Generating pluripotent cells de novo

Abstract

To provide methods of generating or producing pluripotent cells de novo from differentiated or adult cells.SOLUTION: The technology described herein relates to methods, assays and compositions relating to causing a cell to assume a more pluripotent state, e.g., without introducing foreign genetic material. In one aspect, provided herein is a method of generating a pluripotent cell, comprising subjecting a cell to a stress. In some embodiments, the method can further comprise selecting cells exhibiting pluripotency. In some embodiments, the cell is not present as part of a tissue.SELECTED DRAWING: Figure 5

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 61 / 637,631, filed Apr. 24, 2012, and U.S. Provisional Application No. 61 / 779,533, filed Mar. 13, 2013, the entire contents of each of which are hereby incorporated by reference herein.

[0002] Technical Field The technology described herein relates to the production of pluripotent cells.

Background Art

[0003] Background Current methods for obtaining pluripotent cells mainly rely on limited - availability tissues (e.g., embryonic tissues or umbilical cord blood) or the addition of reprogramming factors that involve the introduction of foreign nucleic acids (Hanna, J. et al. Cell 2008 133, 250 - 264; Hockemeyer, D. et al. Cell stem cell 2008 3, 346 - 353; Kim, D. et al. Cell stem cell 2009 4, 472 - 476; Kim, J. B. Nature 2009 461, 649 - 643; Okabe, M. et al. Blood 2009 114, 1764 - 1767). Without the cumbersome situations brought about by the addition of foreign reprogramming factors, a method for easily producing stem cells, particularly autologous stem cells, would accelerate the research on cell differentiation and the development of stem - cell - based therapies. It is hypothesized that exposure of cells to stimuli such as burns, chemical injuries, trauma, and irradiation can change normal somatic cells into cancer cells, but there is no direct evidence that healthy adult somatic cells can be converted into other states without specific manipulation of reprogramming factors.

[0004] ​Previously, researchers reported finding "adult stem cells" in adult tissues (Reynolds, B. A. & Weiss, S. Science 1992 255, 1707-1710; Megeney, L. A. et al., Genes & development 1996 10, 1173-1183; Caplan, A. I. Journal of orthopaedic research 1991 9, 641-650; Lavker, R. M. & Sun, T. T. The Journal of investigative dermatology 1983 81, 121s-127s). Such reports remain controversial. For example, researchers seeking cells that express Oct4, a stem cell marker, were unable to find Oct4-expressing cells in adult bone marrow in normal homeostasis (Lengner, C. J. et al. Cell Cycle 2008 7, 725-728; Berg, J. S. & Goodell, M. A. Cell stem cell 2007 1, 359-360), while others have reported being able to isolate Oct4-expressing cells from various adult tissues (Jiang, Y. et al. Nature 2010 418, 41-49; D’Ippolito, G. et al. Journal of Cell Science 2004, 117, 2971 - 2981; Johnson, J. et al. Cell 2005, 122, 303 - 315; Kucia, M. et al. Leukemia 2006, 20, 857 - 869; Kuroda, Y. et al. PNAS 2011, 107, 8639 - 8643; Obokata, H. et al. Tissue Engineering. Part A 2011, 17, 607 - 615; Rahnemai - Azar, A. et al. Cytotherapy 2011, 13, 179 - 192; Huang, Y. et al. Transplantation 2010, 89, 677 - 685; Zuba - Surma, E. K. et al. Journal of Cellular and Molecular Medicine 2011, 15, 1319 - 1328; Paczkowska, E. et al. Annals of Transplantation 2011, 16, 59 - 71). These cells are hypothesized to be either representative of a population of adult stem cells or merely artifacts of the techniques used. In either case, they remain rare and do not represent a suitable source of pluripotent cells for research and therapeutic purposes. SUMMARY OF THE INVENTION

[0005] Abstract For example, methods are described herein for generating or producing de novo pluripotent cells from differentiated or adult cells. The methods described herein may further relate to, for example, making multipotent cells pluripotent and increasing the pluripotency of cells (or, for example, decreasing the maturity of cells). Aspects of the techniques described herein regarding the production of pluripotent cells are based on the inventors' recognition that environmental stress can induce cells to take on a more pluripotent phenotype.

[0006] In one aspect, provided herein is a method for generating pluripotent cells, the method including the step of subjecting cells to stress. In some embodiments, the method may further include the step of selecting cells that exhibit pluripotency. In some embodiments, the cells do not exist as a tissue portion. In some embodiments, the stress includes removing at least about 40% of the cytoplasm from the cells. In some embodiments, the stress includes removing at least about 40% of the mitochondria from the cells. In some embodiments, the stress is sufficient to disrupt the cell membranes of at least 10% of the cells exposed to the stress. In some embodiments, the cells are somatic cells, stem cells, progenitor cells or embryonic cells. In some embodiments, the cells are isolated cells. In some embodiments, the cells are present in a heterogeneous population of cells. In some embodiments, the cells are present in a homogeneous population of cells. In some embodiments, the step of selecting cells that exhibit pluripotency includes selecting cells that express Oct4 or Nanog, or both Oct4 and Nanog expression. In some embodiments, the step of selecting cells that exhibit pluripotency includes selecting non-adherent cells.

[0007] In some embodiments, at least about 50% of the cytoplasm is removed from the cells. In some embodiments, at least about 60% of the cytoplasm is removed from the cells. In some embodiments, 60-80% of the cytoplasm is removed from the cells. In some embodiments, at least about 80% of the cytoplasm is removed from the cells. In some embodiments, at least about 90% of the cytoplasm is removed from the cells.

[0008] In some embodiments, stress comprises exposing the cells to at least one environmental stimulus selected from the following: trauma, mechanical stimulation, chemical exposure, ultrasonic stimulation, oxygen deprivation, irradiation, and exposure to extreme temperatures. In some embodiments, stress comprises exposing the cells to a pH of about 4.5 to about 6.0. In some embodiments, stress comprises exposing the cells to a pH of about 5.4 to about 5.8. In some embodiments, the cells are exposed for 1 day or less. In some embodiments, the cells are exposed for 1 hour or less. In some embodiments, the cells are exposed for about 30 minutes

[0009] In some embodiments, exposure to extreme temperatures comprises exposing the cells to a temperature below 35°C or above 42°C. In some embodiments, exposure to extreme temperatures comprises exposing the cells to a temperature below freezing or to a temperature of at least about 85°C. In some embodiments, mechanical stimulation comprises passing the cells through at least one device having an aperture smaller than the size of the cells. In some embodiments, mechanical stimulation comprises passing the cells through several devices having progressively smaller apertures.

[0010] In some embodiments, removal of a portion of the cytoplasm removes at least about 50% of the mitochondria from the cytoplasm. In some embodiments, removal of the cytoplasm or mitochondria removes about 50% to 90% of the mitochondria from the cytoplasm. In some embodiments, removal of the cytoplasm or mitochondria removes more than 90% of the mitochondria from the cytoplasm.

[0011] In some embodiments, the method may further comprise culturing the pluripotent cells to expand the pluripotent cells. In some embodiments, the pluripotent cells express one or more pluripotent stem cell markers selected from the group consisting of Oct4 and Nanog.

[0012] In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are adult or neonatal cells. In some embodiments, the method may further comprise the step of maintaining pluripotent cells in vitro. In some embodiments, the epigenetic state of the cells is altered to be more similar to the epigenetic state of embryonic stem cells. In some embodiments, the epigenetic state includes a methylation pattern.

[0013] In one aspect, provided herein is an assay comprising contacting a pluripotent cell produced by the methods described herein with a candidate agent. In some embodiments, the assay can be used to identify an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells.

[0014] In one aspect, provided herein is the use of a pluripotent cell produced by the methods described herein in a method of cell therapy for a subject.

[0015] In one aspect, provided herein is a method of autologous cell therapy in a subject in need of cell therapy, the method comprising generating pluripotent cells from a cell according to the methods described herein, wherein the cell is obtained from the subject, and administering to the subject a composition comprising the pluripotent cells or their differentiated progeny. In some embodiments, the method may further comprise the step of differentiating the pluripotent cells along a predefined cell lineage prior to administering the composition to the subject.

[0016] In one aspect, provided herein is a composition comprising pluripotent cells, wherein the pluripotent cells are generated from a cell by the methods described herein.

[0017] In one aspect, the present specification describes a method for increasing the self-renewal ability of pluripotent cells, which includes the step of culturing cells in the presence of adrenocorticotropic hormone (ACTH) or 3i medium. In some embodiments, the cells are cultured in LIF medium containing ACTH. In some embodiments, ACTH is present at a concentration of about 0.1 μM to about 100 μM. In some embodiments, the cells are cells generated by the method described herein. In some embodiments, the cells are totipotent cells. In some embodiments, the cells are cultured for at least 3 days in the presence of ACTH or 3i medium. In some embodiments, the cells are cultured for at least 5 days in the presence of ACTH or 3i medium. In some embodiments, the cells are cultured for at least 7 days in the presence of ACTH or 3i medium. In some embodiments, after the culturing step, the cells express a detectable level of a stem cell marker selected from the group consisting of: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5.

[0018] In some embodiments, the cells used in the method described herein are in vivo. In some embodiments, the cells used in the method described herein are in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0019]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Modes for Carrying Out the Invention

[0020] Detailed Description Aspects of the technology described herein relate to the production or generation of pluripotent cells from cells. Aspects of the technology described herein are based on the inventors' finding that stress can induce the production of pluripotent stem cells from cells without the need to introduce foreign genes, transcripts, proteins, nuclear components or cytoplasm into the cells, or without the need for cell fusion. In some embodiments, the stress induces a decrease in the amount of cytoplasm and / or mitochondria in the cells; triggers a dedifferentiation process, and gives rise to pluripotent cells. In some embodiments, the stress causes disruption of the cell membrane, for example, in at least 10% of the cells exposed to the stress. These pluripotent cells are characterized by one or more of the ability to differentiate into each of the three germ layers (in vitro and / or in vivo), the formation of teratoma-like cell masses in vivo, and the ability to generate viable embryos and / or chimeric mice.

[0021] This specification describes experiments demonstrating that treatment of cells with certain environmental stresses (including, but not limited to, stresses that reduce the amount of cytoplasm and / or mitochondria in the cell) can reduce mitochondrial activity, demethylate regions of the genome associated with dedifferentiation, and cause cells to exhibit markers of known dedifferentiation pathways. Thus, in some embodiments, this specification provides a method of generating pluripotent cells from a cell, comprising removing at least about 40% of the cytoplasm and / or mitochondria from the cell, and selecting cells that exhibit pluripotency or pluripotency markers, wherein the cells are not present in a tissue. Other stress treatments that can generate pluripotent cells from a cell are also described herein.

[0022] For convenience, the specific terms used herein in the specification, examples, and appended claims are gathered here. Unless otherwise stated or implicit from the context, the following terms and phrases include the meanings provided below. Unless otherwise expressly stated or apparent from the context, the following terms and phrases do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to assist in the description of particular embodiments and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0023] The term "comprising" or "comprises" as used herein is used with respect to compositions, methods, and their respective components that are essential to a method or composition, and allows for the inclusion of unspecified elements, whether or not essential.

[0024] As used herein, the term "consisting essentially of" refers to the elements required for a given embodiment. This term permits the presence of elements that do not materially affect the basic and novel or functional characteristics of the embodiment.

[0025] The term "consisting of" refers to the compositions, methods, and respective components described herein, which exclude any element not recited in the description of the embodiment.

[0026] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein and / or that will be apparent to those of ordinary skill in the art upon reading the present disclosure. Similarly, the term "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "e.g." is derived from the Latin "exempli gratia" and is used herein to indicate non-limiting examples. Thus, the abbreviation "e.g." is synonymous with the term "for example". There is.

[0027] Definitions of common terms in cell biology and molecular biology can be found in "The Merck Manual of Diagnosis and Therapy", 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0); Robert S. Porter et al. (eds.), and in The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9). It can be obtained. Definitions of common terms in molecular biology can also be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.

[0028] Unless otherwise specified, the present invention was carried out using standard procedures such as those described below: Sambrook et al., Molecular Cloning: A Laboratory Manual (3 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001); Davis et Al, Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998) (the entire contents of which are incorporated herein by reference).

[0029] The terms "decrease", "reduce", "reduced", and "reduction" are all used herein generally to mean a statistically significant decrease in amount relative to a reference. However, for the avoidance of doubt, "reduce", "reduction", or "decrease" typically means at least a 10% decrease compared to the absence of a given treatment, and can include, for example, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, for example, a decrease to and including complete absence, or any decrease from 10 - 99% compared to the absence of a given treatment.

[0030] The terms "increased," "increasing," or "enhanced" are all used herein generally to mean an increase in a statistically significant amount; to avoid any ambiguity, the terms "increased," "increasing," or "enhanced" mean an increase of at least 10% compared to a reference level, e.g., an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase from 10 to 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold compared to a reference level, or any increase between 2-fold and 10-fold or greater.

[0031] When used with respect to a disease, disorder or medical condition, the terms "treat," "treatment," "treating," or "remission" as used herein refer to a therapeutic treatment for the condition wherein the goal is to reverse, alleviate, relieve, inhibit, slow down or stop the progression or severity of a symptom or condition. The term "treating" includes the reduction or alleviation of at least one adverse effect or symptom of the condition. Treatment is generally "effective" when one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" when the progression of the condition is reduced or stopped. That is, "treatment" includes not only an improvement in symptoms or markers, but also arrest or at least slowing of the expected progression or worsening of symptoms in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminution of the extent of a defect, stabilized (i.e., not worsening) health state, delay or slowing of disease progression, and remission or alleviation of symptoms. Treatment can also include subjects who survive when death is statistically expected.

[0032] As used herein, the term "administering" refers to the placement into a subject of pluripotent cells produced according to the methods described herein and / or progeny of such pluripotent cells that are at least partially differentiated, by a method or route that results in at least partial localization of the cells at a desired site. A pharmaceutical composition comprising pluripotent cells produced according to the methods described herein and / or progeny of such pluripotent cells that are at least partially differentiated can be administered by any suitable route that produces an effective treatment in a subject.

[0033] As used herein, "subject" means a human or an animal. Typically, the animal is a vertebrate such as a primate, rodent, livestock, or game animal. Primates include, for example, chimpanzees, squirrel monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Livestock and game animals include cows, horses, pigs, deer, bison, water buffalo, cats (e.g., house cats), dogs (e.g., dogs, foxes, wolves), birds (e.g., chickens, emus, ostriches), and fish (e.g., salmon, catfish, and trout). A patient or subject includes any subset of the foregoing, e.g., all of the foregoing. In certain embodiments, the subject is a mammal, such as a primate, such as a human.

[0034] Preferably, the subject is a mammal. The mammal can be, but is not limited to, a human, non-human primate, mouse, rat, dog, cat, horse, or cow. Non-human mammals can be advantageously used as subjects representing animal models of diseases associated with a deficiency, dysfunction, and / or failure of a given cell or tissue, or a deficiency, dysfunction, or failure of a stem cell compartment. Further, the methods described herein can be used to treat livestock and / or pets. The subject can be male or female. The subject has previously been diagnosed or identified as having or being affected by a deficiency, dysfunction, and / or failure of a cell type, tissue, or stem cell compartment, or one or more diseases or conditions associated with such a state, and optionally, but not necessarily having already undergone treatment for such a state. The subject can also be diagnosed or identified as having a condition comprising a deficiency, dysfunction, and / or failure of a cell type or tissue, or a stem cell compartment, but showing improvement in known risk factors as a result of having received one or more treatments for such a state. Alternatively, the subject can also not have previously been diagnosed as having such a state. For example, the subject can be one showing one or more risk factors for such a state, or a subject showing no risk factors for such a state.

[0035] When used with respect to a cell or population of cells, the term "select" as used herein refers to selecting, isolating, segregating, and / or selectively expanding one or more cells having a desired characteristic. The term "select" as used herein does not necessarily mean that cells not having the desired characteristic are unable to proliferate under the conditions provided.

[0036] "Maintain" as used herein refers to the continuation of the viability of a cell or population of cells. The population to be maintained has some metabolically active cells. The number of these cells can be approximately stable or can increase over a period of at least one day.

[0037] As used herein, "detectable level" refers to the level of a substance or activity in a sample that enables the amount of the substance or activity to be distinguished from a reference level (e.g., the level of the substance or activity in cells not exposed to stress). In some embodiments, the detectable level can be at least 10% greater than, e.g., 10% greater, 20% greater, 50% greater, 100% greater, 200% greater, or 300% or more greater than the reference level.

[0038] The terms "statistically significant" or "significant" refer to statistical significance and generally mean a difference of 2 standard deviations (2SD) above or below a reference (e.g., the concentration or abundance of a marker (e.g., a stem cell marker or a differentiation marker)). The term refers to the statistical evidence that a difference exists. This is defined as the establishment of a determination to reject the null hypothesis when the null hypothesis is actually true. The determination is often made using a p-value.

[0039] Unless otherwise indicated in a specific example or stated otherwise, all numbers expressing amounts of ingredients or reaction conditions used herein are to be understood as being modified in all instances by the term "about". When used in connection with percentages, the term "about" can mean ±1%.

[0040] Other terms are defined herein within the description of the various aspects of the technology described herein.

[0041] Aspects of the technology described herein relate to methods of generating pluripotent cells from cells, as well as uses of such pluripotent cells and methods of using them. In contrast to existing methods of generating pluripotent cells (i.e., induced pluripotent stem cells or iPS cells) that rely on increasing the expression of reprogramming factors (e.g., by introducing a nucleic acid construct encoding one or more reprogramming factors (e.g., Oct4)), the methods described herein subject the cells to stress but do not require the introduction of exogenous reprogramming factors.

[0042] In some embodiments, stress reduces the volume of the cytoplasm of the cell and / or the number of mitochondria of the cell. A reduction in the volume of the cytoplasm of the cell or the number of mitochondria of the cell induces a stress response, during which the cell acquires at least pluripotency. In one aspect, provided herein is a method for generating pluripotent cells that comprises removing at least about 40% of the cytoplasm from the cell and selecting cells that exhibit pluripotency, wherein the cells are not present in a tissue. In one aspect, the invention described herein relates to a method for generating pluripotent cells that comprises removing at least about 40% of the mitochondria from the cell and selecting cells that exhibit pluripotency, wherein the cells are not present in a tissue.

[0043] The cells used in the methods, assays and compositions described herein can be any type of cell (e.g., adult cells, embryonic cells, differentiated cells, stem cells, progenitor cells and / or somatic cells). The cells can be described by a combination of the above terms, for example, the cells can be embryonic stem cells or differentiated somatic cells. The cells used in the methods, assays and compositions described herein can be obtained from a subject. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are adult cells. In some embodiments, the cells are neonatal cells. In some embodiments, the cells are fetal cells. In some embodiments, the cells are amniotic fluid cells. In some embodiments, the cells are umbilical cord blood cells.

[0044] "Adult" refers to tissues and cells derived from or within an animal subject at any point after birth. "Embryo" refers to tissues and cells derived from or within an animal subject at any point before birth.

[0045] As used herein, the term "somatic cell" refers to any cell other than a germ cell, a cell that may be present in or obtained from a preimplantation embryo, or a cell resulting from in vitro proliferation of such cells. In other words, somatic cells, unlike germ line cells, refer to any cell that forms the body of an organism. In mammals, the germ line cells (also known as "gametes") are sperm and eggs, which fuse during fertilization to produce a cell called a zygote from which the entire mammalian embryo develops. All other cell types in the mammalian body (except sperm and eggs, the cells from which they are made (gamete mother cells), and undifferentiated stem cells) are somatic cells: internal organs, skin, bone, blood, and connective tissue are all composed of somatic cells. In some embodiments, the somatic cell is a "non-embryonic somatic cell", which thereby means a somatic cell that does not exist in or is not obtained from an embryo and does not result from in vitro proliferation of such cells. In some embodiments, the somatic cell is an "adult somatic cell", which thereby means a cell that exists in or is obtained from an organism other than an embryo or fetus, or results from in vitro proliferation of such cells. It is noted that adult and neonatal or embryonic cells can be distinguished by structural differences (e.g., epigenetic constitution such as methylation patterns). In some embodiments, the somatic cell is a mammalian somatic cell. In some embodiments, the somatic cell is a human somatic cell. In some embodiments, the somatic cell is an adult somatic cell. In some embodiments, the somatic cell is a neonatal somatic cell.

[0046] As used herein, a "differentiated cell" refers to a cell that is more specialized in its fate or function than at a previous point in its development, and includes both terminally differentiated cells and cells that are not terminally differentiated but are more specialized than at a previous point in their development. The development of cells from undirected cells (e.g., stem cells) to cells with an increasing degree of specification to a particular differentiated cell type and ultimately to a terminally differentiated cell is known as progressive differentiation or progressive specification. In the context of cell ontogeny, the adjectives "differentiated" or "differentiating" are relative terms. A "differentiated cell" is a cell that has progressed further along the developmental pathway than the cell to which it is being compared. Thus, a stem cell can differentiate into a lineage-restricted progenitor cell (e.g., a mesodermal stem cell), which in turn can progress further along the pathway to differentiate into other types of progenitor cells (e.g., cardiomyocyte precursors) and then into terminally differentiated cells, which may or may not retain the ability to further proliferate and perform a characteristic role in a particular tissue type.

[0047] As used herein, the term "stem cell" refers to a cell that is in an undifferentiated or partially differentiated state, has the property of self-renewal, and has the ability to develop into a more differentiated cell type, without any specific implied meaning regarding developmental potential (i.e., totipotency, pluripotency, multipotency, etc.). By self-renewal, it is meant that stem cells have the ability to proliferate and generate more such stem cells while maintaining their developmental potential. Thus, the term "stem cell" refers to any subset of cells that has the ability to develop into a more specialized or differentiated phenotype under certain circumstances and retains the ability to proliferate without substantial differentiation under certain circumstances. The term "somatic stem cell" is used herein to refer to any stem cell derived from non-embryonic tissue, including fetal, juvenile, and adult tissue. Natural somatic stem cells have been isolated from a variety of adult tissues, including blood, bone marrow, brain, olfactory epithelium, skin, pancreas, skeletal muscle, and cardiac muscle. Exemplary natural somatic stem cells include, but are not limited to, mesenchymal stem cells and hematopoietic stem cells. In some embodiments, the stem or progenitor cells can be embryonic stem cells. As used herein, "embryonic stem cells" refers to stem cells derived from tissues formed after fertilization but prior to the end of pregnancy (including pre-embryonic tissue (such as blastocysts), embryonic tissue, or fetal tissue taken at any time during pregnancy (typically, but not necessarily, prior to about 10-12 weeks of pregnancy)). Most frequently, embryonic stem cells are totipotent cells derived from the early embryo or blastocyst. Embryonic stem cells can be obtained directly from appropriate tissues (including, but not limited to, human tissues) or from established embryonic cell lines. In one embodiment, embryonic stem cells are obtained as described by Thomson et al. (U.S. Pat. Nos. 5,843,780 and 6,200,806; Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133 ff, 1998; Proc. Natl. Acad. Sci. U.S.A. 92: 7844, 1995, which are hereby incorporated by reference in their entirety).

[0048] Exemplary stem cells include embryonic stem cells, adult stem cells, pluripotent stem cells, neural stem cells, hepatic stem cells, muscle stem cells, muscle progenitor stem cells, endothelial progenitor cells, bone marrow stem cells, chondrogenic stem cells, lymphoid stem cells, mesenchymal stem cells, hematopoietic stem cells, central nervous system stem cells, and ablative nervous system stem cells. Descriptions of stem cells (including methods for isolating and culturing them) can be found, inter alia, in Embryonic Stem Cells, Methods and Protocols, Turksen, ed., Humana Press, 2002; Weisman et al, Annu. Rev. Cell. Dev. Biol. 17:387-403; Pittinger et al, Science, 284: 1434-7, 1999; Animal Cell Culture, Masters, ed., Oxford University Press, 2000; Jackson et al, PNAS 96(25): 14482-86, 1999; Zuk et al, Tissue Engineering, 7:211-228, 2001 ("Zuk et al."); Atala et al, particularly Chapters 33-41; and U.S. Patent Nos. 5,559,022, 5,672,346 and 5,827,735. Descriptions of stromal cells (including methods for isolating them) can be found, inter alia, in Prockop, Science, 276:71-74, 1997; Theise et al, Hepatology, 31:235-40, 2000; Current Protocols in Cell Biology, Bonifacino et al, eds., John Wiley & Sons, 2000 (including updates through March 2002); and U.S. Patent No. 4,963,489.

