Oligonucleotides, compositions and methods

Abstract

To provide oligonucleotides, compositions and methods.SOLUTION: Among other things, the present disclosure provides oligonucleotides, compositions, and methods for preventing and / or treating various conditions, disorders or diseases. In some embodiments, provided oligonucleotides comprise nucleobase modifications, sugar modifications, internucleotidic linkage modifications and / or patterns thereof, and have improved properties, activities and / or selectivities. In some embodiments, the present disclosure provides oligonucleotides, compositions and methods for HTT-related conditions, disorders or diseases, such as Huntington's disease.SELECTED DRAWING: Figure 1A

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 800,409, filed on February 1, 2019, and U.S. Provisional Patent Application No. 62 / 911,335, filed on October 6, 2019, the entire contents of each of which are hereby incorporated by reference.

Background Art

[0002] Background Oligonucleotides that target specific genes are useful in various applications, such as, but not limited to, therapeutic, diagnostic, and / or research applications, including the treatment of various disorders related to the target gene.

Summary of the Invention

Means for Solving the Problems

[0003] Summary In some embodiments, the present disclosure provides oligonucleotides and compositions thereof having significantly improved properties and / or activities. In particular, the present disclosure provides techniques for designing, manufacturing, and using such oligonucleotides and compositions. Specifically, in some embodiments, the present disclosure, when combined with one or more other structural elements described herein, such as a base sequence (or a portion thereof), nucleic acid base modification (and its pattern), internucleotide linkage modification (and its pattern), additional chemical moieties, etc., provides useful internucleotide linkage patterns [e.g., type, modification, and / or configuration of chiral - linked phosphorus (Rp or Sp), etc.] and / or sugar modification patterns (e.g., type, pattern, etc.) that can confer high activity and / or desired properties to oligonucleotides and compositions, including, but not limited to, allele - specific knockdown of mutant alleles of the HTT (huntingtin) gene (this mutant allele is on the same chromosome as and in the same phase as the expanded CAG repeat region associated with Huntington's disease).

[0004] In some embodiments, the target HTT nucleic acid is a mutant that includes both a discrimination position and a mutation such as an extended CAG repeat region (e.g., greater than about 36 CAG) associated with Huntington's disease. In some embodiments, the reference or non-target HTT nucleic acid is wild-type, includes another variant regarding the discrimination position, and lacks an extended CAG repeat region (e.g., the CAG repeat region is less than about 35 CAG and has no association with Huntington's disease). In some embodiments, the HTT oligonucleotide (the oligonucleotide targeting the target HTT nucleic acid) has the ability to discriminate between the target HTT nucleic acid and the reference HTT nucleic acid and has the ability to mediate allele-specific knockdown of the target HTT nucleic acid. In some embodiments, the discrimination position is a single nucleotide polymorphism (SNP) site, a point mutation, etc. In some embodiments, the target HTT nucleic acid sequence and the reference HTT nucleic acid sequence contain different bases at the SNP site. In some embodiments, a certain site in the target HTT nucleic acid is completely complementary to a certain site in the oligonucleotide of the present disclosure, while the corresponding site in the reference HTT nucleic acid is not complementary. For example, in some embodiments, the target HTT nucleic acid sequence includes rs362273, the SNP position is A, and its allele includes an extended CAG repeat (e.g., 36 or more), which is associated with Huntington's disease; the reference HTT nucleic acid sequence includes rs362273, the SNP position is G, and the CAG repeat it contains is less (e.g., 35 or less), which has little or no association with Huntington's disease. In some embodiments, the sequence of the provided oligonucleotide, such as GUUGATCTGTAGCAGCAGCT, is complementary to the target HTT nucleic acid sequence at a specific site, such as the SNP site (e.g.,

Chemical formula

Chemical formula

Chemical formula

[0005] In some embodiments, the HTT oligonucleotide has a nucleotide sequence that is identical between the target mutant HTT nucleic acid and the wild-type HTT nucleic acid. In some embodiments, such oligonucleotides have the ability to knockdown both mutant HTT and wild-type HTT levels, expression, and / or activity; such oligonucleotides can be designed as pan-specific oligonucleotides or non-allele-specific oligonucleotides.

[0006] In some embodiments, the provided oligonucleotides and compositions are useful for the prevention and / or treatment of various pathologies, disorders or diseases, particularly HTT-related pathologies, disorders or diseases including Huntington's disease. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts and / or the products encoded thereby that are associated with Huntington's disease. In some embodiments, the provided oligonucleotides and compositions selectively reduce the levels of HTT transcripts that contain an expanded CAG repeat (e.g., 36 or more) and / or the products encoded thereby.

[0007] In particular, the present disclosure encompasses the recognition that controlling the structural elements of HTT oligonucleotides can significantly affect oligonucleotide properties and / or activities, including knockdown of the HTT target gene (or its product) (e.g., a decrease in activity, expression, and / or level). In some embodiments, Huntington's disease is associated with the presence of a mutant HTT allele that includes a CAG expansion (e.g., an increase in the length of a region containing multiple CAG repeats). In some embodiments, the knockdown is allele-specific, where the mutant allele of HTT is preferentially knocked down compared to the wild type. In some embodiments, the knockdown is pan-specific, where both the mutant and wild-type alleles of HTT are significantly knocked down. In some embodiments, the knockdown of the HTT target gene is mediated by RNase H and / or steric hindrance that affects translation. In some embodiments, the knockdown of the HTT target gene is mediated by a mechanism involving RNA interference. In some embodiments, the controlled structural elements of the HTT oligonucleotide include, but are not limited to, changes in the base sequence, chemical modifications (e.g., modifications of the sugar, base, and / or internucleotide linkage) or patterns thereof, stereochemistry (e.g., the stereochemistry of the backbone chiral internucleotide linkage) or patterns thereof, the structure of the first or second wing or core, and / or conjugation with additional chemical moieties (e.g., carbohydrate moieties, targeting moieties, etc.). In particular, in some embodiments, the present disclosure demonstrates that the properties and / or activities of HTT oligonucleotides can be significantly improved by controlling the stereochemistry (the stereochemistry of the linking phosphorus) of the backbone chiral centers, optionally accompanied by control of other aspects of oligonucleotide design and / or incorporation of carbohydrate moieties.

[0008] In some embodiments, the present disclosure relates to any HTT oligonucleotide that operates by any mechanism and includes any sequence, structure, or format (or portion thereof) described herein, and that includes at least one non-naturally occurring modification of a base, sugar, or internucleotide linkage.

[0009] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides have at least one chirally controlled internucleotide linkage [the linking phosphorus of which is in the Rp or Sp configuration or is highly purified with respect thereto (e.g., 80-100%, 85%-100%, 90%-100%, 95%-100% or 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of all oligonucleotides having the same chemical constitution in the composition share the same stereochemistry at the linking phosphorus), an internucleotide linkage that is not a random mixture of Rp and Sp, such an internucleotide linkage being an "stereochemically defined internucleotide linkage"], for example, also including phosphorothioate linkages in which the linking phosphorus is Rp or Sp. In some embodiments, the number of chirally controlled internucleotide linkages is 1-100, 1-50, 1-40, 1-35, 1-30, 1-25, 1-20, 5-100, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25. In some embodiments, at least one internucleotide linkage is a chirally controlled internucleotide linkage and is Sp, and / or at least one internucleotide linkage is a chirally controlled internucleotide linkage and is Rp. In some embodiments, the pattern of backbone chiral centers of the oligonucleotide or a portion thereof (e.g., the core) is Rp(Sp)2 or includes it. In some embodiments, the pattern of backbone chiral centers of the oligonucleotide or a portion thereof (e.g., the core) is (Np)t[(Rp)n(Sp)m]y, where each of t, n, m and y is independently as described herein or includes it.

[0010] In some embodiments, the present disclosure demonstrates that an oligonucleotide comprising a chirally controlled Rp internucleotide linkage at the -1, +1, or +3 position relative to a discrimination position (a position where a target mutant HTT nucleic acid and a reference wild-type HTT nucleic acid can be discriminated by a base present therein or a complementary base present therein) can confer high activity and / or selectivity and, in some embodiments, can be particularly useful for reducing the level of a disease-related transcript and / or a product encoded thereby. Unless otherwise specified, with respect to the determination of the position of the Rp internucleotide linkage, "-" is counted from the nucleoside at the discrimination position toward the 5' end of the oligonucleotide, and the internucleotide linkage attached to the 5' carbon of the nucleoside at the discrimination position is taken as the -1 internucleotide linkage, and "+" is counted from the nucleoside at the discrimination position toward the 3' end of the oligonucleotide, and the internucleotide linkage attached to the 3' carbon of the nucleoside at the discrimination position is taken as the +1 internucleotide linkage. In some embodiments, Rp at the -1 position resulted in an increase in activity and selectivity. In some embodiments, Rp at the +1 position resulted in an increase in activity and selectivity. In some embodiments, Rp at the +3 position resulted in an increase in activity. For example, as shown herein, HTT oligonucleotides WV-12281 (one phosphorothioate with an Rp configuration at the -1 position relative to the SNP position), WV-12282 (+1), and WV-12284 (+3) can confer high selectivity when utilized for allele-specific knockdown of mutant alleles.

[0011] In some embodiments, the present disclosure relates to an HTT oligonucleotide composition, wherein the HTT oligonucleotide comprises at least one chirally uncontrolled chiral internucleotide linkage.

[0012] In some embodiments, the oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotide linkages. In some embodiments, the oligonucleotide comprises one or more neutral internucleotide linkages. In some embodiments, the HTT oligonucleotide comprises non-negatively charged or neutral internucleotide linkages. In some embodiments, the present disclosure provides an oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises at least 10 contiguous bases that are identical or complementary to the nucleotide sequence of the HTT gene or its transcript, the oligonucleotide comprises at least one non-negatively charged internucleotide linkage, and the oligonucleotide has the ability to reduce the level, expression, and / or activity of the HTT target gene or its gene product.

[0013] In some embodiments, the present disclosure encompasses the recognition that various optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., can improve one or more properties and / or activities when incorporated into the oligonucleotide.

[0014] In some embodiments, the additional chemical moiety is selected from GalNAc, glucose, GluNAc (N-acetylglucosamine), and anisamide moieties and their derivatives or any additional chemical moiety described herein and / or known in the art. In some embodiments, the oligonucleotide can comprise two or more additional chemical moieties, where the additional chemical moieties are the same or different, or in the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not in the same category. In some embodiments, certain additional chemical moieties facilitate delivery of the oligonucleotide to a desired cell, tissue, and / or organ; and / or facilitate internalization of the oligonucleotide; and / or increase oligonucleotide stability.

[0015] In some embodiments, the present disclosure 1) A common base sequence; 2) A common backbone binding pattern; and 3) A common backbone chiral center pattern A chiral-controlled oligonucleotide composition is provided that includes a plurality of oligonucleotides sharing (1), (2), and (3). The composition is a substantially pure formulation of a single oligonucleotide in that the non-random or controlled level of oligonucleotides in the composition has a common base sequence, a common backbone binding pattern, and a common backbone chiral center pattern.

[0016] In some embodiments, the oligonucleotide composition is a chiral-controlled oligonucleotide composition that includes a plurality of oligonucleotides of a particular oligonucleotide type, and the composition is chirally controlled in that the oligonucleotides of the particular oligonucleotide type are highly purified compared to a substantially racemic formulation of oligonucleotides having the same base sequence and chiral internucleotide binding pattern.

[0017] In some embodiments, the present disclosure provides a chiral-controlled oligonucleotide composition that includes a plurality of oligonucleotides having the ability to induce HTT knockdown, where the oligonucleotides are of a particular oligonucleotide type, and the composition is chirally controlled in that the oligonucleotides of the particular oligonucleotide type are highly purified compared to a substantially racemic formulation of oligonucleotides having the same base sequence.

[0018] In some embodiments, the provided oligonucleotide comprises one or more blocks. In some embodiments, a block shares a common chemistry (e.g., at least one common modification of the sugar, base, or internucleotide linkage, or a combination or pattern thereof, or a stereochemical pattern) that is not present in adjacent blocks, and / or comprises one or more contiguous nucleosides, and / or nucleotides, and / or sugars, or bases, and / or internucleotide linkages, or vice versa. In some embodiments, the HTT oligonucleotide comprises three or more blocks, where the blocks at both ends are not the same, and thus the oligonucleotide is asymmetric. In some embodiments, a block is a wing or a core. In some embodiments, the core is also referred to as a gap.

[0019] In some embodiments, the oligonucleotide comprises at least one wing and at least one core, where the wing structurally differs from the core in that the wing contains a structure [e.g., stereochemistry or a chemical modification (or a pattern thereof) in the sugar, base, or internucleotide linkage, etc.] that is not present in the core, or vice versa. In some embodiments, the structure of the oligonucleotide comprises a wing-core-wing structure. In some embodiments, the structure of the oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, where one wing differs from the other wing and the core in terms of structure [e.g., stereochemistry, additional chemical moieties, or a chemical modification (or a pattern thereof) in the sugar, base, or internucleotide linkage] (e.g., an asymmetric oligonucleotide).

[0020] In some embodiments, the wing contains a sugar modification or pattern thereof that is not present in the core. In some embodiments, the wing contains a sugar modification that is not present in the core. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars of the wing are independently modified. In some embodiments, each wing sugar is independently modified. In some embodiments, each sugar of the wing is the same. In some embodiments, at least one sugar of the wing is different from another sugar of that wing. In some embodiments, one or more sugar modifications and / or sugar modification patterns in the first wing (e.g., 5'-wing) of the oligonucleotide are different from one or more sugar modifications and / or sugar modification patterns in the second wing (e.g., 3'-wing) of the oligonucleotide. In some embodiments, the modification is a 2'-OR modification, where R is as described herein. In some embodiments, R is an optionally substituted C 1~4 alkyl. In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the modified sugar is a high-affinity sugar, such as a bicyclic sugar (e.g., LNA sugar), 2'-MOE, etc. In some embodiments, the sugars of the 3'-wing are high-affinity sugars. In some embodiments, the 3'-wing contains one or more high-affinity sugars. In some embodiments, each sugar of the 3'-wing is independently a high-affinity sugar. In some embodiments, the high-affinity sugar is a 2'-MOE sugar. In some embodiments, the high-affinity sugar is bound to a non-negatively charged internucleotide linkage.

[0021] In some embodiments, the wing comprises one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, each non-negatively charged internucleotide linkage is independently a neutral internucleotide linkage. In some embodiments, as demonstrated herein, an oligonucleotide comprising a wing that comprises one or more non-negatively charged internucleotide linkages can provide high activity and / or selectivity. In some embodiments, in the description of the internucleotide linkage and its pattern (including the stereochemical pattern), the internucleotide linkage that joins the wing nucleoside and the core nucleoside is considered part of the core. In some embodiments, the non-negatively charged internucleotide linkage is chirally controlled and is Rp or Sp.

[0022] In some embodiments, the core sugar is a native DNA sugar that does not contain a substitution at the 2'-position (the 2'-carbon is two -H's). In some embodiments, each core sugar is a native DNA sugar that does not contain a substitution at the 2'-position (the 2'-carbon is two -H's).

[0023] In some embodiments, the discrimination position (e.g., an SNP locus or other mutation that discriminates a wild-type target sequence from a disease-related sequence or a mutant sequence) is at the 4th, 5th, or 6th position from the 5'-end of the core region. In some embodiments, the 4th, 5th, or 6th nucleobase from the 5'-end of the core region (counting from the 5'-end of the core) is characteristic of the sequence and discriminates one sequence from another (e.g., an SNP). In some embodiments, the discrimination position is at the 4th position from the 5'-end of the core region. In some embodiments, the discrimination position is at the 5th position from the 5'-end of the core region. In some embodiments, the discrimination position is at the 6th position from the 5'-end of the core region. In some embodiments, the discrimination position is at the 9th, 10th, or 11th position from the 5'-end of the oligonucleotide. In some embodiments, the discrimination position is at the 9th position from the 5'-end of the oligonucleotide. In some embodiments, the discrimination position is at the 10th position from the 5'-end of the oligonucleotide. In some embodiments, the discrimination position is at the 11th position from the 5'-end of the oligonucleotide.

[0024] In some embodiments, the oligonucleotide or oligonucleotide composition is useful for the prevention or treatment of a condition, disorder, or disease. In some embodiments, an HTT oligonucleotide or HTT oligonucleotide composition is useful for a method of treating an HTT-related condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof.

[0025] In some embodiments, the oligonucleotide or oligonucleotide composition is useful for the manufacture of a medicament for treating a condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof. In some embodiments, an HTT oligonucleotide or HTT oligonucleotide composition is useful for the manufacture of a medicament for treating an HTT-related condition, disorder, or disease, such as Huntington's disease, in a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Brief Description of the Drawings

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Mode for Carrying Out the Invention

[0027] Detailed Description of Specific Embodiments The technology of the present disclosure can be more easily understood by referring to the following detailed description of specific embodiments.

[0028] Definitions As used herein, unless otherwise specified, the following definitions shall apply. For the purposes of the present disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. In addition, general principles of organic chemistry are described in “Organic Chemistry”, Thomas Sorrell, University Science Books, Sausalito: 1999 and “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, M. b. and March, J., John Wiley & Sons, New York: 2001.

[0029] As used herein in the present disclosure, unless the context clearly dictates otherwise: (i) the term "a" or "an" can be understood to mean "at least one"; (ii) the term "or" can be understood to mean "and / or"; (iii) the terms "comprising," "including," "having" (whether used with "but not limited to") and "containing" (whether used with "but not limited to") can be understood to include the listed elements or steps, whether presented alone or in combination with one or more additional elements or steps; (iv) the term "another" can be understood to mean at least an additional / second one or more; (v) the terms "about" and "substantially" can be understood to allow for the standard deviation as would be understood by one of ordinary skill in the art; and (vi) when ranges are provided, the endpoints are included.

[0030] Unless otherwise specified, descriptions of oligonucleotides and their elements (e.g., base sequences, sugar modifications, internucleotide linkages, linkage phosphorus stereochemistry, etc.) are from 5' to 3'. Unless otherwise specified, the oligonucleotides described herein may be provided and / or utilized in salt form, particularly pharmaceutically acceptable salt form. As would be understood by one of ordinary skill in the art upon reading this disclosure, in some embodiments, an oligonucleotide may be provided as a salt, such as a sodium salt. As would be understood by one of ordinary skill in the art, in some embodiments, even if an individual oligonucleotide in a composition could be in one or more different salt forms at a particular instant (and even if dissolved), the oligonucleotide chain may exist as an anionic form, e.g., when in a liquid composition, and the same chemical composition and / or structure may be considered. For example, one of ordinary skill in the art would understand that even if an individual internucleotide linkage along an oligonucleotide chain is in the acidic (H) form at a given pH, or in one of several possible salt forms (e.g., sodium salt, or a salt of another cation depending on what ions may be present in a formulation or composition), such individual oligonucleotides may be appropriately considered to have the same chemical composition and / or structure as long as its acidic form (e.g., when present, with all cations replaced by H) has the same chemical composition and / or structure.

[0031] Aliphatic: As used herein, "aliphatic" means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or contains one or more unsaturated units, or a substituted or unsubstituted monocyclic, bicyclic or polycyclic hydrocarbon ring that is completely saturated or contains one or more unsaturated units but is not aromatic, or a combination thereof. In some embodiments, the aliphatic group contains 1 to 50 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1 to 20 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 10 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 9 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 8 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 7 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 6 aliphatic carbon atoms. In yet another embodiment, the aliphatic group contains 1 to 5 aliphatic carbon atoms, and in yet another embodiment, the aliphatic group contains 1, 2, 3 or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, straight-chain or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0032] Alkenyl: As used herein, the term "alkenyl" refers to an aliphatic group having one or more double bonds, as defined herein.

[0033] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and includes saturated aliphatic groups such as straight-chain alkyl groups, branched alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups and cycloalkyl-substituted alkyl groups. In some embodiments, the alkyl has 1 to 100 carbon atoms. In some embodiments, the straight-chain or branched-chain alkyl has about 1 to 20 carbon atoms in its backbone (e.g., C1 to C 20 , in the case of a branched chain, C2 to C 20) or has from about 1 to 10. In some embodiments, the cycloalkyl ring has from about 3 to 10 carbon atoms in its ring structure (in which case such rings are monocyclic, bicyclic or polycyclic) or has about 5, 6 or 7 carbons in its ring structure. In some embodiments, the alkyl group can be a lower alkyl group, where the lower alkyl group contains 1 to 4 carbon atoms (e.g., for straight-chain lower alkyl, C1 - C4).

[0034] Alkynyl: As used herein, the term "alkynyl" refers to an aliphatic group having one or more triple bonds, as defined herein.

[0035] Analog: The term "analog" includes any chemical moiety that is structurally different from a reference chemical moiety or a chemical moiety of a reference class, but can perform at least one function of such reference chemical moiety or chemical moiety of the reference class. As non-limiting examples, nucleotide analogs are structurally different from nucleotides but perform at least one function of nucleotides; nucleobase analogs are structurally different from nucleobases but perform at least one function of nucleobases, and so on.

[0036] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and / or insects. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal and / or a clone.

[0037] Antisense: As used herein, the term "antisense" refers to the characteristics of an oligonucleotide or other nucleic acid having a base sequence that is complementary or substantially complementary to a target HTT nucleic acid capable of hybridization. In some embodiments, the target HTT nucleic acid is the target gene mRNA. In some embodiments, hybridization is required for, or causes, a decrease in the level, expression or activity of the target HTT nucleic acid or its gene product in a single activity. The term "antisense oligonucleotide" as used herein refers to an oligonucleotide that is complementary to a target HTT nucleic acid. In some embodiments, the antisense oligonucleotide has the ability to lead to a decrease in the level, expression or activity of the target HTT nucleic acid or its product. In some embodiments, the antisense oligonucleotide has the ability to lead to a decrease in the level, expression or activity of the target HTT nucleic acid or its product through mechanisms involving RNase H, steric hindrance and / or RNA interference.

[0038] Aryl: As used herein, the term "aryl", whether used alone or as part of a larger moiety such as in "aralkyl", "aralkoxy", or "aryloxyalkyl", refers to a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 30 ring members, where at least one ring in the ring system is aromatic. In some embodiments, the aryl group is a monocyclic, bicyclic, or polycyclic ring system having a total of 5 to 14 ring members, where at least one ring in the ring system is aromatic and each ring in the ring system contains 3 to 7 ring members. In some embodiments, the aryl group is a biaryl group. The term "aryl" may be used synonymously with the term "aryl ring". In certain embodiments of the present disclosure, "aryl" refers to an aromatic ring system including, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl, etc., which may carry one or more substituents. Also, within the scope of the term "aryl", as used herein, groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, are also included.

[0039] Chiral control: As used herein, "chiral control" refers to the control of the stereochemical designation of chiral linking phosphates in chiral internucleotide linkages within an oligonucleotide. As used herein, a chiral internucleotide linkage is an internucleotide linkage in which the linking phosphate is chiral. In some embodiments, the control is achieved via non-existent chiral elements from the sugar and base moieties of the oligonucleotide, for example, in some embodiments, the control is achieved via one or more chiral auxiliary groups during the oligonucleotide preparation process as described in the present disclosure, and this chiral auxiliary agent is often part of the chiral phosphoramidite used in the oligonucleotide preparation process. In contrast to chiral control, those skilled in the art will understand that conventional oligonucleotide synthesis without the use of chiral auxiliary agents cannot control the stereochemistry at chiral internucleotide linkages when forming chiral internucleotide linkages using such conventional oligonucleotide synthesis. In some embodiments, the stereochemical designation of each chiral linking phosphate in each chiral internucleotide linkage within the oligonucleotide is controlled.

[0040] Chirally Controlled Oligonucleotide Compositions: As used herein, terms such as "chirally controlled oligonucleotide composition" and "chirally controlled nucleic acid composition" refer to a composition comprising a plurality of oligonucleotides (or nucleic acids) that share 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, where the plurality of oligonucleotides (or nucleic acids) share the same bonding phosphorus stereochemistry at one or more chiral internucleotide linkages (chirally controlled or stereodefined internucleotide linkages, where the chiral bonding phosphorus is Rp or Sp in the composition (stereodefined), rather than a random mixture of Rp and Sp as in non-chirally controlled internucleotide linkages). The level of the plurality of oligonucleotides (or nucleic acids) in the chirally controlled oligonucleotide composition is predetermined / controlled (e.g., through chirally controlled oligonucleotide preparation for stereoselectively forming one or more chiral internucleotide linkages). In some embodiments, about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all the oligonucleotides in the chirally controlled oligonucleotide composition are oligonucleotides among this plurality.In some embodiments, about 0.1% to 100% (e.g., 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share a common base sequence are a plurality of oligonucleotides. In some embodiments, the level is about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) of all oligonucleotides in a composition that shares a common base sequence (e.g., of a plurality of oligonucleotides or oligonucleotide types), all oligonucleotides in a composition that shares a common base sequence, a common backbone linkage pattern, and a common backbone phosphorus modification pattern, all oligonucleotides in a composition that shares a common base sequence, a common base modification pattern, a common sugar modification pattern, a common internucleotide linkage type pattern, and / or a common internucleotide linkage modification pattern, or all oligonucleotides in a composition that share the same chemical constitution.In some embodiments, the plurality of oligonucleotides have the same stereochemistry with about 1 to 50 (e.g., about 1 to 10, 1 to 20, 5 to 10, 5 to 20, 10 to 15, 10 to 20, 10 to 25, 10 to 30 or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) chiral internucleotide linkages. In some embodiments, the plurality of oligonucleotides have the same stereochemistry with about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, 50% to 90% or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%) chiral internucleotide linkages. In some embodiments, the oligonucleotides (or nucleic acids) among the plurality have the same chemical constitution.In some embodiments, the level of the oligonucleotides (or nucleic acids) among the plurality is about 1% to 100% (e.g., about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition that shares the same chemical composition as the oligonucleotides (or nucleic acids) among the plurality. In some embodiments, each chiral internucleotide bond is a chirally controlled internucleotide bond, and the composition is a completely chirally controlled oligonucleotide composition. In some embodiments, the oligonucleotides (or nucleic acids) among the plurality are structurally identical. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 95%. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 96%. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 97%. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 98%. In some embodiments, the chirally controlled internucleotide bond has a diastereomeric purity of at least 99%. In some embodiments, the percentage of the level is (DS).nc or at least (DS) nc wherein DS is a diastereomeric purity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more), and nc is the number of chirally controlled internucleotide linkages as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, the percentage level is (DS) nc or at least (DS) nc wherein DS is 95% to 100%. For example, when DS is 99% and nc is 10, the percentage is 90% or at least 90% ((99%) 10≈0.90 = 90%). In some embodiments, the level of the plurality of oligonucleotides in the composition is expressed as the product of the diastereomeric purity of each chirally controlled internucleotide linkage in the oligonucleotide. In some embodiments, the diastereomeric purity of the internucleotide linkage that connects two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereomeric purity of the internucleotide linkage of the dimer that connects the same two nucleosides, where the dimer is prepared using equivalent conditions, in some examples the same synthetic cycle conditions (e.g., for the linkage between Nx and Ny of an oligonucleotide....NxNy....., the dimer is NxNy). In some embodiments, not all chiral internucleotide linkages are chirally controlled internucleotide linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, the internucleotide linkages that are not chirally controlled typically have a diastereomeric purity of about 80%, 75%, 70%, 65%, 60%, less than 55%, or about 50%, as found in stereochemically random oligonucleotide compositions (e.g., as is understood by those skilled in the art, conventional oligonucleotide synthesis, such as by the phosphoramidite method). In some embodiments, the oligonucleotides (or nucleic acids) among the plurality are of the same type. In some embodiments, the chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acid types. For example, in some embodiments, the chirally controlled oligonucleotide composition comprises one or more oligonucleotide types. In some embodiments, the chirally controlled oligonucleotide composition comprises two or more oligonucleotide types. In some embodiments, the chirally controlled oligonucleotide composition comprises a large number of oligonucleotide types. In some embodiments, the chirally controlled oligonucleotide composition is a composition of oligonucleotides of a certain oligonucleotide type, and this composition comprises a plurality of oligonucleotides of that oligonucleotide type at non-random or controlled levels.

