Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems

Abstract

To provide compositions and methods for the treatment of sensorineural hearing loss and auditory neuropathy, particularly, forms of the disease that are associated with a mutation in otoferlin (OTOE), by way of OTOE gene therapy.SOLUTION: The disclosure provides a variety of compositions that include a first nucleic acid vector that contains a polynucleotide encoding an N-terminal portion of an OTOE isoform 5 protein and a second nucleic acid vector that contains a polynucleotide encoding a C-terminal portion of an OTOE isoform 5 protein. These vectors can be used to increase the expression of OTOE in a subject, such as a human subject suffering from sensorineural hearing loss.SELECTED DRAWING: Figure 1A

Description

Technical Field

[0001] Sequence Listing This application includes a sequence listing that was submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The name of the ASCII copy created on October 23, 2020 is 51471-004WO5_Sequence_Listing_10_23_2020_ST25, and the size is 222,004 bytes.

[0002] Compositions and methods for the treatment of sensorineural hearing loss and auditory nerve disorders, particularly in the form of diseases associated with mutations in otoferlin (OTOF), by OTOF gene therapy are described herein. The present disclosure provides a dual vector system comprising a first nucleic acid vector comprising a polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein and a second nucleic acid vector comprising a polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein. Using these vectors, the expression of wild-type OTOF can be increased or provided to a subject, such as a human subject suffering from sensorineural hearing loss.

Background Art

[0003] Sensorineural hearing loss is a type of hearing loss caused by defects in the cells of the inner ear or the nerve pathways that project from the inner ear to the brain. In many cases, sensorineural hearing loss is acquired and can be caused by noise, infections, head trauma, ototoxic drugs, or aging, but there is also congenital sensorineural hearing loss associated with autosomal recessive mutations. One such form of autosomal recessive sensorineural hearing loss is associated with mutations in the otoferlin (OTOF) gene, which is related to non-symptomatic hearing loss before language acquisition. In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a possible solution. However, OTOF is too large to be treated using standard gene therapy techniques. There is a need for new treatment methods for treating OTOF-related sensorineural hearing loss.

Summary of the Invention

[0004] The present invention is based on the discovery by the inventors that OTOF isoform 5 is preferentially expressed in the inner ear of non-human primates, and that human OTOF isoform 5, rather than human OTOF isoform 1, was able to restore hearing in genetically engineered congenital deaf mice lacking otopetrin. Accordingly, the present invention provides compositions and methods for treating sensorineural hearing loss or auditory nerve disorders in subjects such as human subjects. The compositions and methods of the present disclosure relate to a dual vector system for delivering a polynucleotide encoding otopetrin (OTOF) isoform 5 protein to a subject having or at risk of developing sensorineural hearing loss or auditory nerve disorder (e.g., a subject having a mutation in OTOF). For example, using the compositions and methods described herein, a first nucleic acid vector (e.g., a first adeno-associated virus (AAV) vector) and a second nucleic acid vector (e.g., a second AAV vector), each encoding a functional OTOF isoform 5 protein, can be delivered to a subject by viral gene therapy. The compositions and methods described herein can also be used to increase the expression of WT OTOF protein (e.g., full-length OTOF isoform 5 protein) in cochlear hair cells (e.g., inner hair cells) and / or to treat subjects having or at risk of developing sensorineural hearing loss, such as subjects having a mutation in OTOF.

[0005] In a first aspect, the present invention provides a dual vector system comprising a first AAV vector including a Myo15 promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein, a splice donor sequence located 3' of the first coding polynucleotide, and a first recombination-inducing region located 3' of the splice donor sequence; and a second AAV vector including a second recombination-inducing region, a splice acceptor sequence located 3' of the second recombination-inducing region, a second coding polynucleotide encoding a C-terminal portion of OTOF isoform 5 protein located 3' of the splice acceptor sequence, and a poly(A) sequence located 3' of the second coding polynucleotide. The first coding polynucleotide and the second coding polynucleotide encoding OTOF isoform 5 protein do not overlap, and neither the first AAV vector nor the second AAV vector encodes a full-length OTOF isoform 5 protein.

[0006] In some embodiments, the first AAV vector and the second AAV vector comprise an AAV1 capsid. In some embodiments, the first AAV vector and the second AAV vector comprise an AAV9 capsid.

[0007] In some embodiments, the Myo promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 7 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 9 and / or SEQ ID NO: 10, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 8 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 14 and / or SEQ ID NO: 15, which binds to (e.g., is operably linked to) the first region, and optionally contains a linker having 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 7. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 8. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 19. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 21. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 22. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 36. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 37. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 42. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 43.

[0008] In some embodiments, the Myo promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 8 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 14 and / or SEQ ID NO: 15, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 7 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 9 and / or SEQ ID NO: 10, which binds to (e.g., is operably linked to) the first region. Optionally, a linker having 1 to 100 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, or 20 to 100 nucleotides) is contained between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 8. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 7. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 20. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 41.

[0009] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 7 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 9 and / or SEQ ID NO: 10. In some embodiments, this region comprises or consists of the sequence of SEQ ID NO: 7.

[0010] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 8 or a functional portion or derivative thereof, comprising the sequence of SEQ ID NO: 14 and / or SEQ ID NO: 15. In some embodiments, this region comprises, or consists of, the sequence of SEQ ID NO: 8.

[0011] In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 9. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequences of SEQ ID NO: 9 and SEQ ID NO: 10. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 11. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 12. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 13. In some embodiments, the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 33.

[0012] In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 14. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 15. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 34. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 35. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequences of SEQ ID NO: 14 and SEQ ID NO: 15. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 16. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 17. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 18. In some embodiments, the functional portion of SEQ ID NO: 8 comprises the sequence of SEQ ID NO: 38.

[0013] In some embodiments, the Myo15 promoter has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to any of the nucleic acid sequences of SEQ ID NOs: 33-41. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 33. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 34. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 35. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 36. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 37. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 38. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 39. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 40. In some embodiments, the Myo15 promoter comprises, or consists of, the sequence of SEQ ID NO: 41.

[0014] In some embodiments, the Myo15 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 23 or a functional portion or derivative thereof, including the sequence of SEQ ID NO: 25, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof, including the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27, which binds to (e.g., is operably linked to) the first region. Optionally, a linker having 1 to 400 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 1 to 325, 1 to 350, 1 to 375, 1 to 400, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 50 to 150, 50 to 200, 50 to 250, 50 to 300, 50 to 350, 50 to 400, 100 to 150, 100 to 200, 100 to 250, 100 to 300, 100 to 350, 100 to 400, 150 to 200, 150 to 250, 150 to 300, 150 to 350, 150 to 400, 200 to 250, 200 to 300, 200 to 350, 200 to 400, 250 to 300, 250 to 350, 250 to 400, 300 to 400, or 350 to 400 nucleotides) is contained between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 23. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 24. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 31. In some embodiments, the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 32.

[0015] In some embodiments, the Myo15 promoter comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof, the sequence of which comprises the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27, and a second region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 23 or a functional portion or derivative thereof, the sequence of which comprises SEQ ID NO: 25, which binds to (e.g., is operably linked to) the first region, and optionally contains a linker having 1 to 400 nucleotides (e.g., 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45, 1 to 50, 1 to 60, 1 to 70, 1 to 80, 1 to 90, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 1 to 325, 1 to 350, 1 to 375, 1 to 400, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 90, 10 to 100, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 90, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 50 to 150, 50 to 200, 50 to 250, 50 to 300, 50 to 350, 50 to 400, 100 to 150, 100 to 200, 100 to 250, 100 to 300, 100 to 350, 100 to 400, 150 to 200, 150 to 250, 150 to 300, 150 to 350, 150 to 400, 200 to 250, 200 to 300, 200 to 350, 200 to 400, 250 to 300, 250 to 350, 250 to 400, 300 to 400, or 350 to 400 nucleotides) between the first region and the second region. In some embodiments, the first region comprises or consists of the sequence of SEQ ID NO: 24. In some embodiments, the second region comprises or consists of the sequence of SEQ ID NO: 23.

[0016] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 23 or a functional portion or derivative thereof, which includes the sequence of SEQ ID NO: 25. In some embodiments, this region comprises, or consists of, the sequence of SEQ ID NO: 23.

[0017] In some embodiments, the Myo15 promoter comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to SEQ ID NO: 24 or a functional portion or derivative thereof, which includes the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27. In some embodiments, this region comprises, or consists of, the sequence of SEQ ID NO: 24.

[0018] In some embodiments, the functional portion of SEQ ID NO: 23 includes the sequence of SEQ ID NO: 25. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 26. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 27. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequences of SEQ ID NO: 26 and SEQ ID NO: 27. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 28. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 29. In some embodiments, the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 30.

[0019] In another aspect, the present invention provides a dual vector system comprising a first AAV1 vector containing a ubiquitous promoter operably linked to a first coding polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein, a splice donor sequence located 3' to the first coding polynucleotide, and a first recombination-inducing region located 3' to the splice donor sequence; and a second AAV1 vector containing a second recombination-inducing region, a splice acceptor sequence located 3' to the second recombination-inducing region, a second coding polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein located 3' to the splice acceptor sequence, and a poly(A) sequence located 3' to the second coding polynucleotide. The first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not overlap, and neither the first AAV1 vector nor the second AAV1 vector encodes a full-length OTOF isoform 5 protein.

[0020] In some embodiments, the ubiquitous promoter is selected from the group consisting of a CAG promoter, a cytomegalovirus (CMV) promoter, and a shortened CMV - chicken β-actin promoter (smCBA). In some embodiments, the ubiquitous promoter is the smCBA promoter. In some embodiments, the smCBA promoter comprises or consists of the sequence of SEQ ID NO: 44.

[0021] In some embodiments of any of the foregoing aspects, the first recombination-inducing region and the second recombination-inducing region are the same. In some embodiments of any of the foregoing aspects, the first recombination-inducing region and / or the second recombination-inducing region is an AK recombination-inducing region. In some embodiments, the AK recombination-inducing region comprises or consists of the sequence of SEQ ID NO: 47.

[0022] In some embodiments of any of the foregoing aspects, the first recombination-inducing region and / or the second recombination-inducing region is an AP gene fragment. In some embodiments, the AP gene fragment comprises, or consists of, any one of the sequences of SEQ ID NOs: 48 to 53. In some embodiments, the AP gene fragment comprises, or consists of, the sequence of SEQ ID NO: 51.

[0023] In some embodiments of any of the foregoing aspects, each of the first coding polynucleotide and the second coding polynucleotide encodes approximately half of the OTOF isoform 5 protein sequence.

[0024] In some embodiments of any of the foregoing aspects, the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO: 1. In some embodiments of any of the foregoing aspects, the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO: 1.

[0025] In some embodiments of any of the foregoing aspects, the first coding polynucleotide and the second coding polynucleotide are split at the OTOF exon boundary. In some embodiments, the first coding polynucleotide and the second coding polynucleotide are split at the boundary between exon 20 and exon 21 of OTOF.

[0026] In some embodiments of any of the foregoing aspects, the first coding polynucleotide consists of exons 1 to 20 of the polynucleotide encoding the OTOF isoform 5 protein, and the second coding polynucleotide consists of exons 21 to 45 and 47 of the polynucleotide encoding the OTOF isoform 5 protein (e.g., the polynucleotide encoding the human OTOF isoform 5 protein).

[0027] In some embodiments of any of the foregoing aspects, the first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not contain introns.

[0028] In some embodiments of any of the foregoing aspects, the OTOF isoform 5 protein is a human OTOF isoform 5 protein (e.g., a protein having the sequence of SEQ ID NO: 1).

[0029] In some embodiments of any of the foregoing aspects, the OTOF isoform 5 protein comprises the sequence of SEQ ID NO: 1 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 1.

[0030] In some embodiments of any of the foregoing aspects, the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 2. In some embodiments of any of the foregoing aspects, the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 3.

[0031] In some embodiments of any of the foregoing aspects, the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58. In some embodiments, the N-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 56.

[0032] In some embodiments of any of the foregoing aspects, the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions. In some embodiments, the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59. In some embodiments, the C-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 57.

[0033] In some embodiments of any of the foregoing aspects, the first vector comprises a first inverted terminal repeat (ITR) sequence 5' of the promoter and a second ITR sequence 3' of the recombination-inducing region, and the second vector comprises a first ITR sequence 5' of the recombination-inducing region and a second ITR sequence 3' of the poly(A) sequence. In some embodiments, the ITRs of the first vector and the second vector are AAV2 ITRs. In some embodiments, the ITRs of the first vector and the second vector have at least 80% sequence identity to the AAV2 ITR (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0034] In some embodiments of any of the foregoing aspects, the poly(A) sequence is the bovine growth hormone (bGH) poly(A) signal sequence. In some embodiments of any of the foregoing aspects, the splice donor sequence of the first vector comprises, or consists of, the sequence of SEQ ID NO: 54.

[0035] In some embodiments of any of the foregoing aspects, the splice acceptor sequence of the second vector comprises, or consists of, the sequence of SEQ ID NO: 55. In some embodiments of any of the foregoing aspects, the first AAV vector comprises 5' of a first coding polynucleotide encoding a Kozak sequence 3' of the promoter and an N-terminal portion of the OTOF isoform 5 protein.

[0036] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272-6041 of SEQ ID NO: 60. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 2049-6264 of SEQ ID NO: 60.

[0037] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 62. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 19 to 4115 of SEQ ID NO: 62.

[0038] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 64. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 64.

[0039] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 65. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 19 to 4090 of SEQ ID NO: 65.

[0040] In some embodiments of any of the foregoing aspects, the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 61. In some embodiments of any of the foregoing aspects, the second AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 61.

[0041] In some embodiments of any of the foregoing aspects, the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 63. In some embodiments of any of the foregoing aspects, the second AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 19 to 4589 of SEQ ID NO: 63.

[0042] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 66. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 12 to 4227 of SEQ ID NO: 66.

[0043] In some embodiments of any of the foregoing aspects, the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 68. In some embodiments of any of the foregoing aspects, the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 12 to 4200 of SEQ ID NO: 68.

[0044] In some embodiments of any of the foregoing aspects, the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 67. In some embodiments of any of the foregoing aspects, the second AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 12 to 4655 of SEQ ID NO: 67.

[0045] In another aspect, the present invention provides a pharmaceutical composition comprising the dual vector system of the present invention and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated for administration to the inner ear.

[0046] In another aspect, the present invention provides a kit comprising the dual vector system or the pharmaceutical composition of the present invention. In another aspect, the present invention provides a method of increasing OTOF expression (e.g., wild-type OTOF expression, e.g., full-length OTOF isoform 5 expression) in a subject in need thereof by administering to the subject a therapeutically effective amount of the dual vector system of the present invention.

[0047] In another aspect, the present invention provides a method for treating a subject having or at risk of developing sensorineural hearing loss by administering to the subject a therapeutically effective amount of the dual vector system of the present invention.

[0048] In another aspect, the present invention provides a method for treating a subject having or at risk of developing auditory neuropathy by administering to the subject a therapeutically effective amount of the dual vector system of the present invention.

[0049] In some embodiments of any of the foregoing aspects, the subject has a mutation in OTOF. In some embodiments of any of the foregoing aspects, the subject is confirmed to have a mutation in OTOF.

[0050] In some embodiments of any of the foregoing aspects, the method further comprises confirming the subject as having a mutation in OTOF prior to administering the composition. In some embodiments of any of the foregoing aspects, the subject is or is confirmed to have autosomal recessive deafness 9 (DFNB9).

[0051] In some embodiments of any of the foregoing aspects, the method further comprises evaluating the subject's hearing prior to administering the dual vector system. In some embodiments of any of the foregoing aspects, the dual vector system is administered locally to the ear. In some embodiments, the dual vector system is administered by injection through the round window membrane, injection into the semicircular canal, canalostomy, insertion of a catheter through the round window membrane, middle ear injection, or intratympanic injection.

[0052] In some embodiments of any of the foregoing aspects, the method increases OTOF expression in cochlear hair cells. In some embodiments, the cochlear hair cells are inner hair cells. In some embodiments of any of the foregoing aspects, the subject is a mammal. In some embodiments, the subject is a human.

[0053] In some embodiments of any of the foregoing aspects, the method further comprises evaluating the subject's hearing after administration of the dual vector system. In some embodiments of any of the foregoing aspects, the dual vector system increases OTOF expression in cells (e.g., cochlear hair cells), improves hearing (e.g., as evaluated by standard tests such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions), prevents or reduces hearing loss, delays the onset of hearing loss, delays the progression of hearing loss, improves speech discrimination ability, or improves hair cell function.

[0054] In some embodiments of any of the foregoing aspects, the dual vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, delay the progression of hearing loss, improve hearing (e.g., as evaluated by standard tests such as audiometry, ABR, ECOG, and otoacoustic emissions), improve speech discrimination ability, or improve hair cell function.

[0055] In another aspect, the present invention provides a method of increasing OTOF expression in a cell by introducing the dual vector system of the present invention into the cell. In some embodiments, the cell is a cochlear hair cell. In some embodiments, the cell is an inner hair cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell.

[0056] In some embodiments of any of the foregoing aspects, the first vector and the second vector are administered simultaneously. In some embodiments of any of the foregoing aspects, the first vector and the second vector are administered sequentially.

[0057] In some embodiments of any of the foregoing aspects, the first vector and the second vector are 1×10 7 vector genomes (VG) / ear to about 2×10 15 VG / ear (e.g., 1×10 7VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×1012 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 is administered at a concentration of VG / ear).

[0058] Definition As used herein, the term "about" refers to a value within 10% above or below the recited value.

[0059] As used herein, "administer" refers to providing or giving a therapeutic agent (e.g., a composition comprising a first nucleic acid vector encoding an N-terminal portion of an otoferlin protein and a second nucleic acid vector encoding a C-terminal portion of an otoferlin protein) to a subject by any effective route. Exemplary routes of administration are described hereinbelow.

[0060] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include cells isolated from common tissues in vivo (e.g., epithelial tissue, nerve tissue, connective tissue, or muscle tissue) and / or common organs, tissue systems, blood vessels, or other structures and / or regions.

[0061] As used herein, the term "cochlear hair cell" refers to a special group of cells in the inner ear involved in sound perception. There are two types of cochlear hair cells: inner hair cells and outer hair cells. Damage to cochlear hair cells and gene mutations that disrupt the function of cochlear hair cells are associated with hearing loss and deafness.

[0062] As used herein, the terms "conservative mutation", "conservative substitution", and "conservative amino acid substitution" refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume. These properties are summarized in Table 1 below for each of the 20 natural amino acids.