[0049] As used herein, the term "progenitor cell" refers to a cell that is in an undifferentiated or partially differentiated state and has the ability to differentiate into at least one more differentiated phenotype without any specific implied meaning regarding developmental potential (i.e., totipotency, pluripotency, multipotency, etc.) and does not have the property of self-renewal. Thus, the term "progenitor cell" refers to any subset of cells that have the ability to differentiate into a more specialized or differentiated phenotype under certain circumstances. In some embodiments, the stem or progenitor cells are pluripotent stem cells. In some embodiments, the stem or progenitor cells are totipotent stem cells.

[0050] The term "totipotency" refers to a stem cell that can give rise to any tissue or cell type in the body. A "pluripotent" stem cell can give rise to any cell type in the body other than germ line cells. Stem cells that can give rise to fewer or a limited number of different cell types are generally referred to as "multipotent". Thus, totipotent cells differentiate into pluripotent cells that can give rise to most (but not all) of the tissues required for fetal development. Pluripotent cells undergo further differentiation into multipotent cells that are directed to give rise to cells with specific functions. For example, multipotent hematopoietic stem cells give rise to red blood cells, white blood cells, and platelets in the blood.

[0051] As used herein, the term "pluripotency" refers to a cell that has the ability to differentiate into cell types characteristic of all three germ layers (i.e., the endoderm (e.g., intestinal tissue), the mesoderm (e.g., blood, muscle, and blood vessels), and the ectoderm (e.g., skin and nerve)) under various conditions. Pluripotent cells are primarily characterized by their ability to differentiate into all three germ layers, for example, using the nude mouse teratoma formation assay. Pluripotency is also evidenced by the expression of embryonic stem (ES) cell markers, but the preferred test for pluripotency is demonstration of the ability to differentiate into cells of each of the three germ layers.

[0052] The "ACC" and "STAP" cells described in the examples in this specification are non-limiting examples of pluripotent cells. "STAP stem cells" are non-limiting examples of pluripotent stem cells. The terms "pluripotent cell" and "pluripotent stem cell" may be used interchangeably in this specification because both types of cells can be appropriately used for the purposes of the present invention.

[0053] As used herein, the term "pluripotent" or "pluripotent state" refers to cells that have the ability to differentiate into all three germ layers: the endoderm (intestinal tissue), the mesoderm (including blood, muscle, and blood vessels), and the ectoderm (e.g., skin and nerve).

[0054] When used in reference to "multipotent cells", the term "multipotent" refers to cells that can differentiate into several, but not all, cell types derived from all three germ layers. Thus, multipotent cells are partially differentiated cells. Multipotent cells are well known in the art, and non-limiting examples of multipotent cells can include adult stem cells such as, for example, hematopoietic stem cells and neural stem cells. Multipotency means that a stem cell can form many types of cells within a given lineage, but not cells of other lineages. For example, multipotent hematopoietic stem cells can form many different types of blood cells (red, white, platelets, etc.), but they cannot form nerve cells. The term "multipotent" refers to cells with a lower degree of developmental totipotency than totipotency and pluripotency.

[0055] The term "totipotent" refers to cells that have a degree of differentiation indicating the ability to create all cells in the adult body, as well as extraembryonic tissues including the placenta. A fertilized egg (zygote) is totipotent, as are the early cleavage cells (blastomeres).

[0056] The cells used in the methods described herein can be cells that do not exist in a tissue. As used herein, "tissue" refers to an organized biomaterial (e.g., a group, layer, or aggregate) of similarly specialized cells associated in the performance of at least one specific function. When a cell is removed from an organized superstructure in which it is organized or otherwise separated from an organized superstructure that exists in vivo, it no longer exists in a tissue. For example, when a blood sample is separated into two or more non-identical fractions or the spleen is minced and mechanically dissociated using a Pasteur pipette, the cells no longer exist in a tissue. In some embodiments, the cells that do not exist in a tissue are isolated cells. As used herein with respect to cells, the term "isolated" refers to a cell that has been mechanically or physically separated from another group of cells to which it is normally associated in vivo. Methods for isolating one or more cells from another group of cells are well known in the art. See, for example, Culture of Animal Cells: a manual of basic techniques (3rd edition), 1994, R. I. Freshney (ed.), Wiley-Liss, Inc.; Cells: a laboratory manual (vol. 1), 1998, D. L. Spector, R. D. Goldman, L. A. Leinwand (eds.), Cold Spring Harbor Laboratory Press; Animal Cells: culture and media, 1994, D. C. Darling, S. J. Morgan, John Wiley and Sons, Ltd. Optionally, the isolated cells are cultured in vitro, for example, in the presence of other cells.

[0057] In some embodiments, the cells are not present in a tissue but are present in a population of cells. In some embodiments, the population of cells is a population of cells. As used herein, "population of cells" refers to a group of at least two cells, e.g., 2 cells, 3 cells, 4 cells, 10 cells, 100 cells, 1000 cells, 10,000 cells, 100,000 cells, or any number in between, or more cells. Optionally, the population of cells can be cells having a common origin, e.g., it can be the progeny of the same parent cell, it can be clonal, it can be isolated from or the progeny of cells isolated from the same tissue, or it can be isolated from or the progeny of cells isolated from the same tissue sample. The population of cells can include one or more cell types, e.g., 1 cell type, 2 cell types, 3 cell types, 4 cell types, or more cell types. The population of cells can be heterogeneous or homogeneous. The population of cells can be substantially homogeneous if it contains at least 90% of the same cell type (e.g., 90%, 92%, 95%, 98%, 99%, or more of the cells in the population are of the same cell type). The population of cells can be heterogeneous if less than 90% of the cells present in the population are of the same cell type.

[0058] In some embodiments, the methods described herein may relate to conferring a pluripotent phenotype on non-pluripotent cells (e.g., differentiated cells). In some embodiments, generating pluripotent cells may include generating cells having a more pluripotent phenotype, i.e., conferring on the cells a phenotype having a broader differentiation capacity. As a non-limiting example, very small embryonic-like (VSEL) cells may be unipotent rather than pluripotent and / or may be limited in their ability to differentiate into a particular differentiated cell type (perhaps due to an epigenetic state of VSEL that is more similar to differentiated cells than embryonic stem cells). According to the methods described herein, a more pluripotent phenotype can be conferred on unipotent cells and / or cells having a limited differentiation capacity. A more pluripotent phenotype may be a phenotype that can differentiate into a greater number of differentiated cell types (e.g., of two unipotent cells), and a phenotype that can differentiate into a greater number of differentiated cell types in its lineage is more pluripotent, and / or pluripotent cells are more pluripotent than unipotent cells.

[0059] Methods for generating the pluripotent cells (or more pluripotent cells) described herein may include, for example, removing a portion of the cytoplasm from the cell and / or removing mitochondria from the cell. In some embodiments, removing a portion of the cytoplasm or mitochondria from the cell removes partial epigenetic control of the cell. In some embodiments, at least about 40% of the cytoplasm is removed, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more of the cytoplasm of the cell is removed. In some embodiments, 60% - 80% of the cytoplasm of the cell is removed. In some embodiments, at least about 40% of the mitochondria are removed, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more of the mitochondria of the cell are removed. In some embodiments, 50% - 90% of the mitochondria of the cell are removed.

[0060] A method of subjecting cells to stress and / or removing a portion of the cytoplasm or mitochondria from the cells can be any environmental stimulus that causes pores and / or ruptures in the cell membrane below the lethal threshold. The stress can include non-physiological stress in a tissue or cell culture. Non-limiting examples of suitable environmental stimuli include trauma, mechanical stimulation, chemical exposure, ultrasonic stimulation, oxygen deprivation, nutrient deprivation, irradiation, exposure to extreme temperatures, dissociation, trituration, physical stress, high osmotic pressure, low osmotic pressure, membrane damage, toxins, extreme ion concentration, reactive oxygen species, UV exposure, intense visible light, lack of essential nutrients, or a non-physiological acidic environment. In some embodiments, one environmental stimulus can be applied to the cells. In some embodiments, multiple environmental stimuli can be applied to the cells, for example, two stimuli, three stimuli, four stimuli, or more stimuli can be applied. The multiple environmental stimuli can be applied simultaneously or separately. In some embodiments, the stress can be a stress that causes membrane disruption in at least 10% of the cells exposed to the stress. As used herein, "membrane disruption" refers to damaging, rupturing, or breaking the membrane such that sufficient pores or gaps are formed to release a detectable amount of organelles and / or cellular material (including but not limited to mitochondria and DNA) into the extracellular environment. Methods for detecting the release of cellular material (e.g., mitochondria) are known in the art and described elsewhere herein. The released cellular material can be free, encapsulated, or surrounded by a membrane.

[0061]

[0062] ​Stress can cause membrane disruption in at least 10% of the cells exposed to stress, such as 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. In some embodiments, the cells exposed to stress can be cells of the same type and characteristics as the cells to be made more pluripotent as described herein. For example, a stress appropriate for one type of cell may not be appropriate for another type of cell.

[0063] The length of time the cells are exposed to stress can vary depending on the stimulus used. For example, when using low-nutrient conditions to stress the cells according to the methods described herein, the cells can be cultured under low-nutrient conditions for 1 week or more, such as 1 week, 2 weeks, or 3 weeks or longer. In some embodiments, the cells are cultured under low-nutrient conditions for about 3 weeks. In another non-limiting example, cells exposed to low pH or low oxygen conditions according to the methods described herein can be exposed for several minutes or longer (e.g., including several hours), such as at least 2 minutes, at least 5 minutes, at least 20 minutes, at least 1 hour, at least 2 hours, at least 6 hours or longer.

[0064] Mechanical stimuli that induce the generation of pluripotent cells can include any form of contact of a substance or surface with the cell membrane that mechanically disrupts membrane integrity. Mechanical stimuli can include exposing the cells to shear stress and / or high pressure. An exemplary form of mechanical stimulus is trituration. Trituration is the process of abrading and / or reducing the surface of particles via friction. Non-limiting examples of processes for trituration of cells include passing the cells through a device, where the device has an aperture smaller than the size of the cells. For example, by vacuum pressure and / or fluid flow, cells can be passed through a pipette having an internal space with at least a portion having a diameter smaller than the diameter of the cells. In some embodiments, the cells are passed through at least one device having an aperture smaller than the size of the cells. In some embodiments, the cells are passed through several devices having progressively smaller apertures. In some embodiments, the cells can be triturated for 5 minutes or more, such as 5 minutes, 10 minutes, 20 minutes, 30 minutes, or 60 minutes. In some embodiments, the cells can be triturated by passing the cells through a Pasteur pipette having an inner diameter of 50 μm. In some embodiments, the cells can be triturated by passing the cells through a Pasteur pipette having an inner diameter of 50 μm for 20 minutes.

[0065] Other methods of applying stress necessary to induce cells to generate pluripotent cells include, for example, exposure to certain chemicals or physicochemical conditions (such as high or low pH, osmotic shock, extreme temperature, oxygen deprivation, etc.). This type and other treatments for inducing the generation of pluripotent cells are further considered below. Chemical exposure can include, for example, any combination of pH, osmotic pressure, and / or pore-forming compounds that disrupt or damage the integrity of the cell membrane. As non-limiting examples, cells can be exposed to a non-physiological acidic environment or low pH, streptolysin O, or distilled water (i.e., osmotic shock).

[0066] Low pH can include a pH lower than 6.8, such as 6.7, 6.5, 6.3, 6.0, 5.8, 5.4, 5.0, 4.5, 4.0 or lower. In some embodiments, the low pH is from about 3.0 to about 6.0. In some embodiments, the low pH is from about 4.5 to about 6.0. In some embodiments, the low pH is 5.4 to 5.8. In some embodiments, the low pH is 5.4 to 5.6. In some embodiments, the low pH is about 5.6. In some embodiments, the low pH is about 5.7. In some embodiments, the low pH is about 5.5. In some embodiments, the cells can be exposed to low pH conditions for up to several days, such as 6 days or less, 4 days or less, 3 days or less, 2 days or less, 1 day or less, 12 hours or less, 6 hours or less, 3 hours or less, 2 hours or less, 1 hour or less, 30 minutes or less, 20 minutes or less, or 10 minutes or less. In some embodiments, the cells can be exposed to a pH of 5.4 to 5.6 for 3 days or less. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for 3 days or less. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for 1 hour or less. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for about 30 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for about 20 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for 3 days or less. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for 1 hour or less. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for about 30 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for about 20 minutes.

[0067] In some embodiments, cells can be exposed to ATP to induce the generation of pluripotent cells. In some embodiments, cells can be exposed to ATP at a concentration of about 20 μM to about 200 mM. In some embodiments, cells can be exposed to ATP at a concentration of about 200 μM to about 20 mM. In some embodiments, cells can be exposed to ATP at a concentration of about 2.4 mM. In some embodiments, cells can be exposed to ATP diluted in HBSS. In some embodiments, cells can be exposed to ATP for 1 minute or more, for example, at least 1 minute, at least 2 minutes, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour or longer. In some embodiments, cells can be exposed to ATP for about 5 minutes to about 30 minutes. In some embodiments, cells can be exposed to ATP for about 15 minutes. In some embodiments, cells can be exposed to about 2.4 mM ATP for about 15 minutes.

[0068] In some embodiments, cells can be exposed to CaCl2 to induce the generation of pluripotent cells. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 20 μM to about 200 mM. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 200 μM to about 20 mM. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 2 mM. In some embodiments, cells can be exposed to CaCl2 diluted in HBSS. In some embodiments, cells can be exposed to CaCl2 for 1 day or more, for example, at least 1 day, at least 2 days, at least 1 week, at least 2 weeks, at least 3 weeks or longer. In some embodiments, cells can be exposed to CaCl2 for about 1 week to 3 weeks. In some embodiments, cells can be exposed to CaCl2 for about 2 weeks. In some embodiments, cells can be exposed to about 2 mM CaCl2 for about 2 weeks. In some embodiments, cells can be exposed to about 2 mM CaCl2 for about 1 week.

[0069] Examples of pore-forming compounds include streptolysin O (SLO), saponin, digitonin, filipin, Ae I, cellolysin of Physarum polycephalum, aerolysin, amatoxin, amoebapore, amoebapore homolog derived from Entamoeba dispar, brevinin-1E, brevinin-2E, barbaticin, cytolysin of Enterococcus faecalis, δ-hemolysin, diphtheria toxin, E1 Tor cytolysin of Vibrio cholerae, equinatoxin, enterotoxin of Aeromonas hydrophila, esculentin, granulysin, hemolysin of Vibrio parahaemolyticus, intermedilysin of Streptococcus intermedins, lentiviral lysis peptide, leukotoxin of Actinobacillus actinomycetemcomitans, magainin, melittin, membrane-bound lymphotoxin, Met-enkephalin, neokyotorphin, neokyotorphin fragment 1, neokyotorphin fragment 2, neokyotorphin fragment 3, neokyotorphin fragment 4, NK lysin, pardaxin, α-cytolysin of Staphylococcus aureus, α-cytolysin of Clostridium septicum, Bacillus thuringiensis toxin, colicin, complement, defensin, histricin, listeriolysin, magainin, melittin, pneumolysin, yeast killer toxin, valinomycin, pedersen's crown ether, perforin, perfringolysin O, θ-toxin of Clostridium perfringens, phallolysin, phallotoxin, and other molecules, such as those described in Regen et al. Biochem Biophys Res Common 1989 159:566-571 (incorporated herein by reference in its entirety). Methods for purifying or synthesizing pore-forming compounds are well known to those skilled in the art. Furthermore, pore-forming compounds are commercially available (e.g., streptolysin O (Cat No. S5265; Sigma-Aldrich; St. Louis, MO)).As a non-limiting example, the cells can be exposed to SLO for 5 minutes or more, such as at least 5 minutes, at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, or longer. In some embodiments, the cells are exposed to SLO for about 30 minutes to 2 hours. In some embodiments, the cells are exposed to SLO for about 50 minutes. As a non-limiting example, the cells can be exposed to SLO at a concentration of about 10 ng / mL to 1 mg / mL. In some embodiments, the cells can be exposed to SLO at a concentration of about 1 μg / mL to 100 μg / mL. In some embodiments, the cells can be exposed to SLO at about 10 μg / mL. In some embodiments, the cells can be exposed to SLO at about 10 μg / mL for about 50 minutes.

[0070] The oxygen deprivation conditions that induce the generation of pluripotent cells can include culturing the cells under reduced oxygen conditions, for example, culturing the cells in 10% or less oxygen. In some embodiments, the cells are cultured under 5% or less oxygen. The length of the culture under reduced oxygen conditions can be 1 hour or more, such as 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or longer. In some embodiments, the cells can be cultured under reduced oxygen conditions for 1 week to 1 month. In some embodiments, the cells can be cultured under reduced oxygen conditions for about 3 weeks.

[0071] The nutrient deprivation conditions that induce the generation of pluripotent cells can include the lack of any factor or nutrient beneficial for cell proliferation. In some embodiments, the nutrient deprivation conditions include culturing the cells in a basal culture medium, such as F12 or DMEM, without additional supplements such as FBS or growth factors. The length of culturing under nutrient deprivation conditions can be 1 hour or more, for example, 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or longer. In some embodiments, the cells can be cultured under nutrient deprivation conditions for 1 week to 1 month. In some embodiments, the cells can be cultured under nutrient deprivation conditions for about 2 weeks. In some embodiments, the cells can be cultured under nutrient deprivation conditions for about 3 weeks. In some embodiments, the nutrient deprivation conditions can include conditions without growth factors or conditions using less than 50% of the standard concentration of one or more growth factors for a given cell type.

[0072] Exposure to extreme temperatures that induce the generation of pluripotent cells can include exposure to either low or high temperatures. For mammalian cells, extreme low temperature can be a temperature lower than 35°C, such as 34°C, 33°C, 32°C, 31°C, or lower. In some embodiments, extreme low temperature can be a temperature lower than freezing. Freezing of cells can cause membrane perforation by ice crystals and provide a way to reduce the cytoplasm. For mammalian cells, extreme high temperature can be a temperature higher than 42°C, such as 43°C, 44°C, 45°C, 46°C, or higher. In some embodiments, extreme high temperature can be a temperature of about 85°C or higher. The length of culturing under extreme temperatures can be 20 minutes or more, for example, 20 minutes, 30 minutes, 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or longer. Clearly, the higher the temperature, the shorter the exposure generally tolerated to enable the generation of pluripotent cells.

[0073] Further examples of stress that can be used in the methods described herein include, but are not limited to, ultrasonic stimulation and irradiation treatment.

[0074] In some embodiments, after exposure to stress, the cells can be cultured prior to selection according to the methods described herein below. The cells can be cultured for at least 1 hour prior to selection, for example, to remove the stressing stimulus and culture the cells for at least 1 hour, at least 2 hours, at least 6 hours, at least 12 hours, at least 1 day, at least 2 days, at least 7 days or longer prior to the selection as described herein. As a non-limiting example, the cells can be exposed to SLO for about 50 minutes and then cultured in SLO-free culture medium for about 7 days prior to selection. In some embodiments, the culture medium used to culture the cells prior to selection does not contain differentiation factors or does not promote differentiation. In some embodiments, the culture medium is suitable for culturing stem cells and / or pluripotent cells. Examples of such media are described herein below.

[0075] In some embodiments, the amount of cytoplasm in the cells is decreased. The decrease in cytoplasm in the cells can be determined by monitoring the cell size. Methods for determining cell size are well known to those skilled in the art and include, as a non-limiting example, cell fluorescence measurement analysis. Briefly, single cells are stained with propidium iodide, filtered, and measured on a DAKO GALAXY (trademark) (DAKO) analyzer using, for example, FLOMAX (trademark) software. Cell fluorescence measurement analysis can then be performed to establish cell size. Microbeads of a pre-defined size are resuspended in isotonic phosphate-buffered saline (pH 7.2) and used as a standard for comparing the size of the cells contained in the spheroids using cell fluorescence measurement analysis. Both the cells and the beads are analyzed using the same instrument settings (forward scatter representing the cell and bead size, and side scatter representing the cell granularity). The cell size can be calculated on a curve using the bead size on the x-axis and the forward scatter value on the y-axis.

[0076] In some embodiments, the amount of mitochondria in the cell is reduced. Methods for determining the number of mitochondria in a cell are well known to those of skill in the art and include staining with a mitochondria-specific dye and counting the number of visible mitochondria per cell as seen under a microscope. Mitochondria-specific dyes are commercially available (e.g., MITOTRACKER™ (Cat No M7512 Invitrogen; Grand Island, NY)). In some embodiments, the number of mitochondria or the intensity of the signal from the mitochondria-specific dye can be reduced by at least 40% after treatment using the methods described herein. In some embodiments, cells in which the number of mitochondria or the intensity of the signal from the mitochondria-specific dye is reduced by at least 40% after treatment using the methods described herein are selected.

[0077] The amount of mitochondria and / or membrane disruption can also be detected by measuring the redox activity in the extracellular environment. As mitochondria are released into the extracellular environment by the stress described herein, the level of ROS in the extracellular environment can increase and can be used to measure the effectiveness of a given stress.

[0078] In some embodiments of any of the aspects described herein, the cells can be subjected to stress in the presence of LIF (leukemia inhibitory factor).

[0079] In some instances, after removing some of the cytoplasm of the cell and / or mitochondria, the method further comprises selecting cells that exhibit pluripotency. Pluripotent cells can be selected by selecting cells that exhibit a marker, phenotype, or function of pluripotent cells. Selection of the cells can include isolating and growing cells that exhibit the desired characteristics, or culturing a population of cells with unknown characteristics under conditions such that cells with the desired characteristics survive and / or grow at a higher rate than cells without the desired characteristics. Non-limiting examples of markers and characteristics of pluripotent cells are set forth hereinbelow. In some embodiments, selection of the cells for pluripotency comprises, at least in part, selecting cells that express Oct4. In some embodiments, selection of the cells for pluripotency comprises, at least in part, selecting cells that express Nanog. In some embodiments, selection of the cells for pluripotency comprises, at least in part, selecting cells that express Oct4, Nanog, E-cadherin, and / or SSEA. In some embodiments, pluripotent cells can be selected by selecting cells that express SSEA-1 and E-cadherin using antibodies specific for these markers and FACS. In some embodiments, the cells can be selected based on size using FACS or other cell sorting devices known in the art and / or described herein. The cells can also be selected by virtue of their inability to adhere to a culture dish.

[0080] Cells can also be selected based on smaller size after subjecting them to stress. That is, stressed cells that progress to pluripotency are smaller than their non-pluripotent somatic precursors. In some embodiments, cells having a diameter of less than 8 μm are selected, such as cells having a diameter of 8 μm or less, 7 μm or less, 6 μm or less, 5 μm or less, or a smaller diameter. Cells can be selected based on size after culturing for a short period (e.g., several minutes to several days) or allowing them to rest after stress treatment. In some embodiments, cells can be selected based on size immediately after stress treatment. Cells can be selected based on size by any method known in the art (e.g., using filters or by FACS).

[0081] In some embodiments of the methods described herein, pluripotent cells generated according to the methods described herein can be cultured to allow for the proliferation of the pluripotent cells (i.e., the proliferation of stem cells). In some embodiments, pluripotent cells generated according to the methods described herein can be maintained in vitro. In one aspect, the techniques described herein relate to a composition comprising pluripotent cells and / or their progeny that are at least partially differentiated. In some embodiments, pluripotent cells and / or their progeny that are at least partially differentiated can be maintained in vitro, for example, as a cell line. The cell line can be used to screen and / or test candidate agents (e.g., therapeutic agents for a given disease and / or agents that modulate stem cells) as described herein below. In some embodiments, the pluripotent cells and / or their progeny that are at least partially differentiated can be derived from cells obtained from a subject having a disease (e.g., a disease associated with a defect in a natural cell or tissue type or a natural pluripotency and / or multipotency of cells (such as those described herein below), and / or a disease in which cells having a genetic mutation are involved (e.g., cancer)). The compositions described herein can be used, for example, in disease modeling, drug discovery, diagnosis, and personalized medicine.