[0041] Equivalent: As used herein, the term "equivalent" is used to represent two (or more) sets of conditions or situations that are sufficiently similar to each other to enable comparison of the results obtained or the phenomena observed. In some embodiments, equivalent sets of conditions or situations are characterized by a plurality of substantially identical features and one or a few variant features. One of ordinary skill in the art will understand that the sets of conditions are equivalent to each other when the differences in the results obtained or the phenomena observed under different sets of conditions or situations are warranted by a sufficient number and variety of substantially identical features such that the differences are caused by, or indicative of, the differences in such variant features.

[0042] Alicyclic: The terms "alicyclic", "carbocyclic", "carbocyclyl", "carbocyclic group", and "carbocyclic ring" are used synonymously and, as used herein, refer to a saturated or partially unsaturated, but non-aromatic, monocyclic, bicyclic, or polycyclic ring system having 3 to 30 ring members, as described herein, unless otherwise specified. Alicyclic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, the alicyclic group has 3 to 6 carbons. In some embodiments, the alicyclic group is saturated and is a cycloalkyl. The term "alicyclic" can also include aliphatic rings fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, the alicyclic group is bicyclic. In some embodiments, the alicyclic group is tricyclic. In some embodiments, the alicyclic group is polycyclic. In some embodiments, "alicyclic" refers to a C3-C6 monocyclic hydrocarbon having a single point of attachment to the remainder of the molecule that is fully saturated or contains one or more unsaturated units, but is not aromatic, or a C8-C 10Bicyclic or polycyclic hydrocarbons, or completely saturated or containing one or more units of unsaturation but not aromatic, having a single point of attachment to the remainder of the molecule, C9-C 16 Refers to polycyclic hydrocarbons.

[0043] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide characterized by containing adjacent cores with 5' and 3' wings positioned laterally. In some embodiments, in a gapmer, at least one internucleotide phosphodiester bond of the oligonucleotide is a native phosphodiester bond. In some embodiments, two or more internucleotide phosphodiester bonds of the oligonucleotide chain are native phosphodiester bonds. In some embodiments, the gapmer is a sugar-modified gapmer, where each wing sugar independently includes a sugar modification and the core sugar does not include the sugar modification found in the wing sugars. In some embodiments, each core sugar is unmodified and 2'-unsubstituted (like native DNA). In some embodiments, each wing sugar is independently a 2'-modified sugar. In some embodiments, at least one wing sugar is a bicyclic sugar. In some embodiments, the sugar units in each wing have the same sugar modification (e.g., 2'-OMe (2'-OMe wing), 2'-MOE (2'-MOE wing), etc.). In some embodiments, each wing sugar has the same modification. The core and wings can be of various lengths. In some embodiments, the wings are 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleoside lengths or more (in many embodiments, 3, 4, 5, or 6 or more), and the core is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleoside lengths or more (in many embodiments, 8, 9, 10, 11, 12, or more). In some embodiments, the oligonucleotide includes or consists of a wing-core-wing structure of 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, or 6-9-2. In some embodiments, the oligonucleotide is a gapmer.

[0044] Heteroaliphatic: As used herein, the term "heteroaliphatic" is given its ordinary meaning in the art and refers to an aliphatic group as described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH2, and CH3 are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof). In some embodiments, the heteroaliphatic group is heteroalkyl. In some embodiments, the heteroaliphatic group is heteroalkenyl.

[0045] Heteroalkyl: As used herein, the term "heteroalkyl" is given its ordinary meaning in the art and refers to an alkyl group as described herein in which one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol) substitution, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, and the like.

[0046] Heteroaryl: As used herein, the terms "heteroaryl" and "heteroal-", when used alone or as part of a larger moiety such as "heteroalkyl", or "heteroalkoxy", refer to monocyclic, bicyclic or polycyclic ring systems having a total of 5 to 30 ring members, where at least one ring in the ring system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, the heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments a group having 5, 6, 9, or 10 ring atoms. In some embodiments, the heteroaryl group has 6, 10, or 14 π electrons shared in a cyclic array; and in addition to carbon atoms, has 1 to 5 heteroatoms. Examples of heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, heteroaryl is a hetero-biaryl group such as bipyridyl. As used herein, the terms "heteroaryl" and "heteroal-" also include groups in which a heteroaromatic ring is fused to one or more aryl rings, cycloaliphatic rings, or heterocyclyl rings and the linking group or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. The heteroaryl group can be monocyclic, bicyclic or polycyclic.The term "heteroaryl" can be used synonymously with the terms "heteroaryl ring", "heteroaryl group", or "heteroaromatic", and any of these terms includes a ring that is optionally substituted. The term "heteroalkyl" refers to an alkyl group substituted by a heteroaryl group, where the alkyl moiety and the heteroaryl moiety are each independently optionally substituted.

[0047] Heteroatom: As used herein, the term "heteroatom" means an atom that is not carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or substitutable nitrogen in a heterocyclic ring (e.g., N as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (as in N-substituted pyrrolidinyl), etc.); in some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0048] Heterocycle: As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic group", and "heterocyclic ring" are used synonymously and refer to a monocyclic, bicyclic, or polycyclic ring moiety (e.g., a 3- to 30-membered ring) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, the heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated and has one or more, preferably 1 to 4, heteroatoms as defined above in addition to carbon atoms. When used in connection with the ring atoms of a heterocycle, the term "nitrogen" includes substituted nitrogen. By way of example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, and nitrogen, nitrogen is N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or +It may be NR (such as in N-substituted pyrrolidinyl). The heterocyclic ring can be attached to its pendant group by any heteroatom or carbon atom that provides a stable structure, and any of the ring atoms can optionally be substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle", "heterocyclyl", "heterocyclic ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used synonymously herein and include groups in which a heterocyclyl ring is fused to one or more aryl rings, heteroaryl rings, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. The heterocyclyl group can be monocyclic, bicyclic, or polycyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, where the alkyl portion and the heterocyclyl portion are each independently optionally substituted.

[0049] Identity: "Identity" or "sameness" or "similarity" refers to the sequence similarity between two nucleic acid molecules. Identity and sameness can each be determined by comparing the positions of each sequence that can be aligned for comparison purposes. When equivalent positions in the sequences under comparison are occupied by the same base, and thus those molecules are identical at that position; when equivalent sites are occupied by the same or similar nucleic acid residues (e.g., when the steric and / or electronic properties are similar), and thus those molecules can be said to be homologous (similar) at that position. An expression as a percentage of homology / similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the sequences under comparison. In some embodiments, "unrelated" or "non-homologous" sequences share less than 40%, less than 35%, less than 30%, or less than 25% identity with the sequences described herein. In the comparison of two sequences, the identity and homology / similarity can also be reduced by the absence of residues (amino acids or nucleic acids) or the presence of extra residues. In some embodiments, polymer molecules (e.g., oligonucleotides, nucleic acids, proteins, etc.) are considered "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymer molecules are considered "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.

[0050] In some embodiments, the term "homology" refers to a mathematically based comparison of sequence similarity used to identify genes having similar functions or motifs. The nucleic acid sequences described herein can be used as "query sequences" to perform searches of public databases, thereby identifying, for example, other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, when performing a BLAST nucleotide search with the NBLAST program, score = 100, wordlength = 12, nucleotide sequences homologous to the nucleic acid molecules of the present disclosure can be obtained. In some embodiments, gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402 to obtain gapped alignments for comparison purposes. When using the BLAST and gapped BLAST programs, the default parameters of each program (e.g., XBLAST and BLAST) can be used (www.ncbi.nlm.nih.gov).

[0051] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical. For example, the percent identity of two nucleic acid or polypeptide sequences can be calculated by aligning the two sequences for optimal comparison (e.g., gaps may be introduced into one or both of the first and second sequences for optimal alignment, and non-identical sequences may be disregarded for comparison purposes). In certain embodiments, the length of the sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Next, the nucleotides at the corresponding positions are compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, and thus those molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions that they share, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. Comparison of sequences and determination of the percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17) incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparison performed with the ALIGN program uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.The percent identity between two nucleotide sequences can instead be determined using the NWSgapdna.CMP matrix with the GAP program in the GCG software package.

[0052] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to a linkage that connects nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide linkage is a phosphodiester linkage as widely found in naturally occurring DNA and RNA molecules (natural phosphate linkage (-OP(=O)(OH)O-), which may exist in salt form as understood by those skilled in the art). In some embodiments, the internucleotide linkage is a modified internucleotide linkage (not a natural phosphate linkage). In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" where at least one oxygen atom or -OH of the phosphodiester linkage is replaced with a different organic or inorganic moiety. In some embodiments, such organic or inorganic moiety is selected from =S, =Se, =NR’, -SR’, -SeR’, -N(R’)2, B(R’)3, -S-, -Se-, and -N(R’)-, where each R’ is independently as defined and described in this disclosure. In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphorothioate linkage (or phosphorothioate diester linkage, -OP(=O)(SH)O-, which may exist in salt form as understood by those skilled in the art), or a phosphorothioate triester linkage. In some embodiments, the modified internucleotide linkage is a phosphorothioate linkage. In some embodiments, the internucleotide linkage is, for example, one of a PNA (peptide nucleic acid) or PMO (phosphorodiamidate morpholino oligomer) linkage. In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the modified internucleotide linkage is a neutral internucleotide linkage (e.g., n001 in certain provided oligonucleotides). It is understood by those skilled in the art that an internucleotide linkage may exist as an anion or cation at a given pH due to the presence of acidic or basic moieties in the linkage.In some embodiments, the modified internucleotide linkage is a modified internucleotide linkage designated as s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17, and s18 as described in International Publication No. WO 2017 / 210647.

[0053] In vitro: As used herein, the term "in vitro" refers to events that occur not within a living organism (e.g., an animal, a plant, and / or a microorganism), but rather in an artificial environment, such as in a test tube or reaction vessel, under cell culture, etc.

[0054] In vivo: As used herein, the term "in vivo" refers to events that occur within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0055] Linking phosphorus: As defined herein, the phrase "linking phosphorus" is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotide linkage, which corresponds to the phosphorus atom of the phosphodiester internucleotide linkage as present in naturally occurring DNA and RNA. In some embodiments, the linking phosphorus atom is in a modified internucleotide linkage, where each oxygen atom of the phosphodiester bond is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the linking phosphorus atom is the P of Formula I as defined herein. In some embodiments, the linking phosphorus atom is chiral. In some embodiments, the linking phosphorus atom is achiral (e.g., as in a native phosphate linkage).

[0056] Linker: The terms "linker", "linkage moiety", etc. refer to any chemical moiety that connects one chemical moiety to another chemical moiety. As will be understood by those skilled in the art, a linker can be divalent or trivalent or more, depending on the number of chemical moieties to which the linker is connected. In some embodiments, the linker is the moiety that connects one oligonucleotide to another oligonucleotide in a multimer. In some embodiments, the linker is optionally a moiety located between the terminal nucleoside and the solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid. In some embodiments, in an oligonucleotide, the linker connects a chemical moiety (e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.) to the oligonucleotide chain (e.g., at its 5'-end, 3'-end, nucleobase, sugar, internucleotide linkage, etc.).

[0057] Lower alkyl: The term "lower alkyl" refers to a C 1~4 linear or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0058] Lower haloalkyl: The term "lower haloalkyl" refers to a C 1~4 linear or branched alkyl group substituted with one or more halogen atoms.

[0059] Modified nucleobase: The terms "modified nucleobase", "modified base", etc. refer to a chemical moiety that is chemically different from a nucleobase but has the ability to perform at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase containing a modification. In some embodiments, a modified nucleobase has the ability to perform at least one function of a nucleobase, e.g., the ability to form a moiety in a polymer that has the ability to base pair with a nucleic acid containing at least a complementary base sequence. In some embodiments, a modified nucleobase is a substituted A, T, C, G, or U or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.

[0060] Modified nucleoside: The term "modified nucleoside" refers to a moiety that is derived from or chemically similar to a natural nucleoside and includes a chemical modification that differentiates it from the natural nucleoside. Non-limiting examples of modified nucleosides include those having a modification in the base and / or sugar. Non-limiting examples of modified nucleosides include those having a 2'-modification in the sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleic acid base). In some embodiments, a modified nucleoside has the ability to form a moiety in a polymer that has at least one functional ability of the nucleoside, e.g., the ability to base pair with a nucleic acid containing at least a complementary base sequence.

[0061] Modified nucleotide: The term "modified nucleotide" includes any chemical moiety that is structurally different from a natural nucleotide but has the ability to perform at least one function of a natural nucleotide. In some embodiments, a modified nucleotide includes a modification in the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide includes a modified sugar, modified nucleic acid base, and / or modified internucleotide linkage. In some embodiments, a modified nucleotide has the ability to form a subunit in a polymer that has at least one functional ability of the nucleotide, e.g., the ability to base pair with a nucleic acid containing at least a complementary base sequence.

[0062] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. A modified sugar mimics the conformation, electronic properties, or some other physicochemical property of a sugar. In some embodiments, as described in the present disclosure, the modified sugar is a substituted ribose or deoxyribose. In some embodiments, the modified sugar includes a 2'-modification. Examples of useful 2'-modifications are widely utilized in the art and are described herein. In some embodiments, the 2'-modification is 2'-OR, wherein R is optionally substituted C 1~10It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., the sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, a modified sugar is a sugar other than ribose or deoxyribose as typically found in natural RNA or DNA.

[0063] Nucleic acid: As used herein, the term "nucleic acid" includes any nucleotide and polymers thereof. The term "polynucleotide" as used herein refers to a polymer form of nucleotides of any length, whether ribonucleotides (RNA) or deoxyribonucleotides (DNA) or combinations thereof. These terms refer to the primary structure of the molecule and thus include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include, but are not limited to, modified nucleotides and / or polynucleotides such as methylated, protected, and / or capped nucleotides or polynucleotides, and any analogs of RNA or DNA. These terms include poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified internucleotide linkages. This term includes nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both a ribose moiety and a deoxyribose moiety, and nucleic acids containing a ribose moiety and a modified ribose moiety. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing from 2 to about 10,000 nucleotide monomer units, where the prefix oligo- refers to a nucleic acid containing from 2 to about 200 nucleotide monomer units.

[0064] Nucleobase: The term "nucleobase" refers to the part of a nucleic acid that participates in hydrogen bonds that sequence specifically bind one nucleic acid strand to another complementary strand. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase comprises a heteroaryl ring in which the ring atoms are nitrogen and, when in a nucleoside, that nitrogen is attached to the sugar moiety. In some embodiments, the nucleobase comprises a heterocyclic ring in which the ring atoms are nitrogen and, when in a nucleoside, that nitrogen is attached to the sugar moiety. In some embodiments, the nucleobase is a "modified nucleobase", i.e., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G or U. In some embodiments, the modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the conformation, electronic properties, or some other physicochemical property of a nucleobase and retains the property of hydrogen bonds that sequence specifically bind one nucleic acid strand to another nucleic acid strand. In some embodiments, the modified nucleobase can pair with all five of the naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of oligonucleotide duplexes. As used herein, the term "nucleobase" also encompasses structural analogs used in place of natural or naturally occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, the nucleobase is optionally substituted A, T, C, G or U, or an optionally substituted tautomer of A, T, C, G or U.In some embodiments, "nucleobase" refers to a nucleobase unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U as in an oligonucleotide or nucleic acid).

[0065] Nucleoside: The term "nucleoside" refers to the moiety in which a nucleobase or modified nucleobase is covalently attached to a sugar or modified sugar. In some embodiments, the nucleoside is a natural nucleoside such as adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0066] Nucleoside analog: The term "nucleoside analog" refers to a chemical moiety that is chemically different from a natural nucleoside but has the ability to perform at least one function of a nucleoside. In some embodiments, the nucleoside analog includes an analog of a sugar and / or an analog of a nucleobase. In some embodiments, a modified nucleoside has the ability to perform at least one function of a nucleoside, such as the ability to form a moiety in a polymer that has the ability to base pair with a nucleic acid containing a complementary base sequence.

[0067] Nucleotide: As used herein, the term "nucleotide" refers to the monomeric unit of a polynucleotide consisting of a nucleobase, a sugar, and one or more internucleotide linkages (e.g., a phosphate linkage in native DNA and RNA). Naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil, (U)] are derivatives of purines or pyrimidines, but it should be understood that base analogs, both naturally occurring and non-naturally occurring, are also included. Naturally occurring sugars are pentose (five-carbon sugars) deoxyribose (which forms DNA) or ribose (which forms RNA), but it should be understood that sugar analogs, both naturally occurring and non-naturally occurring, are also included. Nucleotides are joined by internucleotide linkages to form nucleic acids, or polynucleotides. A number of internucleotide linkages are known in the art (including, but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include other variants of the phosphate backbone of natural nucleic acids such as PNA (peptide nucleic acid), phosphotriester, phosphorothioic acid, H-phosphonate, phosphoramidate, boranophosphate, methylphosphonate, phosphonoacetic acid, thiophosphonoacetic acid, and those described herein. In some embodiments, a native nucleotide includes a naturally occurring base, sugar, and internucleotide linkage. As used herein, the term "nucleotide" also encompasses structural analogs used in place of natural or native nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, "nucleotide" refers to the nucleotide units in an oligonucleotide or nucleic acid.

[0068] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides and can encompass any combination of natural and non-natural nucleobases, sugars, and internucleotide linkages.

[0069] The oligonucleotide can be single-stranded or double-stranded. A single-stranded oligonucleotide can have a double-stranded region (formed by two portions of the single-stranded oligonucleotide), and a double-stranded oligonucleotide containing two oligonucleotide strands can have a single-stranded region, for example, in a region where the two oligonucleotide strands are not complementary to each other. Exemplary oligonucleotides include, but are not limited to, structural genes, genes containing control and termination regions, self-replicating systems such as viral DNA or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermir(supermir), aptamers, antimir, antagomir, Ul adapter, triple-stranded forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0070] The oligonucleotides of the present disclosure can be of various lengths. In a particular embodiment, the oligonucleotide can range from about 2 to about 200 nucleoside lengths. In various related embodiments, single-stranded, double-stranded, or triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, about 20 to about 30 nucleoside lengths. In some embodiments, the oligonucleotide is about 9 to about 39 nucleoside lengths. In some embodiments, the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleoside lengths. In some embodiments, the oligonucleotide is at least 4 nucleoside lengths. In some embodiments, the oligonucleotide is at least 5 nucleoside lengths. In some embodiments, the oligonucleotide is at least 6 nucleoside lengths. In some embodiments, the oligonucleotide is at least 7 nucleoside lengths. In some embodiments, the oligonucleotide is at least 8 nucleoside lengths. In some embodiments, the oligonucleotide is at least 9 nucleoside lengths. In some embodiments, the oligonucleotide is at least 10 nucleoside lengths. In some embodiments, the oligonucleotide is at least 11 nucleoside lengths. In some embodiments, the oligonucleotide is at least 12 nucleoside lengths. In some embodiments, the oligonucleotide is at least 15 nucleoside lengths. In some embodiments, the oligonucleotide is at least 15 nucleoside lengths. In some embodiments, the oligonucleotide is at least 16 nucleoside lengths. In some embodiments, the oligonucleotide is at least 17 nucleoside lengths. In some embodiments, the oligonucleotide is at least 18 nucleoside lengths. In some embodiments, the oligonucleotide is at least 19 nucleoside lengths. In some embodiments, the oligonucleotide is at least 20 nucleoside lengths.In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is a double-strand of a complementary strand that is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is a double-strand of a complementary strand that is at least 21 nucleosides in length. In some embodiments, each nucleoside counted towards the oligonucleotide length independently comprises A, T, C, G or U, or A, T, C, G or U optionally substituted, or a tautomer optionally substituted with A, T, C, G or U.

[0071] Oligonucleotide type: As used herein, the phrase "oligonucleotide type" is used to define an oligonucleotide having a specific base sequence, a pattern of backbone linkages (i.e., internucleotide linkage type, e.g., a pattern such as phosphate, phosphorothioate, phosphorothioate triester, etc.), a pattern of backbone chiral centers [i.e., a pattern of linked phosphorus stereochemistry (Rp / Sp)], and a pattern of backbone phosphorus modifications (e.g., the pattern of "-XLR" groups in Formula I as defined herein). In some embodiments, oligonucleotides of a common designated "type" are structurally identical to each other. 1 ” groups).

[0072] One of ordinary skill in the art will understand that the disclosed synthetic methods provide a degree of control during the synthesis of an oligonucleotide chain such that each nucleotide unit of the oligonucleotide chain can be pre-designed and / or selected to have a particular stereochemistry at the linking phosphorus and / or a particular modification at the linking phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, the oligonucleotide chain is pre-designed and / or selected to have a particular combination of stereocenters at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or determined to have a particular combination of modifications at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or selected to have a particular combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides a composition (e.g., a chirally controlled oligonucleotide composition) comprising or consisting of a plurality of oligonucleotide molecules. In some embodiments, all such molecules are of the same type (i.e., structurally identical to each other). However, in some embodiments, the composition provided comprises a plurality of different types of oligonucleotides, typically in a predetermined relative amount.

[0073] Optionally substituted: As described herein, the compounds of the present disclosure, such as oligonucleotides, may include optionally substituted moieties and / or substituted moieties. In general, the term "substituted" means that one or more hydrogens of the indicated moiety are replaced with a suitable substituent, whether or not the term "optionally" precedes it. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when two or more positions in any given structure may be substituted with two or more substituents selected from the designated group, the substituents may be the same or different at each position. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents contemplated by the present disclosure preferably result in the formation of stable or chemically feasible compounds. The term "stable," as used herein, refers to a compound that does not substantially change when subjected to the conditions for its generation, detection, and in certain embodiments, its recovery, purification, and use, for one or more of the purposes disclosed herein. Specific substituents are described below.

[0074] A substitutable atom, e.g., a suitable monovalent substituent on a suitable carbon atom, is independently halogen; -(CH2) 0~4 R 〇 ; -(CH2) 0~4 OR 〇 ; -O(CH2) 0~4 R o , -O-(CH2) 0~4 C(O)OR 〇 ; -(CH2) 0~4 CH(OR 〇 )2; R 〇 which may be substituted with, -(CH2) 0~4 Ph; R 〇 which may be substituted with, -(CH2) 0~4 O(CH2) 0~1 Ph; R 〇 which may be substituted with, -CH=CHPh; R 〇 which may be substituted with -(CH2) 0~4 O(CH2) 0~1 -pyridyl; -NO2; -CN; -N3; -(CH2)0~4 N(R 〇 )2;-(CH2) 0~4 N(R 〇 )C(O)R 〇 ;-N(R 〇 )C(S)R 〇 ;-(CH2) 0~4 N(R 〇 )C(O)NR 〇 2;-N(R 〇 )C(S)NR 〇 2;-(CH2) 0~4 N(R 〇 )C(O)OR 〇 ;-N(R 〇 )N(R 〇 )C(O)R 〇 ;-N(R 〇 )N(R 〇 )C(O)NR 〇 2;-N(R 〇 )N(R 〇 )C(O)OR 〇 ;-(CH2) 0~4 C(O)R 〇 ;-C(S)R 〇 ;-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 C(O)SR 〇 ;-(CH2) 0~4 C(O)OSiR 〇 3;-(CH2) 0~4 OC(O)R 〇 ;-OC(O)(CH2) 0~4 SR 〇 、-SC(S)SR 〇 ;-(CH2) 0~4 SC(O)R 〇 ;-(CH2) 0~4 C(O)NR 〇 2;-C(S)NR 〇 2;-C(S)SR 〇 ;-(CH2) 0~4 OC(O)NR 〇 2;-C(O)N(OR 〇 )R 〇 ;-C(O)C(O)R 〇 ;-C(O)CH2C(O)R 〇 ;-C(NOR 〇 )R〇 ;-(CH2) 0~4 SSR 〇 ;-(CH2) 0~4 S(O)2R 〇 ;-(CH2) 0~4 S(O)2OR 〇 ;-(CH2) 0~4 OS(O)2R 〇 ;-S(O)2NR 〇 2;-(CH2) 0~4 S(O)R 〇 ;-N(R 〇 )S(O)2NR 〇 2;-N(R 〇 )S(O)2R 〇 ;-N(OR 〇 )R 〇 ;-C(NH)NR 〇 2;-Si(R 〇 )3;-OSi(R 〇 )3;-B(R 〇 )2;-OB(R 〇 )2;-OB(OR 〇 )2;-P(R 〇 )2;-P(OR 〇 )2;-P(R 〇 )(OR 〇 );-OP(R 〇 )2;-OP(OR 〇 )2;-OP(R 〇 )(OR 〇 );-P(O)(R 〇 )2;-P(O)(OR 〇 )2;-OP(O)(R 〇 )2;-OP(O)(OR 〇 )2;-OP(O)(OR 〇 )(SR 〇 );-SP(O)(R 〇 )2;-SP(O)(OR 〇 )2;-N(R 〇 )P(O)(R 〇 )2;-N(R 〇 )P(O)(OR 〇 )2;-P(R 〇 )2[B(R 〇 )3];-P(OR 〇 )2[B(R 〇 )3];-OP(R 〇 )2[B(R〇 )3]; -OP(OR 〇 )2[B(R 〇 )3]; -(C 1~4 (linear or branched alkylene)O-N(R 〇 )2; or -(C 1~4 (linear or branched alkylene)C(O)O-N(R 〇 )2, wherein each R 〇 may be substituted as defined herein and is independently hydrogen, C 1~20 aliphatic, C having 1 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus 1~20 heteroaliphatic, -CH2-(C 6~14 aryl), -O(CH2) 0~1 (C 6~14 aryl), -CH2-(5- to 14-membered heteroaryl ring), a 5- to 20-membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or, notwithstanding the above definition, two independent occurrences of R 〇 may together with one or more intervening atoms form a 5- to 20-membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be substituted as defined below.

