgc gagagggcgc 1380 agggacttcc tttgtcccaa atctgtgcgg agccgaaatc tgggaggcgc cgccgcaccc 1440 cctctagcgg gcgcggggcg aagcggtgcg gcgccggcag gaaggaaatg ggcggggagg 1500 gccttcgtgc gtcgccgcgc cgccgtcccc ttctccctct ccagcctcgg ggctgtccgc 1560 ggggggacgg ctgccttcgg gggggacggg gcagggcggg gttcggcttc tggcgtgtga 1620 ccggcggctc tagagcctct gctaaccatg ttcatgcctt cttctttttc ctacag 1676 <210> 3 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> EmGFP <400> 3 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 tgataaccct ga 732 <210> 4 <211> 708 <212> RNA <213> Artificial Sequence <220> <223> EBV EBER <400> 4 ccauaaagcc uaggguguaa aacaccgacc gcgccaccag auggcacacg ugggggaaau 60 gaggguuagc auaggcaacc cccgccuaca caccaacuau agcaaacccc gccccgucac 120 ggugacguag ucugucuuga ggagauguag acuuguagac acugcaaaac cucaggaccu 180 acgcugcccu agagguuuug cuagggagga gacgugugug gcuguagcca cccgucccgg 240 guacaagucc cgggugguga ggacgguguc ugugguuguc uucccagacu cugcuuucug 300 ccgucuucgg ucaaguacca gcuggugguc cgcauguuuu gauccaaacu uuuguuuuag 360 gauuuaugca uccauuaucc cgcaguucca ccuaaacggg gcuuaacguu gcaucccaga 420 agaugcacgc uuaaccccgc cuacaaccgu gacguagcug uuuaccagca uguauagagu 480 uacgguucgc uacaucaaac aggacagccg uugcccuagu gguuucggac acaccgccaa 540 cgcucagugc ggugcuaccg acccgagguc aagucccggg ggaggagaag agaggcuucc 600 cgccuagagc auuugcaagu caggauucuc uaaucccucu gggagaaggg uauucggcuu 660 guccgcuauu uuuuuguggc uaguuuugca cccacaacau guaaaggg 708 <210> 5 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> HIV TAR <400> 5 ggucucucug guuagaccag aucugagccu gggagcucuc uggcuaacua gggaacc 57 <210> 6 <211> 149 <212> PRT <213> Artificial Sequence <220> <223> Polio virus 2Apro <400> 6 Gly Phe Gly His Gln Asn Lys Ala Val Tyr Thr Ala Gly Tyr Lys Ile 1 5 10 15 Cys Asn Tyr His Leu Ala Thr Gln Asp Asp Leu Gln Asn Ala Val Asn 20 25 30 Val Met Trp Ser Arg Asp Leu Leu Val Thr Glu Ser Arg Ala Gln Gly 35 40 45 Thr Asp Ser Ile Ala Arg Cys Asn Cys Asn Ala Gly Val Tyr Tyr Cys 50 55 60 Glu Ser Arg Arg Lys Tyr Tyr Pro Val Ser Phe Val Gly Pro Thr Phe 65 70 75 80 Gln Tyr Met Glu Ala Asn Asn Tyr Tyr Pro Ala Arg Tyr Gln Ser His 85 90 95 Met Leu Ile Gly His Gly Phe Ala Ser Pro Gly Asp Cys Gly Gly Ile 100 105 110 Leu Arg Cys His His Gly Val Ile Gly Ile Ile Thr Ala Gly Gly Glu 115 120 125 Gly Leu Val Ala Phe Ser Asp Ile Arg Asp Leu Tyr Ala Tyr Glu Glu 130 135 140 Glu Ala Met Glu Gln 145 <210> 7 <211> 190 <212> PRT <213> Artificial Sequence <220> <223> Vaccinia virus E3L <400> 7 Met Ser Lys Ile Tyr Ile Asp Glu Arg Ser Asn Ala Glu Ile Val Cys 1 5 10 15 Glu Ala Ile Lys Thr Ile Gly Ile Glu Gly Ala Thr Ala Ala Gln Leu 20 25 30 Thr Arg Gln Leu Asn Met Glu Lys Arg Glu Val Asn Lys Ala Leu Tyr 35 40 45 Asp Leu Gln Arg Ser Ala Met Val Tyr Ser Ser Asp Asp Ile Pro Pro 50 55 60 Arg Trp Phe Met Thr Thr Glu Ala Asp Glu Ala Asp Ala Asp Ala Met 65 70 75 80 Ser Asp Val Ile Ile Asp Asp Val Ser Arg Glu Lys Ser Met Arg Glu 85 90 95 Asp His Lys Ser Phe Asp Asp Val Ile Pro Ala Lys Lys Ile Ile Asp 100 105 110 Trp Lys Gly Ala Asn Pro Val Thr Val Ile Asn Glu Tyr Cys Gln Ile 115 120 125 Thr Arg Arg Asp Trp Ser Phe Arg Ile Glu Ser Val Gly Pro Ser Asn 130 135 140 Ser Pro Thr Phe