System for regulating gene expression
The polyA aptamer polynucleotide system addresses the issues of sensitivity and leakiness in gene expression regulation by using a 5' splice donor site, engineered intron, and ligand-binding aptamers, achieving precise control of gene expression for therapeutic applications.
Patent Information
- Application Number
- JP2025073295
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-06-24
- Filing Date
- 2025-04-25
- Publication Date
- 2025-08-13
AI Technical Summary
Existing nucleic acid-based constructs for regulating gene expression suffer from low sensitivity and high leakiness, limiting their effectiveness in precise control of gene expression.
A polyA aptamer polynucleotide system is developed, comprising a 5' splice donor site, engineered intron, 3' splice acceptor sites, ligand-binding aptamers, and a polyA switch with cleavage signals, which utilizes alternative splicing to regulate gene expression.
The system enhances sensitivity and reduces leakiness, enabling precise control of gene expression in response to specific ligands, suitable for applications in diabetes management, cancer biomarker detection, and therapeutic gene delivery.
Smart Images

Figure 2025118711000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 894,611, filed August 30, 2019, U.S. Provisional Application No. 62 / 904,635, filed September 23, 2019, and U.S. Provisional Application No. 63 / 043,504, filed June 24, 2020, the contents of each of which are incorporated herein by reference in their entirety.
[0002] Government Licensing Rights This invention was made with government support under EB013584 awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]
[0003] Nucleic acid-based constructs for regulating gene expression can be improved by increasing sensitivity and reducing leakiness. Summary of the Invention [Means for solving the problem]
[0004] The present disclosure recognizes the discovery of nucleic acid constructs associated with regulatable gene product expression. In some embodiments, the present disclosure provides compositions and methods for regulating gene expression using the nucleic acid constructs. In some embodiments, the present disclosure recognizes the utility of alternative splicing in regulating gene expression in nucleic acid constructs. In some embodiments, the present disclosure recognizes the utility of utilizing ligand-binding aptamers to regulate gene expression.
[0005] In some embodiments, the present disclosure provides a system for regulating gene expression comprising a polyA aptamer polynucleotide comprising, in a 5' to 3' direction, a 5' splice donor site, an engineered intron, a first 3' splice acceptor site, two or more ligand-binding aptamers having one or more ligand-binding pockets and a polyA switch comprising at least one polyA cleavage signal therein, a second 3' splice acceptor site, and a nucleic acid sequence encoding an expressible polypeptide.
[0006] In some embodiments, the polyA aptamer polynucleotide of the present disclosure comprises two ligand-binding aptamers. In some embodiments, the polyA aptamer polynucleotide comprises three ligand-binding aptamers. In some embodiments, the polyA aptamer polynucleotide comprises a polyA switch comprising a three-way junction. In some embodiments, the three-way junction comprises a junction of one or more RNA double-stranded stems. In some embodiments, a portion of the three-way junction is single-stranded. In some embodiments, the RNA double-stranded stem comprises a ligand-binding aptamer. In some embodiments, the nucleic acid sequence encoding the expressible polypeptide comprises a 5'UTR.
[0007] In some embodiments, the present disclosure provides a method for regulating expression of a gene product in a cell. The method includes introducing into the cell a system comprising, in a 5' to 3' direction, a 5' splice donor site, an engineered intron, a first 3' splice acceptor site, two or more ligand-binding aptamers having one or more ligand-binding pockets, a polyA switch comprising at least one polyA cleavage signal therein, and a second 3' splice acceptor site. In some embodiments, the gene product expressed by the methods described herein is exogenous to the cell. In some embodiments, the gene product expressed by the methods described herein is endogenous to the cell. In some embodiments, the methods provided by the disclosure occur in one or more cells of an individual, the ligand is glucose, the individual has diabetes, prediabetes, or a diabetic complication, and / or the expressible polynucleotide is insulin. In some embodiments, the methods provided by the disclosure occur in one or more cells of an individual, the expressible polynucleotide is a therapeutic gene product, such as human growth hormone, clotting factor X, or dystrophin. In some embodiments, the methods provided by the present disclosure occur in one or more cells of an individual, wherein the ligand is a gene product of a cancer biomarker and the expressible polynucleotide is a suicide gene. In some embodiments, the methods provided by the present disclosure occur in an individual, wherein the expressible polynucleotide is a reporter gene, and the location and / or intensity of expression of the reporter gene provides information regarding the spatial distribution, temporal variation, or both, of the ligand in one or more cells of the individual. In some embodiments, the methods provided by the present disclosure occur in an individual, tissue, or cell, wherein the expressible polynucleotide encodes a detectable gene product, and wherein each individual, tissue, or cell is imaged. [Brief explanation of the drawings]
[0008] [Figure 1](FIG. 1A) Provides a schematic diagram of an embodiment of a polyA aptamer polynucleotide described herein. The mechanism of a "hybrid" switch based on ligand-induced alternative splicing and polyA signal cleavage is shown. (FIG. 1B) Provides a schematic diagram of an embodiment of a polyA aptamer polynucleotide described herein. The organization of a Y-shaped polyA switch is shown. The names of the different parts of the Y-shaped structure are labeled. [Figure 1C-1] 1 provides a schematic diagram of an embodiment of a polyA aptamer polynucleotide described herein, showing the configuration of a representative Y-shaped polyA switch, Y196CAA. [Figure 1C-2] Same as above. [Figure 1C-3] Same as above. [Figure 2A-1] Figures 2A and 2B show the results of additional Y-shaped structures with different configurations and polyA cleavage signals positioned at different positions. The polyA signal is indicated by a red line. The three-way junction is indicated by a box. Figures 2A and 2B show alternative Y-shaped configurations with three aptamers (aptamers A, B, and C) arranged differently around the three-way junction. Figure 2C shows three aptamers stacked on top of each other without a three-way junction. [Figure 2A-2] Same as above. [Figure 2A-3] Same as above. [Figure 2B-1] Figures 2A and 2B show the results of additional Y-shaped structures with different configurations and polyA cleavage signals positioned at different positions. The polyA signal is indicated by a red line. The three-way junction is indicated by a box. Figures 2A and 2B show alternative Y-shaped configurations with three aptamers (aptamers A, B, and C) arranged differently around the three-way junction. Figure 2C shows three aptamers stacked on top of each other without a three-way junction. [Figure 2B-2] Same as above. [Figure 2B-3] Same as above. [Figure 2C-1]Figures 2A and 2B show the results of additional Y-shaped structures with different configurations and polyA cleavage signals positioned at different positions. The polyA signal is indicated by a red line. The three-way junction is indicated by a box. Figures 2A and 2B show alternative Y-shaped configurations with three aptamers (aptamers A, B, and C) arranged differently around the three-way junction. Figure 2C shows three aptamers stacked on top of each other without a three-way junction. [Figure 2C-2] Same as above. [Figure 2C-3] Same as above. [Figure 2C-4] Same as above. [Figure 3A-1] Figure 3 shows the results of varying the number of polyA cleavage signals in the polyA aptamer polynucleotides described herein. Figure 3A shows two polyA signals (red boxes) located on two different stems. Figure 3B shows only one polyA signal partially embedded in arm 1-2. Figure 3C shows two polyA signals (red boxes) embedded in arm 1-2. [Figure 3A-2] Same as above. [Figure 3A-3] Same as above. [Figure 3A-4] Same as above. [Figure 3A-5] Same as above. [Figure 3B-1] Figure 3 shows the results of varying the number of polyA cleavage signals in the polyA aptamer polynucleotides described herein. Figure 3A shows two polyA signals (red boxes) located on two different stems. Figure 3B shows only one polyA signal partially embedded in arm 1-2. Figure 3C shows two polyA signals (red boxes) embedded in arm 1-2. [Figure 3B-2] Same as above. [Figure 3B-3] Same as above. [Figure 3C-1]Figure 3 shows the results of varying the number of polyA cleavage signals in the polyA aptamer polynucleotides described herein. Figure 3A shows two polyA signals (red boxes) located on two different stems. Figure 3B shows only one polyA signal partially embedded in arm 1-2. Figure 3C shows two polyA signals (red boxes) embedded in arm 1-2. [Figure 3C-2] Same as above. [Figure 3C-3] Same as above. [Figure 4A]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4B-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4B-2] Same as above. [Figure 4C-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4C-2] Same as above. [Figure 4C-3] Same as above. [Figure 4C-4] Same as above. [Figure 4D-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4D-2] Same as above. [Figure 4D-3] Same as above. [Figure 4D-4] Same as above. [Figure 4E]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4F-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4F-2] Same as above. [Figure 4F-3] Same as above. [Figure 4F-4] Same as above. [Figure 4G-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4G-2] Same as above. [Figure 4G-3] Same as above. [Figure 4G-4] Same as above. [Figure 4H-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4H-2] Same as above. [Figure 4H-3] Same as above. [Figure 4H-4] Same as above. [Figure 4I-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4I-2] Same as above. [Figure 4I-3] Same as above. [Figure 4J-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4J-2] Same as above. [Figure 4J-3] Same as above. [Figure 4K-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4K-2] Same as above. [Figure 4K-3] Same as above. [Figure 4K-4] Same as above. [Figure 4L-1]
[0033] Figure 4L shows the results of three-way junction modifications of polyA aptamer polynucleotides described herein. Figure 4L shows the best three-way junction sequence. [Figure 4L-2] Same as above. [Figure 4L-3] Same as above. [Figure 4L-4] Same as above. [Figure 5-1] 1 shows the consequences of modifying the polyA signal relative to the location of the three-way junction of the polyA aptamer polynucleotide described herein. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 6A-1]
[0033] Figure 6A shows the results of modifying the third double-stranded stem (designated arms 3-1 and 3-2 in Figure 1B) of the polyA aptamer polynucleotide described herein. Figure 6A shows the results of modifying arm 3-1. Figure 6B shows the results of modifying arm 3-2. [Figure 6A-2] Same as above. [Figure 6A-3] Same as above. [Figure 6A-4] Same as above. [Figure 6B-1]
[0033] Figure 6A shows the results of modifying the third double-stranded stem (designated arms 3-1 and 3-2 in Figure 1B) of the polyA aptamer polynucleotide described herein. Figure 6A shows the results of modifying arm 3-1. Figure 6B shows the results of modifying arm 3-2. [Figure 6B-2] Same as above. [Figure 6B-3] Same as above. [Figure 6B-4] Same as above. [Figure 6B-5] Same as above. [Figure 6B-6] Same as above. [Figure 6B-7] Same as above. [Figure 6B-8] Same as above. [Figure 7A-1]
[0033] Figure 7A shows the results of modifying the second double-stranded stem (designated arms 2-1 and 2-2 in Figure 1B) of the polyA aptamer polynucleotide described herein. Figure 7A shows the results of modifying arm 2-2. Figure 7B shows the results of modifying arm 2-1. [Figure 7A-2] Same as above. [Figure 7A-3] Same as above. [Figure 7A-4] Same as above. [Figure 7B-1]
[0033] Figure 7A shows the results of modifying the second double-stranded stem (designated arms 2-1 and 2-2 in Figure 1B) of the polyA aptamer polynucleotide described herein. Figure 7A shows the results of modifying arm 2-2. Figure 7B shows the results of modifying arm 2-1. [Figure 7B-2] Same as above. [Figure 7B-3] Same as above. [Figure 7B-4] Same as above. [Figure 7B-5] Same as above. [Figure 7B-6] Same as above. [Figure 7B-7] Same as above. [Figure 7B-8] Same as above. [Figure 7B-9] Same as above. [Figure 7B-10] Same as above. [Figure 7B-11] Same as above. [Figure 7B-12] Same as above. [Figure 8-1] 1B shows the results of modifying the top of the first double-stranded stem (designated arm 1-2 in FIG. 1B) of the polyA aptamer polynucleotide described herein. [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 8-4] Same as above. [Figure 8-5] Same as above. [Figure 8-6] Same as above. [Figure 8-7] Same as above. [Figure 8-8] Same as above. [Figure 8-9] Same as above. [Figure 8-10]Same as above. [Figure 8-11] Same as above. [Figure 8-12] Same as above. [Figure 8-13] Same as above. [Figure 8-14] Same as above. [Figure 8-15] Same as above. [Figure 8-16] Same as above. [Figure 8-17] Same as above. [Figure 8-18] Same as above. [Figure 8-19] Same as above. [Figure 9-1] 1B shows the results of modifying the lower portion of the first double-stranded stem (designated arm 1-1 in FIG. 1B) of the polyA aptamer polynucleotide described herein. [Figure 9-2] Same as above. [Figure 10A]