[0075] R 〇 (or a ring formed by the combination of two independent occurrences of R 〇 with their intervening atoms) suitable monovalent substituents are independently halogen, -(CH2) 0~2 R ● , -(haloR ● ), -(CH2) 0~2 OH, -(CH2) 0~2 OR ● , -(CH2) 0~2 CH(OR ● )2; -O(haloR ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● , -(CH2) 0~2 C(O)OH, -(CH2)0~2 C(O)OR ● 、 -(CH2) 0~2 SR ● 、 -(CH2) 0~2 SH、 -(CH2) 0~2 NH2、 -(CH2) 0~2 NHR ● 、 -(CH2) 0~2 NR ● 2、 -NO2、 -SiR ● 3、 -OSiR ● 3、 -C(O)SR ● 、 -(C 1~4 linear or branched alkylene)C(O)OR ● 、 or -SSR ● and, in the formula, each R ● is unsubstituted or, when preceded by "halo", is substituted by only one or more halogens and, independently, is selected from C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph and a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on the saturated carbon atoms of R 〇 include =O and =S.

[0076] For example, suitable divalent substituents on suitable carbon atoms are, independently, the following: =O, =S, =NNR * 2, =NNHC(O)R * 、 =NNHC(O)OR * 、 =NNHS(O)2R * 、 =NR * 、 =NOR * 、 -O(C(R * 2)) 2~3 O-, or -S(C(R * 2)) 2~3 S-, and in the formula, each independent occurrence of R * is hydrogen or a C that can be substituted as defined below 1~6Selected from aliphatics and unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl rings having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents bonded to vicinal substitutable carbons of a "optionally substituted" group include -O(CR * 2) 2~3 O-, wherein each independent occurrence of R * is hydrogen or a C 1~6 aliphatic selected from aliphatics and unsubstituted 5- to 6-membered saturated, partially unsaturated, and aryl rings having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0077] R * Suitable substituents on the aliphatic group of are independently halogen, -R ● , -(haloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, wherein each R ● is unsubstituted or, when preceded by "halo", substituted with only one or more halogens and is independently C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0078] In some embodiments, suitable substituents on substitutable nitrogen are independently -R † , -NR † 2, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH2C(O)R † , -S(O)2R † , -S(O)2NR † 2, -C(S)NR † 2, -C(NH)NR † 2, or -N(R† )S(O)2R † wherein each R † is independently hydrogen, C 1~6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl ring having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the above definition, two independent occurrences of R † together with one or more intervening atoms form an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0079] R † Suitable substituents on the aliphatic group of R ● are independently halogen, -R ● , -(haloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● 2, or -NO2, wherein each R ● is unsubstituted or, when preceded by "halo", is substituted by only one or more halogens and is independently C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0080] Oral: The phrases "oral administration" and "administered orally" as used herein have the meaning understood in the art and refer to the administration of a compound or composition by mouth.

[0081] P modification: As used herein, the term "P modification" refers to any modification other than stereochemical modification at the linking phosphorus. In some embodiments, the P modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the linking phosphorus. In some embodiments, "P modification" is -X-L-R 1 wherein X, L, and R 1 each is, independently, as defined and described in this disclosure.

[0082] Parenteral: The phrases "parenteral administration" and "administered parenterally" as used herein have the meaning understood in the art and refer to a mode of administration other than enteral and topical administration, usually by injection, including, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injection and infusion.

[0083] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0084] Pharmaceutical Composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage amount appropriate for administration in a treatment regimen that demonstrates a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be formulated for administration in solid or liquid form including, but not limited to: oral administration, such as a drink (aqueous or non-aqueous solution or suspension), tablet, e.g., buccal, sublingual, and those targeted for systemic absorption, bolus, powder, granule, paste for application to the tongue; parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., as a sterile solution or suspension, or as a sustained release formulation; topical application, such as as a cream, ointment, or controlled release patch or spray applied to the skin, lung, or oral cavity; intravaginal or rectal, e.g., as a pessary, cream, or foam; sublingual; intraocular; transdermal; or formulated specifically for administration in solid or liquid form including those adapted for nasal, pulmonary, and other mucosal surfaces.

[0085] Pharmaceutically Acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with human and animal tissues within the scope of sound medical judgment, without undue toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable risk / benefit ratio.

[0086] Pharmaceutically Acceptable Carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or medium such as a liquid or solid filler, diluent, excipient, or solvent that encapsulates a material involved in the transport or conveyance of a subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include saccharides such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic and compatible substances used in pharmaceutical formulations.

[0087] Pharmaceutically acceptable salts: The term "pharmaceutically acceptable salts" as used herein refers to salts of such compounds that are suitable for use in a pharmaceutical context, i.e., within the scope of sound medical judgment, salts that are not accompanied by undue toxicity, irritation, allergic response, etc., are suitable for use in contact with the tissues of humans and lower animals, and are commensurate with a reasonable risk-benefit ratio. Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge, et al. have described in detail pharmaceutically acceptable salts in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts, which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or are salts of amino groups formed by using other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc.In some embodiments, the provided compound contains one or more acidic groups, such as oligonucleotides, and pharmaceutically acceptable salts are alkali salts, alkaline earth metal salts, or ammonium salts (e.g., ammonium salts of N(R)3 [where each R is independently as defined and described in this disclosure]). Representative alkali salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, the provided compound contains two or more acidic groups, e.g., an oligonucleotide may contain two or more acidic groups (e.g., in natural phosphate linkages and / or modified internucleotide linkages). In some embodiments, pharmaceutically acceptable salts of such compounds, or salts in general, contain two or more cations that may be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or salt in general), all ionizable hydrogens in the acidic group (e.g., having a pKa of about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 or less; in some embodiments, about 7 or less; in some embodiments, about 6 or less; in some embodiments, about 5 or less; in some embodiments, about 4 or less; in some embodiments, about 3 or less in an aqueous solution) are replaced by cations. In some embodiments, each phosphorothioate and phosphate group is independently present in its salt form (e.g., in the case of a sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively).In some embodiments, each phosphorothioate and phosphodiester internucleotide linkage is independently present in its salt form (e.g., in the case of sodium salts, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide, where each acidic phosphate group and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if present, is present in its salt form (all sodium salts).

[0088] Protecting group: As used herein, the term "protecting group" is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3 rd edition, John Wiley & Sons, 1999 (which is hereby incorporated by reference in its entirety). Also included are protecting groups specifically adapted for nucleoside and nucleotide chemistry as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012 (the entirety of Chapter 2 is hereby incorporated by reference). Suitable amino protecting groups include, but are not limited to, those described herein and / or in International Publication No. WO 2018 / 022473, International Publication No. WO 2018 / 098264, International Publication No. WO 2018 / 223056, International Publication No. WO 2018 / 223073, International Publication No. WO 2018 / 223081, International Publication No. WO 2018 / 237194, International Publication No. WO 2019 / 032607, International Publication No. WO 2019 / 055951, and / or International Publication No. WO 2019 / 075357 (the descriptions of each of these protecting groups are independently hereby incorporated by reference).

[0089] Subject: As used herein, the term "subject" or "test subject" refers to any organism to which a compound (e.g., an oligonucleotide being provided) or composition is administered for purposes such as, for example, experimentation, diagnosis, prevention and / or treatment in the present disclosure. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms, etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject may be suffering from and / or be susceptible to a disease, disorder and / or condition.

[0090] Substantially: As used herein, the term "substantially" refers to a qualitative condition of presenting the entire or almost entire scope or degree of a characteristic or property of interest. A base sequence that is substantially complementary to a second sequence is not identical to the second sequence but is approximately or nearly identical to the second sequence. Additionally, one of ordinary skill in the biological arts will understand that it is rare, if ever, for biological and chemical phenomena to proceed to completion and / or reach absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0091] Sugar: The term "sugar" refers to closed and / or open-chain monosaccharides or polysaccharides. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs that are used in place of conventional sugar molecules such as glycols, where the polymer forms a backbone such as a nucleic acid analog, glycol nucleic acid ("GNA"), etc. As used herein, the term "sugar" also encompasses structural analogs that are used in place of natural or naturally occurring nucleotides such as modified sugars and nucleotide sugars. In some embodiments, the sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, the sugar is a modified ribose or deoxyribose sugar, e.g., 2'-modified, 5'-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, the modified sugar can provide one or more desired properties, activities, etc. In some embodiments, the sugar is ribose or deoxyribose optionally substituted. In some embodiments, "sugar" refers to the sugar unit in an oligonucleotide or nucleic acid.

[0092] Prone to ~: An individual "prone to" a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition compared to a member of the general public. In some embodiments, an individual prone to a disease, disorder, and / or condition has a predisposition to that disease, disorder, and / or condition. In some embodiments, an individual prone to a disease, disorder, and / or condition may not be diagnosed with that disease, disorder, and / or condition. In some embodiments, an individual prone to a disease, disorder, and / or condition may exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, an individual prone to a disease, disorder, and / or condition may not exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, an individual prone to a disease, disorder, and / or condition will develop that disease, disorder, and / or condition. In some embodiments, an individual prone to a disease, disorder, and / or condition will not develop that disease, disorder, and / or condition.

[0093] Therapeutic agent: As used herein, the general term "therapeutic agent" generally refers to any agent that produces a desired effect (e.g., a desired biological, clinical, or pharmacological effect) upon administration to a subject. In some embodiments, an agent is considered a therapeutic agent if it demonstrates a statistically significant effect in an appropriate population. In some embodiments, the appropriate population is a population of subjects afflicted with and / or susceptible to a disease, disorder, or condition. In some embodiments, the appropriate population is a population of model organisms. In some embodiments, the appropriate population can be defined by one or more criteria such as age group, sex, genetic background, pre-existing clinical condition, exposure history to therapies, etc. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, alleviates, ameliorates, reduces, inhibits, prevents, delays the onset of, reduces the severity of, and / or decreases the incidence of one or more symptoms or characteristics of the subject's disease, disorder, and / or condition. In some embodiments, a "therapeutic agent" is an agent that has received or is required to receive approval by a government agency before it can be marketed for administration to humans. In some embodiments, a "therapeutic agent" is an agent that requires a physician's prescription for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0094] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition in a subject afflicted with or susceptible to the disease, disorder, and / or condition. As will be appreciated by those skilled in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell or tissue, and the like. For example, the effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, improves, reduces, inhibits, prevents, delays the onset of, reduces the severity of, and / or decreases the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered as a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0095] Treat: As used herein, the terms "treat", "treatment", or "treating" refer to any method used to partially or completely alleviate, improve, reduce, inhibit, prevent, delay the onset of, reduce the severity of, and / or decrease the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment can be administered to a subject who does not exhibit symptoms of a disease, disorder, and / or condition. In some embodiments, treatment can be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition, for example, for the purpose of reducing the risk of developing a lesion associated with the disease, disorder, and / or condition.

[0096] Unsaturated: The term "unsaturated", as used herein, means that a moiety has one or more unsaturation units.

[0097] Wild type: As used herein, the term "wild type" has the meaning understood in the art thereof, referring to an entity having a structure and / or activity as found in a natural, "normal" (in contrast to mutant, diseased, modified, etc.) state or context. One of ordinary skill in the art will understand that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0098] For purposes of the present disclosure, chemical elements are identified according to the CAS version of the Periodic Table of the Elements, inside front cover of Handbook of Chemistry and Physics, 67th Ed., 1986 - 87.

[0099] As will be understood by one of ordinary skill in the art, the methods and compositions described herein with respect to the provided compounds (e.g., oligonucleotides) apply also to pharmaceutically acceptable salts of such compounds.

[0100] Description of Specific Embodiments Oligonucleotides provide tools useful for a wide variety of applications. For example, HTT oligonucleotides are useful in therapeutic, diagnostic, and research applications, including the treatment of various HTT-related conditions, disorders, and diseases, including Huntington's disease. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their vulnerability to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to avoid such drawbacks and / or to improve various properties and activities. This includes synthetic oligonucleotides that include, among other things, chemical modifications that make such molecules less susceptible to degradation and that improve other properties and / or activities, such as base modifications, sugar modifications, backbone modifications, etc. From a structural perspective, modifications to internucleotide linkages can introduce chirality, and certain properties can be affected by the configuration of the phosphorus atom of the oligonucleotide's linking phosphate. For example, binding affinity, sequence-specific binding to complementary RNA, stability to nucleases, cleavage of target HTT nucleic acids, delivery, pharmacokinetics, etc. can be affected, among other things, by the chirality of the backbone linking phosphorus atom. In particular, the present disclosure provides techniques for controlling and / or exploiting various structural elements in oligonucleotides, such as sugar modifications and their patterns, nucleobase modifications and their patterns, modified internucleotide linkages and their patterns, linking phosphorus stereochemistry and its patterns, additional chemical moieties (typically moieties not in the oligonucleotide chain) and their patterns, etc., and various combinations of one or more or all of such structural elements.

[0101] In some embodiments, the oligonucleotides provided are oligonucleotides that target HTT and can reduce the levels of mutant HTT transcripts and / or one or more products encoded thereby. Such oligonucleotides are particularly useful for the prevention and / or treatment of HTT-related conditions, disorders, and / or diseases, including Huntington's disease.

[0102] In some embodiments, the HTT oligonucleotide comprises a sequence that is fully or substantially identical to, or fully or substantially complementary to, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous bases of the HTT genomic sequence or a transcript therefrom (e.g., pre-mRNA, mRNA, etc.). One of ordinary skill in the art will understand that an “HTT oligonucleotide” can have a nucleotide sequence that is identical (or substantially identical) or complementary (or substantially complementary) to an HTT base sequence (e.g., genomic sequence, transcript sequence, mRNA sequence, etc.) or a portion thereof.

[0103] In some embodiments, the present disclosure provides an HTT oligonucleotide having a base sequence comprising an HTT oligonucleotide as disclosed herein, for example, as disclosed in a table herein, or at least 10 contiguous bases of an oligonucleotide disclosed herein.

[0104] In some embodiments, the present disclosure provides an HTT oligonucleotide having a base sequence as disclosed herein, for example, as disclosed in a table herein, or a portion thereof comprising at least 10 contiguous bases, wherein the HTT oligonucleotide is sterically random or not chirally controlled.

[0105] In some embodiments, the internucleotide linkages of the oligonucleotides comprise or consist of 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 40, 1 to 50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more chirally controlled internucleotide linkages. In some embodiments, the oligonucleotide compositions of the present disclosure comprise oligonucleotides of the same chemical constitution, wherein one or more internucleotide linkages are chirally controlled and one or more internucleotide linkages are sterically random (not chirally controlled). In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide comprises at least one chirally controlled internucleotide linkage. In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide is sterically random or not chirally controlled. In some embodiments, in the HTT oligonucleotide, at least one internucleotide linkage is sterically random and at least one internucleotide linkage is chirally controlled.

[0106] In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more negatively charged internucleotide linkages (e.g., phosphorothioate internucleotide linkages, native phosphate linkages, etc.). In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more negatively charged chiral internucleotide linkages (e.g., phosphorothioate internucleotide linkages). In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more non-negatively charged internucleotide linkages. In some embodiments, the internucleotide linkages of the oligonucleotide comprise or consist of one or more neutral chiral internucleotide linkages. In some embodiments, the present disclosure relates to an HTT oligonucleotide comprising at least one neutral or non-negatively charged internucleotide linkage as described herein.

[0107] HTT In some embodiments, HTT refers to a gene or its gene product from any species (including, but not limited to, nucleic acids such as DNA or RNA, or wild-type or mutant proteins encoded thereby, but not limited thereto), and may also be known as HTT, HD, IT15, huntingtin, huntingtin, or LOMARS; External ID: OMIM: 613004, MGI: 96067, HomoloGene: 1593, GeneCards: HTT; Species: Human: Entrez: 3064; Ensembl: ENSG00000197386; UniProt: P42858; RefSeq (mRNA): NM_002111; RefSeq (protein): NP_002102; Location (UCSC): Chr4: 3.04 - 3.24 Mb; Species: Mouse: Entrez: 15194; Ensembl: ENSMUSG00000029104; UniProt: P42859; RefSeq (mRNA): NM_010414; RefSeq (protein): NP_034544; Location (UCSC): Chr5: 34.76 - 34.91 Mb. Additional HTT sequences from humans, mice, rats, monkeys, etc., including their variants, are readily available to those skilled in the art. In some embodiments, HTT is wild-type or mutant human or mouse HTT.

[0108] In some embodiments, the HTT protein is either unmodified or modified. In some embodiments, the HTT protein has any one or more modifications of 9 N6-acetyllysine; 176 N6-acetyllysine; 234 N6-acetyllysine; 343 N6-acetyllysine; 411 phosphoserine; 417 phosphoserine; 419 phosphoserine; 432 phosphoserine; 442 N6-acetyllysine; 640 phosphoserine; 643 phosphoserine; 1179 phosphoserine; 1199 phosphoserine; 1870 phosphoserine; or 1874 phosphoserine.

[0109] Although not wishing to be bound by any particular theory, the present disclosure notes that mutations in HTT (e.g., CAG repeat expansions) are reported to be key factors in diseases and disorders such as Huntington's disease.

[0110] In some embodiments, mutant HTT is denoted as mHTT, muHTT, m HTT, mu HTT, MU HTT, etc., where m or mu indicates a mutant. In some embodiments, wild-type HTT is denoted as wild-type HTT, wtHTT, wt HTT, WT HTT, WTHTT, etc., where wt indicates wild-type. In some embodiments, mutant HTT includes an expanded CAG repeat region (e.g., 36 - 121, 36 - 250, 37 - 121, 40 - 121 repeats or more). In some embodiments, mutant HTT includes mutant alleles of one or more SNPs (alleles on the same DNA strand or chromosome as the expanded CAG repeat). In some embodiments, mutant HTT includes both an expanded CAG repeat region and mutant alleles of specific SNPs on the same chromosomal strand.

[0111] In some embodiments, human HTT is denoted as hHTT. In some embodiments, mutant HTT is denoted as mHTT. In some embodiments, when mice are used, as would be understood by those skilled in the art, mouse HTT may also be referred to as mHTT.

[0112] In some embodiments, an HTT oligonucleotide is complementary to a portion of an HTT nucleic acid sequence, e.g., a portion of an HTT gene sequence, an HTT mRNA sequence, etc. In some embodiments, such a portion of the nucleotide sequence is characteristic of HTT in that it does not have the same sequence as any other genomic sequence or transcript sequence. In some embodiments, the portion of the gene that is complementary to the oligonucleotide is referred to as the target sequence of the oligonucleotide.

[0113] In some embodiments, the HTT gene sequence (or a portion thereof, e.g., complementary to an HTT oligonucleotide) is an HTT gene sequence (or a portion thereof) known in the art or reported in the literature. Specific nucleotide and amino acid sequences of human HTT can be retrieved from publicly available information sources, e.g., one or more publicly available databases such as GenBank, UniProt, OMEVI, etc. One of ordinary skill in the art will understand that, for example, if a described nucleic acid sequence can be or can contain a genomic sequence, transcripts, splicing products, and / or encoded proteins, etc. can be readily understood from such genomic sequences.

[0114] In some embodiments, the HTT gene (or a portion thereof having a sequence complementary to an HTT oligonucleotide) contains a single nucleotide polymorphism or SNP. Numerous HTT SNPs have been reported and can be retrieved, e.g., from NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the HTT gene can be retrieved by NCBI dbSNP accession number and include, for example, those described herein. In some embodiments, the HTT oligonucleotide targets a SNP allele that is on the same chromosome as (e.g., in the same phase as) the CAG repeat expansion and is not present in the wild-type allele (which does not contain the CAG repeat expansion).

[0115] Huntington's disease (HD) is reportedly a neurodegenerative disorder caused by a mutation in the HTT (huntingtin) gene. Reportedly, this change in a widely expressed single gene results in a progressive neurodegenerative disorder with numerous characteristic symptoms. In some embodiments, the HD-associated mutation is an expansion of the CAG repeat region in the HTT gene, and reportedly, the greater the expansion, the greater the severity of the disease and the earlier the onset. Reportedly, this mutation causes various motor, emotional, and cognitive symptoms and leads to the formation of huntingtin aggregates in the brain.

[0116] According to reports, CAG expansion causes the elongation of the polyglutamine chain of the huntingtin protein, which is a 350 kDa protein (Huntington Disease Collaborative Research Group, 1993. Cell. 72:971-83). Normal and expanded HD allele sizes are known from reports to be, for example, CAG6-37 and CAG35-121 repeats or more, respectively. According to reports, the longer the sequence, the more it is associated with earlier disease onset. According to reports, since there is no HD phenotype in individuals lacking one copy of huntingtin or the severity of the disease increases in individuals homozygous for the expansion, it is suggested that this mutation does not cause a loss of function (Trottier et al., 1995, Nature Med., 10:104-110). According to reports, deregulation and loss of function of the transcriptional coactivator protein are related to the onset of HD. According to reports, mutant huntingtin has been shown to disrupt activator-dependent transcription, especially in the early stage of HD onset (Dunah et al., 2002. Science 296:2238-2243).

[0117] In one report, gene profiling of human blood identified 322 mRNAs that showed significant changes in expression in HD blood samples when compared to normal or pre-symptomatic individuals. Similarly, since the expression of marker genes also changed substantially in postmortem brain samples from the HD caudate nucleus, it is suggested that the upregulation of genes in blood samples reflects the disease mechanism seen in the brain. Monitoring gene expression can provide a sensitive and quantitative method for monitoring disease progression, especially in the early stage of the disease, in both animal models and human patients (Borovecki et al., 2005, Proc. Natl. Acad. Sci. USA 102:11023-11028).

[0118] Huntington's disease has been reported to be an autosomal dominant disorder, generally onsetting in middle age, but cases have been recorded from onset in childhood to onset after the age of 70. According to reports, the early onset age is related to paternal inheritance, and 70% of juvenile cases are inherited from the father.

[0119] In some embodiments, the symptoms of Huntington's disease have emotional, motor and cognitive components. One symptom, chorea, is a characteristic feature of movement disorders and is defined as random, abrupt, excessive involuntary movements occurring at irregular timings. This can vary from barely noticeable to severe. Other frequently observed symptoms or abnormalities include dystonia, rigidity, bradykinesia, oculomotor dysfunction, tremors, etc. Voluntary movement disorders as symptoms include fine motor incoordination, dysarthria and dysphagia. Emotional disorders or symptoms generally include depression and irritability, and the cognitive component includes subcortical dementia (Mangiarini et al. 1996. Cell 87:493 - 506). Changes in the HD brain are widespread, and it has been reported to include neuronal loss and gliosis, especially in the cortex and striatum (Vonsattel and DiFiglia. 1998. J. Neuropathol. Exp. Neurol. 57:369 - 384).

[0120] For certain information regarding HTT and HTT-related conditions, disorders or diseases, see, for example, Kremer et al. 1994. N. E. J. Med. 330: 1401; Kordasiewicz et al. 2012 Neuron 74: 1031-1044; Carroll et al. 2011 Mol. Ther. 19: 2178-2185; Warby et al. 2009 Am. J. Hum. Genet. 84: 351-366; Pfister et al. 2009 Current Biol. 19: 774-778; Kay et al. 2015 Mol. Ther. 23: 1759-1771; Kay et al. 2014 Clin. Genet. 86: 29-36; Lee et al. 2015. Am. J. Hum. Genet. 97: 435-444; Skotte et al. 2014. PLOS ONE 9: e107434; Southwell et al. 2014. Mol. Ther. 22: 2093-2106; Japanese Patent Application Laid-Open No. 2017276286 and No. 2007210038; European Patent Application Laid-Open No. 3277814 and No. 3210633; International Publication No. 2018145009; and U.S. Patent Application Publication No. 20180273945.

[0121] In some embodiments, an HTT oligonucleotide having the ability to reduce the level, activity and / or expression of the HTT gene is useful in a method of preventing or treating an HTT-related condition, disorder or disease, such as Huntington's disease, and / or delaying the onset and / or severity of one or more symptoms of Huntington's disease.

[0122] In some embodiments, the present disclosure provides a method of preventing or treating such a condition, disorder or disease by administering to a subject suffering from or susceptible to an HTT-related condition, disorder or disease a therapeutically effective amount of an HTT oligonucleotide or a composition thereof. In some embodiments, the composition is a chirally controlled oligonucleotide composition.

[0123] HTT oligonucleotide In particular, the present disclosure provides oligonucleotides of various designs that include various nucleobases and their patterns, sugars and their patterns, internucleotide linkages and their patterns, and / or additional chemical moieties and their patterns as described herein. In some embodiments, the oligonucleotides provided are HTT oligonucleotides. In some embodiments, the HTT oligonucleotides provided can lead to a decrease in the expression, level, and / or activity of one or more of the HTT gene and / or its products (e.g., transcript, mRNA, protein, etc.). In some embodiments, the HTT oligonucleotides provided can lead to a decrease in the expression, level, and / or activity of one or more of the HTT gene and / or its products in any cell of a subject or patient. In some embodiments, the cell is any cell that normally expresses HTT or produces HTT protein. In some embodiments, the HTT oligonucleotides provided can lead to a decrease in the expression, level, and / or activity of the HTT target gene or gene product and have a nucleotide sequence consisting of, comprising, or being a portion of (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more adjacent nucleotides) the nucleotide sequence of the HTT oligonucleotides disclosed herein, and the oligonucleotide comprises at least one non-naturally occurring modification of a base, sugar, and / or internucleotide linkage.