Tyr Ala Cys Val Asp Ile Asp Gly Arg Val Phe Asp 145 150 155 160 Lys Ala Asp Gly Lys Ser Lys Arg Asp Ala Lys Asn Asn Ala Ala Lys 165 170 175 Leu Ala Val Asp Lys Leu Leu Gly Tyr Val Ile Ile Arg Phe 180 185 190 <210> 8 <211> 365 <212> PRT <213> Artificial Sequence <220> <223> Reovirus sigma 3 <400> 8 Met Glu Val Cys Leu Pro Asn Gly His Gln Val Val Asp Leu Ile Asn 1 5 10 15 Asn Ala Phe Glu Gly Arg Val Ser Ile Tyr Ser Ala Gln Glu Gly Trp 20 25 30 Asp Lys Thr Ile Ser Ala Gln Pro Asp Met Met Val Cys Gly Gly Ala 35 40 45 Val Val Cys Met His Cys Leu Gly Val Val Gly Ser Leu Gln Arg Lys 50 55 60 Leu Lys His Leu Pro His His Arg Cys Asn Gln Gln Ile Arg His Gln 65 70 75 80 Asp Tyr Val Asp Val Gln Phe Ala Asp Arg Val Thr Ala His Trp Lys 85 90 95 Arg Gly Met Leu Ser Phe Val Ala Gln Met His Glu Met Met Asn Asp 100 105 110 Val Ser Pro Asp Asp Leu Asp Arg Val Arg Thr Glu Gly Gly Ser Leu 115 120 125 Val Glu Leu Asn Trp Leu Gln Val Asp Pro Asn Ser Met Phe Arg Ser 130 135 140 Ile His Ser Ser Trp Thr Asp Pro Leu Gln Val Val Asp Asp Leu Asp 145 150 155 160 Thr Lys Leu Asp Gln Tyr Trp Thr Ala Leu Asn Leu Met Ile Asp Ser 165 170 175 Ser Asp Leu Ile Pro Asn Phe Met Met Arg Asp Pro Ser His Ala Phe 180 185 190 Asn Gly Val Lys Leu Gly Gly Asp Ala Arg Gln Thr Gln Phe Ser Arg 195 200 205 Thr Phe Asp Ser Arg Ser Ser Leu Glu Trp Gly Val Met Val Tyr Asp 210 215 220 Tyr Ser Glu Leu Glu His Asp Pro Ser Lys Gly Arg Ala Tyr Arg Lys 225 230 235 240 Glu Leu Val Thr Pro Ala Arg Asp Phe Gly His Phe Gly Leu Ser His 245 250 255 Tyr Ser Arg Ala Thr Thr Pro Ile Leu Gly Lys Met Pro Ala Val Phe 260 265 270 Ser Gly Met Leu Thr Gly Asn Cys Lys Met Tyr Pro Phe Ile Lys Gly 275 280 285 Thr Ala Lys Leu Lys Thr Val Arg Lys Leu Val Glu Ala Val Asn His 290 295 300 Ala Trp Gly Val Glu Lys Ile Arg Tyr Ala Leu Gly Pro Gly Gly Met 305 310 315 320 Thr Gly Trp Tyr Asn Arg Thr Met Gln Gln Ala Pro Ile Val Leu Thr 325 330 335 Pro Ala Ala Leu Thr Met Phe Pro Asp Thr Ile Lys Phe Gly Asp Leu 340 345 350 Asn Tyr Pro Val Met Ile Gly Asp Pro Met Ile Leu Gly 355 360 365 <210> 9 <211> 504 <212> PRT <213> Artificial Sequence <220> <223> Human p58_IPK <400> 9 Met Val Ala Pro Gly Ser Val Thr Ser Arg Leu Gly Ser Val Phe Pro 1 5 10 15 Phe Leu Leu Val Leu Val Asp Leu Gln Tyr Glu Gly Ala Glu Cys Gly 20 25 30 Val Asn Ala Asp Val Glu Lys His Leu Glu Leu Gly Lys Lys Leu Leu 35 40 45 Ala Ala Gly Gln Leu Ala Asp Ala Leu Ser Gln Phe His Ala Ala Val 50 55 60 Asp Gly Asp Pro Asp Asn Tyr Ile Ala Tyr Tyr Arg Arg Ala Thr Val 65 70 75 80 Phe Leu Ala Met Gly Lys Ser Lys Ala Ala Leu Pro Asp Leu Thr Lys 85 90 95 Val Ile Gln Leu Lys Met Asp Phe Thr Ala Ala Arg Leu Gln Arg Gly 100 105 110 His Leu Leu Leu Lys Gln Gly Lys Leu Asp Glu Ala Glu Asp Asp Phe 115 120 125 Lys Lys Val Leu Lys Ser Asn Pro Ser Glu Asn Glu Glu Lys Glu Ala 130 135 140 Gln Ser Gln Leu Ile Lys Ser Asp Glu Met Gln Arg Leu Arg Ser Gln 145 150 155 160 Ala Leu Asn Ala Phe Gly Ser Gly Asp Tyr Thr Ala Ala Ile Ala Phe 165 170 175 Leu Asp Lys Ile Leu Glu Val Cys Val Trp Asp Ala Glu Leu Arg Glu 180 185 190 Leu Arg Ala Glu Cys Phe Ile Lys Glu Gly Glu Pro Arg Lys Ala Ile 195 200 205 Ser Asp Leu Lys Ala Ala Ser Lys Leu Lys