[0082] Conditions suitable for the proliferation and / or maintenance of stem and / or pluripotent cells are known in the art. Proliferation of stem cells enables expansion of the cell number without substantially inducing or allowing differentiation. As a non-limiting example, conditions suitable for the proliferation of pluripotent cells include plating the cells at 1×10 6 cells / cm 2 in F12 / DMEM (1:1, v / v) supplemented with 2% B27, 20 ng / mL basic fibroblast growth factor, and 10 ng / mL epidermal growth factor. Approximately 50% of the medium can be replaced every 2 - 3 days for the duration of the culture. In some embodiments, conditions suitable for the proliferation of stem and / or pluripotent cells include culturing the cells in B27-LIF (i.e., LIF (1×10 3 units / mL, Chemicon; Cat No: ESG1107 EMD Millipore, Billerica, MA) and B27 supplement (Cat No: 0080085-SA; Invitrogen; Grand Island, NY))-containing serum-free medium). Other media suitable for culturing the cells described herein are described in the examples herein (e.g., ES establishment culture medium, 2i, 3i and ACTH, ES culture conditions, ES-LIF, embryonic neural stem cell culture conditions, and EpiSC culture conditions). In some embodiments, conditions for the proliferation or maintenance of pluripotent cells may include culturing the cells in the presence of LIF (leukemia inhibitory factor).

[0083] During proliferation, the pluripotent cells generated according to the methods described herein continue to express the same pluripotent stem cell markers. Non-limiting examples of pluripotent stem cell markers include SSEA-1, SSEA-2, SSEA-3, SSEA-4 (collectively referred to herein as SSEA), AP, E-cadherin antigen, Oct4, Nanog, Ecat1, Rex1, Zfp296, GDF3, Dppa3, Dppa4, Dppa5, Sox2, Esrrb, Dnmt3b, Dnmt3l, Utf1, Tel1, Bat1, Fgf4, Neo, Cripto, Cdx2, and Slc2a3. Methods for determining whether a cell expresses a pluripotent stem cell marker are well known to those of skill in the art and include, for example, RT-PCR, the use of reporter gene constructs (e.g., expression of the Oct4-GFP construct described herein in conjunction with FACS or fluorescence microscopy), and FACS or fluorescence microscopy using antibodies specific for the cell surface marker of interest.

[0084] Pluripotent cell markers also include telomeres that are elongated compared to the cell. Telomere length can be determined, for example, by isolating genomic DNA, digesting the gDNA with restriction enzymes (e.g., Hinf1 and Rsa1), and detecting the telomeres using a telomere length assay reagent. Such reagents are known in the art and are commercially available (e.g., TELOTAGGG™ TELOMERE LENGTH ASSAY kit (Cat No. 12209136001 Roche; Indianapolis, IN).

[0085] In some embodiments, the cells processed according to the methods described herein can change to be more similar to the epigenetic state of embryonic stem cells than they were prior to being processed according to the disclosed methods. The epigenetic state of a cell refers to chemical marking of the genome that is distinct from changes in the nucleotide sequence of the genome. Epigenetic marks can include DNA methylation (imprinting) as well as methylation and acetylation of proteins (such as histones) that bind to DNA. The term "DNA methylation" refers to the addition of a methyl (CH3) group to a specific base in DNA. In mammals, methylation occurs almost exclusively at the 5-position of cytosine when followed by guanine (CpG). In some embodiments, the epigenetic state can include an epigenetic methylation pattern (e.g., a DNA methylation pattern). Assays for determining the presence and location of epigenetic markings are known in the art and can include, for example, bisulfite sequencing as described in Example 2 herein. Briefly, DNA is treated with the CpGenome™ DNA Modification Kit (Chemicon, Temecula, CA) and the region of interest (e.g., the Nanog and Oct4 genes) is amplified and sequenced. genes) are amplified and sequenced.

[0086] Some aspects of the technology described herein relate to assays using pluripotent stem cells produced by the methods described herein. For example, pluripotent stem cells produced by the methods described herein can be used to screen and / or identify agents that regulate the viability, differentiation, or proliferation of pluripotent stem cells. Such assays involve contacting pluripotent cells produced according to the methods described herein with a candidate agent and determining whether the viability, differentiation, and / or proliferation of the pluripotent cells contacted with the candidate agent vary from the viability, differentiation, and / or proliferation of pluripotent cells not contacted with the candidate agent. In some embodiments, the agent can increase the viability, differentiation, and / or proliferation of pluripotent stem cells. In some embodiments, the agent can decrease the viability, differentiation, and / or proliferation of pluripotent stem cells. In some embodiments, pluripotent stem cells can be contacted with a plurality of candidate agents, for example, to determine synergistic or antagonistic effects or to screen candidate agents in a pool.

[0087] A candidate agent is identified as an agent that regulates the viability of pluripotent stem cells produced if the number of viable (i.e., living) pluripotent cells is higher or lower in the presence of the candidate agent compared to its absence. Methods for determining cell viability are well known in the art and include, by way of non-limiting example, determining the number of viable cells at at least two time points by detecting the strength of a signal from a live cell marker or the number or ratio of cells stained by a live cell marker. Live cell markers are commercially available (e.g., PRESTOBLUE™ (Cat No A-13261; Life Technologies; Grand Island, NY)). A candidate agent is identified as an agent that regulates the proliferation of pluripotent stem cells produced if the proliferation rate of the pluripotent cells changes, i.e., the number of progeny cells produced at a given time is higher or lower in the presence of the candidate agent. Methods for determining cell proliferation rate are known in the art and include, by way of non-limiting example, determining the increase in the number of live cells over time.

[0088] A candidate agent is identified as an agent that regulates the differentiation of pluripotent cells when the rate or characteristics of the differentiation of pluripotent cells are higher or lower in the presence of the candidate agent. Methods for determining the rate or characteristics of cell differentiation are known in the art and, by way of non-limiting example, include detecting a particular lineage of markers or morphology and comparing the cell number or incidence of cells having such markers or morphology in a population contacted with the candidate agent to a population not contacted with the candidate agent. Markers and morphological features of various cell fate lineages and mature cell types are known in the art. By way of non-limiting example, mesodermal cells are distinguished from pluripotent cells by the expression of actin, myosin, and desmin. Chondrocytes can be distinguished from their progenitor cell type by staining with safranin-O and / or FASTGREEN™ dye (Fisher; Pittsburg, PA; F99). Osteocytes can be distinguished from their progenitor cell type by staining with alizarin red S (Sigma; St. Louis, MO: Cat No A5533).

[0089] In some embodiments, the candidate agent can be a potential inhibitor of tumor stem cells and, for example, the methods described herein can be used to generate pluripotent cells from mature tumor cells and to screen for agents that inhibit the generation and / or viability of tumor cells. The methods described herein can also be used to screen for agents that kill mature tumor cells but do not promote the generation and / or survival of tumor stem cells.

[0090] In some embodiments, pluripotent cells are contacted with one or more candidate agents and cultured under conditions that promote differentiation into a particular cell lineage or mature cell type. Conditions suitable for differentiation are known in the art. As a non-limiting example, conditions suitable for differentiation into the mesodermal lineage include DMEM supplemented with 20% fetal bovine serum (FCS), and the medium is changed every three days. As a further non-limiting example, conditions suitable for differentiation into the neural lineage include plating the cells on ornithine-coated chamber slides in F12 / DMEM (1:1, v / v) supplemented with 2%B27, 10%FCS, 10 ng / mL bFGF, and 20 ng / mL EGF. The medium can be changed every three days.

[0091] As used herein, "candidate agent" refers to any object that is not normally present in or present at the administered level in a cell, tissue, or subject. A candidate agent can be selected from the group including: chemicals; small organic or inorganic molecules; nucleic acid sequences; nucleic acid analogs; proteins; peptides; aptamers; peptidomimetics, peptide derivatives, peptide analogs, antibodies; intracellular antibodies; extracts made from biopolymers, biomaterials (e.g., bacteria, plants, fungi, or animal cells or tissues); natural or synthetic compositions or functional fragments thereof. In some embodiments, the candidate agent is any chemical object or moiety including, but not limited to, synthetic and natural non-proteinaceous objects. In certain embodiments, the candidate agent is a small molecule having a chemical moiety. For example, the chemical moiety includes an unsubstituted or substituted alkyl, aromatic, or heterocyclic moiety (including macrolides, leptomycins, and related natural products or their analogs). A candidate agent can be known to have the desired activity and / or properties or can be selected from a library of diverse compounds.

[0092] Candidate drugs can be screened for their ability to regulate the viability, proliferation, and / or differentiation of pluripotent cells. In one embodiment, candidate agents are screened using the assays for viability, differentiation, and / or proliferation described above and in the examples herein.

[0093] Generally, a compound can be tested at any concentration that can regulate cell function, gene expression, or protein activity over an appropriate period of time as compared to a control. In some embodiments, the compound is tested at a concentration in the range of about 0.1 nM to about 1000 mM. In one embodiment, the compound is tested in the range of about 0.1 μM to about 20 μM, about 0.1 μM to about 10 μM, or about 0.1 μM to about 5 μM.

[0094] Depending on the particular embodiment being practiced, a candidate or test agent can be provided free in solution or can be bound to a carrier or solid support, such as beads. Several suitable solid supports can be used for immobilization of the test agent. Examples of suitable solid supports include agarose, cellulose, dextran (e.g., Sephadex, Sepharose as commercially available), carboxymethyl cellulose, polystyrene, polyethylene glycol (PEG), filter paper, nitrocellulose, ion exchange resin, plastic film, polyamine methyl vinyl ether maleic acid copolymer, glass beads, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, and the like. Further, for the methods described herein, test agents can be screened individually or in groups or pools. Group screening is particularly useful when the hit rate for effective test agents is expected to be low, such that more than one positive result is not expected for a given group.

[0095] Methods for developing small molecule, polymer, and genome-based libraries are described, for example, in Ding, et al. J Am. Chem. Soc. 124:1594-1596 (2002) and Lynn, et al., J. Am. Chem. Soc. 123: 8155-8156 (2001). Commercially available compound libraries can be obtained, for example, from ArQule (Woburn, MA), Invitrogen (Carlsbad, CA), Ryan Scientific (Mt. Pleasant, SC), and Enzo Life Sciences (Farmingdale, NY). These libraries can be screened for members' ability to regulate the viability, proliferation, and / or differentiation of pluripotent stem cells. Candidate agents can be natural proteins or fragments thereof. Such candidate agents can be obtained from natural sources, such as cell or tissue lysates. Libraries of polypeptide agents can also be prepared from cDNA libraries generated, for example, using commercially available or routine methods. Candidate agents can also be peptides (e.g., peptides of about 5 to about 30 amino acids, preferably about 5 to about 20 amino acids, and particularly preferably about 7 to about 15). Peptides can be digests of natural proteins, random peptides, or "biased" random peptides. In some methods, candidate agents are polypeptides or proteins. Peptide libraries, e.g., combinatorial libraries of peptides or other compounds, can be fully randomized at any position without sequence preference or invariance. Alternatively, the library can be biased. That is, some positions within the sequence are kept invariant or selected from a limited number of possibilities. For example, in some cases, nucleotide or amino acid residues are randomized within a defined class (e.g., hydrophobic amino acids, hydrophilic residues, spatially biased (small or large) residues, towards the creation of cysteine, for cross-linking, for SH-3 domains, proline for phosphorylation sites, serine, threonine, tyrosine or histidine, or towards purines).

[0096] The candidate agent can also be a nucleic acid. The nucleic acid candidate agent can be a natural nucleic acid, a random nucleic acid, or a "biased" random nucleic acid. For example, digests of prokaryotic or eukaryotic genomes can be used in the same manner as described above for proteins.

[0097] In some embodiments, candidate agents screened and identified as modulating the viability, proliferation, and / or differentiation of pluripotent cells according to the methods described herein increase the viability, proliferation, and / or differentiation of pluripotent cells by at least 5%, preferably at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or more as compared to an untreated control. In some embodiments, candidate agents screened and identified as modulating the viability, proliferation, and / or differentiation of pluripotent cells according to the methods described herein decrease the viability, proliferation, and / or differentiation of pluripotent cells by at least 5%, preferably at least 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or more, down to and including complete reduction (i.e., 0 viability, growth, proliferation, or differentiation).

[0098] In some embodiments, the candidate agent functions directly in the form in which it is administered. Alternatively, the candidate agent can be modified or utilized within the cell to yield a form that modulates the desired activity (e.g., introduction of a nucleic acid sequence into the cell and its transcription, resulting in the production of an inhibitor or activator of gene expression or protein activity within the cell).

[0099] The methods and compositions described herein are intended to be used, for example, in the development of cancer vaccines. Generation of at least partially differentiated progeny of pluripotent tumor cells obtained as described herein (e.g., by treating mature tumor cells according to the methods described herein) can provide a diverse and changing antigen profile, which can enable the development of more potent APC (antigen-presenting cell)-based cancer vaccines.

[0100] In some embodiments, the methods described herein relate to an increase in the transformation efficiency of cells. Subjecting cells to stress, e.g., inducing pluripotency as described herein, can make the cells more receptive to methods of genetic modification (including, but not limited to, insertion of transgenes, viral vectors, and / or zinc finger endonucleases). It is intended that the methods described herein can enable cells to be modified to a genetically receptive state such that naked DNA can be used to transform the resulting pluripotent cells.

[0101] Some aspects of the technology described herein relate to methods of cell therapy that include administering to a subject in need of cell therapy pluripotent cells produced by the methods described herein, or at least partially differentiated progeny of such cells. In some embodiments, a therapeutically effective amount of pluripotent cells or at least partially differentiated progeny of pluripotent cells is provided. In some embodiments, the pluripotent cells and / or their progeny are autologous. In some embodiments, the pluripotent cells and / or their progeny are allogeneic. In some embodiments, the pluripotent cells and / or their progeny are autologous. In some embodiments, the pluripotent cells and / or their progeny are HLA-matched allogeneic. In some embodiments, the pluripotent cells and / or their progeny are syngeneic. In some embodiments, the pluripotent cells and / or their progeny are xenogeneic. In some embodiments, the cell therapy can be autologous therapy; for example, cells from the subject can be used to generate pluripotent cells according to the methods described herein, and the pluripotent cells and / or at least partially differentiated progeny of the pluripotent cells can be administered to the subject. As used herein, a "subject in need of cell therapy" refers to a subject having a disease associated with a defect in a natural cell or tissue type or natural pluripotency and / or multipotency (e.g., stem cells), or being diagnosed as having or at risk of developing a disease.

[0102] In some embodiments, the methods described herein can be used to treat a genetic disorder (e.g., Tay-Sachs or hemophilia) by administering, for example, allogeneic pluripotent cells and / or their progeny obtained as described herein.

[0103] In one aspect, provided herein is a method of preparing a cell or tissue that is compatible with a cell therapy to be administered to a subject, the method comprising generating a pluripotent cell (or a more pluripotent cell) from a cell according to the methods described herein, wherein the cell is an autologous cell or an HLA-compatible allogeneic cell. In some embodiments, the pluripotent cell (or more pluripotent cell) can be differentiated along a predefined cell lineage prior to administering the cell or tissue to the subject.

[0104] Pluripotent cells (e.g., pluripotent stem cells) generated according to the methods described herein can be used in cancer therapy. For example, high-dose chemotherapy + hematopoietic stem cell transplantation to regenerate the hematopoietic system can benefit from the use of pluripotent cells generated as described herein.

[0105] Non-limiting examples of diseases associated with defects in natural cell or tissue types or natural pluripotent and / or multipotent cells include aplastic anemia, Fanconi anemia, and paroxysmal nocturnal hemoglobinuria (PNH). Others include, for example, the following: acute leukemias (including acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute mixed leukemia, and acute undifferentiated leukemia); chronic leukemias (including chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), juvenile chronic myeloid leukemia (JCML), and juvenile myelomonocytic leukemia (JMML)); myeloproliferative disorders (including acute myelofibrosis, angiogenic myeloid metaplasia (myelofibrosis), polycythemia vera, and essential thrombocythemia); lysosomal storage diseases (including mucopolysaccharidoses (MPS), Hurler syndrome (MPS-IH), Scheie syndrome (MPS-IS), Hunter syndrome (MPS-II), Sanfilippo syndrome (MPS-III), Morquio syndrome (MPS-VII), Maroteaux-Lamy syndrome (MPS-VI), Sly syndrome, beta-glucuronidase deficiency (MPS-VII), adrenoleukodystrophy, mucolipidosis II (I-cell disease), Krabbe disease, Gaucher disease, Niemann-Pick disease, Wolman disease, and metachromatic leukodystrophy); histiocytic disorders (including familial erythrophagocytic lymphohistiocytosis, histiocytosis X, and hemophagocytosis); phagocytic cell disorders (including Chédiak-Higashi syndrome, chronic granulomatous disease, neutrophil actin deficiency, and reticular dysgenesis); hereditary platelet abnormalities (including amegakaryocytosis / congenital thrombocytopenia); plasma cell disorders (including multiple myeloma, plasma cell wh (including leukemia and Waldenström macroglobulinemia). Other malignant lesions treatable using stem cell therapy include, but are not limited to, breast cancer, Ewing sarcoma, neuroblastoma, and renal cell carcinoma. The following are also treatable using stem cell therapy: lung disorders (including COPD and bronchial asthma); congenital immunodeficiencies (including ataxia telangiectasia, Kostmann syndrome, leukocyte adhesion deficiency, DiGeorge syndrome, bare lymphocyte syndrome, Omenn syndrome, severe combined immunodeficiency (SCID), SCID with adenosine deaminase deficiency, T- and B-cell-deficient SCID, T-cell deficiency, normal B-cell SCID, unclassified immunodeficiency, and X-linked lymphoproliferative disease); other genetic disorders (including Lesch-Nyhan syndrome, cartilage-hair hypoplasia, Glanzmann thrombasthenia, and marble bone disease); neurological conditions (including acute and chronic stroke, traumatic brain injury, cerebral palsy, multiple sclerosis, amyotrophic lateral sclerosis, and epilepsy); cardiac conditions (including atherosclerosis, congestive heart failure, and myocardial infarction); metabolic disorders (including diabetes); and ocular disorders (including macular degeneration and optic atrophy). Such diseases or disorders can be treated either by administration of pluripotent cells themselves that enable in vivo differentiation into the desired cell type, with or without administration of agents to promote the desired differentiation, and / or by administration of pluripotent cells that have differentiated or are at least partially directed toward differentiating into the desired cell type in vitro. Methods for diagnosing such conditions are well known to those of ordinary skill in the medical arts. In some embodiments, the subject may have been treated using radiation therapy or other treatment that removed a population of cells or stem cells; for example, the subject may be a subject with cancer whose bone marrow has been removed by radiation therapy.

[0106] In some embodiments, pluripotent cells are administered to a subject. In some embodiments, at least partially differentiated cells are administered to a subject. In some embodiments, the method of cell therapy may further include differentiating pluripotent cells along a predefined cell lineage prior to administering the cells. Methods of differentiating stem cells along a desired cell lineage are known in the art and examples are described herein.

[0107] In some embodiments, a composition comprising pluripotent cells obtained according to the methods described herein or at least partially differentiated cells that are progeny of pluripotent cells is administered to a subject.

[0108] In some embodiments, a composition comprising pluripotent cells obtained according to the methods described herein or at least partially differentiated cells that are progeny of pluripotent cells may optionally further comprise G-CSF, GM-CSF, and / or M-CSF, and / or G-CSF, GM-CSF, and / or M-CSF may be administered to or administered to a subject that has been administered in another composition. Administration of G-CSF, GM-CSF, and / or M-CSF may, for example, induce a favorable inflammatory state for organ regeneration and the removal of tissue debris, waste, and accumulation.

[0109] In some embodiments, administration of pluripotent cells and / or their at least partially differentiated progeny can be performed within a relatively short period of time after the production of pluripotent cells in a culture according to the methods described herein (e.g., 1, 2, 5, 10, 24, or 48 hours after production). In some embodiments, administration of at least partially differentiated progeny can be performed within a relatively short period of time after the differentiation of pluripotent cells in a culture according to the methods described herein (e.g., 1, 2, 5, 10, 24, or 48 hours after production). In some embodiments, pluripotent cells and / or their at least partially differentiated progeny can be cryopreserved prior to administration.

[0110] In some aspects, the technology described herein relates to compositions comprising pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of pluripotent cells. In some embodiments, a pharmaceutical composition comprises pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of pluripotent cells, and optionally a pharmaceutically acceptable carrier. The composition may further comprise at least one pharmaceutically acceptable excipient.

[0111] The pharmaceutical composition may contain suitable excipients or stabilizers and may be, for example, a solution, suspension, gel, or emulsion. Typically, the composition contains about 0.01-99%, preferably about 5-95%, cells together with the carrier. The cells can be administered parenterally, subcutaneously, by transplantation or by injection when combined with a pharmaceutically or physiologically acceptable carrier, excipient or stabilizer. For most therapeutic purposes, the cells can be administered in liquid form as a solution or suspension via injection. The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of pluripotent cells. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, and combinations thereof. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and, for example, not reducing the effectiveness of the agent on the subject. In other words, the carrier is pharmaceutically inert and compatible with living cells.

[0112] Suitable formulations also include aqueous and non-aqueous sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, bactericidal antibiotics, and solutes that render the formulation isotonic with the body fluids of the intended recipient. Aqueous and non-aqueous sterile suspensions may contain suspending and thickening agents. The formulations may be presented in unit-dose or multi-dose containers.

[0113] Examples of parenteral dosage forms include, but are not limited to, injectable solutions, injectable suspensions, and emulsions. A parenteral dosage form can be prepared using, for example, a bioabsorbable scaffold material that retains pluripotent cells and / or at least partially differentiated progeny of pluripotent cells generated according to the methods described herein.

[0114] The term "epigenetic modification" refers to chemical marking of the genome. Epigenetic marks can include DNA methylation (imprinting) as well as methylation and acetylation of proteins that bind to DNA (e.g., histones). Parent-of-origin specific gene expression (from either the maternal or paternal chromosome) is often observed in mammals and is due to epigenetic modification. In the parental germ line, epigenetic modification can lead to stable gene silencing or activation.

[0115] As used herein, the term "administration" or "transplantation" refers to the placement of cells into a subject by a method or route that results in at least partial localization of the cells at a desired site such that a desired effect is produced.

[0116] The pluripotent stem cells described herein and / or their at least partially differentiated progeny can be administered by any method found by the clinician to be appropriate, and can include, for example, administration by injection of a cell suspension or, for example, by transplantation of a preparation of cells deposited or grown on or in a transplantable scaffold or support. Transplantable scaffolds can include any of several degradable or absorbable polymers or, for example, silk scaffolds in particular. Routes of administration suitable for the administration of a pharmaceutical composition comprising the pluripotent stem cells described herein and / or their at least partially differentiated progeny include, but are not limited to, local administration, for example, intraperitoneal, parenteral, intracavitary or subcutaneous administration. As used herein, the terms "parenteral administration" and "administer parenterally" refer to a mode of administration other than enteral and local administration, usually by injection, and include, but are not limited to, intraperitoneal, intradermal, subcutaneous injection and infusion. Administration can include the use of needles, catheters and syringes appropriate for injection or surgical implantation. The use of combinations of delivery means and delivery sites is intended to achieve the desired clinical effect.

[0117] The term "epigenetic modification" refers to the chemical marking of the genome. Epigenetic marks can include DNA methylation (imprinting) and methylation and acetylation of proteins that bind to DNA (e.g., histones). Parent-of-origin specific gene expression (from either the maternal or paternal chromosome) is often observed in mammals and is due to epigenetic modification. In the parental germ line, epigenetic modification can lead to stable gene silencing or activation.

