O-methyl rich fully stabilized oligonucleotides

Chemically modified oligonucleotides, specifically 2'-O-methyl modified siRNAs, address the need for efficient RNAi by enhancing RISC entry and tissue distribution while minimizing immune response.

JP2025123220APending Publication Date: 2025-08-22UNIV OF MASSACHUSETTS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025064358
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-02-27
Filing Date
2025-04-09
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

There is a need for self-delivering oligonucleotides that exhibit efficient RNA-induced silencing complex (RISC) entry, minimal immune response, efficient intracellular uptake without formulation, and specific tissue distribution.

Method used

Development of chemically modified oligonucleotides, particularly almost completely 2'-O-methyl modified asymmetric siRNAs with specific non-2'-O-methyl modifications at positions 2 and 14 from the 5' end of the antisense strand, enhancing efficacy for various oligonucleotide therapeutic agents.

Benefits of technology

The modified oligonucleotides improve RNAi efficacy by improving RISC entry, reducing immune response, and ensuring efficient and specific tissue distribution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025123220000023
    Figure 2025123220000023
  • Figure 2025123220000024
    Figure 2025123220000024
  • Figure 2025123220000025
    Figure 2025123220000025
Patent Text Reader

Abstract

To provide novel oligonucleotides that are fully chemically stabilized.SOLUTION: Provided is an oligonucleotide comprising at least 14 contiguous nucleotides, a 5' end and a 3' end; and more than 50% to less than 85% 2'-O-methyl modifications, wherein the nucleotides at positions 4, 5, 6, and 14 from the 5' end of the oligonucleotide comprise a non-2'-O-methyl modification or moiety.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62 / 891,185, filed August 23, 2019, and U.S. Provisional Application No. 62 / 982,534, filed February 27, 2020, the entireties of which are incorporated herein by reference.

[0002] Statement Regarding Government-Sponsored Research This invention was made with government support under grant numbers NS104022, HD086111 and OD020012 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Technical Field The present invention relates to novel oligonucleotides useful for RNA silencing, such as RNA interference (RNAi), that are composed entirely of chemically modified ribonucleotides. The chemically modified nucleotides and linkers are designed to achieve unexpectedly high efficacy, uptake, and tissue distribution. [Background technology]

[0004] background Oligonucleotides containing chemically modified ribonucleotides (e.g., 2'-fluoro and 2'-methoxy modifications) and / or chemically modified linkers (e.g., phosphorothioate modifications) are known to exhibit increased nuclease resistance compared to corresponding unmodified oligonucleotides, while maintaining the ability to promote RNAi. See, e.g., Fosnaugh, et al. (U.S. Publication 2003 / 0143732). Oligonucleotides containing alternating chemically modified nucleotides are known. See, e.g., Bhat et al. (U.S. Publication 2008 / 0119427). Hydrophobic modifications of therapeutic RNAs (e.g., siRNAs) are known. See, e.g., Khvorova, et al. (PCT / US2009 / 005247). Summary of the Invention [Problem to be solved by the invention]

[0005] There remains a need for self-delivering oligonucleotides characterized by efficient RNA-induced silencing complex (RISC) entry, minimal immune response and off-target effects, efficient intracellular uptake without the need for formulation, and efficient and specific tissue distribution. [Means for solving the problem]

[0006] summary The present invention is based on the discovery of chemically modified oligonucleotides that can function as a new class of oligonucleotide therapeutic agents.Surprisingly, it has been found that almost completely 2'-O-methyl modified asymmetric siRNAs, with two non-2'-O-methyl modifications (e.g., 2'-fluoro, 2'-deoxy, 2'-ribose, etc.) at positions 2 and 14 from the 5' end of the antisense strand, unexpectedly improve efficacy.This modification pattern can be used to improve the efficacy of various oligonucleotide therapeutic agents, including but not limited to asymmetric siRNAs, symmetric siRNAs, antisense oligonucleotides (ASOs), microRNAs (miRNAs), miRNA inhibitors, splice switching, phosphorodiamidate morpholino oligomers (PMOs), peptide nucleic acids (PNAs), etc.

[0007] Thus, in one embodiment, the present invention provides an oligonucleotide comprising at least 14 contiguous nucleotides, a 5'-terminus and a 3'-terminus; and greater than 50% to less than 85% 2'-O-methyl modifications, wherein the nucleotides at positions 4, 5, 6, and 14 from the 5'-terminus of the oligonucleotide contain non-2'-O-methyl modifications or moieties.

[0008] In some embodiments, the oligonucleotide comprises an antisense oligonucleotide (ASO).

[0009] In some embodiments, the oligonucleotide has perfect or less than perfect complementarity to the target.

[0010] In certain embodiments, the target comprises mammalian or viral mRNA.

[0011] In certain embodiments, one or more of the nucleotides at positions 2, 8, and 20 from the 5' end of the oligonucleotide comprise a non-2'-O-methyl modification or moiety.

[0012] In certain embodiments, the 3' terminal nucleotide of the oligonucleotide comprises a non-2'-O-methyl modification or moiety.

[0013] In some embodiments, one or more nucleotides at positions 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds. In some embodiments, nucleotides at positions 1 to 6 from the 3' end or 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

[0014] In some embodiments, the non-2'-O-methyl modification or moiety comprises a 2'-F modification or a 2'-H modification or a 2'-OH moiety. In some embodiments, the non-2'-O-methyl modification comprises a 2'-F modification. In some embodiments, the non-2'-O-methyl modification comprises a 2'-H modification. In some embodiments, the non-2'-O-methyl moiety comprises a 2'-OH moiety.

[0015] In some embodiments, the oligonucleotide further comprises a complementary second oligonucleotide comprising at least 13 contiguous nucleotides (e.g., a complementary second oligonucleotide comprising 13-20 contiguous nucleotides, e.g., 14-19 contiguous nucleotides, 14-18 contiguous nucleotides, or e.g., 15 contiguous nucleotides or 16 contiguous nucleotides) and a 5' end and a 3' end.

[0016] In some embodiments, the second oligonucleotide comprises at least 70% 2'-O-methyl modified nucleotides. In some embodiments, the second oligonucleotide comprises at least 80% 2'-O-methyl modified nucleotides. In some embodiments, the second oligonucleotide comprises at least 90% 2'-O-methyl modified nucleotides. In some embodiments, the second oligonucleotide comprises 100% 2'-O-methyl modified nucleotides.

[0017] In certain embodiments, one or more of the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide do not contain a 2'-O-methyl modification.

[0018] In certain embodiments, the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification or moiety.

[0019] In some embodiments, the oligonucleotide comprises 15 to 22 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides). In some embodiments, the oligonucleotide comprises 20 contiguous nucleotides. In some embodiments, the oligonucleotide comprises 21 contiguous nucleotides. In some embodiments, the oligonucleotide comprises 22 contiguous nucleotides.

[0020] In some embodiments, the second oligonucleotide comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides). In some embodiments, the second oligonucleotide comprises 15 contiguous nucleotides. In some embodiments, the second oligonucleotide comprises 16 contiguous nucleotides. In some embodiments, the second oligonucleotide comprises 18 contiguous nucleotides. In some embodiments, the second oligonucleotide comprises 20 contiguous nucleotides.

[0021] In some embodiments, the oligonucleotide comprises 15 to 22 contiguous nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides) and the second oligonucleotide comprises 15 to 20 contiguous nucleotides (e.g., 15, 16, 17, 18, 19, or 20 contiguous nucleotides).

[0022] In some embodiments, the oligonucleotide comprises 19 to 22 contiguous nucleotides (e.g., 19, 20, 21, or 22 contiguous nucleotides) and the second oligonucleotide comprises 14 to 17 contiguous nucleotides (e.g., 14, 15, 16, or 17 contiguous nucleotides).

[0023] In certain embodiments, the oligonucleotide comprises 20 or 21 consecutive nucleotides and the second oligonucleotide comprises 15 and 16 consecutive nucleotides.

[0024] In one embodiment, an oligonucleotide comprises 20 contiguous nucleotides and a second oligonucleotide comprises 15 and 16 contiguous nucleotides.

[0025] In one embodiment, an oligonucleotide comprises 21 contiguous nucleotides and a second oligonucleotide comprises 15 and 16 contiguous nucleotides.

[0026] In some embodiments, the oligonucleotide comprises 20 or 21 contiguous nucleotides and the second oligonucleotide comprises 15 contiguous nucleotides.

[0027] In some embodiments, the oligonucleotide comprises 20 or 21 contiguous nucleotides and the second oligonucleotide comprises 16 contiguous nucleotides.

[0028] In one embodiment, an oligonucleotide comprises 20 contiguous nucleotides and a second oligonucleotide comprises 15 contiguous nucleotides.

[0029] In one embodiment, an oligonucleotide comprises 21 contiguous nucleotides and a second oligonucleotide comprises 16 contiguous nucleotides.

[0030] In some embodiments, the second oligonucleotide contains one or more nucleotide mismatches between the first oligonucleotide and the second oligonucleotide. In some embodiments, the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide. In some embodiments, the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide. In some embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

[0031] In certain embodiments, the nucleotides 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

[0032] In certain embodiments, the second oligonucleotide comprises a hydrophobic molecule at the 3' end of the second oligonucleotide.

[0033] In certain embodiments, the nucleotides 1 and 2 from the 5' end of the oligonucleotide are linked to adjacent ribonucleotides by phosphorothioate linkages.

[0034] In one embodiment, the present invention provides a pharmaceutical composition comprising one or more oligonucleotides as described above and a pharmaceutically acceptable carrier.

[0035] In one aspect, the present invention provides a method for treating or managing a disease or disorder, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition described above.

[0036] In one embodiment, the present invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 14 contiguous nucleotides, the 5'-end and the 3'-end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, the 5'-end and the 3'-end, and has complementarity to the antisense strand; the antisense strand comprises more than 50% to less than 85% 2'-O-methyl modifications; and the nucleotides at positions 4, 5, 6, and 14 from the 5'-end of the antisense strand comprise non-2'-O-methyl modifications.

[0037] In another embodiment, the present invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to the antisense strand; one or more nucleotides at positions 4, 5, and 6 from the 5' end of the antisense strand comprise a non-2'-O-methyl modification; and one or more nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification or moiety.

[0038] In another embodiment, the present invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to a target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to the antisense strand; the antisense strand comprises more than 60% 2'-O-methyl modifications; one or more nucleotides at positions 4, 5, and 6 from the 5' end of the antisense strand comprise a non-2'-O-methyl modification; and the nucleotide at position 7 from the 3' end of the second oligonucleotide comprises a non-2'-O-methyl modification or moiety.

[0039] In certain embodiments, the antisense strand contains perfect or less than perfect complementarity to the target.

[0040] In certain embodiments, the target comprises mammalian or viral mRNA.

[0041] In certain embodiments, one or more of the nucleotides at positions 2, 8, and 20 from the 5' end of the antisense strand comprise a non-2'-O-methyl modification or moiety.

[0042] In certain embodiments, one or more nucleotides at positions 1-7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

[0043] In certain embodiments, nucleotides 1 to 6 from the 3' end or 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

[0044] In some embodiments, the non-2'-O-methyl modification or moiety comprises a 2'-F modification or a 2'-H modification or a 2'-OH moiety. In some embodiments, the non-2'-O-methyl modification comprises a 2'-F modification. In some embodiments, the non-2'-O-methyl modification comprises a 2'-H modification. In some embodiments, the non-2'-O-methyl moiety comprises a 2'-OH moiety.