Asn Asp Asn Thr Glu Ala 210 215 220 Phe Tyr Lys Ile Ser Thr Leu Tyr Tyr Gln Leu Gly Asp His Glu Leu 225 230 235 240 Ser Leu Ser Glu Val Arg Glu Cys Leu Lys Leu Asp Gln Asp His Lys 245 250 255 Arg Cys Phe Ala His Tyr Lys Gln Val Lys Lys Leu Asn Lys Leu Ile 260 265 270 Glu Ser Ala Glu Glu Leu Ile Arg Asp Gly Arg Tyr Thr Asp Ala Thr 275 280 285 Ser Lys Tyr Glu Ser Val Met Lys Thr Glu Pro Ser Ile Ala Glu Tyr 290 295 300 Thr Val Arg Ser Lys Glu Arg Ile Cys His Cys Phe Ser Lys Asp Glu 305 310 315 320 Lys Pro Val Glu Ala Ile Arg Val Cys Ser Glu Val Leu Gln Met Glu 325 330 335 Pro Asp Asn Val Asn Ala Leu Lys Asp Arg Ala Glu Ala Tyr Leu Ile 340 345 350 Glu Glu Met Tyr Asp Glu Ala Ile Gln Asp Tyr Glu Thr Ala Gln Glu 355 360 365 His Asn Glu Asn Asp Gln Gln Ile Arg Glu Gly Leu Glu Lys Ala Gln 370 375 380 Arg Leu Leu Lys Gln Ser Gln Lys Arg Asp Tyr Tyr Lys Ile Leu Gly 385 390 395 400 Val Lys Arg Asn Ala Lys Lys Gln Glu Ile Ile Lys Ala Tyr Arg Lys 405 410 415 Leu Ala Leu Gln Trp His Pro Asp Asn Phe Gln Asn Glu Glu Glu Lys 420 425 430 Lys Lys Ala Glu Lys Lys Phe Ile Asp Ile Ala Ala Ala Lys Glu Val 435 440 445 Leu Ser Asp Pro Glu Met Arg Lys Lys Phe Asp Asp Gly Glu Asp Pro 450 455 460 Leu Asp Ala Glu Ser Gln Gln Gly Gly Gly Gly Asn Pro Phe His Arg 465 470 475 480 Ser Trp Asn Ser Trp Gln Gly Phe Asn Pro Phe Ser Ser Gly Gly Pro 485 490 495 Phe Arg Phe Lys Phe His Phe Asn 500 <210> 10 <211> 88 <212> PRT <213> Artificial Sequence <220> <223> Vaccinia virus K3L <400> 10 Met Leu Ala Phe Cys Tyr Ser Leu Pro Asn Ala Gly Asp Val Ile Lys 1 5 10 15 Gly Arg Val Tyr Glu Lys Asp Tyr Ala Leu Tyr Ile Tyr Leu Phe Asp 20 25 30 Tyr Pro His Ser Glu Ala Ile Leu Ala Glu Ser Val Lys Met His Met 35 40 45 Asp Arg Tyr Val Glu Tyr Arg Asp Lys Leu Val Gly Lys Thr Val Lys 50 55 60 Val Lys Val Ile Arg Val Asp Tyr Thr Lys Gly Tyr Ile Asp Val Asn 65 70 75 80 Tyr Lys Arg Met Cys Arg His Gln 85 <210> 11 <211> 86 <212> PRT <213> Artificial Sequence <220> <223> HIV Tat <400> 11 Met Glu Pro Val Asp Pro Arg Leu Glu Pro Trp Lys His Pro Gly Ser 1 5 10 15 Gln Pro Lys Thr Ala Cys Thr Asn Cys Tyr Cys Lys Lys Cys Cys Phe 20 25 30 His Cys Gln Val Cys Phe Ile Thr Lys Ala Leu Gly Ile Ser Tyr Gly 35 40 45 Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln Gly Ser Gln Thr 50 55 60 His Gln Val Ser Leu Ser Lys Gln Pro Thr Ser Gln Pro Arg Gly Asp 65 70 75 80 Pro Thr Gly Pro Lys Glu 85 <210> 12 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> HSV ICP34.5 <400> 12 Met Ala Arg Arg Arg Arg His Arg Gly Pro Arg Arg Pro Arg Pro Pro 1 5 10 15 Gly Pro Thr Gly Ala Val Pro Thr Ala Gln Ser Gln Val Thr Ser Thr 20 25 30 Pro Asn Ser Glu Pro Ala Val Arg Ser Ala Pro Ala Ala Ala Pro Pro 35 40 45 Pro Pro Pro Ala Gly Gly Pro Pro Pro Ser Cys Ser Leu Leu Leu Arg 50 55 60 Gln Trp Leu His Val Pro Glu Ser Ala Ser Asp Asp Asp Asp Asp Asp 65 70 75 80 Asp Trp Pro Asp Ser Pro Pro Pro Glu Pro Ala Pro Glu Ala Arg Pro 85 90 95 Thr Ala Ala Ala Pro Arg Pro Arg Pro Pro Pro Pro Gly Val Gly Pro 100 105 110 Gly Gly Gly Ala Asp Pro Ser His Pro Pro Ser Arg Pro Phe Arg Leu 115 120 125 Pro Pro Arg Leu Ala Leu Arg Leu Arg Val Thr Ala Glu His Leu Ala 130 135 140 Arg Leu Arg Leu