[0118] In one embodiment, a therapeutically effective amount of the pluripotent stem cells and / or at least partially differentiated progeny thereof described herein is administered to a subject. A "therapeutically effective amount" is an amount of the pluripotent stem cells and / or at least partially differentiated progeny thereof described herein sufficient to produce a measurable improvement in the symptoms or markers of the condition being treated. The actual dosage level of cells in the therapeutic composition can be varied so as to administer an amount of cells effective to achieve the desired therapeutic response for a particular subject. The dosage level selected will depend on a variety of factors including, but not limited to, the activity of the therapeutic composition, the formulation, the route of administration, the combination with other drugs or treatments, the severity of the condition being treated, the physical condition of the subject, the previous medical history of the subject being treated, and the experience and judgment of the clinician or physician administering the treatment. Generally, the dosage and administration schedule should be sufficient to cause a delay and preferably inhibition of the progression of the condition and also preferably cause a decrease in one or more of the symptoms or markers of the condition. The determination and adjustment of therapeutically effective dosages, and the evaluation of when and how to make such adjustments, are known to those of ordinary skill in the medical arts.

[0119] The dosage of the pluripotent stem cells described herein and / or their at least partially differentiated progeny administered according to the methods described herein can be determined by a physician and can be adjusted, if necessary, to suit the observed effects of the treatment. With regard to the duration and frequency of treatment, a skilled clinician determines when the treatment is providing a therapeutic benefit and monitors the subject to determine whether to administer another dose of the cells, increase or decrease the dosage, discontinue the treatment, resume the treatment, or make other changes to the treatment regimen. Repeated dosing may be required if the administered cells are expected to engraft and survive for an intermediate to long period. However, administration can be repeated, if necessary and as tolerated by the subject. The dosage should not be so large as to cause substantial adverse side effects. The dosage can also be adjusted by the individual physician in the event of any complications. However, typically, the dosage for an adult human is from 100 to 1 x 10 9 cells, such as from 100 to 10,000 cells, 1,000 to 100,000 cells, 10,000 to 1,000,000 cells or from 1,000,000 to 1 x 10 9 cells. The effective dosage can be extrapolated, for example, from a dose-response curve derived from animal model test bioassays or systems.

[0120] A therapeutic composition comprising the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof, prepared as described herein, may optionally be tested in one or more appropriate in vitro and / or in vivo animal models of disease (e.g., SCID mouse model) to confirm efficacy, to evaluate in vivo proliferation of the transplanted cells, and to estimate dosage, according to methods well known in the art. In particular, the dosage can first be determined in relevant assays by the activity, stability, or other appropriate measure of treated versus untreated (e.g., comparison of treated animal model versus untreated animal model). In determining an effective amount of the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof, the physician evaluates, among other criteria, the proliferation and volume of the transplanted cells, and the progression of the condition being treated. The dosage may vary depending on the dosage form used and the route of administration utilized.

[0121] With respect to the methods of treatment described herein, it is not intended that administration of the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof be limited to a particular mode of administration, dosage, or frequency of dosing. All modes of administration, including intramuscular, intravenous, intraperitoneal, intracystic, intra-articular, intralesional, subcutaneous, or any other route, are intended that are sufficient to provide an appropriate dosage to treat the condition being treated.

[0122] In some embodiments, the methods described herein can be used to generate pluripotent cells in vivo, for example, cells present in a subject can be subjected to stress as described herein to acquire a pluripotent phenotype. Methods for applying the stress described herein to cells in vivo are readily apparent and can include, for example, introducing a mild acid solution into tissue via injection and / or direct application, changing the temperature with a probe that can heat or cool the surrounding tissue, or via the use of non-invasive methods (e.g., focused beam irradiation). For example, in vivo modulation of pluripotency can be used to increase tissue regeneration or wound healing. Non-limiting examples can include injection of a mild acid into an arthritic knee joint to cause knee joint cells (e.g., synovial or chondrocyte cells) to adopt a pluripotent phenotype and induce the generation of new tissue. Further non-limiting examples can include treatment of subjects having a stroke or central nervous system injury (e.g., spinal cord injury). After inflammation has resolved, cells adjacent to the damaged area can be treated with stress as described herein to generate pluripotent cells that can reposition the damaged tissue and / or regenerate or repair the damaged tissue.

[0123] In further non-limiting examples, a change in epigenetic state (e.g., by treatment with a demethylase) can cause the conversion of non-insulin secreting cells (e.g., pancreatic alpha glucagon cells) to insulin secreting cells (e.g., beta cells). Thus, treatment of non-insulin secreting cells (e.g., pancreatic alpha glucagon cells) according to the methods described herein can result in cells that become insulin secreting cells (e.g., beta-like cells) either in vivo or in vitro.

[0124] Furthermore, it is contemplated that the pluripotent cells described herein can be fused with other cells (i.e., "recipient cells") (e.g., cells that have not been treated according to the methods described herein, non-pluripotent cells, mature cells, malignant cells, and / or damaged cells). Cell fusion can result in increased levels of cell repair enzyme expression and / or activity in recipient cells compared to prior to fusion. This can increase the health and / or function of recipient cells, for example, by increasing the repair of cell damage, mutations, and / or modifications of the epigenetic state of recipient cells.

[0125] In some embodiments, the epigenetic markers (e.g., DNA methylation, demethylation, and / or hydroxymethylation status) of a cell can be modulated by increasing the pluripotency of the cell in vivo. Modulation of epigenetic markers has been shown to be involved in, for example, malignancies, arthritis, autoimmune diseases, aging, etc., and treatment of such epigenetically related conditions according to the methods described herein is contemplated.

[0126] In some embodiments, multiple tissues can be treated simultaneously in vivo, for example, inducing a mildly acidic state in multiple organs, for example, continuously or simultaneously (e.g., brain, heart, liver, lung, and / or thyroid), to treat extensive damage or aging.

[0127] It is further contemplated that the in vivo treatment of cells described herein can be combined with the administration of pluripotent cells produced as described herein and / or their at least partially differentiated progeny.

[0128] It is contemplated herein that the methods described herein can be used, for example, to treat a fetus or embryo in utero.

[0129] The efficacy of a treatment can be evaluated, for example, by measuring a marker, an indicator, a symptom, or an incidence rate of a condition being treated as described herein, or any other measurable and suitable parameter (e.g., the number of pluripotent cell progeny). Monitoring the efficacy of a treatment or prevention by measuring any one of such parameters, or any combination of parameters, is well within the ability of one of ordinary skill in the art.

[0130] An effective treatment is evident if there is a statistically significant improvement in one or more of the markers, indicators, or symptoms of the condition being treated, or if the worsening or development of symptoms does not occur when it would otherwise be expected. By way of example, at least about 10%, and preferably at least about 20%, about 30%, about 40%, about 50% or more favorable changes in a measurable parameter of the condition can indicate an effective treatment. The efficacy of pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of pluripotent cells can also be determined using experimental animal models known in the art for the conditions described herein. When using an experimental animal model, the efficacy of a treatment is demonstrated if a statistically significant change in a marker (e.g., the number of hematopoietic cells present in a mouse after bone marrow ablation and treatment with pluripotent cells as described herein) is observed.

[0131] In one aspect, provided herein is a method of producing pluripotent cells having the ability to differentiate into placental cells, the method comprising culturing pluripotent cells obtained according to the methods described herein in the presence of FGF4. In some embodiments, the pluripotent cells have the ability to differentiate into embryonic stem cells. In some embodiments, the concentration of FGF4 is from about 1 nM to about 1 μM. In some embodiments, the concentration of FGF4 is 1 nM to 1 μM. In some embodiments, the concentration of FGF4 is from about 5 nM to about 500 nM. In some embodiments, the concentration of FGF4 is from about 10 nM to about 100 nM.

[0132] In some aspects, the technology described herein relates to a system for generating pluripotent cells from cells, including removing a portion of the cytoplasm and / or mitochondria from the cells.

[0133] A system for generating pluripotent cells from cells according to the methods described herein may include a vessel in which the cells are subjected to stress. The vessel may be suitable for culturing somatic cells and / or pluripotent cells, for example, when culturing the cells under hypoxic conditions for several days or longer to reduce the amount of cytoplasm and / or mitochondria according to the methods described herein. Alternatively, the vessel may be suitable for stressing the cells rather than culturing them, for example, when triturating the cells in a device having a narrow aperture for a limited period (e.g., less than 1 hour). The vessel can be, for example, a container, tube, microfluidic device, pipette, bioreactor, or cell culture dish. The vessel can be maintained in an environment that provides conditions suitable for culturing somatic cells and / or pluripotent cells (e.g., housed within an incubator), or in an environment that provides conditions that cause environmental stress to the cells (e.g., housed within an incubator that provides a hypoxic environment). The vessel can be designed to provide one or more of the environmental stresses described herein, e.g., one stress, two stresses, three stresses, or more. Vessels suitable for manipulating and / or culturing somatic cells and / or pluripotent cells are well known to those skilled in the art and are commercially available (e.g., CatNo CLS430597 Sigma - Aldrich; St. Louis, MO). In some embodiments the vessel is a microfluidic device. In some embodiments, the vessel is a cell culture dish, flask, or plate.

[0134] In some embodiments, the system may further include means for selecting pluripotent cells. For example, the system may select cells that express a pluripotency marker (e.g., Oct4-GFP) or may include a FACS system that can select by size as described hereinabove. Methods and devices for cell selection are well known to those skilled in the art and are commercially available (e.g., BD LSRII™ and BD FACSDIVA™ software (CatNo. 643629) produced by BD Biosciences; Franklin Lakes, NJ and the BD FACSARIA SORP™ connected thereto).

[0135] In some embodiments, cells that do not exist in the tissue are provided to the system. In some embodiments, the tissue is provided to the system and the system further includes means for isolating one or more types of cells. As a non-limiting example, the system may include a tissue homogenizer. Tissue homogenizers and methods of using them are known in the art and are commercially available (e.g., FASTH21™, Cat No. 21-82041 Omni International; Kennesaw, GA). Alternatively, the system may include a centrifuge for processing blood or fluid samples.

[0136] In some embodiments, the system can be automated. Methods for automating cell isolation, cell culture, and selection devices are known in the art and are commercially available. For example, the FASTH21™ Tissue Homogenizer (Cat No. 21-82041 Omni International; Kennesaw, GA) and the BD FACSARIA SORP™.

[0137] In some embodiments, the system can be sterile, e.g., it can be operated in a sterile environment or the system can be operated as a closed sterile system.

[0138] In one aspect, provided herein is a method for increasing the self-renewal ability of pluripotent cells, comprising the step of culturing the cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. As used herein, "self-renewal ability" refers to the length of time that cells can be cultured and passaged in vitro, e.g., the number of passages that cells and their progeny can be subjected to and continue to produce viable cells. Cells that are made to have increased self-renewal ability according to the methods described herein can be, for example, totipotent cells and / or cells generated by exposing them to stress as described elsewhere herein.

[0139] In some embodiments, culturing in the presence of ACTH can include culturing the cells in a cell culture medium containing from about 0.1 μM to about 1,000 μM, such as from about 0.1 μM to about 100 μM, from about 0.1 μM to about 10 μM, or including about 10 μM. In some embodiments, culturing the cells in the presence of ACTH can include culturing the cells in LIF medium containing ACTH. LIF, ACTH, 2i, and 3i are commercially available and well known in the art. For example, ACTH can be purchased from Sigma-Aldrich (Cat No. A0673; St. Louis, MO), and LIF medium can be purchased from Millipore (e.g., Cat Nos ESG1107; Billerica, MA), and 3i can be purchased from Stem Cells Inc. (e.g., as "iSTEM Stem Cell Culture Medium, Cat No. SCS-SF-ES-01; Newark, CA").

[0140] In some embodiments, the culturing step can proceed for at least 3 days, such as at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, or longer. After the culturing step, the cells can be maintained under appropriate conditions to maintain the pluripotent cells as described elsewhere herein.

[0141] In some embodiments, after the culturing step, the cells may express a detectable and / or increased level of a stem cell marker. Stem cell markers and methods for detecting them are described elsewhere herein. In some embodiments, the stem cell marker may be selected from the group consisting of: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5.

[0142] It is not intended that the description of the disclosed embodiments be exhaustive or to limit the disclosure to the precise forms disclosed. Specific embodiments of the disclosure and examples thereof are described herein for illustrative purposes, but as will be recognized by those of ordinary skill in the relevant art, various equivalent modifications are possible within the scope of the disclosure. For example, method steps or functions are shown in a given order, but alternative embodiments may perform the functions in a different order or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein may be applied to other procedures or methods as appropriate. Combinations of the various embodiments described herein may provide further embodiments. Aspects of the disclosure may be modified, if necessary, using the above references and the constructs, functions, and concepts of the applications to provide still further embodiments of the disclosure. These and other changes may be made to the disclosure in light of the detailed description.

[0143] The specific components of any of the foregoing embodiments can be combined or replaced with components in other embodiments. Further, advantages associated with specific embodiments of the disclosure are described in the context of these embodiments, but other embodiments may exhibit such advantages, and not all embodiments necessarily exhibit such advantages to fall within the scope of the disclosure.

[0144] All patents and other publications identified are hereby expressly incorporated by reference into this specification for the purpose of describing and disclosing, for example, the methods described in such publications that may be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. In no way should this be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or content of these documents are based on information available to the applicants, and are not to be construed as any admission as to the correctness of the date or content of these documents.

[0145] The present invention will be further illustrated by the following examples. The examples are not to be construed as limiting.

[0146] Some embodiments of the technology described herein can be defined according to any of the following numbered clauses. 1. A method for generating pluripotent cells, comprising the step of subjecting cells to stress. 2. The method according to clause 1, wherein the pluripotent cells are generated without introduction of foreign genes, transcripts, proteins, nuclear components or cytoplasm, or without cell fusion. 3. The method according to clause 1 or 2, further comprising the step of selecting cells that exhibit pluripotency. 4. The method according to any one of clauses 1 to 3, wherein the cells do not exist as a part of a tissue. 5. The method according to any one of clauses 1 to 4, wherein the cells are somatic cells, stem cells, progenitor cells or embryonic cells. 6. The method according to any one of clauses 1 to 5, wherein the cells are isolated cells. 7. The method according to any one of clauses 1 to 6, wherein the cells exist in a heterogeneous population of cells. 8. The method according to any one of clauses 1 to 7, wherein the cells exist in a homogeneous population of cells. 9. The method according to any one of clauses 1 to 8, wherein the step of selecting cells that exhibit pluripotency comprises selecting cells that express a stem cell marker. 10. The method according to claim 9, wherein the stem cell marker is selected from the group consisting of: Oct4; Nanog; E-cadherin, and SSEA4. 11. The method according to any one of claims 1 to 10, wherein the step of selecting cells exhibiting pluripotency includes selecting non-adherent cells. 12. The method according to any one of claims 1 to 11, wherein the stress includes non-physiological stress in a tissue or cell culture. 13. The method according to any one of claims 1 to 12, wherein the stress includes exposure of cells to at least one environmental stimulus selected from the following: trauma, mechanical stimulation, chemical exposure, ultrasonic stimulation, oxygen deprivation, irradiation, exposure to extreme temperatures, dissociation, trituration, physical stress, high osmotic pressure, low osmotic pressure, membrane damage, toxins, extreme ion concentrations, reactive oxygen species, UV exposure, intense visible light, lack of essential nutrients, or non-physiological acidic environment. 14. The method according to any one of claims 1 to 13, wherein the stress includes exposing cells to a pH of about 3.0 to about 6.8. 15. The method according to any one of claims 1 to 14, wherein the stress includes exposing cells to a pH of about 4.5 to about 6.0. 16. The method according to claim 15, wherein the stress includes exposing cells to a pH of about 5.4 to about 5.8. 17. The method according to any one of claims 12 to 16, wherein the cells are exposed for 2 to 3 days. 18. The method according to any one of claims 12 to 17, wherein the cells are exposed for 1 day or less. 19. The method according to any one of claims 12 to 18, wherein the cells are exposed for 1 hour or less. 20. The method according to any one of claims 12 to 19, wherein the cells are exposed for about 30 minutes. 21. The method according to claim 13, wherein exposure to extreme temperatures includes exposing cells to a temperature below 35°C or above 42°C. 22. The method according to claim 21, wherein exposure to extreme temperatures includes exposing cells to a temperature below freezing or at least about 85°C. 23. The mechanical stimulation includes exposing cells to shear stress and / or high pressure, The method according to claim 13. 24. The method according to item 23, comprising passing a cell through at least one device having an opening smaller than the size of the cell. 25. The method according to item 23, comprising passing a cell through several devices having progressively smaller openings. 26. The method according to any one of items 1 to 25, further comprising the step of culturing pluripotent cells to proliferate the pluripotent cells. 27. The method according to any one of items 1 to 26, wherein the pluripotent cells express a stem cell marker. 28. The method according to item 27, wherein the stem cell marker is selected from the group consisting of: Oct4; Nanog; E-cadherin, and SSEA4. 29. The method according to any one of items 1 to 28, wherein the cell is a mammalian cell. 30. The method according to any one of items 1 to 29, wherein the cell is a human cell. 31. The method according to any one of items 1 to 30, wherein the cell is an adult cell, a neonatal cell, a fetal cell, an amniotic fluid cell, or a cord blood cell. 32. The method according to any one of items 1 to 31, further comprising the step of maintaining the pluripotent cells in vitro. 33. The method according to any one of items 1 to 32, wherein the epigenetic state of the cell is changed to be closer to the epigenetic state of an embryonic stem cell. 34. The method according to item 33, wherein the epigenetic state comprises a methylation pattern. 35. The method according to any one of items 1 to 34, wherein the stress comprises removing at least about 40% of the cytoplasm from the cell. 36. The method according to item 35, wherein at least about 50% of the cytoplasm is removed from the cell. 37. The method according to item 36, wherein at least about 60% of the cytoplasm is removed from the cell. 38. The method according to item 37, wherein 60 - 80% of the cytoplasm is removed from the cell. 39. The method according to item 37, wherein at least about 80% of the cytoplasm is removed from the cell. 40. The method according to item 39, which removes at least about 90% of the cytoplasm from the cell. 41. The method according to any one of items 1 to 40, wherein the stress includes removing at least about 40% of the mitochondria from the cell. 42. The method according to item 41, wherein the removal of a part of the cytoplasm removes at least about 50% of the mitochondria from the cytoplasm. 43. The method according to item 42, wherein the removal of the cytoplasm or mitochondria removes about 50% to 90% of the mitochondria from the cytoplasm. 44. The method according to item 42, wherein the removal of the cytoplasm or mitochondria removes more than 90% of the mitochondria from the cytoplasm. 45. The method according to any one of items 1 to 44, wherein the stress is sufficient to disrupt at least 10% of the cell membrane of the cells exposed to the stress. 46. An assay comprising contacting the pluripotent cells produced by the method according to any one of items 1 to 45 with a candidate agent. 47. The assay according to item 46, for use in identifying an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells. 48. Use of pluripotent cells produced by the method according to any one of items 1 to 45 in a method of cell therapy for a subject. 49. A method of preparing a cell or tissue that is compatible with a cell therapy to be administered to a subject, comprising: including the step of generating pluripotent cells from the cells according to any one of items 1 to 45; The method, wherein the cells are autologous cells or HLA-matched allogeneic cells. 50. The method according to item 49, further comprising the step of differentiating the pluripotent cells along a predefined cell lineage before administering the cells or tissue to the subject. 51. A composition comprising pluripotent cells, wherein the pluripotent cells are generated from cells by the method according to any one of items 1 to 45. 52. A method of producing pluripotent stem cells, comprising the step of culturing the cells in the presence of adrenocorticotropic hormone (ACTH), 2i, or 3i medium. 53. The method according to claim 52, wherein the cells are cultured in LIF medium containing ACTH. 54. The method according to claim 52 or 53, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. 55. The method according to any one of claims 52 to 54, wherein the cells are cells generated by the method according to any one of claims 1 to 45. 56. The method according to any one of claims 52 to 55, wherein the cells are totipotent cells. 57. The method according to any one of claims 52 to 56, wherein the cells are cultured for at least 3 days in the presence of ACTH, 2i or 3i medium. 58. The method according to any one of claims 52 to 57, wherein the cells are cultured for at least 5 days in the presence of ACTH, 2i or 3i medium. 59. The method according to any one of claims 52 to 58, wherein the cells are cultured for at least 7 days in the presence of ACTH, 2i or 3i medium. 60. After the culturing step, the method according to any one of claims 52 to 59, wherein the cells express a stem cell marker selected from the group consisting of at a detectable level: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5. 61. A method for increasing the self-renewal ability of pluripotent cells, comprising the step of culturing the cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. 62. The method according to claim 61, wherein the cells are cultured in LIF medium containing ACTH. 63. The method according to claim 61 or 62, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. 64. The method according to any one of claims 61 to 63, wherein the cells are cells generated by the method according to any one of claims 1 to 45. 65. The method according to any one of claims 61 to 64, wherein the cells are totipotent cells. 66. The method according to any one of claims 61 to 65, wherein the cells are cultured for at least 3 days in the presence of ACTH, 2i or 3i medium. 67. The method according to any one of items 61 to 66, wherein the cells are cultured for at least 5 days in the presence of ACTH, 2i or 3i medium. 68. The method according to any one of items 61 to 67, wherein the cells are cultured for at least 7 days in the presence of ACTH, 2i or 3i medium. 69. The method according to any one of items 61 to 68, wherein after the culturing step, the cells express a stem cell marker selected from the group consisting of at a detectable level: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5. 70. A method of autologous cell therapy in a subject in need of cell therapy, a. A step of generating pluripotent cells from cells according to any one of items 1 to 45, wherein the cells are obtained from the subject, and b. A step of administering to the subject a composition comprising the pluripotent cells or their differentiated progeny, comprising the method. 71. The method according to item 70, further comprising a step of differentiating the pluripotent cells along a predefined cell lineage before administering the composition to the subject. 72. A method of producing pluripotent cells capable of differentiating into placental cells, comprising culturing the pluripotent cells generated by the method according to any one of items 1 to 45 in the presence of FGF4. 73. The method according to item 72, wherein the concentration of FGF4 is 1 nM to 1 μM. 74. The method according to item 72 or 73, wherein the pluripotent cells have the ability to differentiate into embryonic stem cells. In certain embodiments, the following items are provided: (Item 1) A method of generating pluripotent cells comprising a step of subjecting the cells to stress. (Item 2) The method according to item 1, wherein the pluripotent cells are generated without introduction of foreign genes, transcripts, proteins, nuclear components or cytoplasm, or without cell fusion. (Item 3) The method according to item 1 or 2, further comprising a step of selecting cells exhibiting pluripotency. (Item 4) The method according to any one of Items 1 to 3, wherein the cells do not exist as parts of tissues. (Item 5) The method according to any one of Items 1 to 4, wherein the cells are somatic cells, stem cells, progenitor cells or embryonic cells. (Item 6) The method according to any one of Items 1 to 5, wherein the cells are isolated cells. (Item 7) The method according to any one of Items 1 to 6, wherein the cells exist in a heterogeneous population of cells. (Item 8) The method according to any one of Items 1 to 7, wherein the cells exist in a homogeneous population of cells. (Item 9) The method according to any one of Items 1 to 8, wherein the step of selecting cells showing pluripotency includes selecting cells expressing a stem cell marker. (Item 10) The method according to Item 9, wherein the stem cell marker is selected from the group consisting of: Oct4; Nanog; E-cadherin, and SSEA4. (Item 11) The method according to any one of Items 1 to 10, wherein the step of selecting cells showing pluripotency includes selecting non-adherent cells. (Item 12) The method according to any one of Items 1 to 11, wherein the stress includes non-physiological stress in a tissue or cell culture. (Item 13) The method according to any one of Items 1 to 12, wherein the stress includes exposure of cells to at least one environmental stimulus selected from the following: trauma, mechanical stimulus, chemical exposure, ultrasonic stimulus, oxygen deficiency, irradiation, exposure to extreme temperature, dissociation, trituration, physical stress, high osmotic pressure, low osmotic pressure, membrane damage, toxin, extreme ion concentration, reactive oxygen species, UV exposure, strong visible light, lack of essential nutrients, or non-physiological acidic environment. (Item 14) The method according to any one of Items 1 to 13, wherein the stress includes exposing the cells to a pH of about 3.0 to about 6.8. (Item 15) The method according to any one of Items 1 to 4, comprising exposing cells to a pH where the stress is from about 4.5 to about 6.0. (Item 16) The method according to Item 15, comprising exposing cells to a pH where the stress is from about 5.4 to about 5.8. (Item 17) The method according to any one of Items 12 to 16, wherein the cells are exposed for 2 to 3 days. (Item 18) The method according to any one of Items 12 to 17, wherein the cells are exposed for 1 day or less. (Item 19) The method according to any one of Items 12 to 18, wherein the cells are exposed for 1 hour or less. (Item 20) The method according to any one of Items 12 to 19, wherein the cells are exposed for about 30 minutes. (Item 21) The method according to Item 13, wherein exposure to extreme temperature comprises exposing cells to a temperature below 35°C or above 42°C. (Item 22) The method according to Item 21, wherein exposure to extreme temperature comprises exposing cells to a temperature below freezing or at least about 85°C. (Item 23) The method according to Item 13, wherein mechanical stimulation comprises exposing cells to shear stress and / or high pressure. (Item 24) The method according to Item 23, wherein mechanical stimulation comprises passing cells through at least one device having an opening smaller than the size of the cells. (Item 25) The method according to Item 23, wherein mechanical stimulation comprises passing cells through several devices having progressively smaller openings. (Item 26) The method according to any one of Items 1 to 25, further comprising culturing pluripotent cells to proliferate the pluripotent cells. (Item 27) The method according to any one of items 1 to 26, wherein the pluripotent cells express a stem cell marker. (Item 28) The method according to item 27, wherein the stem cell marker is selected from the group consisting of: Oct4; Nanog; E-cadherin, and SSEA4. (Item 29) The method according to any one of items 1 to 28, wherein the cells are mammalian cells. (Item 30) The method according to any one of items 1 to 29, wherein the cells are human cells. (Item 31) The method according to any one of items 1 to 30, wherein the cells are adult cells, neonatal cells, fetal cells, amniotic fluid cells, or umbilical cord blood cells. (Item 32) The method according to any one of items 1 to 31, further comprising the step of maintaining the pluripotent cells in vitro. (Item 33) The method according to any one of items 1 to 32, wherein the epigenetic state of the cells is changed to be closer to the epigenetic state of embryonic stem cells. (Item 34) The method according to item 33, wherein the epigenetic state includes a methylation pattern. (Item 35) The method according to any one of items 1 to 34, wherein the stress includes removing at least about 40% of the cytoplasm from the cells. (Item 36) The method according to item 35, wherein at least about 50% of the cytoplasm is removed from the cells. (Item 37) The method according to item 36, wherein at least about 60% of the cytoplasm is removed from the cells. (Item 38) The method according to item 37, wherein 60 to 80% of the cytoplasm is removed from the cells. (Item 39) The method according to item 37, wherein at least about 80% of the cytoplasm is removed from the cells. (Item 40) The method according to item 39, which removes at least about 90% of the cytoplasm from the cell. (Item 41) The method according to any one of items 1 to 40, wherein the stress comprises removing at least about 40% of the mitochondria from the cell. (Item 42) The method according to item 41, wherein the removal of a part of the cytoplasm comprises removing at least about 50% of the mitochondria from the cytoplasm. (Item 43) The method according to item 42, wherein the removal of the cytoplasm or mitochondria comprises removing about 50% to 90% of the mitochondria from the cytoplasm. (Item 44) The method according to item 42, wherein the removal of the cytoplasm or mitochondria comprises removing more than 90% of the mitochondria from the cytoplasm. (Item 45) The method according to any one of items 1 to 44, wherein the stress is sufficient to disrupt at least 10% of the cell membrane of the cells exposed to the stress. (Item 46) An assay comprising contacting the pluripotent cells produced by the method according to any one of items 1 to 45 with a candidate agent. (Item 47) The assay according to item 46, for use in identifying an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells. (Item 48) Use of the pluripotent cells produced by the method according to any one of items 1 to 45 in a method of cell therapy for a subject. (Item 49) A method for preparing a cell or tissue that is compatible with a cell therapy to be administered to a subject, comprising: a step of generating pluripotent cells from the cells according to any one of items 1 to 45; The method, wherein the cells are autologous cells or HLA-matched allogeneic cells. (Item 50) The method according to item 49, further comprising a step of differentiating the pluripotent cells along a predefined cell lineage before administering the cells or tissue to the subject. (Item 51) A composition comprising pluripotent cells, wherein the pluripotent cells are generated from cells by the method according to any one of Items 1 to 45. (Item 52) A method for producing pluripotent stem cells, comprising the step of culturing cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. (Item 53) The method according to Item 52, wherein the cells are cultured in LIF medium containing ACTH. (Item 54) The method according to Item 52 or 53, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. (Item 55) The method according to any one of Items 52 to 54, wherein the cells are cells generated by the method according to any one of Items 1 to 45. (Item 56) The method according to any one of Items 52 to 55, wherein the cells are totipotent cells. (Item 57) The method according to any one of Items 52 to 56, wherein the cells are cultured for at least 3 days in the presence of ACTH, 2i or 3i medium. (Item 58) The method according to any one of Items 52 to 57, wherein the cells are cultured for at least 5 days in the presence of ACTH, 2i or 3i medium. (Item 59) The method according to any one of Items 52 to 58, wherein the cells are cultured for at least 7 days in the presence of ACTH, 2i or 3i medium. (Item 60) After the step of culturing, the method according to any one of Items 52 to 59, wherein the cells express a stem cell marker selected from the group consisting of the following at a detectable level: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5. (Item 61) A method for increasing the self-renewal ability of pluripotent cells, comprising the step of culturing cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. (Item 62) The method according to item 61, wherein the cells are cultured in an LIF medium containing ACTH. (Item 63) The method according to item 61 or 62, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. (Item 64) The method according to any one of items 61 to 63, wherein the cells are cells generated by the method according to any one of items 1 to 45. (Item 65) The method according to any one of items 61 to 64, wherein the cells are totipotent cells. (Item 66) The method according to any one of items 61 to 65, wherein the cells are cultured for at least 3 days in the presence of ACTH, 2i or 3i medium. (Item 67) The method according to any one of items 61 to 66, wherein the cells are cultured for at least 5 days in the presence of ACTH, 2i or 3i medium. (Item 68) The method according to any one of items 61 to 67, wherein the cells are cultured for at least 7 days in the presence of ACTH, 2i or 3i medium. (Item 69) After the culturing step, the method according to any one of items 61 to 68, wherein the cells express a stem cell marker selected from the group consisting of: Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-β; Tbx3; and Klf5. (Item 70) A method of autologous cell therapy in a subject in need of cell therapy, comprising: a. A step of generating pluripotent cells from cells according to any one of items 1 to 45, wherein the cells are obtained from the subject; and b. A step of administering to the subject a composition comprising the pluripotent cells or their differentiated progeny. A method comprising the above steps. (Item 71) The method according to item 70, further comprising the step of differentiating pluripotent cells along a predefined cell lineage before administering the composition to the subject. (Item 72) A method for producing pluripotent cells having the ability to differentiate into placental cells, the method comprising culturing the pluripotent cells generated by the method according to any one of items 1 to 45 in the presence of FGF4. (Item 73) The method according to item 72, wherein the concentration of FGF4 is 1 nM to 1 μM. (Item 74) The method according to item 72 or 73, wherein the pluripotent cells have the ability to differentiate into embryonic stem cells.