[0033] Figure 10 shows the results of altering the orientation of the aptamers of the polyA aptamer polynucleotides described herein. Figure 10A shows the results when the orientation of aptamer B is reversed. Figure 10B shows the results when the orientation of aptamer A is reversed. [Figure 10B-1]
[0033] Figure 10 shows the results of altering the orientation of the aptamers of the polyA aptamer polynucleotides described herein. Figure 10A shows the results when the orientation of aptamer B is reversed. Figure 10B shows the results when the orientation of aptamer A is reversed. [Figure 10B-2] Same as above. [Figure 10B-3] Same as above. [Figure 11A-1] Figure 11 shows the contribution of each aptamer in the polyA aptamer polynucleotide described herein. Figure 11A shows the effect of inactivating each aptamer by point mutations A to C (indicated by arrows). Figure 11B shows the effect of deleting aptamer A on induction. [Figure 11A-2] Same as above. [Figure 11A-3] Same as above. [Figure 11B-1]Figure 11 shows the contribution of each aptamer in the polyA aptamer polynucleotide described herein. Figure 11A shows the effect of inactivating each aptamer by point mutations A to C (indicated by arrows). Figure 11B shows the effect of deleting aptamer A on induction. [Figure 11B-2] Same as above. [Figure 11B-3] Same as above. [Figure 12A] 1 shows the results of modifying the 5'UTR of an expressible polynucleotide following a polyA aptamer polynucleotide as described herein. The results of inserting CAA repeats (underlined) into the 5'UTR of an expressible polynucleotide are shown using different parental constructs. [Figure 12B] 1 shows the results of modifying the 5'UTR of an expressible polynucleotide following a polyA aptamer polynucleotide as described herein. 1 shows the results of testing new 5'UTR sequences with strong 3' splice sites using S56 as the parent construct. [Figure 12C] 1 shows the results of modifying the 5'UTR of an expressible polynucleotide following a polyA aptamer polynucleotide described herein, inserting an unstructured spacer sequence into the 5'UTR of Y305 and Y300. [Figure 12D] 1 shows the results of modifying the 5'UTR of an expressible polynucleotide following a polyA aptamer polynucleotide as described herein, showing the insertion of a CAA repeat before the 3' splice site in the 5'UTR. [Figure 13]
[0023] Figure 1 shows the importance of the G-quad sequence in the polyA aptamer polynucleotides described herein. (A) shows the effect of the G-quad sequence on induction using Y196CAA as the parent construct. (B) shows the results of testing different G-quad sequences to replace the 4MAZ G-quad using S56 as the parent construct. [Figure 14]Figure 1 shows confirmation of tetracycline-induced alternative splicing of the polyA aptamer polynucleotide described herein. In the absence of Tc, the IVS2 spliced RNA is degraded by polyA cleavage (lanes 1 and 3). The presence of Tc induces alternative splicing in both Y196CAA-2MAZ and Y196CAA-4MAZ (lanes 2 and 4). Ligand-induced alternative splicing is much more pronounced in the presence of 4MAZ. [Figure 15A-1] Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15A-2] Same as above. [Figure 15A-3] Same as above. [Figure 15B]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15C-1]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15C-2] Same as above. [Figure 15C-3] Same as above. [Figure 15C-4] Same as above. [Figure 15C-5] Same as above. [Figure 15C-6] Same as above. [Figure 15D-1]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15D-2] Same as above. [Figure 15D-3] Same as above. [Figure 15D-4] Same as above. [Figure 15D-5] Same as above. [Figure 15E]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15F-1]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 15F-2] Same as above. [Figure 15G]Figure 15A shows the results of modifying the first 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 15A shows the results of moving the 3' splice site of IVS2 into arm 1-1 of Y196CAA-4MAZ. Figure 15B shows that completely embedding the first 3' splice site in arm 1-1 near aptamer A (red arrow) strongly inhibits induction, resulting in very low induction. Reducing the clamping effect of aptamer A by deleting part of its sequence restores induction. Figure 15C shows the results of moving the 3' splice site of IVS (blue box) along arm 1 of S9m, and Figure 15D shows the results of placing the 3' splice site of IVS in the bulge of arm 1-2. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Figure 15F shows the results of moving the 3' splice site of miniIVS2 further into or away from aptamer A within arm 1-1. Figure 15G shows randomization of three bases after the first 3' splice site (CAGNNN). [Figure 16A] Figure 16A shows the results of modifying the second 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 16A shows the results of modifying the 5'UTR to change the strength of the alternative 3' splice site. Figure 12B shows the results of randomizing three bases after "TAG" in the 5'UTR (TAGNNN) to adjust the strength of the alternative 3' splice site to improve induction. Figure 12C shows the results of incorporating the best TAGNNN sequence selected from the randomization into the 5'UTR of Y329. [Figure 16B]Figure 16A shows the results of modifying the second 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 16A shows the results of modifying the 5'UTR to change the strength of the alternative 3' splice site. Figure 12B shows the results of randomizing three bases after "TAG" in the 5'UTR (TAGNNN) to adjust the strength of the alternative 3' splice site to improve induction. Figure 12C shows the results of incorporating the best TAGNNN sequence selected from the randomization into the 5'UTR of Y329. [Figure 16C] Figure 16A shows the results of modifying the second 3' splice acceptor site of the polyA aptamer polynucleotide described herein. Figure 16A shows the results of modifying the 5'UTR to change the strength of the alternative 3' splice site. Figure 12B shows the results of randomizing three bases after "TAG" in the 5'UTR (TAGNNN) to adjust the strength of the alternative 3' splice site to improve induction. Figure 12C shows the results of incorporating the best TAGNNN sequence selected from the randomization into the 5'UTR of Y329. [Figure 17A-1] 10 shows the results of modifying the size of an engineered intron of a polyA aptamer polynucleotide described herein. 11 shows the results of altering the size and splicing elements of the IVS2 intron. [Figure 17A-2] Same as above. [Figure 17B] 1 shows the results of modifying the size of the engineered intron of the polyA aptamer polynucleotide described herein. 1 shows the results of removing CAA repeats from the construct (S159, S164, and S169) using a shorter engineered intron. [Figure 18A-1]
[0023] Figure 1 shows the results of inclusion of an upstream open reading frame (μORF) in a polyA aptamer polynucleotide as described herein. A schematic diagram of the inclusion of an upstream open reading frame within a polyA aptamer is shown. The inserted upstream ATG start codon is boxed. [Figure 18A-2] Same as above. [Figure 18A-3] Same as above. [Figure 18B]1 shows the results of inclusion of an upstream open reading frame (μORF) in a polyA aptamer polynucleotide as described herein. 2 shows the results of fine-tuning the 5′UTR sequence of a construct with an upstream open reading frame. [Figure 18C-1] 1 shows the results of inclusion of an upstream open reading frame (μORF) in a polyA aptamer polynucleotide as described herein. 1 shows one representative hybrid switch containing an upstream open reading frame. [Figure 18C-2] Same as above. [Figure 18C-3] Same as above. [Figure 19A] Figure 19 shows the ability of the polyA aptamer polynucleotides described herein to control gene expression of an expressible polypeptide in the presence of a ligand. Figure 19A shows the performance of a representative S-series construct versus Y196CAA-4MAZ. Figure 19B shows the dose response of a representative S-series construct versus Y196CAA-4MAZ as visualized by microscopy. Figure 19C shows the performance of Y300 and Y301. Figure 19D shows the dose response of Y362 and Y367 as determined by luciferase reporter assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline. [Figure 19B]Figure 19 shows the ability of the polyA aptamer polynucleotides described herein to control gene expression of an expressible polypeptide in the presence of a ligand. Figure 19A shows the performance of a representative S-series construct versus Y196CAA-4MAZ. Figure 19B shows the dose response of a representative S-series construct versus Y196CAA-4MAZ as visualized by microscopy. Figure 19C shows the performance of Y300 and Y301. Figure 19D shows the dose response of Y362 and Y367 as determined by luciferase reporter assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline. [Figure 19C] Figure 19 shows the ability of the polyA aptamer polynucleotides described herein to control gene expression of an expressible polypeptide in the presence of a ligand. Figure 19A shows the performance of a representative S-series construct versus Y196CAA-4MAZ. Figure 19B shows the dose response of a representative S-series construct versus Y196CAA-4MAZ as visualized by microscopy. Figure 19C shows the performance of Y300 and Y301. Figure 19D shows the dose response of Y362 and Y367 as determined by luciferase reporter assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline. [Figure 19D]Figure 19 shows the ability of the polyA aptamer polynucleotides described herein to control gene expression of an expressible polypeptide in the presence of a ligand. Figure 19A shows the performance of a representative S-series construct versus Y196CAA-4MAZ. Figure 19B shows the dose response of a representative S-series construct versus Y196CAA-4MAZ as visualized by microscopy. Figure 19C shows the performance of Y300 and Y301. Figure 19D shows the dose response of Y362 and Y367 as determined by luciferase reporter assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline. [Figure 19E] Figure 19 shows the ability of the polyA aptamer polynucleotides described herein to control gene expression of an expressible polypeptide in the presence of a ligand. Figure 19A shows the performance of a representative S-series construct versus Y196CAA-4MAZ. Figure 19B shows the dose response of a representative S-series construct versus Y196CAA-4MAZ as visualized by microscopy. Figure 19C shows the performance of Y300 and Y301. Figure 19D shows the dose response of Y362 and Y367 as determined by luciferase reporter assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline. [Figure 20] 1 illustrates the ability of the polyA aptamer polynucleotides described herein to function as endogenous switches that control the expression of endogenous genes in the genome. [Figure 21-1] Figure 1 shows the construction of a Y-shaped polyA switch combining three single base changes. The Y387 construct shown here contains all three changes. [Figure 21-2] Same as above. [Figure 21-3] Same as above. [Figure 22] This shows that the combination of three single base changes significantly increases the inducible expression of an expressible polypeptide at low drug concentrations. Four different parental constructs (Y359, Y360, Y361, Y362C) were used to demonstrate the effect of single base changes on induction. The effect of these single base changes on induction is similar across all four different parental constructs. The top panel shows the fold induction with standard deviation. The bottom panel plots the fold induction for each construct. [Figure 23] Dose-response analysis of expression induction from constructs Y362 and Y386, which contain a Y-shaped polyA switch combining three single base changes. (A) shows that induction by tetracycline reaches 50% of the maximum level (EC50) at levels as low as 0.5–1 μg / ml of Tc, using the maximum induction fold as the EC100 reference. (B) shows a similar calculation using the maximum expression level of the parent construct (HDM-Luc, which has a similar sequence but lacks the Y-shaped structure) as the EC100 reference. In this case, the EC50 is reached at low tetracycline levels of 0.5–1.2 μg / ml. DETAILED DESCRIPTION OF THE INVENTION
[0009] Detailed Description of Specific Embodiments In some embodiments, the present disclosure provides compositions and methods for regulatable gene product expression. In some embodiments, the compositions and methods for regulatable gene product expression comprise a polyA aptamer polynucleotide. In some embodiments, the polyA aptamer polynucleotide comprises, inter alia, one or more splice donor sites, one or more splice acceptor sites, an engineered intron, a polyA switch, and a nucleic acid sequence encoding an expressible polypeptide. In some embodiments, the polyA switch comprises at least one ligand-binding aptamer. In some embodiments, the polyA switch comprises at least one polyA cleavage signal. In some embodiments, the polyA aptamer polynucleotide comprises an RNA double-stranded stem.