[0045] In some embodiments, the sense strand comprises at least 70% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises at least 80% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises at least 90% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises 100% 2'-O-methyl modified nucleotides.

[0046] In certain embodiments, one or more of the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide do not comprise a 2'-O-methyl modification. In certain embodiments, the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification or moiety.

[0047] In some embodiments, the antisense strand comprises 15 to 22 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides). In some embodiments, the antisense strand comprises 20 contiguous nucleotides. In some embodiments, the antisense strand comprises 21 contiguous nucleotides. In some embodiments, the antisense strand comprises 22 contiguous nucleotides.

[0048] In some embodiments, the sense strand comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides). In some embodiments, the sense strand comprises 15 contiguous nucleotides. In some embodiments, the sense strand comprises 16 contiguous nucleotides. In some embodiments, the sense strand comprises 18 contiguous nucleotides. In some embodiments, the sense strand comprises 20 contiguous nucleotides.

[0049] In some embodiments, the antisense strand comprises 15 to 22 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and the sense strand comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides).

[0050] In some embodiments, the antisense strand comprises 19 to 22 contiguous nucleotides (e.g., 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and the sense strand comprises 14 to 17 contiguous nucleotides (e.g., 14 contiguous nucleotides, 15 contiguous nucleotides, 16 contiguous nucleotides, or 17 contiguous nucleotides).

[0051] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0052] In some embodiments, the antisense strand comprises 20 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0053] In some embodiments, the antisense strand comprises 21 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0054] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 15 contiguous nucleotides.

[0055] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 16 contiguous nucleotides.

[0056] In some embodiments, the antisense strand comprises 20 contiguous nucleotides and the sense strand comprises 15 contiguous nucleotides.

[0057] In some embodiments, the antisense strand comprises 21 contiguous nucleotides and the sense strand comprises 16 contiguous nucleotides.

[0058] In some embodiments, the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand. In some embodiments, one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand. In some embodiments, the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand.

[0059] In some embodiments, the nucleotides 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds. In some embodiments, the nucleotides 1 and 2 from the 3' end of the sense strand and the nucleotides 1 and 2 from the 5' end of the sense strand are linked to adjacent ribonucleotides by phosphorothioate bonds.

[0060] In some embodiments, the sense strand comprises a hydrophobic molecule at the 3' end of the second oligonucleotide.

[0061] In certain embodiments, the nucleotides 1 and 2 from the 5' end of the antisense strand are joined to the adjacent ribonucleotide by a phosphorothioate bond.

[0062] In some embodiments, the antisense strand comprises a 5'-phosphate, a 5'-alkylphosphonate, or a 5'-alkylenephosphonate. In some embodiments, the antisense strand comprises a 5'-vinylphosphonate.

[0063] In some embodiments, the double-stranded nucleic acid contains 4 to 16 phosphorothioate linkages. In some embodiments, the double-stranded nucleic acid contains 8 to 13 phosphorothioate linkages.

[0064] In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 to 20 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 18 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 20 base pairs.

[0065] In one embodiment, the present invention provides a pharmaceutical composition comprising one or more of the above-described double-stranded chemically modified nucleic acids and a pharmaceutically acceptable carrier.

[0066] In one aspect, the present invention provides a method for treating or managing a disease or disorder, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition described above.

[0067] In one embodiment, the present invention provides a double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 16 contiguous nucleotides (e.g., 16-30 contiguous nucleotides, e.g., 16-28 contiguous nucleotides, 16-27 contiguous nucleotides, 16-26 contiguous nucleotides, 16-25 contiguous nucleotides, 16-24 contiguous nucleotides, 16-23 contiguous nucleotides, or 16-22 contiguous nucleotides), a 5' end and a 3' end, and has complementarity to a target; and the sense strand comprises at least 13 contiguous nucleotides (e.g., 13-25 contiguous nucleotides, e.g., 13-24 contiguous nucleotides, 13-23 contiguous nucleotides, 13-22 contiguous nucleotides), and a double-stranded nucleic acid structure is provided, the double-stranded nucleic acid structure comprising an antisense strand (22 contiguous nucleotides, 13-21 contiguous nucleotides, 13-20 contiguous nucleotides, 13-19 contiguous nucleotides, or 13-18 contiguous nucleotides), a 5' end and a 3' end, and having complementarity to a first oligonucleotide; the antisense strand comprises more than 50% to less than 85% 2'-O-methyl modifications; nucleotides at positions 2, 6, and 14 from the 5' end of the antisense strand comprise non-2'-O-methyl modifications; the sense strand comprises at least 70% 2'-O-methyl modifications; and nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand comprise non-2'-O-methyl modifications.

[0068] In certain embodiments, the nucleotides at positions 2, 6, 14, and 16 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

[0069] In certain embodiments, one or more of the nucleotides at positions 8, 16, and 20 from the 5' end of the antisense strand do not contain a 2'-O-methyl modification.

[0070] In certain embodiments, the 3'-terminal nucleotide of the antisense strand comprises a non-2'-O-methyl modification or moiety.

[0071] In some embodiments, the sense strand comprises at least 70% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises at least 80% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises at least 90% 2'-O-methyl modified nucleotides. In some embodiments, the sense strand comprises 100% 2'-O-methyl modified nucleotides.

[0072] In some embodiments, the sense strand comprises 70% to 90% 2'-O-methyl modified nucleotides (e.g., 70% 2'-O-methyl modified nucleotides, 71% 2'-O-methyl modified nucleotides, 72% 2'-O-methyl modified nucleotides, 73% 2'-O-methyl modified nucleotides, 74% 2'-O-methyl modified nucleotides, 75% 2'-O-methyl modified nucleotides, 76% 2'-O-methyl modified nucleotides, 77% 2'-O-methyl modified nucleotides, 78% 2'-O-methyl modified nucleotides, 79% 2'-O-methyl modified nucleotides, 80% 2'-O-methyl modified nucleotides, 81% 2'-O-methyl modified nucleotides, 82% 2'-O-methyl modified nucleotides, 83% 2'-O-methyl modified nucleotides, 84% 2'-O-methyl modified nucleotides, 85% 2'-O-methyl modified nucleotides, 86% 2'-O-methyl modified nucleotides, 87% 2'-O-methyl modified nucleotides, 88% 2'-O-methyl modified nucleotides, 89% 2'-O-methyl modified nucleotides or 90% 2'-O-methyl modified nucleotides).

[0073] In some embodiments, the sense strand contains 70% to 85% 2'-O-methyl modified nucleotides (e.g., 70% 2'-O-methyl modified nucleotides, 71% 2'-O-methyl modified nucleotides, 72% 2'-O-methyl modified nucleotides, 73% 2'-O-methyl modified nucleotides, 74% 2'-O-methyl modified nucleotides, 75% 2'-O-methyl modified nucleotides, 76% 2'-O-methyl modified nucleotides, 77% 2'-O-methyl modified nucleotides, 78% 2'-O-methyl modified nucleotides, 79% 2'-O-methyl modified nucleotides, 80% 2'-O-methyl modified nucleotides, 81% 2'-O-methyl modified nucleotides, 82% 2'-O-methyl modified nucleotides, 83% 2'-O-methyl modified nucleotides, 84% 2'-O-methyl modified nucleotides, or 85% 2'-O-methyl modified nucleotides).

[0074] In some embodiments, the sense strand contains 70% to 80% 2'-O-methyl modified nucleotides (e.g., 70% 2'-O-methyl modified nucleotides, 71% 2'-O-methyl modified nucleotides, 72% 2'-O-methyl modified nucleotides, 73% 2'-O-methyl modified nucleotides, 74% 2'-O-methyl modified nucleotides, 75% 2'-O-methyl modified nucleotides, 76% 2'-O-methyl modified nucleotides, 77% 2'-O-methyl modified nucleotides, 78% 2'-O-methyl modified nucleotides, 79% 2'-O-methyl modified nucleotides, or 80% 2'-O-methyl modified nucleotides).

[0075] In some embodiments, the antisense strand comprises 16 to 22 contiguous nucleotides (e.g., 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides). In some embodiments, the antisense strand comprises 20 contiguous nucleotides. In some embodiments, the antisense strand comprises 21 contiguous nucleotides. In some embodiments, the antisense strand comprises 22 contiguous nucleotides.

[0076] In some embodiments, the sense strand comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides). In some embodiments, the sense strand comprises 15 contiguous nucleotides. In some embodiments, the sense strand comprises 16 contiguous nucleotides. In some embodiments, the sense strand comprises 18 contiguous nucleotides. In some embodiments, the sense strand comprises 20 contiguous nucleotides.

[0077] In some embodiments, the antisense strand comprises 15 to 22 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and the sense strand comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides).

[0078] In some embodiments, the antisense strand comprises 19 to 22 contiguous nucleotides (e.g., 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and the sense strand comprises 14 to 17 contiguous nucleotides (e.g., 14 contiguous nucleotides, 15 contiguous nucleotides, 16 contiguous nucleotides, or 17 contiguous nucleotides).

[0079] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0080] In some embodiments, the antisense strand comprises 20 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0081] In some embodiments, the antisense strand comprises 21 contiguous nucleotides and the sense strand comprises 15 and 16 contiguous nucleotides.

[0082] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 15 contiguous nucleotides.

[0083] In certain embodiments, the antisense strand comprises 20 or 21 contiguous nucleotides and the sense strand comprises 16 contiguous nucleotides.

[0084] In some embodiments, the antisense strand comprises 20 contiguous nucleotides and the sense strand comprises 15 contiguous nucleotides.

[0085] In some embodiments, the antisense strand comprises 21 contiguous nucleotides and the sense strand comprises 16 contiguous nucleotides.

[0086] In some embodiments, the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand. In some embodiments, one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand. In some embodiments, the nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand.

[0087] In some embodiments, the nucleotides 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds. In some embodiments, the nucleotides 1 and 2 from the 3' end of the sense strand and the nucleotides 1 and 2 from the 5' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds.

[0088] In certain embodiments, the sense strand comprises a hydrophobic molecule at the 3' end of the sense strand.

[0089] In some embodiments, the nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds. In some embodiments, one or more nucleotides at positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

[0090] In some embodiments, the antisense strand comprises a 5'-phosphate, a 5'-alkylphosphonate, or a 5'-alkylenephosphonate. In some embodiments, the antisense strand comprises a 5'-vinylphosphonate.

[0091] In some embodiments, the double-stranded nucleic acid contains 4 to 16 phosphorothioate linkages. In some embodiments, the double-stranded nucleic acid contains 8 to 13 phosphorothioate linkages.

[0092] In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 to 20 base pairs (e.g., 15, 16, 17, 18, 19, or 20 base pairs). In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 15 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 16 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 18 base pairs. In some embodiments, the double-stranded nucleic acid comprises a double-stranded region of 20 base pairs.