[0063] **Table 1**

[0064] According to this table, it is understood that the families of conservative amino acids include (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Thus, a conservative mutation or substitution is a mutation or substitution in which one amino acid is replaced with a member of the same amino acid family (e.g., Thr is replaced with Ser, or Arg is replaced with Lys).

[0065] As used herein, the terms "effective amount", "therapeutically effective amount", and "sufficient amount" of a composition, vector construct, or viral vector described herein refer to an amount sufficient to produce a beneficial or desired result, including clinical results, when administered to a subject in need thereof, such as a mammal, e.g., a human, and thus, its "effective amount" or its synonyms depend on the circumstances in which it is applied. For example, with respect to the treatment of sensorineural hearing loss, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response as compared to the response obtained without administering the composition, vector construct, or viral vector. The amount of a given composition described herein corresponding to such an amount will vary depending on various factors such as the given agent, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject (e.g., age, sex, weight) or host being treated, etc., but nevertheless can be routinely determined by one of ordinary skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition, vector construct, or viral vector of the present disclosure is an amount that produces a beneficial or desired result in a subject as compared to a control. It should be noted that when administering a combination of active ingredients, the effective amount of the combination may or may not include the amounts of each component that would have been effective if administered individually. As defined herein, a therapeutically effective amount of a composition, vector construct, or viral vector of the present disclosure can be readily determined by one of ordinary skill in the art by routine methods known in the art. The dosing schedule may be adjusted to provide an optimal therapeutic response.

[0066] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell).

[0067] As used herein, the term "expressing" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., splicing, editing, 5' capping, and / or 3' end processing), (3) translation of the RNA into a polypeptide or protein, and (4) post-translational modification of the polypeptide or protein.

[0068] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human cochlear hair cell). Exogenous substances include substances provided from an external source to an organism or a culture derived therefrom.

[0069] As used herein, the term "hair cell-specific expression" refers to the production of RNA transcripts or polypeptides primarily within hair cells (e.g., cochlear hair cells) as compared to other cell types of the inner ear (e.g., spiral ganglion neurons, glia, or other inner ear cell types). Hair cell-specific expression of a transgene can be confirmed by using any standard technique (e.g., quantitative RT-PCR, immunohistochemistry, Western blot analysis, or fluorescence measurement of a reporter (e.g., GFP) operably linked to a promoter) to compare the expression of the transgene (e.g., RNA or protein expression) among various cell types of the inner ear (e.g., hair cells vs. non-hair cells). A hair cell-specific promoter induces the expression of a transgene operably linked thereto (e.g., RNA or protein expression), and the induced expression is at least 50% (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) greater in hair cells (e.g., cochlear hair cells) as compared to at least three (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) of the following inner ear cell types: border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, Dieters cells of the first row, Dieters cells of the second row, Dieters cells of the third row, Hensen cells, Claudius cells, inner sulcus cells, outer sulcus cells, spiral prominence cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, spiral ganglion neurons, Schwann cells.

[0070] As used herein, the terms "increasing" and "decreasing" mean an adjustment that results in a greater or lesser amount, respectively, of a function, expression, or activity relative to a reference value, compared to the reference. For example, following administration of a composition by the methods described herein, the amount of a metering marker (e.g., OTOF expression) described herein in a subject can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to the marker amount prior to administration. Generally, the reference value is measured at a time when the described effect is obtained by administration, e.g., at least 1 week, 1 month, 3 months, or 6 months after initiation of a treatment regimen.

[0071] As used herein, the term "intron" refers to a region within the coding region of a gene whose nucleotide sequence is not translated into the amino acid sequence of the corresponding protein. The term intron also refers to the corresponding region of RNA transcribed from a gene. Introns are transcribed into precursor mRNA but are removed during processing and are not included in the mature mRNA.

[0072] As used herein, "local" or "local administration" means administration at a specific site of the body for the purpose of a local effect rather than a systemic effect. Examples of local administration are administration on the skin of a subject, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional, lymph node administration, intratumoral administration, administration to the inner ear, and administration to a mucosa, in which case the administration is for the purpose of producing a local effect rather than a systemic effect.

[0073] As used herein, the term "operatively linked" refers to a first molecule that can bind to a second molecule, where the molecules are arranged such that the first molecule affects the function of the second molecule. The term "operatively linked" includes juxtaposing two or more components (e.g., a promoter and another array element) such that both components function properly and at least one component can mediate a function that acts on at least one other component. The two molecules may or may not be part of a single, continuous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcriptionally capable polynucleotide molecule of interest within a cell, the promoter is operatively linked to the transcriptionally capable polynucleotide molecule. In a further embodiment, two portions of a transcriptional regulatory element are operatively linked to each other if they are joined such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operatively linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid), or may be operatively linked to each other in the absence of intervening nucleotides.

[0074] As used herein, the terms "otoferlin isoform 5" and "OTOF isoform 5" refer to isoforms of the gene associated with non-syndromic recessive deafness DFNB9. The human isoform of the gene is related to the reference sequence NM_001287489, and the transcript contains exons 1-45 and 47 of human otoferlin, but does not contain exon 46 of the OTOF gene. The human OTOF isoform 5 protein is also known as otoferlin isoform e. The terms "otoferlin isoform 5" and "OTOF isoform 5" refer to variants of the wild-type OTOF isoform 5 protein and polynucleotides encoding the same, for example, with respect to the amino acid sequence of the wild-type OTOF isoform 5 protein (e.g., SEQ ID NO: 1), having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) of variant proteins, or with respect to the polynucleotide sequence of the wild-type OTOF isoform 5 gene, having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more identity) of polynucleotides, provided that the encoded OTOF isoform 5 analog retains the therapeutic function of the wild-type OTOF isoform 5. The OTOF isoform 5 protein variant can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) conservative amino acid substitutions with respect to the wild-type OTOF isoform 5 (e.g., SEQ ID NO: 1), provided that the OTOF isoform 5 variant retains the therapeutic function of the wild-type OTOF isoform 5 and has no more than 10% amino acid substitutions in the N-terminal portion of the amino acid sequence and no more than 10% amino acid substitutions in the C-terminal portion of the amino acid sequence.As used herein, OTOF isoform 5 may refer to a protein localized in inner hair cells or a gene encoding this protein, depending on the context, as understood by those skilled in the art. OTOF isoform 5 may refer to human OTOF isoform 5 or a homolog of another mammalian species. Mouse otoferlin contains one additional exon (exon 48 in mouse otoferlin) compared to human otoferlin, and the exons of mouse otoferlin corresponding to those encoding human OTOF isoform 5 are exons 1-5, 7-46, and 48. The exon numbering rules used herein are based on the exons currently understood to be present in the consensus transcript of human OTOF.

[0075] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule that can ligate additional DNA segments. A plasmid is a type of vector, a nucleic acid molecule that can transport another nucleic acid to which it is ligated. Certain plasmids are capable of self-replication in the host cells into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of the host cell upon introduction into the host cell and thereby replicated along with the host genome. Certain plasmids can induce the expression of genes to which they are operably linked.

[0076] As used herein, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleosides of any length. Generally, a polynucleotide consists of nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) found naturally in DNA or RNA, linked by phosphodiester bonds. However, the term includes molecules having chemically or biologically modified bases, modified backbones, etc., whether or not found in natural nucleic acids, such molecules may be preferred for certain applications. When the present application refers to a polynucleotide, it is understood that both DNA and RNA, and both single-stranded and double-stranded forms in each case (and the complement of each single-stranded molecule), are provided. As used herein, the "polynucleotide sequence" can refer to the polynucleotide substance itself and / or the sequence information that biochemically characterizes a particular nucleic acid (i.e., a series of letters used as abbreviations for bases). The polynucleotide sequences presented herein are shown in the 5' to 3' direction unless otherwise specified.

[0077] As used herein, the terms "complementary" or "complementary to" with respect to a nucleic acid means that, due to the orientation of its nucleobases, the nucleotide sequence of one strand of the nucleic acid forms hydrogen bonds with another sequence on the opposite nucleic acid strand. The complementary bases of DNA are typically A and T, and C and G. In RNA, they are typically C and G, and U and A. Complementarity can be complete or substantial / adequate. Complete complementarity between two nucleic acids means that the two nucleic acids can form a duplex, in which case all bases of the duplex are paired with complementary bases by Watson-Crick pairing. "Substantially" or "adequately" complementary means that the sequence of one strand is not completely and / or perfectly complementary to the sequence of the opposite strand, but sufficient bonding occurs between the bases of the two strands under a set of hybridization conditions (e.g., salt concentration and temperature) to form a stable hybrid complex. Such conditions can be predicted by using the sequence and standard mathematical calculations to predict the Tm (melting temperature) of the hybridized strands, or by empirically determining the Tm using routine methods. The Tm is the temperature at which 50% of the population of hybridization complexes formed between two nucleic acid strands denatures (i.e., half of the population of double-stranded nucleic acid molecules dissociates into single strands). At temperatures below the Tm, formation of the hybridization complex is favored, while at temperatures above the Tm, melting or separation of the strands in the hybridization complex is favored. The Tm of a nucleic acid may be estimated, for example, using Tm = 81.5 + 0.41(%G+C) with a known G+C content in 1M aqueous NaCl solution, although other known Tm calculations take into account the structural properties of the nucleic acid.

[0078] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase promotes transcription of the transgene. Exemplary promoters suitable for use in the compositions and methods described herein include ubiquitous promoters (e.g., the CAG promoter, the cytomegalovirus (CMV) promoter, and the smCBA promoter), and hair cell-specific promoters of the cochlea (e.g., the myosin 15 (Myo15) promoter).

[0079] The "percentage of amino acid sequence identity (%)" to a reference polynucleotide sequence or reference polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide sequence or reference polypeptide sequence after aligning the sequences and introducing gaps as necessary to achieve the maximum percentage of sequence identity. The alignment for the purpose of measuring nucleic acid or amino acid sequence identity percentage can be achieved in various ways within the ability of one of ordinary skill in the art using commonly available computer software such as, for example, BLAST, BLAST-2, or Megalign software. One of ordinary skill in the art can determine appropriate parameters for aligning the sequences, including any algorithms necessary to obtain the maximum alignment over the full length of the sequences being compared. For example, the percentage of sequence identity values can be generated using the sequence comparison computer program BLAST. By way of example, the percentage of sequence identity of a given nucleic acid or amino acid sequence A to, or with, a given nucleic acid or amino acid sequence B (which can alternatively be referred to as a given nucleic acid or amino acid sequence A having a particular identity percentage to, or with, a given nucleic acid or amino acid sequence B) is calculated as follows.

[0080] 100×(fraction X / Y) In the formula, X is the number of nucleotides or amino acids scored as identical matches by an array alignment program (for example, BLAST) in the alignment of the programs of A and B, and Y is the total number of nucleic acids of B. When the length of the nucleic acid or amino acid sequence A is not equal to the length of the nucleic acid or amino acid sequence B, the percentage of sequence identity of A to B is considered not to be equal to the percentage of sequence identity of B to A.

[0081] As used herein, the term "derivative" refers to a nucleic acid, peptide, or protein that contains one or more mutations and / or chemical modifications, or a variant or analog thereof, as compared to the corresponding full-length wild-type nucleic acid, peptide, or protein. Non-limiting examples of chemical modifications involving nucleic acids include, for example, modifications to the base moiety, sugar moiety, phosphate moiety, phosphate-sugar backbone, or combinations thereof.

[0082] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent that is administered to a subject, such as a mammal (e.g., a human), optionally in combination with one or more pharmaceutically acceptable excipients, diluents, and / or carriers, for preventing, treating, or controlling a specific disease or condition that affects or has the potential to affect the subject.

[0083] As used herein, the term "pharmaceutically acceptable" refers to a compound, substance, composition, and / or dosage form that is free of excessive toxicity, irritation, allergic reaction, and other problematic disorders, has a reasonable benefit / risk ratio, and is suitable for contact with the tissues of a subject such as a mammal (e.g., a human). Preferably, the term "pharmaceutically acceptable" means that it is approved by a federal or state government regulatory agency or is listed in the United States Pharmacopeia or other generally recognized pharmacopeias for use in mammals, more specifically humans.

[0084] As used herein, the term "recombinant induction region" refers to a region of homology that mediates recombination between two different sequences. As used herein, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of a polynucleotide encoding OTOF. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990), which is incorporated herein by reference.

[0085] As used herein, the term "sample" refers to a specimen isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villus sample, and cells).

[0086] As used herein, the term "transfection" refers to any of a variety of techniques commonly used for the introduction of exogenous DNA into prokaryotic or eukaryotic host cells, e.g., electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, Nucleofection, squeeze poration, sonoporation, optoporation, magnetofection, impalefection, etc.

[0087] As used herein, the terms "subject" and "patient" refer to animals (e.g., mammals such as humans), veterinary subject animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), and experimental animal models of diseases (e.g., mice, rats). The subject to be treated according to the methods described herein can be a subject diagnosed with hearing loss (e.g., hearing loss associated with OTOF mutations), or a subject at risk of developing these conditions. The diagnosis may be performed by any method or technique known in the art. One of ordinary skill in the art will understand that a subject to be treated according to the present disclosure may be identified as a subject who may be undergoing standard tests or who has a risk due to the presence of one or more risk factors related to a disease or condition but has not undergone testing.

[0088] As used herein, the terms "transduction" and "transducing" refer to a method of introducing a vector construct or a part thereof into a cell. When the vector construct is contained in a viral vector such as an AAV vector, transduction refers to viral infection of the cell and subsequent transfer and integration of the vector construct or a part thereof into the cell genome.

[0089] As used herein, "treatment" and "treating" of a condition, disorder or disease state can include: (1) preventing, delaying or reducing the incidence and / or likelihood of occurrence of at least one clinical or asymptomatic symptom of a condition, disorder or disease state in a subject who has or may have a predisposition to the condition, disorder or disease state but has not yet experienced or manifested clinical or asymptomatic symptoms; or (2) inhibiting a condition, disorder or disease state, i.e., preventing, reducing or delaying the onset of the disease or its recurrence or the onset of at least one of its clinical or asymptomatic symptoms; or (3) alleviating the disease, i.e., regressing at least one of the condition, disorder or disease state, or its clinical or asymptomatic symptoms. The benefits to the subject being treated are statistically significant or at least perceptible to the patient or physician.

[0090] As used herein, the term "vector" includes nucleic acid vectors (e.g., DNA vectors such as plasmids), RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). Various vectors have been developed to deliver polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO94 / 011026, which is incorporated herein by reference as relating to vectors suitable for the expression of genes of interest. Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences, as well as additional sequence elements used, for example, for the expression of proteins and / or the integration of these polynucleotide sequences into the genome of mammalian cells. Specific vectors that can be used for the expression of OTOF described herein include vectors containing regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other vectors useful for the expression of OTOF include polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of the mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of the genes incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0091] As used herein, the term "wild-type" refers to the most frequently occurring genotype for a particular gene in a given organism.

Brief Description of the Drawings

[0092]

Fig. 1A

Fig. 1B

Fig. 2

Fig. 3A

Fig. 3B

Fig. 3C

Fig. 4

Fig. 5

Fig. 6

Fig. 7A

Fig. 7B

Fig. 8

Mode for Carrying Out the Invention

[0093] A first nucleic acid vector (e.g., an AAV vector) containing a promoter and a polynucleotide encoding the N-terminal portion of otoferlin (OTOF) isoform 5 protein (e.g., wild-type (WT) human OTOF isoform 5 protein), and a second nucleic acid vector (e.g., an AAV vector) containing a polynucleotide encoding the C-terminal portion of OTOF isoform 5 protein and a polyadenylation (poly(A)) sequence are administered to treat sensorineural hearing loss or auditory neuropathy in a subject (e.g., a mammalian subject such as a human). When introduced into mammalian cells such as cochlear hair cells, the polynucleotides encoded by the two nucleic acid vectors can bind to form a nucleic acid molecule encoding the full-length OTOF isoform 5 protein. Thus, the compositions and methods described herein can be used to induce or increase the expression of WT OTOF isoform 5 in the cochlear hair cells of a subject suffering from OTOF deficiency (e.g., low OTOF expression, or an OTOF mutation that impairs OTOF expression or function).

[0094] otoferlin OTOF is a 230 kDa membrane protein containing at least six C2 domains that are involved in the binding of calcium, phospholipids, and proteins. Human OTOF is encoded by a gene containing 47 exons, and the full-length protein is composed of 1,997 amino acids. OTOF is located at the ribbon synapses of inner hair cells and is thought to function as a calcium sensor for synaptic vesicle fusion, triggering the fusion of vesicles containing neurotransmitters with the cell membrane. It is also involved in vesicle replenishment and clathrin-mediated endocytosis and has been shown to interact with myosin VI, Rab8b, SNARE proteins, calcium channel Cav1.3, Ergic2, and AP-2. The mechanism by which OTOF mediates exocytosis and the physiological importance of its interaction with its binding partners have not yet been elucidated.

[0095] The otoferlin gene has multiple long and short isoforms. Studies of human hereditary deafness suggest that the long isoforms are important for inner ear function. However, the roles of these individual long isoforms and other protein variants in inner ear function are not understood. To develop an effective gene therapy for patients suffering from deafness secondary to genetically induced otoferlin deficiency, the cDNA sequences encoding the functional OTOF isoforms of the ear must be identified.

[0096] The present invention is based, in part, on the discovery that OTOF isoform 5 is preferentially expressed in the inner ear of non-human primates and that human OTOF isoform 5, but not human OTOF isoform 1, was able to restore hearing in genetically engineered congenital deaf mice with otoferlin deficiency. Accordingly, the dual vector systems described herein (e.g., a dual vector system for the expression of OTOF isoform 5) can be used to treat sensorineural deafness or auditory neuropathy in human subjects having a deficiency (e.g., a mutation) of the OTOF gene.

[0097] Otoferlin-related deafness OTOF was first identified by studies investigating the genetics of autosomal recessive deafness 9 (DFNB9), one of the non-syndromic deafnesses. Subsequently, mutations in OTOF have been found to cause sensorineural deafness in patients worldwide. Many patients with OTOF mutations suffer from auditory neuropathy, a disorder in which the inner ear detects sound but is unable to transmit the sound properly from the ear to the brain. These patients have abnormal auditory brainstem responses (ABRs) and speech discrimination abilities with initially normal otoacoustic emissions. Patients with homozygous or compound heterozygous mutations often develop deafness in infancy, and the severity of the hearing impairment is known to vary depending on the location and type of OTOF mutation.