[0124] In some embodiments, the HTT oligonucleotide includes one or more carbohydrate moieties. In some embodiments, the HTT oligonucleotide includes one or more lipid moieties. In some embodiments, the HTT oligonucleotide includes one or more targeting moieties. Non-limiting examples of such additional chemical moieties that can conjugate to the oligonucleotide chain are described herein.

[0125] In some embodiments, the provided oligonucleotides can lead to a decrease in the expression, level, and / or activity of a target gene, such as the HTT target gene, or its product. In some embodiments, the provided oligonucleotides can lead to a decrease in the expression, level, and / or activity of the HTT target gene or its product by RNase H-mediated knockdown. In some embodiments, the provided oligonucleotides can lead to a decrease in the expression, level, and / or activity of the HTT target gene or its product by sterically blocking translation after binding to the HTT target gene mRNA and / or by altering or interfering with mRNA splicing. However, nevertheless, the present disclosure is not limited to any particular mechanism. In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc. having the ability to function by double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knockdown, steric hindrance of translation, or a combination of two or more such mechanisms.

[0126] In some embodiments, the HTT oligonucleotide is an antisense oligonucleotide (ASO) in that it has a base sequence that is antisense to (e.g., complementary to) the target HTT sequence. In some embodiments, the HTT oligonucleotide is a double-stranded siRNA. In some embodiments, the HTT oligonucleotide is a single-stranded siRNA. The oligonucleotides and compositions thereof provided can be utilized for numerous purposes. For example, the provided HTT oligonucleotides can be co-administered with, or used as part of a treatment regimen with, one or more treatments for Huntington's disease or its symptoms, including, but not limited to, aptamers, lncRNAs, lncRNA inhibitors, antibodies, peptides, small molecules, other oligonucleotides against HTT or other targets, and / or other agents having the ability to inhibit the expression of HTT transcripts, reduce the level and / or activity of HTT gene products, and / or inhibit the expression of genes or reduce the level of gene products that increase the expression, activity, and / or level of HTT transcripts or HTT gene products, or genes or gene products associated with HTT-related disorders.

[0127] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises a structural element or a portion thereof described herein, for example, in a table. In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises a base sequence (or a portion thereof), a chemical modification or chemical modification pattern (or a portion thereof), and / or a format or a portion thereof described herein. In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises a base sequence (or a portion thereof), a chemical modification pattern (or a portion thereof), and / or a format of an oligonucleotide disclosed herein, for example, in Table 1 or a figure, or otherwise disclosed herein. In some embodiments, such an oligonucleotide, such as an HTT oligonucleotide, reduces the expression, level, and / or activity of a gene, such as the HTT gene, or its gene product.

[0128] In particular, the provided oligonucleotides can hybridize to the target HTT nucleic acid (e.g., pre-mRNA, mature mRNA, etc.). For example, in some embodiments, the HTT oligonucleotide can hybridize to an HTT nucleic acid derived from a DNA strand (either strand of the HTT gene). In some embodiments, the HTT oligonucleotide can hybridize to an HTT transcript. In some embodiments, the HTT oligonucleotide can hybridize to an HTT nucleic acid at any stage of RNA processing, including but not limited to pre-mRNA or mature mRNA. In some embodiments, the HTT oligonucleotide can hybridize to any element of the HTT nucleic acid or its complement, including but not limited to a promoter region, enhancer region, transcription termination region, translation initiation signal, translation stop codon, coding region, non-coding region, exon, intron, intron / exon or exon / intron junction, 5'UTR, or 3'UTR.

[0129] In some embodiments, the oligonucleotide hybridizes to two or more variants of a transcript derived from the sense strand. In some embodiments, the HTT oligonucleotide hybridizes to two or more variants of HTT derived from the sense strand. In some embodiments, the HTT oligonucleotide hybridizes to all variants of HTT derived from the sense strand. In some embodiments, the HTT oligonucleotide hybridizes to two or more variants of HTT derived from the antisense strand. In some embodiments, the HTT oligonucleotide hybridizes to all variants of HTT derived from the antisense strand.

[0130] In some embodiments, the HTT target of the HTT oligonucleotide is an HTT RNA that is not mRNA.

[0131] In some embodiments, the HTT oligonucleotide contains increased levels of one or more isotopes. In some embodiments, the provided oligonucleotide is labeled with one or more isotopes of, for example, one or more elements such as hydrogen, carbon, nitrogen, etc. In some embodiments, the provided oligonucleotide in the provided composition, for example, a plurality of oligonucleotides of the composition, contains base modifications, sugar modifications, and / or internucleotide linkage modifications, where the oligonucleotide contains an enhanced level of deuterium. In some embodiments, the provided oligonucleotide is labeled with deuterium at one or more positions (- 1 H is replaced with - 2 H). In some embodiments, one or more 1 H of the oligonucleotide chain or any moiety conjugated to the oligonucleotide chain (e.g., targeting moiety, etc.) is 2 replaced with

[0132] H. Such oligonucleotides can be used in any of the compositions and methods described herein. 1) having a common base sequence complementary to a target sequence (e.g., an HTT target sequence) in a transcript; and 2) providing an oligonucleotide composition comprising a plurality of oligonucleotides comprising one or more modified sugar moieties and / or modified internucleotide linkages.

[0133] In some embodiments, an oligonucleotide having a common base sequence, such as an HTT oligonucleotide, can have the same pattern of nucleoside modifications, such as sugar modifications, base modifications, etc. In some embodiments, the nucleoside modification pattern can be represented by a combination of position and modification. In some embodiments, the backbone linkage pattern includes the position and type of each internucleotide linkage (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.).

[0134] In some embodiments, the modified internucleotide linkage has the structure of Formula I. In some embodiments, the modified internucleotide linkage has the structure of Formula I-a. In some embodiments, the internucleotide linkage has the structure of Formula I, Formula I-a, Formula I-b, Formula I-c, Formula I-n-1, Formula I-n-2, Formula I-n-3, Formula I-n-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2, or a salt form thereof.

[0135] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide linkages, each of which independently has the structure of Formula I, Formula I-a, Formula I-b, Formula I-c, Formula I-n-1, Formula I-n-2, Formula I-n-3, Formula I-n-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2.

[0136] In some embodiments, for example in the provided compositions, the oligonucleotides among a plurality are of the same oligonucleotide type. In some embodiments, the oligonucleotides of a certain oligonucleotide type have a common sugar modification pattern. In some embodiments, the oligonucleotides of a certain oligonucleotide type have a common base modification pattern. In some embodiments, the oligonucleotides of a certain oligonucleotide type have a common nucleoside modification pattern. In some embodiments, the oligonucleotides of a certain oligonucleotide type have the same chemical constitution. In some embodiments, the oligonucleotides of a certain oligonucleotide type are identical. In some embodiments, the oligonucleotides among a plurality are identical. In some embodiments, the oligonucleotides among a plurality share the same chemical constitution.

[0137] In some embodiments, as exemplified herein, oligonucleotides, such as HTT oligonucleotides, are chirally controlled by including one or more chirally controlled internucleotide linkages. In some embodiments, the oligonucleotides provided are stereochemically pure. In some embodiments, the oligonucleotides provided are substantially separated from other stereoisomers.

[0138] In some embodiments, oligonucleotides, such as HTT oligonucleotides, include one or more modified nucleobases, one or more modified sugars, and / or one or more modified internucleotide linkages.

[0139] In some embodiments, oligonucleotides, such as HTT oligonucleotides, include one or more modified sugars. In some embodiments, the oligonucleotides of the present disclosure include one or more modified nucleobases. A variety of modifications can be introduced into the sugars and / or nucleobases according to the present disclosure. For example, in some embodiments, the modification is the modification described in U.S. Patent No. 9,006,198. In some embodiments, the modification is the modification described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 2017 / 0037399, U.S. Patent Application Publication No. 2018 / 0216108, U.S. Patent Application Publication No. 2018 / 0216107, U.S. Patent No. 9,598,458, International Publication No. 2017 / 062862, International Publication No. 2018 / 067973, International Publication No. 2017 / 160741, International Publication No. 2017 / 192679, International Publication No. 2017 / 210647, or International Publication No. 2018 / 098264 (each of these sugar, base, and internucleotide linkage modifications is hereby incorporated by reference).

[0140] When used in the present disclosure, in some embodiments, one or more is 1. In some embodiments, one or more is 2. In some embodiments, one or more is 3. In some embodiments, one or more is 4. In some embodiments, one or more is 5. In some embodiments, one or more is 6. In some embodiments, one or more is 7. In some embodiments, one or more is 8. In some embodiments, one or more is 9. In some embodiments, one or more is 10. In some embodiments, one or more is at least 1. In some embodiments, one or more is at least 2. In some embodiments, one or more is at least 3. In some embodiments, one or more is at least 4. In some embodiments, one or more is at least 5. In some embodiments, one or more is at least 6. In some embodiments, one or more is at least 7. In some embodiments, one or more is at least 8. In some embodiments, one or more is at least 9. In some embodiments, one or more is at least 10.

[0141] In some embodiments, the HTT oligonucleotide is or comprises an HTT oligonucleotide described in a table or figure.

[0142] As demonstrated in the present disclosure, in some embodiments, the provided oligonucleotide (e.g., an HTT oligonucleotide) is characterized in that when it contacts a transcript within a knockdown system, the knockdown of its target (e.g., the HTT transcript of the HTT oligonucleotide, a mutant HTT transcript containing an extended CAG repeat, etc.) is improved compared to the knockdown observed under reference conditions (e.g., selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof). In some embodiments, the knockdown increases by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 - fold or more.

[0143] In some embodiments, the oligonucleotide is provided in salt form. In some embodiments, the oligonucleotide is provided as a salt comprising a negatively charged internucleotide linkage (e.g., a phosphorothioate internucleotide linkage, a native phosphate linkage, etc.) in its salt form. In some embodiments, the oligonucleotide is provided as a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide is provided as a metal salt. In some embodiments, the oligonucleotide is provided as a sodium salt. In some embodiments, the oligonucleotide is provided as a metal salt, e.g., a sodium salt, where each negatively charged internucleotide linkage is independently in salt form (e.g., for a sodium salt, -O - P(O)(SNa)-O - for a phosphorothioate internucleotide linkage, -O - P(O)(ONa)-O - for a native phosphate linkage, etc.).

[0144] In some embodiments, the HTT oligonucleotide or HTT oligonucleotide composition is chirally controlled (e.g., stereochemically pure).

[0145] In some embodiments, the HTT oligonucleotide or HTT oligonucleotide is sterically random.

[0146] In some embodiments, the HTT oligonucleotide targets HTT SNPs rs362272, rs362273, rs362273, rs362307, rs362331, or rs363099.

[0147] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a nucleotide sequence comprising ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGGC, wherein each T can independently be replaced by U or vice versa.

[0148] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT or TTGATCTGTAGCAGCAGCT, wherein each T can independently be replaced by U or vice versa.

[0149] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising GTTGATCTGTAGCAGCAGCT, wherein each T can independently be replaced by U or vice versa.

[0150] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a nucleotide sequence comprising CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT or GGCACAAGGGCACAGACTTC, where each T can independently be replaced by U or vice versa.

[0151] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a nucleotide sequence comprising AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG or TGCACACAGTAGATGAGGGA, where each T can independently be replaced by U or vice versa.

[0152] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a nucleotide sequence comprising AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC or TGAGCGGAGAAACCCTCCAA, where each T can independently be replaced by U or vice versa.

[0153] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a nucleotide sequence that is ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGGC, where each T can independently be replaced by U or vice versa.

[0154] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence of AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, where each T can be independently replaced by U or vice versa.

[0155] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence of GTTGATCTGTAGCAGCAGCT, where each T can be independently replaced by U or vice versa.

[0156] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a nucleotide sequence of CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, where each T can be independently replaced by U or vice versa.

[0157] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a nucleotide sequence of AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, where each T can be independently replaced by U or vice versa.

[0158] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a nucleotide sequence of AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC or TGAGCGGAGAAACCCTCCAA, where each T can independently be replaced by U or vice versa.

[0159] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP of ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGGC, where each T can independently be replaced by U or vice versa.

[0160] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP of AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT or TTGATCTGTAGCAGCAGCT, where each T can independently be replaced by U or vice versa.

[0161] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP of GTTGATCTGTAGCAGCAGCT, where each T can independently be replaced by U or vice versa.

[0162] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP, which is CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, where each T can independently be replaced by U or vice versa.

[0163] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP, which is AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, where each T can independently be replaced by U or vice versa.

[0164] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a nucleotide sequence comprising at least 15 contiguous bases including the position of the SNP, which is AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, where each T can independently be replaced by U or vice versa.

[0165] In some embodiments, the HTT oligonucleotide targets SNP rs362272 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP of ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGGC, wherein each T can independently be replaced by U or vice versa.

[0166] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP of AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT or TTGATCTGTAGCAGCAGCT, wherein each T can independently be replaced by U or vice versa.

[0167] In some embodiments, the HTT oligonucleotide targets SNP rs362273 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP of GTTGATCTGTAGCAGCAGCT, wherein each T can independently be replaced by U or vice versa.

[0168] In some embodiments, the HTT oligonucleotide targets SNP rs362307 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP of CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT or GGCACAAGGGCACAGACTTC, wherein each T can independently be replaced by U or vice versa.

[0169] In some embodiments, the HTT oligonucleotide targets SNP rs362331 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP, which is AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, where each T can independently be replaced by U or vice versa.

[0170] In some embodiments, the HTT oligonucleotide targets SNP rs363099 and has a nucleotide sequence comprising at least 10 contiguous bases including the position of the SNP, which is AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, where each T can independently be replaced by U or vice versa.

[0171] In some embodiments, the HTT oligonucleotide does not target an SNP (where each U can independently be replaced by T or vice versa).

[0172] In some embodiments, the HTT oligonucleotide does not target an SNP and is pan - specific (where each U can independently be replaced by T or vice versa).

[0173] In some embodiments, the HTT oligonucleotide does not target SNPs, is pan-specific, and has a nucleotide sequence comprising at least 15 contiguous bases thereof, or at least 10 contiguous bases thereof, including ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG or GTTACCGCCATCCCCGCCGT (wherein each U may independently be replaced by T or vice versa).

[0174] In some embodiments, the HTT oligonucleotide has a nucleotide sequence comprising the sequence of ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG or GTTACCGCCATCCCCGCCGT (wherein each U may independently be replaced by T or vice versa).

[0175] In some embodiments, the HTT oligonucleotide has a nucleotide sequence which is the sequence of ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG or GTTACCGCCATCCCCGCCGT, (wherein each U may independently be replaced by T or vice versa).

[0176] In some embodiments, the HTT oligonucleotide has a nucleotide sequence comprising at least 15 contiguous bases of the sequence ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG or GTTACCGCCATCCCCGCCGT (wherein each U may independently be replaced by T or vice versa).

[0177] In some embodiments, the HTT oligonucleotide has a nucleotide sequence comprising at least 10 contiguous bases of the sequence ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG or GTTACCGCCATCCCCGCCGT (wherein each U may independently be replaced by T or vice versa).

[0178] In some embodiments, the HTT oligonucleotide is any HTT oligonucleotide disclosed herein, or a salt thereof.

[0179] In some embodiments, the HTT oligonucleotide is any of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently replaced by T or vice versa).

[0180] In some embodiments, the HTT oligonucleotide is any of the stereopure (chirally controlled) HTT oligonucleotides comprising the base sequence of any of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U may be independently replaced by T or vice versa).

[0181] In some embodiments, the HTT oligonucleotide is any of the stereochemically pure (chirally controlled) HTT oligonucleotides having the nucleotide sequence of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can independently be replaced by T or vice versa).

[0182] In some embodiments, the HTT oligonucleotide is a stereopure (chirally controlled) HTT oligonucleotide having a nucleotide sequence comprising at least 15 contiguous nucleotides of the nucleotide sequence of any of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof (wherein each U can be independently replaced by T or vice versa).

[0183] In some embodiments, the HTT oligonucleotide has a sequence that includes at least 10 contiguous bases of the nucleotide sequence of any one of WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or is a stereoisomerically pure (chirally controlled) HTT oligonucleotide or any salt thereof (wherein each U may be independently replaced by T or vice versa).

[0184] In some embodiments, the disclosure relates to a composition comprising an HTT oligonucleotide and a pharmaceutical carrier.

[0185] In some embodiments, the disclosure relates to methods of using an HTT oligonucleotide in the treatment and / or prevention of Huntington's disease.

[0186] In some embodiments, the disclosure relates to methods of using an HTT oligonucleotide to treat at least one symptom of Huntington's disease, prevent it, delay its onset, and / or reduce its severity.

[0187] In some embodiments, the present disclosure relates to a method of manufacturing a medicament comprising an HTT oligonucleotide.

[0188] In some embodiments, the HTT oligonucleotide is any individual HTT oligonucleotide or a member of the genus of HTT oligonucleotides described herein.

[0189] Base sequence In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises the nucleotide sequence described herein or a portion thereof (e.g., 5-50, 5-40, 5-30, 5-20, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10, at least 15 contiguous nucleic acid bases in span) that includes 0 to 5 (e.g., 0, 1, 2, 3, 4, or 5) mismatches. In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises the nucleotide sequence described herein or a portion thereof, where the portion is a span of at least 10 contiguous nucleic acid bases that includes 1 to 5 mismatches, or a span of at least 15 contiguous nucleic acid bases. In some embodiments, the provided oligonucleotide comprises the nucleotide sequence described herein or a portion thereof, where the portion is a span of at least 10 contiguous nucleic acid bases, or a span of at least 10 contiguous nucleic acid bases that includes 1 to 5 mismatches. In some embodiments, the nucleotide sequence of the oligonucleotide comprises or consists of 10 to 50 (e.g., about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at least 24; in some embodiments, at least 25) contiguous bases that are identical or complementary to the nucleotide sequence of the HTT gene or its transcript (e.g., mRNA).

[0190] The nucleotide sequence of the provided oligonucleotide, as understood by those skilled in the art, typically has a length sufficient to mediate target-specific knockdown and complementarity with its target, such as an RNA transcript (e.g., pre-mRNA, mature mRNA, etc.). In some embodiments, the nucleotide sequence of the HTT oligonucleotide has a length sufficient to mediate target-specific knockdown and identity with the HTT transcript target. In some embodiments, the HTT oligonucleotide is complementary to a portion of the HTT transcript (HTT transcript target sequence). In some embodiments, the nucleotide sequence of the HTT oligonucleotide has at least 90% identity with the nucleotide sequence of the oligonucleotide disclosed in the table. In some embodiments, the nucleotide sequence of the HTT oligonucleotide has at least 95% identity with the nucleotide sequence of the oligonucleotide disclosed in the table. In some embodiments, the nucleotide sequence of the HTT oligonucleotide includes a continuous span of 15 or more bases of the oligonucleotide disclosed in the table, except when one or more bases within that span are abasic (e.g., no nucleobase is present in the nucleotide). In some embodiments, the nucleotide sequence of the HTT oligonucleotide includes a continuous span of 19 or more bases of the HTT oligonucleotide disclosed herein, except when one or more bases within that span are abasic (e.g., no nucleobase is present in the nucleotide). In some embodiments, the nucleotide sequence of the HTT oligonucleotide includes a continuous span of 19 or more bases of the oligonucleotide disclosed herein, except for differences in 1 or 2 bases at the 5' end and / or 3' end of the nucleotide sequence.

[0191] In some embodiments, the nucleotide sequence of the oligonucleotide is TCTCCATTCT ATCTTATGTT (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0192] In some embodiments, the nucleotide sequence of the oligonucleotide is GTTGATCTGTAGTAGCAGCT or GTTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0193] In some embodiments, the nucleotide sequence of the oligonucleotide is GTGCACACAGTAGATGAGGG (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0194] In some embodiments, the nucleotide sequence of the oligonucleotide is GTGCAACACAGTAGATGAGGG (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0195] In some embodiments, the nucleotide sequence of the oligonucleotide is GGCACAAGGGCACAGACTTC (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0196] In some embodiments, the nucleotide sequence of the oligonucleotide is GGCACAAAGGGCACAGACTTC (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent bases thereof.

[0197] In some embodiments, the nucleotide sequence of the oligonucleotide is CAAGGGCACAGACTTC (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent bases thereof.

[0198] In some embodiments, the nucleotide sequence of the oligonucleotide is AAGGGCACAGACTTC (wherein each T can independently be replaced by U), or includes it, or includes 10 to 20, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 adjacent bases thereof.

[0199] In some embodiments, the nucleotide sequence of the HTT oligonucleotide is complementary to the nucleotide sequence of the HTT transcript or a portion thereof.

[0200] In some embodiments, the HTT target gene is an allele of the HTT gene. In some embodiments, the HTT oligonucleotide is allele-specific and is designed to target a specific allele of HTT (e.g., an allele associated with an HTT-related condition, disorder, or disease). In some embodiments, the nucleotide sequence of the oligonucleotide is fully complementary to the sequence (or a portion thereof) of an HTT transcript from an allele associated with a condition, disorder, or disease, and is not fully complementary to the sequence (or a portion thereof) of an HTT transcript with low or no association with the condition, disorder, or disease. In some embodiments, the disorder-associated allele of HTT contains an SNP, mutation, or other sequence variation, and the HTT oligonucleotide is designed to be complementary to this sequence. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to one allele of the SNP and not the other. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to one allele of the SNP, and this allele is on the same DNA strand as the expanded CAG repeat. In some embodiments, the nucleotide sequence of the oligonucleotide is fully complementary to the sequence (or a portion thereof) of an HTT transcript from an allele containing an expanded CAG repeat, and is not fully complementary to the sequence (or a portion thereof) of an HTT transcript from an allele containing a normal CAG repeat. In some embodiments, the HTT oligonucleotide is pan-specific and is designed to target all alleles of HTT (e.g., all or most of the known alleles of HTT contain the same sequence or a complementary sequence within the span of bases recognized by the HTT oligonucleotide). In some embodiments, the oligonucleotide reduces the expression, level, and / or activity of both wild-type HTT and mutant HTT, and / or their transcripts and / or products.

[0201] In some embodiments, the HTT oligonucleotide comprises the nucleotide sequence set forth in the table or a portion thereof, the sugars, nucleobases, and / or internucleotide linkage modifications described herein, and / or additional chemical moieties described herein (in addition to the oligonucleotide strand, e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.).

[0202] In some embodiments, the terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base pairing between an oligonucleotide (e.g., an HTT oligonucleotide) and a target sequence (e.g., an HTT target sequence), as would be understood by one of ordinary skill in the art in the context in which they are used. As a non-limiting example, if the target sequence has a nucleotide sequence such as 5'-GCAUAGCGAGCGAGGGAAAAC-3', an oligonucleotide having a nucleotide sequence of 5'GUUUUCCCUCGCUCGCUAUGC-3' is complementary (fully complementary) to such a target sequence. It is noted that generally the degree of complementarity does not change with substitution of U by T, or vice versa. As used herein, an oligonucleotide that is "substantially complementary" to a target sequence is generally or nearly complementary, but not 100% complementary. In some embodiments, a substantially complementary sequence (e.g., an HTT oligonucleotide) has 1, 2, 3, 4, or 5 mismatches when aligned with its target sequence. In some embodiments, the HTT oligonucleotide has a nucleotide sequence that is substantially complementary to an HTT target sequence. In some embodiments, the HTT oligonucleotide has a nucleotide sequence that is substantially complementary to the complement of the sequence of the HTT oligonucleotide disclosed herein. As would be understood by one of ordinary skill in the art, in some embodiments, it is not necessary for the oligonucleotide sequence to be 100% complementary to its target in order for the oligonucleotide to function (e.g., to effect knockdown of the target HTT nucleic acid). In some embodiments, homology, sequence identity, or complementarity is 60% to 100%, such as about or at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%. In some embodiments, the provided oligonucleotide has 75% to 100% (such as about or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%) sequence complementarity with a target region (e.g., a target sequence) within the target HTT nucleic acid. In some embodiments, the percentage is about 80% or more.In some embodiments, the percentage is at least about 85%, the percentage is at least about 90%. In some embodiments, the percentage is at least about 95%. For example, an oligonucleotide provided that is 20 nucleobases in length will have 90 percent complementarity if 18 of its 20 nucleobases are complementary. Typically, when determining complementarity, A and T (or U) are complementary nucleobases, and C and G are complementary nucleobases.

[0203] In some embodiments, the present disclosure provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table. In some embodiments, the present disclosure provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table, wherein one or more Us are independently and optionally replaced by Ts or vice versa. In some embodiments, the HTT oligonucleotide can comprise at least one T and / or at least one U. In some embodiments, the present disclosure provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides described in the table, wherein the sequence has greater than 50% identity to the sequence of the oligonucleotides described in the table. In some embodiments, the present disclosure provides an HTT oligonucleotide comprising the sequence of the oligonucleotides disclosed in the table. In some embodiments, the present disclosure provides an HTT oligonucleotide whose nucleotide sequence is the sequence of the oligonucleotides disclosed in the table. In some embodiments, the present disclosure provides an HTT oligonucleotide comprising a sequence found in the oligonucleotides in the table, wherein the oligonucleotide has the backbone linkage pattern, backbone chiral center pattern, and / or backbone phosphorus modification pattern of the same oligonucleotide or another oligonucleotide in the table herein.

[0204] In particular, the present disclosure provides various oligonucleotides each having a defined base sequence in Table 1 and elsewhere. In some embodiments, the present disclosure provides an oligonucleotide having a base sequence that is, includes, or includes a portion of, the base sequence of the oligonucleotides disclosed herein, for example in a table, for example Table 1 of the present specification. In some embodiments, the present disclosure provides an oligonucleotide having a base sequence that is, includes, or includes a portion of, the base sequence of the oligonucleotides disclosed herein, for example in a table, where the oligonucleotide further includes chemical modifications, stereochemistry, format, additional chemical moieties described herein (e.g., targeting moieties, lipid moieties, carbohydrate moieties, etc.), and / or other structural features.

[0205] In some embodiments, a "portion" (e.g., a portion of a base sequence or modification pattern) is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer unit lengths (e.g., for a base sequence, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length). In some embodiments, a "portion" of a base sequence is at least 5 bases in length. In some embodiments, a "portion" of a base sequence is at least 10 bases in length. In some embodiments, a "portion" of a base sequence is at least 15 bases in length. In some embodiments, a "portion" of a base sequence is at least 20 bases in length. In some embodiments, a portion of a base sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more adjacent (consecutive) bases. In some embodiments, a portion of a base sequence is 15 or more adjacent (consecutive) bases.