[0093] In certain aspects, the present invention provides branched oligonucleotide compounds capable of mediating RNA silencing in a cell, comprising two or more double-stranded nucleic acids, wherein the nucleic acids (N) are linked to each other by one or more moieties selected from a linker (L), a spacer (S), and optionally a branch point (B), and wherein each double-stranded nucleic acid comprises an antisense strand of any of the above aspects or embodiments of the invention and a sense strand of any of the above aspects or embodiments of the invention. In one embodiment, each antisense strand comprises at least 14 contiguous nucleotides (e.g., 14 to 30 contiguous nucleotides, e.g., 16 to 28 contiguous nucleotides, 16 to 27 contiguous nucleotides, 16 to 26 contiguous nucleotides, 16 to 25 contiguous nucleotides, 16 to 24 contiguous nucleotides, 16 to 23 contiguous nucleotides, or 16 to 22 contiguous nucleotides), at the 5'-terminus and 3'-terminus, and at least one antisense strand comprises more than 50% to less than 85% 2'-O-methyl modifications, wherein the nucleotide at position 14 from the 5'-terminus of at least one antisense strand contains a non-2'-O-methyl modification or moiety; and one or more nucleotides at positions 1 to 7 from the 3'-terminus of at least one antisense strand are linked to adjacent nucleotides by phosphorothioate linkages.

[0094] In certain embodiments, each antisense strand contains more than 50% to less than 85% 2'-O-methyl modifications; the nucleotide at position 14 from the 5' end of each antisense strand contains a non-2'-O-methyl modification or moiety; and / or one or more nucleotides at positions 1-7 from the 3' end of each antisense strand are linked to adjacent nucleotides by phosphorothioate linkages.

[0095] In some embodiments, each antisense strand comprises 15 to 22 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and each sense strand comprises 15 to 20 contiguous nucleotides (e.g., 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides).

[0096] In some embodiments, each antisense strand comprises 19 to 22 contiguous nucleotides (e.g., 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, or 22 contiguous nucleotides), and each sense strand comprises 14 to 17 contiguous nucleotides (e.g., 14 contiguous nucleotides, 15 contiguous nucleotides, 16 contiguous nucleotides, or 17 contiguous nucleotides).

[0097] In certain embodiments, each antisense strand comprises 20 or 21 contiguous nucleotides and each sense strand comprises 15 and 16 contiguous nucleotides.

[0098] In certain embodiments, each antisense strand comprises 20 contiguous nucleotides and each sense strand comprises 15 and 16 contiguous nucleotides.

[0099] In certain embodiments, each antisense strand comprises 21 contiguous nucleotides and each sense strand comprises 15 and 16 contiguous nucleotides.

[0100] In certain embodiments, each antisense strand comprises 20 or 21 contiguous nucleotides and each sense strand comprises 15 contiguous nucleotides.

[0101] In certain embodiments, each antisense strand comprises 20 or 21 contiguous nucleotides and each sense strand comprises 16 contiguous nucleotides.

[0102] In certain embodiments, each antisense strand comprises 20 contiguous nucleotides and each sense strand comprises 15 contiguous nucleotides.

[0103] In certain embodiments, each antisense strand comprises 21 contiguous nucleotides and each sense strand comprises 16 contiguous nucleotides.

[0104] In certain embodiments, the nucleotides 1 and 2 from the 5' end of the sense and antisense strands are joined to adjacent nucleotides by phosphorothioate bonds.

[0105] In certain embodiments, each double-stranded nucleic acid is independently attached to a linker, spacer, or branch point at the 3' or 5' end of the sense or antisense strand.

[0106] In some embodiments, the compound further comprises a hydrophobic moiety attached to the 5' terminal position of the branched oligonucleotide compound. In some embodiments, the hydrophobic moiety comprises an alkyl, alkenyl, or aryl moiety; a vitamin or cholesterol derivative; a lipophilic amino acid; or a combination thereof.

[0107] In some embodiments, each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent.

[0108] In certain embodiments, the 20th nucleotide from the 5' end of the antisense strand comprises a non-2'-O-methyl modification or moiety.

[0109] In certain embodiments, nucleotides 7, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification or moiety.

[0110] In some embodiments, the non-2'-O-methyl modification comprises a 2'-F modification or a 2'-H modification or a 2'-OH moiety. In some embodiments, the non-2'-O-methyl modification comprises a 2'-F modification. In some embodiments, the non-2'-O-methyl modification comprises a 2'-H modification. In some embodiments, the non-2'-O-methyl modification comprises a 2'-OH moiety.

[0111] In some embodiments, the sense strand comprises at least 80% 2'-O-methyl modified nucleotides, in some embodiments, the sense strand comprises at least 90% 2'-O-methyl modified nucleotides, in some embodiments, the sense strand comprises 100% 2'-O-methyl modified nucleotides.

[0112] In some embodiments, the antisense strand comprises 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides. In some embodiments, the sense strand comprises 15, 16, 17, 18, 19, or 20 contiguous nucleotides.

[0113] In some embodiments, the nucleotide at position 14 from the 5' end of the antisense strand and one or more nucleotides at positions 2, 4, 5, 6, 16, and 20 from the 5' end of the antisense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 2 and 14 from the 5' end of the antisense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 2, 14, and 20 from the 5' end of the antisense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 4, 5, 6, and 14 from the 5' end of the antisense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 4, 5, 6, 14, and 20 from the 5' end of the antisense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 2, 4, 5, 6, and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications (e.g., 2'-F modifications). In some embodiments, the nucleotides at positions 2, 4, 5, 6, 14, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications (e.g., 2'-F modifications). In some embodiments, the nucleotides at positions 2, 6, 14, and 16 from the 5' end of the antisense strand contain non-2'-O-methyl modifications (e.g., 2'-F modifications). In some embodiments, the nucleotides at positions 2, 6, 14, 16, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications (e.g., 2'-F modifications). In some embodiments, one or more nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). In some embodiments, the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain a non-2'-O-methyl modification (e.g., a 2'-F modification). [Brief explanation of the drawings]

[0114] The above and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0115] 1A to 1D show schematic diagrams of four complete chemically stabilized siRNA patterns.

[0116] [Figure 1A] Patterns 2A to 2F are shown schematically, each lacking a 2'-OMe modification at positions 4, 5, 6, and 14 of the guide (antisense) strand. Patterns 2B, 2D, and 2F also lack a 2'-OMe modification at position 20 of the guide strand. Patterns 2A and 2B represent siRNAs with a 20-nucleotide guide strand and a 15-nucleotide passenger (sense) strand. Patterns 2C and 2D represent siRNAs with a 20-nucleotide guide strand and an 18-nucleotide passenger (sense) strand. Patterns 2E and 2F represent siRNAs with a 22-nucleotide guide strand and a 20-nucleotide passenger (sense) strand.

[0117] [Figure 1B] Patterns 3A to 3F are shown schematically, each lacking a 2'-OMe modification at positions 2, 4, 5, 6, and 14 of the guide (antisense) strand. Patterns 3B, 3D, and 3F also lack a 2'-OMe modification at position 20 of the guide strand. Patterns 3A and 3B represent siRNAs with a 20-nucleotide guide strand and a 15-nucleotide passenger (sense) strand. Patterns 3C and 3D represent siRNAs with a 20-nucleotide guide strand and an 18-nucleotide passenger (sense) strand. Patterns 3E and 3F represent siRNAs with a 22-nucleotide guide strand and a 20-nucleotide passenger (sense) strand.

[0118] [Figure 1C] Patterns 4A to 4F are shown schematically, each lacking a 2'-OMe modification at positions 2, 6, 14, and 16 of the guide (antisense) strand and positions 7, 9, 10, and 11 from the 3' end of the passenger strand. Patterns 4B, 4D, and 4F also lack a 2'-OMe modification at position 20 of the guide strand. Patterns 4A and 4B represent siRNAs with a 20-nucleotide guide strand and a 15-nucleotide passenger strand. Patterns 4C and 4D represent siRNAs with a 20-nucleotide guide strand and an 18-nucleotide passenger (sense) strand. Patterns 4E and 4F represent siRNAs with a 22-nucleotide guide strand and a 20-nucleotide passenger (sense) strand.

[0119] [Figure 1D] Patterns 5A to 5F are shown schematically, each lacking a 2'-OMe modification at positions 2, 6, 14, and 14 of the guide (antisense) strand and positions 7, 10, and 11 from the 3' end of the passenger strand. Patterns 5B, 5D, and 5F also lack a 2'-OMe modification at position 20 of the guide strand. Patterns 5A and 5B represent siRNAs with a 20-nucleotide guide strand and a 15-nucleotide passenger strand. Patterns 5C and 5D represent siRNAs with a 20-nucleotide guide strand and an 18-nucleotide passenger (sense) strand. Patterns 5E and 5F represent siRNAs with a 22-nucleotide guide strand and a 20-nucleotide passenger (sense) strand.

[0120] [Figure 2] FIG. 2 shows sugar modifications according to certain exemplary embodiments.

[0121] [Figure 3] FIG. 3 illustrates oligonucleotide backbone attachment according to an exemplary embodiment.

[0122] [Figure 4A] Figure 4 shows the in vitro efficacy of sFLT1i13 mRNA silencing with Pattern 3A. Figure 4A shows HeLa cells treated with Pattern 3A and control siRNA at the indicated concentrations for 72 hours, and Figure 4B shows WM-115 cells. mRNA was measured using the Promega Dual-Glo® Luciferase (Figure 4A) or Affymetrix Quantigene 2.0 (Figure 4B) assay systems. Data were normalized to the control reporter (fLuc) (Figure 4A) or housekeeping gene (HPRT) (Figure 4B) and graphed as a percentage of the untreated control. [Figure 4B] Figure 4 shows the in vitro efficacy of sFLT1i13 mRNA silencing with Pattern 3A. Figure 4A shows HeLa cells treated with Pattern 3A and control siRNA at the indicated concentrations for 72 hours, and Figure 4B shows WM-115 cells. mRNA was measured using the Promega Dual-Glo® Luciferase (Figure 4A) or Affymetrix Quantigene 2.0 (Figure 4B) assay systems. Data were normalized to the control reporter (fLuc) (Figure 4A) or housekeeping gene (HPRT) (Figure 4B) and graphed as a percentage of the untreated control.

[0123] [Figure 5A] Figure 5 shows the in vitro efficacy of sFLTe15a mRNA silencing with the Pattern 3A variant, which also contains a 2'F at position 8 of the guide strand. Figure 5A shows HeLa cells treated with Pattern 1A, Pattern 2A, and control siRNA at the indicated concentrations for 72 hours, and Figure 5B shows WM-115 cells. mRNA was measured using the Promega Dual-Glo® Luciferase (Figure 5A) or Affymetrix Quantigene 2.0 (Figure 5B) assay systems. Data were normalized to a control reporter (fLuc) (Figure 5A) or a housekeeping gene (HPRT) (Figure 5B) and graphed as a percentage of the untreated control. [Figure 5B]Figure 5 shows the in vitro efficacy of sFLTe15a mRNA silencing with the Pattern 3A variant, which also contains a 2'F at position 8 of the guide strand. Figure 5A shows HeLa cells treated with Pattern 1A, Pattern 2A, and control siRNA at the indicated concentrations for 72 hours, and Figure 5B shows WM-115 cells. mRNA was measured using the Promega Dual-Glo® Luciferase (Figure 5A) or Affymetrix Quantigene 2.0 (Figure 5B) assay systems. Data were normalized to a control reporter (fLuc) (Figure 5A) or a housekeeping gene (HPRT) (Figure 5B) and graphed as a percentage of the untreated control.