[0098] By administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein, sensorineural hearing loss or auditory neuropathy can be treated. The full-length OTOF isoform 5 coding sequence is too large to be included in the types of vectors commonly used in gene therapy (e.g., adeno-associated virus (AAV) vectors, which are thought to have a packaging limit of 5 kb). The compositions and methods described herein overcome this problem by splitting the OTOF isoform 5 coding sequence between two different nucleic acid vectors (e.g., AAV vectors) that can bind intracellularly to reconstitute the full-length OTOF isoform 5 sequence. Using these compositions and methods, subjects having one or more mutations in the OTOF gene, e.g., OTOF mutations that reduce OTOF expression, reduce OTOF function, or are associated with hearing loss (e.g., frameshift mutations, nonsense mutations, deletions, or missense substitutions), can be treated. When the first nucleic acid vector and the second nucleic acid vector are administered in a composition, the polynucleotides encoding the N-terminal portion and the C-terminal portion of the OTOF isoform 5 bind within a cell (e.g., a human cell, e.g., a cochlear hair cell) to form a single nucleic acid molecule containing the full-length OTOF isoform 5 coding sequence (e.g., via homologous recombination and / or splicing).

[0099] The nucleic acid vectors (e.g., AAV vectors) used in the compositions and methods described herein include polynucleotide sequences encoding wild-type OTOF isoform 5 or variants thereof, e.g., when combined, having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the amino acid sequence of wild-type mammalian (e.g., human or mouse) OTOF isoform 5, such as polynucleotide sequences encoding proteins. The polynucleotides used in the nucleic acid vectors described herein can encode the N-terminal and C-terminal portions of the OTOF isoform 5 amino acid sequence of Table 2 below (e.g., when combined, two portions encoding the full-length OTOF isoform 5 amino acid sequence described in Table 2, e.g., SEQ ID NO: 1).

[0100] According to the method described herein, a subject is administered a composition comprising a first nucleic acid vector and a second nucleic acid vector, each comprising an N-terminal portion and a C-terminal portion of a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, or a polynucleotide sequence encoding an amino acid sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to the amino acid sequence of SEQ ID NO: 1, or a polynucleotide sequence encoding an amino acid sequence comprising one or more conservative amino acid substitutions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions) relative to SEQ ID NO: 1, provided that the encoded OTOF analog retains the therapeutic function of wild-type OTOF isoform 5 (e.g., the ability to regulate exocytosis of ribbon synapses, or the ability to rescue or improve the ABR response in an animal model of hearing loss associated with otoferlin gene deficiency (e.g., OTOF mutation)). Up to 10% of the amino acids in the N-terminal portion and up to 10% of the amino acids in the C-terminal portion of the human OTOF isoform 5 protein can be replaced with conservative amino acid substitutions. The OTOF isoform 5 protein can be encoded by a polynucleotide having the sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The OTOF isoform 5 protein can also be encoded by a polynucleotide having a single nucleotide variant (SNV) that has been found to be non-pathogenic in human subjects. The OTOF isoform 5 protein can be the human OTOF isoform 5 protein or a homolog of the human isoform 5 protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal).

[0101]

Table 2-1

[0102]

Table 2-2

[0103]

Table 2-3

[0104]

Table 2-4

[0105]

Table 2-5

[0106]

Table 2-6

[0107]

Table 2-7

[0108]

Table 2-8

[0109]

Table 2-9

[0110]

Table 2-10

[0111]

Table 2-11

[0112]

Table 2-12

[0113] [Table 2-13]

[0114] [Table 2-14]

[0115] [Table 2-15]

[0116] [Table 2-16]

[0117] [Table 2-17]

[0118] [Table 2-18]

[0119] [Table 2-19]

[0120] [Table 2-20]

[0121] [Table 2-21]

[0122] [Table 2-22]

[0123]

Table 2-23

[0124]

Table 2-24

[0125]

Table 2-25

[0126]

Table 2-26

[0127]

Table 2-27

[0128]

Table 2-28

[0129] Expression of OTOF in mammalian cells Mutations in OTOF are associated with sensorineural hearing loss and auditory neuropathy. The compositions and methods described herein increase the expression of WT OTOF isoform 5 protein by administering a first nucleic acid vector containing a polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein and a second nucleic acid vector containing a polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein. For use in the treatment of sensorineural hearing loss and auditory neuropathy, nucleic acid vectors can be targeted to the interior of cells, particularly specific cell types. A wide variety of methods for delivering proteins to mammalian cells and for stably expressing genes encoding proteins in mammalian cells have been established.

[0130] Polynucleotide encoding OTOF One platform that can be used to achieve therapeutically effective intracellular concentrations of OTOF isoform 5 in mammalian cells is by stably expressing the gene encoding OTOF isoform 5 (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells or by episomal plasmid formation in the nucleus of mammalian cells). The gene is a polynucleotide encoding the primary amino acid sequence of the corresponding protein. To introduce an exogenous gene into mammalian cells, the gene can be incorporated into a vector. The vector can be introduced into cells by a variety of methods, including transformation, transfection, transduction, direct uptake, particle bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described, for example, in Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015) are described in more detail, and each disclosure is incorporated herein by reference.

[0131] OTOF isoform 5 can also be introduced into mammalian cells by targeting a vector containing a portion of the gene encoding the OTOF isoform 5 protein to cell membrane phospholipids. For example, the vector can be targeted to phospholipids on the extracellular surface of the cell membrane by binding the vector molecule to the VSV-G protein, a viral protein that has an affinity for all cell membrane phospholipids. Such constructs can be generated using methods well known to those skilled in the art.

[0132] It is important for gene expression that the polynucleotide encoding the OTOF isoform 5 protein be recognized and bound by mammalian RNA polymerase. Thus, sequence elements that exhibit a high affinity for transcription factors that recruit RNA polymerase and facilitate the assembly of the transcription complex at the transcription start site may be included within the polynucleotide. Such sequence elements include, for example, mammalian promoters, the sequences of which can be recognized and bound by specific transcription initiation factors and ultimately by RNA polymerase.

[0133] Polynucleotides suitable for use in the compositions and methods described herein include those encoding an OTOF protein downstream of a mammalian promoter (e.g., a polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein downstream of a mammalian promoter). Promoters useful for the expression of an OTOF protein in mammalian cells include the ubiquitous promoter and the cochlear hair cell-specific promoter. Ubiquitous promoters include the CAG promoter, the cytomegalovirus (CMV) promoter, and a truncated form of the chimeric CMV - chicken β-actin promoter (CBA), where the hybrid chicken β-actin / rabbit β-globin intron is substantially shortened to produce a smaller version of the promoter called smCBA. Cochlear hair cell-specific promoters include the myosin 15 (Myo15) promoter. The Myo15 promoter sequence for use in the methods and compositions described herein is set forth below and in Table 3. On the other hand, promoters derived from viral genomes can also be used to stably express these agents in mammalian cells. Examples of functional viral promoters that can be used to facilitate mammalian expression of these agents include the adenovirus late promoter, the vaccinia virus 7.5K promoter, the SV40 promoter, the HSV tk promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV LTR promoter, the Moloney virus promoter, the Epstein - Barr virus (EBV) promoter, and the Rous sarcoma virus (RSV) promoter.

[0134] Mouse myosin 15 promoter In some embodiments, the Myo15 promoter for use in the compositions and methods described herein comprises a polynucleotide sequence having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to a region of the mouse Myo15 locus that can specifically express a transgene in hair cells, such as a polynucleotide sequence from a region of the mouse Myo15 locus that can specifically express a transgene in hair cells, or a variant thereof. These regions include the polynucleotide sequence immediately preceding the mouse Myo15 translation start site and upstream regulatory elements located more than 5 kb away from the mouse Myo15 translation start site. The mouse Myo15 promoter for use in the compositions and methods described herein may optionally include a linker that operably links a region of the mouse Myo15 locus that can specifically express a transgene in hair cells, or the region of the mouse Myo15 locus can be directly ligated without an intervening linker.

[0135] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein comprises a first region (upstream regulatory element) having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to a region comprising the first non-coding exon of the mouse Myo15 gene (nucleic acids -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 7) or a functional portion or derivative thereof, and a polynucleotide sequence immediately preceding the mouse Myo15 translation start site (nucleic acids -1 to -1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 8) or a functional portion or derivative thereof that is bound (e.g., operably linked) thereto, having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity). The functional portion of SEQ ID NO: 7 may have a nucleic acid sequence of -7166 to -7091 (set forth in SEQ ID NO: 9) and / or a nucleic acid sequence of -7077 to -6983 (set forth in SEQ ID NO: 10) relative to the mouse Myo15 translation start site. The first region may comprise the polynucleotide sequence of SEQ ID NO: 9 fused to the polynucleotide sequence of SEQ ID NO: 10 without the intervening nucleic acid set forth in SEQ ID NO: 11, or the first region may comprise the polynucleotide sequence of SEQ ID NO: 10 fused to the polynucleotide sequence of SEQ ID NO: 9 without the intervening nucleic acid set forth in SEQ ID NO: 12. Alternatively, the first region may comprise the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 joined by an endogenous intervening polynucleotide sequence (e.g., the first region may have or may comprise a nucleic acid sequence of -7166 to -6983 relative to the mouse Myo15 translation start site, as set forth in SEQ ID NO: 13 and SEQ ID NO: 33) or a nucleic acid linker. In a mouse Myo15 promoter in which the first region comprises both SEQ ID NO: 9 and SEQ ID NO: 10, the two sequences may be included in any order (e.g., SEQ ID NO: 9 may be joined to (e.g., precede) SEQ ID NO: 10, or SEQ ID NO: 10 may be joined to (e.g., precede) SEQ ID NO: 9).The functional part of SEQ ID NO: 8 may have a nucleic acid sequence of -590 to -509 (described in SEQ ID NO: 14) relative to the mouse Myo15 translation start site and / or a nucleic acid sequence of -266 to -161 (described in SEQ ID NO: 15) relative to the mouse Myo15 translation start site. In some embodiments, the sequence containing SEQ ID NO: 14 has the sequence of SEQ ID NO: 34. In some embodiments, the sequence containing SEQ ID NO: 15 has the sequence of SEQ ID NO: 35. The second region may include the polynucleotide sequence of SEQ ID NO: 14 fused to the polynucleotide sequence of SEQ ID NO: 15 without the intervening nucleic acid described in SEQ ID NO: 16, or the second region may include the polynucleotide sequence of SEQ ID NO: 15 fused to the polynucleotide sequence of SEQ ID NO: 14 without the intervening nucleic acid described in SEQ ID NO: 17. The second region may include the nucleic acid sequence of SEQ ID NO: 34 fused to the nucleic acid sequence of SEQ ID NO: 35 without the intervening nucleic acid described in SEQ ID NO: 38, or the second region may include the nucleic acid sequence of SEQ ID NO: 35 fused to the nucleic acid sequence of SEQ ID NO: 34 without an intervening nucleic acid. Alternatively, the second region may include the sequences of SEQ ID NO: 14 and SEQ ID NO: 15 linked by an endogenous intervening polynucleotide sequence (e.g., the second region may have a nucleic acid sequence of -590 to -161 relative to the mouse Myo15 translation start site as described in SEQ ID NO: 18) or a nucleic acid linker. In the mouse Myo15 promoter where the second region includes both SEQ ID NO: 14 and SEQ ID NO: 15, the two sequences may be included in any order (e.g., SEQ ID NO: 14 may be linked to (e.g., precede) SEQ ID NO: 15, or SEQ ID NO: 15 may be linked to (e.g., precede) SEQ ID NO: 14).

[0136] The first region and the second region of the mouse Myo15 promoter can be directly linked or linked by a nucleic acid linker. For example, the mouse Myo15 promoter can be a sequence of SEQ ID NO: 7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 9-13 and 33, such as SEQ ID NOs: 9 and 10) fused to a sequence of SEQ ID NO: 8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 14-18, 34, 35, and 38, such as SEQ ID NOs: 14 and 15) without an intervening nucleic acid. For example, the polynucleotide sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO: 7 to SEQ ID NO: 8 is shown in SEQ ID NO: 19. Alternatively, a linker can be used to link a sequence of SEQ ID NO: 7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 9-13 and 33, such as SEQ ID NOs: 9 and 10) to a sequence of SEQ ID NO: 8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 14-18, 34, 35, and 38, such as SEQ ID NOs: 14 and 15). Exemplary Myo15 promoters containing functional portions of both SEQ ID NO: 7 and SEQ ID NO: 8 are provided in SEQ ID NOs: 21, 22, 36, 37, 42, and 43.

[0137] The length of the nucleic acid linker for use with the mouse Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the mouse Myo15 promoter described herein does not interfere with the ability of the mouse Myo15 promoter of the present invention to induce transgene expression in hair cells.

[0138] In some embodiments, the sequence of SEQ ID NO: 7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 9-13 and 33, e.g., SEQ ID NOs: 9 and 10) is coupled (e.g., operably linked) to the sequence of SEQ ID NO: 8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 14-18, 34, 35 and 38, e.g., SEQ ID NOs: 14 and 15), and in some embodiments, the order of the regions is reversed (e.g., the sequence of SEQ ID NO: 8 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 14-18, 34, 35 and 38, e.g., SEQ ID NOs: 14 and 15) is coupled (e.g., operably linked) to the sequence of SEQ ID NO: 7 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 9-13 and 33, e.g., SEQ ID NOs: 9 and 10)). For example, the polynucleotide sequence of the mouse Myo15 promoter resulting from the direct fusion of SEQ ID NO: 8 to SEQ ID NO: 7 is shown in SEQ ID NO: 20. An example of a mouse Myo15 promoter in which a functional portion or derivative of SEQ ID NO: 8 precedes a functional portion or derivative of SEQ ID NO: 7 is provided in SEQ ID NO: 41. Regardless of order, the sequence of SEQ ID NO: 7 or a functional portion or derivative thereof, and the sequence of SEQ ID NO: 8 or a functional portion or derivative thereof, can be coupled by direct fusion or by a nucleic acid linker as described above.

[0139] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the first non-coding exon of the mouse Myo15 gene (which is nucleic acid -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is shown in SEQ ID NO: 7) or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 7 can have a nucleic acid sequence of -7166 to -7091 (described in SEQ ID NO: 9) and / or a nucleic acid sequence of -7077 to -6983 (described in SEQ ID NO: 10) relative to the mouse Myo15 translation start site. The mouse Myo15 promoter can comprise the polynucleotide sequence of SEQ ID NO: 9 fused to the polynucleotide sequence of SEQ ID NO: 10 without the intervening nucleic acid described in SEQ ID NO: 11, or the mouse Myo15 promoter can comprise the polynucleotide sequence of SEQ ID NO: 10 fused to the polynucleotide sequence of SEQ ID NO: 9 without the intervening nucleic acid described in SEQ ID NO: 12. Alternatively, the mouse Myo15 promoter can comprise the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 joined by an endogenous intervening polynucleotide sequence (e.g., the first region can have or can comprise a nucleic acid sequence of -7166 to -6983 relative to the mouse Myo15 translation start site, as described in SEQ ID NO: 13 and SEQ ID NO: 33) or a polynucleotide linker. In a mouse Myo15 promoter comprising both SEQ ID NO: 9 and SEQ ID NO: 10, the two sequences can be included in either order (e.g., SEQ ID NO: 9 can be joined to (e.g., precede) SEQ ID NO: 10, or SEQ ID NO: 10 can be joined to (e.g., precede) SEQ ID NO: 9).

[0140] In some embodiments, the mouse Myo15 promoter for use with the compositions and methods described herein is a polynucleotide sequence upstream immediately prior to the mouse Myo15 translation start site (nucleic acids 1 to 1157 relative to the mouse Myo15 translation start site, the sequence of which is shown in SEQ ID NO: 8) or a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a functional portion or derivative thereof. The functional portion of SEQ ID NO: 8 may have a nucleic acid sequence of -590 to -509 (described in SEQ ID NO: 14) and / or a nucleic acid sequence of -266 to -161 (described in SEQ ID NO: 15) relative to the mouse Myo15 translation start site. In some embodiments, the sequence containing SEQ ID NO: 14 has the sequence of SEQ ID NO: 34. In some embodiments, the sequence containing SEQ ID NO: 15 has the sequence of SEQ ID NO: 35. The mouse Myo15 promoter may comprise the polynucleotide sequence of SEQ ID NO: 14 fused to the polynucleotide sequence of SEQ ID NO: 15 without the intervening nucleic acid described in SEQ ID NO: 16, or the mouse Myo15 promoter may comprise the polynucleotide sequence of SEQ ID NO: 15 fused to the polynucleotide sequence of SEQ ID NO: 14 without the intervening nucleic acid described in SEQ ID NO: 17. The mouse Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 34 fused to the nucleic acid sequence of SEQ ID NO: 35 without the intervening nucleic acid described in SEQ ID NO: 38, or the mouse Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 35 fused to the nucleic acid sequence of SEQ ID NO: 41 without an intervening nucleic acid. Alternatively, the mouse Myo15 promoter may comprise the sequences of SEQ ID NO: 14 and SEQ ID NO: 15 joined by an endogenous intervening polynucleotide sequence (e.g., the second region may have a nucleic acid sequence of -590 to -161 relative to the mouse Myo15 translation start site as described in SEQ ID NO: 18) or a nucleic acid linker. In a mouse Myo15 promoter containing both SEQ ID NO: 14 and SEQ ID NO: 15, the two sequences may be included in any order (e.g., SEQ ID NO: 14 may be joined to (e.g., precede) SEQ ID NO: 15, or SEQ ID NO: 15 may be joined to (e.g., precede) SEQ ID NO: 14).

[0141] In some embodiments, the mouse Myo15 promoter for use in the compositions and methods described herein comprises a functional portion or derivative of a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a nucleic acid sequence upstream immediately prior to the mouse Myo15 translation start site (the nucleic acids from -1 to -1157 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 8), flanked on both sides by a region comprising the first non-coding exon of the Myo15 gene (the nucleic acids from -6755 to -7209 relative to the mouse Myo15 translation start site, the sequence of which is set forth in SEQ ID NO: 7) having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to a region. For example, a functional portion or derivative of SEQ ID NO: 8 such as SEQ ID NO: 14 or 34 can be directly fused or linked by a nucleic acid linker to a portion of SEQ ID NO: 7 such as any one of SEQ ID NOs: 9-13 and 33, which is directly fused or linked by a nucleic acid linker to a different functional portion of SEQ ID NO: 8 such as SEQ ID NO: 15 or 35. In other embodiments, a functional portion or derivative of SEQ ID NO: 8 such as SEQ ID NO: 15 or 35 can be directly fused or linked by a nucleic acid linker to a portion of SEQ ID NO: 7 such as any one of SEQ ID NOs: 9-13 and 33, which is directly fused or linked by a nucleic acid linker to a different functional portion of SEQ ID NO: 8 such as SEQ ID NO: 14 or 34. For example, a polynucleotide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the nucleic acid sequences of SEQ ID NOs: 34, 33, and 35 can be fused to generate a polynucleotide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the nucleic acid sequence of SEQ ID NO: 39.In some embodiments, polynucleotides having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the nucleic acid sequences of SEQ ID NO: 35, 33, and 34 are fused to generate a polynucleotide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the nucleic acid sequence of SEQ ID NO: 40.