Example

[0147] Example 1 All organisms possess primitive survival instincts. When plants are subjected to severe external stress, they activate mechanisms for survival that cause dedifferentiation of cells and enable regeneration of damaged areas or the entire organism. Such mechanisms seem to be important for lower organisms to survive extreme environmental changes, but they have not yet been proven in mammals.

[0148] The inventors hypothesized that physical stress could revert mature mammalian cells to a stem cell-like state similar to that seen in plants and lower organisms. To test this hypothesis, mature cells obtained from seven adult somatic tissues were studied. First, CD45-positive lymphocytes recovered from Oct4-GFP mice were studied to focus on which physical stress might be most effective in changing mature cells and reverting them to a less mature state. Cells from this mouse provide a readout of reversion to the stem cell phenotype when the stem cell-specific Oct4 promoter is activated. Mature and fully differentiated cells were exposed to several major external stimuli.

[0149] For example, CD45-positive lymphocytes were exposed to a low pH solution to provide strong chemical stress. Within 3 days of the exposure, GFP-expressing cells were observed, and within 5 days, spherical colonies composed of GFP-expressing cells were observed. The cells thus generated are referred to in this example as StressAltered Stem Cells (SASC or SAC). SAC can also be referred to as Rejuvenated Stem Cells (RSC) or animal callus cells (ACC). SAC expressed several markers normally associated with embryonic stem cells. SAC exhibited differentiation ability equivalent to that of ES cells, contributed to the generation of chimeric mice, and had the ability to generate an entire fetus when injected into 4N blastocysts. The cells thus generated initially showed low mitochondrial activity and other states normally associated with the induction of a cell-based damage defense mechanism. They then showed demethylation of the Oct4 and Nanog gene promoters. The reprogramming of stress-altered cells appeared to be induced via mesenchymal-epithelial transition. This finding is consistent with the description of cells contained in plant callus in response to damage (external stimuli). Plant callus is formed from the stress-induced conversion of cells with the ability to form clonal bodies into pluripotent plant stem cells. Such spherical colonies, generated from mature and fully differentiated somatic mammalian cells in response to a significant external stimulus, are referred to herein as animal callus, and stress-altered cells contained in such colonies or callus are referred to as "animal callus cells" (ACC) or SAC.

[0150] Thus, severe physical and chemical stresses reprogrammed normal mature somatic cells into pluripotent stem cells with the ability to embryonate. Although not desirably linked to theory, the reprogramming mechanism appears to involve induction of cellular survival and repair processes commonly seen in response to injury. It has been demonstrated herein that mammalian cells possess a survival mechanism very similar to that of plants for reverting to a reprogrammed state in response to severe stressing external stimuli.

[0151] According to what has been reported, various types of cells have been reprogrammed into a pluripotent stem cell state via induction or forced expression of specific genes. 1-5 It is also thought that damage to cells as a result of exposure to stimuli such as burns, chemical injury, trauma and irradiation can change normal cells into cancer cells.

[0152] Various remarks All organisms seem to have a common instinct for surviving damage associated with stressful stimuli by adapting themselves to the environment and regenerating their bodies. In plants, ontogeny is observed not only in zygotes but also in fully differentiated cells and immature pollen. In vertebrates, salamanders have the ability to regenerate several anatomical structures and organs including their limbs. 1 It is particularly noted that the amazing regenerative abilities shown by both plants and salamanders are induced by external stimuli, which cause cellular dedifferentiation of somatic cells that were previously fully differentiated. Although billions of years have passed since the earliest forms of life and various organisms have evolved in their own unique ways, this survival instinct may have been inherited from the common ancestor of modern organisms. Mammalian cells that have finally differentiated are usually thought not to have the ability to reverse the differentiation process, but mammals may possess a previously unrecognized program for avoiding death in response to intense environmental changes.

[0153] Plant callus, which is a mass of proliferating cells formed in response to external stimuli such as wounds, can be stimulated during culture by plant hormones. 2 Callus contains reprogrammed somatic cells called callus cells, each of which has the ability to regenerate the whole body clonally. Callus cells are not originally present in plants but are generated from somatic cells in response to external stimuli. Recent studies have demonstrated that mammalian somatic cells can be reprogrammed by exogenous processes such as gene induction. 3-7 However, reprogramming of mammalian somatic cells in response to external physical and / or chemical stimuli in a manner analogous to that in plants has not been reported. Interestingly, extreme external stimuli such as exposure to irritants including burns, chemical injuries, trauma, and irradiation are thought to be able to change normal somatic cells into cancer cells. Such experiences seem to indicate that external stimuli can bring about cell changes in mammals.

[0154] In this study, it was hypothesized that, similar to plants, mammalian cells possess a mechanism for surviving exposure to critical external stimuli. This report presents evidence that the application of critical physical and chemical stimuli can induce reprogramming of mature, fully differentiated mammalian somatic cells obtained from various tissues, and that such stress-transformed cells have the ability to form animal callus containing "animal callus cells" that can regenerate clonal bodies.

[0155] Results Critical physical and chemical stimuli applied to mature somatic cells. Since the embryonic transcription factor Oct4 is considered to be decisive in regulating the pluripotent state of cells, the first strategy was to identify which external stimuli can most efficiently change mature cells to be reprogrammed to express Oct4. To avoid contamination by undifferentiated cells, first, CD45-positive hematopoietic lineage cells were studied. Oct4-GFP (GOF) mice were used. 8CD45-positive cells recovered from the spleen obtained from 2+ were exposed to various severe physical and chemical stimuli. The exposure included the following: osmotic treatment, treatment with severe mechanical trituration, exposure to low pH, application of cell membrane damage using streptolysin O (SLO), exposure to low nutrient, and exposure to low oxygen and high Ca

[0156] concentration. Next, GFP-expressing cells were identified, sorted, and recovered using FACS. The gene expression of Oct4 was confirmed by RT-PCR. Exposure to each of the applied stimuli reprogrammed some of the mature cells to express GFP (Figure 5A). Exposure of mature cells to the chemical stress of low pH and the physical stress of severe mechanical trituration seemed to be the most effective treatments for changing mature cells to express Oct4. To determine the optimal pH for inducing conversion to Oct4-expressing cells, CD45-positive cells were exposed to solutions of varying acidity (pH 4.0 to pH 6.8). Three days after exposure to the acidic solution, the GFP expression of the cells was analyzed using FACS. Acid solutions with pH 5.4 to 5.6 changed the cells most efficiently to express GFP (Figure 5B). As a result, the focus was placed on exposure to low pH as the stress treatment selected for the remaining studies. 9 and ACTH 10 , ES culture conditions, ES-LIF 11 , embryonic neural stem cell culture conditions, B27-LIF 12 and EpiSC culture conditions 13 . Cells were plated in each medium, and GFP-expressing colonies were counted (Figure 5C). Medium B27-LIF seemed to be the most effective in generating GFP-expressing spherical colonies. Therefore, B27-LIF medium was utilized for the culture of the treated cells.

[0157] Stress-treated CD45-positive cells were cultured in B27-LIF medium, and within 5 days, GFP-expressing spherical colonies were observed, while no GFP-expressing colonies were observed in the untreated control (Figure 1A). The spherical colonies grew to approximately 70 μm in diameter over the first 7 days and the spherical colonies could be maintained for an additional 7 days under those culture conditions. The outer shape of the colonies was somewhat distorted (baroque), more resembling the shape of callus seen in botany than a sphere. Therefore, the cell colonies generated by stress treatment were called animal callus (AC). The cultured cells were dissociated and then population analysis was performed using FACS. Analysis revealed that the application of a specific significant stimulus resulted in the generation of stress-altered cells (now called animal callus cells (ACC)) that had not previously existed in the CD45-positive cell population (Figure 1B). The phenotypic changes of CD45-positive cells as a result of stress treatment were observed at the single-cell level. CD45-positive cells did not express GFP, while ACC expressed GFP, accompanied by a decrease in the expression of CD45 (data not shown). Examination of single cells revealed that the cell size of the treated cells appeared to be smaller than that of the untreated cells. Therefore, the cell size of the ACC population was analyzed by FACS. The cell size of ACC was very small, with 80% of the cells being less than 8 μm in diameter (Figure 1C). To examine the phenotypic changes over time associated with CD45 reduction and Oct4 expression, stress-treated CD45-positive cells were analyzed on days 1, 3, and 7. On day 1, most of the cells still expressed CD45 but did not express Oct4. On day 3, the marker expression had shifted to indicate CD45-negative cells or CD45-negative / Oct4-positive (faint) cells.

[0158] On day 7, CD45 expression had disappeared and Oct4-expressing cells were observed (Figure 1D). Notably, during the first 7 days of culture, the number of PI-positive cells (dead cells) gradually increased (data not shown). This suggests that the stress treatment and culture conditions gradually changed the characteristics of the cells and selected for cells that successfully changed to express Oct4. ​

[0159] Characterization of ACC. To confirm somatic cell reprogramming as a result of exposure to extreme stimuli, the expression of early embryonic development marker genes in ACC was examined. ES cells were used in the following experiments as a positive control for early embryonic development. Marker expression and DNA methylation were characterized as follows: On day 7, immunofluorescence staining showed that the spherical colonies containing ACC uniformly expressed the pluripotent cell markers E-cadherin antigen, Nanog, SSEA-1, PCAM-1, and AP, and were Oct4-GFP positive (data not shown). Gene expression analysis showed that ACC and ES cells expressed comparable levels of Oct4, Nanog, Sox2, Ecat1, Esg1, Dax1, Fgf5, Klf4, and Rex1 genes, while primary CD45-positive cells did not (Figure 2A). The gene expression of ES-specific genes in ACC reached a peak on day 7 (Figure 2A). Bisulfite sequencing was performed to determine the methylation status of the Oct4 and Nanog gene promoters in ACC. Both natural and cultured lymphocyte control samples showed extensive methylation of both promoters, while ACC showed extensive demethylation of these regions, similar to that seen in ES cells (Figure 2B). Therefore, it has been demonstrated that mammalian somatic cells are reprogrammed by external stimuli.

[0160] To determine whether Oct4 gene expression occurs not only in GOF mice but also in wild-type mice as a result of stress treatment of mature cells, CD45-positive lymphocytes were recovered from the spleens obtained from ICR mice. The lymphocytes were then exposed to stress treatment and analyzed using FACS over time up to day 7. An SSEA-1-positive / E-cadherin-positive cell population was seen in the stress-treated group, but SSEA-1 / E-cadherin expression was not observed in the non-stress-treated control group (Figure 6A). These double-positive cells expressed Oct4 gene expression, which was confirmed by RT-PCR (Figure 6B). These results demonstrated that as a result of stress treatment, ACCs, which are Oct4-positive and express pluripotency markers, were generated from CD45-positive cells regardless of the mouse strain.

[0161] These results mean that mature, fully differentiated adult somatic cells have reverted to "stem cellness" as a result of stress treatment.

[0162] To evaluate the stem cellness of ACCs, their self-renewal ability and their differentiation ability were examined. To study their self-renewal ability, ACC colonies derived from previously mature CD45-positive lymphocytes were dissociated into single cells and plated at 1 cell per well in 96-well plates to generate clonally derived populations. Ten days after plating, spherical colonies were seen in 4 out of 96 wells. The doubling time of ACCs varied from well to well. Some divided in 12 - 16 hours and others divided in 30 - 34 hours. ACCs were passaged at least 5 times and continuous expression of Oct4 was observed. As a result, ACCs showed the ability of self-renewal and the ability to differentiate into cells from all three germ layers in vitro.

[0163] The ACs derived from mature GOF lymphocytes were dissociated into single cells again, sorted to contain only the population of cells expressing GFP, and then cultured in a differentiation medium. 14 to 21 days after plating, the cells expressed the ectodermal markers βIII-tubulin and GFAP, the mesodermal marker α-smooth muscle actin, and the endoderm-like markers α-fetoprotein and cytokeratin 7 (data not shown). Therefore, the ACCs differentiated into cells representing the three germ layers in vitro.

[0164] Stress changes in mature somatic cells obtained from various adult tissues. To examine whether ACCs can be generated from not only mature lymphocytes but also other types of somatic cells, the brain, skin, muscle, fat, bone marrow, lung, and liver were recovered from Oct4-GFP (GOF) mice 8 Cells were isolated from tissue samples, dissociated into single cells, and treated under various physical and / or chemical stress conditions. The efficiency of the process of changing the cells varied depending on both the source of the cells and the stress conditions to which the cells were exposed (Figure 7A). The ability of stress to change mature cells to express Oct4 differed depending on the origin of the cells, but the stress was able to change the cells to express Oct4 to some extent in mature cells derived from all three germ layers (Figure 7A). ACC colonies derived from any mature tissue expressed the pluripotency markers E-cadherin, Nanog, PCAM-1, and AP (data not shown), as well as ES-specific marker genes (Figure 7B). Regardless of the source of the tissue and the origin of the germ layer, significant physical and chemical stress changed mature somatic cells to revert to a stem cell state.

[0165] Cell modification at the initial stage of ACC generation. These results demonstrate that strong physical and chemical stimuli result in the reprogramming of somatic cells. It was observed that stress-treated lymphocytes formed ACs within 5 days. It was hypothesized that a strong change in molecular events occurred as a result of stress exposure. Therefore, the research was focused on the initial stage of reprogramming, which is the first 7 days after exposure to the stimulus.

[0166] Since ACC survived after significant stress exposure, it was hypothesized that survival mechanisms, which are normally turned on to repair cell damage, were induced during ACC generation. First, stress and DNA repair 14 The expression of several candidate genes involved in the cellular response to stress and DNA repair was compared in native CD45+ cells and stress-treated CD45+ cells on days 1, 3, and 7. Analysis of a mixture of ACC-generating cells and other cells revealed that cellular response gene expression was already observed on day 1, and these genes were upregulated over 7 days (Figure 8). Since the upregulation of cellular response genes correlated with ACC generation, ACC was sorted on days 3 and 7, and gene expression was analyzed. All candidate genes except Hif3a were upregulated to varying degrees during ACC generation (Figure 3A). Four heat shock genes and one DNA repair gene were found to be upregulated during ACC generation. Furthermore, 7 of the upregulated genes are known to be directly involved in regulating the cellular redox state. These results suggested that the ability of self-repair or self-defense was induced during ACC generation.

[0167] Since ACC showed upregulation of genes related to cellular redox, the mitochondrial function of ACC was then examined. Mitochondria are organelles that are responsible for the majority of ATP production via redox reactions using oxygen within eukaryotic cells. GFP expression in ACC spherical colonies gradually decreased from the cells located at the periphery 7 days after culturing the colonies without passage. The ACC on day 10 contained central cells expressing GFP and differentiated peripheral cells that did not express GFP (data not shown). The morphology of mitochondria was examined in ACC and also It was evaluated in differentiated cells. ACC mitochondria had depressions and were observed as perinuclear clusters that looked spherical, while differentiated cells were fibrous and contained many mitochondria that were widely spread in the cytoplasm. The ATP production of ACC was less than that in native CD45-positive cells (Figure 3B). Also, the reactive oxygen species (ROS) production of ACC was less than that in native CD45-positive cells (Figure 3C). Finally, key factors involved in mtDNA replication were evaluated; these were mitochondrial transcription factor A (Tfam), mitochondrial-specific DNA polymerase γ (Polg), and its accessory subunit (Polg2). The gene expression of Tfam, Polg, and Polg2 in ACC was lower than that in differentiated cells (Figure 3D). As a result, ACC contained a small number of mitochondria, and the mitochondrial activity of ACC was lower than that of differentiated cells. These results meant that ACC had acquired a metabolic system different from that of differentiated cells in order to survive after a severe stress response.

[0168] The developmental ability of ACC: Finally, it was evaluated whether ACC possessed a developmental ability similar to that of plant callus cells. As a first test for developmental ability, ACC transplanted subcutaneously into immunodeficient (SCID) mice was studied. Six weeks after transplantation, ACC generated tissues representing all three germ layers (data not shown).