[0010] Aptamers Aptamers are short RNA sequences that fold like receptors and bind to specific ligands. Efficient in vitro evolution methods for generating aptamers with high affinity for specific ligands are well established. The binding affinity of aptamers can often reach the nanomolar range, comparable to that of antibodies. In this respect, aptamers can be considered RNA-based antibodies. What distinguishes aptamers from antibodies is their small size (often less than 50 bases) and modular nature. These features allow aptamers to integrate with and regulate other RNA structures without losing their binding function. Aptamers have been demonstrated to transform self-cleaving RNA ribozymes into ligand-dependent molecules, functioning like molecular switches in vitro and in cells.
[0011] In some embodiments, a polyA aptamer polynucleotide comprises one or more RNA double-stranded stems. In some embodiments, an RNA double-stranded stem is a nucleic acid structure formed by intramolecular base pairing of complementary nucleic acids contained within a single polyA aptamer polynucleotide. In some embodiments, an RNA double-stranded stem may also be referred to as an arm. In some embodiments, a polyA aptamer polynucleotide comprises one or more RNA double-stranded stems. In some embodiments, a polyA aptamer polynucleotide comprises two RNA double-stranded stems. In some embodiments, a polyA aptamer polynucleotide comprises three RNA double-stranded stems. In some embodiments, an RNA double-stranded stem comprises a ligand-binding aptamer. In some embodiments, a polyA aptamer polynucleotide comprises two ligand-binding aptamers. In some embodiments, a polyA aptamer polynucleotide comprises three ligand-binding aptamers.
[0012] In some embodiments, at least two RNA double-stranded stems are linked to form a junction. In some embodiments, the junction of the RNA double-stranded stems comprises a single-stranded region. In some embodiments, three RNA stems are associated to form a three-way junction. In some embodiments, the three-way junction comprises at least one single-stranded region. In some embodiments, the three-way junction comprises one, two, or three single-stranded regions.
[0013] In some embodiments, the sequence of the double-stranded RNA stem is selected from one of the following: [Table 1]
[0014] In some embodiments, the single-stranded region formed by the junction of the RNA double-stranded stems comprises at least one nucleic acid. In some embodiments, the single-stranded region formed by the junction of the RNA double-stranded stems comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleic acids. In some embodiments, the three-way junction comprises first, second, and third single-stranded regions. In some embodiments, the first single-stranded region comprises at least one base selected from C and A. In some embodiments, the second single-stranded region comprises at least one base selected from C and A.
[0015] In some embodiments, the RNA double-stranded stem is 30, 20, 10, or 5 base pairs in length. In some embodiments, the RNA double-stranded stem is 5-30, 10-30, 20-30, 5-10, 5-20, 5-30, or 10-20 base pairs in length. In some embodiments, the RNA double-stranded stem is up to 30 base pairs in length. In some embodiments, the RNA double-stranded stem is less than 30, 20, or 10 base pairs in length.
[0016] In some embodiments, the polyA aptamer polynucleotide comprises one or more aptamers. In some embodiments, the polyA aptamer polynucleotide comprises two aptamers. In some embodiments, the polyA aptamer polynucleotide comprises three aptamers. In some embodiments, the aptamer comprised in the polyA aptamer polynucleotides described herein comprises at least one single-stranded region and at least one aptamer RNA double-stranded stem. In some embodiments, the aptamer RNA double-stranded stem comprises a single-stranded region. In some embodiments, the aptamer RNA comprises [ka] (e.g., arm 2-2). In some embodiments, the aptamer RNA has an RNA double-stranded stem having the sequence: [ka] (e.g., 3-2) In some embodiments, the aptamer RNA has an RNA double-stranded stem with a length ranging from 6 to 10, 7 to 11, 8 to 12, 9 to 13, or 10 to 14 base pairs.
[0017] Poly(A) cleavage signal According to various embodiments, any of a variety of poly A signals (e.g., encoded by poly A signal sequences) may be used. By way of non-limiting example, poly A signal sequences used in mammalian cells include: AAUAAA, AUUAAA, AGUAAA, ACUAAA, UAUAAA, CAUAAA, GAUAAA, AAUAUA, AAUACA, and AAUAGA. In some embodiments, the poly A switch may include two or more poly A signal sequences (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more).
[0018] Polyadenylation is a fundamental mRNA processing mechanism present in all mammalian cells. Typically, mammalian polyA signals are found in the 3' untranslated region (UTR). In contrast, the present disclosure provides compositions and methods comprising a polyA cleavage signal present in an expression construct at a location other than the 3' untranslated region (UTR) of an expressible polynucleotide, such as a gene. When a polyA signal is artificially created in a 5' UTR, which is not normally found in cells, efficient cleavage of the polyA signal results in the addition of a polyA tail at that site. This results in the removal and degradation of the second half of the mRNA associated with the transgene sequence, thus resulting in loss of gene expression. In some embodiments, the polyA signal is present upstream of the translation start site of a nucleic acid sequence encoding an expressible polynucleotide (mRNA) that encodes an expressed polypeptide. In some embodiments, the polyA signal is located in the 5' UTR of the mRNA. In some embodiments, the single-stranded region of the three-way junction comprises all or part of the polyA cleavage signal. In some embodiments, the third single-stranded region of the three-way junction comprises all or part of the polyA cleavage signal. In some embodiments, the RNA double-stranded stem comprises all or part of a poly A cleavage signal. In some embodiments, the third RNA double-stranded stem comprises all or part of a poly A cleavage signal. In some embodiments, a portion of a poly A cleavage signal used herein comprises one, two, three, or four nucleotides. In some embodiments, the poly A cleavage signal has the sequence AAUAAA. In some embodiments, the poly A cleavage signal has the sequence AUUAAA, AGUAAA, ACUAAA, UAUAAA, CAUAAA, GAUAAA, AAUAUA, AAUACA, AAUAGA, AAAAAG, or ACUAAA. In embodiments where two or more poly A signals are utilized in the construct, the poly A signals can be the same or different. In certain embodiments, the expressible polynucleotide can be transcribed by RNA polymerase II.
[0019] In some embodiments, the presence of a polyA cleavage signal in the 5' UTR targets the second half of the mRNA after the polyA signal for degradation, and this ability is utilized in various compositions and methods of the disclosure. In some embodiments, the presence of a polyA cleavage signal in the 5' UTR results in cleavage of the pre-mRNA / mRNA encoded by the polyA aptamer polynucleotide. In some embodiments, cleavage of the pre-mRNA / mRNA encoded by the polyA aptamer polynucleotide results in degradation of the second half of the pre-mRNA / mRNA. In some embodiments, cleavage of the pre-mRNA / mRNA encoded by the polyA aptamer polynucleotide does not result in expression of a polypeptide.
[0020] In certain embodiments, the polyA cleavage signal is present in a polyA aptamer polynucleotide that includes at least one ligand-binding aptamer to which one or more ligands can bind. In some embodiments, binding of the ligand to the ligand-binding aptamer determines whether a polyA cleavage signal is present in the pre-mRNA / mRNA after alternative splicing. In some embodiments, binding of the ligand to the ligand-binding aptamer determines whether the pre-mRNA / mRNA is cleaved after alternative splicing. In some embodiments, binding of the ligand to the ligand-binding aptamer determines whether the expressible polypeptide is expressed after alternative splicing.
[0021] Engineered introns In some embodiments, the polyA aptamer polynucleotide comprises an engineered intron. In some embodiments, the engineered intron comprises one or more splice sites. In some embodiments, the splice site is or comprises a splice donor site (e.g., comprising a GU sequence). In some embodiments, the splice site is or comprises a splice acceptor site (e.g., comprising an AG sequence). In some embodiments, the splice sites in the engineered intron (e.g., in conjunction with each other and / or with one or more endogenous splice site(s)) function to excise the engineered intron from the polyA aptamer polynucleotide.
[0022] In some embodiments, the engineered intron is preceded by a 5' splice donor site. In some embodiments, the polyA aptamer polynucleotide comprises a 5' splice donor site in a region 5' to the engineered intron. In some embodiments, the polyA aptamer polynucleotide comprises a first 3' splice acceptor site 3' to the engineered intron. In some embodiments, the engineered intron of the polyA aptamer polynucleotides described herein comprises a 5' splice donor site and a first 3' splice acceptor site. In some embodiments, the polyA aptamer polynucleotide comprises a nucleic acid sequence encoding an expressible polypeptide. In some embodiments, the polyA aptamer polynucleotide comprises a second 3' splice acceptor site immediately 5' to the nucleic acid sequence encoding the expressible polypeptide.