[0142] Human myosin 15 promoter The polynucleotides of the compositions and methods described herein include nucleic acid sequences derived from regions of the human Myo15 locus that can specifically express a transgene in hair cells, or variants thereof, e.g., having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the regions of the human Myo15 locus that can specifically express a transgene in hair cells. The polynucleotides of the compositions and methods described herein may optionally include a linker that operably links the region of the human Myo15 locus that can specifically express a transgene in hair cells, or the regions of the human Myo15 locus may be directly joined without an intervening linker.

[0143] In some embodiments, the human Myo15 promoter used in the methods and compositions described herein comprises a first region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the sequence set forth in SEQ ID NO: 23 or a functional portion or derivative thereof, and a second region that binds to (e.g., is operably linked to) the sequence set forth in SEQ ID NO: 24 or a functional portion or derivative thereof and has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) thereto. The functional portion of SEQ ID NO: 23 may have the sequence set forth in SEQ ID NO: 25. The functional portion of SEQ ID NO: 24 may have the sequence set forth in SEQ ID NO: 26 and / or the sequence set forth in SEQ ID NO: 27. The second region may comprise the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 without the intervening nucleic acid set forth in SEQ ID NO: 28, or the second region may comprise the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO: 26 without the intervening nucleic acid set forth in SEQ ID NO: 29. Alternatively, the second region may comprise the sequences of SEQ ID NO: 26 and SEQ ID NO: 27 joined by an endogenous intervening nucleic acid sequence (as set forth in SEQ ID NO: 30) or a nucleic acid linker. In a human Myo15 promoter in which the second region comprises both SEQ ID NO: 26 and SEQ ID NO: 27, the two sequences may be included in either order (e.g., SEQ ID NO: 26 may be joined to (e.g., precede) SEQ ID NO: 27, or SEQ ID NO: 27 may be joined to (e.g., precede) SEQ ID NO: 26).

[0144] The first region and the second region of the human Myo15 promoter can be directly bound or bound by a nucleic acid linker. For example, the human Myo15 promoter can be fused to the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30, e.g., SEQ ID NO: 26 and / or 27) without an intervening nucleic acid, or a functional portion or derivative thereof (e.g., SEQ ID NO: 25) of the sequence of SEQ ID NO: 23. Alternatively, a linker can be used to bind a sequence of SEQ ID NO: 23 or a functional portion or derivative thereof (e.g., SEQ ID NO: 25) to a sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30, e.g., SEQ ID NO: 26 and / or 27). Exemplary human Myo15 promoters containing functional portions of both SEQ ID NO: 23 and SEQ ID NO: 24 are provided by SEQ ID NOs: 31 and 32.

[0145] In some embodiments, a sequence of SEQ ID NO: 23 or a functional portion or derivative thereof (e.g., SEQ ID NO: 25) is bound (e.g., operably linked) to a sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30, e.g., SEQ ID NO: 26 and 27), and in some embodiments, the order of the regions is reversed (e.g., a sequence of SEQ ID NO: 24 or a functional portion or derivative thereof (e.g., any one or more of SEQ ID NOs: 26-30, e.g., SEQ ID NO: 26 and / or 27) is bound (e.g., operably linked) to a sequence of SEQ ID NO: 23 or a functional portion or derivative thereof (e.g., SEQ ID NO: 25)). Regardless of the order, the sequence of SEQ ID NO: 23 or a functional portion or derivative thereof and the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof can be directly fused or bound by a nucleic acid linker as described above.

[0146] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to the sequence shown in SEQ ID NO: 23 or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 23 may have the sequence of the nucleic acid shown in SEQ ID NO: 25.

[0147] In some embodiments, the human Myo15 promoter for use in the compositions and methods described herein comprises a region having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity) to the sequence shown in SEQ ID NO: 18 or a functional portion or derivative thereof. The functional portion of SEQ ID NO: 24 may have the sequence shown in SEQ ID NO: 26 and / or the sequence shown in SEQ ID NO: 27. The human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 26 fused to the nucleic acid sequence of SEQ ID NO: 27 without the intervening nucleic acid described in SEQ ID NO: 28, or the human Myo15 promoter may comprise the nucleic acid sequence of SEQ ID NO: 27 fused to the nucleic acid sequence of SEQ ID NO: 26 without the intervening nucleic acid described in SEQ ID NO: 29. Alternatively, the human Myo15 promoter may comprise the sequences of SEQ ID NO: 26 and SEQ ID NO: 27 joined by an endogenous intervening nucleic acid sequence (e.g., as shown in SEQ ID NO: 30) or a nucleic acid linker. In a human Myo15 promoter comprising both SEQ ID NO: 26 and SEQ ID NO: 27, the two sequences may be included in any order (e.g., SEQ ID NO: 26 may be joined to (e.g., preceded by) SEQ ID NO: 27, or SEQ ID NO: 27 may be joined to (e.g., preceded by) SEQ ID NO: 26).

[0148] The length of the nucleic acid linker for use with the human Myo15 promoter described herein can be about 5 kb or less (e.g., about 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, 90 bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp, 30 bp, 25 bp, 20 bp, 15 bp, 10 bp, 5 bp, 4 bp, 3 bp, 2 bp, or less). The nucleic acid linker that can be used with the human Myo15 promoter described herein does not interfere with the ability of the Myo15 promoter of the present invention to induce transgene expression in hair cells.

[0149] The above-described Myo15 promoter is summarized in Table 3 below.

[0150]

Table 3-1

[0151]

Table 3-2

[0152]

Table 3-3

[0153]

Table 3-4

[0154]

Table 3-5

[0155]

Table 3-6

[0156]

Table 3-7

[0157]

Table 3-8

[0158]

Table 3-9

[0159]

Table 3-10

[0160]

Table 3-11

[0161]

Table 3-12

[0162]

Table 3-13

[0163]

Table 3-14

[0164]

Table 3-15

[0165]

Table 3-16

[0166]

Table 3-17

[0167]

Table 3-18

[0168]

Table 3-19

[0169]

Table 3-20

[0170] Additional Myo15 promoters useful in combination with the compositions and methods described herein include nucleic acid molecules having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to the polynucleotide sequences shown in Table 3 and to functional portions or derivatives of the polynucleotide sequences shown in Table 3. The Myo15 promoters described in Table 3 are characterized in International Patent Application Publication Nos. WO2019210181A1 and WO2020163761A1, which are incorporated herein by reference.

[0171] In embodiments where the smCBA promoter is included in the dual vector system described herein (e.g., in the first vector of the dual vector system), the smCBA promoter can have the sequence of the smCBA promoter described in U.S. Patent No. 8,298,818, which is incorporated herein by reference. In some embodiments, the smCBA promoter has the following sequence.

[0172] GGTACCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCA (SEQ ID NO: 44).

[0173] When a polynucleotide encoding OTOF is integrated into the nuclear DNA of mammalian cells or stabilized as an episomal monomer or concatemer, transcription of this polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing mammalian cells to external chemical reagents such as agents that regulate the binding of transcription factors and / or RNA polymerase to mammalian promoters and thus regulate gene expression. The chemical reagent can function, for example, to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent can function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, thereby increasing the transcription rate of a gene located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to mammalian cells to promote gene expression according to established protocols.

[0174] Other DNA sequence elements that may be included in the nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences. An enhancer represents another class of regulatory elements that induces a conformational change in the polynucleotide containing the gene of interest such that the DNA assumes a three-dimensional orientation favorable for the binding of transcription factors and RNA polymerase at the transcription start site. Thus, the polynucleotides for use in the compositions and methods described herein include polynucleotides encoding OTOF, and further include mammalian enhancer sequences. Currently, many enhancer sequences derived from mammalian genes are known, and examples include enhancers of genes encoding mammalian globin, elastase, albumin, α-fetoprotein, and insulin. The enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses that can infect eukaryotic cells. Examples include the SV40 enhancer (bp 100-270) in the second half of the origin of replication, the cytomegalovirus immediate early promoter enhancer, the polyoma enhancer in the second half of the origin of replication, and the adenovirus enhancer. Additional enhancer sequences that induce activation of eukaryotic gene transcription are disclosed in Yaniv, et al., Nature 297:17 (1982). The enhancer may be spliced, for example, at the 5' or 3' position of this gene, within a vector containing a polynucleotide encoding the OTOF protein. In a preferred orientation, the enhancer is placed 5' to the promoter, which is then placed 5' to the polynucleotide encoding the OTOF protein.

[0175] The nucleic acid vectors described herein may include the Woodchuck post-transcriptional regulatory element (WPRE). WPRE acts at the mRNA level and increases the total amount of intracellular mRNA by promoting the nuclear export of transcripts and / or by enhancing the efficiency of polyadenylation of nascent transcripts. The addition of WPRE to a vector can result in a substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo. WPRE can be located in a second nucleic acid vector between the polynucleotide encoding the C-terminal portion of the OTOF protein and the poly(A) sequence. In some embodiments of the compositions and methods described herein, WPRE has the following sequence.

[0176] GATCCAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGA (SEQ ID NO: 45).

[0177] In other embodiments, WPRE has the following sequence. AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAA(SEQ ID NO: 46).

[0178] In some embodiments, the nucleic acid vectors for use in the compositions and methods described herein include a reporter sequence, which can be useful, for example, for verifying the expression of the OTOF gene in specific cells and tissues (e.g., cochlear hair cells). Reporter sequences that can be provided in the transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters well known in the art. When associated with regulatory elements that drive their expression, reporter sequences provide a signal detectable by conventional means, including enzyme assays, radiation assays, colorimetric assays, fluorescence assays or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of the vector incorporating the signal is detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the vector incorporating the signal may be visually measured by the production of color or light in a luminometer.

[0179] Dual hybrid vector for expressing OTOF The otof isoform 5 protein (e.g., the otof isoform 5 protein having the sequence of SEQ ID NO: 1) can be expressed in mammalian cells using a dual hybrid vector system. In this method, two nucleic acid vectors (e.g., two adeno-associated virus vectors) are used to express a single large protein. Each of the two nucleic acid vectors (e.g., two adeno-associated virus vectors) contains a portion of the polynucleotide encoding the protein (e.g., one vector contains the polynucleotide encoding the N-terminal portion of the protein, and the other vector contains the polynucleotide encoding the C-terminal portion of the protein, and the polynucleotide encoding the N-terminal portion of the protein and the polynucleotide encoding the C-terminal portion of the protein do not overlap). The dual hybrid vector also features an overlapping region (e.g., a recombination region contained within each vector) where homologous recombination can occur, as well as a splice donor sequence and a splice acceptor sequence (e.g., the first vector contains the splice donor sequence and the second vector contains the splice acceptor sequence). The recombination region is 3’ of the splice donor sequence of the first nucleic acid vector and 5’ of the splice acceptor sequence of the second nucleic acid vector. Next, the first polynucleotide sequence and the second polynucleotide sequence can combine to form a single sequence based on one of two mechanisms: 1) recombination in the overlapping region, or 2) concatemerization of the ITRs. The remaining recombination-inducing region(s) and / or concatemerized ITRs can be removed by splicing, resulting in the formation of a continuous polynucleotide sequence encoding the full-length protein of interest.

[0180] The recombinant regions that can be used in the compositions and methods described herein include the F1 phage AK gene having the following sequence: GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAAT (SEQ ID NO: 47), and an alkaline phosphatase (AP) gene fragment described in U.S. Patent No. 8,236,557, which is incorporated herein by reference. In some embodiments, the AP gene fragment has the following sequence.

[0181] CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 48).

[0182] In some embodiments, the AP gene fragment has the following sequence. CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTCCGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGA (SEQ ID NO: 49).

[0183] In some embodiments, the AP gene fragment has the following sequence. GCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGGCGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 50).

[0184] In some embodiments, the AP gene fragment has the following sequence. CCCCGGGTGCGCGGCGTCGGTGGTGCCGGCGGGGGGCGCCAGGTCGCAGGCGGTGTAGGGCTCCAGGCAGGCGGCGAAGGCCATGACGTGCGCTATGAAGGTCTGCTCCTGCACGCCGTGAACCAGGTGCGCCTGCGGGCCGCGCGCGAACACCGCCACGTCCTCGCCTGCGTGGGTCTCTTCGTCCAGGGGCACTGCTGACTGCTGCCGATACTCGGGGCTCCCGCTCTCGCTCTCGGTAACATCCGGCCGGGCGCCGTCCTTGAGCACATAGCCTGGACCGTTTC (SEQ ID NO: 51).

[0185] In some embodiments, the AP gene fragment has the following sequence. CGTATAGGAGGACCGTGTAGGCCTTCCTGTCCCGGGCCTTGCCAGCGGCCAGCCCGATGAAGGAGCTCCCTCGCAGGGGGTAGCCTCCGAAGGAGAAGACGTGGGAGTGGTCGGCAGTGACGAGGCTCAGCGTGTCCTCCTCGCTGGTGAGCTGGCCCGCCCTCTCAATGGCGTCGTCGAACATGATCGTCTCAGTCAGTGCCCGGTAAGCCCTGCTTTCATGATGACCATGGTCGATGCGACCACCCTCCACGAAGAGGAAGAAGCCGCGGGGGTGTCTGCTCAGCAGG (SEQ ID NO: 52).

[0186] In some embodiments, the AP gene fragment has the following sequence. CGCAGGGCAGCCTCTGTCATCTCCATCAGGGAGGGGTCCAGTGTGGAGTCTCGGTGGATCTCGTATTTCATGTCTCCAGGCTCAAAGAGACCCATGAGATGGGTCACAGACGGGTCCAGGGAAGCCTGCATGAGCTCAGTGCGGTTCCACACGTACCGGGCACCCTGGCGTTCGCCGAGCCATTCCTGCACCAGATTCTTCCCGTCCAGCCTGGTCCCACCTTGGCTGTAGTCATCTGGGTACTCAGGGTCTGGGGTTCCCATGCGAAACATGTACTTTCGGCCTCCA (SEQ ID NO: 53).

[0187] Exemplary splice donor sequences for use in the methods and compositions described herein can include the following sequences. GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGA (SEQ ID NO: 54).

[0188] Exemplary splice acceptor sequences for use in the methods and compositions described herein can include the following sequences. TAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 55).

[0189] Additional examples of splice donor and splice acceptor sequences are known in the art. The dual hybrid vectors for use in the methods and compositions described herein are designed such that approximately half of the OTOF gene is contained within each vector (e.g., each vector contains a polynucleotide encoding approximately half of the OTOF isoform 5 protein). The determination of how to divide the polynucleotide sequence between the two nucleic acid vectors can be made based on the size of the promoter and the position of the portion of the polynucleotide encoding the OTOF C2 domain. In a dual hybrid vector system, when using a short promoter such as the CAG, CMV, smCBA, or Myo15 promoter having a sequence of 1 kb or less (e.g., the Myo15 promoter described above, e.g., the Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) (e.g., a promoter of 1 kb or less, e.g., approximately 1 kb, 950 bp, 900 bp, 850 bp, 800 bp, 750 bp, 700 bp, 650 bp, 600 bp, 550 bp, 500 bp, 450 bp, 400 bp, 350 bp, 300 bp, or less), the OTOF polynucleotide sequence can be divided between the two nucleic acid vectors at an exon boundary that occurs after the portion of the polynucleotide encoding the C2D domain and before the portion of the polynucleotide encoding the C2E domain, e.g., the exon 26 / 27 boundary. The nucleic acid vector containing a promoter of this size can optionally contain the OTOF UTR (e.g., full-length 5' and 3' UTR). In a dual hybrid vector system, when using a long promoter such as the Myo15 promoter longer than 1 kb (e.g., SEQ ID NO: 19) (e.g., a promoter longer than 1 kb, e.g., 1.1 kb, 1.25 kb, 1.5 kb, 1.75 kb, 2 kb, 2.5 kb, 3 kb or more), the OTOF polynucleotide sequence can be divided between the two nucleic acid vectors at an exon boundary that occurs either after the portion of the polynucleotide encoding the C2C domain and before the portion of the polynucleotide encoding the C2D domain, e.g., the exon 19 / 20 boundary or the exon 20 / 21 boundary, or within the portion of the polynucleotide encoding the C2D domain, e.g., the exon 25 / 26 boundary.Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, e.g., Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) can be used even in a dual vector system designed for large promoters. In this case, additional elements (e.g., OTOF UTR sequence) can be included in the first vector (e.g., a vector containing a part of the polynucleotide encoding the C2C domain).

[0190] One exemplary two-hybrid vector system using a short promoter includes a CAG promoter operably linked to exons 1-26 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), a 3' splice donor sequence of the polynucleotide sequence, and a recombination-inducing region 3' of the splice donor sequence, a first nucleic acid vector; a recombination-inducing region, a 3' splice acceptor sequence 3' of the recombination-inducing region, a polynucleotide 3' of the splice acceptor sequence including exons 27-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF, e.g., SEQ ID NO: 1), and a second nucleic acid vector including a poly(A) sequence (e.g., bGH poly(A) signal sequence). The first nucleic acid vector and the second nucleic acid vector can each also include full-length 5' and 3' OTOF UTRs (e.g., a 127 bp human OTOF 5'UTR can be included in the first nucleic acid vector and a 1035 bp human OTOF 3'UTR can be included in the second nucleic acid vector). Another exemplary two-hybrid vector system using a short promoter includes an smCBA promoter or a Myo15 promoter of 1 kb or less (e.g., a Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), a 3' splice donor sequence of the polynucleotide sequence, and a recombination-inducing region 3' of the splice donor sequence, a first nucleic acid vector; a recombination-inducing region, a 3' splice acceptor sequence 3' of the recombination-inducing region, a polynucleotide 3' of the splice acceptor sequence including exons 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF, e.g., SEQ ID NO: 1), and a second nucleic acid vector including a poly(A) sequence (e.g., bGH poly(A) signal sequence).The first nucleic acid vector can also include the full-length 5' OTOF UTR (for example, a 127 bp human OTOF 5' UTR can be included in the first nucleic acid vector). The CMV promoter can be used in place of the CAG, smCBA, or Myo15 promoter in any of the aforementioned dual vector systems.