[0124] Figures 6A-6D show that Pattern 2A DCA and PC DCA compounds exhibit increased guide strand accumulation in the liver, kidney, and placenta compared to the control pattern with cholesterol conjugates, despite half dosing.

[0125] [Figure 6A] Pattern 2A and control schematics are shown. Pattern 2A siRNA contained a 5'-vinyl phosphonate.

[0126] [Figure 6B] Increased guide strand accumulation in the liver, kidney, and placenta compared to controls is shown. CD1 pregnant mice were treated with Pattern 2A or control siRNA at the indicated concentrations, and tissues were harvested at the indicated times. siRNA guide strands were measured in tissues using a peptide nucleic acid (PNA) hybridization assay. sFLT1-2519 O-methyl-rich: 20 mg / kg*, 120-hour dose; sFLT1-2283 control: 20 mg / kg**, 120-hour dose. *40 mg / kg was the total dose of sFLT1-X siRNA (20 mg / kg sFLT1-2283 + 20 mg / kg sFLT1-2519a on E14). **20 mg / kg was the total dose of sFLT1-2283 siRNA (10 mg / kg sFLT1-2283 on E14 + 10 mg / kg sFLT1-2283 on E15).

[0127] [Figure 6C] Showing increased guide strand accumulation in the liver and similar guide strand accumulation in the placenta compared to controls. Conditions are the same as in Figure 6B, except HTT-10150 DCA and PC-DC control were used; 20 mg / kg**, 48 hour dose.

[0128] Figures 7A-7D show that Pattern 3B PC DCA compounds exhibit guide strand accumulation, sFLT1i13 mRNA silencing and increased sFLT1 protein levels in the placenta compared to control patterns with cholesterol or PC DCA conjugates.

[0129] [Figure 7A] Pattern 3B and control diagrams are shown. "20 / 15mer" represents 20 nucleotide antisense / 15 nucleotide sense siRNA, "20 / 18mer" represents 20 nucleotide antisense / 18 nucleotide sense siRNA, "5' VP" represents siRNA with 5'-terminal vinylphosphonate modification, "5' OH" represents siRNA with 5'-terminal 2'-OH, "5'PS" represents siRNA with 5'-terminal phosphorothioate, and "low PS" represents siRNA with phosphorothioate modification at positions 1 and 2 from the 5' and 3' ends of the antisense and sense strands.

[0130] [Figure 7B]Figure 1 shows increased guide strand accumulation in the placenta compared to controls. CD1 pregnant mice were treated with Pattern 3B or control siRNA, and tissues were harvested. siRNA guide strands were measured in tissues using a peptide nucleic acid (PNA) hybridization assay. sFLT1-2283 and sFLT1-519 O-methyl-rich: 20 mg / kg*, 120-hour dose; sFLT1-2283 control: 20 mg / kg**, 120-hour dose; HTT-10150 control PC DCA: 20 mg / kg, 48-hour dose. *40 mg / kg was the total dose of sFLT1-X siRNA (20 mg / kg sFLT1-2283 + 20 mg / kg sFLT1-2519a at E14). **20 mg / kg was the total dose of sFLT1-2283 siRNA (10 mg / kg sFLT1-2283 on E14 + 10 mg / kg sFLT1-2283 on E15).

[0131] [Figure 7C] Figure 7 shows sFLT1i13 mRNA silencing in placentas compared to control (PBS). CD1 pregnant mice were treated with Pattern 3B or control siRNA as described in Figure 7B. sFLT1-i13 mRNA levels were measured using Quantigene 2.0 RNA assay. Data were normalized to the housekeeping gene (FLT1) and graphed as % of the untreated, i.e., PBS control (n = 5 mice, 6 placentas / mouse, mean ± SD shown). p values ​​were calculated by one-way ANOVA.

[0132] [Figure 7D]Figure 7 shows sFLT1 protein expression in placentas compared to the control (PBS). CD1 pregnant mice were treated with Pattern 3B or control siRNA as described in Figure 7B. sFLT1-i13 protein levels were quantified using ProteinSimple® Wes. 2.4 μg total protein; 1:1000 mouse monoclonal anti-vascular endothelial growth factor receptor-1 antibody (Sigma V4262); 1:50 mouse monoclonal anti-beta-actin (Abcam 6276). Data were normalized to the protein loading control (beta-actin) and graphed as % of the untreated, i.e., PBS control (n=5 mice, 1 placenta / mouse, mean±SD shown). p-values ​​were calculated by one-way ANOVA.

[0133] [Figure 8] Figure 8 shows the in vitro efficacy of HTT mRNA silencing with Pattern 1B and Pattern 4B. HeLa cells were treated with Pattern 1B, Pattern 4B, and control siRNA at the concentrations shown for 72 hours. mRNA was measured using the Affymetrix Quantigene 2.0 assay system. Data were normalized to the housekeeping gene (HPRT) and graphed as % of the untreated control.

[0134] [Figure 9] Figure 9 shows increased guide strand accumulation in the striatum, medial cortex, and hippocampus with biantennary siRNA of Pattern 4B compared to control. Wild-type FVB / NJ mice were treated with the indicated amounts of Pattern 4B and control siRNA, and tissues were harvested at the indicated time points. siRNA guide strands were measured in tissues using a peptide nucleic acid (PNA) hybridization assay. Averages for each mouse are shown. HTT-10150 dose: Pattern 4B: 0.2375 mg, 2.5 months until tissue harvest; control: 0.475 mg, 3.75 months until tissue harvest.

[0135] [Figure 10A]Figures 10A-10D show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 20 of the guide strand. Figures 10A, 10C, and 10D show HeLa cells, and Figure 10B shows WM-115 cells, treated for 72 hours with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 10D compares siRNAs with a 20-nucleotide antisense strand versus 21-nucleotide antisense strand. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. [Figure 10B] Figures 10A-10D show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 20 of the guide strand. Figures 10A, 10C, and 10D show HeLa cells, and Figure 10B shows WM-115 cells, treated for 72 hours with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 10D compares siRNAs with a 20-nucleotide antisense strand versus 21-nucleotide antisense strand. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. [Figure 10C]Figures 10A-10D show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 20 of the guide strand. Figures 10A, 10C, and 10D show HeLa cells, and Figure 10B shows WM-115 cells, treated for 72 hours with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 10D compares siRNAs with a 20-nucleotide antisense strand versus 21-nucleotide antisense strand. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. [Figure 10D] Figures 10A-10D show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 20 of the guide strand. Figures 10A, 10C, and 10D show HeLa cells, and Figure 10B shows WM-115 cells, treated for 72 hours with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations. Figure 10D compares siRNAs with a 20-nucleotide antisense strand versus 21-nucleotide antisense strand. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control.

[0136] [Figure 11]Figure 11 shows the in vitro efficacy of HTT mRNA silencing with siRNAs with or without 2'-OMe at position 20 of the guide strand in pattern 4 (4A vs. 4B). HeLa cells were treated with siRNAs containing 75-80% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using the Affymetrix Quantigene 2.0 assay system. Data were normalized to the housekeeping gene (HPRT) and graphed as a % of the untreated control.

[0137] [Figure 12A] Figures 12A-12C show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 5 of the guide strand. Figures 12A and 12C show HeLa cells, and Figure 12B shows WM-115 cells, treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. [Figure 12B] Figures 12A-12C show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 5 of the guide strand. Figures 12A and 12C show HeLa cells, and Figure 12B shows WM-115 cells, treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. [Figure 12C]Figures 12A-12C show the in vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 5 of the guide strand. Figures 12A and 12C show HeLa cells, and Figure 12B shows WM-115 cells, treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control.

[0138] [Figure 13A] Figures 13A-13B show the in vitro efficacy of sFLT1i13 and sFLT1e15a mRNA silencing with siRNAs with or without 2'-OMe at positions 5 and / or 7 of the guide strand. The guide strand in Figure 13A shows the presence or absence of 2'-OMe at position 5, while a 2'-OMe is present at position 7. The guide strand in Figure 13B shows the presence or absence of 2'-OMe at positions 5 and 7. HeLa cells were treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control. [Figure 13B]Figures 13A-13B show the in vitro efficacy of sFLT1i13 and sFLT1e15a mRNA silencing with siRNAs with or without 2'-OMe at positions 5 and / or 7 of the guide strand. The guide strand in Figure 13A shows the presence or absence of 2'-OMe at position 5, while a 2'-OMe is present at position 7. The guide strand in Figure 13B shows the presence or absence of 2'-OMe at positions 5 and 7. HeLa cells were treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours. mRNA was measured using Promega Dual-Glo® Luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control.

[0139] [Figure 14] Figure 14 shows the in vitro efficacy of HTT mRNA silencing (see Figure 11) with Pattern 4 siRNA compared to siRNA with other modification patterns. HeLa cells were treated with siRNA at the concentrations shown for 72 hours. mRNA was measured using the Affymetrix Quantigene 2.0 assay system. Data were normalized to the housekeeping gene (HPRT) and graphed as % of the untreated control.

[0140] [Figure 15] FIG. 15 shows exemplary modified intersubunit linkers.

[0141] [Figure 16] FIG. 16 shows an example biantennary siRNA chemical scaffold.

[0142] [Figure 17] Figure 17 shows an oligonucleotide branching motif according to an exemplary embodiment. The double helix represents the oligonucleotide. Combinations of various linkers, spacers, and branching points allow for the production of a wide variety of branched hsiRNA structures.

[0143] [Figure 18]FIG. 18 shows branched oligonucleotides of the invention having conjugated biologically active moieties.

[0144] [Figure 19] FIG. 19 shows examples of amidite linkers, spacers and branching moieties.

[0145] [Figure 20] Figure 20 shows the in vitro efficacy of sFLT1i13 mRNA silencing with Pattern 3 variant iRNAs. HeLa cells were treated with Pattern 3 variant iRNAs at the concentrations indicated for 72 hours. The Pattern 3 variants are: 1) a 20-nucleotide antisense and a 14-nucleotide sense strand (squares), 2) a 20-nucleotide antisense and an 18-nucleotide sense strand (triangles), and 3) a 21-nucleotide antisense and a 16-nucleotide sense strand (circles). mRNA was measured using Promega Dual-Glo® Luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control.

[0146] [Figure 21]Figure 21 shows the in vitro efficacy of sFTL1 e15a mRNA silencing with Pattern 1 variant iRNAs with non-2'-O-methyl nucleotides at positions 2 and 14 of the antisense strand and 100% 2'-O-methyl modified nucleotides on the sense strand. The antisense strand optionally has a non-2'-O-methyl nucleotide at the 3' end (i.e., position 20 of the 20-nucleotide strand, position 21 of the 21-nucleotide strand). HeLa cells were treated with Pattern 1 variant iRNAs at the indicated concentrations for 72 hours. Pattern 1 variants are: 1) a 20-nucleotide antisense and a 15-nucleotide sense strand (squares), 2) a 20-nucleotide antisense and an 18-nucleotide sense strand (triangles), and 3) a 21-nucleotide antisense and a 16-nucleotide sense strand (circles). mRNA was measured using Promega Dual-Glo® luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control. DETAILED DESCRIPTION OF THE INVENTION

[0147] Detailed Description Provided herein are oligonucleotides containing a novel chemical configuration that is fully chemically stabilized and contains only two non-2'-O-methyl modifications (e.g., 2'-fluoro modifications) at positions 2 and 14 of the antisense strand (Figure 1). Without intending to be bound by scientific theory, positions 2 and 14 of the antisense strand form direct contacts with AGO2. Unexpectedly, this chemical configuration was found to be fully functional in terms of mRNA silencing. Furthermore, 2'-fluoro-free configurations in which positions 2 and 14 are modified with ribose and / or DNA were also found. Use of the novel oligonucleotides described herein not only extends the duration of in vivo efficacy but also reduces concerns about the toxicity of oligonucleotides containing a high percentage of 2'-fluoro modifications.