[0169] ACC differentiated into cells representing all three germ layers both in vivo and in vitro. Therefore, the chimeric contribution ability of ACC was evaluated. ACC for use in chimeric generation studies was prepared using F1 GFP (C57BL / 6GFP × DBA / 2 or 129 / SvGFP × C57BL / 6GFP) or CD45-positive cells derived from GOF. Gene expression analysis revealed that ACC expressed the highest levels of pluripotency marker genes on day 7, so day 7 ACC was utilized for chimeric mouse generation studies. First, the conventional method for chimeric generation was utilized. AC was dissociated into single cells via trypsin treatment. Subsequently, ACC was injected into blastocysts (Figure 4A). Using this approach, the chimeric contribution of dissociated ACC was very low (Table 1). Therefore, ACC without prior trypsin treatment (which often causes cell damage 15 ) was injected into blastocysts. Using a microknife under a microscope, AC was cut into small clusters. Subsequently, small clusters of AC were injected into blastocysts (Figure 4A). Using this approach, the chimeric contribution of ACC increased dramatically (data not shown). Chimeric mice generated using ACC grew normally (data not shown), and germline transmission was observed. The chimeric contribution rate of each tissue was analyzed by FACS. The results showed that lymphocyte-derived ACC contributed to all tissues (Figure 4B).

[0170] As demonstrated above, ACC can be generated from various cells derived from all three germ layers (Figs. 7A - 7B). To examine whether ACCs from various tissues have different differentiation tendencies, ACCs were generated from various tissues of F1 GFP mice and injected into ICR blastocysts. Subsequently, FACS was used to analyze the contribution rate of each tissue in the generated chimeric mice. It was found that ACCs from any tissue contributed to the generation of chimeric mice (Fig. 9). Furthermore, the contribution rates to the skin, brain, muscle, fat, liver, and lung were analyzed in chimeric mice generated using ACCs from various tissues. ACCs from any tissue contributed to the generation of tissues representing all three germ layers, and no differentiation tendency was observed (Fig. 9).

[0171] The generation of mice by tetraploid complementation, which involves the injection of pluripotent cells into 4N host blastocysts, represents the most stringent test for developmental potential because the resulting embryos are derived only from the injected donor cells. 16 ACC was generated from lymphocytes from DBA×B6GFP Fl mice or 129 / SvGFP×B6GFP Fl. Injection of ACC into 4N blastocysts resulted in the generation of (mid) late gastrula stage "all - ACC embryos" (data not shown). Genotyping analysis demonstrated that the "all - ACC embryos" had the specific genes of the strain used to generate the ACC. Thus, ACC possessed the ability to generate clones, just like plant callus cells.

[0172] Discussion Mammalian somatic cells show the ability to form animal callus (AC) as a result of exposure to significant external stimuli in a manner very similar to plants. The cells contained in these calluses (animal callus cells, ACC) have the ability to generate chimeric mice and new embryos consisting only of cells completely generated from ACC. The results described herein demonstrate that mammalian somatic cells regain the ability to differentiate into any of the three germ layers by external stimuli. This means that somatic cells have greater flexibility than previously thought. Furthermore, this study demonstrates the possibility of somatic cell reprogramming without gene induction or introduction of foreign proteins, and provides new insights into the potential of adult stem cells; it represents a major milestone in the elucidation of stem cell biology.

[0173] Materials and Methods Tissue collection and cell culture. For the isolation of mature lymphocytes, spleens from GOF mice or ICR mice were minced with scissors and mechanically dissociated using a Pasteur pipette. The dissociated spleens were drawn through a cell strainer (BD Biosciences, San Jose). The collected cells were resuspended in DMEM medium and the same volume of lympholyte (CEDARLANE®,[ Ontario, Canada) was added, followed by centrifugation at 1000 g for 15 minutes. The lymphocyte layer was removed and obtained using a CD45 antibody (ab25603, abcam, Cambridge, MA). CD 45-positive cells were sorted by FACS Aria (BD Biosciences). Then, the CD45-positive cells were treated with a stress treatment (pH 5.5 solution, 15 minutes) and plated in B27 medium supplemented with 1000 U LIF (Sigma) and 10 ng / ml FGF2 (Sigma).

[0174] Exposure to external stimuli - stress treatment. To apply mechanical stress to mature cells, a Pasteur pipette was heated and then stretched to create a lumen with a diameter of approximately 50 microns and then cut. Mature somatic cells were then triturated through these pipettes for 20 minutes and then cultured for 7 days. To apply hypoxia stimulation to mature cells, the cells were cultured in a 5% oxygen incubator for 3 weeks. Nutrient deprivation stimulation was applied to mature cells by culturing the cells in basal culture medium for 3 weeks. To expose mature cells to physiological stress, the cells were treated with a low pH (pH 5.5) solution and then cultured for 7 days. Also, significant damage was inflicted on the cells. To create pores in the mature cell membrane, the cells were treated with SLO (streptolysin O).

[0175] SLO-treated cells were incubated in HBSS containing 10 μg / ml SLO at 37 °C for 50 minutes and then cultured in culture medium without SLO for 7 days. Cells exposed to nutrient deprivation stress were cultured in basal medium for 2 - 3 weeks. Cells exposed to "ATP" stress were incubated in HBSS containing 2.4 mM ATP at 37 °C for 15 minutes and then cultured in culture medium for 7 days. Cells exposed to "Ca" stress were cultured in culture medium containing 2 mM CaCl2 for 2 weeks.

[0176] Bisulfite sequencing. Cells obtained from GOF mice were dissociated into single cells. GFP-positive cells were collected by using FACS Aria. Genomic DNA was extracted from ACC and examined. Bisulfite treatment of DNA was performed using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA, http: / / www.chemicon.com) according to the manufacturer's instructions. The obtained modified DNA was amplified by nested polymerase chain reaction PCR using two forward (F) primers and one reverse (R) primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT (SEQ ID NO: 1); F2, ATGGGTTGAAATATTGGGTTTATTTA (SEQ ID NO: 2); R, CCACCCTCTAACCTTAACCTCTAAC (SEQ ID NO: 3)) and Nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT (SEQ ID NO: 4); F2, AATGTTTATGGTGGATTTTGTAGGT (SEQ ID NO: 5); R, CCCACACTCATATCAATATAATAAC (SEQ ID NO: 6)). PCR was performed using TaKaRaEx Taq Hot Start Version (RR030A). DNA - sequencing was performed using M13 primers with the help of GRAS (The Genome Resource and Analysis Unit).

[0177] Immunohistochemistry. Cultured cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% TritonX-100 / PBS before blocking with 1% BSA solution (Life Technology, Tokyo, Japan). Secondary antibodies were goat anti-mouse or rabbit conjugated to Alexa-488 or -594 (Invitrogen). Cell nuclei were visualized using DAPI (Sigma) . Slides were mounted using SlowFade Gold antifade reagent (Invitrogen).

[0178] Fluorescently labeled cell sorting and flow cytometry. Before FACS, cells were prepared according to standard protocols and suspended in 0.1% BSA / PBS on ice. PI (BD Biosciences) was used to exclude dead cells. Cells were sorted on a BD FACSAria SORP and analyzed on a BD LSRII using BD FACSDiva Software (BD Biosciences).

[0179] RNA preparation and RT-PCR analysis. RNA was isolated using the RNeasy Micro kit (QIAGEN). Reverse transcription was performed using the SuperScript III First-Strand Synthesis kit (Invitrogen). SYBR Green Mix I (Roche Diagnostics) was used for amplification, and the samples were run on a Lightcycler-II Instrument (Roche Diagnostics). The samples were run on a Lightcycler-II Instrument (Roche Diagnostics).

[0180] Animal studies. For tumorigenicity studies, cells suspended in 100 μl PBS were subcutaneously injected into the flanks of age-matched immunodeficient SCID mice. Mice were sacrificed and necropsied after 6 weeks.

[0181] ATP and ROS assays. Intracellular ATP levels were measured by the ATP Bioluminescence Assay Kit HS II (Roche) according to the supplier's protocol. Luminescence intensity was measured by using a Gelomax96 Microplate Luminometer (Promega, Madison, WI), and The luminescence readings were normalized by cell counting. For the measurement of ROS levels, cells were incubated in the dark for 15 minutes at 37 °C in medium containing 2 μM dihydroethidium (Molecular Probes). The cells were then washed with PBS and suspended in PBS containing 0.5% BSA. The fluorescence intensity of 30,000 cells was recorded with the aid of a BDBiosciences LSR II (BD Bioscience, Spark, MD).

[0182] Generation and analysis of chimeric mice. Generation of diploid and tetraploid chimeras. Diploid embryos were obtained from ICR strain females mated with ICR males, and tetraploid embryos were obtained from BDF1 strain females mated with BDF1 males. Tetraploid embryos were generated by electrofusion of two-cell embryos. 17 In this study, since trypsin treatment caused low chimerism, ACC globular colonies were cut into small pieces using a microknife under a microscope, and then small clusters of ACC were injected into blastocysts on day 4.5 by a large pipette. The next day, chimeric blastocysts were transferred into pseudopregnant females on day 2.5.

[0183] References 1. Brockes, J. P. & Kumar, A. Plasticity and reprogramming of differentiated cells in amphibian regeneration. Nature reviews. Molecular cell biology 3, 566 - 574, doi:10.1038 / nrm881 (2002). 2. Sinnott, J. J. & Burklund, C. W. The treatment of carotid insufficiency. The Nebraska state medical journal 45, 357 - 359 (1960). 3. Hanna, J. et al. Direct reprogramming of terminally differentiated mature Blymphocytes to pluripotency. Cell 133, 250-264, doi:10.1016 / j.cell.2008.03.028(2008). 4. Hockemeyer, D. et al. A drug-inducible system for direct reprogramming ofhuman somatic cells to pluripotency. Cell stem cell 3, 346-353,doi:10.1016 / j.stem.2008.08.014 (2008). 5. Kim, D. et al. Generation of human induced pluripotent stem cells by directdelivery of reprogramming proteins. Cell stem cell 4, 472-476,doi:10.1016 / j.stem.2009.05.005 (2009). 6. Kim, J. B. et al. Direct reprogramming of human neural stem cells by OCT4.Nature 461, 649-643, doi:10.1038 / nature08436 (2009). 7. Okabe, M. et al. Definitive proof for direct reprogramming of hematopoieticcells to pluripotency. Blood 114, 1764-1767, doi:10.1182 / blood-2009-02-203695(2009). 8. Ohbo, K. et al. Identification and characterization of stem cells in prepubertal spermatogenesis in mice small star, filled. Developmental biology 258, 209-225 (2003). 9. Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453, 519-523, doi:10.1038 / nature06968 (2008). 10. Ogawa, K., Matsui, H., Ohtsuka, S. & Niwa, H. A novel mechanism for regulating clonal propagation of mouse ES cells. Genes to cells : devoted to molecular & cellular mechanisms 9, 471-477, doi:10.1111 / j.1356-9597.2004.00736.x (2004). 11. Gough, N. M. et al. LIF: a molecule with divergent actions on myeloid leukaemic cells and embryonic stem cells. Reproduction, fertility, and development 1, 281-288 (1989). 12. Hitoshi, S. et al. Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes & development 18, 1806-1811, doi:10.1101 / gad.1208404(2004). 13. Tesar, P. J. et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448, 196-199, doi:10.1038 / nature05972 (2007). 14. Saretzki, G., Armstrong, L., Leake, A., Lako, M. & von Zglinicki, T. Stress defense in murine embryonic stem cells is superior to that of various differentiated murine cells. Stem Cells 22, 962-971, doi:10.1634 / stemcells.22-6-962 (2004). 15. Mitalipova, M. M. et al. Preserving the genetic integrity of human embryonic stem cells. Nature biotechnology 23, 19-20, doi:10.1038 / nbt0105-19 (2005). 16. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J. C. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 90, 8424-8428 (1993). 17. Nagy, A. et al. Embryonic stem cells alone are able to support fetal development in the mouse. Development 110, 815-821 (1990).

[0184] [Table 1]

[0185] [Table 2]

[0186] [Table 3]

[0187] Example 2: Inducible Fate Conversion of Somatic Cells to Pluripotency Described herein is "Stimulus-triggered Acquisition of Pluripotency" (STAP), a phenomenon for nuclear reprogramming in which strong external stimuli can fully reprogram mammalian somatic cells into pluripotent cells without the use of nuclear transfer or introduction of transcription factors. In the presence of LIF, transient low pH stress induces the expression of pluripotent cell markers such as Oct3 / 4 and causes the dedifferentiation of CD45 + hematopoietic cells. In these STAP cells, substantial demethylation is seen in the oct3 / 4 and nanog promoter regions, similar to ES cells. STAP cells derived from hematopoietic cells carry gene rearrangement in the T cell receptor, indicating that committed somatic cells can give rise to STAP cells by lineage conversion. Blastocyst injection shows that STAP cells can efficiently contribute to chimeras, even in a tetraploid complementation assay, and contribute to offspring via germline transmission. Therefore, the epigenetic state of cell fate determination can be completely reset in a context-dependent manner by strong environmental cues.

[0188] In the canalization review of Waddington's epigenetic landscape, the fate of somatic cells is progressively determined as cell differentiation proceeds downward. Reversal of the differentiated cell state generally requires artificial, physical, or genetic manipulation of its nuclear function, such as 1 nuclear transplantation 2 and multiple transcription factor introduction. Without these direct nuclear manipulations, it remains unanswered whether somatic cells can undergo re-initialization of their nuclear programs simply in response to external triggers. Such situations are known to occur in plants; drastic changes in the culture environment can convert the fate of mature somatic cells (e.g., dissociated carrot cells) into immature bud somatic cells from which an entire plant structure including shoots and roots develops in the presence of auxin. Whether animal somatic cells can have a similar ability, at least under special conditions, is a challenging question. Over the past decade, the existence of pluripotent cells (or closely related cell types) in adult tissues has been a controversial issue, and conflicting conclusions have been reported by various groups. However, none of them have demonstrated that such pluripotent cells can arise from differentiated somatic cells.

[0189] CD45 (leukocyte common antigen)-positive hematopoietic cells are typical lineage-directed somatic cells often used as starting cell types for reprogramming research such as the induction of iPS cells. They do not express pluripotency-related markers such as Oct3 / 4 unless reprogrammed. In particular, most of the CD45 + cells derived from spleen tissue are thought to be non-stem leukocyte populations (maturing cells or progenitor cells), and the conversion of iPS cells from lymphocytes carrying genomic rearrangement of the T cell receptor β-chain (tcrβ) gene is regarded as a true proof of reprogramming from lineage-directed somatic cells. Therefore, the inventors used spleen CD45 +I became interested in the question of whether cells could be converted to acquire pluripotency by strong changes in the external environment, such as those caused by simple chemical perturbations.

[0190] Results Low pH treatment induced fate conversion in directed somatic cells. CD45 cells were recovered from adult spleens obtained from oct3 / 4::gfp B6 mice 15 and exposed to various types of strong transient stimuli, including physical and chemical ones. After floating culture for several days using LIF-containing B27 medium, the activation of the oct3 / 4 promoter was examined. Among these various perturbations, low pH perturbation was focused on. As shown below, this type of perturbation was found to be the most effective for oct3 / 4 induction. + Without exposure to the stimulus, none of the cells sorted by CD45 expressed oct3 / 4::GFP, regardless of the culture period in LIF-containing medium that allowed the survival of the sorted cells. In contrast, treatment of spleen CD45

[0191] cells with low pH medium (pH 4.5 - 6.0; Figure 12A) for 30 minutes resulted in the appearance of a substantial number of oct3 / 4::GFP + cells in the culture on day 7 (d7) (Figure 12B; the most effective range was pH 5.4 - 5.8; Figure 16B). These cells continued to express oct3 / 4::GFP for at least another 7 days (a total of 14 days) without subculture. At d7 of this non-adherent culture, low pH-induced oct3 / 4::GFP + cells formed spherical (or slightly distorted) clusters (data not shown; consisting of several to dozens of cells), and they no longer expressed CD45 (Figure 12C). Interestingly, the cell size of low pH-induced oct3 / 4::GFP + cells was smaller than that of untreated CD45 + cells. +Substantially smaller than the cell size of the cells (see immunostaining of oct3 / 4::GFP and CD45 in single cells; Fig. 12C); when evaluated by forward scatter analysis in FACS, 80% of said cells are less than 8 μm in diameter, while control CD45 + cells were in the range of 8 - 10 μm (Fig. 12D (the left peak indicates Oct3 / 4::GFP + cells, and the right peak indicates CD45 + cells)). These observations suggest a dramatic change between the oct3 / 4::GFP + and CD45 + populations other than the difference in the expression of the two markers.

[0192] Time-course analysis (Fig. 12C) showed dynamic changes in the cell population between d1 and d3. Most of the viable cells at d1 (the number of viable cells corresponded to about 85% of the d0 population) were still CD45 + and oct3 / 4::GFP - . At d2 and d3, substantial populations of the total viable cells (21% and 34% respectively) became oct3 / 4::GFP + , and were faint for CD45 (Fig. 12C; about 50 - 60% of the plated cells had been lost by then). At d7, a significant number of oct3 / 4::GFP + / CD45 - cells (54% of the total viable cells) formed a population different from that of oct3 / 4::GFP - / CD45 - (Fig. 12B, top; the total cell number at d7 was the same as that at d3). The distinct generation of the oct3 / 4::GFP + / CD45 - population was not seen in cultures of untreated CD45 + cells (Fig. 12B, bottom). Thus, the number of the oct3 / 4::GFP + / CD45 - population in the low pH treatment group was sufficiently substantial and corresponded to about half of the total viable cells at d7. In fact, when the oct3 / 4::GFP signal first appeared at d2, GFP +The number of cells corresponded to approximately 8% of the initially plated CD45 + cells. Therefore, over the first two days after low pH treatment, it is unlikely that a very small population (e.g., contaminating CD45 - cells) rapidly proliferated to form such a substantial oct3 / 4::GFP + population.

[0193] In live imaging analysis (data not shown), low pH-treated CD45 + cells tended to form small clusters (unlike untreated cells), which gradually turned on the GFP signal over the first few days. Subsequently, these small oct3 / 4::GFP + clusters frequently fused by d5 and formed larger spheroids. This indicates that the clusters are polyclonal. Interestingly, these GFP + clusters (unlike GFP - cells) were highly motile and often extended cell protrusions (data not shown).

[0194] To test whether lineage-directed splenic CD45 + cells (particularly the T cell population) contributed to oct3 / 4::GFP + cells, genomic rearrangement of tcrβ was examined by genomic PCR in isolated oct3 / 4::GFP + spheroids, and each spheroid was found to contain cells with tcrβ gene rearrangement (data not shown). To rule out the possibility of detecting rearrangement in contaminating oct3 / 4::GFP - / CD45 + cells, oct3 / 4::GFP + / CD45 - cells were sorted by FACS at d7 and subjected to the tcrβ gene rearrangement assay. Again, tcrβ gene rearrangement was clearly observed (Figure 12E). These findings suggest that lineage-directed somatic cell populations (at least T cells) in splenic cells have their fate determined by CD45+ to oct3 / 4::GFP + By converting to, it was demonstrated that oct3 / 4::GFP + contributed to the cells.

[0195] Low pH-induced Oct3 / 4 + Cells are pluripotent. Next, whether the expression of oct3 / 4::GFP in stimulus-induced cells represents the pluripotent state of these cells or simply represents specific changes in gene expression patterns (in this case, oct3 / 4 and cd45) without acquisition of pluripotency was examined. By immunostaining, the oct3 / 4::GFP of d7 + spheroids were shown to express pluripotency-related markers such as Oct3 / 4, SSEA-1, Nanog, E-cadherin, and AP (data not shown). By gene expression analysis by qPCR, the low pH-induced oct3 / 4::GFP of d7 + cells, unlike CD45 + cells, were shown to express genes of oct3 / 4, nanog, sox2, ecatl, esgl, daxl, and klf4 at levels comparable to those in ES cells (Figure 13A (this series represents the expression of oct3 / 4, nanog, sox2, ecatl, esgl, daxl, and klf4 from left to right); these markers were already positive at d3). This indicates that the low pH-induced oct3 / 4::GFP + cells express a set of true marker genes characteristic of pluripotency that are not expressed in CD45 + cells. + This indicates that the low pH-induced oct3 / 4::GFP cells express a set of true marker genes characteristic of pluripotency that are not expressed in CD45 cells.

[0196] Next, it was tested whether this dramatic change in the gene expression pattern was accompanied by changes in the epigenetic modification of pluripotency-related genes. For this purpose, bisulfite sequencing was performed to examine the methylation status of the oct3 / 4 and nanog promoter regions. CD45 + cells showed highly methylated patterns at both promoters with or without further culture. In contrast, low pH-induced oct3 / 4::GFP+ The cells showed extensive demethylation in these regions, like ES cells (Figure 13B). This demonstrates that the cells have undergone substantial reprogramming of the epigenetic state in these genes important for their pluripotency.

[0197] Next, it was examined whether the low pH-induced cells have the ability to generate derivatives of the three germ layers, which is a common criterion for pluripotent properties. By both in vitro differentiation assays (data not shown) and teratoma formation tests (data not shown), these cells were found to give rise to ectodermal (e.g., β-tubulin III + ), mesodermal (e.g., smooth muscle actin + ), and endodermal ( e.g., alpha-fetoprotein + ) cells.

[0198] In summary, these findings demonstrate that the differentiated state of a directed somatic cell lineage can be converted to a pluripotent cell state by a strong externally applied stimulus. Hereinafter in this specification, the fate conversion of somatic cells to pluripotent cells by a strong external stimulus such as low pH is referred to as "stimulus-triggered acquired pluripotency" (STAP), and the resulting cells are called STAP cells.

[0199] STAP cells from other tissue sources. Another important question about STAP cells is whether the phenomenon of low pH-induced conversion is limited to CD45 + leukocytes. To address this question, similar conversion experiments were performed using somatic cells recovered from the brain, skin, muscle, fat, bone marrow, lung, and liver tissues of oct3 / 4::gfp mice.

[0200] Cells from tissue samples were dissociated into single cells, subjected to transient low pH exposure, and cultured in LIF-containing medium. The conversion efficacy varied among the tissues of their origin, but oct3 / 4::GFP +Cells were reproducibly observed in the d7 culture (Figure 14A (this series represents, from left to right, CD45 + cells, bone marrow, brain, lung, muscle, fat, fibroblasts, liver, and chondrocytes)). Notably, STAP cells were efficiently induced from mesenchymal cells of adipose tissue where CD45 + cells are rare (data not shown), and also from primary cultured cells of chondrocytes. This indicates that non-CD45 + cell populations can give rise to STAP cells. These oct3 / 4::GFP + cell clusters also expressed pluripotency-related markers (Figure 14B (this series represents, from left to right, the expression of Oct3 / 4, Nanog, Sox2, Klf4, and Rex1) and Figure 18B, data not shown) and ES cell-specific marker genes (Figure 14B and Figure 18B).

[0201] Characteristics of STAP cells as pluripotent cells. Thus, STAP cells expressed ES cell-specific genes and showed a similar methylation pattern in the oct3 / 4 and nanog genes. Furthermore, STAP cells could be established in culture media for mouse ES cells such as LIF-containing media, but not in mouse EpiSC media (data not shown).

[0202] However, although STAP cells showed substantial similarity to mouse ES cells, some different characteristics were also found. For example, STAP cells showed limited self-renewal ability. Unlike mouse ES cells (data not shown), when STAP cell spheroids were enzymatically dissociated into single cells for clonal culture in each well of a 96-well plate, no colonies (AP + or oct3 / 4::GFP + ) were formed after further 10-day culture in LIF-containing media (G-MEM-based or B27-based) under either adherent or non-adherent conditions (data not shown). Spherical colony formation was rarely seen (typically in 2 - 4 wells out of 96), and all of these colonies were AP - and oct3 / 4::GFP- This was the case. Even when STAP cell spheroids were partially dissociated and cultured under high cell density conditions (data not shown; presumably more supportive of self-renewal), the cell number began to decline after 2 passages, and oct3 / 4::GFP + cells could not be maintained beyond 5 passages. These characteristics regarding proliferation and maintenance suggest that STAP cells represent a pluripotent cell population whose characteristics are partially different from those of mouse ES and iPS cells.