[0191] An exemplary dual hybrid vector system using a long promoter comprises a first nucleic acid vector that operably links a Myo15 promoter of more than 1 kb (for example, SEQ ID NO: 19), a 3' splice donor sequence of the polynucleotide sequence, and a recombination-inducing region 3' of the splice donor sequence, to exons 1-19 or 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (for example, human OTOF isoform 5, for example, SEQ ID NO: 1); and a second nucleic acid vector comprising a recombination-inducing region, a splice acceptor sequence 3' of the recombination-inducing region, a polynucleotide 3' of the splice acceptor sequence comprising exons 20-45 and 47 (when the first nucleic acid vector comprises exons 1-19 of the polynucleotide) or exons 21-45 and 47 (when the first nucleic acid vector comprises exons 1-20 of the polynucleotide) of a polynucleotide encoding an OTOF isoform 5 protein (for example, human OTOF isoform 5, for example, SEQ ID NO: 1), and a poly(A) sequence (for example, bGH poly(A) signal sequence). The first nucleic acid vector and the second nucleic acid vector of the aforementioned Myo15 promoter dual hybrid vector system do not include the OTOF UTR. A short promoter (for example, CMV promoter, CAG promoter, smCBA promoter, or Myo15 promoter having a sequence of 1 kb or less, for example, Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) can also be used in the aforementioned dual vector system designed for a large promoter. When a short promoter is included in these dual vector systems, the 5' OTOF UTR may be included in the first vector.

[0192] To accommodate the OTOF UTR, the OTOF coding sequence can be split at a different location. A first nucleic acid vector contains a Myo15 promoter of more than 1 kb (e.g., SEQ ID NO: 19) operably linked to exons 1-25 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), a 3' splice donor sequence of the polynucleotide sequence, and a recombination-inducing region 3' of the splice donor sequence. A second nucleic acid vector contains a recombination-inducing region, a 3' splice acceptor sequence 3' of the recombination-inducing region, a polynucleotide 3' of the splice acceptor sequence containing exons 26-45 and 47 of a polynucleotide encoding an OTOF protein (e.g., human OTOF isoform 5, e.g., SEQ ID NO: 1), and a poly(A) sequence (e.g., bGH poly(A) signal sequence). In a dual hybrid vector system, the second nucleic acid also contains a full-length OTOF 3'UTR (e.g., 1035 bp human OTOF UTR). Short promoters (e.g., CMV promoter, CAG promoter, smCBA promoter, or a Myo15 promoter having a sequence of 1 kb or less, e.g., a Myo15 promoter having the sequence of SEQ ID NO: 21 or SEQ ID NO: 42) can also be used in the aforementioned dual vector system designed for large promoters. When these dual vector systems contain short promoters, the 5' OTOF UTR may be included in the first vector.

[0193] The polynucleotide sequence encoding the OTOF isoform 5 protein can be a cDNA sequence (e.g., a sequence without introns). In some embodiments, the first nucleic acid vector and / or the second nucleic acid vector of the dual vector system can include intron sequences. The intron sequence can be included between one or more exons of the OTOF coding sequence, or the intron sequence can be included between an exon of the coding sequence and another component of the nucleic acid vector (e.g., between an exon of the OTOF coding sequence and a splice donor sequence in the first nucleic acid vector, or between an exon of the OTOF coding sequence and a splice acceptor sequence in the second nucleic acid vector).

[0194] In some embodiments, the polynucleotide encoding OTOF isoform 5 is split between the first nucleic acid vector and the second nucleic acid vector (e.g., an AAV vector) of the dual vector system at the exon 20 / 21 boundary. When the polynucleotide encoding OTOF isoform 5 is split between the first nucleic acid vector and the second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide sequence encoding the N-terminal portion of OTOF has the following sequence.

[0195]

[0196] When the polynucleotide encoding otoferlin isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the polynucleotide sequence encoding the C-terminal portion of otoferlin has the following sequence.

[0197]

[0198] In an embodiment where the polynucleotide encoding otof isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the N-terminal portion of the otof polypeptide has the following sequence.

[0199] MALLIHLKTVSELRGRGDRIAKVTFRGQSFYSRVLENCEDVADFDETFRWPVASSIDRNEMLEIQVFNYSKVFSNKLIGTFRMVLQKVVEESHVEVTDTLIDDNNAIIKTSLCVEVRYQATDGTVGSWDDGDFLGDESLQEEEKDSQETDGLLPGSRPSSRPPGEKSFRRAGRSVFSAMKLGKNRSHKEEPQRPDEPAVLEMEDLDHLAIRLGDGLDPDSVSLASVTALTTNVSNKRSKPDIKMEPSAGRPMDYQVSITVIEARQLVGLNMDPVVCVEVGDDKKYTSMKESTNCPYYNEYFVFDFHVSPDVMFDKIIKISVIHSKNLLRSGTLVGSFKMDVGTVYSQPEHQFHHKWAILSDPDDISSGLKGYVKCDVAVVGKGDNIKTPHKANETDEDDIEGNLLLPEGVPPERQWARFYVKIYRAEGLPRMNTSLMANVKKAFIGENKDLVDPYVQVFFAGQKGKTSVQKSSYEPLWNEQVVFTDLFPPLCKRMKVQIRDSDKVNDVAIGTHFIDLRKISNDGDKGFLPTLGPAWVNMYGSTRNYTLLDEHQDLNEGLGEGVSFRARLLLGLAVEIVDTSNPELTSSTEVQVEQATPISESCAGKMEEFFLFGAFLEASMIDRRNGDKPITFEVTIGNYGNEVDGLSRPQRPRPRKEPGDEEEVDLIQNASDDEAGDAGDLASVSSTPPMRPQVTDRNYFHLPYLERKPCIYIKSWWPDQRRRLYNANIMDHIADKLEEGLNDIQEMIKTEKSYPERRLRGVLEELSCGCCRFLSLADKDQGHSSRTRLDRERLKSCMREL (SEQ ID NO: 58).

[0200] In an embodiment where the polynucleotide encoding OTOF isoform 5 is split between a first nucleic acid vector and a second nucleic acid vector (e.g., an AAV vector) at the exon 20 / 21 boundary, the C-terminal portion of the OTOF polypeptide has the following sequence.

[0201]

[0202] A transfer plasmid that can be used to produce a nucleic acid vector for use in the compositions and methods described herein is provided in Table 4. The transfer plasmid (e.g., a plasmid containing a DNA sequence that is delivered by a nucleic acid vector, e.g., delivered by AAV) is co-delivered into producer cells together with a helper plasmid (e.g., a plasmid that provides proteins necessary for AAV production) and a rep / cap plasmid (e.g., a plasmid that provides an AAV capsid protein and a protein that inserts the transfer plasmid DNA sequence into the capsid shell, etc.) to generate a nucleic acid vector for administration (e.g., an AAV vector). Nucleic acid vectors (e.g., nucleic acid vectors (e.g., AAV vectors)) containing polynucleotides encoding the N-terminal portion of the OTOF isoform 5, and nucleic acid vectors (e.g., AAV vectors) containing polynucleotides encoding the C-terminal portion of the OTOF isoform 5 can be combined (e.g., in a single formulation) prior to administration. The following transfer plasmids: SEQ ID NO: 60 and SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 63, SEQ ID NO: 64 and SEQ ID NO: 61, SEQ ID NO: 65 and SEQ ID NO: 63, SEQ ID NO: 66 and SEQ ID NO: 67, and SEQ ID NO: 68 and SEQ ID NO: 67 are designed to produce nucleic acid vectors (e.g., AAV vectors) for co-formulation or co-administration (e.g., simultaneous or sequential administration) in a dual hybrid vector system.

[0203]

Table 4-1

[0204]

Table 4-2

[0205]

Table 4-3

[0206]

Table 4-4

[0207]

Table 4-5

[0208]

Table 4-6

[0209]

Table 4-7

[0210]

Table 4-8

[0211]

Table 4-9

[0212]

Table 4-10

[0213]

Table 4-11

[0214]

Table 4-12

[0215]

Table 4-13

[0216]

Table 4-14

[0217]

Table 4-15

[0218]

Table 4-16

[0219]

Table 4-17

[0220]

Table 4-18

[0221]

Table 4-19

[0222]

Table 4-20

[0223]

Table 4-21

[0224]

Table 4-22

[0225]

Table 4-23

[0226]

Table 4-24

[0227]

Table 4-25

[0228]

Table 4-26

[0229]

Table 4-27

[0230]

Table 4-28

[0231]

Table 4-29

[0232]

Table 4-30

[0233]

Table 4-31

[0234]

Table 4-32

[0235]

Table 4-33

[0236]

Table 4-34

[0237]

Table 4-35

[0238]

Table 4-36

[0239]

Table 4-37

[0240]

Table 4-38

[0241]

Table 4-39

[0242]

Table 4-40

[0243]

Table 4-41

[0244]

Table 4-42

[0245]

Table 4-43

[0246]

Table 4-44

[0247]

Table 4-45

[0248]

Table 4-46

[0249]

Table 4-47

[0250]

Table 4-48

[0251]

Table 4-49

[0252]

Table 4-50

[0253]

Table 4-51

[0254]

Table 4-52

[0255]

Table 4-53

[0256]

Table 4-54

[0257]

Table 4-55

[0258]

Table 4-56

[0259]

Table 4-57

[0260]

Table 4-58

[0261]

Table 4-59

[0262]

Table 4-60

[0263]

Table 4-61

[0264]

Table 4-62

[0265]

Table 4-63

[0266]

Table 4-64

[0267]

Table 4-65

[0268]

Table 4-66

[0269]

Table 4-67

[0270]

Table 4-68

[0271]

Table 4-69

[0272]

Table 4-70

[0273]

Table 4-71

[0274]

Table 4-72

[0275]

Table 4-73

[0276]

Table 4-74

[0277]

Table 4-75

[0278]

Table 4-76

[0279]

Table 4-77

[0280]

Table 4-78

[0281]

Table 4-79

[0282]

Table 4-80

[0283]

Table 4-81

[0284]

Table 4-82

[0285]

Table 4-83

[0286]

Table 4-84

[0287]

Table 4-85

[0288]

Table 4-86

[0289]

Table 4-87

[0290]

Table 4-88

[0291] Vector for OTOF expression In addition to achieving high-speed transcription and translation, stable expression of foreign genes in mammalian cells can be achieved by integrating a polynucleotide containing the gene into the nuclear genome of mammalian cells. Various vectors have been developed for delivering and integrating polynucleotides encoding foreign proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are disclosed, for example, in WO1994 / 011026, which is incorporated herein by reference. Expression vectors for use in the compositions and methods described herein include a polynucleotide sequence encoding a portion of OTOF, as well as additional sequence elements used, for example, for the expression of these agents and / or the integration of these polynucleotide sequences into the genome of mammalian cells. Specific vectors that can be used for the expression of OTOF include plasmids containing regulatory sequences such as promoters and enhancer regions that direct gene transcription. Other vectors useful for OTOF expression include polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of the mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to direct efficient transcription of the gene incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0292] AAV vector for nucleic acid delivery In some embodiments, the nucleic acids of the compositions and methods described herein are incorporated into recombinant AAV (rAAV) vectors and / or viral particles to facilitate their introduction into cells. rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide encoding the N-terminal or C-terminal portion of the OTOF protein) and (2) viral sequences that promote the stability and expression of the heterologous gene. The viral sequences can include sequences of AAV that are required in cis for DNA replication and packaging into viral particles (e.g., functional ITRs). Such rAAV vectors can also include a marker or reporter gene. In useful rAAV vectors, all or part of one or more AAV WT genes is deleted, but functional flanking ITR sequences are retained. The AAV ITR can be of any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITR can be an AAV2 ITR. Methods of using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), each of which disclosures is incorporated herein by reference in its entirety for its disclosure of AAV vectors for gene delivery.

[0293] The nucleic acids and vectors described herein can be incorporated into rAAV viral particles to facilitate introduction of the nucleic acid or vector into cells. The AAV capsid protein constitutes the non-nucleic acid portion outside the viral particle and is encoded by the AAV cap gene. The cap gene encodes the three viral coat proteins VP1, VP2, and VP3 required for assembly of the viral particle. Construction of rAAV viral particles is described, for example, in US 5,173,414, US 5,139,941, 5,863,541, 5,869,305, 6,057,152, and 6,376,237, as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), each of which is incorporated herein by reference because they pertain to AAV vectors for gene delivery.

[0294] Examples of rAAV viral particles useful in combination with the compositions and methods described herein include viral particles derived from various AAV serotypes, including AAV1, AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. When targeting cochlear hair cells, AAV1, AAV2, AAV6, AAV9, Anc80, Anc80L65, DJ / 9, 7m8, and PHP.B may be particularly useful. Serotypes evolved for retinal transduction may also be used in the methods and compositions described herein. The first nucleic acid vector and the second nucleic acid vector (e.g., an AAV vector) of the compositions and methods described herein may have the same serotype or different serotypes. Construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated herein by reference because they pertain to AAV vectors for gene delivery.

[0295] Useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include those in which an AAV vector of a given serotype (e.g., AAV9) is pseudotyped with a capsid gene derived from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0296] AAV viral particles having mutations within the capsid of the viral particle can be used to infect certain cell types more effectively than non-mutated capsid viral particles. For example, suitable AAV variants can have ligand insertion mutations to facilitate targeting AAV to certain cell types. The construction and characterization of AAV capsid variants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV viral particles that can be used in the methods described herein include capsid hybrids generated by viral molecular breeding and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0297] In some embodiments, the use of an AAV vector to deliver a functional OTOF isoform 5 protein requires the use of a dual vector system, where the first member of the dual vector system encodes the N-terminal portion of the OTOF isoform 5 protein and the second member encodes the C-terminal portion of the OTOF isoform 5 protein, such that upon administration of the dual vector system to a cell, the polynucleotide sequences contained within the two vectors bind to form a single sequence, which can result in the production of the full-length OTOF isoform 5 protein.

[0298] In some embodiments, the first member of the dual vector system also includes, in the 5' to 3' order, a first inverted terminal repeat ("ITR"), a promoter (e.g., the Myo15 promoter), a Kozak sequence, the N-terminal portion of the OTOF isoform 5 coding sequence, a splice donor sequence, an AP gene fragment (e.g., the AP head sequence), and a second ITR. The second member of the dual vector system includes, in the 5' to 3' order, a first ITR, an AP gene fragment (e.g., the AP head sequence), a splice acceptor sequence, the C-terminal portion of the OTOF isoform 5 coding sequence, a polyA sequence, and a second ITR. In some embodiments, the N-terminal portion of the OTOF isoform 5 coding sequence and the C-terminal portion of the OTOF isoform 5 coding sequence do not overlap and bind intracellularly (e.g., by recombination at the overlapping region (AP gene fragment) or by concatemerization of the ITRs) to generate the full-length OTOF isoform 5 amino acid sequence as shown in SEQ ID NO: 1. In certain embodiments, the N-terminal portion of the OTOF isoform 5 coding sequence encodes amino acids 1 to 802 of SEQ ID NO: 1 (SEQ ID NO: 58), and the C-terminal portion of the OTOF isoform 5 coding sequence encodes amino acids 803 to 1997 of SEQ ID NO: 1 (SEQ ID NO: 59).

[0299] In some embodiments, the first member of the dual vector system comprises the Myo15 promoter of SEQ ID NO: 21 (also represented by nucleotides 235-1199 of SEQ ID NO: 66), operably linked to a nucleotide encoding the N-terminal 802 amino acids of the OTOF isoform 5 protein (amino acids 1-802 of SEQ ID NO: 1). It is encoded by exons 1-20 of the native polynucleotide sequence encoding the protein. In certain embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5 protein is nucleotides 1222-3627 of SEQ ID NO: 66. In some embodiments, the nucleotide sequence encoding the N-terminal amino acids of the OTOF isoform 5 protein is any nucleotide sequence encoding amino acids 1-802 of SEQ ID NO: 1 due to the redundancy of the genetic code. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or fully codon optimized for expression. In some embodiments, the first member of the dual vector system comprises a Kozak sequence corresponding to nucleotides 1216-1225 of SEQ ID NO: 66. In some embodiments, the first member of the dual vector system comprises a splice donor sequence corresponding to nucleotides 3628-3711 of SEQ ID NO: 66. In some embodiments, the first member of the dual vector system comprises an AP leader sequence corresponding to nucleotides 3718-4004 of SEQ ID NO: 66. In certain embodiments, the first member of the dual vector system comprises nucleotides 235-4004 of SEQ ID NO: 66, flanked on each of the 5' and 3' sides by inverted terminal repeats. In some embodiments, the adjacent inverted terminal repeats are any variant of the AAV2 inverted terminal repeats that can be encapsidated by a plasmid carrying the AAV2 Rep gene. In certain embodiments, the 5' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 66, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).The 3' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 4098 to 4227 of SEQ ID NO: 66, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). For any given pair of inverted terminal repeat sequences in a transfer plasmid used to generate a viral vector (usually by transfecting the plasmid into cells together with other plasmids having AAV genes required for viral vector formation), for example, any of SEQ ID NO: 60, 62, 64, 65, 66, or 68, those skilled in the art will understand that the corresponding sequences in the viral vector may change because the ITRs take on a "flip" or "flop" orientation during recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as the sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4227 of SEQ ID NO: 66.