[0148] definition Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. In the event of any potential ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms include pluralities and plural terms include the singular. The use of "or" means "and / or" unless otherwise required. The use of terms such as "comprises," "including," and "including" is not limiting. Unless otherwise specified, singular terms used herein include plural referents. Thus, for example, reference to a "protein" includes a plurality of protein molecules.

[0149] In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein is that which is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in the various general and more specific references cited and described herein, unless otherwise specified. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature and experimental procedures and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are that which is well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and patient treatment.

[0150] In order that the present invention may be more readily understood, selected terms are defined below.

[0151] The term "complementary" refers to an oligonucleotide that hybridizes to form a double-stranded nucleic acid by nucleotide-nucleotide correlation or Watson-Crick base pairing. The term "complementarity" refers to the state of an oligonucleotide (e.g., a sense strand or an antisense strand) that is partially or completely complementary to another oligonucleotide. An oligonucleotide described herein as having complementarity to a second oligonucleotide can be 100% (full complementarity), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% complementary to the second oligonucleotide. Thus, an oligonucleotide described herein as having less than 100% complementarity to a second oligonucleotide has less than perfect complementarity.

[0152] As used herein in the context of oligonucleotide sequences, "A" represents a nucleoside containing the base adenine (e.g., adenosine or a chemically modified derivative thereof), "G" represents a nucleoside containing the base guanine (e.g., guanosine or a chemically modified derivative thereof), "U" represents a nucleoside containing the base uracil (e.g., uridine or a chemically modified derivative thereof), and "C" represents a nucleoside containing the base cytosine (e.g., cytidine or a chemically modified derivative thereof).

[0153] As used herein, the term "3' end" refers to the end of a nucleic acid that contains an unmodified hydroxyl group on the 3' carbon of its ribose ring. The 3' end can be covalently linked to another molecule, such as a hydrophobic molecule, or to another nucleic acid (e.g., via a linker).

[0154] As used herein, the term "5' end" refers to the end of a nucleic acid that contains a phosphate group attached to the 5' carbon of the ribose ring. The 5' end can be further modified with a hydrophobic, phosphonate, linker, or alkylene moiety.

[0155] As used herein, the term "nucleoside" refers to a molecule consisting of a heterocyclic base and its sugar.

[0156] As used herein, the term "nucleotide" generally refers to a nucleoside having a phosphate or phosphorothioate group in its 3' or 5' sugar hydroxyl group.

[0157] An RNAi agent, e.g., an siRNA, having a strand that is "sequence sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi)" means that the strand has sufficient sequence to induce destruction of the target mRNA by RNAi.

[0158] As used herein, the term "isolated RNA" (e.g., "isolated siRNA," "isolated siRNA," or "isolated siRNA precursor") refers to an RNA molecule that is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0159] The term "discriminatory RNA silencing" refers to the ability of an RNA molecule to substantially inhibit the expression of a "first" or "target" polynucleotide sequence, while not substantially inhibiting the expression of a "second" or "non-target" polynucleotide sequence, for example, when both polynucleotide sequences are present in the same cell.In some embodiments, the target polynucleotide sequence corresponds to a target gene, while the non-target polynucleotide sequence corresponds to a non-target gene.In other embodiments, the target polynucleotide sequence corresponds to a target allele, while the non-target polynucleotide sequence corresponds to a non-target allele.In some embodiments, the target polynucleotide sequence is a DNA sequence encoding the regulatory region (e.g., promoter or enhancer element) of a target gene.In other embodiments, the target polynucleotide sequence is the target mRNA encoded by a target gene.

[0160] As used herein, the term "siRNA" refers to a small interfering RNA that induces the RNA interference (RNAi) pathway. siRNA molecules vary in length (generally 18-30 base pairs) and can contain varying degrees of complementarity to the target mRNA. The term "siRNA" includes duplexes of two separate strands and single strands that can form hairpin structures containing the duplex region.

[0161] As used herein, the term " antisense strand " refers to the strand of siRNA duplex that has some degree of complementarity with target gene or mRNA and has complementarity with the sense strand of siRNA duplex.The nucleotide position of antisense strand is determined from the 5' end of antisense strand or the 3' end of antisense strand.For example, the 2nd and 14th positions from the 5' end of antisense strand correspond to the 2nd and 14th nucleotides when counted from the 5' end of antisense strand.

[0162] As used herein, the term " sense strand " refers to the strand of siRNA duplex that comprises complementarity with the sense strand of anti-siRNA duplex.The nucleotide position of sense strand can be from the 5 ' end of sense strand or from the 3 ' end of sense strand.For example, the 7th, 10th and 11th positions of the 3 ' end of sense strand correspond to the 7th, 10th and 11th nucleotides when counted from the 3 ' end of sense strand, and if sense strand comprises a 3 ' single-stranded overhang region, the position described here that corresponds to the 3 ' end of the double-stranded region of sense strand.

[0163] As used herein, the term "overhang" or "tail" refers to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides at the 3' end of one or both of the sense and antisense strands that are single-stranded, i.e., do not base-pair with the other strand of the siRNA duplex (i.e., do not form a duplex).

[0164] As used herein, the term "antisense oligonucleotide" or "ASO" refers to a nucleic acid (e.g., RNA) having sufficient sequence complementarity to direct an RNA (e.g., a SNP-containing mRNA or SNP-containing pre-mRNA) to block a region of the target RNA in an effective manner, e.g., to inhibit translation of the target mRNA and / or splicing of the target pre-mRNA. An antisense oligonucleotide having a "sequence sufficiently complementary to the target RNA" means that the antisense agent has a sequence sufficient to mask the binding site of a protein that otherwise regulates splicing and / or that the antisense agent has a sequence sufficient to mask the binding site of a ribosome and / or that the antisense agent has a sequence sufficient to alter the tertiary structure of the target RNA to prevent it from being spliced ​​and / or translated.

[0165] In certain exemplary embodiments, the siRNA of the invention is asymmetric. In certain exemplary embodiments, the siRNA of the invention is symmetric.

[0166] In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of about 8 to 20 nucleotides or nucleotide analogs in length, about 10 to 18 nucleotides or nucleotide analogs in length, about 12 to 16 nucleotides or nucleotide analogs in length, or about 13 to 15 nucleotides or nucleotide analogs in length (e.g., a duplex region of about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs). In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 15 to 20 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 15 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 16 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 17 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 18 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 19 base pairs. In an exemplary embodiment, the siRNA of the present invention comprises a duplex region of 20 base pairs.

[0167] In some exemplary embodiments, the siRNA of the present invention comprises one or two overhangs.In some embodiments, each overhang of the siRNA comprises at least about 3, about 4, about 5, about 6, about 7, about 8, about 9 or about 10 consecutive nucleotides.In some embodiments, each overhang of the siRNA of the present invention is about 4, about 5, about 6 or about 7 nucleotides in length.In some embodiments, the sense strand overhang has the same number of nucleotides in length as the antisense strand overhang.In other embodiments, the sense strand overhang has fewer nucleotides than the antisense strand overhang.In other embodiments, the antisense strand overhang has fewer nucleotides than the sense strand overhang.In some embodiments, each nucleotide in the overhang region is conjugated to the adjacent nucleotide by phosphorothioate bond.

[0168] In certain exemplary embodiments, the siRNA of the present invention comprises a sense strand and / or an antisense strand, each having a length of about 10, about 15, about 20, about 25, or about 30 nucleotides. In certain embodiments, the siRNA of the present invention comprises a sense strand and / or an antisense strand, each having a length of about 15 to about 25 nucleotides. In certain embodiments, the siRNA of the present invention comprises a sense strand and an antisense strand, each having a length of about 20 nucleotides. In certain embodiments, the sense strand and the antisense strand of the siRNA are the same length. In other embodiments, the sense strand and the antisense strand of the siRNA are different lengths.

[0169] In certain exemplary embodiments, the siRNA of the present invention comprises an antisense strand having a length of more than 15 nucleotides and comprising or consisting of more than 50% to less than 85% 2'-O-methyl modified nucleotides, and a sense strand having a length shorter than the antisense strand, wherein the length of the sense strand is at least about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In certain embodiments, the sense strand is 14 nucleotides in length. In certain embodiments, the sense strand is 15 nucleotides in length. In certain embodiments, the sense strand is 16 nucleotides in length. In certain embodiments, the sense strand is 17 nucleotides in length. In certain embodiments, the sense strand is 18 nucleotides in length. In certain embodiments, the sense strand is 19 nucleotides in length. In certain embodiments, the sense strand is 20 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises an antisense strand having a length of about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In certain embodiments, the antisense strand is 20 nucleotides in length. In certain embodiments, the antisense strand is 21 nucleotides in length. In certain embodiments, the antisense strand is 22 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises more than 50% to less than 85% 2'-O-methyl modified nucleotides, an antisense strand having a length of about 18 to about 25 nucleotides, and a sense strand having a length of about 13 to about 20 nucleotides. In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 20 nucleotides in length and a sense strand that is about 15 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 20 nucleotides in length and a sense strand that is about 18 nucleotides in length.

[0170] In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 22 nucleotides in length and a sense strand that is about 20 nucleotides in length. In certain embodiments, the siRNA of the present invention comprises an antisense strand that is about 21 nucleotides in length and a sense strand that is about 16 nucleotides in length.

[0171] In certain embodiments, the siRNA of the invention comprises an antisense strand that is 20 nucleotides in length and a sense strand that is 15 nucleotides in length.

[0172] In certain embodiments, the siRNA of the invention comprises an antisense strand that is 21 nucleotides in length and a sense strand that is 16 nucleotides in length.

[0173] As used herein, the term "chemically modified nucleotide" or "nucleotide analog" or "altered nucleotide" or "modified nucleotide" refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Examples of nucleotide analogs are modified at any position to alter certain chemical properties of the nucleotide while maintaining the ability of the nucleotide analog to perform its intended function. Examples of nucleotide positions that can be derivatized include the 5-position, e.g., 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine, etc.; the 6-position, e.g., 6-(2-amino)propyluridine; and the 8-position for adenosine and / or guanosine, e.g., 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deazanucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyladenosine, or otherwise known in the art) nucleotides; and other heterocycle-modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0174] Nucleotide analogs may also contain modifications to the sugar portion of the nucleotide. For example, the 2'-OH group (2'-hydroxy) may be replaced with H (2'-deoxy) or a group selected from R, F (2'-fluoro), Cl, Br, I, SH, SR, NH, NHR, NR, or COOR (wherein R is substituted or unsubstituted C-C alkyl, alkenyl, alkynyl, aryl, etc.). Other possible modifications include those described in U.S. Patents 5,858,988 and 6,291,438.