[0206] In some embodiments, the present disclosure provides an oligonucleotide (e.g., an HTT oligonucleotide) whose base sequence is the base sequence of an oligonucleotide in the table or a portion thereof. In some embodiments, the present disclosure provides an HTT oligonucleotide of the sequence of an oligonucleotide in the table, where the oligonucleotide has the ability to lead to a decrease in the expression, level, and / or activity of the HTT gene or its gene product. As will be understood by those skilled in the art, in the provided base sequences, each U can optionally and independently be replaced by T or vice versa, and the sequences can include those with a mixture of U and T. In some embodiments, C can optionally and independently be replaced by 5mC.

[0207] In some embodiments, a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides. In some embodiments, a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides that includes 0 to 3 mismatches. In some embodiments, a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides that includes 0 to 3 mismatches, where a span with 0 mismatches is complementary and a span with 1 or more mismatches is a non-limiting example of substantial complementarity. In some embodiments, the base includes a portion characteristic of a nucleic acid (e.g., a gene) in that a portion thereof is identical or complementary to a portion of the nucleic acid or its transcript and not identical or complementary to a portion of any other nucleic acid (e.g., a gene) or its transcript in the same genome. In some embodiments, a portion is characteristic of human HTT. In some embodiments, a portion is characteristic of human mHTT.

[0208] In some embodiments, the HTT oligonucleotide is, as described herein, about 49, 45, 40, 30, 35, 25, or 23 nucleotides or less in length. In some embodiments, if the 5' end of the sequences described herein begins with U or T, the U can be deleted and / or replaced by another base. In some embodiments, the oligonucleotide has a base sequence of an oligonucleotide in the table, or includes it, or includes a base sequence that is a portion of the format or a portion of the format disclosed herein.

[0209] In some embodiments, the oligonucleotide, such as an HTT oligonucleotide, is sterically random. In some embodiments, the oligonucleotide, such as an HTT oligonucleotide, is chirally controlled. In some embodiments, the oligonucleotide, such as an HTT oligonucleotide, is chirally pure (or "stereochemically pure", "stereochemically homogeneous"), where the oligonucleotide exists as a single stereoisomeric form (in many cases, a single diastereoisomer (or "diastereomer") form, since multiple chiral centers may be present in the oligonucleotide, such as at the linking phosphorus, sugar carbons, etc.). As will be appreciated by those skilled in the art, a chirally pure oligonucleotide is separated from other stereoisomeric forms (although chemical and biological processes, selectivity and / or purification, etc. rarely reach absolute perfection, so some impurities may be present within a range). In a chirally pure oligonucleotide, each chiral center is independently defined (stereochemically defined, or chirally controlled, e.g., for the chiral linking phosphorus of a chiral internucleotide bond, Rp or Sp (such an internucleotide bond is a stereochemically defined internucleotide bond or a chirally controlled internucleotide bond)). In contrast to a chirally controlled and chirally pure oligonucleotide containing a stereochemically defined linking phosphorus, for example, a racemic (or "sterically random", "chirally uncontrolled") oligonucleotide containing a chiral linking phosphorus by conventional phosphoramidite oligonucleotide synthesis without stereochemical control during the coupling step, combined with conventional sulfurization (which creates sterically random phosphorothioate internucleotide bonds), refers to a random mixture of various stereoisomers (typically diastereoisomers (or "diastereomers") since there are multiple chiral centers in the oligonucleotide). For example, A * A * A[wherein, * is a phosphorothioate internucleotide bond (which contains a chiral linking phosphorus)] for a racemic oligonucleotide formulation is four diastereomers [22 =4. Consider that there are two chiral phosphorothioate internucleotide linkages, each of which can exist in either of two configurations (Sp or Rp): A * S A * S A, A * S A * R A, A * R A * S A, and A * R A * R A [wherein * S represents an Sp phosphorothioate internucleotide linkage, * R represents an Rp phosphorothioate internucleotide linkage]. Chiral pure oligonucleotides, for example, A * S A * For S A, this exists in a single stereoisomeric form and is separated from other stereoisomers (e.g., diastereomer A * S A * R A, A * R A * S A, and A * R A * R A). In some embodiments, the Rp phosphorothioate is * S or * represented as S. In some embodiments, the Rp phosphorothioate is * R or * represented as R.

[0210] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more sterically random internucleotide linkages (e.g., a mixture of Rp and Sp linked phosphates in the internucleotide linkage from conventional unchirally controlled oligonucleotide synthesis). In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chirally controlled internucleotide linkages (e.g., Rp or Sp linked phosphates in the internucleotide linkage from chirally controlled oligonucleotide synthesis). In some embodiments, the internucleotide linkage is a phosphorothioate internucleotide linkage. In some embodiments, the internucleotide linkage is a sterically random phosphorothioate internucleotide linkage. In some embodiments, the internucleotide linkage is a chirally controlled phosphorothioate internucleotide linkage.

[0211] In particular, the present disclosure provides techniques for preparing chirally controlled (in some embodiments, stereochemically pure) oligonucleotides. In some embodiments, the oligonucleotides are stereochemically pure. In some embodiments, the oligonucleotides of the present disclosure are from about 5% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80 to 100%, 90 to 100%, 95 to 100%, 50% to 90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% pure. In some embodiments, the internucleotide linkages of the oligonucleotides comprise or consist of one or more (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chiral internucleotide linkages, each of which independently has a diastereomeric purity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, the oligonucleotides of the present disclosure, such as HTT oligonucleotides, are (DS) CILhaving a diastereomeric purity, where DS is the diastereomeric purity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more), and CIL is the number of chirally controlled internucleotide linkages (e.g., 1 - 50, 1 - 40, 1 - 30, 1 - 25, 1 - 20, 5 - 50, 5 - 40, 5 - 30, 5 - 25, 5 - 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, DS is 95% - 100%. In some embodiments, each internucleotide linkage is independently chirally controlled and CIL is the number of chirally controlled internucleotide linkages.

[0212] Various HTT oligonucleotides are described and / or referenced herein.

[0213] The base sequences and structures of various HTT oligonucleotides include, but are not limited to, ONT-450, ONT-451, ONT-452, ONT-453, ONT-454, WV-902, WV-903, WV-904, WV-905, WV-906, WV-907, WV-908, WV-909, WV-910, WV-911, WV-912, WV-913, WV-914, WV-915, WV-916, WV-917, WV-918, WV-919, WV-920, WV-921, WV-922, WV-923, WV-924, WV-925, WV-926, WV-927, WV-928, WV-929, WV-930, WV-931, WV-932, WV-933, WV-934, WV-935, WV-936, WV-937, WV-938, WV-939, WV-940, WV-941, WV-944, WV-945, WV-948, WV-949, WV-950, WV-951, WV-952, WV-953, WV-954, WV-955, WV-956, WV-957, WV-958, WV-959, WV-960, WV-961, WV-962, WV-963, WV-964, WV-965, WV-973, WV-974, WV-975, WV-982, WV-983, WV-984, WV-985, WV-986, WV-987, WV-1001, WV-1002, WV-1003, WV-1004, WV-1005, WV-1006, WV-1007, WV-1008, WV-1009, WV-1010, WV-1011, WV-1012, WV-1013, WV-1014, WV-1015, WV-1016, WV-1017, WV-1018, WV-1019, WV-1020, WV-1021, WV-1022, WV-1023, WV-1024, WV-1025, WV-1026, WV-1027, WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045, WV-1046, WV-1047, WV-1048, WV-1049, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055WV-1056, WV-1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, WV-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-1071, WV-1072, WV-1073, WV-1074, WV-1075, WV-1076, WV-1077, WV-1078, WV-1079, WV-1080, WV-1081, WV-1082, WV-1083, WV-1084, WV-1085, WV-1086, WV-1087, WV-1088, WV-1089, WV-1090, WV-1091, WV-1092, WV-1234, WV-1235, WV-1497, WV-1508, WV-1509, WV-1510, WV-1511, WV-1654, WV-1655, WV-1788, WV-1789, WV-1790, WV-1799, WV-2022, WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-2030, WV-2031, WV-2032, WV-2033, WV-2034, WV-2035, WV-2036, WV-2037, WV-2038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV-2046, WV-2047, WV-2048, WV-2049, WV-2050, WV-2051, WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061, WV-2062, WV-2063, WV-2064, WV-2065, WV-2066, WV-2067, WV-2068, WV-2069, WV-2070, WV-2071, WV-2072, WV-2073, WV-2074, WV-2075, WV-2076, WV-2077, WV-2078, WV-2079, WV-2080, WV-2081, WV-2082, WV-2083, WV-2084, WV-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2163, WV-2164, WV-2269, WV-2270, WV-2271, WV-2272Including WV-2374, WV-2375, WV-2376, WV-2377, WV-2378, WV-2379, WV-2380, WV-2416, WV-2417, WV-2418, WV-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV-2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-2604, WV-2605, WV-2606, WV-2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2617, WV-2618, WV-2619, WV-2620, WV-2623, WV-2638, WV-2639, WV-2640, WV-2641, WV-2642, WV-2643, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2682, WV-2683, WV-2684, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, WV-2690, WV-2691, WV-2692, and WV-2732, they are described in International Publication No. 2017 / 015555 and International Publication No. 2017 / 192664 (of which the disclosures regarding these oligonucleotides are incorporated by reference). Further HTT oligonucleotides are described herein.,

[0214] By way of example, specific exemplary base sequences, nucleobase modifications and their patterns, sugar modifications and their patterns, internucleotide linkages and their patterns, linkage phosphorus stereochemistry and its patterns, linkers, and / or additional chemical moieties are provided in Table 1 below. In particular, these oligonucleotides can be utilized, for example, for targeting HTT transcripts to reduce the level of HTT transcripts and / or their products.

[0215]

Table 1

[0216]

Table 2

[0217]

Table 3

[0218]

Table 4

[0219]

Table 5

[0220]

Table 6

[0221]

Table 7

[0222]

Table 8

[0223]

Table 9

[0224]

Table 10

[0225]

Table 11

[0226]

Table 12

[0227]

Table 13

[0228]

Table 14

[0229]

Table 15

[0230]

Table 16

[0231]

Table 17

[0232]

Table 18

[0233]

Table 19

[0234]

Table 20

[0235]

Table 21

[0236]

Table 22

[0237]

Table 23

[0238]

Table 24

[0239]

Table 25

[0240]

Table 26

[0241]

Table 27

[0242]

Table 28

[0243]

Table 29

[0244]

Table 30

[0245]

Table 31

[0246]

Table 32

[0247]

Table 33

[0248]

Table 34

[0249]

Table 35

[0250]

Table 36

[0251]

Table 37

[0252]

Table 38

[0253]

Table 39

[0254]

Table 40

[0255]

Table 41

[0256]

Table 42

[0257]

Table 43

[0258]

Table 44

[0259]

Table 45

[0260]

Table 46

[0261]

Table 47

[0262]

Table 48

[0263]

Table 49

[0264]

Table 50

[0265]

Table 51

[0266]

Table 52

[0267]

Table 53

[0268]

Table 54

[0269]

Table 55

[0270]

Table 56

[0271]

Table 57

[0272]

Table 58

[0273]

Table 59

[0274]

Table 60

[0275]

Table 61

[0276]

Table 62

[0277]

Table 63

[0278]

Table 64

[0279]

Table 65

[0280]

Table 66

[0281]

Table 67

[0282]

Table 68

[0283]

Table 69

[0284]

Table 70

[0285]

Table 71

[0286]

Table 72

[0287]

Table 73

[0288]

Table 74

[0289]

Table 75

[0290]

Table 76

[0291]

Table 77

[0292]

Table 78

[0293]

Table 79

[0294]

Table 80

[0295]

Table 81

[0296]

Table 82

[0297]

Table 83

[0298]

Table 84

[0299]

Table 85

[0300]

Table 86

[0301]

Table 87

[0302]

Table 88

[0303]

Table 89

[0304]

Table 90

[0305]

Table 91

[0306]

Table 92

[0307]

Table 93

[0308]

Table 94

[0309]

Table 95

[0310]

Table 96

[0311]

Table 97

[0312]

Table 98

[0313]

Table 99

[0314]

Table 100

[0315]

Table 101

[0316]

Table 102

[0317]

Table 103

[0318]

Table 104

[0319]

Table 105

[0320]

Table 106

[0321]

Table 107

[0322]

Table 108

[0323]

Table 109

[0324]

Table 110

[0325]

Table 111

[0326]

Table 112

[0327]

Table 113

[0328]

Table 114

[0329]

Table 115

[0330]

Table 116

[0331]

Table 117

[0332]

Table 118

[0333]

Table 119

[0334]

Table 120

[0335]

Table 121

[0336]

Table 122

[0337]

Table 123

[0338]

Table 124

[0339]

Table 125

[0340]

Table 126

[0341]

Table 127

[0342]

Table 128

[0343]

Table 129

[0344]

Table 130

[0345]

Table 131

[0346]

Table 132

[0347] m: 2'-OMe; m5: Methyl at the 5-position of C (the nucleobase is 5-methylcytosine); m5Ceo: 5-Methyl 2'-O-methoxyethyl C; m5mC: 5-Methyl 2'-OMe C; m5lC: Methyl at the 5-position of C (the nucleobase is 5-methylcytosine) and the sugar is LNA sugar; eo: 2'-MOE (2'-OCH2CH2OCH3); f: 2'-F; r: 2'-OH; O, PO: Phosphodiester (phosphoric acid). This can be a terminal group or a bond, such as a bond between a linker and an oligonucleotide chain, an internucleotide bond (natural phosphoric acid bond), etc. The phosphodiester is typically indicated by "O" in the stereochemistry / bond column and is typically not marked in the description column (if it is a terminal group, such as a 5'-terminal group, it is indicated in the description column and not typically indicated in the stereochemistry / bond); if the bond is not indicated in the description column, unless otherwise specified, it is typically a phosphodiester. Note that in the description column, the phosphoric acid bond between a linker (e.g., L001) and an oligonucleotide chain may not be marked, and may not be indicated by "O" in the stereochemistry / bond column. For example, in the description column of WV-10631 (Mod012L001mG*SmUmGmCmA...), the phosphodiester bond between L001 and the oligonucleotide chain (starting with mG*SmUmGmCmA...) is not marked; this internucleotide bond is indicated by the first "O" in OSOOO... in the stereochemistry / bond column.

[0348] *, PS: Phosphorothioate. This can be a terminal group (if it is a terminal group, such as a 5'-terminal group, it is indicated in the description column and not typically indicated in the stereochemistry / bond) or a bond, such as a bond between a linker (e.g., L001) and an oligonucleotide chain, an internucleotide bond (phosphorothioate internucleotide bond), etc.

[0349] R, Rp: Phosphorothioate in the Rp conformation. Note that *R in the description indicates a single phosphorothioate bond in the Rp conformation; S, Sp: Phosphorothioate in the Sp conformation. Note that *S in the description indicates a single phosphorothioate bond in the Sp conformation; X: Stereochemically random phosphorothioate; l: LNA sugar; n001:

Chem.

Chemical Structure

Chemical Structure

Chemical Structure

Chemical Structure

Chemical Structure

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chem.

Chem.

Chem.

[0350] Further structural elements of the HTT oligonucleotide are described, for example, in International Publication No. WO 2018 / 022473, International Publication No. WO 2018 / 098264, International Publication No. WO 2018 / 223056, International Publication No. WO 2018 / 223073, International Publication No. WO 2018 / 223081, International Publication No. WO 2018 / 237194, International Publication No. WO 2019 / 032607, International Publication No. WO 2019 / 055951, and / or International Publication No. WO 2019 / 075357 (the structural elements of these oligonucleotides are incorporated herein by reference).

[0351] Length As will be understood by those skilled in the art, oligonucleotides can be of various lengths such that they provide the desired properties and / or activities for various uses. In the art, many techniques are available for evaluating, selecting and / or optimizing oligonucleotide length and can be utilized in the present disclosure. As demonstrated herein, in many embodiments, the oligonucleotides provided are of a length suitable for hybridizing to their target and reducing the level of the target and / or its encoded product. In some embodiments, the oligonucleotide is of a length sufficient to recognize the target HTT nucleic acid (e.g., HTT mRNA). In some embodiments, the oligonucleotide is of a length sufficient to distinguish the target HTT nucleic acid from other nucleic acids (e.g., nucleic acids having a nucleotide sequence other than HTT) and reduce off-target effects. In some embodiments, the oligonucleotide, e.g., an HTT oligonucleotide, is of a length sufficient to reduce the complexity of manufacture or production and reduce the product cost.

[0352] In some embodiments, the nucleotide sequence of the oligonucleotide is about 10 to 500 nucleobases in length. In some embodiments, the nucleotide sequence is about 10 to 500 nucleobases in length. In some embodiments, the nucleotide sequence is about 10 to 50 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to 50 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to about 30 nucleobases in length. In some embodiments, the nucleotide sequence is about 10 to about 25 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to about 22 nucleobases in length. In some embodiments, the nucleotide sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases in length.

[0353] In some embodiments, each nucleobase independently comprises a monocyclic, bicyclic, or polycyclic ring, optionally substituted, wherein at least one ring atom is nitrogen. In some embodiments, each nucleobase is independently adenine, cytosine, guanosine, thymine, or uracil, optionally substituted, or a tautomer of adenine, cytosine, guanosine, thymine, or uracil, optionally substituted.

[0354] Regions, wings, and cores of HTT oligonucleotides In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises several regions, each of which independently comprises one or more consecutive nucleosides and optionally one or more internucleotide linkages. In some embodiments, a region is different from one or more adjacent regions in that it has one or more structural features that are different from the corresponding structural features of the one or more adjacent regions. Exemplary structural features include nucleobase modifications and their patterns, sugar modifications and their patterns, internucleotide linkages and their patterns (which can be internucleotide linkage types (e.g., phosphate, phosphorothioate, phosphorothioate triester, neutral internucleotide linkage, etc.) and their patterns, linking phosphorus modifications (backbone phosphorus modifications) and their patterns (e.g., when the internucleotide linkage has the structure of Formula I, -XLR 1 pattern), backbone chiral center (linking phosphorus) stereochemistry and its pattern [e.g., a combination of Rp and / or Sp of a chirally controlled internucleotide linkage (in order from 5' to 3'), and optionally including an unchirally controlled internucleotide linkage and / or a native phosphate linkage when present (e.g., OSOOO RSSRS SSSRS SOOOS in Table 1)]. In some embodiments, a region comprises a chemical modification (e.g., a sugar modification, a base modification, an internucleotide linkage, or the stereochemistry of an internucleotide linkage) that is not present in one or more adjacent regions. In some embodiments, a region lacks a chemical modification that is present in one or more adjacent regions.

[0355] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, comprises or consists of two or more regions. In some embodiments, the oligonucleotide comprises or consists of three or more regions. In some embodiments, the oligonucleotide comprises or consists of two adjacent regions, where one region is referred to as a wing region and the other is referred to as a core region. The structure of such an oligonucleotide comprises or consists of a wing-core or core-wing structure. In some embodiments, the oligonucleotide comprises or consists of three adjacent regions, where two adjacent regions are positioned laterally to one region. In some embodiments, the central region is a core region and each of the laterally positioned regions is a wing region (a 5'-wing when attached to the 5' end of the core and a 3'-wing when attached to the 3' end of the core). The structure of such an oligonucleotide comprises or consists of a wing-core-wing structure.

[0356] In some embodiments, the first region (e.g., the wing) differs from the second region (e.g., the core) in that the first region contains one or more sugar modifications or patterns thereof that are not present in the second region. In some embodiments, the first (e.g., wing) region contains a sugar modification that is not present in the second (e.g., core) region. In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1~6 that is aliphatic. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1~6It is alkyl. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the modified sugar is a bicyclic sugar, such as an LNA sugar. In some embodiments, each sugar in the region is independently modified. In some embodiments, each sugar in a region (e.g., a wing) independently includes modifications that can be the same as or different from each other. In some embodiments, each sugar in a region (e.g., a wing) includes the same modification, such as a 2'-modification as described herein. In some embodiments, the sugars in a region (e.g., the core) are unmodified. In some embodiments, each sugar in a region (e.g., the core) is an unmodified DNA sugar (with two -H at the 2' position). In some embodiments, the structure of the provided oligonucleotide comprises or consists of a wing-core, core-wing, or wing-core-wing structure, where each wing independently includes one or more sugar modifications and each sugar in the core is a natural DNA sugar (with two -H at the 2' position).

[0357] In addition to or instead of this, the first region (e.g., a wing) can include one or more internucleotide linkages or patterns thereof that are different from another region (e.g., the core or another wing). In some embodiments, a region (e.g., a wing) includes two or more consecutive natural phosphate linkages. In some embodiments, a region (e.g., the core) does not include consecutive natural phosphate linkages. In some embodiments, the structure of the provided oligonucleotide comprises or consists of a wing-core, core-wing, or wing-core-wing structure, where at least one wing independently includes two or more consecutive natural phosphate linkages and the core does not include consecutive natural phosphate linkages. In some embodiments, in a wing-core-wing structure, each wing independently includes two or more consecutive internucleotide linkages. Unless otherwise noted, for the purposes of the stereochemistry of the wing-core-wing structure, the internucleotide linkage connecting the core to the wing is included in the core (see, e.g., the above).

[0358] In some embodiments, the region is a 5'-wing, 3'-wing, or core. In some embodiments, the 5'-wing is on the 5'-end side of the oligonucleotide, the 3'-wing is on the 3'-end side of the oligonucleotide, and the core is between the 5'-wing and the 3'-wing, and the oligonucleotide comprises or consists of a wing-core-wing structure or format. In some embodiments, the core comprises a span of adjacent native DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least 5 adjacent native DNA sugars (2'-deoxyribose). In some embodiments, the core comprises a span of at least 10 adjacent native DNA sugars (2'-deoxyribose). In some embodiments, the core is referred to as a gap. In some embodiments, an oligonucleotide comprising or consisting of a wing-core-wing structure is described as a gapmer. In some embodiments, the provided oligonucleotide structure comprises or consists of a wing-core structure. In some embodiments, the provided oligonucleotide structure comprises or consists of a core-wing structure. Non-limiting examples of oligonucleotides having a core-wing structure include WV-2023 and WV-2025. In some embodiments, the oligonucleotide structure comprises or consists of an oligonucleotide chain comprising or consisting of a wing-core-wing, wing-core, or wing-core, where the oligonucleotide chain is optionally conjugated to additional chemical moieties via a linker as described in the present disclosure. In some embodiments, the present disclosure provides an oligonucleotide that targets HTT and has a structure comprising one or two wings and a core and comprises or consists of a wing-core-wing, core-wing, or wing-core structure.

[0359] Ribonuclease H (RNase H, e.g., RNase H1, RNase H2, etc.) reportedly recognizes a structure containing an RNA-DNA hybrid (e.g., a heteroduplex) and cleaves the RNA. In some embodiments, an oligonucleotide containing a span of adjacent native DNA sugars (e.g., 2'-deoxyribose in the core region) has the ability to anneal to an RNA such as mRNA to form a heteroduplex; and this heteroduplex structure has the ability to be recognized by RNase H, and the RNA is cleaved by RNase H. In some embodiments, the core of the provided oligonucleotide contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more adjacent native DNA sugars, and the core has the ability to specifically anneal to a target transcript [e.g., an HTT transcript (e.g., pre-mRNA, mature mRNA, etc.)]; and the formed structure has the ability to be recognized by RNase H, and the transcript is cleaved by RNase H. In some embodiments, the core of the provided oligonucleotide contains 5 or more adjacent DNA sugars.

[0360] Regions, such as wings, cores, etc., can be of various suitable lengths. In some embodiments, a region (e.g., a wing, a core, etc.) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases. As described in the present disclosure, in some embodiments, each nucleobase independently comprises a monocyclic, bicyclic or polycyclic ring optionally substituted, the ring having at least one nitrogen ring atom; in some embodiments, each nucleobase independently is optionally substituted A, T, C, G or U, or an optionally substituted tautomer of A, T, C, G or U. In some embodiments, this number is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 for a wing. In some embodiments, each wing of the wing-core-wing structure is independently of the length as described in the present disclosure. In some embodiments, two wings have the same length. In some embodiments, two wings are of different lengths. In some embodiments, this number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more for a core.

[0361] In some embodiments, a wing comprises one or more sugar modifications. In some embodiments, the two wings of the wing-core-wing structure comprise different sugar modifications (and the oligonucleotide has or comprises an "asymmetric" format). In some embodiments, the sugar modification results in improved stability and / or annealing properties as compared to the case where no sugar modification is present.

[0362] In some embodiments, a particular sugar modification, such as 2'-MOE, confers higher stability under certain conditions compared to other sugar modifications, such as 2'-OMe. In some embodiments, the wing contains a 2'-MOE modification. In some embodiments, each nucleoside unit of the wing containing a pyrimidine base (e.g., C, U, T, etc.) contains a 2'-MOE modification. In some embodiments, each sugar unit of the wing contains a 2'-MOE modification. In some embodiments, each nucleoside unit of the wing containing a purine base (e.g., A, G, etc.) does not contain a 2'-MOE modification (e.g., each such nucleoside unit contains 2'-OMe or no 2'-modification, etc.). In some embodiments, each nucleoside unit of the wing containing a purine base contains a 2'-OMe modification. In some embodiments, each internucleotide bond at the 3'-position of the sugar unit containing a 2'-MOE modification is a native phosphate bond.

[0363] In some embodiments, the wing does not contain a 2'-MOE modification. In some embodiments, the wing contains a 2'-OMe modification. In some embodiments, each nucleoside unit of the wing independently contains a 2'-OMe modification.