[0023] In some embodiments, the polyA aptamer polynucleotide comprises a promoter 5' to the splice donor site. Exemplary promoters include, for example, CMV, E1F, VAV, TCRv beta, MCSV, SV40 promoter, RSV promoter, and PGK promoter.
[0024] In some embodiments, in the absence of a ligand bound to the ligand-binding aptamer, splicing of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein occurs between the 5' splice donor site and the first 3' splice acceptor site. In some embodiments, splicing between the 5' splice donor site and the first 3' splice acceptor site of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein results in an mRNA comprising a polyA cleavage signal before the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide. In some embodiments, the presence of a polyA cleavage signal before the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide results in cleavage at the polyA cleavage site and degradation of the sequence encoding the expressible polypeptide.
[0025] In some embodiments, in the presence of a ligand bound to a ligand-binding aptamer, splicing of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein occurs between the 5' splice donor site and the second 3' splice acceptor site. In some embodiments, splicing of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein between the 5' splice donor site and the second 3' splice acceptor site results in an mRNA comprising a nucleic acid sequence encoding an expressible polypeptide. In some embodiments, splicing of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein between the 5' splice donor site and the second 3' splice acceptor site results in removal of the polyA cleavage signal by splicing it out. In some embodiments, splicing of a pre-mRNA encoded by a polyA aptamer polynucleotide described herein between the 5' splice donor site and the second 3' splice acceptor site results in expression of an expressible polypeptide.
[0026] In some embodiments, the polyA aptamer polynucleotide comprises two or more ligand-binding aptamers. In some embodiments, each of the two or more ligand-binding aptamers binds to a different ligand. In some embodiments, the polyA aptamer polynucleotide comprises two or more distinct polyA switches. In some embodiments, a first polyA switch comprises a first aptamer that binds to a first ligand, and a second polyA switch comprises a second aptamer that binds to a second ligand. In some embodiments, the first and second aptamers are not identical, and the first and second ligands are not identical. In some embodiments, the first and second aptamers are not identical, and the first and second ligands are the same.
[0027] In some embodiments, the engineered intron is any sequence. In some embodiments, the engineered intron is about 100, 200, 300, 400, or 500 nucleotides in length. In some embodiments, the engineered intron is within the range of 100-200, 110-200, 120-200, 130-200, 140-200, 150-200, 160-200, 170-200, or 180-200 bases in length. In some embodiments, the engineered intron is at most 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, or 220 bases in length. In some embodiments, the engineered intron has the following sequence: GTGAGTCTTAAGCCAGCTACCATTCTGCTTTTATTTTATCGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATCTTCATACCTCTTATCTTCCTCTGCAG (SEQ ID NO: 1)
[0028] In some embodiments, the engineered intron has the following sequence: GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTTATCGCCTCTTTGCACC ATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG (SEQ ID NO: 49)
[0029] As used herein, an intron can refer to either a DNA sequence or its corresponding RNA sequence.
[0030] In some embodiments, the polyA aptamer polynucleotide comprises an additional sequence to promote, regulate, or assist polyA signal cleavage within the polyA aptamer polynucleotide. In some embodiments, the polyA aptamer polynucleotide comprises a GU-rich region 5' of the nucleic acid sequence encoding the expressible polypeptide and 3' of the polyA cleavage signal. In some embodiments, the polyA aptamer polynucleotide comprises an additional sequence to promote, regulate, or assist splicing within the polyA aptamer polynucleotide. In some embodiments, the polyA aptamer polynucleotide comprises a nucleic acid triplet sequence that can modulate the strength of alternative splicing. In some embodiments, the nucleic acid triplet sequence is 3' to a second 3' acceptor site in the 5'UTR. In some embodiments, the nucleic acid triplet sequence is 3' to an engineered intron. In some embodiments, the sequence of the nucleic acid triplet sequence comprises any three nucleotides. In some embodiments, the sequence of the nucleic acid triplet sequence comprises TAG, TCT, TTC, TTG, TGA, TGC, TCC, ACA, AAC, ACC, AGC, AGG, CCT, CCC, TTT, TGA, TCT, TAC, CAC, or CAT.
[0031] In some embodiments, the polyA aptamer polynucleotide comprises a GU-rich region 5' of the nucleic acid sequence encoding the expressible polypeptide and 3' of the polyA cleavage signal. In some embodiments, the polyA aptamer polynucleotide comprises a G-rich region 5' of the nucleic acid sequence encoding the expressible polypeptide and 3' of the GU-rich region. In some embodiments, the G-rich region is understood in the art to be a MAZ sequence. In some embodiments, the polyA aptamer polynucleotide comprises one or more G-rich regions. In some embodiments, the polyA aptamer polynucleotide comprises one or more consecutive G-rich regions. In some embodiments, the polyA aptamer polynucleotide comprises one or more MAZ sequences. In some embodiments, the polyA aptamer polynucleotide comprises one or more consecutive MAZ sequences. In some embodiments, the polyA aptamer polynucleotide comprises one, two, three, four, five, or six MAZ sequences. Consecutive MAZ sequences may be separated by one or more spacer sequences. In some embodiments, the sequence of the G-rich region is AACGGGGGAGGGGGAGGAAAGGGGGAGGGGGAGGAAAGGGGGAGGGGGAGGAAAGGGGGAGGGGGAGGGA (SEQ ID NO: 47).
[0032] In some embodiments, the polyA aptamer polynucleotide comprises one or more start codons. In some embodiments, the polyA aptamer polynucleotide comprises one or more out-of-frame start codons. In some embodiments, the out-of-frame start codons are out-of-frame with respect to the coding sequence of a nucleic acid sequence encoding an expressible polypeptide. In some embodiments, the polyA aptamer polynucleotide comprises at least one in-frame start codon. In some embodiments, the polyA aptamer polynucleotide comprises at least one out-of-frame start codon 3' of the first 3' splice acceptor site 3' of the engineered intron.
[0033] Expressible Polypeptides In some embodiments, a polyA aptamer polynucleotide comprises a nucleic acid sequence encoding an expressible polypeptide. In some embodiments, the nucleic acid sequence encoding the expressible polypeptide comprises a 5' UTR. In some embodiments, the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide comprises a 3' splice acceptor site. In some embodiments, the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide comprises a branchpoint and a 3' splice acceptor site. A branchpoint is understood in the art to include the nucleotide or nucleotides involved in initiating nucleophilic attack on the 5' donor splice site. In some embodiments, the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide does not comprise a branchpoint. In some embodiments, the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide comprises a spacer sequence. In some embodiments, the spacer sequence comprises at least one CAA repeat. In some embodiments, the 5' UTR of the nucleic acid sequence encoding the expressible polypeptide has the sequence GCGGCCGCCTTAATTAACAGTGTTCACTAGAGCCAACAACAACAACAACAACAACAACAACAACGACACC (SEQ ID NO: 48).
[0034] In some embodiments, the nucleic acid sequence encoding an expressible polypeptide contemplated by the present disclosure can be any nucleic acid sequence or any gene encoding any polypeptide. In some embodiments, it is a nucleic acid sequence encoding a non-coding RNA. In some embodiments, the nucleic acid sequence encoding an expressible polypeptide contemplated by the present disclosure can be an exogenous nucleic acid. In some embodiments, the nucleic acid sequence encoding an expressible polypeptide contemplated by the present disclosure can be a gene endogenous to the subject into which the polyA aptamer polynucleotide is introduced. In some embodiments, the polyA aptamer polynucleotide of the present disclosure is introduced into a region of the individual's genome where the expression of the gene of interest is regulated. Thus, in some embodiments, the polyA aptamer polynucleotide of the present disclosure can be used to regulate the expression of a gene endogenous to the individual. In some embodiments, the nucleic acid sequence encoding an expressible polypeptide of the polyA aptamer polynucleotide of the present disclosure is an endogenous nucleic acid sequence.
[0035] In some embodiments, the expressible polypeptide is insulin. In some embodiments, the expressible polypeptide is human growth hormone. In some embodiments, the expressible polypeptide is clotting factor X. In some embodiments, the expressible polypeptide is dystrophin. In some embodiments, the expressible polypeptide is a suicide protein. In some embodiments, the suicide protein is a protein that induces cell death. Exemplary suicide proteins include Mixed Lineage Kinase Domain-Like Pseudokinase (MLKL), Receptor-Interacting Serine / Threonine-Protein Kinase 3 (RIPK3), Receptor-Interacting Serine / Threonine-Protein Kinase 1 (RIPK1), Fas-Associated Protein with a Death Domain (FADD) or Gasdermin D (GSDMD), Cysteine-Aspartic Acid Protease, Cysteine Aspartase, or Cysteine-Dependent Aspartate-Directed Protease (Caspase-1 or CASP-1), Caspase-4, Caspase-5, Caspase-12, PYCARD / ASC (PYD and CARD domain containing Fas-Associated Protein with a Death Domain), or variants thereof.
[0036] In some embodiments, the expressible polypeptide is a detectable gene product. In some embodiments, the detectable gene product is a reporter. In some embodiments, the reporter is a protein that can provide a detectable signal and / or includes the ability to generate a detectable signal (e.g., by catalyzing a reaction that converts a compound into a detectable product). The detectable signal can include, for example, fluorescence or luminescence. Detectable signals, methods for detecting them, and methods for incorporating them into reagents (e.g., polypeptides, including reporter proteins) are well known in the art. In some embodiments of any of the aspects, the detectable signal can include signals that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means such as fluorescence, chemiluminescence, or chemiluminescence, or any other suitable means. In some embodiments of any of the aspects, the reporter protein is selected from the group consisting of luciferase, nanoluciferase, beta-lactamase, beta-galactosidase, horseradish peroxidase, alkaline phosphatase, catalase, carbonic anhydrase, green fluorescent protein, red fluorescent protein, cyan fluorescent protein, yellow fluorescent protein, trypsin, proteases, peptides that complement and activate truncated reporter proteins, and kinases.
[0037] In some embodiments, the activity or function of a polyA aptamer polynucleotide of the present disclosure is measured by expression of an expressible polypeptide. In some embodiments, the activity or function of a polyA aptamer polynucleotide of the present disclosure is measured by fold induction. In some embodiments, the fold induction is calculated as the ratio of the expressible polypeptide in the presence of a ligand to the expressible polypeptide in the absence of a ligand. In some embodiments, the fold induction is calculated as the ratio of the expressible polypeptide in the presence of an aptamer to the expressible polypeptide in the presence of a different aptamer. In some embodiments, the fold induction is calculated as the ratio of the expressible polypeptide in the presence of an aptamer comprising at least one splice acceptor site and one splice donor site to the expressible polypeptide in the presence of a different aptamer that does not have a splice site. In some embodiments, the fold induction is calculated as the ratio of the expression of an endogenous gene before introduction of a polyA aptamer polynucleotide to the expression of the endogenous gene after introduction of a polyA aptamer polynucleotide that regulates expression of the same endogenous gene.