[0300] In some embodiments, the second member of the dual vector system contains nucleotides followed by a stop codon immediately after the C-terminal 1195 amino acids (amino acids 803-1997 of SEQ ID NO: 1) of the OTOF isoform 5 protein. In certain embodiments, the nucleotide sequence encoding the C-terminal amino acids of the OTOF isoform 5 protein is nucleotides 587-4174 of SEQ ID NO: 67. In some embodiments, the nucleotide sequence encoding the C-terminal amino acids of the OTOF isoform 5 protein is any nucleotide sequence encoding amino acids 803-1997 of SEQ ID NO: 1 due to the redundancy of the genetic code. The nucleotide sequence encoding the OTOF isoform 5 protein can be partially or fully codon-optimized for expression. In some embodiments, the second member of the dual vector system contains a splice acceptor sequence corresponding to nucleotides 538-586 of SEQ ID NO: 67. In some embodiments, the second member of the dual vector system contains an AP leader sequence corresponding to nucleotides 229-515 of SEQ ID NO: 67. In some embodiments, the second member of the dual vector system contains a poly(A) sequence corresponding to nucleotides 4217-4438 of SEQ ID NO: 67. In certain embodiments, the second member of the dual vector system contains nucleotides 229-4438 of SEQ ID NO: 67 flanked by inverted terminal repeats on the 5' and 3' sides, respectively. In some embodiments, the adjacent inverted terminal repeats are any variant of the AAV2 inverted terminal repeats that can be capsid-formed by a plasmid carrying the AAV2 Rep gene. In certain embodiments, the 5' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 12-141 of SEQ ID NO: 67, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).The 3'-adjacent inverted terminal repeat has a sequence corresponding to nucleotides 4526 to 4655 of SEQ ID NO: 67, or a sequence having at least 80% sequence identity thereto (at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). For any given pair of inverted terminal repeat sequences in the transfer plasmid used to create a viral vector (usually by transfecting the plasmid into a cell together with another plasmid having the AAV genes necessary for viral vector formation), for example, any of SEQ ID NO: 61, 63, or 67, those skilled in the art will understand that the corresponding sequences in the viral vector may change because the ITRs take on a "flip" or "flop" orientation during recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same as the sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the first member of the dual vector system comprises nucleotides 12 to 4655 of SEQ ID NO: 67.

[0301] In some embodiments, the dual vector system is an AAV1 dual vector system. In some embodiments, the dual vector system is an AAV9 dual vector system. Pharmaceutical composition The nucleic acid vectors (e.g., AAV vectors) described herein can be incorporated into a vehicle for administration to a patient, such as a human patient suffering from sensorineural hearing loss or auditory neuropathy, as described herein. A pharmaceutical composition comprising a vector, such as a viral vector, containing a polynucleotide encoding an OTOF isoform 5 protein can be prepared using methods known in the art. For example, such compositions can be prepared in a desired form, such as a lyophilized formulation or an aqueous solution, using, for example, a physiologically acceptable carrier, excipient, or stabilizer (Remington’s Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980); incorporated herein by reference).

[0302] A mixture of the nucleic acid vectors (e.g., AAV vectors) described herein can be prepared in water appropriately mixed with one or more excipients, carriers, or diluents. Dispersions may also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and in oils. These formulations may contain preservatives to prevent the growth of microorganisms under normal storage and use conditions. Suitable pharmaceutical forms for injection include sterile aqueous solutions or sterile dispersions and sterile powders for the immediate preparation of injectable sterile solutions or sterile dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulation may be sterile and may have a fluidity that allows for easy injection. The formulation may be stable under the conditions of manufacture and storage and may be protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Suitable fluidity can be maintained, for example, by the use of coating agents such as lecithin, by maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The suppression of the action of microorganisms can be brought about by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, such as sugars or sodium chloride. Prolongation of the absorption of the injectable composition can be brought about by using in the composition agents that delay absorption, such as aluminum monostearate and gelatin.

[0303] For example, the solution containing the pharmaceutical composition described in this specification can be appropriately buffered as necessary, and the liquid diluent can be initially made isotonic with sufficient physiological saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous media that can be employed are known to those skilled in the art in light of the present disclosure. For example, 1 dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution or injected into the site scheduled for injection. Depending on the condition of the subject to be treated, some variation in the dose is inevitable. For local administration to the inner ear, the composition may be formulated to contain a synthetic perilymph solution. An exemplary synthetic perilymph solution contains 20 - 200 mM of NaCl, 1 - 5 mM of KCl, 0.1 - 10 mM of CaCl2, 1 - 10 mM of glucose, and 2 - 50 mM of HEPES, and has a pH between about 6 and 9 and an osmolality of about 300 mOsm / kg. In any case, the person responsible for administration determines the appropriate dose for an individual subject. Further, in the case of human administration, the formulation may meet the standards of sterility, pyrogenicity, general safety, and purity required by the FDA Office of Biologics standards.

[0304] Method of treatment The compositions described herein may be administered to a subject with sensorineural hearing loss or auditory nerve damage by various routes such as, for example, local administration to the inner ear (e.g., injection or catheter insertion through the round window membrane, injection into the semicircular canals, by canalostomy, or administration to the perilymph or endolymph by intratympanic or middle ear injection, e.g., administration to cochlear hair cells), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. When the composition is administered by direct delivery to the inner ear, a second fenestra or vent may be added at another location in the inner ear. The most appropriate route of administration in a given case depends on the particular composition to be administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time and route of administration), the patient's age, weight, gender, severity of the disease to be treated, the patient's diet, and the patient's excretion rate. The composition may be administered once or more than once (e.g., once a year, twice a year, three times a year, every other month, monthly, or every other week). In some embodiments, the first nucleic acid vector and the second nucleic acid vector (e.g., an AAV vector) are administered simultaneously (e.g., in one composition). In some embodiments, the first nucleic acid vector and the second nucleic acid vector (e.g., an AAV vector) are administered sequentially (e.g., the second nucleic acid vector is administered immediately after the first nucleic acid vector, or 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 8 hours, 12 hours, 1 day, 2 days, 7 days, 2 weeks, 1 month, or more after the first nucleic acid vector). The first nucleic acid vector and the second nucleic acid vector can have the same or different serotypes (e.g., AAV serotypes).

[0305] Subjects that can be treated as described herein are subjects having or at risk of developing sensorineural hearing loss or auditory neuropathy. The compositions and methods described herein are for subjects having a mutation in OTOF (e.g., a mutation that reduces the function or expression of OTOF, or an OTOF mutation associated with sensorineural hearing loss), subjects having a family history of autosomal recessive sensorineural hearing loss or hearing loss (e.g., a family history of OTOF-related sensorineural hearing loss), or subjects of unknown OTOF mutation status and / or OTOF activity level and can be used to treat. The methods described herein may include the step of screening for mutations in OTOF of the subject prior to treatment or administration with the compositions described herein. The subject can be screened for OTOF mutations using standard methods known to those of skill in the art (e.g., genetic testing). The methods described herein may also include the step of evaluating the hearing of the subject prior to treatment or administration with the compositions described herein. Hearing can be evaluated using standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions. The compositions and methods described herein can also be administered as a prophylactic treatment to patients at risk of developing hearing loss or auditory neuropathy, e.g., patients having a family history of hereditary hearing loss, or patients having an OTOF mutation that has not yet shown hearing loss or auditory impairment.

[0306] Treatment may include administration of a composition containing the nucleic acid vector (e.g., an AAV vector) described herein at various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount to be administered, as well as the specific route of administration and formulation, are within the skill of those in the clinical arts. The unit dose need not be administered as a single injection but may include continuous infusion over a set period. Administration may be carried out using a syringe pump to control the infusion rate in order to minimize damage to the cochlea. When the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the AAV vector is, for example, about 1×10 9 vector genomes (VG) to 1×10 16 VG (e.g., 1×10 9 VG / mL, 2×10 9 VG / mL, 3×10 9 VG / mL, 4×10 9 VG / mL, 5×10 9 VG / mL, 6×10 9 VG / mL, 7×10 9 VG / mL, 8×10 9 VG / mL, 9×10 9 VG / mL, 1×10 10 VG / mL, 2×10 10 VG / mL, 3×10 10 VG / mL, 4×10 10 VG / mL, 5×10 10 VG / mL, 6×10 10 VG / mL, 7×10 10 VG / mL, 8×10 10 VG / mL, 9×10 10 VG / mL, 1×10 11 VG / mL, 2×10 11 VG / mL, 3×10 11 VG / mL, 4×10 11 VG / mL, 5×10 11 VG / mL, 6×1011 VG / mL, 7×10 11 VG / mL, 8×10 11 VG / mL, 9×10 11 VG / mL, 1×10 12 VG / mL, 2×10 12 VG / mL, 3×10 12 VG / mL, 4×10 12 VG / mL, 5×10 12 VG / mL, 6×10 12 VG / mL, 7×10 12 VG / mL, 8×10 12 VG / mL, 9×10 12 VG / mL, 1×10 13 VG / mL, 2×10 13 VG / mL, 3×10 13 VG / mL, 4×10 13 VG / mL, 5×10 13 VG / mL, 6×10 13 VG / mL, 7×10 13 VG / mL, 8×10 13 VG / mL, 9×10 13 VG / mL, 1×10 14 VG / mL, 2×10 14 VG / mL, 3×10 14 VG / mL, 4×10 14 VG / mL, 5×10 14 VG / mL, 6×10 14 VG / mL, 7×10 14 VG / mL, 8×10 14 VG / mL, 9×10 14 VG / mL, 1×10 15 VG / mL, 2×10 15 VG / mL, 3×10 15 VG / mL, 4×10 15 VG / mL, 5×10 15 VG / mL, 6×10 15 VG / mL, 7×10 15 VG / mL, 8×10 15 VG / mL, 9×10 15 VG / mL, or 1×10 16It may have a titer of (VG / mL) in an amount of 1 μL to 200 μL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μL). The AAV vector is about 1×10 7 VG / ear to about 2×10 15 VG / ear (e.g., 1×10 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8 VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×10 13 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 can be administered to the subject at a dose of VG / ear).

[0307] The compositions described herein are administered in an amount sufficient to improve hearing, increase WT OTOF expression (e.g., expression of OTOF isoform 5 in cochlear hair cells, e.g., inner hair cells), or increase OTOF function. Hearing may be evaluated using standard audiometric tests (e.g., pure tone audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions), and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to the auditory measurements obtained prior to treatment. In some embodiments, the compositions are administered in an amount sufficient to improve the subject's ability to understand speech. The compositions described herein can also be administered in an amount sufficient to delay or prevent the onset or progression of sensorineural hearing loss or auditory neuropathy (e.g., in subjects having a mutation in OTOF or a family history of autosomal recessive deafness but not showing hearing impairment, or in subjects showing mild to moderate hearing loss). OTOF expression can be evaluated using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting proteins or mRNAs, and can increase by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to the OTOF expression prior to administration of the compositions described herein. OTOF function can be evaluated directly (e.g., using electrophysiological methods or imaging methods to assess exocytosis) or indirectly based on audiometric tests, and can increase by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) compared to the OTOF function prior to administration of the compositions described herein. These effects can occur after administration of the compositions described herein, e.g., within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more. Depending on the dose and route of administration used for treatment, the patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the composition.According to the results of the evaluation, the patient may be made to receive additional treatment.

[0308] Kit The compositions described herein can be provided as a kit for use in the treatment of sensorineural hearing loss or auditory neuropathy (e.g., hearing loss associated with a mutation in OTOF). The composition can include the nucleic acid vectors described herein (e.g., AAV vectors) (e.g., a first nucleic acid vector comprising a polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein and a second nucleic acid vector comprising a polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein), and optionally can include those packaged in an AAV viral capsid (e.g., AAV1 capsid). The kit can further include an instructional document that instructs the user of the kit, e.g., a physician, to perform the methods described herein. The kit can optionally include a syringe or other instrument for administering the composition.

Examples

[0309] The following examples are presented to provide those skilled in the art with an illustration of how the compositions and methods described herein can be used, made, and evaluated, and are intended solely to exemplify the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0310] Example 1. Human OTOF isoform 5, rather than human OTOF isoform 1, restored the function of OTOF in mice Q828X / Q828X in mice The OTOF gene has multiple long and short isoforms. Studies of human hereditary deafness suggest that the long isoforms are important for inner ear function. However, the roles of these individual long isoforms and other protein variants in inner ear function are not understood. To develop an effective gene therapy for patients with deafness secondary to genetically induced OTOF deficiency, the cDNA sequences encoding the functional OTOF isoforms of the ear must be identified.

[0311] In humans, seven OTOF isoforms have been identified in extra-otic tissues. Two of these isoforms (isoform 1 (V1) and isoform 5 (V5)) are long (both 1997 amino acids in length).

[0312] Using the dual hybrid AAV technology, the human V1 isoform and the human V5 isoform were locally delivered to the inner ear of genetically engineered congenital hearing-impaired mice with Otoferlin deficiency. One month after delivery of the human V5 isoform to the congenital hearing-impaired mice, hearing recovery was observed (Figure 1A). In contrast, no hearing recovery was seen in mice injected with the V1 human long isoform. These studies established the OTOF V5 sequence as one that can restore hearing in relation to gene therapy.

[0313] The experiments performed to compare functional recovery and OTOF expression using a dual hybrid vector system to encode either OTOF isoform 1 or OTOF isoform 5 are described in detail below.

[0314] AAV delivery to the inner ear The vector (AAV2quad(Y-F)-smCBA-OTOF isoform 1 (native or codon-optimized), or AAV2quad(Y-F)-smCBA-OTOF isoform 5 (native or codon-optimized)) was injected via the round window membrane into P30-50 OTOF Q828X / Q828XIt was delivered to mutant mice (mouse model of human OTOF mutation p.Gln828Ter). The polynucleotide encoding the N-terminal portion of the OTOF protein and the polynucleotide encoding the C-terminal portion of the OTOF protein were split between two vectors of a double-hybrid vector system using the exon 20 / 21 boundary, and the AP gene fragment (SEQ ID NO: 51) was used as the recombination-inducing region for both vectors of the double-hybrid vector system. The vectors were delivered as follows. The animals were anesthetized with isoflurane. Ophthalmic ointment (Puralube Vet) was applied to both eyes, and meloxicam (Putney) / Rimadyl was administered subcutaneously at 0.3 - 2.0 mg / kg as an analgesic. The surgical site was shaved and scrubbed with Betadine (Avrio Health LP) and 70% alcohol prior to the postauricular incision to expose the bleb. A small hole was created in the bleb using a sterile 26 - 30G needle or a drill bit with a diameter of 0.004 - 0.008 mm (Performance Micro Tool), and it was expanded using sterile sharp forceps to visualize the circular window niche. Next, a hole was made in the circular window at the tip of a pulled glass micropipette or a 35G polyimide tube (WPI Instrument), and the leaked liquid was absorbed using sterile gauze. Next, 2 microliters of the vector was injected using a micropipette (depth of approximately 0.5 mm) or a polyimide tube. The injection lasted for about 30 seconds. When the delivery was complete, a small piece of the sternocleidomastoid muscle was cut and pushed into the bleb to cover the circular window. The adipose tissue was returned to the original area. Next, 3 - 4 drops of GLUture (Zoetis Inc.) were used to close the skin incision and it was dried for 1 - 2 minutes. Next, the animals were transferred to a clean and warm recovery cage. The animals were checked for signs of pain, infection, or other distress for 5 days postoperatively. The analgesic was administered once a day for the first 3 days after surgery. The animals were also given physiological saline, nutritional support, and additional analgesics as needed.

[0315] Auditory brainstem response Mice were evaluated for peripheral auditory function by auditory brainstem response (ABR) 4 weeks after injection. Anesthesia (ketamine 100 mg / kg, ip, xylazine 10 mg / kg, ip, additional ketamine as needed) was administered, and after confirming appropriate anesthesia depth, subcutaneous needle electrodes were placed at the auricle apex and ventral auricle (differential recording), and the base of the tail (ground). A custom acoustic system (Eaton-Peabody Laboratories, MEE) containing two speakers and a probe tube microphone was placed in the external auditory canal, and in-ear calibration was performed before each test session. Calibration of the probe tube microphone was performed using a reference 1 / 4-inch microphone and a preamplifier (PCB Piezotronics model 2530, 426B31; Larson-Davis model 2221). In-ear calibration was performed using the probe tube microphone and a custom microphone amplifier (Eaton-Peabody Laboratories, MEE). All ABR stimuli and responses were generated and acquired using an RZ6 Multi-I / O signal processor and BioSigRZ software (Tucker-Davis Technologies). Responses from the needle electrodes were amplified and digitized with an RA4PAMedusa preamplifier connected to an RA4LI low-impedance headstage (Tucker-Davis Technologies). ABR stimuli were 5 ms tone pips (0.5 ms cos 2 lamp) at 22.6 kHz, presented at a rate of 40 / second with alternating polarity at 5 dB steps from 5 to 105 dB SPL. For each sound level, a total of 1024 trials were averaged (after artifact removal), digitally filtered (0.1 - 5 kHz), and further high-pass filtered (0.3 kHz) offline. The ABR threshold was determined by visual inspection of the stacked waveforms ("waterfall plot") as the lowest sound level at which a reproducible peak or trough was detected. If no response was detected up to the instrument limit (105 dB SPL), an upper limit value of 110 dB SPL was assigned. The results of the ABR threshold at 22.6 kHz are shown in Figure 1A.

[0316] Immunohistochemistry After the physiological tests were completed, the mice were euthanized by excessive intake of carbon dioxide inhalation. Immediately after euthanasia, the mice were perfused with 10% neutral buffered formalin (NBF) via the vascular system. The inner ear temporal bones were collected, immersed in 10% NBF for 2 - 16 hours, and then decalcified with 8% EDTA for 3 days. The cochleae were dissected from the decalcified temporal bones and washed 3 times with PBS. After incubation with a blocking solution of 5% horse serum in PBST (0.5% Triton X - 100 in 1×PBS) for 1 hour at room temperature, the dissected cochlear pieces were incubated with a mouse anti - otoferlin antibody (abcam ab53233, diluted 1:200 with PBST) at 4°C for 12 - 16 hours, followed by washing 3 times with PBS and then incubation with an Alexa568 donkey anti - mouse secondary antibody (ThermoFisher Scientific A10037) at room temperature for 1 - 2 hours. After counterstaining with DAPI and a final wash with PBS, the cochlear pieces were mounted on glass slides and covered with glass coverslips using Vectashield mounting medium (Vector Laboratories H - 1000). The tissues were imaged using a Zeiss Axio ImagerM2 microscope. The images are shown in Figure 1B.

[0317] Example 2. Administration of high - dose OTOF isoform 5 improved the Q828X / Q828X functional recovery of mice OTOF Q828X / Q828X To evaluate the effect of administration of high - dose OTOF isoform 5 on the functional recovery of mutant mice, a vector (AAV1 - smCBA - OTOF isoform 5 (native or codon - optimized)) was injected into 4 - to 7 - week - old OTOF Q828X / Q828XInjection was performed through the round window membrane of the mouse. Similar to the vector used in Example 1, the polynucleotide encoding the N-terminal portion of the OTOF protein and the polynucleotide encoding the C-terminal portion of the OTOF protein were divided between two vectors of a dual hybrid vector system using the exon 20 / 21 boundary, and the AP gene fragment (SEQ ID NO: 51) was used as the recombination induction region for both vectors of the dual hybrid vector system. As described in Example 1 above, the ABR response was measured approximately 4 weeks after virus injection. These animals showed a stronger ABR response regardless of codon optimization compared to the animals administered with 7E9 or 6E9 vector genomes / ear (Figure 1A) (Figure 2).