[0364] In some embodiments, the structure of the oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where one wing includes a 2'-OMe sugar modification and the other wing includes a bicyclic sugar; where one wing includes 2'-OMe and the other wing includes a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars (unsubstituted at the 2' position); where the majority of the sugars in one wing include 2'-OMe and the majority of the sugars in the other wing are, independently, bicyclic sugars; where the majority of the sugars in one wing include 2'-OMe and the majority of the sugars in the other wing are, independently, bicyclic sugars, and the majority of the sugars in the core are natural DNA sugars; where the majority of the sugars in one wing include 2'-OMe and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar includes 2'-OMe; where the majority of the sugars in one wing include 2'-OMe and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar includes 2'-OMe, and the majority of the sugars in the core are natural DNA sugars; where the majority of the sugars in one wing are bicyclic sugars and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar includes 2'-OMe; where the majority of the sugars in one wing are, independently, bicyclic sugars and in the other wing, at least one sugar is a bicyclic sugar and at least one sugar includes 2'-OMe, and the majority of the sugars in the core are natural DNA sugars; where each sugar in one wing includes 2'-OMe and each sugar in the other wing is, independently, a bicyclic sugar; where each sugar in one wing includes 2'-OMe and each sugar in the other wing is, independently, a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars; where each sugar in one wing is, independently, a bicyclic sugar and each sugar in the other wing includes 2'-OMe, and each sugar in the core is a natural DNA sugar; where one wing includes a bicyclic sugar and the other wing includes 2'-MOE; where one wing includes a bicyclic sugar and the other wing includes 2'-MOE, and the majority of the sugars in the core are natural DNA sugars;Here, the majority of the sugars in one wing are, independently, bicyclic sugars, and the majority of the sugars in the other wing contain 2'-MOE; here, the majority of the sugars in one wing contain, independently, bicyclic sugars, and the majority of the sugars in the other wing contain 2'-MOE, and the majority of the sugars in the core are natural DNA sugars; here, the majority of the sugars in one wing are, independently, bicyclic sugars, and in the other wing, at least one sugar contains 2'-MOE and at least one sugar is a bicyclic sugar; here, the majority of the sugars in one wing are, independently, bicyclic sugars, and in the other wing, at least one sugar contains 2'-MOE and at least one sugar is a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars; here, the majority of the sugars in one wing contain 2'-MOE, and in the other wing, at least one sugar contains 2'-MOE and at least one sugar is a bicyclic sugar; here, the majority of the sugars in one wing contain 2'-MOE, and in the other wing, at least one sugar contains 2'-MOE and at least one sugar is a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars; here, each sugar in one wing is, independently, a bicyclic sugar, and each sugar in the other wing contains, independently, 2'-MOE; and / or here, each sugar in one wing of the oligonucleotide is, independently, a bicyclic sugar, each sugar in the other wing contains 2'-MOE, and the majority of the sugars in the core are natural DNA sugars.;

[0365] In some embodiments, the structure of the oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where each sugar in one wing contains 2'-MOE, each sugar in the other wing is, independently, a bicyclic sugar, and each sugar in the core is a natural DNA sugar.

[0366] In some embodiments, the bicyclic sugar is an LNA, cEt, or BNA sugar.

[0367] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where one wing includes 2'-OMe and the other wing includes 2'-F. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where one wing includes 2'-OMe and the other wing includes 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0368] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing include 2'-OMe and the majority of the sugars in the other wing include 2'-F. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing include 2'-OMe and the majority of the sugars in the other wing include 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0369] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing include 2'-OMe, in the other wing at least one sugar includes 2'-F, and at least one sugar includes 2'-OMe. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing include 2'-OMe, in the other wing at least one sugar is 2'-F, and at least one sugar includes 2'-OMe, and the majority of the sugars in the core are DNA sugars.

[0370] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F, in the other wing, at least two sugars contain 2'-F, and at least two sugars contain 2'-OMe. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F, in the other wing, at least two sugars contain 2'-F, and at least two sugars contain 2'-OMe, and the majority of the sugars in the core are natural DNA sugars.

[0371] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where each sugar in one wing of the oligonucleotide contains 2'-OMe and each sugar in the other wing of the provided oligonucleotide contains 2'-F. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where each sugar in one wing of the oligonucleotide contains 2'-OMe, each sugar in the other wing of the oligonucleotide contains 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0372] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where each sugar in one wing contains 2'-F, each sugar in the other wing contains 2'-OMe, and each sugar in the core is a DNA sugar.

[0373] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where one wing contains 2'-F and the other wing contains 2'-MOE. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where one wing contains 2'-F and the other wing contains 2'-MOE, and the majority of the sugars in the core contain 2'-deoxy.

[0374] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F and the majority of the sugars in the other wing contain 2'-MOE. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F and the majority of the sugars in the other wing contain 2'-MOE, and the majority of the sugars in the core are natural DNA sugars.

[0375] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F, in the other wing at least one sugar contains 2'-MOE, and at least one sugar contains 2'-F. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-F, in the other wing at least one sugar contains 2'-MOE, and at least one sugar contains 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0376] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-MOE, in the other wing, at least one sugar contains 2'-MOE, and at least one sugar contains 2'-F. In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where the majority of the sugars in one wing contain 2'-MOE, in the other wing, at least one sugar contains 2'-MOE, and at least one sugar contains 2'-F, and the majority of the sugars in the core are natural DNA sugars.

[0377] In some embodiments, the structure of an oligonucleotide, such as an HTT oligonucleotide, includes a wing-core-wing structure, where each sugar in one wing of the oligonucleotide contains 2'-MOE, each sugar in the other wing contains 2'-F, and each sugar in the core is a natural DNA sugar.

[0378] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, has a wing-core-wing structure. In some embodiments, the core includes one or more natural DNA sugars. In some embodiments, the core includes five or more consecutive natural DNA sugars. In some embodiments, the core optionally includes 5 to 10, 5 to 15, 5 to 20, 5 to 25, 5 to 30, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more natural DNA sugars that are consecutive. In some embodiments, the core includes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive natural DNA sugars. In some embodiments, the core includes 10 or more consecutive natural DNA sugars. In some embodiments, the core is capable of hybridizing to a target mRNA, thereby forming a double-stranded structure recognizable by RNase H, enabling RNase H to cleave this mRNA.

[0379] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, has a wing-core-wing structure and has an asymmetric format.

[0380] In some embodiments, in an oligonucleotide having an asymmetric format, one wing differs from the other in a sugar modification or pattern thereof, or a backbone internucleotide linkage or pattern thereof, or a backbone chiral center or pattern thereof. In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, has an asymmetric format in that one wing contains a sugar modification that differs from that of the other wing. In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, has an asymmetric format in that one wing contains a pattern of sugar modifications that differs from that of the other wing.

[0381] In some embodiments, the HTT oligonucleotide (or wing, core, block, or any portion thereof) is described in any of International Publication No. WO2017015555; International Publication No. WO2017192664; International Publication No. WO201200366; International Publication No. WO2011 / 034072; International Publication No. WO2014 / 010718; International Publication No. WO2015 / 108046; International Publication No. WO2015 / 108047; International Publication No. WO2015 / 108048; International Publication No. WO2011 / 005761; International Publication No. WO2011 / 108682; International Publication No. WO2012 / 039448; International Publication No. WO2018 / 067973; International Publication No. WO2005 / 028494; International Publication No. WO2005 / 092909; International Publication No. WO2010 / 064146; International Publication No. WO2012 / 073857; International Publication No. WO2013 / 012758; International Publication No. WO2014 / 010250; International Publication No. WO2014 / 012081; International Publication No. WO2015 / 107425; International Publication No. WO2017 / 015555; International Publication No. WO2017 / 015575; International Publication No. WO2017 / 062862; International Publication No. WO2017 / 160741; International Publication No. WO2017 / 192664; International Publication No. WO2017 / 192679; International Publication No. WO2017 / 210647; International Publication No. WO2018 / 022473; or International Publication No. WO2018 / 098264 (wherein each modification, any modification pattern, any internucleotide linkage, any internucleotide linkage pattern, or any format (including but not limited to an asymmetric format) described therein is incorporated by reference), and can include any modification, any modification pattern, any internucleotide linkage, any internucleotide linkage pattern, any chiral center pattern, or any format (including but not limited to an asymmetric format).

[0382] In some embodiments, the structure of the oligonucleotide, such as the HTT oligonucleotide, comprises or consists of an asymmetric format. In some embodiments, the structure of the oligonucleotide, such as the HTT oligonucleotide, comprises or consists of a symmetric format.

[0383] In some embodiments, the structure of the oligonucleotide, such as the HTT oligonucleotide, is or includes an asymmetric format, where the structure of the oligonucleotide is a wing-core-wing structure, where the format of the first wing is different from the format of the second wing. In some embodiments, the structure of the oligonucleotide, such as the HTT oligonucleotide, is or includes an asymmetric format, where the structure of the oligonucleotide is a wing-core-wing structure, where the first and second wings differ in sugar modification (or a combination or pattern thereof) and / or internucleotide linkage (or a combination or pattern thereof). In some embodiments, the structure of the oligonucleotide, such as the HTT oligonucleotide, is or includes an asymmetric format, where the structure of the oligonucleotide is a wing-core-wing structure, where the first and second wings differ in sugar modification (or a combination or pattern thereof).

[0384] In some embodiments, the core region comprises a sequence complementary to one allele at a discrimination position, e.g., an SNP locus. In some embodiments, the core region comprises a sequence complementary to one allele of an SNP (e.g., this is on the same strand / chromosome as a disease-related or causative sequence (e.g., an expanded CAG repeat of the HTT gene)), but is not complementary to the other allele of the SNP (e.g., this is on the same strand / chromosome as a sequence that is less likely or not at all associated with the disease or a cause of the disease (e.g., a normal or shorter CAG repeat of the HTT gene)). In some embodiments, for an SNP, such a sequence is one nucleic acid base. In some embodiments, the core region comprises a nucleic acid base complementary to an allele of an SNP that is on the same strand / chromosome as an expanded CAG repeat of the HTT gene. In particular, the present disclosure demonstrates that the properties and / or activities of the oligonucleotide can be modulated by the positioning of such nucleic acid bases. In some embodiments, the position of such a nucleic acid base is the 4th, 5th, 6th, 7th, or 8th position counting from the 5' end of the core region (with the first nucleoside from the 5' end in the core region being position 1). In some embodiments, the position is the 4th position from the 5' end of the core region. In some embodiments, the position is the 5th position from the 5' end of the core region. In some embodiments, the position is the 6th position from the 5' end of the core region. In some embodiments, the position is the 7th position from the 5' end of the core region. In some embodiments, the position is the 8th position from the 5' end of the core region. In some embodiments, the position of such a nucleic acid base is the 7th, 8th, 9th, 10th, 11th, or 12th position counting from the 5' end of the oligonucleotide (with the first nucleoside from the 5' end in the oligonucleotide being position 1). In some embodiments, the position is the 7th position from the 5' end of the oligonucleotide. In some embodiments, the position is the 8th position from the 5' end of the oligonucleotide. In some embodiments, the position is the 9th position from the 5' end of the oligonucleotide. In some embodiments, the position is the 10th position from the 5' end of the oligonucleotide. In some embodiments, the position is the 11th position from the 5' end of the oligonucleotide.In some embodiments, the oligonucleotide comprises a 5' end wing that comprises 5 nucleosides and only 5 nucleosides. In some embodiments, each wing sugar is 2'-modified. In some embodiments, each wing sugar is 2'-OMe modified. In some embodiments, each core sugar independently does not comprise a 2'-OR modification, wherein R is as described in the present disclosure. In some embodiments, each core sugar is independently an unmodified DNA sugar.

[0385] In some embodiments, an oligonucleotide, such as an HTT oligonucleotide, can comprise any first wing, core, and / or second wing as described herein or as known in the art.

[0386] In some embodiments, an oligonucleotide having a nucleotide sequence that is, comprises, or spans the HTT oligonucleotide sequences disclosed herein can comprise a first wing, core, and / or second wing as described herein or as known in the art.

[0387] RNAi agent The oligonucleotides of the present disclosure can perform one or more functions through various biological mechanisms and / or pathways. In some embodiments, the present disclosure provides oligonucleotides that can, in part, mainly, or entirely, reduce the level, expression, and / or activity of a gene or its product by RNA interference. As will be understood by those skilled in the art, such oligonucleotides can be either single-stranded or double-stranded. In some embodiments, the single-stranded or double-stranded oligonucleotide has the ability to reduce the level, expression, and / or activity of a target gene (e.g., HTT) or its gene product by a mechanism involving RNA interference.

[0388] In some embodiments, the present disclosure relates to an oligonucleotide having a nucleotide sequence that includes the nucleotide sequence of the oligonucleotide in Table 1, is that, or a span of 15 or more contiguous nucleotides therefrom (optionally having 1 to 3 mismatches), e.g., an HTT oligonucleotide, wherein the oligonucleotide has the ability to mediate RNA interference.

[0389] In some embodiments, the present disclosure relates to an HTT oligonucleotide having a nucleotide sequence that includes the nucleotide sequence of the oligonucleotide in Table 1, is that, or a span of 15 or more contiguous nucleotides therefrom (optionally having 1 to 3 mismatches), wherein the HTT oligonucleotide has the ability to mediate single-stranded RNA interference.

[0390] In some embodiments, the present disclosure relates to an HTT oligonucleotide having a nucleotide sequence that includes the nucleotide sequence of the oligonucleotide in Table 1, is that, or a span of 15 or more contiguous nucleotides therefrom (optionally having 1 to 3 mismatches), wherein the HTT oligonucleotide has the ability to mediate single-stranded RNA interference.

[0391] In some embodiments, the RNAi agent is an agent having the ability to mediate RNA interference (e.g., a nucleic acid, including but not limited to single-stranded or double-stranded nucleic acids). In some embodiments, the present disclosure provides an RNAi agent that targets HTT.

[0392] In some embodiments, the present disclosure relates to a single-stranded RNAi agent whose nucleotide sequence is a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) adjacent bases of HTT or its transcript, or is a sequence that is complementary to or includes such a span. In some embodiments, the present disclosure relates to a single-stranded RNAi agent that is any of the HTT oligonucleotides in Table 1, or includes the same, or has a nucleotide sequence that includes a span of at least 15 adjacent bases thereof. In some embodiments, such a span of adjacent bases is characteristic of HTT and is not identical or complementary to any other sequence in the genome or transcriptome.

[0393] In some embodiments, the present disclosure relates to a double-stranded RNAi agent comprising a sense and an antisense strand, wherein the nucleotide sequence of the antisense strand is a span of 15 to 30 (e.g., at least 15, 16, 17, 18, 19, 20, or 21) adjacent bases of HTT or its transcript, or is a sequence that is complementary to or includes such a span. In some embodiments, the present disclosure relates to a double-stranded RNAi agent comprising a sense and an antisense strand, wherein the antisense strand is any of the HTT oligonucleotides in Table 1, or includes the same, or has a nucleotide sequence that includes a span of at least 15 adjacent bases thereof. In some embodiments, the present disclosure relates to a double-stranded RNAi agent comprising a sense and an antisense strand, wherein the antisense strand is any of the HTT oligonucleotides in Table 1, or includes the same, or has a nucleotide sequence that includes a span of at least 10 adjacent bases thereof. In some embodiments, such a span of adjacent bases is characteristic of HTT and is not identical or complementary to any other sequence in the genome or transcriptome.

[0394] In some embodiments, the RNAi agent, such as an HTT RNAi agent, can be in a double-stranded or single-stranded format of an RNAi agent described herein or known in the art. Various formats of double-stranded RNAi agents are known in the art, for example, as described in Elbashir et al. 2001 Gen. Dev. 15: 188; Elbashir et al. 2001 Nature 411: 494; Elbashir et al. 2001 EMBO J. 20: 6877-6888; Sun et al. Nat. Biotech. 26: 1379; Chiu et al. 2003 RNA 9: 1034-1048; Kim et al. (2005) Nat Biotech 23:222-226; U.S. Patent No. 8,084,600; U.S. Patent No. 9,175,289; U.S. Patent No. 8,329,888; U.S. Patent No. 8,090,542; U.S. Patent No. 7,507,811; U.S. Patent No. 8,828,956; U.S. Patent Application Publication No. 2013 / 0035368; U.S. Patent Application Publication No. 2005 / 0255487; U.S. Patent Application Publication No. 2008 / 0242851; International Publication No. 2015 / 051366; and European Patent No. 3,052,464, and can be utilized in the present disclosure. Various formats of single-stranded RNAi agents are known in the art, for example, as described in European Patent No. 1,520,022, U.S. Patent No. 8,729,036, U.S. Patent No. 9,476,044, U.S. Patent No. 9,243,246, International Publication No. 2004 / 007718, etc., and can be utilized in the present disclosure.

[0395] In some embodiments, the strand of a single-stranded RNAi agent or the antisense strand of a double-stranded RNAi agent comprises, in order from 5' to 3', a 5' terminal region, a seed region, a region after the seed, and a 3' end. In some embodiments, within the strand, the seed region comprises nucleotides at positions about 2 to about 7 or about 8 counting from the 5' end. In some embodiments, the 5' terminal region comprises a portion of the strand that is 5' of the seed region. In some embodiments, the 3' terminal region comprises either a terminal dinucleotide (e.g., TT or UU) at the 3' end or a portion that functionally replaces the terminal dinucleotide (e.g., a 3' end cap). For the 3' end cap, see, e.g., U.S. Patent No. 8,084,600 and International Publication No. 2015 / 051366. In some embodiments, the region after the seed comprises a portion of the strand that is between the seed region and the 3' terminal region.

[0396] In some embodiments, the 5' terminal region comprises a phosphate group or an analog thereof. In some embodiments, additional chemical moieties as described herein are conjugated, either directly or indirectly, to the 5' terminal region. In some embodiments, additional chemical moieties that are derivatives having the ability to bind to GalNAc or ASPGR are conjugated, either directly or indirectly, to the 5' terminal region.

[0397] In some embodiments, the seed region is particularly important for recognizing and being complementary to the target region. In some embodiments, the seed region has less suitable mismatches to the target compared to the 5' terminal region or the region after the seed.

[0398] In some embodiments, a single-stranded RNAi agent, such as a single-stranded HTT RNAi reagent, comprises a chemical moiety at the 5' end that contains phosphorus. In some embodiments, the single-stranded RNAi agent has a group containing phosphorus at its 5' end. In some embodiments, the single-stranded RNAi agent has a phosphate group or an analog thereof at its 5' end.

[0399] In some embodiments, the single-stranded RNAi agent, or one or both strands of the double-stranded RNAi agent, is conjugated to an ASGPR ligand. In some embodiments, the ASGPR ligand is GalNAc or a derivative thereof having the ability to bind to ASGPR.

[0400] Non-limiting examples of oligonucleotides that can be used as a single-stranded RNAi agent include WV-5153, WV-5154, WV-5155, WV-5156, WV-5157, WV-5158, WV-5159, WV-5160, WV-5161, WV-5162, WV-5163, WV-5164, WV-5165, WV-5166, WV-5167, WV-5168, WV-5169, WV-5170, WV-5171, WV-5172, WV-5173, WV-5174, WV-5175, WV-5176, WV-5177, WV-5178, WV-5179, WV-5180, WV-5181, WV-5182, WV-5183, WV-5184, WV-5185, WV-5186, WV-5187, WV-5188, WV-5189, WV-5190, WV-5191, WV-5192, WV-5193, WV-5194, WV-5195, WV-5196, WV-5197, WV-5198, WV-5199, WV-5200, WV-5201, WV-5202, WV-5203, WV-5204, WV-5205, WV-5206, WV-5207, WV-5208, WV-5209, WV-5210, WV-5211, WV-5212, WV-5213, WV-5214, WV-5215, WV-5216, WV-5217, WV-5218, WV-5219, WV-5220, WV-5221, WV-5222, WV-5223, WV-5224, WV-5225, WV-5226, WV-5227, WV-5228, WV-5229, WV-5230, WV-5231, WV-5232, WV-5233, WV-5234, WV-5235, WV-5236, WV-5237, WV-5238, WV-5239, WV-5240, WV-5241, WV-5242, WV-5243, WV-5244, WV-5245, WV-5246, WV-5247, WV-5248, WV-5249, WV-5250, WV-5251, WV-5252, WV-5253, WV-5254, WV-5255, WV-5256, WV-5257, WV-5258, WV-5259, WV-5260, WV-5261, WV-5262, WV-5263, WV-5264, WV-5265, WV-5266, WV-5267, WV-5268, WV-5269, WV-5270, WV-5271, WV-5272WV-5273, WV-5274, WV-5275, WV-5276, WV-5277, WV-5278, WV-5279, WV-5280, WV-5281, WV-5282, WV-5283, WV-5284, WV-5285, WV-5286, WV-10107, WV-10108, WV-10109, WV-10110, WV-10111, WV-10112, WV-10113, WV-10114, WV-10115, WV-10116, WV-10117, WV-10118, WV-10119, WV-10120, WV-10121, WV-10122, WV-10123, WV-10124, WV-10125, WV-10126, WV-10127, WV-10128, WV-10129, WV-10130, WV-10131, WV-10132, WV-10133, WV-10134, WV-10135, WV-10136, WV-10137, WV-10138, WV-10139, WV-10140, WV-10141, WV-10142, WV-10143, WV-10144, WV-10145, and WV-10146 are included.

[0401] In some embodiments, the disclosure relates to a double-stranded RNAi agent comprising a strand of a single-stranded RNAi agent that anneals to a second strand. In some embodiments, the disclosure relates to a double-stranded HTT RNAi agent comprising a strand of the single-stranded HTT RNAi agent described herein that anneals to a second strand.

[0402] In some embodiments, oligonucleotides such as double-stranded or single-stranded HTT RNAi agents include internucleotide linkages and / or their patterns, nucleobases and their patterns, sugars and their patterns, backbone chiral center patterns, and / or additional chemical moieties described herein. In some embodiments, useful structural elements such as nucleobases, sugars, internucleotide linkages, linking phosphorus stereochemistry, 5'-terminal groups (e.g., phosphates and their analogs / derivatives), additional chemical moieties, linkers, and useful patterns and / or combinations thereof are described in International Publication No. WO 2018 / 223056 and incorporated herein by reference.

[0403] Internucleotide linkage In some embodiments, the HTT oligonucleotide comprises a base modification, a sugar modification, and / or an internucleotide linkage modification. In the present disclosure, various internucleotide linkages can be utilized to join units containing a nucleobase, such as a nucleoside. In some embodiments, the provided oligonucleotide comprises both one or more modified internucleotide linkages and one or more native phosphate linkages. As is widely known to those skilled in the art, native phosphate linkages are widely found in native DNA and RNA molecules; this has a structure of -OP(O)(OH)O-, links the sugars in the nucleosides of DNA and RNA, and can be in various salt forms at physiological pH (about 7.4), and native phosphate linkages are mainly in salt form with anions that are -OP(O)(O - )O-. A modified internucleotide linkage, or non-native phosphate linkage, is an internucleotide linkage that is not a native phosphate linkage or its salt form. Modified internucleotide linkages can also be in their salt forms depending on their structures. For example, as understood by those skilled in the art, a phosphorothioate internucleotide linkage having a structure of -OP(O)(SH)O- can be in various salt forms with anions that are, for example, -OP(O)(S - )O- at physiological pH (about 7.4).

[0404] In some embodiments, the HTT oligonucleotide comprises a modified internucleotide linkage, such as an internucleotide linkage that is a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate.

[0405] In some embodiments, the modified internucleotide linkage is a chiral internucleotide linkage comprising a chiral bonded phosphorus. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage in the Rp or Sp configuration (as used herein, respectively* R or * is denoted as S).

[0406] In some embodiments, the chiral internucleotide bond is a non-negatively charged internucleotide bond. In some embodiments, the chiral internucleotide bond is a neutral internucleotide bond. In some embodiments, the chiral internucleotide bond is chirally controlled with respect to its chiral bonding phosphorus. In some embodiments, the chiral internucleotide bond is stereochemically pure with respect to its chiral bonding phosphorus. In some embodiments, the chiral internucleotide bond is not chirally controlled. In some embodiments, the pattern of backbone chiral centers comprises or consists of the positions of chirally controlled internucleotide bonds and the bonding phosphorus configuration (Rp or Sp) and the positions of achiral internucleotide bonds (e.g., native phosphate bonds).

[0407] In some embodiments, the internucleotide bond comprises a P modification, where the P modification is a modification at the bonding phosphorus. In some embodiments, the modified internucleotide bond is a moiety that serves to bind two moieties that each independently contain two sugars or nucleobases but do not contain phosphorus, such as in peptide nucleic acid (PNA).

[0408] In some embodiments, the oligonucleotide comprises modified internucleotide bonds, such as those having the structure of Formula I, Formula I-a, Formula I-b, or Formula I-c, and those described in this specification and / or International Publication Nos. WO 2018 / 022473, WO 2018 / 098264, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, and / or WO 2019 / 075357 (each of the internucleotide bonds (e.g., those of Formula I, Formula I-a, Formula I-b, Formula I-c, etc.) of which is hereby incorporated by reference).

[0409] In some embodiments, the modified internucleotide linkage is a non-negatively charged internucleotide linkage. In some embodiments, the provided oligonucleotide comprises one or more non-negatively charged internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage is a positively charged internucleotide linkage. In some embodiments, the non-negatively charged internucleotide linkage is a neutral internucleotide linkage. In some embodiments, the present disclosure provides an oligonucleotide comprising one or more neutral internucleotide linkages. In some embodiments, the non-negatively charged internucleotide linkage has a structure of Formula I-n-1, Formula I-n-2, Formula I-n-3, Formula I-n-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, Formula II-d-2, etc., or a salt form thereof, as described in this specification and / or U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 2017 / 0037399, U.S. Patent Application Publication No. 2018 / 0216108, U.S. Patent Application Publication No. 2018 / 0216107, U.S. Patent No. 9,598,458, International Publication No. 2017 / 062862, International Publication No. 2018 / 067973, International Publication No. 2017 / 160741, International Publication No. 2017 / 192679, International Publication No. 2017 / 210647, International Publication No. 2018 / 098264, International Publication No. 2018 / 022473, International Publication No. 2018 / 223056, International Publication No. 2018 / 223073, International Publication No. 2018 / 223081, International Publication No. 2018 / 237194, International Publication No. 2019 / 032607, International Publication No. 2019 / 032612, International Publication No. 2019 / 055951, and / or International Publication No. 2019 / 075357 (each of these non-negatively charged internucleotide linkages (e.g., those of Formula I-n-1, Formula I-n-2, Formula I-n-3, Formula I-n-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, Formula II-d-2, etc., or a suitable salt form thereof) is independently incorporated herein by reference).

[0410] Non-limiting examples of oligonucleotides comprising non-negative charge internucleotide linkages include WV-19823, WV-19824, WV-19825, WV-19826, WV-19827, WV-19828, WV-19829, WV-19830, WV-19831, WV-19832, WV-19833, WV-19834, WV-19835, WV-19836, WV-19837, WV-19841, WV-19842, WV-19843, WV-19844, WV-19845, WV-19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, WV-16214, WV-16215, WV-16216, WV-19844, WV-19845, WV-19846, WV-19847, WV-19848, WV-19849, WV-19850, WV-19851, WV-19852, WV-19853, WV-19854, and WV-19855.