[0203] Mouse EpiSCs are another category of pluripotent stem cells, which are thought to be at a slightly more advanced differentiation stage. STAP cells seemed to behave differently from EpiSC cells in several aspects. In adherent culture, like mouse ES cells, oct3 / 4::GFP + cells formed hemispherical colonies by piling up, unlike the monolayer flat colonies seen for mouse EpiSCs. Also, STAP cells could not be maintained in EpiSC medium, suggesting that STAP cells are not similar to EpiSCs (data not shown). Furthermore, treatment with a ROCK inhibitor that improves single cell passaging of EpiSCs (reference; Ohgushi) did not promote colony formation from dissociated STAP cells (data not shown).

[0204] Immunostaining showed that STAP cells were negative for Claudin7 and ZO-1, which are EpiSC markers, and positive for Klf2 / 4 (data not shown). The grouping among ES cells, STAP cells, and EpiSCs may not be so simple. Because the expression of Esrrβ, an ES cell marker, was low in both STAP cells and EpiSCs, while elf5 expression was specifically low in STAP cells (Figure 15A (this series represents ES, EpiSC, STAP, and CD45 from left to right)). In the cluster analysis of the whole genome transcriptome, STAP cells were closest to ES cells and had substantial similarity to blastocysts in RNA expression, but the parental CD45+ The most distant from cells (data not shown). The status of X chromosome inactivation in STAP cells was interesting; approximately 40% of female STAP cells (d7) showed inactivated chromosomes, and X chromosome inactivation was cancelled in the remaining (approximately 60%) (Figure 15B).

[0205] These findings raised the possibility that the differentiation state of STAP cells may represent a new metastable pluripotent state that is closely related to but different from ES cells.

[0206] Chimera formation and germline transmission in mice. Finally, the chimera-forming ability of STAP cells was evaluated by blastocyst injection assay. Different from ES cells, when STAP cells (B6 background) were dissociated into single cells and injected into ICR blastocysts, no chimeric mice with dark coat color were born (Table 4). Since it was almost impossible to maintain single STAP cells in vitro, it was inferred that cell dissociation somehow changed its ability. Therefore, STAP cell clusters were manually cut into small pieces using a microknife under a microscope and then injected into blastocysts as a whole (data not shown). Using this technique, chimeric mice were born at a substantial rate and all developed normally (data not shown). Next, the tissue contribution of injected STAP cells generated from CD45 + cells of mice constitutively expressing GFP (F1 of C57BL / 6GFP crossed with DBA / 2 or 129 / Sv) was examined. High to moderate contributions of GFP-expressing cells were seen in chimeric embryos injected with STAP cell clusters (data not shown).

[0207] The contribution rate of GFP + cells in each tissue was analyzed by FACS in these chimeric embryos. CD45 +Cell-derived STAP cells contributed to all tissues examined (data not shown). Furthermore, offspring derived from STAP cells were born in chimeric mice (Table 5). This ability of STAP cells is important and demonstrates the true nature of these pluripotent cells. This is because germline transmission is considered a strict criterion for pluripotency as well as genetic and epigenetic normality. 22 Next, a tetraploid (4N) complementation assay was performed by injecting cells into 4N blastocysts. This is considered the most stringent test for the developmental ability of the injected cells. This is because the resulting embryos are derived only from these donor cells. 23 (Data not shown). When injected into 4N blastocysts, CD45 + cell-derived STAP cells (from DBA×B6GFP or 129 / Sv×B6GFP F1 mice) generated "all GFP + embryos" at E10.5 (data not shown). This demonstrates that STAP cells alone are sufficient to construct the entire embryonic structure.

[0208] Taken together, these findings clearly show that STAP cells have the developmental ability to differentiate into all somatic cells and the germ line in the context of the embryonic environment.

[0209] Discussion The data described herein revealed the surprisingly flexible adaptability potentially possessed by somatic cells. This dynamic adaptability, even to conversion into pluripotent cells, appears when cells are transiently exposed to strong stimuli not normally experienced in their living environment.

[0210] CD45 + The conversion from CD45 cells to STAP cells was not substantially affected by treatment with at least an HDAC inhibitor (e.g., trichostatin A) or 5-aza-cytidine.

[0211] In this specification, it has been demonstrated that the low pH treatment substantially reduced the cell number in the culture. However, in fact, the decrease in viable cells during the first 24 hours is negligible, suggesting that this treatment did not appear to have an acute lethal effect on the majority of the cells. Instead, a delayed cell decrease gradually occurred between d2 and d5. Consistent with this, several genes 21 involved in cellular stress responses and DNA repair + were strongly induced at d3 in oct3 / 4::GFP cells that had experienced low pH, but not in control cells cultured in the same medium, as demonstrated by the data. This suggests that the cells responded to the stimulus as a life-threatening or sublethal stress. Interestingly, their gene expression levels were still higher at d7; therefore, it will be interesting in the future to study the role of stress-induced genes for cell survival (possibly) as well as their possible involvement in the reprogramming process.

[0212] Another unresolved question is whether cell reprogramming can be initiated specifically by the low pH treatment or by some other type of sublethal stress (e.g., physical damage, plasma membrane perforation, osmotic shock, growth factor deprivation, hypoxia, and high Ca 2+ medium exposure). Notably, at least some of them (especially physical damage by severe trituration and membrane perforation by streptolysin O) + induced the generation of oct3 / 4::GFP cells from CD45 + cells (Figure 18A). These findings raise the possibility that specific common regulatory modules underlying these distantly related sublethal stresses act as keys to liberate somatic cells from their tightly locked epigenetic states of differentiation and lead to comprehensive changes in epigenetic regulation. Considering that some oct3 / 4::GFP + cells appeared by d2, such a reprogramming mechanism may start to function within the first two days.

[0213] References 1 Wakayama, T., Perry, A. C., Zuccotti, M., Johnson, K. R. & Yanagimachi, R. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394, 369-374, doi:10.1038 / 28615 (1998). 2 Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676, doi:10.1016 / j.cell.2006.07.024 (2006). 3 Jiang, Y. et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41-49, doi:10.1038 / nature00870 (2002). 4 D'Ippolito, G. et al. Marrow-isolated adult multilineage inducible (MIAMI) cells, a unique population of postnatal young and old human cells with extensive expansion and differentiation potential. Journal of cell science 117, 2971-2981, doi:10.1242 / jcs.01103 (2004). 5 Johnson, J. et al. Oocyte generation in adult mammalian ovaries by putative germ cells in bone marrow and peripheral blood. Cell 122, 303-315, doi:10.1016 / j.cell.2005.06.031 (2005). 6 Kucia, M. et al. A population of very small embryonic-like (VSEL) CXCR4(+) SSEA-1(+) Oct-4+ stem cells identified in adult bone marrow. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K 20, 857-869, doi:10.1038 / sj.leu.2404171 (2006). 7 Kuroda, Y. et al. Unique multipotent cells in adult human mesenchymal cell populations. Proceedings of the National Academy of Sciences of the United States of America 107, 8639-8643, doi:10.1073 / pnas.0911647107 (2010). 8 Obokata, H. et al. The potential of stem cells in adult tissues representative of the three germ layers. Tissue engineering. Part A 17, 607-615, doi:10.1089 / ten.TEA.2010.0385 (2011). 9 Rahnemai-Azar, A. et al. Human marrow-isolated adult multilineage-inducible(MIAMI) cells protect against peripheral vascular ischemia in a mouse model.Cytotherapy 13, 179-192, doi:10.3109 / 14653249.2010.515579 (2011). 10 Huang, Y. et al. Bone marrow transplantation temporarily improves pancreatic function in streptozotocin-induced diabetes: potential involvement of verysmall embryonic-like cells. Transplantation 89, 677-685,doi:10.1097 / TP.0b013e3181c9dc7d (2010). 11 Zuba-Surma, E. K. et al. Transplantation of expanded bone marrow-derivedvery small embryonic-like stem cells (VSEL-SCs) improves left ventricularfunction and remodelling after myocardial infarction. Journal of cellular andmolecular medicine 15, 1319-1328, doi:10.1111 / j.1582-4934.2010.01126.x (2011). 12 Paczkowska, E. et al. Aldehyde dehydrogenase (ALDH) - a promising new candidate for use in preclinical and clinical selection of pluripotent very small embryonic-like stem cells (VSEL SCs) of high long-term repopulating hematopoietic potential. Annals of transplantation : quarterly of the Polish Transplantation Society 16, 59-71 (2011). 13 Lengner, C. J., Welstead, G. G. & Jaenisch, R. The pluripotency regulator Oct4: a role in somatic stem cells? Cell Cycle 7, 725-728 (2008). 14 Berg, J. S. & Goodell, M. A. An argument against a role for Oct4 in somatic stem cells. Cell stem cell 1, 359-360, doi:10.1016 / j.stem.2007.09.007 (2007). 15 Ohbo, K. et al. Identification and characterization of stem cells in prepubertal spermatogenesis in mice small star, filled. Developmental biology 258, 209-225 (2003). 16 Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453, 519-523, doi:10.1038 / nature06968 (2008). 17 Ogawa, K., Matsui, H., Ohtsuka, S. & Niwa, H. A novel mechanism for regulating clonal propagation of mouse ES cells. Genes to cells : devoted to molecular & cellular mechanisms 9, 471-477, doi:10.1111 / j.1356-9597.2004.00736.x (2004). 18 Gough, N. M. et al. LIF: a molecule with divergent actions on myeloid leukaemic cells and embryonic stem cells. Reproduction, fertility, and development 1, 281-288 (1989). 19 Hitoshi, S. et al. Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes & development 18, 1806-1811, doi:10.1101 / gad.1208404(2004). 20 Tesar, P. J.et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448, 196-199, doi:10.1038 / nature05972 (2007). 21 Saretzki, G., Armstrong, L., Leake, A., Lako, M. & von Zglinicki, T. Stress defense in murine embryonic stem cells is superior to that of various differentiated murine cells. Stem Cells 22, 962-971, doi:10.1634 / stemcells.22-6-962 (2004). 22 Surani, M. A. & Barton, S. C. Development of gynogenetic eggs in the mouse: implications for parthenogenetic embryos. Science 222, 1034-1036 (1983). 23 Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J. C. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 90, 8424-8428 (1993). 24 A. P. Dyban, V. S. B. Cytogenetics of Mammalian Embryonic Development. Oxford Univ. Press, New York (1987). 25 Gropp, A., Winking, H., Herbst, E. W. & Claussen, C. P. Murine trisomy: developmental profiles of the embryo, and isolation of trisomic cellular systems. The Journal of experimental zoology 228, 253-269, doi:10.1002 / jez.1402280210 (1983).

[0214] Materials and Methods Tissue collection and cell culture. To isolate mature lymphocytes, spleens from 1-week-old GOF mice or ICR mice were minced with scissors and mechanically dissociated using a Pasteur pipette. The dissociated spleens were drawn through a cell strainer (BD Biosciences, San Jose). The collected cells were resuspended in DMEM medium, and an equal volume of lympholyte (CEDARLANE®, Ontario, Canada) was added, followed by centrifugation at 1000 g for 15 minutes. The lymphocyte layer was removed, and CD45 antibody (ab25603, abcam, Cambridge, MA) was used. CD45-positive cells were sorted by FACS Aria (BD Biosciences). Next the CD45-positive cells were treated with a stress treatment (pH 5.5 solution, 15 minutes) and plated in B27 medium supplemented with 1000 U LIF (Sigma).

[0215] Exposure to external stimuli - stress treatment. To apply mechanical stress to mature cells, Pasteur pipettes were heated and then stretched to create a lumen with a diameter of approximately 50 microns and then cut. Mature somatic cells were then triturated through these pipettes for 20 minutes and cultured for 7 days. To apply hypoxia stimulation to mature cells, the cells were cultured in a 5% oxygen incubator for 3 weeks. Nutrient deprivation stimulation was applied to mature cells by culturing the cells in basal culture medium for 3 weeks. High Ca culture concentration was applied to mature cells by culturing the cells in medium containing 2 mM CaCl2 for 7 days. To expose mature cells to physiological stress, the cells were treated with a low pH (pH 5.5) solution and cultured for 7 days. Also, more severe damage was inflicted on the cells. To create pores in the mature cell membrane, the cells were treated with 230 ng / ml of SLO (streptolysin O) (S5265, Sigma) for 2 hours and then cultured for 7 days.

[0216] Bisulfite sequencing. Cells obtained from GOF mice were dissociated into single cells. GFP-positive cells were collected by using FACS Aria™. Genomic DNA was extracted from the SAC and examined. Bisulfite treatment of DNA was performed using the CpGenome™ DNAModification Kit (Chemicon, Temecula, CA, http: / / www.chemicon.com) according to the manufacturer's instructions.

[0217] The obtained modified DNA was amplified by nested polymerase chain reaction PCR using two forward (F) primers and one reverse (R) primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT; F2, ATGGGTTGAAATATTGGGTTTATTTA; R, CCACCCTCTAACCTTAACCTCTAAC) and Nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT; F2, AATGTTTATGGTGGATTTTGTAGGT; R, CCCACACTCATATCAATATAATAAC). PCR was performed using TaKaRaEx Taq Hot Start Version (RR030A). DNA sequencing was performed using M13 primers with the help of GRAS (The Genome Resource and Analysis Unit). performed with the help of GRAS (The Genome Resource and Analysis Unit). Performed.

[0218] Immunohistochemistry. Cultured cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 / PBS before blocking with 1% BSA solution (Life Technology, Tokyo, Japan). Secondary antibodies were goat anti-mouse or rabbit conjugated to Alexa-488 or -594 (Invitrogen). Cell nuclei were visualized using DAPI (Sigma). Slides were mounted using SlowFade Gold antifade reagent (Invitrogen). conjugated goat anti-mouse or rabbit to Alexa-488 or -594 (Invitrogen). Cell nuclei were visualized using DAPI (Sigma). Slides were mounted using SlowFade Gold antifade reagent (Invitrogen).

[0219] Fluorescence-activated cell sorting and flow cytometry. Before FACS, cells were prepared according to a standard protocol and suspended in 0.1% BSA / PBS on ice. PI (trademark) (BD Biosciences) was used to exclude dead cells. In negative controls, the primary antibody was replaced with an IgG negative control of the same isotype to ensure specificity. Cells were sorted on a BD FACSAria SORP (trademark) and analyzed using BD FACSDiva (trademark). )Analyzed on BD LSRII (trademark) using software (BD Biosciences).

[0220] RNA preparation and RT-PCR analysis. RNA was isolated using the RNeasy (trademark) Micro Kit (QIAGEN) and reverse transcription was performed using the SuperScript III First Strand Synthesis Kit (Invitrogen). SYBR Green (trademark) Mix I (Roche Diagnostics) was used for amplification, and the samples were run on a Lightcycler-II (trademark) Instrument (Roche Diagnostics).

[0221] Animal studies. For tumorigenicity studies, cells suspended in 100 ml PBS were injected subcutaneously into the flank of age-matched immunodeficient SCID mice. After 6 weeks, the mice were sacrificed and necropsied.

[0222] ATP and ROS assays. Intracellular ATP levels were measured by the ATP Bioluminescence Assay Kit HS II (trademark) (Roche) according to the supplier's protocol. Luminescence intensity was measured by using a Gelomax (trademark) 96 Microplate Luminometer (Promega, Madison, WI), and the luminescence readings were normalized by cell counting. For measurement of ROS levels, cells were incubated in the dark at 37 °C for 15 minutes in medium containing 2 μM dihydroethidium (Molecular Probes). The cells were then washed with PBS and suspended in PBS containing 0.5% BSA. The fluorescence intensity of 30,000 cells was recorded with the help of a BD Biosciences LSR II (BD Bioscience, Spark, MD).

[0223] Generation and analysis of chimeric mice. ​Generation of diploid and tetraploid chimeras. Diploid embryos were obtained from ICR strain females mated with ICR males, and tetraploid embryos were obtained from BDF1 strain females mated with BDF1 males. Tetraploid embryos were generated by electrofusion of two-cell embryos. In this study, since trypsin treatment caused low chimerism, SAC spherical colonies were cut into small pieces using a microknife under a microscope, and then small clusters of SAC were injected into blastocysts on day 4.5 by a large pipette. The next day, the chimeric blastocysts were transferred into pseudopregnant females on day 2.5.

[0224] In vitro differentiation assay. Mesoderm lineage differentiation assay. Stress-altered cell masses were collected on day 7 and dissociated into single cells, and then only Oct4-GFP positive cells were collected by a cell sorter. The collected cells were placed in DMEM supplemented with 20% FCS. The medium was changed every 3 days. After 7 - 14 days, muscle cells were stained with anti-α-smooth muscle actin antibody (N1584, DAKO). Negative con In the negative control, the primary antibody was replaced with an IgG negative control of the same isotype to ensure specificity.

[0225] Neural lineage differentiation assay. The stress-altered cell mass was collected on day 7, dissociated into single cells, and then only Oct4-GFP positive cells were collected by a cell sorter. The collected cells were plated on ornithine-coated chamber slides (Nalge Nunc International) in F12 / DMEM (1:1, v / v) supplemented with 2%B27 (Invitrogen), 10%FCS, 10 ng / ml bFGF (R&D Systems), and 20 ng / ml EGF (R&D Systems). The medium was changed every 3 days. After 10 - 14 days, the cells were fixed with 4% paraformaldehyde for 30 minutes at 4°C, washed with PBS containing 0.2% Triton X-100 for 15 minutes at room temperature, incubated with PBS containing 2% FCS for 20 minutes to block non-specific reactions, and then incubated with anti-βIII tubulin mouse monoclonal antibody (G7121, Promega) and anti-GFAP mouse monoclonal antibody (AB5804, CHEMICON). In the negative control, the primary antibody was replaced with an IgG negative control of the same isotype to ensure specificity.

[0226] Hepatic differentiation assay. The stress-altered cell mass was collected on day 7, dissociated into single cells, and then only Oct4-GFP positive cells were collected by a cell sorter. The collected cells were in 500 mL of hepatocyte basal medium (Lonza, Wuppertal, Germany) supplemented with 10% FCS, 1% penicillin / streptomycin (Sigma), 0.5 mL ascorbic acid, and 10 mL ​Plated on a chamber 2-well slide glass (Nalge Nunc International) in a hepatocyte culture medium composed of BSA-FAF (fatty acid-free), 0.5 mL hydrocortisone, 0.5 mL transferrin, 0.5 mL (insulin), 0.5 mL EGF, and 0.5 mL gentamicin-amphotericin (GA-1000; all from Lonza). Differentiated cells were detected by immunohistochemistry using the following antibodies: anti-alpha-fetoprotein mouse monoclonal antibody (MAB1368, R&D System) and anti-cytokeratin 7 ma ouse monoclonal antibody (ab668, abcam). In the negative control, the primary antibody was replaced with an IgG negative control of the same isotype to ensure specificity.

[0227] In vivo differentiation assay: Stress-altered cell aggregates were collected on day 7 and dissociated into single cells, and then only Oct4-GFP positive cells were collected by a cell sorter. The collected cells were resuspended in 50 μl of DMEM containing 10% FBS. This solution was seeded onto a 3×3×1 mm sheet composed of a non-woven mesh of polyglycolic acid fibers with a diameter of 200 microns and then subcutaneously transplanted into the dorsal flanks of 4-week-old NOD / SCID mice. After 4 weeks, the grafts were recovered and analyzed using immunohistochemical techniques. The grafts were fixed with 10% formamide, embedded in paraffin, and routinely processed to a thickness of 4 μm. The sections were stained with hematoxylin and eosin. Endodermal tissue was identified using an anti-alpha-fetoprotein mouse monoclonal antibody (MAB1368, R&D System), which is an endodermal marker Ectodermal tissue was identified using an anti-betaIII-tubulin mouse monoclonal antibody (G7121, Promega). Mesodermal tissue was identified using an anti-alpha-smooth muscle actin antibody (N1584, DAKO) In the negative control, the primary antibody was replaced with an IgG negative control of the same isotype to ensure specificity.

[0228] TCRβ chain rearrangement analysis. gDNA was extracted from the tail tips of chimeric mice generated using SAC and SAC derived from CD45 positive cells. PCR was performed using 50 ng of gDNA with the following primers: (5’-GCACCTGTGGGGAAGAAACT-3’ and 5’-TGAGAGCTGTCTCCTACTATCGATT-3’). The amplified DNA was electrophoresed using a 1.5% agarose gel. Electrophoresis was performed.

[0229] Genotyping of chimeric mice. gDNA was extracted from the tail tips of 4N chimeric mice. Genotyping was performed using the following primers: (GFP: F-AGAACTGGGACCACTCCAGTG and R-TTCACCCTCTCCACTGACAGATCT. IL-2: F-CTAGGCCACAGAATTGAAAGATCT and R-GTAGGTGGAAATTCTAGCATCATCC).

[0230] Next, the optimal culture conditions for maintaining stress-responsive Oct4-expressing cells were determined. Several previously described culture media were examined, including: ES establishment culture medium, 3i 16 and ACTH 17 ; ES culture conditions, ES-LIF 18 ; Oct4-expressing neural stem cell culture conditions, B27-LIF 19 ; and EpiSC culture conditions 20 . Cells were plated in each medium and GFP-expressing colonies were counted (Fig. S1C). Medium B27-LIF appeared to be the most effective in generating GFP-expressing spherical colonies. Therefore, the inventors utilized B27-LIF medium for culturing the treated cells.

[0231] To examine whether SACs generated from cells obtained from various tissues have different differentiation tendencies, SACs were generated from various tissues of F1 GFP mice and then injected into ICR blastocysts. Subsequently, FACS was used to analyze the contribution rate of each tissue in the generated chimeric mice. It was found that SACs from any tissue contributed to the generation of chimeric mice (data not shown). Furthermore, the contribution rates to the skin, brain, muscle, fat, liver, and lung were analyzed in chimeric mice generated using SACs from various tissues. SACs from any tissue contributed to generating tissues representing all three germ layers, and no differentiation tendency was observed (data not shown).

[0232]

Table 4

[0233]

Table 5

[0234] Example 3 Although not wishing to be bound by theory, the methods described herein may be activating apoptosis or processes associated with regulated cell death. Mild injury to cells can induce the activation of repair genes. Severe injury to cells can activate survival mechanisms not previously defined. When cells are exposed to a significant stress such as the stress described herein, cellular components (e.g., mitochondria, vesicles, nucleus, ribosomes, endoplasmic reticulum, exosomes, endosomes, cell membrane, mitochondria, lysosomes, ATP, proteins, enzymes, carbohydrates, lipids, etc.) are "cellieu" from damaged cells It is conceivable that it is released into. The data described herein indicate that this "serum" may be able to reconstruct and / or promote cell survival. Furthermore, although not wishing to be bound by theory, it is conceivable that mitochondria (and other organelles) may be able to direct cell reconstruction. Due to their small size, simplicity, ability to direct cell differentiation, and prokaryotic-like nature, mitochondria can survive stress that is lethal to the parent cell. Mitochondria can be released from cells, encapsulated in membranes, and / or bound to other cell components.

[0235] Alternatively, although not wishing to be bound by theory, the nucleus may remain intact and be encapsulated in the cell membrane, which may contain some mitochondria. These damaged cells, which have very little cytoplasm and very few organelles (which have lost epigenetic control of the nucleus), can then interact with and perhaps fuse with the extruded organelles. This provides the cell with the intracellular components necessary for growth and replication, but the cell has lost epigenetic control and thus a more primitive (e.g., more pluripotent) state is induced.

[0236] Example 4: Developmental capacity for embryonic and placental lineages in reprogrammed cells with acquired pluripotency Generally, the fate of postnatal somatic cells is fixed and does not change unless they undergo nuclear transfer 1、2 or genetic manipulation using key transcription factors 3 As demonstrated herein, the inventors have discovered an unexpected phenomenon of somatic cell reprogramming into pluripotent cells by sub-lethal stimuli, termed stimulus-triggered acquisition of pluripotency (STAP) 4。This specification also describes the demonstration that reprogrammed STAP cells exhibit unique differentiation capabilities different from those of ES cells. As seen in the blastocyst injection assay, STAP cells can contribute not only to embryonic tissues but also to the placental lineage. Their efficacy for placental contribution was further enhanced by culture using FGF4. Conversely, when cultured for further passages in ES cell maintenance medium, STAP cells, which originally exhibit limited self-renewal ability, generate vigorously growing cell lines that exhibit characteristics similar to ES cells but not trophoblast-like. These altered STAP cells (STAP stem cells) give rise to mice in the tetraploid complementation assay 5 , but no longer contribute to placental tissue. Therefore, STAP cells, unlike iPS cells, may represent a novel metastable state of pluripotency different from that of ES cells 6 . The STAP stem cell technology can provide a versatile and powerful resource for the new generation of regenerative medicine.