[0175] As used herein, the term "metabolically stabilized" refers to RNA molecules that contain 2'-ribose modifications that replace the native 2'-hydroxyl group with a 2'-O-methyl group, a 2'-fluoro group, and / or a 2'-deoxy group.

[0176] Similarly, the term "stabilized" refers to an RNA molecule containing a 2'-ribose modification that replaces the 2'-hydroxyl group with a 2'-O-methyl or a group that is neither 2'-O-methyl nor 2-hydroxyl. The term "fully stabilized" or "fully modified" refers to an RNA molecule that contains a 2'-modification at every position, generally greater than 50% to less than 85% 2'-O-methyl modified. In some embodiments, a fully stabilized RNA molecule may contain one, two, or three non-2'-O-methyl modified nucleotides, such as 2'-F or 2'-H modified nucleotides. The term "nearly fully stabilized" or "nearly fully modified" refers to an RNA molecule that contains one, two, or three positions that do not have a 2'-modification, generally at least 85% 2'-O-methyl modified. The oligonucleotides described herein can be stabilized, metabolically stabilized, near-fully stabilized, and / or fully stabilized.

[0177] In certain embodiments, the double-stranded region of siRNA comprises one or more non-2'-O-methyl modifications and / or more than 50% 2'-O-methyl modifications to less than 85% 2'-O-methyl modifications, 2'-methoxy (2'-O-methyl) modifications.In some exemplary embodiments, antisense strand comprises about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83% or about 84% 2'-methoxy modifications.In some embodiments, sense strand comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% 2'-methoxy modifications.

[0178] In one embodiment, an oligonucleotide is provided that contains 2'-fluoro or 2'-deoxy modifications at one or more nucleotides at positions 2, 4, 5, 6, 14, and 16 from the 5' end, and 2'-methoxy modifications at each of the other nucleotide positions.In one exemplary embodiment, an antisense strand is provided that contains three 2'-fluoro modifications and more than 50% to less than 85% non-2'-fluoro modifications (e.g., 2'-methoxy modifications).In one exemplary embodiment, an antisense strand is provided that contains four 2'-fluoro modifications and more than 50% to less than 85% non-2'-fluoro modifications (e.g., 2'-methoxy modifications).In one exemplary embodiment, an antisense strand is provided that contains five 2'-fluoro modifications and more than 50% to less than 85% non-2'-fluoro modifications (e.g., 2'-methoxy modifications). In certain exemplary embodiments, an antisense strand is provided that includes 6 2'-fluoro modifications and greater than 50% to less than 85% non-2'-fluoro modifications (eg, 2'-methoxy modifications).

[0179] In certain exemplary embodiments, an antisense strand is provided that contains 3, 4, 5, or 6 non-2'-O-methyl modifications (2'-F, 2'-H, or 2'-OH) and greater than 50% to less than 85% 2'-O-methyl modifications.

[0180] As used herein, the term "phosphorothioate" refers to a nucleotide phosphate group modified by replacing the oxygen of the phosphate group with one or more sulfurs. Phosphorothioates further contain a cationic counterion (e.g., sodium, potassium, calcium, magnesium, etc.). The term "phosphorothioated nucleotide" refers to a nucleotide having one or two phosphorothioate linkages to another nucleotide. In some embodiments, the single-stranded tail of the siRNA of the present invention comprises or consists of phosphorothioated nucleotides. In some embodiments, the double-stranded oligonucleotides described herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphorothioated nucleotides in the double-stranded region. In some embodiments, the double-stranded oligonucleotides described herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphorothioated nucleotides in the double-stranded region and one or more single-stranded tails comprising or consisting of phosphorothioated nucleotides.

[0181] In certain embodiments, the compounds, oligonucleotides, and nucleic acids described herein can be modified to contain one or more internucleotide linkages as provided in Figure 3. In certain embodiments, the compounds, oligonucleotides, and nucleic acids described herein contain one or more internucleotide linkages selected from phosphodiester and phosphorothioate.

[0182] For example, certain internucleotide linkages provided herein, including phosphodiester and phosphorothioate, are capable of reacting at physiological pH. -It is understood that the cationic moiety has a formal charge of 1, which is balanced by a cationic moiety, for example, an alkali metal such as sodium or potassium, an alkaline earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.

[0183] The term " lipid preparation " used herein can refer to the liposome preparation, for example, liposome is used to form aggregates with nucleic acid to promote the penetration of nucleic acid into cells.Without being bound by theory, liposome is useful for cell penetration because its phospholipid bilayer can easily fuse with the phospholipid bilayer of cell membrane, thereby allowing nucleic acid to penetrate into cells.

[0184] siRNA patterns 2 to 5 Patterns 2-5 and exemplary Patterns 2A-2F, 3A-3F, 4A-4F and 5A-5F embodiments are reproduced below, where "mN" is a 2'-O-methyl modified nucleotide, "xN" is a non-2'-O-methyl modified nucleotide such as a 2'-fluoro modified nucleotide or a 2'-deoxy modified nucleotide, "#" is a phosphorothioate backbone modification, and "N" is a nucleotide selected from A, U, G or C: Pattern 2 Antisense 5'→3' (mN)(mN)(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(Xn)(mN)(mN)(mN)(mN)(mN)(mN) Sense 5'→3' (mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) Pattern 3 Antisense 5'→3' (mN)(xN)(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN) Sense 5'→3' (mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) Pattern 4 Antisense 5'→3' (mN)(xN)(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)(xN)(mN)(mN)(mN)(mN) Sense 5'→3' (mN)(mN)(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN) Pattern 5 Antisense 5'→3' (mN)(xN)(mN)(mN)(mN)(xmN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN) Sense 5'→3' (mN)(mN)(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)

[0185] In certain embodiments, the above patterns 2 to 5 may comprise an antisense strand of 20 to 22 nucleotides, wherein the antisense strand is extended from the 3' end with 2'-O-methyl modified nucleotides. A 20-nucleotide antisense strand is shown above. In certain embodiments, the above patterns 2 to 5 may comprise a sense strand of 15 to 20 nucleotides, wherein the sense strand is extended from the 3' end with 2'-O-methyl modified nucleotides. A 15-nucleotide sense strand is shown above. In certain embodiments, the above antisense strand may comprise one or more phosphorothioate linkages # at the 5' and / or 3' end. In certain embodiments, the above sense strand may comprise one or more phosphorothioate linkages # at the 5' and / or 3' end. In certain embodiments, the 5'-terminal nucleotide of the antisense strand may comprise 5'-vinylphosphonate, 5'-OH, or 5'-phosphorothioate (5'PS). In certain embodiments, the 3'-terminal nucleotide of the antisense strand may comprise a non-2'-O-methyl modified nucleotide. In further embodiments, the siRNA of Patterns 2 to 5 may be a branched siRNA structure comprising two or more linked siRNAs of Patterns 2 to 5. In certain embodiments, the siRNA of Patterns 2, 3, 4, or 5 comprises two siRNAs having a linker connecting the two siRNAs via the 3'-end of the sense strand, and is a bibranched siRNA of Patterns 2, 3, 4, or 5.

[0186] Exemplary Pattern 2, 3, 4, and 5 embodiments ("A", "B", "C", "D", "E", and "F" variants) are shown below. Pattern 3 includes the "G" and "H" variants: P2A Antisense 5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2B アンチセンス5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2C アンチセンス5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2D アンチセンス5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2E アンチセンス5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2F アンチセンス5'→3' (mN)#(mN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3A アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3B アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3C アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3D アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3E アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3F アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3G アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) P3H アンチセンス5'→3' (mN)#(xN)#(mN)(xN)(xN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) P4A アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(xN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4B アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(xN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4C アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(xN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4D アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(xN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4E アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4F アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(xN)(xN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5A アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xmN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5B アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5C アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5D アンチセンス5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(xN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5E Antisense 5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5F Antisense 5'→3' (mN)#(xN)#(mN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(xN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(xN)(xN)(mN)(mN)(xN)(mN)(mN)(mN)(mN)#(mN)#(mN)

[0187] siRNA design In some embodiments, the oligonucleotide molecule of the present invention is an siRNA duplex consisting of a sense strand and a complementary antisense strand, wherein the antisense strand is sufficiently complementary to mRNA to mediate RNAi. In some exemplary embodiments, each strand of the siRNA molecule independently has a length of about 10 to 50 or more nucleotides, i.e., each strand independently contains 10 to 50 nucleotides (or nucleotide analogs, or a combination of nucleotides and nucleotide analogs). In other exemplary embodiments, the siRNA molecule independently has a length of about 16 to 30 nucleotides, for example, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, wherein one of the strands is sufficiently complementary to the target region to mediate RNAi.

[0188] In some exemplary embodiments, the strands are aligned such that at least 4, 5, 6, 7, 8, 9, 10, or more bases at the end of one or both strands are unaligned (i.e., there are no complementary bases on the opposite strand), resulting in an overhang of 4, 5, 6, 7, 8, 9, 10, or more residues at one or both ends of the duplex when the strands are annealed. In some exemplary embodiments, the siRNA molecules have a length of about 10 to 50 or more nucleotides, i.e., each strand independently contains 10 to 50 nucleotides (or nucleotide analogs, or a combination of nucleotides and nucleotide analogs). In exemplary embodiments, the siRNA molecules have a length of about 16 to 30, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, where one strand is substantially complementary to the target sequence and the other strand is identical or substantially identical to the first strand.

[0189] In other exemplary embodiments, the siRNA molecule has a length of about 15 to about 25, or about 16 to about 25, or, for example, independently, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides per strand, where one strand is sufficiently complementary to the target region to mediate RNAi. In certain exemplary embodiments, the strands are aligned such that at least 4, 5, 6, 7, 8, 9, 10, or more bases at the end of one or both strands are unaligned (i.e., there are no complementary bases on the opposite strand), resulting in an overhang of 4, 5, 6, 7, 8, 9, 10, or more residues at one or both ends of the duplex when the strands are annealed.

[0190] Generally, siRNAs can be designed using any method known in the art, for example, by using the following protocol.

[0191] 1. The siRNA must be specific to the target sequence. The first strand must be complementary to the target sequence, and the other strand is substantially complementary to the first strand. Exemplary target sequences are selected from the 5'-untranslated region (5'-UTR) or intron region of a target gene, such as a target gene containing a mutation. Cleavage of mRNA at these locations should preclude translation of the corresponding mutant protein. Target sequences from other regions of the target gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with a low G / C content (35-55%) may be more active than those with a G / C content higher than 55%. Thus, in certain embodiments, the present invention encompasses nucleic acid molecules having a G / C content of 35-55%.