[0038] Ligand According to various embodiments, the ligand can be selected to promote the desired end goal of the provided system. Thus, the ligand can be or include a polypeptide, nucleic acid, small molecule, drug, metabolite, or combinations thereof. In some embodiments, the ligand can be or include a cellular metabolite, an abnormal cellular protein, or a protein expressed by a pathogenic organism (e.g., a virus, bacterium, or fungus). For example, in some embodiments, the ligand can be an exogenously administered small molecule so that the administration and function of the system can be easily adjusted as needed in a particular therapeutic context. For example, in some embodiments, the ligand is tetracycline or a derivative thereof. In some embodiments, the ligand can be selected so that expression of the expressible polypeptide occurs in response to a particular biological condition (e.g., infection, tumor formation, high or low glucose), e.g., as a biosensor system capable of detecting one or more intracellular "signatures" within a cell, tissue, or subject. Thus, in some embodiments, the ligand is endogenous to the subject (e.g., an endogenous protein). In some embodiments, the ligand is neomycin or a derivative thereof. In some embodiments, the ligand is theophylline or a derivative thereof. In some embodiments, the ligand is glucose. In some embodiments, the ligand is a cancer biomarker.
[0039] vector In some embodiments, the polyA aptamer polynucleotides of the present disclosure may be introduced by a vector. In some embodiments, the vector may be a viral vector. Suitable viral vectors include, but are not limited to, lentiviral vectors, retroviral vectors, alphavirus, picornal (e.g., polio), vaccinia, adenovirus, adeno-associated virus, herpes virus, and avian pox virus vectors.
[0040] Exemplary Uses Including Treatment According to the present disclosure, polyA aptamer polynucleotides and / or systems comprising one or more polyA aptamer polynucleotides can be used in any of a variety of applications. For example, in some embodiments, polyA aptamer polynucleotides of the present disclosure are used to treat individuals suffering from a disease, e.g., by providing controllable expression of a therapeutic protein encoded by the expressible polynucleotide. In some embodiments, the disease is a deficiency of a specific protein(s) caused by a genetic disorder. In some embodiments, the disease is diabetes, prediabetes, or a diabetic complication. In some embodiments, the disease is cancer. In some embodiments, the disease is muscular dystrophy. In some embodiments, the disease is an inherited factor X deficiency. In some embodiments, polyA aptamer polynucleotides of the present disclosure are provided in combination with other treatments for a disease. In some embodiments, polyA aptamer polynucleotides of the present disclosure are used to induce reprogramming of cells into pluripotent stem cells (induced pluripotent stem cells or iPSCs). In some embodiments, the polyA aptamer polynucleotides of the present disclosure are introduced or administered before, during, or after other treatments for the disease. In some embodiments, the therapeutic protein can be or include insulin, growth hormone, dystrophin, albumin, Factor IX, Oct4, Sox2, Klf4, cMyc, and any combination thereof.
[0041] In some embodiments, a system comprising polyA aptamer polynucleotides may be used to provide information on whether a therapy is effective in a particular subject.In some embodiments where it is desirable to determine whether one or more therapies are effective in a subject, the system can be used in a subject before the therapy is administered, for example, to detect the presence or absence of a specific indicator compound for the therapy, and then, after the therapy is administered one or more times, the system can be used in a subject to detect the presence or absence of a specific indicator compound.In other embodiments, the system is not used to monitor the therapy until the therapy is administered one or more times to a subject, so as to identify the presence or absence of a specific compound that indicates the effectiveness of the therapy.
[0042] In some embodiments, polyA aptamer polynucleotides and / or systems comprising one or more polyA aptamer polynucleotides may be used as biosensors. According to various embodiments, the provided systems may provide spatial and / or temporal information about a particular environment (e.g., intracellular, extracellular, and / or environmental). For example, in some embodiments, a system comprising at least one polyA aptamer polynucleotide may be used to detect one or more specific molecular signatures in a subject and enable the production of a desired expressible polypeptide to achieve a desired biological state in response to the presence of the molecular signature(s). In some embodiments, the molecular signature may be or include the presence of a particular endogenous gene product (e.g., a disease-related gene product / protein), the presence of a toxin, the presence of an exogenous gene product, the presence of a metabolite (e.g., a metabolite from an environmental pollutant), and any combination thereof.
[0043] In some embodiments, a polyA aptamer polynucleotide may comprise one or more reporter moieties (e.g., a reporter gene product, e.g., an imaging reporter). In some embodiments, an expressible polynucleotide comprised in a polyA aptamer polynucleotide encodes a reporter gene product (e.g., a protein). In some embodiments, the reporter gene product may be or may include luciferase, green fluorescent protein, red fluorescent protein, β-galactosidase, infrared fluorescent protein, near-infrared fluorescent protein, opsin, and any combination thereof.
[0044] In some embodiments, systems comprising polyA aptamer polynucleotides can encode both a reporter gene product and a therapeutic gene product. In some such embodiments, expression of the reporter gene product and the therapeutic gene product can be controlled by the same aptamer. In some embodiments, expression of the reporter gene product and the therapeutic gene product can be controlled by different aptamers. [Example]
[0045] This example describes a responsive gene regulation mechanism that harnesses the power of drug-induced alternative splicing to control poly(A) cleavage. Figure 1 provides a depiction of several embodiments of the present disclosure. As shown in Figure 1A, when an engineered short intron (mini-IVS2) and a new poly(A) signal (red) are artificially created in the 5' UTR of a transgene, efficient splicing of the intron and cleavage of the poly(A) signal results in the destruction of the second half of the mRNA and thus the loss of gene expression. Binding of a specific ligand to an engineered aptamer as part of a Y-shaped switch (green) efficiently induces alternative splicing. Ligand-induced alternative splicing results in the removal of the Y-shaped structure and the artificial 5' UTR poly(A) signal. This then results in the preservation of intact mRNA and thus induced gene expression. Note that a second 3' splice site (3'ss) is constructed in the 5' UTR sequence. This 3' splice site is activated only after a ligand (e.g., tetracycline, "Tc") binds to the aptamer. The 4MAZ sequence next to the Y structure is intended to enhance alternative splicing upon ligand binding.
[0046] Figure 1B provides a demonstration of the polyA switch containing the three aptamers described herein. Each aptamer is located on one arm of a Y-shaped RNA structure. This Y-shaped design has several key advantages. It incorporates three aptamers to control a strategically placed polyA signal (pA) at the central three-way junction. This utilizes the combined power of the tetracycline-binding effects generated by the three different aptamers. The Y-shaped structure is compact and requires a short overall sequence to accommodate the three aptamers. The Y-shaped structure is designed to intrinsically fold during RNA biogenesis. The three aptamers are arranged in a forward-forward-reverse orientation to minimize the possibility of alternative folding between aptamers. Furthermore, double-stranded RNA stems longer than 35 bp are known to elicit innate immune responses in cells. Therefore, all stems within the Y structure are significantly shorter than 35 bp to eliminate the innate immune response.
[0047] Figure 1C provides an example nucleic acid sequence (Y196CAA) of the polyA switch described herein. Over 370 constructs were designed and tested to broadly probe the effects of all components of the Y-shaped structure, including (1) the length of each arm, (2) the sequence of each arm, (3) the loops in each arm, and (4) the sequence and size of the central three-way junction where the polyA signal is located. The effects of modifying these components are further described in these non-limiting examples.
[0048] Example 1: Regulation of polyA cleavage signals position Constructs were created to test additional Y-shaped structures with different configurations and polyA cleavage signals positioned at different positions. Four different constructs were created: B1–B4, in which the polyA signal (red) was placed near aptamer C and clamped by a three-way junction (Figure 2A; B1 construct is shown). These showed no or minimal induction. Four additional constructs with polyA signals near the three-way junction were created: T1–T4 (Figure 2B). These also showed minimal or moderate induction. Figure 2C illustrates a polyA switch in which three aptamers are stacked on top of each other without a three-way junction. Minimal induction was observed for this configuration. The specific Y-shaped configuration shown in Figure 1B, in which the polyA signal was placed near the three-way junction, was used for additional testing. In this configuration, the three-way junction bends in a different orientation, providing a unique shape for clamping the polyA signal. The stability of each arm is determined by two factors: the number of base pairs and the composition of the base pairs (eg, GC is more stable than AU or GU pairs).
[0049] Number of poly(A) cleavage signals Tests were conducted to evaluate the optimal number of polyA signals in the Y-shaped structure. Figure 3A shows a test of three structures from the Y series using two polyA signals, indicated by the red boxes. Y1 shows the highest induction of these three constructs, approximately 12-fold. In this group, the majority of arm 3-1 is an AU or GU pair, so a longer stem is required to reach a certain level of stability. As demonstrated in the figure, the arms of the constructs exemplified herein contain double-stranded nucleic acid stems. Shortening arm 3-1 results in lower induction. Figure 3B further illustrates the effect of arm length. Y5 to Y9 contain only one polyA signal (red box) with variable lengths of arm 3-1 (blue box) and arm 2-1 (green box). The lengths of arm 3-1 and arm 2-1 decrease by 1 bp from Y5 to Y9. This single polyA configuration results in better induction. Figure 3C shows that induction is approximately halved when two polyA signals (Y6mut) are present consecutively in arms 1-2. Y6mut: Same as Y6, except that two polyA signals (red boxes) are embedded in arms 1-2. Based on these results, the optimal number and position of polyA signals are determined: a single polyA signal partially embedded in arms 1-2 and at the three-way junction. This configuration is used as the basis for further optimization.
[0050] Example 2: Optimization of a three-way junction Altering the environment of the three-way junction directly affects the clamping of the polyA signal. Therefore, the performance of the Y-shaped switch is highly sensitive to changes in the three-way junction. To identify the best sequence, we performed extensive mutation / insertion / deletion tests around the three-way junction. Figure 4A shows that a U-to-G mutation at Y22 doubles induction, presumably because this mutation creates a new GU base pair on arm 3-1 that tightens the clamping of the polyA signal. Figure 4B provides an example showing the effect of different three-way junction sequences on induction. Figure 4C compares constructs with three base pairs and one base in box 1 of the three-way junction. Y107-Y110 is a derivative of Y79 with three bases in box 1. Y107-Y110 has only one base in box 1. Y107 performs similarly to Y79, indicating that one unpaired base in box 1 is sufficient. Figure 4D shows the results of inserting a single base into box 2 of the three-way junction, which results in a subtle change in folding at the three-way junction. The results suggest that the best configuration is a single unpaired base in box 2. For the construct in Figure 4E, single bases in boxes 1 and 2 were randomized. Sixteen combinations were tested, and the results showed that Y127, Y130, and Y134 were the best among them when compared to the parent Y79 tested on the same day. Figure 4F shows further optimization of the construct using Y130 as the basis. None of the tested modifications resulted in significant improvement. Figure 4G shows additional modifications made to Y143, which resulted in little change in induction. Figure 4H shows additional modifications made to Y147. Y163 slightly improves induction compared to Y147, while Y162 slightly decreases induction. Figure 4I shows additional modifications made to Y163. Y177 improves induction compared to Y163, while Y178 reduces induction. Figure 4J shows the modifications made to Y152. These modifications result in significant improvements compared to Y152. In particular, Y166 nearly doubles induction.Y166 serves as a new base for further optimization. Figure 4K shows additional modifications made to Y166. These modifications result in significant improvements compared to Y166 and also serve as a new base for optimization.