[0318] Example 3. Administration of a composition containing a dual hybrid vector expressing OTOF to a mouse restores the electrophysiological characteristics of auditory function Homozygous (HOM) OTOF-Q828X mice (7 weeks old) were left untreated or treated with 4E10 (4×10 10 ) vector genomes (vg) / ear of AAV1-Myo15 (SEQ ID NO: 21)-hOTOF (isoform 5, SEQ ID NO: 1) (by injection through the round window membrane). Thus, exon 1-20 (SEQ ID NO: 56) of the polynucleotide encoding the N-terminal portion of the OTOF protein and exons 21-45 and 47 (SEQ ID NO: 57) of the polynucleotide encoding the C-terminal portion of the OTOF protein were delivered in separate vectors (Figure 3A). The AP recombination induction region (SEQ ID NO: 51) was included in both vectors of the dual hybrid vector system. The auditory brainstem response (ABR) threshold was used to evaluate auditory function. Untreated animals (untreated Otof HOM) did not show a detectable recovery of auditory function, while treated animals showed a strong recovery, which was consistent from 4 weeks after treatment (Otof HOM 4 weeks after treatment) to 8 weeks after treatment (Otof HOM 8-11 weeks after treatment). The ABR thresholds of heterozygous animals (Otof HET) were also tested.

[0319] In another experimental set, homozygous OTOF-Q828X mice were left untreated as described above or treated with 4E10 (4×10 10 ) vg / ear of an AAV1-cleaved chimeric CMV - chicken β-actin (smCBA, SEQ ID NO: 44)-hOTOF (isoform 5, SEQ ID NO: 1) dual hybrid vector system (by injection through the round window membrane) (Figure 3B). The first vector contained exons 1 - 20 (SEQ ID NO: 56) of the polynucleotide encoding the N-terminal portion of the OTOF protein and exons 21 - 45 and 47 (SEQ ID NO: 57) of the polynucleotide encoding the C-terminal portion of the OTOF protein, and both vectors contained the AP recombination region (SEQ ID NO: 51). Untreated animals did not show detectable recovery of auditory function, while treated animals showed strong recovery at 4 weeks post-treatment (Otof HOM at 4 weeks post-treatment). When these same animals were evaluated at 8 weeks post-treatment (Otof HOM at 8 weeks post-treatment), the ABR threshold increased, suggesting low persistence of recovery by the smCBA promoter. The ABR thresholds of heterozygous animals were also tested.

[0320] In yet another experimental set, homozygous OTOF-Q828X mice were left untreated as described above or treated with an AAV1-smCBA (SEQ ID NO: 44)-hOTOF (isoform 5, SEQ ID NO: 1) dual hybrid vector at 8E9 (8×10 9 ) vg / ear (low dose), 1.6E10 (1.6×10 10 ) vg / ear (medium dose), or 6.4E10 (6.4×10 10)Treated with either vg / ear (high dose) (by injection through a round window membrane). The first vector included exons 1-20 (SEQ ID NO: 56) of a polynucleotide encoding the N-terminal portion of the OTOF protein, as well as exons 21-45 and 47 (SEQ ID NO: 57) of a polynucleotide encoding the C-terminal portion of the OTOF protein, and both vectors included an AP recombination region (SEQ ID NO: 51). The ABR threshold was used to evaluate the auditory function at 4 and 8 weeks after treatment (Figure 3C). A dose-dependent recovery of ABR was observed at both time points. Comparing the 8-week and 4-week time points, the recovery of auditory function was stable at low and medium doses, but decreased in high-dose animals. The ABR threshold of heterozygous animals was also tested.

[0321] Example 4. Administration of a composition containing a dual hybrid vector expressing mouse OTOF to mice restores the electrophysiological characteristics of auditory function Homozygous OTOF-Q828X mice (6 - 7 weeks old) were treated, as described above, by injection through the round window membrane with the AAV2quad(Y-F)-Myo15 (SEQ ID NO: 21)-mouse OTOF (mOTOF, transcript variant 1, RefSeq NM_001100395) and AAV2quad(Y-F)-Myo15 (SEQ ID NO: 31)-mOTOF (transcript variant 1, RefSeq NM_001100395) dual hybrid vector system (total injection volume 2 μL, 1 μL of each vector). Auditory function was evaluated using ABR thresholds. Exons 1 - 20 of the polynucleotide encoding the N-terminal portion of the mOTOF protein were contained in the 5' vector, and the remaining C-terminal portion of the mOTOF polynucleotide was contained in the 3' vector. The AP recombination-inducing region (SEQ ID NO: 51) was contained in both vectors of the dual hybrid vector system. The titer of the 5' AAV2quad(Y-F)-Myo15 (SEQ ID NO: 21)-mOTOF vector was 1.49E12 vg / mL, the titer of the 5' AAV2quad(Y-F)-Myo15 (SEQ ID NO: 31)-mOTOF vector was 2.68E12 vg / mL, and the titers of the corresponding 3' vectors were 1.05E12 vg / mL and 1.58E12 vg / mL. Untreated animals did not show a detectable recovery of auditory function, while treated animals showed a strong recovery, which was consistent from 4 weeks to 17 weeks after treatment (Figure 4). Figure 4 shows the average auditory thresholds at 22.6 kHz + / - standard deviation.

[0322] Example 5. A dual hybrid vector can be used to express full-length functional GFP in the hair cells of non-human primates Non-human primates at 2.6 years old were locally injected into the round window of the inner ear at a flow rate of 6 μL / min with an AAV1-Myo15 (SEQ ID NO: 21)-GFP dual hybrid vector system (viral titers of 3.18E13 vg / mL for the 5' vector and 3.42E13 vg / mL for the 3' vector) (total injection volume of 60 μL, 30 μL for each vector). Four weeks after injection, the inner ear was removed and the surface of the basilar membrane was treated. GFP was expressed in hair cells throughout the apical-basal axis of the cochlea by the dual hybrid vector. High-magnification images at 4 kHz showed that GFP expression was observed within inner hair cells (IHCs) (B in FIG. 5). Myo7A immunohistochemistry was used to visualize hair cells (A in FIG. 5), and the nuclei were stained with DAPI (C in FIG. 5).

[0323] Example 6. Construction of a dual hybrid vector system encoding human OTOF HEK293T cells (obtained from ATCC, Manassas, VA) were seeded in cell culture-treated dishes until they reached 70 - 80% confluence in the container. Gene transfection was performed using the AAV-1 packaging system from Cell Biolabs, Inc. (San Diego, CA). For a culture surface area of 175 cm 2 per, 16 μg of pHelper, 8 μg of pAAV-RC1, and 8 μg of the transfer plasmid SEQ ID NO: 66 were mixed with PEI (PEIpro, polyplus) at a weight ratio of 1:1. Subsequently, the DNA / PEI mixture was added to the cell culture medium. Three days after gene transfection, the cell culture medium and cells were collected, and AAV was extracted and purified. AAV from the cell culture medium was concentrated by tangential flow filtration. AAV from the cells was released from the cells by 3 cycles of freeze-thaw. AAV from any fraction was finally purified by iodixanol density gradient purification, and the purified AAV and sterile DPBS (Mg+, Ca+) containing 0.01% pluronic F68 were passed through a 100 kDa MWCO centrifugal filter to exchange the buffer, generating purified AAV. It is the first member of the dual vector system. Using the transfer plasmid SEQ ID NO: 67, the same procedure was performed to create the second member of the dual vector system.

[0324] Using the same procedure, a dual vector system encoding OTOF with AAV9 was created, except that during the gene transfer step, pAAV-RC1 was replaced with an equivalent plasmid containing the AAV9 cap gene instead of the AAV1 cap gene.

[0325] Example 7. The dual hybrid vector system encoding human OTOF is expressed in non-human primates In non-human primates (NHP), the native otoferlin protein is expressed in the sensory cells of the inner ear. The BaseScope™ system was used to detect the expression of human otoferlin introduced with the virus in NHP.

[0326] The first cohort of six naive NHP (1.5 - 4 years old) was injected through the round window membrane with the Myo15-otoferlin dual hybrid vector packaged in the AAV1 serotype as described in Example 6. Each ear was administered a total volume of 60 μl by combining 1.1×10 12 copies of each of the two vectors. The ears were ventilated through the lateral semicircular canal to allow for perilymph outflow during virus delivery. A second cohort of naive NHP (1.5 - 4 years old) was injected in the same manner and dosage as the first cohort using the Myo15-otoferlin dual hybrid system packaged in the AAV9 serotype. This is also described in Example 6.

[0327] Four weeks after the viral vector injection, all animals were sacrificed by cardiac perfusion with 10% neutral buffered formalin (NBF), and the temporal bones were harvested. After decalcification with Immunocal for 5 days, the temporal bones were embedded in paraffin, sectioned at 5 μm intervals, and stained with BaseScope™ (Advanced Cell Diagnostics, Newark, CA) using a probe specific for the spliced mRNA at the junction of the two vectors between exons 20 and 21 of human otoferlin. Thus, for detection, it was necessary that the dual vectors hybridize properly in vivo and express the full-length human OTOF isoform 5.

[0328] The BaseScope (trademark) assay was performed on the LeicaBondRX automated staining platform. Briefly, paraffin sections were baked at 60 °C for 30 minutes and deparaffinized. After a 5-minute target retrieval step at 95 °C, a 10-minute proteinase step at 40 °C followed, and finally the standard BaseScope (trademark) protocol, including eight amplification steps, was performed with the E20 / 21 probe. The probe signal was detected using FastRed dye, which can be observed as red staining under a bright-field microscope. First, the images were scanned and digitized at a magnification of 40x and screened for positives. Subsequently, confocal imaging (63×, 1.4 NA, excitation: 568 nm at 1% laser output, emission BP578 - 730 nm with a 642V detector) was used to confirm the positive signal using the fluorescence signal of the FastRed dye. Figure 6 shows sections from representative NHPs treated with the Myo15-otopetrin AAV1 dual vector system. In animals injected with AAV1, clear positives were observed in the sensory cells of all injected animals, with a bias towards the apical turn of the cochlea and the utricle. In animals injected with AAV9, 3 out of 6 showed clear positives, and the expression in the apical turn of the cochlea and the utricle also showed a similar trend (not shown in the figure). In both cases, the OTOF transcript was localized in the inner hair cells, outer hair cells, and hair cells of the vestibular organs.

[0329] Example 8. Quantification and localization of an alternative Myo15 promoter dual hybrid vector system encoding eGFP in NHPs To confirm the specificity and transduction efficiency of the hair cell-specific Myo15 promoter in NHPs, a dual vector system with the same recombinant transgene region and promoter as described in Example 6 was used. However, the 5’ and 3’ portions of human otopetrin of each of the two vectors were replaced with the first 393 nucleotides encoding the 5’ portion of eGFP in the 5’ vector and the last 908 nucleotides encoding the 3’ portion of eGFP in the 3’ vector, respectively. eGFP can be easily detected even in the otopetrin wild-type background.

[0330] All animals received an injection of 60 μl of the dual viral vector through the round window membrane, and the ears were ventilated at the lateral semicircular canal. The animals used in this study were 1.5 - 4 years old. Six NHP ears were injected with an alternative vector expressing eGFP under the Myo15 promoter of the above AAV1 serotype at a titer of 1.6×10 12 vector genomes per ear. Another six NHP ears were injected with the same alternative dual viral vector system expressing eGFP under the Myo15 promoter of the AAV9 serotype at a titer of 1.9×10 12 vector genomes per ear. The NHP test doses were adjusted by correlating mouse expression data from previous medium and high dose experiments and comparing it to a smaller scale NHP medium dose experiment (Table 5 below). Potential NHP results were estimated as the percentage of inner hair cells (IHCs) expressing eGFP from the high dose dual vector approach (Table 5).

[0331]

Table 5

[0332] Using the native eGFP signal as the readout, whole mount confocal imaging (40×, 0.95 NA, excitation: 488 nm at 14% laser power, emission BP495 - 543 nm at 600 V detector gain) was used to confirm expression in NHP across the entire organ of Corti (Error! Reference source not found. Figure 7A). Quantification of the number of inner hair cells showing expression correlated well with predictions from the AAV1 serotype dose titration (Error! Reference source not found. Figure 7B), and the AAV9 serotype showed a lower expression rate.

[0333] Example 9. Administration of a composition containing a dual hybrid vector expressing OTOF isoform 5 to a subject with sensorineural hearing loss According to the methods disclosed herein, physicians in the art can treat a patient, e.g., a human patient having sensorineural hearing loss (sensorineural hearing loss associated with OTOF mutations), thereby improving or restoring hearing. For this purpose, a physician in the art uses a Myo15 promoter (e.g., SEQ ID NO: 19, 21, 22, 31 or 32) operably linked to exons 1-20 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., a polynucleotide having the sequence of SEQ ID NO: 1, e.g., SEQ ID NO: 56), a 3' splice donor sequence of the polynucleotide sequence, and a 3' AP recombination-inducing region of the splice donor sequence (e.g., an AP gene fragment, any one of SEQ ID NOs: 48-53, e.g., SEQ ID NO: 51), a first AAV vector (e.g., AAV1), an AP recombination-inducing region (an AP gene fragment, any one of SEQ ID NOs: 48-53, e.g., SEQ ID NO: 51), a 3' splice acceptor sequence of the recombination-inducing region, an exon 21-45 and 47 of a polynucleotide encoding an OTOF isoform 5 protein (e.g., human OTOF isoform 5, e.g., a polynucleotide having the sequence of SEQ ID NO: 1, e.g., SEQ ID NO: 57), and a polynucleotide 3' of the splice acceptor sequence including a bGH poly(A) sequence, and a second AAV vector (e.g., AAV1). A composition comprising the double hybrid AAV vector can be administered to a human patient, e.g., by local administration to the inner ear (e.g., by injection through the round window membrane, injection into the semicircular canal, or by canalostomy) to treat sensorineural hearing loss.

[0334] After administering the composition to a patient, one of ordinary skill in the art can monitor the expression of OTOF and the improvement of the patient in response to treatment in various ways. For example, a physician can monitor a patient's hearing by performing standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emission measurements after administration of the composition. If an improvement in the patient's hearing is shown in one or more tests after administration of the composition compared to the audiometry results before administration of the composition (e.g., improved ABR), it is found that the patient is showing a favorable response to the treatment. Subsequent doses can be determined and administered as needed.

[0335] Exemplary embodiments of the present invention are described in the paragraphs listed below. E1. A first adeno-associated virus (AAV) vector comprising a Myo15 promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein, a splice donor signal sequence located 3' of the first coding polynucleotide, and a first recombination-inducing region located 3' of the splice donor signal sequence; a second recombination-inducing region, a splice acceptor signal sequence located 3' of the second recombination-inducing region, a second coding polynucleotide encoding a C-terminal portion of OTOF isoform 5 protein located 3' of the splice acceptor signal sequence, and a poly(A) sequence located 3' of the second coding polynucleotide, and a second AAV vector; a dual vector system, wherein the first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not overlap, and the first AAV vector or the second AAV vector does not encode the full-length OTOF isoform 5 protein.

[0336] E2. The dual vector system according to E1, wherein the first AAV vector and the second AAV vector comprise an AAV1 capsid. E3. The Myo15 promoter comprises a first region having at least 85% sequence identity to SEQ ID NO: 7 or a functional portion or derivative thereof, the first region comprising the sequence of SEQ ID NO: 9 and / or the sequence of SEQ ID NO: 10, and a second region having at least 85% sequence identity to SEQ ID NO: 8 or a functional portion or derivative thereof, the second region comprising the sequence of SEQ ID NO: 14 and / or the sequence of SEQ ID NO: 15, which is operably linked thereto, and optionally comprises a linker containing 1 to 100 nucleotides between the first region and the second region. The double vector system according to E1 or E2.

[0337] E4. The double vector system according to E3, wherein the first region comprises or consists of the sequence of SEQ ID NO: 7. E5. The double vector system according to E3, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 9.

[0338] E6. The double vector system according to E3, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 10. E7. The double vector system according to E3, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 9 and the sequence of SEQ ID NO: 10.

[0339] E8. The double vector system according to E7, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 11. E9. The double vector system according to E7, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 12.

[0340] E10. The double vector system according to E7, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 13. E11. The double vector system according to E7, wherein the functional portion of SEQ ID NO: 7 comprises the sequence of SEQ ID NO: 33.

[0341] E12. The double vector system according to any one of E3 to E11, wherein the second region comprises or consists of the sequence of SEQ ID NO: 8. E13. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 14.

[0342] E14. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 15. E15. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequences of SEQ ID NO: 14 and SEQ ID NO: 15.

[0343] E16. The double vector system according to E15, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 16. E17. The double vector system according to E15, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 17.

[0344] E18. The double vector system according to E15, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 18. E19. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 34.

[0345] E20. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 35. E21. The double vector system according to any one of E3 to E11, wherein the functional part of SEQ ID NO: 8 includes the sequences of SEQ ID NO: 34 and SEQ ID NO: 35.

[0346] E22. The double vector system according to E21, wherein the functional part of SEQ ID NO: 8 includes the sequence of SEQ ID NO: 38. E23. The double vector system according to E3, wherein the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 19.

[0347] E24. The double vector system according to E3, wherein the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 21. E25. The double vector system according to E3, wherein the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 22.

[0348] E26. The double vector system according to E3, wherein the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 42. E27. The double vector system according to E3, wherein the Myo15 promoter comprises or consists of the sequence of SEQ ID NO: 43.

[0349] E28. The double vector system according to E1 or E2, wherein the Myo15 promoter comprises a first region having at least 85% sequence identity to the sequence of SEQ ID NO: 23 or a functional portion or derivative thereof, and the sequence of SEQ ID NO: 26 and / or SEQ ID NO: 27 operably linked thereto, and a second region having at least 85% sequence identity to the sequence of SEQ ID NO: 24 or a functional portion or derivative thereof, optionally including a linker containing 1 to 400 nucleotides between the first region and the second region.

[0350] E29. The double vector system according to E28, wherein the first region comprises or consists of the sequence of SEQ ID NO: 23. E30. The double vector system according to E28, wherein the functional portion of SEQ ID NO: 23 comprises the sequence of SEQ ID NO: 25.