Arg Arg Ala Gly Gly Glu Gly Ala Pro Glu Pro Pro 145 150 155 160 Ala Thr Pro Ala Thr Pro Ala Thr Pro Ala Thr Pro Ala Thr Pro Ala 165 170 175 Arg Val Arg Phe Ser Pro His Val Arg Val Arg His Leu Val Val Trp 180 185 190 Ala Ser Ala Ala Arg Leu Ala Arg Arg Gly Ser Trp Ala Arg Glu Arg 195 200 205 Ala Asp Arg Ala Arg Phe Arg Arg Arg Val Ala Glu Ala Glu Ala Val 210 215 220 Ile Gly Pro Cys Leu Gly Pro Glu Ala Arg Ala Arg Ala Leu Ala Arg 225 230 235 240 Gly Ala Gly Pro Ala Asn Ser Val 245 <210> 13 <211> 108 <212> RNA <213> Artificial Sequence <220> <223> nc866 <400> 13 cgggucggag uuagcucaag cgguuaccuc cucaugccgg acuuucuauc uguccaucuc 60 ugugcugggg uucgagaccc gcgggugcuu acugacccuu uuaugcaa 108 <210> 14 <211> 272 <212> RNA <213> Artificial Sequence <220> <223> Long nc886 <400> 14 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagccggguc ggaguuagcu caagcgguua ccuccucaug ccggacuuuc 120 uaucugucca ucucugugcu gggguucgag acccgcgggu gcuuacugac ccuuuuaugc 180 aacuuccagg cgcggcggcu gcugcgguag cuuuuuuggc cacuggccgc gcgcggcgua 240 agcgguuagg cuggaaagcg aaagcauuaa gu 272 <210> 15 <211> 447 <212> PRT <213> Artificial Sequence <220> <223> NS5A <400> 15 Ser Gly Ser Trp Leu Arg Asp Val Trp Asp Trp Ile Cys Thr Val Leu 1 5 10 15 Ala Asp Phe Lys Thr Trp Leu Gln Ser Lys Leu Leu Pro Arg Leu Pro 20 25 30 Gly Val Pro Phe Phe Ser Cys Gln Arg Gly Tyr Lys Gly Val Trp Arg 35 40 45 Gly Asp Gly Ile Met Tyr Thr Thr Cys Pro Cys Gly Ala Gln Ile Thr 50 55 60 Gly His Val Lys Asn Gly Ser Met Arg Ile Val Gly Pro Arg Thr Cys 65 70 75 80 Ser Asn Thr Trp His Gly Thr Phe Pro Ile Asn Ala Tyr Thr Thr Gly 85 90 95 Pro Cys Thr Pro Ser Pro Ala Pro Asn Tyr Ser Arg Ala Leu Trp Arg 100 105 110 Val Ala Ala Glu Glu Tyr Val Glu Val Thr Arg Val Gly Asp Phe His 115 120 125 Tyr Val Thr Gly Met Thr Thr Asp Asn Val Lys Cys Pro Cys Gln Val 130 135 140 Pro Ala Pro Glu Phe Phe Thr Glu Leu Asp Gly Val Arg Leu His Arg 145 150 155 160 Tyr Ala Pro Ala Cys Lys Pro Leu Leu Arg Asp Glu Val Thr Phe Gln 165 170 175 Val Gly Leu Asn Gln Tyr Thr Val Gly Ser Gln Leu Pro Cys Glu Pro 180 185 190 Glu Pro Asp Val Thr Val Val Thr Ser Met Leu Thr Asp Pro Ser His 195 200 205 Ile Thr Ala Glu Ala Ala Arg Arg Arg Leu Ala Arg Gly Ser Pro Pro 210 215 220 Ser Leu Ala Ser Ser Ser Ala Ser Gln Leu Ser Ala Leu Ser Leu Lys 225 230 235 240 Ala Thr Cys Thr Thr His His Gly Ala Pro Asp Thr Asp Leu Ile Glu 245 250 255 Ala Asn Leu Leu Trp Arg Gln Glu Met Gly Gly Asn Ile Thr Arg Val 260 265 270 Glu Ser Glu Asn Lys Ile Val Ile Leu Asp Ser Phe Glu Pro Leu Arg 275 280 285 Ala Glu Glu Asp Glu Arg Glu Val Ser Val Ala Ala Glu Ile Leu Arg 290 295 300 Lys Thr Arg Lys Phe Pro Ala Ala Met Pro Val Trp Ala Arg Pro Asp 305 310 315 320 Tyr Asn Pro Pro Leu Leu Glu Ser Trp Lys Asn Pro Asp Tyr Val Pro 325 330 335 Pro Val Val His Gly Cys Pro Leu Pro Pro Thr Lys Ala Pro Pro Ile 340 345 350 Pro Pro Pro Arg Arg Lys Arg Thr Val Val Leu Thr Glu Ser Thr Val 355 360 365 Ser Ser Ala Leu Ala Glu Leu Ala Thr Lys Thr Phe Gly Ser Ser Gly 370 375 380 Ser Ser Ala Val Asp Ser Gly Thr Ala Thr Gly Pro Pro Asp Gln Ala 385 390 395 400 Ser Ala Glu Gly Asp Ala Gly Ser Asp Ala Glu Ser Tyr Ser Ser Met 405 410 415 Pro Pro