[0051] Y174, Y175, Y176, and Y177 (see Figure 4L) are among the best three-way junction sequences. All of these constructs have a single C or A base in box 1 and box 2. In these constructs, the first three bases of the polyA signal AAUAAA (red box) open into the three-way junction pocket. The last two bases of the polyA signal are embedded in arms 1 and 2.
[0052] Changing the position of the polyA signal relative to the three-way junction pocket can alter the induction ability (Figure 5). In Y135–Y140, the three-way junction pocket is shifted along the polyA signal relative to Y101. As a result, the polyA signal is buried deeper in arm 1–2. These modifications result in lower induction. Y101mut, a derivative of Y101, contains an inverted C–G pair (indicated by a red arrow) in arm 2–1, which removes a potential 3' splice site. Construct Y141–Y159 is based on Y101mut. The three-way junction pocket is shifted along the polyA signal. The induction results of shifting the three-way junction pocket along the polyA signal are shown in the last part of Figure 5.
[0053] Example 3: Double-stranded stem The polyA aptamer polynucleotide constructs described herein comprise a nucleic acid (e.g., RNA) double-stranded stem. Such double-stranded regions are also referred to as arms in this disclosure. Modifications to the length, stability, and nucleotide composition can affect the strength and efficacy of polyA aptamer polynucleotides.
[0054] Previous results (using constructs Y1 to Y9, Figure 3) indicated that the stability of arm 3-1 must be within a certain range. Arm 3 is a very sensitive region because it is very close to the polyA signal. A slight change in the stability of arm 3 can result in significant changes in the polyA signal clamp, leading to induction. Using Y35 as a base, we performed numerous modifications to optimize arm 3. Figures 6A and 6B show the induction variation based on changes in arm 3. In these figures, the parent construct is on the right, and the results of modifications are shown on the left. Figure 6A shows the results of modifications to arm 3-1. Constructs Y43 to Y45, with reduced strength for arm 3-2, are based on Y35. Constructs Y188C and Y189C, with reduced strength for arm 3-2, are based on Y175. Constructs Y188D and Y189D, with reduced strength for arm 3-2, are based on Y176. Constructs Y219A-224A, which have weaker arm 3-2 strength, are based on Y197 by changing GC pairs to GU pairs at various locations. Figure 6B shows the results of modifying arm 3-2. Constructs Y201-Y203 are based on Y175. Constructs Y216B-217B, which have weaker arm 3-2, are based on Y208. The results show that increasing the length of arm 3-2 and altering the loop sequence significantly reduces induction.
[0055] Most of these modifications significantly reduced induction, none more so than Y35. Thus, arm 3 of Y35 represents the optimal arm 3 sequence of the Y-shaped structure among those tested. Several other parent constructs used for arm 3 modifications, such as Y175, Y197, and Y210, all share the same arm 3 sequence of Y35.
[0056] Modifications to the double-stranded stem, Arm 2 (i.e., Arm 2-1 and Arm 2-2), alter the stability of Arm 2. These modifications include length, sequence, and point mutations that create mismatches in the stem (Figure 7). Figure 7A shows the results of modifications to Arm 2-2. Constructs Y48-Y53 are based on Y35. Figure 7B shows the results of Arm 2-1 modifications. These modifications demonstrate that induction is less sensitive to changes in Arm 2 stability than Arm 3. This is presumably because Arm 2 is not directly connected to the polyA signal. Nevertheless, Arm 2 requires a certain level of stability to achieve good induction. An unstable Arm 2 results in very low induction. The Arm 2 sequences shown in these results were determined empirically. Some of the Arm 2 sequences are already within the optimal stability range and represent near-optimal sequences that result in highly efficient induction. Further increases in stability increase or decrease induction.
[0057] Figure 8 shows the results of various modifications of arm 1-2. Figure 9 shows the results of various modifications of arm 1-1.
[0058] Example 4: Aptamer Orientation The orientation of each aptamer relative to other aptamers can have an effect on the function of the polyA aptamer polynucleotide. Figure 10A shows the results for constructs Y54-Y57 based on Y35, in which the orientation of aptamer B is reversed. Reversing the orientation of aptamer B nearly eliminates induction. Figure 10B shows the induction results for constructs Y240-Y252 based on Y196CAA, in which the orientation of aptamer A is reversed. Reversing the orientation of aptamer A completely eliminates induction, regardless of the length of arms 1-2.
[0059] Example 5: Contribution of each aptamer to induction Figure 11A shows the contribution of each aptamer in the Y-shaped structure to induction. Each aptamer in the Y-shaped structure can be disabled by mutations A to C (arrows) within the binding pocket, which eliminates binding to its ligand, tetracycline. NA: Aptamer A is ineffective. NB: Aptamer B is ineffective. NC: Aptamer C is ineffective. NAB: Aptamer A and B are ineffective. NBC: Aptamer B and C are ineffective. NAC: Aptamer A and C are ineffective. These results show that aptamer C contributes most to the final induction, followed by aptamer B and then aptamer A.
[0060] Figure 11B shows the effect of removing aptamer A from the Y-shaped structure. Boxes indicate the sequence removed for each construct. Removing aptamer A significantly reduces levels compared to the parent Y196CAA, but retains moderate induction.
[0061] Example 6: Modification of 5'UTR Figure 12A demonstrates that the level of induction can be altered by inserting CAA repeats (underlined) into the 5'UTR. Here, inserting CAA repeats at Y196, Y208, Y209, and Y211 all results in higher induction. Inserting a spacer sequence containing a CAA repeat into the 5'UTR of Y301 results in variable effects on induction. These spacer sequences, while only slightly different from each other, result in large differences in induction, demonstrating that this region is highly sensitive to alterations. Figure 12B shows several examples of testing new 5'UTR sequences with strong 3' splice sites using S56 as the parent construct. Figure 12C shows the results of adding an essentially unstructured RNA sequence to the 5'UTR near the translation initiation ATG without using a CAA repeat. These constructs are based on Y300 and Y305. Among the Y300-based constructs, Y329 is the most effective. Although it does not outperform Y305, it has the advantage of not using a CAA repeat. Figure 12D shows that the insertion position of the CAA repeat also significantly affects induction.
[0062] Example 7: Importance of G-quad sequences We tested the effect of G-quad sequences on induction. Figure 13A shows that the G-quads of 3MAZ or CD44 reach similar induction levels compared to 2MAZ, which used Y196CAA as the parent. However, 4MAZ dramatically doubled induction due to its ability to effectively induce alternative splicing. Figure 13B shows the induction results when different G-quad sequences were tested to replace the G-quad of 4MAZ using the S56 construct as the parent. In these constructs, 4MAZ is replaced by one CD44 G-quad "TGGTGGTGGAATGGT" (S177), two CD44 G-quads "TGGTGGTGGAATGGTAAATGGTGGTGGAATGGT" (S178), or four CD44 G-quads "TGGTGGTGGAATGGTAAATGGTGGTGGAATGGTAAATGGTGGTGGAATGGTAAATGGTGGTGGAATGGTAAATGGTGGTGGAATGGT" (S179). The results demonstrate that the effect of 4MAZ is unique and cannot be replaced by other G-quad sequences. The 4MAZ sequence has unique properties and is a key element of the hybrid switch, which requires both efficient poly(A) signal cleavage and Tc-induced alternative splicing. Figure 14 further demonstrates the importance of the 4MAZ sequence. RT-PCR revealed the mechanism of drug-induced alternative splicing. In the absence of Tc, the IVS2 spliced RNA is degraded by poly(A) cleavage (lanes 1 and 3). The presence of Tc induces alternative splicing in both Y196CAA-2MAZ and Y196CAA-4MAZ (lanes 2 and 4). Sanger sequencing confirmed that the Tc-induced band (lower band) contains the predicted alternatively spliced RNA junction. Tc-induced alternative splicing is much more pronounced in Y196CAA-4MAZ than in Y196CAA-2MAZ (lane 4 vs. 2). In this induced alternative splicing, both the poly(A) signal and the Y-shaped structure are removed in the presence of Tc, resulting in a significant increase in the induction of protein expression.
[0063] Example 8: Modulation of the first 3' splice acceptor site To further optimize the mechanism of Tc-induced alternative splicing, we extensively probed the effects of the IVS2 3' splice site location and surrounding sequence / structure. Modifications included embedding the IVS2 3' splice site within arm 1, moving the IVS2 3' splice site closer or farther from the aptamer binding site, placing the IVS2 3' splice site within a loose bulge in arm 1, altering the length or stability of arm 1 hosting the IVS2 3' splice site, and altering the splicing strength of the IVS2 3' splice site. Figure 15A shows the results of gradually shifting the IVS2 3' splice site within arm 1 of Y196CAA-4MAZ (S1-S4). It also shows that induction is nearly eliminated when the IVS2 3' splice site is mutated from CAG to CCC (S5). Figure 15B shows that when the 3' splice site of IVS2 is completely buried in arm 1-1 near the Tc-binding pocket of aptamer A (red arrow; S9), this splice site is strongly inhibited, resulting in very low induction. This indicates that the aptamer does not clamp the 3' splice site of IVS2 too tightly. Furthermore, deleting a portion of the aptamer A sequence (S9m) reduces the clamping effect of aptamer A, restoring induction. Moving the 3' splice site of IVS2 along arm 1 of S9m results in S19, which is shorter than the parent S9m but has a similar induction level (Figure 15C). Figure 15D shows the effect on induction when the 3' splice site CAG of IVS2 is positioned within the bulge of arm 1-2. S47–S50 are based on S19. At 1 μg / mL Tc, most of them result in lower induction. At 5 μg / mL Tc, all but S50 result in similar or higher induction than S19. Figure 15E shows the results of changing the predicted strength of splicing by mutating the base after the 3' splice site of IVS2. Altering the strength of the 3' splice site of IVS2 does not significantly change induction in the S9m- and Y196CAA-4MAZ-based constructs. Figure 15F shows the results of moving the 3' splice site of mini-IVS2 further into or away from the stem, all of which result in lower induction.Figure 15G shows the effect of randomizing three bases after the CAG at the 3' splice site of mini-IVS2 to select the best-performing sequence. This group of constructs (particularly Y362, Y366, and Y367) showed superior switching efficiency compared to Y300 and Y301. The best NNN sequences identified by the test were: Y344 base: Y359 (CAT), Y360 (TTT), Y361 (TGA), Y362 (TCT); Y358 base: Y363 (CAT), Y366 (TAC), Y367 (TTT).