[0192] 2. The sense strand of the siRNA is designed based on the sequence of the selected target site. In exemplary embodiments, the sense strand comprises about 13 to about 20, about 13 to about 18, about 13 to about 15, about 15 to about 20, or about 15 to about 18 nucleotides, e.g., 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In certain embodiments, the sense strand comprises about 19 to 25 nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides. In certain embodiments, the sense strand comprises 19, 20, or 21 nucleotides. However, those skilled in the art will recognize that siRNAs shorter than 19 nucleotides, e.g., 13, 14, 15, 16, 17, or 18 nucleotides in length, or longer than 25 nucleotides, can also function to mediate RNAi. Therefore, siRNAs of such lengths are within the scope of the present invention as long as they retain the ability to mediate RNAi. Long RNA silencing agents have been shown to induce potentially unwanted interferon or protein kinase R (PKR) response in some mammalian cells.In some exemplary embodiments, the RNA silencing agents of the present invention do not induce PKR response (i.e., are sufficiently short in length).However, for example, in the cell type that cannot generate PRK response or the situation where PKR response is downregulated or suppressed by other means, long RNA silencing agents can be useful.

[0193] The siRNA molecule of the present invention has sufficient complementarity with the target sequence so that the siRNA can mediate RNAi.Generally, siRNA is suitable that comprises a nucleotide sequence that is sufficiently identical to the target sequence portion of the target gene to perform RISC-mediated cleavage of the target gene.Therefore, in exemplary embodiments, the sense strand of siRNA is designed to have a sequence that is sufficiently identical to a portion of the target.For example, the sense strand can have 100% identity to the target site.However, 100% identity is not necessary.More than 80% identity between the sense strand and the target RNA sequence, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity is suitable.The present invention has the advantage that it can tolerate some sequence diversity to enhance the efficiency and specificity of RNAi. In some embodiments, the sense strand has 4, 3, 2, 1 or 0 mismatched nucleotides with the target region, such as the target region that has at least 1 base pair difference between wild type and mutant allele, and the other strand is identical or substantially identical to the first strand.In addition, the siRNA sequence that has small insertion or deletion of 1 or 2 nucleotides can also be effective for mediating RNAi.Alternatively, the siRNA sequence that has nucleotide analogue substitution or insertion can also be effective for inhibition.

[0194] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into the first or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., percent (%) homology = number of identical positions / total number of positions × 100), optionally penalizing the score for the number of gaps introduced and / or the length of the gaps introduced.

[0195] The sequence comparison and percent identity determination between two sequences can be achieved using a mathematical algorithm. In some embodiments, alignment is made over the portion of the aligned sequence that has sufficient identity, but not over the portion that has a low degree of identity (i.e., local alignment). An illustrative, non-limiting example of a local alignment algorithm used for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0196] In other embodiments, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the entire length of the aligned sequences (i.e., gapped alignment). To obtain gapped alignments for comparison purposes, gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In other embodiments, the alignment is optimized by introducing appropriate gaps, and the percent identity is determined over the entire length of the aligned sequences (i.e., global alignment). An illustrative, non-limiting example of a mathematical algorithm used for global comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0197] 3. The antisense or guide strand of siRNA is usually the same length as the sense strand and comprises complementary nucleotides.In some embodiments, the strands of siRNA are paired in such a way that they have a 3' overhang of 4-15 nucleotides, for example, 4, 5, 6 or 7 nucleotides.In some embodiments, the antisense or guide strand of siRNA is longer than the sense strand.

[0198] 4. Compare potential targets to the appropriate genome database (human, mouse, rat, etc.) using any method known in the art and eliminate from consideration any target sequences that have significant homology to other coding sequences. One such method for such sequence homology searching is known as BLAST, available at the National Center for Biotechnology Information website.

[0199] 5. Select one or more sequences that meet the evaluation criteria.

[0200] Further general information regarding the design and use of siRNAs can be found in "The siRNA User Guide," available at the Max-Plank-Institut für Biophysikalishe Chemie website.

[0201] Alternatively, siRNA may be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing to a target sequence (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C hybridization for 12-16 hours; followed by washing). Further exemplary hybridization conditions include hybridization in 1×SSC at 70°C or 1×SSC, 50% formamide at 50°C, followed by washing in 0.3×SSC at 70°C, or hybridization in 4×SSC at 70°C or 4×SSC, 50% formamide at 50°C, followed by washing in 1×SSC at 67°C. The hybridization temperature for hybrids predicted to be less than 50 base pairs in length should be 5-10°C lower than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following formula: For hybrids less than 18 base pairs in length, Tm (°C) = 2 (number of A+T bases) + 4 (number of G+C bases). For hybrids 18-49 base pairs in length, Tm (°C) = 81.5 + 16.6 (log 10 [Na+]) + 0.41 (% G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the sodium ion concentration in the hybridization buffer ([Na+] = 0.165M in 1x SSC). Further examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, which are incorporated herein by reference.

[0202] Negative control siRNA must have the same nucleotide composition as siRNA, but does not have significant sequence complementarity with appropriate genome.Such negative control can be designed by random scrambling of the nucleotide sequence of selected siRNA.Homology search can be carried out to ensure that negative control lacks homology with any other gene in appropriate genome.In addition, negative control siRNA can be designed by introducing one or more base mismatches into sequence.

[0203] 6. To verify the effectiveness of an siRNA in disrupting a target mRNA (e.g., a wild-type or mutant target mRNA), the siRNA can be incubated with a target cDNA in a Drosophila-based in vitro mRNA expression system. 32 Newly synthesized target mRNA radiolabeled with P is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Suitable controls include omitting the siRNA and using non-targeting cDNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but lacks significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by random scrambling of the nucleotide sequence of the selected siRNA. A homology search can be performed to ensure that the negative control lacks homology to any other genes in the appropriate genome. Additionally, a negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0204] Modified Nucleotides In some embodiments, oligonucleotide, for example, siRNA, comprises one or more chemically modified nucleotides.In some embodiments, oligonucleotide is composed of chemically modified nucleotides.In some exemplary embodiments, more than 90%, more than 98%, more than 97%, more than 96%, more than 95%, more than 90%, more than 85%, more than 80%, more than 75%, more than 70%, more than 65%, more than 60%, more than 55% or more than 50% of oligonucleotide comprises chemically modified nucleotides.In some exemplary embodiments, 100% of oligonucleotide comprises chemically modified nucleotides. In some embodiments, the sense strand and the sense strand of anti-siRNA each comprise one or more chemically modified nucleotides.In some embodiments, each nucleotide of the sense strand and the antisense strand is chemically modified.In some embodiments, the antisense strand comprises 2'-methoxy nucleotide and 2'-fluoro nucleotide.In some embodiments, the sense strand comprises 2'-methoxy nucleotide.In some embodiments, the nucleotide at position 1 and 2 from the 5' end of the sense and antisense strands is linked to the adjacent nucleotide by phosphorothioate bond.In some embodiments, the 5' end and 3' end of the nucleotide is linked to the adjacent nucleotide by phosphorothioate bond.

[0205] Delivery and Distribution In another aspect, provided herein is a method for selectively delivering a nucleic acid described herein to a specific organ in a patient, comprising administering to the patient an oligonucleotide described herein such that the oligonucleotide is selectively delivered. In one embodiment, the organ is the liver. In another embodiment, the organ is the kidney. In another embodiment, the organ is the spleen. In another embodiment, the organ is the heart. In another embodiment, the organ is the brain. In another embodiment, the organ is the placenta.

[0206] The compositions described herein facilitate simple, efficient, non-toxic delivery of metabolic oligonucleotides and potent silencing of therapeutic targets in a wide range of tissues in vivo.

[0207] In another aspect, provided herein is a method for selective in vivo delivery of a compound described herein to a target organ, tissue, or cell, comprising administering the compound to a subject.

[0208] In certain embodiments, the method is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% selective for the target organ, i.e., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the oligonucleotides administered to the subject are located in the target organ.

[0209] In certain exemplary embodiments, the compound or pharmaceutical composition is administered by intravenous, intraperitoneal, intracranial, intrathecal, intrastriatal, or intracerebroventricular injection. In certain embodiments, the compound or pharmaceutical composition is administered by intracerebroventricular injection.

[0210] Synthetic oligonucleotides can be delivered to cells by methods known in the art, including cationic liposome transfection and electroporation. To achieve long-term target gene suppression and facilitate delivery under certain circumstances, one or more oligonucleotides can be expressed intracellularly from a recombinant DNA construct. Methods for expressing oligonucleotide duplexes, such as siRNA duplexes, intracellularly from a recombinant DNA construct to enable long-term target gene suppression in cells are known in the art, including systems containing mammalian Pol III promoters capable of expressing functional double-stranded iRNAs (e.g., H1 or U6 / snRNA promoter systems (Tuschl, T., 2002, supra); (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra). RNA Pol III transcription termination occurs at runs of four consecutive T residues in the DNA template, providing a mechanism for terminating siRNA transcripts at specific sequences. The siRNA is complementary to the target gene sequence in the 5'-3' and 3'-5' orientations, and the two strands of the siRNA can be expressed in the same or separate constructs. Hairpin siRNAs expressed in cells driven by the H1 or U6 snRNA promoter can inhibit target gene expression (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra). Constructs containing siRNA sequences under the control of a T7 promoter also produce functional siRNA when cotransfected into cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra).A single construct may contain multiple siRNA-encoding sequences, such as multiple regions of a gene encoding a target, targeting the same gene or multiple genes, and may be driven, for example, by separate Pol III promoter sites.

[0211] Viral delivery mechanisms can also be used to induce specific silencing of target genes through the expression of oligonucleotides, for example, by producing recombinant adenoviruses carrying oligonucleotides under the transcriptional control of an RNA Pol II promoter (Xia et al., 2002, supra). Infection of HeLa cells with these recombinant adenoviruses can reduce endogenous target gene expression. Injection of recombinant adenovirus vectors into transgenic mice expressing the oligonucleotide target gene results in reduced target gene expression in vivo. In animal models, whole embryo electroporation can efficiently deliver synthetic siRNA to postimplantation mouse embryos (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by a "high-pressure" delivery technique, which involves rapid injection (within 5 seconds) of a large volume of oligonucleotide-containing solution into the animal via the tail vein (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Nanoparticles and liposomes can also be used to deliver oligonucleotides to animals. In some exemplary embodiments, recombinant adeno-associated viruses (rAAV) and their related vectors can be used to deliver one or more siRNAs to cells, such as neuronal cells (e.g., brain cells) (U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766).

[0212] Modified Oligonucleotides In some embodiments of the present invention, the RNA silencing agents of the present invention (or any portion thereof), such as siRNA, described herein, can be modified to further improve the activity of the RNA silencing agent. For example, the RNA silencing agents can be modified with any of the modifications described herein. Modifications can, in part, further enhance target discrimination, enhance the stability of the agent (e.g., prevent degradation), promote cellular uptake, enhance targeting efficiency, improve binding efficiency (e.g., to the target), improve patient tolerance of the agent, and / or reduce toxicity.

[0213] 1) Modifications that enhance target discrimination In some embodiments, the oligonucleotides of the present invention can be substituted with destabilizing nucleotides to enhance single-nucleotide target discrimination (see U.S. Provisional Application No. 11 / 698,689, filed January 25, 2007; U.S. Provisional Application No. 60 / 762,225, filed January 25, 2006; and PCT / US19 / 46013, filed August 9, 2019, each of which is incorporated herein by reference). Such modifications can be sufficient to eliminate the specificity of the oligonucleotide to non-target mRNAs (e.g., wild-type mRNAs) without significantly affecting the specificity of the oligonucleotide to target mRNAs (e.g., gain-of-function mutant mRNAs).