[0351] E31. The double vector system according to any one of E28 to E30, wherein the second region comprises or consists of the sequence of SEQ ID NO: 24. E32. The double vector system according to any one of E28 to E30, wherein the functional portion of SEQ ID NO: 24 comprises the sequence of SEQ ID NO: 26.

[0352] E33. The double vector system according to any one of E28 to E30, wherein the functional portion of SEQ ID NO: 24 comprises the sequence of SEQ ID NO: 27. E34. The double vector system according to any one of E28 to E30, wherein the functional portion of SEQ ID NO: 24 includes the sequences of SEQ ID NO: 26 and SEQ ID NO: 27.

[0353] E35. The double vector system according to E34, wherein the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 28. E36. The double vector system according to E34, wherein the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 29.

[0354] E37. The double vector system according to E34, wherein the functional portion of SEQ ID NO: 24 includes the sequence of SEQ ID NO: 30. E38. The double vector system according to E28, wherein the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 31.

[0355] E39. The double vector system according to E28, wherein the Myo15 promoter includes or consists of the sequence of SEQ ID NO: 32. E40. The double vector system according to E1 or E2, wherein the Myo15 promoter includes a sequence having at least 85% sequence identity to SEQ ID NO: 34.

[0356] E41. The double vector system according to E1 or E2, wherein the Myo15 promoter includes a sequence having at least 85% sequence identity to SEQ ID NO: 38. E42. The double vector system according to E1 or E2, wherein the Myo15 promoter includes a sequence having at least 85% sequence identity to SEQ ID NO: 39.

[0357] E43. The double vector system according to E1 or E2, wherein the Myo15 promoter includes a sequence having at least 85% sequence identity to SEQ ID NO: 40. A ubiquitous promoter operably linked to a first coding polynucleotide encoding the N-terminal portion of the E44.OTOF isoform 5 protein, a splice donor signal sequence located 3' to the first coding polynucleotide, and a first recombination-inducing region located 3' to the splice donor signal sequence, a first AAV1 vector, a second recombination-inducing region, a splice acceptor signal sequence located 3' to the second recombination-inducing region, a second coding polynucleotide encoding the C-terminal portion of the OTOF isoform 5 protein located 3' to the splice acceptor signal sequence, and a poly(A) sequence located 3' to the second coding polynucleotide, a second AAV1 vector, wherein the first coding polynucleotide and the second coding polynucleotide do not overlap, and the first AAV1 vector or the second AAV1 vector does not encode the full-length OTOF isoform 5 protein, a dual-vector system.

[0358] E45. The dual-vector system according to E44, wherein the ubiquitous promoter is selected from the group consisting of a CAG promoter, a cytomegalovirus (CMV) promoter, and a shortened CMV - chicken β-actin promoter (smCBA promoter).

[0359] E46. The dual-vector system according to E45, wherein the ubiquitous promoter is the smCBA promoter. E47. The dual-vector system according to E46, wherein the smCBA promoter comprises or consists of the sequence of SEQ ID NO: 44.

[0360] E48. The dual-vector system according to any one of E1 - E47, wherein the first recombination-inducing region and the second recombination-inducing region are the same. E49. The double vector system according to any one of E1 to E48, wherein the first recombination induction region and / or the second recombination induction region is an AK recombination induction region.

[0361] E50. The double vector system according to E49, wherein the AK recombination induction region contains or consists of the sequence of SEQ ID NO: 47. E51. The double vector system according to any one of E1 to E48, wherein the first recombination induction region and / or the second recombination induction region is an AP gene fragment.

[0362] E52. The double vector system according to E51, wherein the AP gene fragment contains or consists of any one of the sequences of SEQ ID NOs: 48 to 53. E53. The double vector system according to E52, wherein the AP gene fragment contains or consists of the sequence of SEQ ID NO: 51.

[0363] E54. The double vector system according to any one of E1 to E53, wherein each of the first coding polynucleotide and the second coding polynucleotide encodes approximately half of the OTOF isoform 5 protein sequence.

[0364] E55. The double vector system according to any one of E1 to E54, wherein the first coding polynucleotide and the second coding polynucleotide are divided at the OTOF exon boundary.

[0365] E56. The double vector system according to E55, wherein the first coding polynucleotide and the second coding polynucleotide are divided at the OTOF exon 20 / exon 21 boundary.

[0366] E57. The first coding polynucleotide consists of exons 1 to 20 of the polynucleotide encoding the OTOF isoform 5 protein, and the second coding polynucleotide consists of exons 21 to 45 and 47 of the polynucleotide encoding the OTOF isoform 5 protein. The double vector system according to any one of E1 to E55.

[0367] E58. The first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not contain introns. The double vector system according to any one of E1 to E57.

[0368] E59. The OTOF isoform 5 protein is a human OTOF isoform 5 protein. The double vector system according to any one of E1 to E58. E60. The OTOF isoform 5 protein includes the sequence of SEQ ID NO: 1 or a variant thereof having one or more conservative amino acid substitutions. The double vector system according to any one of E1 to E59.

[0369] E61. In the OTOF isoform 5 protein variant, 10% or less of the amino acids are conservative amino acid substitutions. The double vector system according to E60. E62. The OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 1. The double vector system according to E60.

[0370] E63. The OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 2. The double vector system according to any one of E1 to E60 and E62. E64. The OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 3. The double vector system according to any one of E1 to E60 and E62.

[0371] E65. The double vector system according to any one of E1 to E64, wherein the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO: 1, and the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO: 1.

[0372] E66. The double vector system according to any one of E1 to E65, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58 or a variant thereof having one or more conservative amino acid substitutions.

[0373] E67. The double vector system according to E66, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the N-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions.

[0374] E68. The double vector system according to E66, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58. E69. The double vector system according to any one of E1 to E66 and E68, wherein the N-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 56.

[0375] E70. The double vector system according to any one of E1 to E69, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59 or a variant thereof having one or more conservative amino acid substitutions.

[0376] E71. The double vector system according to E70, wherein 10% or less (e.g., 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) of the amino acids in the C-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions.

[0377] E72. The double vector system according to E70, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59. E73. The double vector system according to any one of E1 to E70 and E72, wherein the C-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO: 57.

[0378] E74. The double vector system according to any one of E1 to E73, wherein the first vector includes a first inverted terminal repeat (ITR) sequence at the 5' of the promoter and a second ITR sequence at the 3' of the recombination-inducing region, and the second vector includes a first ITR sequence at the 5' of the recombination-inducing region and a second ITR sequence at the 3' of the poly(A) sequence.

[0379] E75. The double vector system according to E74, wherein the ITRs of the first vector and the second vector are AAV2 ITRs, and have at least 80% sequence identity to the AAV2 ITR (for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity).

[0380] E76. The double vector system according to any one of E1 to E75, wherein the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence. E77. The double vector system according to any one of E1 to E76, wherein the splice donor sequence of the first vector includes or consists of the sequence of SEQ ID NO: 54.

[0381] E78. The double vector system according to any one of E1 to E77, wherein the splice acceptor sequence of the second vector includes or consists of the sequence of SEQ ID NO: 55. E79. The double vector system according to any one of E1 to E78, wherein the first AAV vector includes a Kozak sequence at the 3' of the promoter and the 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein.

[0382] E80. The double vector system according to E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO: 60. E81. The double vector system according to E1 or E80, wherein the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6264 of SEQ ID NO: 60.

[0383] E82. The double vector system according to E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO: 62. E83. The double vector system according to E1 or E82, wherein the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 19 to 4115 of SEQ ID NO: 62.

[0384] E84. The double vector system according to E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6014 of SEQ ID NO: 64. E85. The double vector system according to E44 or E84, wherein the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 2049 to 6237 of SEQ ID NO: 64.

[0385] E86. The double vector system according to E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 177 to 3924 of SEQ ID NO: 65. E87. The double vector system according to E44 or E86, wherein the first AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence at positions 19 to 4090 of SEQ ID NO: 65.

[0386] E88. The double vector system according to any one of E1, E44, E80, E81, E84, and E85, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO: 61.

[0387] E89. The double vector system according to any one of E1, E44, E80, E81, E84, E85, and E88, wherein the second AAV vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 2049 to 6693 of SEQ ID NO: 61.

[0388] E90. The double vector system according to any one of E1, E44, E82, E83, E86, and E87, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO: 63.

[0389] E91. The double vector system according to any one of E1, E44, E82, E83, E86, E87, and E90, wherein the second AAV vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 19 to 4589 of SEQ ID NO: 63.

[0390] E92. The double vector system according to E1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO: 66. E93. The double vector system according to E1 or E92, wherein the first AAV vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4227 of SEQ ID NO: 66.

[0391] E94. The double vector system according to E44, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 230 to 3977 of SEQ ID NO: 68. E95. The double vector system according to E44 or E94, wherein the first AAV vector comprises a polynucleotide sequence comprising or consisting of the sequence of nucleotides 12 to 4200 of SEQ ID NO: 68.

[0392] E96. The double vector system according to any one of E1, E44, and E92 - E95, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO: 67.

[0393] E97. The double vector system according to any one of E1, E44, and E92 - E96, wherein the second AAV vector comprises, or consists of, a polynucleotide sequence comprising the sequence of nucleotides 12 - 4655 of SEQ ID NO: 67.

[0394] E98. A method of increasing OTOF expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the double vector system according to any one of E1 - E97.

[0395] E99. A method of treating a subject having, or at risk of developing, sensorineural hearing loss, the method comprising administering to the subject a therapeutically effective amount of the double vector system according to any one of E1 - E97.

[0396] E100. A method of treating a subject having, or at risk of developing, auditory neuropathy, the method comprising administering to the subject a therapeutically effective amount of the double vector system according to any one of E1 - E97.

[0397] E101. The method according to any one of E98 - E100, wherein the subject has a mutation in OTOF. E102. The method according to any one of E98 - E100, wherein the subject has been confirmed to have a mutation in OTOF.

[0398] E103. The method according to any one of E98 - E100, further comprising confirming the subject as having a mutation in OTOF before administering the double vector system.

[0399] E104. The method according to any one of E98 - E103, wherein the subject has, or is confirmed to have, autosomal recessive deafness 9 (DFNB9). E105. The method according to any one of E98 to E104, further comprising evaluating the hearing of the subject before administering the double vector system.

[0400] E106. The method according to any one of E98 to E105, wherein the double vector system is administered locally to the middle ear or the inner ear. E107. The method according to E106, wherein the double vector system is administered by injection through the round window membrane, injection into the semicircular canal, canalostomy, insertion of a catheter through the round window membrane, middle ear injection, or intratympanic injection.

[0401] E108. The method according to any one of E98 to E107, wherein the method increases OTOF expression in cochlear hair cells. E109. The method according to E108, wherein the cochlear hair cells are inner hair cells.

[0402] E110. The method according to any one of E98 to E109, wherein the subject is a mammal. E111. The method according to E110, wherein the subject is a human.

[0403] E112. The method according to any one of E98 to E111, further comprising evaluating the hearing of the subject after administering the double vector system. E113. The method according to any one of E98 to E112, wherein the double vector system prevents or reduces hearing loss, delays the onset of hearing loss, delays the progression of hearing loss, improves hearing, improves speech discrimination ability, or improves hair cell function.

[0404] E114. The method according to any one of E98 to E113, wherein the double vector system is administered in an amount sufficient to increase OTOF expression in cochlear hair cells, prevent or reduce hearing loss, delay the onset of hearing loss, delay the progression of hearing loss, improve hearing, improve speech discrimination ability, or improve hair cell function.

[0405] A method for increasing OTOF expression in a cell, the method comprising introducing the double vector system according to any one of E1 to E97 into the cell.

[0406] E116. The method according to E115, wherein the cell is a cochlear hair cell. E117. The method according to E116, wherein the cell is an inner hair cell. E118. The method according to any one of E115 to E117, wherein the cell is a mammalian cell.

[0407] E119. The method according to E118, wherein the cell is a human cell. E120. The method according to any one of E98 to E119, wherein the first vector and the second vector are administered simultaneously.

[0408] E121. The method according to any one of E98 to E120, wherein the first vector and the second vector are administered sequentially. E122. The first vector and the second vector are about 1×10 7 vector genomes (VG) / ear to about 2×10 15 The method according to any one of E98 to E121, administered at a concentration of VG / ear.

[0409] Other embodiments Various modifications and variations described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been described in connection with specific embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the invention. Other embodiments are found in the claims.

Claims

1. A first adeno-associated virus (AAV) vector comprising a Myo15 promoter operably linked to a first coding polynucleotide encoding an N-terminal portion of otoferlin (OTOF) isoform 5 protein, a splice donor signal sequence located 3′ to the first coding polynucleotide, and a first recombination-inducing region located 3′ to the splice donor signal sequence, a second recombination-inducing region, a splice acceptor signal sequence located 3′ to the second recombination-inducing region, a second coding polynucleotide encoding a C-terminal portion of OTOF isoform 5 protein located 3′ to the splice acceptor signal sequence, and a poly(A) sequence located 3′ to the second coding polynucleotide, and a second AAV vector, a dual vector system, wherein the first coding polynucleotide and the second coding polynucleotide encoding the OTOF isoform 5 protein do not overlap, and the first AAV vector or the second AAV vector does not encode the full-length OTOF isoform 5 protein.

2. The dual vector system according to claim 1, wherein the first AAV vector and the second AAV vector comprise an AAV1 capsid.

3. The Myo15 promoter comprises a first region having at least 85% sequence identity to SEQ ID NO: 7 or a functional portion or derivative thereof, the first region comprising the sequence of SEQ ID NO: 9 and / or SEQ ID NO: 10, and a second region having at least 85% sequence identity to SEQ ID NO: 8 or a functional portion or derivative thereof, the second region comprising the sequence of SEQ ID NO: 14 and / or SEQ ID NO: 15, operably linked thereto, optionally comprising a linker comprising 1 to 100 nucleotides between the first region and the second region. The dual vector system according to claim 1 or 2.

4. The dual vector system according to any one of claims 1 to 3, wherein the Myo15 promoter comprises or consists of the sequence of SEQ ID NO:

21.

5. The dual vector system according to any one of claims 1 to 4, wherein the first recombination-inducing region and / or the second recombination-inducing region is an AP gene fragment.

6. The double vector system according to claim 5, wherein the AP gene fragment contains, or consists of, any one of the sequences of SEQ ID NOs: 48 to 53.

7. The double vector system according to claim 6, wherein the AP gene fragment contains, or consists of, the sequence of SEQ ID NO:

51.

8. The double vector system according to any one of claims 1 to 7, wherein the OTOF isoform 5 protein contains the sequence of SEQ ID NO: 1, or a variant thereof having one or more conservative amino acid substitutions.

9. The double vector system according to claim 8, wherein 10% or less of the amino acids in the OTOF isoform 5 protein variant are conservative amino acid substitutions.

10. The double vector system according to claim 8, wherein the OTOF isoform 5 protein consists of the sequence of SEQ ID NO:

1.

11. The double vector system according to any one of claims 1 to 8 and 10, wherein the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

2.

12. The double vector system according to any one of claims 1 to 8 and 10, wherein the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

3.

13. The double vector system according to any one of claims 1 to 12, wherein the first coding polynucleotide encodes amino acids 1 to 802 of SEQ ID NO: 1, and the second coding polynucleotide encodes amino acids 803 to 1997 of SEQ ID NO:

1.

14. The double vector system according to any one of claims 1 to 13, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 58, or a variant thereof having one or more conservative amino acid substitutions.

15. The double vector system according to claim 14, wherein 10% or less of the amino acids in the N-terminal portion of the OTOF isoform 5 protein variant are conservative amino acid substitutions.

16. The double vector system according to claim 14, wherein the N-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO:

58.

17. The double vector system according to any one of claims 1 to 14 and 16, wherein the N-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

56.

18. The double vector system according to any one of claims 1 to 17, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO: 59 or a variant thereof having one or more conservative amino acid substitutions.

19. The double vector system according to claim 18, wherein 10% or less of the amino acids in the C-terminal portion of the OTOF isoform 5 protein mutant are conservative amino acid substitutions.

20. The double vector system according to claim 18, wherein the C-terminal portion of the OTOF isoform 5 protein consists of the sequence of SEQ ID NO:

59.

21. The double vector system according to any one of claims 1 to 18 and 20, wherein the C-terminal portion of the OTOF isoform 5 protein is encoded by the sequence of SEQ ID NO:

57.

22. The double vector system according to any one of claims 1 to 21, wherein the first vector includes a first inverted terminal repeat (ITR) sequence 5' of the promoter and a second ITR sequence 3' of the recombination-inducing region, and the second vector includes a first ITR sequence 5' of the recombination-inducing region and a second ITR sequence 3' of the poly(A) sequence.

23. The double vector system according to claim 22, wherein the ITRs of the first vector and the second vector have at least 80% sequence identity to the AAV2 ITR.

24. The double vector system according to any one of claims 1 to 23, wherein the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence.

25. The double vector system according to any one of claims 1 to 24, wherein the splice donor sequence of the first vector includes or consists of the sequence of SEQ ID NO:

54.

26. The double vector system according to any one of claims 1 to 25, wherein the splice acceptor sequence of the second vector includes or consists of the sequence of SEQ ID NO:

55.

27. The double vector system according to any one of claims 1 to 26, wherein the first AAV vector includes a Kozak sequence 3' of the Myo15 promoter and the 5' of the first coding polynucleotide encoding the N-terminal portion of the OTOF isoform 5 protein.

28. The dual vector system according to claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 235 to 4004 of SEQ ID NO:

66.

29. The dual vector system according to claim 1 or 28, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 229 to 4438 of SEQ ID NO:

67.

30. The dual vector system according to claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2272 to 6041 of SEQ ID NO:

60.

31. The dual vector system according to claim 1, wherein the first AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 182 to 3949 of SEQ ID NO:

62.

32. The dual vector system according to claim 1 or 30, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 2267 to 6476 of SEQ ID NO:

61.

33. The dual vector system according to claim 1 or 31, wherein the second AAV vector comprises a polynucleotide sequence comprising the sequence of nucleotides 187 to 4396 of SEQ ID NO:

63.

34. A method for increasing OTOF expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the dual vector system according to any one of claims 1 to 33.

35. A method for treating a subject suffering from or at risk of developing sensorineural hearing loss, the method comprising administering to the subject a therapeutically effective amount of the dual vector system according to any one of claims 1 to 33.

36. A method for treating a subject suffering from or at risk of developing auditory neuropathy, the method comprising administering to the subject a therapeutically effective amount of the dual vector system according to any one of claims 1 to 33.

Images