Leu Glu Gly Glu Pro Gly Asp Pro Asp Leu Ser Asp Gly Ser 420 425 430 Trp Ser Thr Val Ser Glu Glu Ala Ser Glu Asp Val Val Cys Cys 435 440 445 <210> 16 <211> 148 <212> PRT <213> Artificial Sequence <220> <223> NS5A (1-148) <400> 16 Ser Gly Ser Trp Leu Arg Asp Val Trp Asp Trp Ile Cys Thr Val Leu 1 5 10 15 Ala Asp Phe Lys Thr Trp Leu Gln Ser Lys Leu Leu Pro Arg Leu Pro 20 25 30 Gly Val Pro Phe Phe Ser Cys Gln Arg Gly Tyr Lys Gly Val Trp Arg 35 40 45 Gly Asp Gly Ile Met Tyr Thr Thr Cys Pro Cys Gly Ala Gln Ile Thr 50 55 60 Gly His Val Lys Asn Gly Ser Met Arg Ile Val Gly Pro Arg Thr Cys 65 70 75 80 Ser Asn Thr Trp His Gly Thr Phe Pro Ile Asn Ala Tyr Thr Thr Gly 85 90 95 Pro Cys Thr Pro Ser Pro Ala Pro Asn Tyr Ser Arg Ala Leu Trp Arg 100 105 110 Val Ala Ala Glu Glu Tyr Val Glu Val Thr Arg Val Gly Asp Phe His 115 120 125 Tyr Val Thr Gly Met Thr Thr Asp Asn Val Lys Cys Pro Cys Gln Val 130 135 140 Pro Ala Pro Glu 145 <210> 17 <211> 172 <212> RNA <213> Artificial Sequence <220> <223> VAI RNA <400> 17 gggcacucuu ccguggucug guggauaaau ucgcaagggu aucauggcgg acgaccgggg 60 uucgaacccc ggauccggcc guccgccgug auccaugcgg uuaccgcccg cgugucgaac 120 ccaggugugc gacgucagac aacgggggag cgcuccuuuu ggcuuccuuc ca 172 <210> 18 <211> 172 <212> RNA <213> Artificial Sequence <220> <223> VAI (c.74U>V) <400> 18 gggcacucuu ccguggucug guggauaaau ucgcaagggu aucauggcgg acgaccgggg 60 uucgaacccc ggavccggcc guccgccgug auccaugcgg uuaccgcccg cgugucgaac 120 ccaggugugc gacgucagac aacgggggag cgcuccuuuu ggcuuccuuc ca 172 <210> 19 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long <400> 19 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggaucc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgcuagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 20 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long (c.74>V) <400> 20 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggavcc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgcuagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 21 <211> 478 <212> RNA <213> Artificial Sequence <220> <223> VAI-VAII <400> 21 gcgcagucgu ugacgcucua gaccgugcaa aaggagagcc uguaagcggg cacucuuccg 60 uggucuggug gauaaauucg caaggguauc auggcggacg accgggguuc gaaccccgga 120 uccggccguc cgccgugauc caugcgguua ccgcccgcgu gucgaaccca ggugugcgac 180 gucagacaac gggggagcgc uccuuuuggc uuccuuccag gcgcggcggc ugcugcgcua 240 gcuuuuuugg ccacuggccg cgcgcggcgu aagcgguuag gcuggaaagc gaaagcauua 300 aguggcucgc ucccuguagc cggaggguua uuuuccaagg guugagucgc aggacccccg 360 guucgagucu cgggccggcc ggacugcggc gaacgggggu uugccucccc gucaugcaag 420 accccgcuug caaauuccuc cggaaacagg gacgagcccc uuuuuugcuu uucccaga 478 <210> 22 <211> 172 <212> RNA <213> Artificial Sequence <220> <223> VAI (c.74U>M) <400> 22 gggcacucuu ccguggucug guggauaaau ucgcaagggu aucauggcgg acgaccgggg 60 uucgaacccc ggamccggcc guccgccgug auccaugcgg uuaccgcccg cgugucgaac 120 ccaggugugc gacgucagac aacgggggag cgcuccuuuu ggcuuccuuc ca 172 <210> 23 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long (c.74U>M) <400> 23 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggamcc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgcuagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 