[0064] Example 9: Modulation of a second 3' splice acceptor site in the 5' UTR Assays were performed to test the effect of modulating a second strong 3' splice acceptor site in the 5'UTR. The 5'UTR sequence of Y196CAA-4MAZ, located after 4MAZ and before the start codon ATG, has the following sequence: [ka] Adding an additional branch point (S10), ppt (S11), or mutating CAG to CCC (S12) or AAG (S13) all resulted in reduced induction (Figure 16A). To activate the correct 3' splice site (IVS2 3' splice site) in the absence of Tc and in the presence of Tc (second alternative 3' splice site), we used a short intron-primed construct and used a randomization approach to select the best three bases after TAG in the 5' UTR (TAGNNN) to improve induction (Figure 16B). We also inserted these best three bases (NNN) into the 5' UTR of Y329 and evaluated their performance (Figure 16C). Among these, Y344 performed best.
[0065] Example 10: Intron size The effect of reducing the size of the IVS2 intron on the overall size of the hybrid switch was examined. Figure 17A shows an exemplary intron sequence. Construct S164-S168 is similar to S159-S163, but contains the branch point TACTAAC inserted at the same position before the 3' splice site of IVS2. The intron sequence of S164 is shown as an example. [ka] Construct S169-S173 is similar to S159-S163, but has the branch point TACTAAC and an additional 3' splice site CAG inserted at the same position before the 3' splice site of IVS2. The intron sequence of S169 is shown as an example. [ka] Reducing the IVS2 intron size from 476 bases to 120–200 bases significantly reduced induction (Figure 16B). Adding different splicing elements, Y164–Y173, to force IVS2 intron splicing resulted in even lower induction compared to the intron without these elements. This indicates that shortening or adding elements to the IVS2 intron alters the selection of 3' splice site activation in the presence of Tc. Previously, we showed that CAA repeats alter the splicing strength of the 3' splice site in the 5' UTR. Here, CAA repeats (red) are removed from S159, S164, and S169. Compared to S56, S192 (with a 120-base intron) resulted in better induction at 1 μg / mL Tc and similar induction at 5 μg / mL Tc. The more compact S192 intron shortening provides a new base for further modifications.
[0066] Example 11: Addition of an upstream out-of-frame AUG (μORF) Construct S192 was introduced to test the effect of introducing an out-of-frame upstream AUG on reporter gene translation from the IVS2 spliced transcript. The modifications included: (1) changing TAC to ATG immediately after the 3' splice site of IVS2 to create a new start codon (red box), (2) changing the corresponding base on the other side of arm 1 to maintain base pairing in the stem, and (3) mutating the in-frame stop codon tga to aga in arm 2-1 (red arrow), allowing translation from this new ATG to generate a significantly longer protein. See Figure 18A.
[0067] The sequence after the 3' splice site CAG of IVS2 is shown. The new μORF is underlined. [ka] This approach significantly reduces leaky expression from the IVS2 spliced transcript and therefore significantly increases induction, as demonstrated by the results for S206.
[0068] This construct is further optimized by fine-tuning the 5'UTR sequence based on S206 (Figure 18B). All of these constructs show very good induction. These constructs are more compact due to the shorter intron and partially deleted aptamer A, and perform very well at a low Tc concentration of 1 μg / mL, reaching a high induction of approximately 700-fold at 5 μg / mL.
[0069] In summary, in the process of optimizing the effect of Tc on splicing selection between the IVS2 3' splice site and the alternative 3' splice site, we found that the best position for placing the IVS2 3' splice site was to embed it within arm 1 of the Y structure. To place the IVS2 3' splice site in that position, aptamer A was deleted from the Y structure. Creating an upstream out-of-frame AUG (μORF) that eliminates reporter gene translation from the IVS2 spliced transcript reduces leaky expression. Compared to Y196CAA-4MAZ, S222 (Figure 17C) exhibited higher fold induction, higher gene expression levels, and, perhaps more importantly, was highly sensitive to Tc and performed well at low Tc concentrations.
[0070] Structure Performance Figure 19A shows a comparison of the performance of representative S-series constructs to Y196CAA-4MAZ. Figure 18B shows the dose response of expression from hybrid switch constructs visualized by microscopy.
[0071] To avoid potential immunogenicity caused by protein translation of the upstream open reading frame (μORF), we constructed another hybrid switch without the μORF, aiming to surpass the performance of S222. To construct this new hybrid switch, we returned to the Y196CAA-4MAZ design because S222 has three aptamers compared to two. To further improve Y196CAA-4MAZ, we (1) used a 120-base mini-IVS2 intron, (2) optimized the 3' splice site of the mini-IVS2 sequence, and (3) optimized the 5' UTR sequence, including the downstream alternative 3' splice site. These efforts resulted in a group of constructs that outperformed S222 in performance. Tetracycline induction suppressed gene expression to 50% of its maximal level (EC ) at drug concentrations as low as 0.5–1 μg / ml. 50) is so efficient that it induces up to 100% tetracycline levels. This tetracycline concentration can be routinely achieved in human serum using FDA-approved doses and is an order of magnitude lower than previously achieved using any RNA-based gene regulation technology. Figure 19C shows the performance of these new constructs compared to that of S222. The 5'UTR sequence of Y300 is: [ka] Y301: Based on Y300 with modified 5'UTR [ka] Figure 19D shows the performance of Y362 and Y367 as determined by luciferase assay. Figure 19E shows the response of Y362 and Y367 to 1 μg / ml tetracycline as determined by fluorescence-activated cell sorting (FACS) using the eGFP reporter signal. "Fold induction" in all results was calculated as the ratio of transgene expression in the presence versus absence of tetracycline.
[0072] Example 12: Insertion of a riboswitch at an endogenous site When combined with CRISPR, the Y-shaped poly(A) switch creates a powerful technology platform for controlling the expression of any endogenous gene in the mammalian genome. Figure 20 provides a schematic diagram using the stem cell membrane protein CD133 to demonstrate the principle. Conditional gene expression of endogenous CD133 is achieved by inserting the Y196 riboswitch into the 5'UTR of CD133 using CRISPR-Cas9 and a repair matrix. Figure 20A (top): Three gRNAs (g1, g2, and g3) are used to locate CRISPR-Cas9 cleavage near the translation start of CD133. Figure 20A (bottom): A repair matrix containing a mini-CMV promoter, an IVS2 intron, and the Y196 riboswitch flanked by upstream and downstream homologous sequences to CD133 is used for repair. Figure 20B provides a schematic diagram of the experimental procedure. The Y196 riboswitch is first inserted into the parent CD133 by CRISPR-Cas9. - The engineered cells then switched on CD133 expression in a dose-dependent manner in response to Tc. An FITC-conjugated antibody against the CD133 protein was used to label and isolate cells responding to Tc. Figure 19C shows that the conditional expression of endogenous CD133 was regulated by Tc. Expression of CD133 in the engineered cell clone (in this case, 293T cells) showed little or no background leakage. CD133 expression was specifically induced by Tc but not by its analog, Doxy. ND: no drug treatment; Tc: tetracycline; Doxy: doxycycline. Cell clones were treated with or without drugs for 2 days and then harvested for flow analysis. The X-axis indicates the intensity of antibody staining of individual cells. Figure 20D shows that, as expected, CD133 protein induced by Tc (as revealed by FITC-anti-CD133 antibody) was localized to the cell membrane, similar to normal endogenous CD133 protein. Stable cell clones were treated with 2 μg / ml of drug for 2 days or without drug and then harvested for image flow analysis (Amnis). Again, induction is clearly specific to Tc but not to Doxy.
[0073] The data described provide a highly responsive gene regulation mechanism that harnesses the power of drug-induced alternative splicing to control polyA cleavage. The engineered combination creates a sensitive RNA-based switch that can be controlled by small-molecule drugs, enabling tight regulation of gene expression in mammalian cells. In contrast to other reported methods, this hybrid switch technology described herein exhibits very low leaky expression, effectively turning on transgene expression nearly 700-fold in human cells. Furthermore, induction with tetracycline reduces gene expression to 50% of its maximal level (EC ) at drug concentrations as low as 0.5–1 μg / ml. 50 This tetracycline concentration can be routinely achieved in human serum using FDA-approved doses and is an order of magnitude lower than previously achieved using other RNA-based gene regulation technologies.
[0074] This hybrid switch technology is therefore advantageously safe for use in human patients to control the expression of therapeutic genes or transgenes. Thus, the present disclosure fulfills a long-standing need in the art to provide a highly efficient and non-immunogenic technique for regulating genes of interest in cells at drug concentrations that are safe for human consumption.
[0075] Example 13: Combination of single base changes at three positions Combinations of three base changes to the Y-shaped structure were tested to determine their cumulative effect on the induction performance of the polyA aptamer. As shown in Figure 21, the three mutations consisted of an "A" deletion in arm 1-1, an "A" to "G" change to close the unpaired break in arm 2-2, and an "A" insertion at the three-way junction before the polyA signal. These mutations were performed using four different parent constructs with different bases after the mini-IVS2 intron. In total, 12 constructs, listed in Table 1, were designed to probe the cumulative effect. [Table 2]
[0076] Figure 22 demonstrates that the combination of three single base changes significantly increases induction at low drug concentrations. Furthermore, Figures 23A and 23B show dose-response analysis of constructs Y362 and Y387. Y362 and Y387 effectively turn on transgene expression up to 650-700 fold in 293T cells using only 1 μg / ml of tetracycline. For both constructs, induction by tetracycline was observed at EC 100 Using the maximum fold induction as a reference, levels as low as 0.5–1 μg / ml of Tc resulted in 50% of the maximum level (EC 50 ) (Figure 23A). 100 Calculations using the maximum expression level of the parental construct (HDM-Luc, which has a similar sequence but does not have the Y-shaped structure) as a reference also showed similar EC values, as low as 0.5–1.2 μg / ml. 50 The values are shown in Figure 23B. Y387 is the EC 100 EC of 0.5 μg / ml, regardless of reference 50 This is a particularly effective design for showing values.
[0077] Example 14: Methods The assays described in the figures submitted herein were performed as follows:
[0078] Luciferase assay Cells were seeded into 96-well plates at a density of 25,000–30,000 cells / well. After 24 h of incubation, each well was transfected with 50 ng of DNA vector and incubated for an additional 18 h with medium containing either no or various concentrations of tetracycline. Luciferase activity was measured in relative light units (RLU) using a Polarstar Omega plate reader (BMG Labtech, USA). To make 36 mL of assay buffer, 144 μL of 1 M DTT, 108 μL of 0.1 M ATP, 252 μL of 0.1 M luciferin, and 360 μL of 0.05 M CoA were added to 35 mL of base buffer (25 mM tricine, 0.5 mM EDTA-Na, 0.54 mM Na-triphosphate, 16.3 mM MgSO.7H2O, and 0.8% Triton X-100). After removing the cell culture medium, 40 μL of assay buffer was added to each well, and luciferase activity was read in duplicate on a Polarstar Omega plate reader. Fold induction was calculated as the ratio of transgene expression in the presence versus absence of tetracycline.