[0411] In some embodiments, the non-negative charge internucleotide linkage can improve the delivery and / or activity of the HTT oligonucleotide (e.g., the ability to reduce the level, activity and / or expression of the HTT gene or its gene product).

[0412] In some embodiments, a modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises a triazolyl which is optionally substituted. In some embodiments, a modified internucleotide linkage (e.g., a non-negatively charged internucleotide linkage) comprises an alkynyl which is optionally substituted. In some embodiments, a modified internucleotide linkage comprises a triazole or alkyne moiety. In some embodiments, the triazole moiety, such as a triazolyl group, is optionally substituted. In some embodiments, the triazole moiety, such as a triazolyl group) is substituted. In some embodiments, the triazole moiety is unsubstituted. In some embodiments, a modified internucleotide linkage comprises a cyclic guanidine moiety which is optionally substituted. In some embodiments, a modified internucleotide linkage comprises a cyclic guanidine moiety which is optionally substituted,

Chemical formula

[0413] In some embodiments, a non-negatively charged internucleotide linkage or a neutral internucleotide linkage is an internucleotide linkage comprising a triazole moiety. In some embodiments, a non-negatively charged internucleotide linkage or a non-negatively charged internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, an internucleotide linkage comprising a triazole moiety (e.g., an optionally substituted triazolyl group)

Chemical formula

Chemical formula

Chem.

Chem.

[0414] In some embodiments, the internucleotide bond is a Tmg group

Chem.

Chem.

[0415] In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1 to 10 heteroatoms. In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 3- to 20-membered heterocyclyl or heteroaryl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, such heterocyclyl or heteroaryl group is a 5-membered ring. In some embodiments, such heterocyclyl or heteroaryl group is a 6-membered ring.

[0416] In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms. In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 5- to 20-membered heteroaryl group having 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 5- to 6-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted 5-membered heteroaryl group having 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the heteroaryl group is directly bonded to the linking phosphorus. In some embodiments, the non-negative charge internucleotide linkage comprises an optionally substituted triazolyl group. In some embodiments, the non-negative charge internucleotide linkage comprises an unsubstituted triazolyl group, such as

Chemical formula

Chemical formula

[0417] In some embodiments, the non-negatively charged internucleotide linkage comprises a 5- to 20-membered heterocyclyl group optionally substituted with 1 to 10 heteroatoms. In some embodiments, the non-negatively charged internucleotide linkage comprises a 5- to 20-membered heterocyclyl group optionally substituted with 1 to 10 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises a 5- to 6-membered heterocyclyl group optionally substituted with 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, the non-negatively charged internucleotide linkage comprises a 5-membered heterocyclyl group optionally substituted with 1 to 4 heteroatoms, wherein at least one heteroatom is nitrogen. In some embodiments, at least two heteroatoms are nitrogen. In some embodiments, the heterocyclyl group is directly bonded to the linking phosphorus. In some embodiments, the heterocyclyl group is bonded to the linking phosphorus via a linker, e.g., when the heterocyclyl group is part of a guanidine moiety that is directly bonded to the linking phosphorus by its =N—, via =N—. In some embodiments, the non-negatively charged internucleotide linkage optionally comprises a [Chemical formula] group. In some embodiments, the non-negatively charged internucleotide linkage comprises a substituted [Chemical formula] group. In some embodiments, the non-negatively charged internucleotide linkage [Chemical formula] group. In some embodiments, each R 1 is independently, optionally substituted C 1~6is alkyl. In some embodiments, each R 1 is independently methyl.

[0418] In some embodiments, a modified internucleotide linkage, such as a non-ionic internucleotide linkage, contains a triazole or alkyne moiety, each optionally substituted. In some embodiments, the modified internucleotide linkage contains a triazole moiety. In some embodiments, the modified internucleotide linkage contains an unsubstituted triazole moiety. In some embodiments, the modified internucleotide linkage contains a substituted triazole moiety. In some embodiments, the modified internucleotide linkage contains an alkyl moiety. In some embodiments, the modified internucleotide linkage contains an alkynyl group, optionally substituted. In some embodiments, the modified internucleotide linkage contains an unsubstituted alkynyl group. In some embodiments, the modified internucleotide linkage contains a substituted alkynyl group. In some embodiments, the alkynyl group is directly bonded to the linking phosphorus.

[0419] In some embodiments, the HTT oligonucleotide contains different types of internucleotide linkages. In some embodiments, a chirally controlled oligonucleotide contains at least one native phosphodiester bond and at least one modified (non-native) internucleotide linkage. In some embodiments, the HTT oligonucleotide contains at least one native phosphodiester bond and at least one phosphorothioate. In some embodiments, the HTT oligonucleotide contains at least one non-ionic internucleotide linkage.

[0420] In some embodiments, the neutral or non-negative charge internucleotide linkage has the structure of any neutral or non-negative charge internucleotide linkage described in U.S. Patent No. 9,394,333, U.S. Patent No. 9,744,183, U.S. Patent No. 9,605,019, U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 2017 / 037399, U.S. Patent Application Publication No. 2018 / 216108, U.S. Patent Application Publication No. 2018 / 216107, U.S. Patent No. 9,598,458, International Publication No. 2017 / 062862, International Publication No. 2018 / 067973, International Publication No. 2017 / 160741, International Publication No. 2017 / 192679, International Publication No. 2017 / 210647, International Publication No. 2018 / 098264, International Publication No. 2018 / 022473, International Publication No. 2018 / 223056, International Publication No. 2018 / 223073, International Publication No. 2018 / 223081, International Publication No. 2018 / 237194, International Publication No. 2019 / 032607, International Publication No. 2019 / 032612, International Publication No. 2019 / 055951, and / or International Publication No. 2019 / 075357 (each such neutral or non-negative charge internucleotide linkage being incorporated herein by reference).

[0421] In some embodiments, the neutral internucleotide linkage has the structure of Formula II-d-2. In some embodiments, each R’ is independently C optionally substituted with 1~6 aliphatic. In some embodiments, each R’ is independently C optionally substituted with 1~6 alkyl. In some embodiments, each R’ is independently -CH3. In some embodiments, each R s is -H.

[0422] In some embodiments, the non-negative charge internucleotide linkage is

Chemical Formula

[0423] In some embodiments, the provided oligonucleotide comprises one or more non-charged internucleotide linkages and / or one or more internucleotide linkages of Formula I, Formula I-a, Formula I-b, Formula I-c, Formula I-n-1, Formula I-n-2, Formula I-n-3, Formula I-n-4, Formula II, Formula II-a-1, Formula II-a-2, Formula II-b-1, Formula II-b-2, Formula II-c-1, Formula II-c-2, Formula II-d-1, or Formula II-d-2.

[0424] In some embodiments, the HTT oligonucleotide comprises a neutral internucleotide linkage and a chirally controlled internucleotide linkage. In some embodiments, the HTT oligonucleotide comprises a neutral internucleotide linkage and a chirally controlled internucleotide linkage that is not a neutral internucleotide linkage. In some embodiments, the HTT oligonucleotide comprises a neutral internucleotide linkage and a chirally controlled phosphorothioate internucleotide linkage.

[0425] Although not wishing to be bound by any particular theory, the present disclosure notes that neutral internucleotide linkages can be more hydrophobic than phosphorothioate internucleotide linkages (PS), and that PS can be more hydrophobic than natural phosphate linkages (PO). Typically, unlike PS or PO, neutral internucleotide linkages carry a low charge. Although not wishing to be bound by any particular theory, the present disclosure notes that incorporating one or more neutral internucleotide linkages into an HTT oligonucleotide can increase the ability of the oligonucleotide to be taken up by cells and / or escape from endosomes. Although not wishing to be bound by any particular theory, the present disclosure notes that the melting temperature of the duplex formed between an HTT oligonucleotide and its target nucleic acid can be adjusted using the incorporation of one or more neutral internucleotide linkages.

[0426] Although not wishing to be bound by any particular theory, the present disclosure notes that incorporating one or more non-negatively charged internucleotide linkages, such as neutral internucleotide linkages, into an HTT oligonucleotide can potentially increase the ability of the oligonucleotide to mediate functions such as gene knockdown. In some embodiments, an HTT oligonucleotide having the ability to mediate knockdown of the level of an HTT oligonucleotide, such as a nucleic acid or a product encoded thereby, comprises one or more non-negatively charged internucleotide linkages. In some embodiments, an HTT oligonucleotide having the ability to mediate knockdown of the expression of the HTT gene comprises one or more non-negatively charged internucleotide linkages.

[0427] In some embodiments, typical linkages such as those in natural DNA and RNA are internucleotide linkages that form a bond between two sugars, which may be unmodified or modified as described herein. In many embodiments, as exemplified herein, the internucleotide linkage forms a bond with a ribose or deoxyribose, optionally modified at one oxygen atom thereof, at its 5' carbon and with a ribose or deoxyribose, optionally modified at the other oxygen atom thereof, at its 3' carbon. In some embodiments, each nucleoside unit linked by an internucleotide linkage independently comprises a nucleobase that is independently A, T, C, G, or U, optionally substituted, or a tautomer thereof that is a substituted A, T, C, G, or U.

[0428] In some embodiments, the HTT oligonucleotide comprises an internucleotide linkage in which the negatively charged non-bridging oxygen of the canonical phosphodiester linkage is replaced by an uncharged alkyl substituent such as a methyl (Met) or ethyl (Et) group, as in P-alkylphosphonic acid nucleic acids (phNA) such as P-methyl or P-ethyl phNA. See, for example, Micklefield et al. 2001 Curr. Med. Chem. 8, 1157-1179; and Arangundy-Franklin et al. 2019 Nat. Chem. 11, 533-542.

[0429] In some embodiments, the HTT oligonucleotide is phosphonomethyl-threosyl nucleic acid (tPhoNA) and / or comprises phosphonomethyl-threosyl internucleotide linkages. Liu et al. 2018 J. Am. Chem. Soc. 140, 6690-6699.

[0430] As those skilled in the art will understand, in the present disclosure, many other types of internucleotide linkages can be utilized, such as those described in U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,938; 5,405,939; 5,434,257; 5,453,496; 5,455,233; 5,466,677; 5,466,677; 5,470,967; 5,476,925; 5,489,677; 5,519,126; 5,536,821; 5,541,307; 5,541,316; 5,550,111; 5,561,225; 5,563,253; 5,571,799; 5,587,361; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,625,050; 5,633,360; 5,64,562; 5,663,312; 5,677,437; 5,677,439; 6,160,109; 6,239,265; 6,028,188; 6,124,445; 6,169,170; 6,172,209; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; or RE39464.In some embodiments, the modified internucleotide linkage is as described in U.S. Patent No. 9,982,257, U.S. Patent Application Publication No. 2017 / 0037399, U.S. Patent Application Publication No. 2018 / 0216108, International Publication No. 2017 / 192664, International Publication No. 2017 / 015575, International Publication No. 2017 / 062862, International Publication No. 2018 / 067973, International Publication No. 2017 / 160741, International Publication No. 2017 / 192679, International Publication No. 2017 / 210647, International Publication No. 2018 / 098264, PCT / US18 / 35687, PCT / US18 / 38835, or PCT / US18 / 51398 (the nucleobases, sugars, internucleotide linkages, chiral auxiliaries / reagents, and oligonucleotide synthesis techniques (reagents, conditions, cycles, etc.) of each of which are hereby incorporated by reference).

[0431] In some embodiments, each internucleotide linkage in the HTT oligonucleotide is independently selected from a native phosphate linkage, a phosphorothioate linkage, and a non-negatively charged internucleotide linkage (e.g., n001). In some embodiments, each internucleotide linkage in the HTT oligonucleotide is independently selected from a native phosphate linkage, a phosphorothioate linkage, and a neutral internucleotide linkage (e.g., n001).

[0432] In some embodiments, the HTT oligonucleotide comprises one or more nucleotides independently comprising a phosphorus modification that tends to "self-release" under certain conditions. That is, under certain conditions, a particular phosphorus modification is designed to self-cleave from the oligonucleotide to provide, for example, a native phosphate linkage. For specific examples of such phosphorus-modified groups, reference can be made to U.S. Patent No. 9,982,257. In some embodiments, the self-releasing group comprises a morpholino group. In some embodiments, the self-releasing group is characterized by its ability to deliver an agent to an internucleotide phosphorus linker, and this agent promotes further modification of the phosphorus atom, such as desulfurization. In some embodiments, the agent is water and the further modification is the formation of a native phosphate linkage by hydrolysis.

[0433] In some embodiments, the HTT oligonucleotide comprises one or more internucleotide linkages that improve one or more pharmaceutical properties and / or activities of the oligonucleotide. In the art, it is well-established that certain oligonucleotides are readily degraded by nucleases and exhibit low cellular uptake across the cytoplasmic membrane (Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28);3441-65; Wagner et al., Med. Res. Rev. (2000), 20(6):417-51; Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408; Gosselin et al., (1996), 43(1):196-208; Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41). Vives et al. (Nucleic Acids Research (1999), 27(20):4071-76) reported that tert-butyl SATE pro-oligonucleotides showed a significant increase in cellular permeability compared to the parental oligonucleotide under certain conditions.

[0434] In some embodiments, the present disclosure demonstrates that, at least in some cases, Sp internucleotide linkages, particularly at the 5' end and / or 3' end, can improve oligonucleotide stability. In some embodiments, the present disclosure demonstrates that, in particular, natural phosphate linkages and / or Rp internucleotide linkages can improve the removal of oligonucleotides from a system. As will be appreciated by those skilled in the art, various assays known in the art can be utilized to evaluate such properties according to the present disclosure.

[0435] To achieve the desired oligonucleotide properties and / or activities, various internucleotide linkages can be utilized with other structural elements, such as combinations of sugars. For example, the present disclosure can utilize modified internucleotide linkages and modified sugars, optionally along with native phosphate linkages and native sugars, in the design of oligonucleotides in the conventional manner. In some embodiments, the present disclosure provides HTT oligonucleotides comprising one or more modified sugars.

[0436] In some embodiments, the present disclosure provides HTT oligonucleotides comprising one or more modified sugars and one or more modified internucleotide linkages, one or more of which can be chirally controlled.

[0437] In some embodiments, in an HTT oligonucleotide, chirally controlled internucleotide linkages can occur in a specific pattern, which can affect one or more activities and / or properties of the oligonucleotide.

[0438] HTT Oligonucleotide Compositions and Stereochemistry In particular, the present disclosure provides various HTT oligonucleotide compositions. In some embodiments, the present disclosure provides oligonucleotide compositions of the oligonucleotides described herein. In some embodiments, an HTT oligonucleotide composition, such as an HTT oligonucleotide composition, comprises a plurality of HTT oligonucleotides described in the present disclosure. In some embodiments, an HTT oligonucleotide composition, such as an HTT oligonucleotide composition, is chirally controlled. In some embodiments, an HTT oligonucleotide composition, such as an HTT oligonucleotide composition, is not chirally controlled (stereorandom).

[0439] The linked phosphorus of natural phosphate linkages is achiral. The linked phosphorus of many modified internucleotide linkages, such as phosphorothioate internucleotide linkages, is chiral. In some embodiments, during the preparation of oligonucleotide compositions (e.g., in conventional phosphoramidite oligonucleotide synthesis), the configuration of the chiral linked phosphorus is not intentionally designed or controlled, resulting in an oligonucleotide composition that is not chirally controlled (stereorandom) (substantially racemic formulation), a random complex mixture of various stereoisomers (diastereoisomers). For an oligonucleotide having -n chiral internucleotide linkages (where the linked phosphorus is chiral), typically 2 n stereoisomers result (e.g., when n = 10, 2 10 = 1,032; when n = 20, 2 20 = 1,048,576). These stereoisomers have the same chemical constitution but differ with respect to the stereochemical pattern of their linked phosphorus.

[0440] In some embodiments, a stereorandom oligonucleotide composition has properties and / or activities sufficient for a particular purpose and / or application. In some embodiments, a stereorandom oligonucleotide composition can be produced more inexpensively, easily, and / or simply compared to a chirally controlled oligonucleotide composition.

[0441] However, in some embodiments, the stereoisomers in a stereorandom composition can have various properties, activities, and / or toxicities, such that, in particular, compared to certain chirally controlled oligonucleotide compositions of oligonucleotides of the same chemical constitution, an inconsistent therapeutic effect and / or unintended side effects can occur with the stereorandom composition.

[0442] In some embodiments, the present disclosure encompasses techniques for the design and preparation of chirally controlled HTT oligonucleotide compositions. In some embodiments, the present disclosure provides, for example, a chirally controlled oligonucleotide composition of a number of oligonucleotides that contain S and / or R in their stereochemistry / bonding as in Table 1. In some embodiments, the chirally controlled oligonucleotide composition contains a plurality of oligonucleotides at a controlled / pre-determined (not random like a stereorandom composition) level, where these oligonucleotides share the same linking phosphorus stereochemistry in one or more chiral internucleotide linkages (chirally controlled internucleotide linkages). In some embodiments, the oligonucleotides share the same pattern of backbone chiral centers (stereochemistry of the linking phosphorus). In some embodiments, the pattern of backbone chiral centers is as described in the present disclosure. In some embodiments, the oligonucleotides are structurally identical.

[0443] In some embodiments, the level of diastereopurity of the plurality of oligonucleotides in the composition can be determined as the product of the diastereopurities of each chirally controlled internucleotide linkage in the oligonucleotide. In some embodiments, the diastereopurity of the internucleotide linkage that links two nucleosides in an HTT oligonucleotide (or nucleic acid) is represented by the diastereopurity of the internucleotide linkage of the dimer that links the same two nucleosides, where this dimer is prepared using equivalent conditions, in some examples, the same synthetic cycle conditions.

[0444] In some embodiments, all of the chiral internucleotide linkages are chirally controlled, and this composition is a fully chirally controlled oligonucleotide composition. In some embodiments, not all of the chiral internucleotide linkages are chirally controlled internucleotide linkages, and this composition is a partially chirally controlled oligonucleotide composition.

[0445] Oligonucleotides can contain or consist of various backbone chiral center patterns (the stereochemical pattern of chiral linked phosphorus). Certain useful backbone chiral center patterns are described in this disclosure. In some embodiments, multiple oligonucleotides share a common backbone chiral center pattern, which is or includes a pattern described in this disclosure (e.g., as in “Linked phosphorus stereochemistry and its patterns,” the pattern of backbone chiral centers of chiral controlled oligonucleotides in Table 1, etc.).

[0446] In some embodiments, a chiral controlled oligonucleotide composition is a chirally pure (or stereochemically pure, stereopure) oligonucleotide composition, where the oligonucleotide composition contains multiple oligonucleotides, where these oligonucleotides are identical [including that each chiral element of the oligonucleotide is independently defined (stereochemically defined), including each chiral linked phosphorus], and the composition does not contain other stereoisomers. A chirally pure (or stereochemically pure, stereopure) oligonucleotide composition of HTT oligonucleotide stereoisomers does not contain other stereoisomers (as would be understood by one of ordinary skill in the art, one or more unintended stereoisomers may be present as impurities - for exemplary purities, see those described in this disclosure).

[0447] Chirally controlled oligonucleotide compositions can demonstrate several advantages over stereorandom oligonucleotide compositions. In particular, chirally controlled oligonucleotide compositions are more uniform in terms of oligonucleotide structure than the corresponding stereorandom oligonucleotide compositions. By controlling stereochemistry, compositions of individual stereoisomers can be prepared and evaluated, and thus chirally controlled oligonucleotide compositions of stereoisomers with desired properties and / or activities can be developed. In some embodiments, chirally controlled oligonucleotide compositions provide, for example, better delivery, stability, clearance, activity, selectivity, and / or toxicity profiles compared to the corresponding stereorandom oligonucleotide compositions. In some embodiments, chirally controlled oligonucleotide compositions provide better efficacy, fewer side effects, and / or a more convenient and effective dosing regimen. In particular, using the backbone chiral center patterns as described herein can result in controlled cleavage of oligonucleotide targets (e.g., transcripts such as pre-mRNA, mature mRNA; including control of cleavage sites, rate and / or extent of cleavage at the cleavage site, and / or overall rate and extent of cleavage) and a significant increase in HTT target selectivity.

[0448] In some embodiments, an HTT oligonucleotide composition comprises one or more stereocontrolled (chirally controlled; in some embodiments, stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages. In some embodiments, an HTT oligonucleotide composition comprises one or more stereocontrolled (chirally controlled; in some embodiments, stereopure) internucleotide linkages and one or more stereorandom internucleotide linkages.

[0449] In some embodiments, the HTT oligonucleotide composition comprises one or more internucleotide linkages that are stereocontrolled (e.g., chirally controlled, or stereochemically pure) and one or more internucleotide linkages that are stereorandom. Such oligonucleotides can target various targets, can have various base sequences, and can have the ability to function by one or more of various modalities (e.g., RNase H mechanism, steric hindrance, double-stranded or single-stranded RNA interference, exon skipping modulation, CRISPR, aptamer, etc.).

[0450] Non-limiting examples of three-dimensionally random oligonucleotide compositions, such as three-dimensionally random HTT oligonucleotide compositions, include, but are not limited to, WV-1027, WV-1028, WV-1029, WV-1030, WV-1031, WV-1032, WV-1033, WV-1034, WV-1035, WV-1036, WV-1037, WV-1038, WV-1039, WV-1040, WV-1041, WV-1042, WV-1043, WV-1044, WV-1045, WV-1046, WV-1047, WV-1048, WV-1049, WV-1050, WV-1051, WV-1052, WV-1053, WV-1054, WV-1055, WV-1056, WV-1057, WV-1058, WV-1059, WV-1060, WV-1061, WV-1062, WV-1063, WV-1064, WV-1065, WV-1066, WV-1067, WV-1068, WV-1069, WV-1070, WV-1071, WV-1072, WV-2023, WV-2024, WV-2025, WV-2026, WV-2027, WV-2028, WV-2029, WV-2030, WV-2031, WV-2032, WV-2033, WV-2034, WV-2035, WV-2036, WV-2037, WV-2038, WV-2039, WV-2040, WV-2041, WV-2042, WV-2043, WV-2044, WV-2045, WV-2046, WV-2047, WV-2048, WV-2049, WV-2050, WV-2051, WV-2052, WV-2053, WV-2054, WV-2055, WV-2056, WV-2057, WV-2058, WV-2059, WV-2060, WV-2061, WV-2062, WV-2063, WV-2064, WV-2065, WV-2066, WV-2067, WV-2068, WV-2069, WV-2070, WV-2071, WV-2072, WV-2073, WV-2074, WV-2075, WV-2076, WV-2077, WV-2078, WV-2079, WV-2080, WV-2081, WV-2082, WV-2083, WV-2084, WV-2085, WV-2086, WV-2087, WV-2088, WV-2089, WV-2090, WV-2605, WV-2606,WV-2607, WV-2608, WV-2609, WV-2610, WV-2611, WV-2612, WV-2613, WV-2614, WV-2615, WV-2616, WV-2617, WV-2618, WV-2619, WV-2620, WV-13625, WV-13626, WV-13627, WV-13628, WV-13629, WV-13630, WV-13631, WV-13632, WV-13633, WV-13634, WV-13635, WV-13646, WV-13647, WV-13648, WV-13649, WV-13650, WV-13651, WV-13652, WV-13653, WV-13654, WV-13655, WV-13656, and WV-13667 are described herein.,

[0451] Non-limiting examples of stereochemically pure (or chirally controlled) oligonucleotide compositions, such as stereochemically pure (or chirally controlled) HTT oligonucleotide compositions, include, but are not limited to, WV-2269, WV-2270, WV-2271, WV-2272, WV-2374, WV-2375, WV-2380, WV-2416, WV-2417, WV-2418, WV-2419, WV-2431, WV-2589, WV-2590, WV-2591, WV-2592, WV-2593, WV-2594, WV-2595, WV-2596, WV-2597, WV-2598, WV-2599, WV-2600, WV-2601, WV-2602, WV-2603, WV-2604, WV-2659, WV-2671, WV-2672, WV-2673, WV-2674, WV-2675, WV-2676, WV-2682, WV-2683, WV-2684, WV-2685, WV-2686, WV-2687, WV-2688, WV-2689, WV-2690, WV-2691, WV-2692, WV-2732, WV-13952, WV-13953, WV-13954, WV-13955, WV-13956, WV-13957, WV-13958, WV-13959, WV-13960, WV-13961, WV-13962, WV-14059, WV-14060, WV-14061, WV-14062, WV-14063, WV-14064, WV-14065, WV-14066, WV-14067, WV-14068, WV-14069, WV-14070, WV-14071, WV-14072, WV-14073, WV-14074, WV-14075, WV-14076, WV-14077, WV-14078, WV-14079, WV-14080, WV-14081, WV-14082, WV-14083, WV-14084, WV-14085, WV-14086, WV-14092, WV-14093, WV-14094, WV-14095, WV-14096, WV-14097, WV-14098, WV-14099, WV-14100, WV-14101, WV-14133, WV-14134, WV-14135, WV-14136, WV-14137, WV-14138, WV-14139, and WV-14140, as described herein.

[0452] An oligonucleotide composition comprising one or more internucleotide linkages that are stereocontrolled (e.g., chirally controlled or stereopure) and one or more internucleotide linkages that are stereorandom, non-limiting examples of which, for example, include, but are not limited to, HTT oligonucleotide compositions, WV-13636, WV-13637, WV-13638, WV-13639, WV-13640, WV-13641, WV-13642, WV-13643, WV-13644, WV-13645, WV-13657, WV-13658, WV-13659, WV-13660, WV-13661, WV-13662, WV-13663, WV-13664, WV-13665, WV-13666.

[0453] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition. In some embodiments, the chirally controlled oligonucleotide composition provided comprises a plurality of HTT oligonucleotides of the same chemical constitution and having one or more internucleotide linkages. In some embodiments, for example, the plurality of oligonucleotides in the chirally controlled oligonucleotide composition are a plurality of HTT oligonucleotides selected from Table 1, wherein the oligonucleotide comprises at least one Rp or Sp linked phosphorus in the chirally controlled internucleotide linkage. In some embodiments, for example, in the chirally controlled oligonucleotide composition, the plurality of oligonucleotides are a plurality of HTT oligonucleotides selected from Table 1, wherein each phosphorothioate internucleotide linkage in the oligonucleotide is independently chirally controlled (each phosphorothioate internucleotide linkage is independently Rp or Sp). In some embodiments, the HTT oligonucleotide composition, e.g., the HTT oligonucleotide composition, is a substantially pure formulation of a single oligonucleotide, which can be said to be so in that oligonucleotides other than that single oligonucleotide present in the composition are impurities from the preparation process of the single oligonucleotide, optionally after certain purification procedures. In some embodiments, the single oligonucleotide is an HTT oligonucleotide of Table 1, wherein each chiral internucleotide linkage of the oligonucleotide is chirally controlled (e.g., indicated as S or R rather than X in "Stereochemistry / Bond").