24 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long (c.191C>D) <400> 24 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggaucc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgduagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 25 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long (c.74U>V, c.191C>D) <400> 25 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggavcc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgduagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 26 <211> 330 <212> RNA <213> Artificial Sequence <220> <223> VAI long (c.74U>M, c.191C>G) <400> 26 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggamcc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuuccaggcg cggcggcugc ugcgguagcu uuuuuggcca cuggccgcgc gcggcguaag 300 cgguuaggcu ggaaagcgaa agcauuaagu 330 <210> 27 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> SeV 106 aa of the C-terminal of C protein <400> 27 Met Leu Glu Thr Leu Ile Asn Lys Ile Tyr Thr Gly Pro Leu Gly Glu 1 5 10 15 Glu Leu Val Gln Thr Leu Tyr Leu Arg Ile Trp Ala Met Glu Glu Thr 20 25 30 Pro Glu Ser Leu Lys Ile Leu Gln Met Arg Glu Asp Ile Arg Asp Gln 35 40 45 Val Leu Lys Met Lys Thr Glu Arg Trp Leu Arg Thr Leu Ile Arg Gly 50 55 60 Glu Lys Thr Lys Leu Lys Asp Phe Gln Lys Arg Tyr Glu Glu Val His 65 70 75 80 Pro Tyr Leu Met Lys Glu Lys Val Glu Gln Val Ile Met Glu Glu Ala 85 90 95 Trp Ser Leu Ala Ala His Ile Val Gln Glu 100 105 <210> 28 <211> 230 <212> PRT <213> Artificial Sequence <220> <223> Influenza virus NS1 <400> 28 Met Asp Ser Asn Thr Val Ser Ser Phe Gln Val Asp Cys Phe Leu Trp 1 5 10 15 His Ile Arg Lys Gln Val Val Asp Gln Glu Leu Ser Asp Ala Pro Phe 20 25 30 Leu Asp Arg Leu Arg Arg Asp Gln Arg Ser Leu Arg Gly Arg Gly Asn 35 40 45 Thr Leu Gly Leu Asp Ile Lys Ala Ala Thr His Val Gly Lys Gln Ile 50 55 60 Val Glu Lys Ile Leu Lys Glu Glu Ser Asp Glu Ala Leu Lys Met Thr 65 70 75 80 Met Ala Ser Thr Pro Ala Ser Arg Tyr Ile Thr Asp Met Thr Ile Glu 85 90 95 Glu Leu Ser Arg Asn Trp Phe Met Leu Met Pro Lys Gln Lys Val Glu 100 105 110 Gly Pro Leu Cys Ile Arg Met Asp Gln Ala Ile Met Glu Lys Asn Ile 115 120 125 Met Leu Lys Ala Asn Phe Ser Val Ile Phe Asp Arg Leu Glu Thr Leu 130 135 140 Val Leu Leu Arg Ala Phe Thr Glu Glu Gly Ala Ile Val Gly Glu Ile 145 150 155 160 Ser Pro Leu Pro Ser Phe Pro Gly His Thr Ile Glu Asp Val Lys Asn 165 170 175 Ala Ile Gly Val Leu Ile Gly Gly Leu Glu Trp Asn Asp Asn Thr Val 180 185 190 Arg Val Ser Lys Asn Leu Gln Arg Phe Ala Trp Arg Ser Ser Asn Glu 195 200 205 Asn Gly Gly Pro Pro Leu Thr Pro Lys Gln Lys Arg Lys Met Ala Arg 210 215 220 Thr Ala Arg Pro Lys Val 225 230 <210> 29 <211> 149 <212> PRT <213> Artificial Sequence <220> <223> HSV Us11 <400> 29 Met Ser Gln Thr Gln Pro Pro Ala Pro Val Gly Pro Gly Asp Pro Asp 1 5 10 15 Val Tyr Leu Lys Gly Val Pro Ser Ala Gly Met His Pro Arg Gly Val 20 25 30 His Ala Pro Arg Gly His Pro Arg Met Ile Ser Gly Pro Pro Gln Arg 35 40 45 Gly Asp Asn Asp Gln Ala Ala Gly Gln Cys Gly Asp Ser Gly Leu Leu 50 55 60 Arg Val Gly Ala Asp Thr Thr Ile Ser Lys Pro Ser Glu Ala Val Arg 65 70 75 80 Pro Pro Thr Ile Pro Arg Thr Pro