[0079] RT-PCR Cells transfected with each construct were grown in culture medium in the absence or presence of tetracycline at 37°C for 18 hours. Total RNA was isolated according to the protocol provided with the RiboPure™ RNA Purification Kit (Ambion, Austin, TX). For RT-PCR, RT was performed using SuperScript III (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol, and PCR was performed using primers targeting the start of the transcript and reporter gene.
[0080] Fluorescence microscope Cells were plated in a 12-well plate at 1.2 x 10 5Cells were seeded at a density of 1000 cells / well. After 24 hours of incubation, each well was transfected with 500 ng of DNA vector and incubated for an additional 18 hours with medium containing either no tetracycline or various concentrations of tetracycline. Images were taken at 200x magnification using a fluorescence microscope (Zeiss Axiovert 40CFL).
[0081] Example 15: Exemplary construct sequences The following sequences are additional examples of embodiments of components of the systems described herein: The sequences are provided as DNA sequences when transcribing components of an RNA aptamer. +1: Start of transcription Black: 5' leading RNA sequence Underlined: IVS2 intron or mini-IVS2 intron Bold: Y-shaped Poly-A switch (4MAZ is underlined) Italic: 5'UTR ATG: Bold indicates start of translation [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
change
[0082] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the above description, but rather is as set forth in the following claims. The present invention provides, for example, the following items. (Item 1) A system for regulating gene expression comprising, in a 5' to 3' direction: a) a 5' splice donor site; b) an engineered intron; c) a first 3' splice acceptor site; and d) two or more ligand-binding aptamers having one or more ligand-binding pockets and a polyA switch comprising at least one polyA cleavage signal therein; e) a second 3' splice acceptor site; and f) a nucleic acid sequence encoding an expressible polypeptide, (Item 2) 2. The system of claim 1, wherein the polyA switch comprises two ligand-binding aptamers. (Item 3) 2. The system of claim 1, wherein the polyA switch comprises three ligand-binding aptamers. (Item 4) Item 10. The system of item 1, wherein the polyA switch comprises a three-way junction. (Item 5) 5. The system of item 4, wherein the three-way junction comprises a junction of a first double-stranded RNA stem, a second double-stranded RNA stem, and a third double-stranded RNA stem. (Item 6) 6. The system of item 5, wherein the first double-stranded RNA stem does not comprise a ligand-binding aptamer. (Item 7) 6. The system of claim 5, wherein each of the first, second, and third double-stranded RNA stems comprises a ligand-binding aptamer. (Item 8) 6. The system of item 5, wherein the three-way junction comprises at least one single-stranded region. (Item 9) 9. The system of claim 8, wherein the three-way junction comprises a first single-stranded region, a second single-stranded region, and a third single-stranded region. (Item 10) 10. The system of claim 9, wherein the first single-stranded region is located between the first double-stranded RNA stem and the second double-stranded RNA stem. (Item 11) 10. The system of claim 9, wherein the second single-stranded region is located between the second double-stranded RNA stem and the third double-stranded RNA stem. (Item 12) 10. The system of item 9, wherein the third single-stranded region is located between the third double-stranded RNA stem and the first double-stranded RNA stem of the first aptamer. (Item 13) 2. The system of any one of the preceding items, wherein the first aptamer and second aptamer are in the same orientation in the 5' to 3' direction. (Item 14) The system of any one of the preceding items, wherein a third aptamer is oriented opposite the first and second aptamers in the 5' to 3' direction. (Item 15) 2. The system of item 1, wherein one or more nucleotides of the poly A cleavage signal are within the three-way junction, the third double-stranded RNA stem, the third single-stranded region, or the first double-stranded RNA stem. (Item 16) 16. The system of item 15, wherein the third single-stranded region comprises the first four bases of the poly A cleavage signal. (Item 17) 16. The system of item 15, wherein the first double-stranded RNA stem comprises the last two bases of the polyA cleavage signal. (Item 18) 16. The system of item 15, wherein the first double-stranded RNA stem comprises the entire poly A cleavage signal. (Item 19) Item 4. The system according to item 3, wherein the double-stranded RNA stem between the binding pocket of the third aptamer and the three-way junction is 10 to 15 base pairs in length. (Item 20) Item 11. The system of item 10, wherein the first single-stranded region comprises at least one base selected from C and A. (Item 21) Item 12. The system of item 11, wherein the second single-stranded region comprises at least one base selected from C and A. (Item 22) 6. The system of item 5, wherein the sequence of the second double-stranded RNA stem is SEQ ID NO: 3. (Item 23) Item 6. The system of item 5, wherein the sequence of the third double-stranded RNA stem is SEQ ID NO: 2. (Item 24) 6. The system of item 5, wherein the sequence of the first double-stranded RNA stem is SEQ ID NO: 4. (Item 25) 6. The system of item 5, wherein the sequence of the first double-stranded RNA stem is SEQ ID NO: 5. (Item 26) 2. The system of claim 1, wherein the nucleic acid sequence encoding the expressible polypeptide further comprises a 5' UTR. (Item 27) 27. The system of item 26, wherein the 5'UTR further comprises a CAA repeat. (Item 28) 27. The system of item 26, wherein the 5'UTR further comprises one or more 3' splice acceptor sites. (Item 29) 27. The system of item 26, wherein the engineered 5'UTR has the sequence of SEQ ID NO: 48. (Item 30) 2. The system of claim 1, further comprising a GU-rich region 5' of the nucleic acid sequence encoding the expressible polypeptide and 3' of the poly A cleavage signal. (Item 31) 30. The system of item 29, wherein the 3' acceptor site is followed by a nucleic acid triplet sequence that modulates the strength of alternative splicing. (Item 32) 32. The system of claim 31, wherein the nucleic acid triplet is 3' to a second 3' acceptor site in the 5' UTR and has a sequence selected from TAG, TCT, TTC, TTG, TGA, TGC, TCC, ACA, AAC, ACC, AGC, AGG, CCT, and CCC. (Item 33) 2. The system of claim 1, further comprising a G-rich region 5' of the nucleic acid sequence encoding the expressible polypeptide and 3' of the GU-rich region. (Item 34) Item 34. The system of item 33, wherein the G-rich region comprises four MAZ sequences. (Item 35) 2. The system according to item 1, wherein the engineered intron has a sequence of 100 to 200 bases in length. (Item 36) Item 1, wherein the engineered intron has the sequence of SEQ ID NO: 1. (Item 37) 2. The system of item 1, wherein the engineered intron is followed by a nucleic acid triplet sequence that regulates the strength of intron splicing. (Item 38) 38. The system of item 37, wherein the nucleic acid triplet sequence is selected from TTT, TGA, TCT, TAC, CAC, and CAT. (Item 39) Item 1, wherein the system comprises a sequence selected from the group consisting of SEQ ID NO: 6 to SEQ ID NO: 56. The system described. (Item 40) 40. The system of item 39, wherein the system comprises a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56. (Item 41) A vector for delivery of the system according to item 1. (Item 42) 42. The vector according to item 41, wherein the vector is a viral vector. (Item 43) 43. The vector according to item 42, wherein the vector is selected from an adenoviral vector, a lentiviral vector, an adeno-associated viral vector, a polioviral vector, and a retroviral vector. (Item 44) 1. A method for modulating expression of a gene product in a cell, comprising: Into the cell, in a 5' to 3' direction, a) a 5' splice donor site; b) an engineered intron; c) a first 3' splice acceptor site; and d) two or more ligand-binding aptamers having one or more ligand-binding pockets and a polyA switch comprising at least one polyA cleavage signal therein; e) a second 3' splice acceptor site. (Item 45) 45. The method of item 44, wherein the gene product is exogenous to the cell. (Item 46) 46. The method of item 45, wherein the system further comprises a nucleic acid sequence encoding the gene product immediately 3' of the splice site of e). (Item 47) 45. The method of item 44, wherein the gene product is endogenous to the cell. (Item 48) 48. The method of claim 47, wherein the method does not include administering a ligand to inhibit expression of an endogenous gene product. (Item 49) 45. The method of item 44, wherein the system further comprises a promoter 5' to the splice site of a). (Item 50) 50. The method of claim 49, wherein the promoter is a CMV promoter. (Item 51) 10. The method of any one of the preceding items, wherein the method occurs in one or more cells of an individual, the ligand is glucose, the individual has diabetes, pre-diabetes, or a diabetic complication, and / or the expressible polynucleotide is insulin. (Item 52) 10. The method of any one of the preceding items, wherein the method occurs in one or more cells of an individual, the ligand is a gene product of a cancer biomarker, and the expressible polynucleotide is a suicide gene. (Item 53) The method occurs in an individual, the expressible polynucleotide is a reporter gene, and the location and / or intensity of expression of the reporter gene is determined by one or more 10. The method of any one of the preceding items, which provides information about the spatial distribution, temporal variation, or both, of a ligand in a cell. (Item 54) 10. The method of any one of the preceding items, wherein the method occurs in an individual, tissue, or cell, the expressible polynucleotide encodes a detectable gene product, and each of the individual, tissue, or cell is imaged. (Item 55) 51. The method according to item 50, wherein the vector of a) and / or the cell of b) is provided to the individual before, during, and / or after therapy. (Item 56) In the 5' to 3' direction, a) a 5' splice donor site; b) an engineered intron; c) a first 3' splice acceptor site; and d) two or more ligand-binding aptamers having one or more ligand-binding pockets and a polyA switch comprising at least one polyA cleavage signal therein; e) a second 3' splice acceptor site; and f) a nucleic acid sequence encoding an expressible polypeptide. (Item 57) 57. The nucleic acid molecule of item 56, wherein the nucleic acid is DNA. (Item 58) 57. The nucleic acid molecule of item 56, wherein the nucleic acid is RNA. (Item 59) 57. A vector for delivery of a nucleic acid according to item 56. (Item 60) 60. The vector of item 59, wherein the vector is a viral vector. (Item 61) 60. The vector of item 59, wherein the vector is selected from an adenoviral vector, a lentiviral vector, an adeno-associated viral vector, a polioviral vector, and a retroviral vector.
Claims
[Claim 1] The invention described in the specification.
Citation Information
Patent Citations
Method and construct for expressing polypeptide multimers in eukaryotic cells using alternative splicing.
JP2007529223A
Exogenous regulation of mammalian gene expression through aptamer-mediated regulation of polyadenylation
JP2018533955A
Regulation of gene expression by aptamer-mediated modulation of alternative splicing
WO2016126747A1