[0237] This specification describes an interesting phenomenon of cell fate conversion: somatic cells regain pluripotency after experiencing sub-lethal stimuli such as low pH exposure. 4 . Spleen CD45 + cells (including polarized T cells) were exposed to pH 5.7 for 30 minutes and then cultured in the presence of LIF, a substantial portion of the surviving cells began to express Oct3 / 4, a pluripotent cell marker, on day 2 (d2). By d7, pluripotent cell clusters were formed with a true pluripotent marker profile and the ability to differentiate into the three germ layers (e.g., as shown by teratoma formation). These STAP cells can also efficiently contribute to chimeric mice and can undergo germline transmission in the blastocyst injection assay. These characteristics are similar to those of ES cells, but STAP cells appear to be different from ES cells, at least in their limited self-renewal ability (typically up to 3 - 5 passages maximum) and their vulnerability to dissociation culture. 4 .

[0238] In this example, the inventors further studied the unique properties of STAP cells, focusing on their differentiation ability into two major categories of cells in blastocysts. 7~9 : The inner cell mass type (or ES cell-like) cells and trophectoderm / placental lineage cells after blastocyst injection assay revealed unexpected findings. Generally, the progeny of injected ES cells are found in the embryonic part of the chimeras and are rare in the placental part 7 (data not shown). Surprisingly, the injected STAP cells contributed not only to the embryo but also to the placenta and extraembryonic membranes (Figure 22). This dual lineage contribution was observed in approximately 60% of the chimeric embryos.

[0239] This finding promoted the study of the trophectoderm differentiation ability of STAP cells. Trophectoderm cell lines (trophectoderm stem cells; TS cells) 8、9 are known to be induced in extended adhesion culture of blastocysts in the presence of FGF4. When STAP cell clusters were cultured under the same conditions (Figure 23A; 1 cluster per well in a 96-well plate), the spherical STAP cell clusters gradually disappeared, and cells with a flat appearance different from STAP cells proliferated and formed colonies by d7 - d10 (data not shown). Different from STAP cells with high-level oct3 / 4::GFP expression, these flat cells (adhering to the bottom of the plate) showed a moderate GFP signal on day 7 of culture with FGF4 (data not shown). By immunostaining, FGF4-induced (F4I) cells, in addition to a moderate level of oct3 / 4::GFP, are trophectoderm markers 10~12It was shown to strongly express integrin α7 and Eomesodermin (data not shown). The expression of Nanog was detectable but very low (data not shown). Consistent with this, qPCR analysis showed that F4I cells express substantial levels of trophectoderm lineage marker genes (e.g., cdx2), but their expression of oct3 / 4 and nanog was lower than that seen in parental STAP cells (Figure 23B). These F4I cells could be efficiently expanded by subculturing every 3 days using trypsin digestion, and they remained stable for more than 30 passages in the presence of FGF4 (in its absence, proliferation stopped). This establishment and expansion could be carried out both on MEF cells and on gelatin-coated bottoms, but those cultured on MEF feeders tended to show a more distinct epithelial appearance (data not shown).

[0240] In blastocyst injection assays, placental contribution of F4I cells was frequently observed (50 - 60%) (data not shown). In chimeric placentas, F4I cells typically contributed approximately 10% of all placental cells (Figure 23C, lanes 1 - 3; note that control ES cells did not give substantial placental contribution, lanes 4 - 6). These findings suggest that STAP cells have the ability to generate TS-like cells through FGF4 treatment, at least considering trophectoderm marker expression and placental contribution. Induction of this type of TS-like cell is not common in ES cells (without genetic manipulation) 11 , and such ability may represent another characteristic of STAP cells that is different from ES cells.

[0241] On the other hand, F4I cells derived from STAP cells may also have characteristics different from blastocyst-derived TS cells. First, unlike conventional TS cells 13 , F4I cells expressed moderate levels of oct3 / 4 (data not shown). Furthermore, although the degree of contribution was generally low (data not shown), unlike TS cells, F4I cells injected into blastocysts also contributed to the embryonic part (in all cases with chimeric placentas).

[0242] In summary, these observations indicate that the STAP cell population is qualitatively different from ES cells with respect to their ability for placental differentiation.

[0243] Taking this into account, we studied the differentiation into germ lineages, another cell type present in blastocysts. Unlike ES cells, STAP cells have limited self-renewal ability and cannot be expanded from single cells. STAP cells could not be maintained for more than 5 passages in conventional LIF-containing media (including the B27+LIF medium used in STAP cell establishment), even using partial dissociation culture of clusters. However, an ACTH-containing medium with LIF 15 (hereinafter referred to as ACTH medium in this specification) had a relatively good supporting effect on the growth rate of STAP cell colonies (data not shown). When cultured in this medium on MEF feeders or gelatin in ACTH medium (Fig. 24A), some parts of the STAP cell clusters (typically found in 20-50% of the wells in single cluster culture using 96-well plates) continued to grow (data not shown). These growing colonies were similar to those of mouse ES cells and expressed high levels of oct3 / 4::GFP. Different from the parental STAP cells, the cells in these expanded colonies became resistant to dissociation after 7 days of culture in this medium and could be passaged as single cells (data not shown). In contrast to STAP cells, these changed cells could be expanded exponentially for at least 120 days of culture, like ES cells (Fig. 24B). As shown by multicolor FISH analysis 16 this enhanced expandability was not accompanied by chromosomal abnormalities (data not shown). After 7 days of expansion, the cells grew and could be maintained in any of the ES cell media tested, but this initial 7-day expansion was most efficiently performed using ACTH medium (e.g., colonies formed slowly and at a lower frequency in 3i medium 17 ; data not shown).

[0244] Hereinafter in this specification, proliferative cells derived from STAP cells are referred to as STAP stem cells. Unlike STAP cells, STAP stem cells did not produce TS-like cells in culture using FGF4 (data not shown). Through immunostaining, X chromosome inactivation found in the substantial part of female STAP cells 18 was found to no longer be observed in STAP stem cells (data not shown). STAP stem cells expressed various RNA (Figure 24C) and protein (data not shown) markers for ES cells. CD45 + The DNA methylation levels at the oct3 / 4 and nanog loci, which become demethylated upon conversion from CD45 + to STAP cells, remained low (Figure 24D). In differentiation culture 19~21 , STAP stem cells generated ectoderm, mesoderm and endoderm derivatives (data not shown). These findings demonstrate that STAP stem cells exhibit characteristics indistinguishable from those of ES cells.

[0245] Consistent with this, STAP stem cells were able to form teratomas even after multiple passages (data not shown), and were able to efficiently contribute to chimeric mice by blastocyst injection (data not shown). In the tetraploid complementation assay 5 , the remarkable efficacy of STAP stem cells in their embryonic contribution was explicitly demonstrated by the fact that these cells were able to give rise to mice with the ability to grow into adults and even produce offspring (data not shown). Considering that eight independent lines of STAP stem cells reproducibly showed this ability (note that such complete complementation is often difficult even for commonly used ES cell lines), the inventors infer that STAP cells originating from adult somatic cells can be an attractive source for the derivation of pluripotent stem cell lines that are equivalent (or, in some cases, superior to the blastocyst itself) in this regard.

[0246] Importantly, unlike STAP and F4I cells, STAP stem cells appear to have lost their ability to contribute to placental tissue (data not shown), but they give rise to various tissues in chimeras (Figs. 25A - 25B). Therefore, the difference between STAP cells and STAP stem cells is not limited simply to self-renewal activity, but also includes the loss of the ability to differentiate into the placental lineage.

[0247] These findings indicate a unique pluripotent state of STAP cells. The inability to clone STAP cells from a single cell (above) hinders lineage analysis at the single cell level, but it is worth noting that the STAP procedure can convert somatic cells into a pluripotent cell population with the ability for both embryonic and placental lineages. A thorough understanding of the differentiation state of STAP cells is an important topic for future research. In particular, it would be interesting to study whether STAP cells represent a more immature state than ES cells, as suggested by their ability for the placental lineage, similar to embryonic cells at the morula stage. Recent studies have reported that conventional ES cell cultures also contain a very small population of Oct3 / 4 - cells with characteristics similar to very early embryos. 22 STAP cells may have a similar metastable state that allows for bipotency, but unlike ES cells, this is found in the majority of the cell population.

[0248] It has been demonstrated herein that STAP cells have the ability to transform into ES-like pluripotent stem cell lines. STAP cells (derived from female mice) are somewhat mosaic in X chromosome inactivation; inactivation is lost in approximately 40% of STAP cells 4 while the rest maintain it, which is worth noting. In ES cells, in contrast, both X chromosomes are reproducibly activated. Interestingly, after induction, STAP "stem" cells do not show X chromosome inactivation, like ES cells. This also suggests in this sense that the epigenetic control in parental STAP cells is similar but not identical to that of mouse ES cells.

[0249] These results demonstrate their unexpected "spontaneous conversion ability" to reprogram the fate of the directed somatic cells themselves into naive cells upon exposure to sub-lethal stimuli. This raises a number of interesting and profound biological questions, including the above. Moreover, this newly discovered STAP phenomenon can reform the methodology in stem cell medicine. It is conceivable that the generation of various types of tissues can be enabled by the directed differentiation from STAP cells or STAP stem cells induced from somatic cells without gene introduction (which can increase the risk of cancerous transformation). Furthermore, unlike iPS cell conversion, STAP conversion occurs at a significantly higher frequency and proceeds by a specific endogenous program triggered by strong stimuli such as low pH exposure. Since STAP stem cells, like ES cells, can be easily expanded and cloned, it is more suitable than STAP cells for the large-scale generation of medically useful tissues under strict quality control. In the preliminary studies of the present inventors, the present inventors have succeeded in demonstrating the efficient differentiation of STAP stem cells into 23 retinal precursors 24 , cortical precursors 25 and beating cardiomyocytes

[0250] Method Cell culture. STAP cells were generated from CD45 + cells by transient exposure to a low pH solution and subsequent culture in B27+LIF medium (Obokata et al, 2013; submitted simultaneously ). For the establishment of the F4I cell line, STAP cell clusters were transferred onto FGF4-containing TS medium on MEF feeder cells in 96-well plates. The cells were subjected to the first passage between d7 and d10 using the conventional trypsin method. For the establishment of the STAP stem (STAPS) cell line, STAP spheroids were transferred onto ACTH-containing medium on MEF feeder or gelatin-coated dishes. After 4 - 7 days, the cells were subjected to the first passage using the conventional trypsin method, and the suspended cells were plated in ES maintenance medium containing 5% FCS and 1% KSR.

[0251] Generation and analysis of chimeric mice. For the injection of STAP stem cells, F4I cells, and ES cells, the conventional blastocyst injection method was used. Since trypsin treatment caused low chimerism, STAP cell clusters were injected en masse for STAP cell injection. STAP spherical colonies were cut into small pieces using a microknife under a microscope, and then small clusters of STAP colonies were injected into 4.5-day-old blastocysts by a large pipette. The next day, chimeric blastocysts were transferred into 2.5-day-old pseudopregnant females. Tetraploid embryos were produced by electrofusion of two-cell embryos.

[0252] In vitro and in vivo differentiation assays: Teratoma formation was examined by subcutaneous injection of 1×10 5 individual STAPS cells into the dorsal flanks of 4-week-old NOD / SCID mice. In vitro neural differentiation was induced by the SDIA and SFEBq methods 24、26 . In vitro mesoderm differentiation 25 was induced by culturing STAPS cell aggregates with growth factor (activin) or 10% FCS.

[0253] Karyotype analysis. Subconfluent STAPS cells were arrested at metaphase by colcemid and subjected to multicolor FISH analysis (M-FISH). Mouse chromosome-specific staining probes were combinatorially labeled using 7 different fluorescent dyes and hybridized as previously described (Jentsch et al., 2003).

[0254] Cell culture. STAP cells were generated from CD45 + cells as described and subsequently cultured in B27+LIF medium for 7 days (Obokata et al, 2013; submitted simultaneously). For the establishment of F4I cell lines, STAP cell clusters were transferred onto FGF4-containing TS medium on MEF feeder cells in 96-well plates. Cells were subcultured for the first time between d7 and d10 using the conventional trypsin method. Subsequent subcultures were performed every 3 days.

[0255] For the establishment of STAP stem (STAPS) cell lines, STAP spheroids were transferred onto ACTH-containing medium on MEF feeder cells. After 4 - 7 days, the cells were subjected to the first passage using the conventional trypsin method, and the suspended cells were plated in ES maintenance medium containing 5% FCS and 1% KSR. Subsequent passages were performed every 2 days.

[0256] Generation and analysis of chimeric mice. For the production of diploid and tetraploid chimeras, diploid embryos were obtained from ICR strain females mated with ICR males, and tetraploid embryos were obtained from BDF1 strain females mated with BDF1 males. Tetraploid embryos were produced by electrofusion of 2-cell embryos. For the injection of STAP stem cells, F4I cells, and ES cells, the conventional blastocyst injection method was used. Since trypsin treatment caused low chimerism, for STAP cell injection, STAP cell clusters were injected as a whole. STAP spherical colonies were cut into small pieces using a microknife under a microscope, and then small clusters of STAP colonies were injected into 4.5-day-old blastocysts by a large pipette. The next day, the chimeric blastocysts were transferred into 2.5-day-old pseudopregnant females.

[0257] In vitro and in vivo differentiation assays: 1×10 5 Individual STAP-S cells were subcutaneously injected into the dorsal flanks of 4-week-old NOD / SCID mice. After 6 weeks, the grafts were harvested and analyzed histochemically. The grafts were fixed with 10% formamide, embedded in paraffin, and routinely processed to a thickness of 4 μm. Sections were stained with hematoxylin and eosin.

[0258] In vitro neural differentiation was induced by the SDIA and SFEBq methods. In vitro mesoderm differentiation was induced by culturing STAPS cell aggregates with growth factor (activin) or 10% FCS.

[0259] Immunostaining. Cells were fixed with 4% PFA for 15 minutes and then incubated with primary antibodies after permeabilization with 0.5% Triton X-100: anti-H3K27me3 (Millipore; 1:300), anti-Oct3 / 4 (Santa Cruz Biotechnology; 1 :300), anti-Nanog (eBioscience; 1:300), anti-KLF2 / 4 (R&D System ; 1:300), and anti-Esrrβ (R&D System; 1:300). After overnight incubation, the bound antibodies were visualized using a secondary antibody conjugated to Alexa546 (Molecular Probes). Nuclei were stained with DAPI (Molecular Probes).

[0260] RNA preparation and RT-PCR analysis. RNA was isolated using the RNeasy® Mini kit (QIAGEN). Reverse transcription was performed using the SuperScript III First Strand Synthesis kit (Invitrogen). Power SYBR® Green Mix (Roche Diagnostics) was used for PCR amplification, and samples were run on a LightCycler-II® Instrument (Roche Diagnostics) above.

[0261] Karyotype analysis. Karyotype analysis was performed by multicolor fluorescence in situ hybridization (M-FISH). Sub-confluent STAPS cells were arrested in metaphase for 2.5 hours at 37°C in 5% CO2 with colcemid (final concentration 0.270 μg / ml) in the culture medium. Cells were washed with PBS, treated with trypsin / ethylenediaminetetraacetic acid (EDTA), resuspended in cell culture medium, and centrifuged at 1200 rpm for 5 minutes. To the cell pellet in 3 ml of PBS, 7 ml of pre-warmed hypotonic 0.0375 M KCl solution was added. Cells were incubated at 37°C for 20 minutes. Cells were centrifuged at 1200 rpm for 5 minutes, and the pellet was resuspended in 3 - 5 ml of 0.0375 M KCl solution. Cells were fixed with methanol / acetic acid (3:1; vol / vol) by gentle pipetting. After four fixations, cells were spread on glass slides. For the FISH procedure, mouse chromosome-specific staining probes were combinatorially labeled using seven different fluorescent dyes and hybridized as previously described (Jentsch et al., 2003). For each cell line, 9 - 15 metaphase spreads were acquired by using a Leica DM RXA RF8 epifluorescence microscope (Leica Mikrosysteme GmbH, Bensheim, Germany) equipped with a Sensys CCD camera (Photometrics, Tucson, AZ). The camera and microscope were controlled by Leica Q-FISH software (Leica Microsystems hanging solutions, Cambridge, United Kingdom). Metaphase spreads were processed based on Leica MCK software and presented as multicolor karyograms. Control. presented as a karyogram.

[0262] Bisulfite sequencing. Genomic DNA was extracted from STAP cells. Bisulfite treatment of the DNA was performed using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA, http: / / www.chemicon.com) according to the manufacturer's instructions.

[0263] The resulting modified DNA was amplified by nested polymerase chain reaction (PCR) using two forward (F) primers and one reverse (R) primer: oct3 / 4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT (SEQ ID NO: 73); F2, ATGGGTTGAAATATTGGGTTTATTTA (SEQ ID NO: 74); R, CCACCCTCTAACCTTAACCTCTAAC (SEQ ID NO: 75)), and nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT (SEQ ID NO: 76); F2, AATGTTTATGGTGGATTTTGTAGGT (SEQ ID NO: 77); R, CCCACACTCATATCAATATAATAAC (SEQ ID NO: 78)). PCR was performed using TaKaRaEx Taq Hot Start Version (RR030A). A sequencing was performed using M13 primers at the Genome Resource and Analysis Unit, RIKEN CDB.

[0264] References 1. Gurdon, JB. The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J Embryol Exp Morphol. 10, 622 - 640 (1962) 2. Wakayama, T., Perry, A. C., Zuccotti, M., Johnson, K. R. & Yanagimachi,R. Full-term development of mice from enucleated oocytes injected with cumuluscell nuclei. Nature 394, 369-374 (1998). 3. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells frommouse embryonic and adult fibroblast cultures by defined factors. Cell 126,663-676 (2006). 4. Obokata et al, Stimulus-Triggered Fate Conversion of Somatic Cells intoPluripotency. Co-submitted to this manuscript. 5. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J. C.Derivation of completely cell culture-derived mice from early-passage embryonicstem cells. Proc Nation Acad Sci USA 90, 8424-8428 (1993). 6. Ohgushi, M. and Sasai, Y. Lonely death dance of human pluripotent stemcells: ROCKing between metastable cell states. Trends in Cell Biology 21, 274-282(2011). 7. Niwa, H. How is pluripotency determined and maintained? Development 134, 635-646 (2007) 8. Quinn J, Kunath T, Rossant J. Mouse trophoblast stem cells. Methods Mol Med. 121, 125-148 (2006). 9. Rossant J. Stem cells and lineage development in the mammalian blastocyst. Reprod Fertil Dev. 19, 111-8 (2007) 10. Tanaka TS, Kunath T, Kimber WL, Jaradat SA, Stagg CA, Usuda M, Yokota T, Niwa H, Rossant J, Ko MS. Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. Genome Res.12, 1921-1928 (2002) 11. Klaffky E, Williams R, Yao CC, Ziober B, Kramer R, Sutherland A. Trophoblast-specific expression and function of the integrin alpha 7 subunit in the peri-implantation mouse embryo. Dev Biol. 239, 161-175 (2001). 12. Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, BartonSC, Surani MA, Ryan K, Nehls MC, Wilson V, Evans MJ. Eomesodermin is requiredfor mouse trophoblast development and mesoderm formation. Nature 404, 95-99(2000). 13. Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J.Interaction between Oct3 / 4 and Cdx2 determines trophectoderm differentiation.Cell 123, 917-929 (2005) 14. Toyooka Y, Shimosato D, Murakami K, Takahashi K, Niwa H. Identification andcharacterization of subpopulations in undifferentiated ES cell culture.Development 135, 909-918 (2008). 15. Ogawa, K., Matsui, H., Ohtsuka, S. & Niwa, H. A novel mechanism forregulating clonal propagation of mouse ES cells. Genes to cells 9, 471-477(2004). 16. Jentsch I, Geigl J, Klein CA, Speicher MR. Seven-fluorochrome mouse M-FISHfor high-resolution analysis of interchromosomal rearrangements. CytogenetGenome Res. 103, 84-88 (2003), 17. Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453, 519-523 (2008). 18. Murakami K, Araki K, Ohtsuka S, Wakayama T, Niwa H. Choice of random rather than imprinted X inactivation in female embryonic stem cell-derived extra-embryonic cells. Development 138, 197-202 (2011). 19. Watanabe, K., Kamiya, D., Nishiyama, A., Katayama, T., Nozaki, S., Kawasaki, H., Mizuseki, K., Watanabe, Y., and Sasai, Y. (2005) Directed differentiation of telencephalic precursors from embryonic stem cells. Nature Neurosci. 8, 288-296 20. Kawasaki, H., Mizuseki, K., Nishikawa, S., Kaneko, S., Kuwana, Y., Nakanishi, S., Nishikawa, S.-I. and Sasai, Y. (2000) Induction of midbrain dopaminergic neurons from ES cells by Stromal Cell-Derived Inducing Activity. Neuron 28, 31-40. 21. Gouon-Evans V, Boussemart L, Gadue P, Nierhoff D, Koehler CI, Kubo A, Shafritz DA, Keller G. (2006) BMP-4 is required for hepatic specification of mouse embryonic stem cell-derived definitive endoderm. Nat Biotechnol. 24, 1402-1411. 22. Macfarlan TS, Gifford WD, Driscoll S, Lettieri K, Rowe HM, Bonanomi D, Firth A, Singer O, Trono D, Pfaff SL. Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487, 57-63 (2012). 23. Eiraku, M., Takata, N., Ishibashi, H., Kawada, M., Sakakura, E., Okuda, S., Sekiguchi, K., Adachi, T. and Sasai, Y. (2011) Self-organizing optic-cup morphogenesis in three-dimensional culture. Nature 472, 51-56. 24. Eiraku, M, Watanabe, K., Matsuo-Takasaki, M., Kawada, M., Yonemura, S., Matsumura, M., Wataya, T., Nishiyama, A., Muguruma, K. and Sasai, Y. (2008) Self-Organized Formation of Polarized Cortical Tissues from ES cells and its Active Manipulation by Extrinsic Signals. Cell Stem Cell 3, 519-532 25. Boheler KR, Czyz J, Tweedie D, Yang HT, Anisimov SV, Wobus AM. Differentiation of pluripotent embryonic stem cells into cardiomyocytes. Circ Res. 91, 189 - 201 (2002). 26. Kawasaki, H., Mizuseki, K., Nishikawa, S., Kaneko, S., Kuwana, Y., Nakanishi, S., Nishikawa, S.-I. and Sasai, Y. Induction of midbrain dopaminergic neurons from ES cells by Stromal Cell-Derived Inducing Activity. Neuron 28, 31 - 40(2000)

[0265]

Table 6

[0266]

Table 7

[0267]

Table 8

[0268]

Table 9

Claims

**Claim 1** A method for increasing the number of cells expressing pluripotent stem cell markers in a population of non-embryonic, normally differentiated somatic cells, comprising the step of subjecting the cell population to an effective amount of ATP to increase the level of stress-inducible genes. **Claim 2** The method according to claim 1, wherein the cells expressing pluripotent stem cell markers are generated without introduction of foreign genes, transcripts, proteins, nuclear components or cytoplasm, or without cell fusion. **Claim 3** The method according to claim 1, further comprising the step of selecting cells expressing pluripotent stem cell markers. **Claim 4** The method according to claim 1, wherein the stem cell marker is selected from the group consisting of Oct4, Nanog, E-cadherin, and SSEA. **Claim 5** The method according to claim 1, wherein the cell population is exposed to an amount of ATP effective for increasing the level of stress-inducible genes, in the range of 20 μM to 200 mM. **Claim 6** The method according to claim 5, wherein the cells are exposed to ATP for between 1 minute and 1 hour, preferably 15 minutes.

Images