Arg Val Pro Arg Glu Pro Arg Val 85 90 95 Pro Arg Pro Pro Arg Glu Pro Arg Glu Pro Arg Val Pro Arg Ala Pro 100 105 110 Arg Asp Pro Arg Val Pro Arg Asp Pro Arg Asp Pro Arg Gln Pro Arg 115 120 125 Ser Pro Arg Glu Pro Arg Thr Pro Arg Thr Pro Arg Glu Pro Arg Thr 130 135 140 Ala Arg Gly Ser Val 145 <210> 30 <211> 213 <212> PRT <213> Artificial Sequence <220> <223> E3K3 fusion protein <400> 30 Met Ile Ile Asp Asp Val Ser Arg Glu Lys Ser Met Arg Glu Asp His 1 5 10 15 Lys Ser Phe Asp Asp Val Ile Pro Ala Lys Lys Ile Ile Asp Trp Lys 20 25 30 Asp Ala Asn Pro Val Thr Val Ile Asn Glu Tyr Cys Gln Ile Thr Lys 35 40 45 Arg Asp Trp Ser Phe Arg Ile Glu Ser Val Gly Pro Ser Asn Ser Pro 50 55 60 Thr Phe Tyr Ala Cys Val Asp Ile Asp Gly Arg Val Phe Asp Lys Ala 65 70 75 80 Asp Gly Lys Ser Lys Arg Asp Ala Lys Asn Asn Ala Ala Lys Leu Ala 85 90 95 Val Asp Lys Leu Leu Gly Tyr Val Ile Ile Arg Phe Glu Gly Arg Gly 100 105 110 Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Ala 115 120 125 Phe Cys Tyr Ser Leu Pro Asn Ala Gly Asp Val Ile Lys Gly Arg Val 130 135 140 Tyr Glu Asn Asp Tyr Ala Leu Tyr Ile Tyr Leu Phe Asp Tyr Pro His 145 150 155 160 Ser Glu Ala Ile Leu Ala Glu Ser Val Lys Met His Met Asp Arg Tyr 165 170 175 Val Glu Tyr Arg Asp Lys Leu Val Gly Lys Thr Val Lys Val Lys Val 180 185 190 Ile Arg Val Asp Tyr Thr Lys Gly Tyr Ile Asp Val Asn Tyr Lys Arg 195 200 205 Met Cys Arg His Gln 210 <210> 31 <211> 231 <212> PRT <213> Artificial Sequence <220> <223> E3Y3 fusion protein <400> 31 Met Ile Ile Asp Asp Val Ser Arg Glu Lys Ser Met Arg Glu Asp His 1 5 10 15 Lys Ser Phe Asp Asp Val Ile Pro Ala Lys Lys Ile Ile Asp Trp Lys 20 25 30 Asp Ala Asn Pro Val Thr Val Ile Asn Glu Tyr Cys Gln Ile Thr Lys 35 40 45 Arg Asp Trp Ser Phe Arg Ile Glu Ser Val Gly Pro Ser Asn Ser Pro 50 55 60 Thr Phe Tyr Ala Cys Val Asp Ile Asp Gly Arg Val Phe Asp Lys Ala 65 70 75 80 Asp Gly Lys Ser Lys Arg Asp Ala Lys Asn Asn Ala Ala Lys Leu Ala 85 90 95 Val Asp Lys Leu Leu Gly Tyr Val Ile Ile Arg Phe Glu Gly Arg Gly 100 105 110 Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu 115 120 125 Thr Leu Ile Asn Lys Ile Tyr Thr Gly Pro Leu Gly Glu Glu Leu Val 130 135 140 Gln Thr Leu Tyr Leu Arg Ile Trp Ala Met Glu Glu Thr Pro Glu Ser 145 150 155 160 Leu Lys Ile Leu Gln Met Arg Glu Asp Ile Arg Asp Gln Val Leu Lys 165 170 175 Met Lys Thr Glu Arg Trp Leu Arg Thr Leu Ile Arg Gly Glu Lys Thr 180 185 190 Lys Leu Lys Asp Phe Gln Lys Arg Tyr Glu Glu Val His Pro Tyr Leu 195 200 205 Met Lys Glu Lys Val Glu Gln Val Ile Met Glu Glu Ala Trp Ser Leu 210 215 220 Ala Ala His Ile Val Gln Glu 225 230 <210> 32 <211> 912 <212> DNA <213> Artificial Sequence <220> <223> EmGFP-VAI (c.74U>A) <400> 32 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 tgataaccct gactgtaagc gggcactctt ccgtggtctg gtggataaat tcgcaagggt 780 atcatggcgg acgaccgggg ttcgaacccc ggaaccggcc gtccgccgtg atccatgcgg 840 ttaccgcccg cgtgtcgaac ccaggtgtgc gacgtcagac aacgggggag cgctcctttt 900 ggcttccttc ca 912 <210> 33 <211> 1062 <212> DNA <213> Artificial Sequence <220> <223> EmGFP-VAI L (c.74U>A) <400> 33 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccttgaccta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaag gtctatatca ccgccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gacccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 tgataaccct gagtcgggac gctctggccg gtgaggcgtg cgcagtcgtt gacgctctag 780 accgtgcaaa aggagagcct gtaagcgggc actcttccgt ggtctggtgg ataaattcgc 840 aagggtatca tggcggacga ccggggttcg aaccccggaa ccggccgtcc gccgtgatcc 900 atgcggttac cgcccgcgtg tcgaacccag gtgtgcgacg tcagacaacg ggggagcgct 960 ccttttggct tccttccagg cgcggcggct gctgcggtag cttttttggc cactggccgc 1020 gcgcggcgta agcggttagg ctggaaagcg aaagcattaa gt 1062 <210> 34 <211> 264 <212> RNA <213> Artificial Sequence <220> <223> VAI (264bp) 74c3p <400> 34 cuguaagcgg gcacucuucc guggucuggu ggauaaauuc gcaaggguau cauggcggac 60 gaccgggguu cgaaccccgg acccggccgu ccgccgugau ccaugcgguu accgcccgcg 120 ugucgaaccc aggugugcga cgucagacaa cgggggagcg cuccuuuugg cuuccuucca 180 ggcgcggcgg cugcugcggu agcuuuuuug gccacuggcc gcgcgcggcg uaagcgguua 240 ggcuggaaag cgaaagcauu aagu 264 <210> 35 <211> 246 <212> RNA <213> Artificial Sequence <220> <223> VAI (246bp) 74c5p <400> 35 gucgggacgc ucuggccggu gaggcgugcg cagucguuga cgcucuagac cgugcaaaag 60 gagagccugu aagcgggcac ucuuccgugg ucugguggau aaauucgcaa ggguaucaug 120 gcggacgacc gggguucgaa ccccggaccc ggccguccgc cgugauccau gcgguuaccg 180 cccgcguguc gaacccaggu gugcgacguc agacaacggg ggagcgcucc uuuuggcuuc 240 cuucca 246 <210> 36 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Hh-Rbz <400> 36 uuggucugau gaguccguga ggacgaaacg gagucuagac uccguc 46 <210> 37 <211> 90 <212> RNA <213> Artificial Sequence <220> <223> HDV-Rbz <400> 37 gggucggcau ggcaucucca ccuccucgcg guccgaccug ggcauccgaa ggaggacgca 60 cguccacucg gauggcuaag ggagagccac 90 <210> 38 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> T7 terminator <400> 38 ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttg 48 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for L gene amplification <400> 39 tgggtcattc cctgaccaga 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for L gene amplification <400> 40 cagcttcgat cgttctgcac 20 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for VAI amplification <400> 41 atcgagcctt atgacagc 18 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for VAI amplification <400> 42 gatacccttg cgaatttatc cacc 24
Claims
[Claim 1] A method for producing a negative-strand RNA virus or viral vector, comprising: Encoding a factor that inhibits protein kinase R (PKR) operably linked to a regulatory sequence expressing the factor from a gene corresponding to the factor and supplying the factor to a packaging cell; The genomic RNA of a negative-strand RNA virus or a viral vector is introduced into the packaging cell. A is expressed, and a minus-strand RNA virus or a viral vector is transformed in the presence of the factor. To form a Recovering the formed negative strand RNA virus or viral vector; Including, The PKR-inhibiting agent is a PKR-inhibiting viral agent or nc886. or p58IPK, The relationship between the virus or viral vector and the PKR-inhibitory factor is heterologous. and / or the relationship between the regulatory sequence and the PKR inhibitory factor is heterologous; method.