[0454] In some embodiments, a chirally controlled oligonucleotide composition can exhibit increased activity and / or stability, increased delivery, and / or decreased ability to cause adverse effects such as complement or TLR9 activation, compared to the corresponding stereorandom oligonucleotide composition. In some embodiments, a stereorandom (not chirally controlled) oligonucleotide composition differs from its corresponding chirally controlled oligonucleotide composition in that its corresponding plurality of oligonucleotides do not contain any chirally controlled internucleotide linkages, but otherwise the stereorandom oligonucleotide composition is identical to the chirally controlled oligonucleotide composition.

[0455] In some embodiments, the present disclosure relates to a chirally controlled HTT oligonucleotide composition having the ability to reduce the level, activity or expression of the HTT gene or its gene product.

[0456] In some embodiments, the present disclosure provides a chirally controlled HTT oligonucleotide composition comprising a plurality of oligonucleotides having the ability to reduce the level, activity or expression of the HTT gene or its gene product and sharing a common base sequence that is the base sequence disclosed herein (e.g., in Table 1, where each T can be independently replaced by U and vice versa), contains it, or contains a span thereof (e.g., at least 10 or 15 adjacent bases). In some embodiments, the present disclosure provides a chirally controlled HTT oligonucleotide composition comprising a plurality of oligonucleotides having the ability to reduce the level, activity or expression of the HTT gene or its gene product and sharing a common base sequence that is the base sequence disclosed herein (e.g., in Table 1, where each T can be independently replaced by U and vice versa) or contains it. In some embodiments, the present disclosure provides a chirally controlled HTT oligonucleotide composition comprising a plurality of oligonucleotides having the ability to reduce the level, activity or expression of the HTT gene or its gene product and sharing a common base sequence that is the base sequence disclosed herein (e.g., in Table 1, where each T can be independently replaced by U and vice versa).

[0457] In some embodiments, the provided chirally controlled oligonucleotide composition is a chirally controlled HTT oligonucleotide composition comprising a plurality of HTT oligonucleotides. In some embodiments, the chirally controlled oligonucleotide composition is a chirally pure (or “stereochemically pure”) oligonucleotide composition. In some embodiments, the present disclosure provides a chirally pure oligonucleotide composition of the HTT oligonucleotides in Table 1, where each chiral internucleotide bond of the oligonucleotide is independently chirally controlled (Rp or Sp can be determined, for example, from being R or S rather than X in “Stereochemistry / Bond”). As will be understood by those skilled in the art, while it is not unheard of, it is rare for chemical selectivity to achieve perfection (absolute 100%). In some embodiments, the chirally pure oligonucleotide composition comprises a plurality of oligonucleotides, where the oligonucleotides in the plurality are structurally identical and all have the same structure (the same stereoisomeric form; since HTT oligonucleotides typically have multiple chiral centers, in the context of an oligonucleotide, typically the same diastereomeric form), and the chirally pure oligonucleotide composition does not contain any other stereoisomers (since HTT oligonucleotides typically have multiple chiral centers, in the context of an oligonucleotide, typically diastereomers; for example, within the range achievable by stereoselective preparation). As will be understood by those skilled in the art, a stereochemically random (or “racemic,” “not chirally controlled”) oligonucleotide composition is a random mixture of many stereoisomers (e.g., 2 n diastereoisomers [where n is the number of chiral phosphorus linkages for an oligonucleotide in which other chiral centers (e.g., sugar carbon chiral centers) are chirally controlled and each independently exists in one configuration and only the chiral phosphorus linkages at the chiral phosphorus centers are not chirally controlled]).

[0458] Specific data indicating that a chirally controlled oligonucleotide composition, such as a chirally controlled HTT oligonucleotide composition, has properties and / or activities in reducing the level, activity and / or expression of the HTT gene or its gene product are shown, for example, in the Examples section of this document.

[0459] In some embodiments, the disclosure provides an HTT oligonucleotide composition comprising an oligonucleotide comprising at least one chiral-linked phosphorus. In some embodiments, the disclosure provides an HTT oligonucleotide composition comprising an HTT oligonucleotide comprising at least one chiral-linked phosphorus. In some embodiments, the disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide comprises a chirally controlled phosphorothioate internucleotide linkage, wherein the linked phosphorus has an Rp configuration. In some embodiments, the disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotide comprises a chirally controlled phosphorothioate internucleotide linkage, wherein the linked phosphorus has an Sp configuration.

[0460] In some embodiments, the provided chirally controlled oligonucleotide compositions (e.g., chirally controlled HTT oligonucleotide compositions) are unexpectedly effective when compared to reference oligonucleotide compositions. In some embodiments, the desired biological effect can be enhanced 5, 10, 15, 20, 25, 30, 40, 50, or more than 100-fold (e.g., as measured by the level of reduction of mRNA, protein, etc., where the level of the target is decreased). In some embodiments, the change is measured by a decrease in the undesired mRNA level compared to the reference condition. In some embodiments, the change is measured by an increase in the desired mRNA level compared to the reference condition. In some embodiments, the change is measured by a decrease in the undesired mRNA level compared to the reference condition. In some embodiments, the reference condition is, for example, the absence of treatment with a chirally controlled oligonucleotide composition. In some embodiments, the reference condition is a corresponding stereorandom composition of an oligonucleotide having the same chemical constitution.

[0461] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein the linking phosphorus of at least one chirally controlled internucleotide bond is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein the majority of the linking phosphorus of the chirally controlled internucleotide bonds is Sp. In some embodiments, about 50% - 100%, 55% - 100%, 60% - 100%, 65% - 100%, 70% - 100%, 75% - 100%, 80% - 100%, 85% - 100%, 90% - 100%, 55% - 95%, 60% - 95%, 65% - 95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chirally controlled internucleotide bonds (or of all chiral internucleotide bonds, or of all internucleotide bonds) are Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein the majority of the chiral internucleotide bonds are chirally controlled and their linking phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein each chiral internucleotide bond is chirally controlled and each chiral linking phosphorus is Sp. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein at least one chirally controlled internucleotide bond has an Rp linking phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, wherein at least one chirally controlled internucleotide bond contains an Rp linking phosphorus and at least one chirally controlled internucleotide bond contains an Sp linking phosphorus.

[0462] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, wherein at least two chirally controlled internucleotide linkages have different linkage phosphorus stereochemistry and / or different P-modifications, where the P-modification is a modification of the linkage phosphorus. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, wherein at least two chirally controlled internucleotide linkages have different stereochemistry, and the pattern of backbone chiral centers of the oligonucleotide is characterized by an alternating pattern of stereochemistry.

[0463] In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises a native phosphate linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises a phosphorothioate internucleotide linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises a native phosphate linkage and a phosphorothioate internucleotide linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises a phosphorothioate triester internucleotide linkage. In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises a native phosphate linkage and a phosphorothioate triester internucleotide linkage.In certain embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein within each of the oligonucleotides, at least two individual internucleotide linkages have different P-modifications from each other, and each of the oligonucleotides comprises phosphorothioate internucleotide linkages and phosphorothioate triester internucleotide linkages.

[0464] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, comprising a plurality of oligonucleotides sharing a common base sequence that is the base sequence of an HTT oligonucleotide disclosed herein, wherein at least one internucleotide linkage is chirally controlled.

[0465] Stereochemistry and pattern of backbone chiral centers In contrast to natural phosphate linkages, the linking phosphorus of chiral modified internucleotide linkages, such as phosphorothioate internucleotide linkages, is chiral. In particular, the present disclosure provides techniques (e.g., oligonucleotides, compositions, methods, etc.) that include control of the stereochemistry of chiral linking phosphorus in chiral internucleotide linkages. In some embodiments, as demonstrated herein, control of stereochemistry can result in improved properties and / or activities, including desired stability, reduced toxicity, improved reduction of HTT nucleic acid, etc. In some embodiments, the present disclosure provides a backbone chiral center pattern useful for an oligonucleotide and / or a region thereof, the pattern being, from 5' to 3', a combination of the stereochemistry (Rp or Sp) of each chiral linking phosphorus in the chiral linking phosphorus, the indication of each achiral linking phosphorus (Op if present), etc. In some embodiments, the backbone chiral center pattern can control the cleavage pattern of HTT nucleic acid when contacted with an oligonucleotide or a composition thereof provided in a cleavage system (e.g., in vitro assay, cell, tissue, organ, organism, subject, etc.). In some embodiments, the pattern of backbone chiral centers improves the cleavage efficiency and / or selectivity of HTT nucleic acid when contacted with an oligonucleotide or a composition thereof provided in a cleavage system.

[0466] In some embodiments, the HTT oligonucleotide (or wing, core, block, or any portion thereof) can include any pattern of chiral centers described in any of International Publication No. WO 2017 / 015555; International Publication No. WO 2017 / 192664; International Publication No. WO 2012 / 00366; International Publication No. WO 2011 / 034072; International Publication No. WO 2014 / 010718; International Publication No. WO 2015 / 108046; International Publication No. WO 2015 / 108047; International Publication No. WO 2015 / 108048; International Publication No. WO 2011 / 005761; International Publication No. WO 2011 / 108682; International Publication No. WO 2012 / 039448; International Publication No. WO 2018 / 067973; International Publication No. WO 2005 / 028494; International Publication No. WO 2005 / 092909; International Publication No. WO 2010 / 064146; International Publication No. WO 2012 / 073857; International Publication No. WO 2013 / 012758; International Publication No. WO 2014 / 010250; International Publication No. WO 2014 / 012081; International Publication No. WO 2015 / 107425; International Publication No. WO 2017 / 015555; International Publication No. WO 2017 / 015575; International Publication No. WO 2017 / 062862; International Publication No. WO 2017 / 160741; International Publication No. WO 2017 / 192664; International Publication No. WO 2017 / 192679; International Publication No. WO 2017 / 210647; International Publication No. WO 2018 / 022473; or International Publication No. WO 2018 / 098264 (the chiral center patterns of which are incorporated by reference).

[0467] In some embodiments, the oligonucleotides in the chirally controlled oligonucleotide composition each include at least two internucleotide linkages having different stereochemistry and / or different P-modifications from each other. In some embodiments, the at least two internucleotide linkages have different stereochemistry from each other, and these oligonucleotides each include a backbone chiral center pattern including an alternating bond phosphorus stereochemistry.

[0468] In some embodiments, the phosphorothioate triester linkage includes a chiral auxiliary, which is used, for example, to control the stereoselectivity of reactions, such as coupling reactions, in the HTT oligonucleotide synthesis cycle. In some embodiments, the phosphorothioate triester linkage does not include a chiral auxiliary. In some embodiments, the phosphorothioate triester linkage is intentionally maintained until and / or during administration of the oligonucleotide composition to a subject.

[0469] In some embodiments, the oligonucleotide is attached to a solid support. In some embodiments, the solid support is a support for oligonucleotide synthesis. In some embodiments, the solid support includes glass. In some embodiments, the solid support is CPG (controlled pore glass). In some embodiments, the solid support is a polymer. In some embodiments, the solid support is polystyrene. In some embodiments, the solid support is highly crosslinked polystyrene (HCP). In some embodiments, the solid support is a hybrid support of controlled pore glass (CPG) and highly crosslinked polystyrene (HCP). In some embodiments, the solid support is a metal foam. In some embodiments, the solid support is a resin. In some embodiments, the oligonucleotide is cleaved from the solid support.

[0470] In some embodiments, all other chiral centers in the oligonucleotide except the chiral linking phosphorus center are stereochemically defined (e.g., the carbon chiral centers in the sugar, which are defined, for example, in phosphoramidites for oligonucleotide synthesis). The purity of many oligonucleotides and their compositions, particularly stereochemical purity, and particularly diastereomeric purity, can be controlled by the stereoselectivity at the chiral linking phosphorus in the coupling step when forming the chiral internucleotide bond (diastereoselectivity in many cases of oligonucleotide synthesis where the oligonucleotide contains two or more chiral centers, as will be understood by those skilled in the art). In some embodiments, the coupling step has a stereoselectivity of 60% (diastereoselectivity if there are other chiral centers) at the linking phosphorus. After such a coupling step, the newly formed internucleotide bond can be said to have a stereochemical purity of 60% (diastereomeric purity typically for oligonucleotides, taking into account the presence of other chiral centers). In some embodiments, each coupling step independently has a stereoselectivity of at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, each coupling step independently has substantially 100% stereoselectivity.

[0471] In some embodiments, the coupling step has a stereoselectivity of virtually 100% in that each detectable product from the coupling step analyzed by an analytical method (e.g., NMR, HPLC, etc.) has the intended stereoselectivity. In some embodiments, chiral-controlled internucleotide linkages are typically formed with a stereoselectivity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%). In some embodiments, each chiral-controlled internucleotide linkage independently has a stereochemical purity (diastereomeric purity for oligonucleotides having multiple chiral centers) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%) at its chiral-bond phosphorus.

[0472] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 couplings of a monomer (a phosphoramidite for oligonucleotide synthesis in many embodiments, as will be understood by those skilled in the art) independently have a stereoselectivity of less than about 60%, 70%, 80%, 85% or 90% [for oligonucleotide synthesis, typically diastereoselectivity with respect to one or more of the formed bond chiral centers].

[0473] In some embodiments, the stereochemical purity, e.g., diastereomeric purity, is from about 60% to 100%.

[0474] In some embodiments, the compounds of the present disclosure (e.g., oligonucleotides, chiral auxiliaries, etc.) contain multiple chiral elements (e.g., multiple carbons and / or phosphorus (e.g., the linking phosphorus of a chiral internucleotide bond) chiral centers). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral elements of the provided compound (e.g., an HTT oligonucleotide) each independently have a diastereomeric purity as described herein.

[0475] As will be appreciated by those skilled in the art, in some embodiments, the diastereoselectivity of coupling or the diastereomeric purity of the chiral linking phosphorus center can be evaluated by the diastereoselectivity of dimer formation or the diastereomeric purity of the dimer prepared under the same or equivalent conditions, where the dimer has the same 5'- and 3'-nucleosides and internucleotide bonds.

[0476] For the identification or confirmation of the stereochemistry of chiral elements (e.g., the configuration of chiral linking phosphorus) and / or the backbone chiral center pattern, and / or the evaluation of diastereoselectivity (e.g., the diastereoselectivity of the coupling step in oligonucleotide synthesis) and / or stereochemical purity (e.g., the diastereomeric purity of internucleotide bonds, compounds (e.g., oligonucleotides), etc.), various techniques can be utilized. Exemplary techniques include NMR [e.g., 1D (one-dimensional) and / or 2D (two-dimensional) 1 H- 31PHETCOR (heteronuclear correlation spectroscopy), HPLC, RP-HPLC, mass spectrometry, LC-MS, and cleavage of internucleotide bonds by stereospecific nucleases, etc. can be mentioned, and these can be used individually or in combination. Useful exemplary nucleases include benzonase, micrococcal nuclease, and svPDE (snake venom phosphodiesterase) specific for a specific internucleotide bond having an Rp-linked phosphorus (e.g., Rp phosphorothioate bond); and nuclease P1, mung bean nuclease, and nuclease S1 specific for an internucleotide bond having an Sp-linked phosphorus (e.g., Sp phosphorothioate bond). While not wishing to be bound by any particular theory, the present disclosure notes that, in at least some cases, the cleavage of oligonucleotides by a specific nuclease can be affected by structural elements such as chemical modifications (e.g., 2'-modification of sugars), base sequences, or stereochemical context. For example, in some cases, it has been observed that benzonase and micrococcal nuclease specific for an internucleotide bond having an Rp-linked phosphorus were unable to cleave an isolated Rp phosphorothioate internucleotide bond where an Sp phosphorothioate internucleotide bond was located laterally.

[0477] In some embodiments, multiple HTT oligonucleotides share the same chemical constitution. In some embodiments, multiple HTT oligonucleotides are identical (the same stereoisomer). In some embodiments, a chirally controlled oligonucleotide composition, e.g., a chirally controlled HTT oligonucleotide composition, is a stereochemically pure oligonucleotide composition in which the oligonucleotides among the multiple are identical (the same stereoisomer), and this composition does not contain any other stereoisomers. Those skilled in the art will understand that one or more other stereoisomers may be present as impurities since processing, selection, purification, etc. do not achieve perfection.

[0478] In some embodiments, the provided composition is characterized in that when it contacts an HTT nucleic acid [e.g., an HTT transcript (e.g., pre-mRNA, mature mRNA, other types of RNA, etc. that hybridize with the oligonucleotide of the composition)], the level of the HTT nucleic acid and / or the product encoded thereby (e.g., a protein) is reduced as compared to that observed under reference conditions. In some embodiments, the reference conditions are selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. In some embodiments, the reference condition is the absence of the composition. In some embodiments, the reference condition is the presence of a reference composition. In some embodiments, the reference composition is a composition in which the oligonucleotide thereof does not hybridize with the HTT nucleic acid. In some embodiments, the reference composition is a composition in which the oligonucleotide thereof does not contain a sequence sufficiently complementary to the HTT nucleic acid. In some embodiments, the provided composition is a chirally controlled oligonucleotide composition, and the reference composition is otherwise identical but not chirally controlled (e.g., a racemic formulation of an oligonucleotide having the same chemical constitution as the oligonucleotide (e.g., multiple, of a particular oligonucleotide type, etc.) in the chirally controlled oligonucleotide composition), a non-chirally controlled oligonucleotide composition.

[0479] As pointed out above and as understood in the art, in some embodiments, the base sequence of the HTT oligonucleotide can refer to the identity and / or modified state of the nucleoside residues in the oligonucleotide (e.g., the sugar and / or base components as compared to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil), and / or the hybridization properties of such residues (i.e., the ability to hybridize with specific complementary residues).

[0480] As demonstrated herein, oligonucleotide structural elements (e.g., patterns of sugar modifications, backbone linkages, backbone chiral centers, backbone phosphorus modifications, etc.) and combinations thereof can unexpectedly result in improved properties and / or biological activities.

[0481] In some embodiments, an oligonucleotide composition has the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, an oligonucleotide composition has the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product by sterically blocking translation by cleavage of the mRNA after annealing to HTT mRNA (e.g., pre-mRNA or mature mRNA). In some embodiments, the provided HTT oligonucleotide composition has the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product. In some embodiments, the provided HTT oligonucleotide composition has the ability to reduce the expression, level, and / or activity of the HTT gene or its gene product by sterically blocking translation by cleavage of HTT mRNA (pre-mRNA or mature mRNA) after annealing to HTT mRNA and / or by changing or interfering with mRNA splicing.

[0482] In some embodiments, an HTT oligonucleotide composition, e.g., an HTT oligonucleotide composition, is a substantially pure formulation of a single oligonucleotide stereoisomer, e.g., an HTT oligonucleotide stereoisomer, in that the oligonucleotides in the composition that are not the oligonucleotide stereoisomer are impurities from the preparation process of the oligonucleotide stereoisomer, optionally after a specific purification procedure.

[0483] In some embodiments, the present disclosure provides oligonucleotides and oligonucleotide compositions that are chirally controlled and, in some embodiments, stereochemically pure. For example, in some embodiments, the compositions provided include one or more individual oligonucleotide types that are non-random or at a controlled level. In some embodiments, oligonucleotides of the same oligonucleotide type are identical.

[0484] Sugar In the present disclosure, various sugars can be utilized, including modified sugars. In some embodiments, the present disclosure optionally combines sugar modifications and their patterns with other structural elements (e.g., internucleotide linkage modifications and their patterns, patterns of the chiral centers of the backbone, etc.) that can result in improved properties and / or activities when incorporated into oligonucleotides.

[0485] The most common naturally occurring nucleosides include ribose sugar (e.g., in RNA) or deoxyribose sugar (e.g., in DNA) linked to the nucleobases adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, the sugars, e.g., the various sugars in many of the oligonucleotides in Table 1, are (unless otherwise noted) natural DNA sugars (those in DNA nucleic acids or oligonucleotides, having the following structure

Chemical formula

Chemical formula

[0486] The suga...

Claims

1. An oligonucleotide, wherein (a) the oligonucleotide targets SNP rs362273 and the nucleotide sequence of the oligonucleotide comprises at least 15 contiguous bases including the SNP position of the nucleotide sequence GTTGATCTGTAGCAGCAGCT (wherein each T can independently be replaced by U); or (b) the oligonucleotide targets SNP rs362272 and the nucleotide sequence of the oligonucleotide comprises at least 15 contiguous bases including the SNP position of the nucleotide sequence ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGC, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGGCT (wherein each T can independently be replaced by U); or (c) the oligonucleotide targets SNP rs362273 and the nucleotide sequence of the oligonucleotide comprises at least 15 contiguous bases including the SNP position of the nucleotide sequence AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTGATCTGTAGCAGCAGCT, GTGATCTGTAGCAGCAGCT or TTGAATCTGTAGCAGCAGCT (wherein each T can independently be replaced by U); or (d) the oligonucleotide targets SNP rs362307 and the nucleotide sequence of the oligonucleotide comprises at least 15 contiguous bases including the SNP position of the nucleotide sequence GGCA CAAGGGCA CAGAC, GGCA CAAGGGCA CAGACT or GGCA CAAGGGCA CAGACTT (wherein each T can independently be replaced by U); or (e) the oligonucleotide targets SNP rs362331 and the nucleotide sequence of the oligonucleotide comprises at least 15 contiguous bases including the SNP position of the nucleotide sequence GTGCACACAGTAGATGAGGGG (wherein each T can independently be replaced by U); or (f) The oligonucleotide targets SNP rs363099, and the nucleotide sequence of the oligonucleotide comprises at least 15 adjacent bases including the SNP position of nucleotide sequences AAGGC TGAGCGGAGAAACCC, AGGCTGAGCGGAGAAAC CCT, CAAGGC TGAGCGGAGAAACC, CTGAGCGGAGAAAC CCTCCA, GCTGAGCGGAGAAAC CCTCC, GGCTGAGCGGAGAAAC CCT C or TGAGCGGAGAAAC CCTCCAA (wherein each T can be independently replaced by U); The oligonucleotide is an oligonucleotide comprising one or more chiral internucleotide linkages. **Claim 2** The nucleotide sequence of the oligonucleotide is (a) GTTGATCTGTAGCAGCAGCT (wherein each T can be independently replaced by U); (b) ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCAG, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC or TAGAGGACGCCGTGCAGGG C (wherein each T can be independently replaced by U); (c) AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT or TTGATCTGTAGCAGCAGCT (wherein each T can be independently replaced by U); (d) GGCA CAAGGGCA CAGAC, GGCA CAAGGGCA CAGACT or GGCA CAAGGGCA CAGACTT (wherein each T can be independently replaced by U); (e) GTGCACACAGTAGATGAGGG (wherein each T can be independently replaced by U); or (f) AAGGC TGAGCGGAGAAACCC, AGGCTGAGCGGAGAAAC CCT, CAAGGC TGAGCGGAGAAACC, CTGAGCGGAGAAAC CCTCCA, GCTGAGCGGAGAAAC CCTCC, GGCTGAGCGGAGAAAC CCT C or TGAGCGGAGAAAC CCTCCAA (wherein each T can be independently replaced by U) The oligonucleotide according to claim 1, which comprises or is the same as

3. Each internucleotide bond of the oligonucleotide is independently a natural phosphate bond, a phosphorothioate bond, or 【Chemical 1】 The oligonucleotide according to claim 1 or 2, which is

4. The oligonucleotide according to claim 1 or 2, which comprises one or more natural phosphate bonds, one or more Sp phosphorothioate bonds, and one or more Rp n001 bonds.

5. The oligonucleotide according to any one of claims 1 to 4, which comprises or consists of a 5'-wing and a 3'-wing each independently containing one or more modified sugars, and a core between the 5'-wing and the 3'-wing.

6. The oligonucleotide according to claim 5, which comprises a 5'-wing containing five consecutive 2'-OMe modified sugars and a 3'-wing containing five consecutive 2'-OMe modified sugars.

7. The oligonucleotide according to claim 5 or 6, wherein the core contains one or more unmodified natural DNA sugars.

8. An oligonucleotide, which is WV-21404, WV-21405, WV-21406, WV-21412, WV-12282, WV-12283, WV-12284, WV-19840, WV-21178, WV-21179, WV-21180, WV-21181, WV-21403, WV-21409, WV-21410, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167 or WV-28168.

9. The oligonucleotide according to any one of claims 1 to 8, which is in the form of a pharmaceutically acceptable salt.

10. The oligonucleotide according to any one of claims 1 to 9, which is in the form of a sodium salt.

11. The oligonucleotide according to any one of claims 1 to 10, having a diastereomeric purity of at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%.

12. A chirally controlled oligonucleotide composition of the oligonucleotide according to any one of claims 1 to 10.

13. At least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the oligonucleotide in the composition or the oligonucleotide in the composition sharing the same base sequence as the oligonucleotide is, independently of each other, the oligonucleotide according to any one of claims 1 to 10, the composition according to claim 11.

14. A pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide and a pharmaceutically acceptable inert ingredient, wherein the oligonucleotide is the oligonucleotide according to any one of claims 1 to 11.

15. At least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the oligonucleotide in the composition or the oligonucleotide in the composition sharing the same base sequence as the oligonucleotide is, independently of each other, the oligonucleotide according to any one of claims 1 to 10, the composition according to claim 14.

16. The composition according to any one of claims 12 to 15, wherein the oligonucleotide is in the form of a pharmaceutically acceptable salt.

17. The composition according to any one of claims 12 to 15, wherein the oligonucleotide is in the sodium salt form.

18. A composition comprising an oligonucleotide selected from WV-21404, WV-21405, WV-21406, WV-21412, WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21409, WV-21410, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168 and WV-9679.

19. The composition according to claim 18, wherein the oligonucleotide is in the form of a pharmaceutically acceptable salt.

20. A method of treating, preventing, delaying the onset of, and / or reducing the severity of at least one symptom of Huntington's disease, the method comprising administering to a subject affected by or susceptible to the disease an effective amount of the oligonucleotide or composition according to any one of claims 1 to 19.

21. The method according to claim 20, wherein the subject has an HTT allele comprising an expanded CAG repeat region and has an HTT allele that is completely complementary to the nucleotide sequence of the oligonucleotide.

22. The oligonucleotide, composition or method described in the present application.