[0214] In some exemplary embodiments, the oligonucleotide of the present invention is modified by introducing at least one universal nucleotide into the antisense strand. A universal nucleotide contains a base moiety that can indiscriminately base pair with any of the four common nucleotide bases (e.g., A, G, C, U). Universal nucleotides are suitable because they have relatively little effect on the stability of an RNA duplex or a duplex formed by the guide strand of an RNA silencing agent and a target mRNA. Exemplary universal nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In an exemplary embodiment, the universal nucleotide is an inosine residue or a naturally occurring analog thereof.

[0215] In some embodiments, the oligonucleotide of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides from the specificity discriminator nucleotide (i.e., the nucleotide that recognizes disease-related polymorphism).For example, the destabilizing nucleotide can be introduced within 5, 4, 3, 2, or 1 nucleotide from the specificity discriminator nucleotide.In exemplary embodiments, the destabilizing nucleotide is introduced at a position 3 nucleotides from the specificity discriminator nucleotide (i.e., there are two stabilizing nucleotides between the discriminator nucleotide and the specificity discriminator nucleotide).In RNA silencing agents having two strands or strand portions (such as siRNA and shRNA), the destabilizing nucleotide can be introduced into the strand or strand portion that does not contain the specificity discriminator nucleotide.In some exemplary embodiments, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity discriminator nucleotide.

[0216] In some embodiments, the RNA silencing agent of the present invention is modified by introducing at least one destabilizing nucleotide within 11 nucleotides of the specificity discriminator nucleotide (e.g., within 11 nucleotides of the nucleotide that recognizes a disease-related polymorphism (e.g., the SNP position nucleotide)). For example, the destabilizing nucleotide can be introduced within 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide from the specificity discriminator nucleotide. In exemplary embodiments, the destabilizing nucleotide is introduced at a position that is 3 nucleotides from the specificity discriminator nucleotide (i.e., there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity discriminator nucleotide). In RNA silencing agents having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced into the strand or strand portion that does not contain the specificity discriminator nucleotide. In a particularly exemplary embodiment, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity discriminator nucleotide.

[0217] In certain embodiments, the RNA silencing agent of the present invention has Formula 1: [ka] [During the ceremony, D is selected from the group consisting of O, OCH2, OCH2, CH2, and CH; C is O - , OH, OR 1 , N.H. - , NH2, S - and SH; A is selected from the group consisting of O and CH2; R 1 is a protecting group; and --- is an optional double bond. wherein the nucleotide sequence is modified by the introduction of a modified intersubunit linkage, which bridges two optionally modified nucleosides.

[0218] In some embodiments, C is O -If so, then A or D is not O.

[0219] In certain embodiments, D is CH2.

[0220] In certain embodiments, D is O.

[0221] In certain embodiments, D is OCH2.

[0222] In other embodiments, the modified intersubunit linkage of Formula VIII is represented by Formula 2: [ka] The modified intersubunit bond of

[0223] In other embodiments, the modified intersubunit linkage of Formula VIII is represented by Formula 3: [ka] The modified intersubunit bond of

[0224] In other embodiments, the modified intersubunit linkage of Formula VIII is represented by Formula 4: [ka] The modified intersubunit bond of

[0225] In other embodiments, the modified intersubunit linkage has Formula 5: [ka] is a modified intersubunit bond.

[0226] In other embodiments, the modified intersubunit linkage has the formula 6: [ka] The modified intersubunit bond of

[0227] In other embodiments, the modified intersubunit linkage of formula VII is formula 7: [ka] The modified intersubunit bond of

[0228] In certain embodiments, an RNA silencing agent of the invention is modified by the introduction of one or more of the intersubunit linkers of Figure 15. In an exemplary embodiment, the intersubunit linker of Figure 15 is inserted between the SNP position nucleotide and the nucleotides located immediately adjacent to and on either side of the SNP position nucleotide in the antisense strand.

[0229] In certain embodiments, the RNA silencing agent of the present invention comprises a nucleotide sequence of the following formula in the intersubunit linker: [ka] The amino acid sequence is modified by the introduction of one or more vinylphosphonate (VP) motifs having the formula:

[0230] In some embodiments, the VP motif can be inserted into any position of an oligonucleotide, such as an RNA. For example, for an oligonucleotide having a length of 20 nucleotides, the VP motif can be introduced into positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, or 19-20, and any combination thereof.

[0231] In certain exemplary embodiments, the VP motif is inserted in one or more of positions 1-2, 5-6, 6-7, 10-11, 18-19, and / or 19-20 of the antisense strand.

[0232] In other exemplary embodiments, a VP motif is inserted at one or more of positions 1-2, 6-7, 10-11 and / or 19-20 of the antisense strand.

[0233] In an exemplary embodiment, the VP motif is inserted adjacent to the SNP position nucleotide of the antisense strand (i.e., between the SNP position nucleotide and the nucleotides immediately adjacent to and on either side of it). In another exemplary embodiment, the VP motif is inserted adjacent to the MM position nucleotide of the antisense strand (i.e., between the MM position nucleotide and the nucleotides immediately adjacent to and on either side of it).

[0234] 2) Modifications to enhance efficacy and specificity In some embodiments, siRNA of the present invention can be modified according to asymmetric design rules to promote the enhancement of the effectiveness and specificity of RNAi (see U.S. Patent No. 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705).This modification promotes the entry of the antisense strand of siRNA (for example, the siRNA produced by the siRNA or shRNA designed by the method of the present invention) into RISC in preference to the sense strand, so that the antisense strand preferentially guides the cleavage or translational suppression of target mRNA, thereby increasing or improving the efficiency of target cleavage and silencing. In certain embodiments, the asymmetry of the RNA silencing agent is enhanced by reducing the base pair strength between the 5' end of the antisense strand (AS 5') and the 3' end of the sense strand (S 3') of the RNA silencing agent relative to the bond strength or base pair strength between the 3' end of the antisense strand (AS 3') and the 5' end of the sense strand (S '5') of the RNA silencing agent.

[0235] In some embodiments, the asymmetry of the siRNA of the present invention can be enhanced so that there are fewer G:C base pairs between the 5'-end of the first or antisense strand and the 3'-end of the sense strand than between the 3'-end of the first or antisense strand and the 5'-end of the sense strand. In other embodiments, the asymmetry of the RNA silencing agent of the present invention can be enhanced so that there is at least one mismatched base pair between the 5'-end of the first or antisense strand and the 3'-end of the sense strand. In some exemplary embodiments, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In other embodiments, the asymmetry of the siRNA of the present invention can be enhanced so that there is at least one wobble base pair, for example, G:U, between the 5'-end of the first or antisense strand and the 3'-end of the sense strand. In other embodiments, the asymmetry of the RNA silencing agent of the present invention can be enhanced so that there is at least one base pair containing a rare nucleotide, for example, inosine (I). In some exemplary embodiments, base pair is selected from the group consisting of I:A, I:U and I:C.In still other embodiments, the asymmetry of the siRNA of the present invention can be enhanced by having at least one base pair that comprises modified nucleotide.In some exemplary embodiments, modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G and 2,6-diamino-A.

[0236] In certain embodiments, the RNA silencing agent of the present invention comprises a linker having the following formula to one or more inter-subunit linkages in the oligonucleotide: [ka] The VP motif is modified by the introduction of the VP motif having the following structure:

[0237] 3) RNA silencing agents with enhanced stability The RNA silencing agent (e.g., siRNA) described herein can be further modified to improve stability in serum or cell culture medium.To enhance stability, the 3'-residue can be stabilized against degradation, and can be selected to be composed of, for example, purine nucleotides, particularly adenosine or guanosine nucleotides.Alternatively, the substitution of pyrimidine nucleotides with modified analogs, for example, the substitution of uridine with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNA interference.

[0238] In exemplary embodiments, the present invention relates to an RNA silencing agent (e.g., siRNA) comprising a first and second strand, wherein the second strand and / or the first strand are modified by substituting an internal nucleotide with a modified nucleotide, so that the in vivo stability is enhanced compared to the corresponding unmodified RNA silencing agent.As defined herein, an "internal" nucleotide is one that is located at any position other than the 5'-end or 3'-end of a nucleic acid molecule, polynucleotide, or oligonucleotide.Internal nucleotides can be within a single-stranded molecule or within a strand of a double-stranded or double-stranded molecule.In some embodiments, the sense strand and / or antisense strand are modified by substituting at least one internal nucleotide.In other embodiments, the sense strand and / or antisense strand are modified by substituting at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more internal nucleotides. In other embodiments, the sense and / or antisense strands are modified by substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of their internal nucleotides. In yet other embodiments, the sense and / or antisense strands are modified by substitution of all internal nucleotides.

[0239] In exemplary embodiments of the present invention, RNA silencing agent (for example, siRNA) can comprise at least one modified nucleotide analogue.Nucleotide analogue can be located at the position of, for example, the 5'-end and / or 3'-end region of RNA silencing agent (for example, siRNA), so that target-specific silencing activity, for example, RNAi-mediated activity or translational repression activity, is not substantially affected.In some embodiments, the end can be stabilized by incorporating modified nucleotide analogue.

[0240] In certain embodiments, the RNA silencing agent of the present invention comprises a nucleotide sequence of the following formula: [ka] The VP motif is modified by the introduction of the VP motif having the following structure:

[0241] A variety of oligonucleotide types (e.g., gapmers, mixmers, miRNA inhibitors, splice-switching oligonucleotides ("SSOs"), phosphorodiamidate morpholino oligonucleotides ("PMOs"), peptide nucleic acids ("PNAs"), etc.) can be used in the oligonucleotides described herein, optionally using various combinations of modifications (e.g., chemical modifications) and / or conjugations described herein and in, for example, U.S. Application No. 15 / 089,423; U.S. Application No. 15 / 236,051; U.S. Application No. 15 / 419,593; U.S. Application No. 15 / 697,120 and U.S. Patent No. 9,809,817; and U.S. Application No. 15 / 814,350 and U.S. Patent No. 9,862,350 (each of which is incorporated herein by reference in its entirety for all purposes).

[0242] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., containing modifications to the phosphate-sugar backbone). For example, the phosphodiester linkage of natural RNA can be modified to include at least one nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, the phosphoester group attached to an adjacent ribonucleotide is replaced with a modified group, e.g., a phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2'-OH-group is replaced with H or a group selected from R, halo, SH, SR, NH, NHR, NR, or ON (where R is C-C alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I). Examples of suitable sugar modifications according to certain exemplary embodiments are shown in Figure 2.

[0243] In certain embodiments, the modification is 2'-fluoro, 2'-amino and / or 2'-thio modification.Specific exemplary modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine and / or 5-amino-allyl-uridine.In certain embodiments, the 2'-fluoro ribonucleotide is all uridine and cytidine.Further exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine and 5-fluoro-uridine. 2'-deoxy-nucleotide and 2'-OMe nucleotide can also be used in the modified RNA-silencing agent of the present invention.Additional modified residues include deoxy-abasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside and ribavirin.In some exemplary embodiments, the 2' portion is a methyl group, so that the linking portion is a 2'-O-methyl oligonucleotide.

[0244] In exemplary embodiments, the RNA silencing agents described herein include locked nucleic acids (LNAs). LNAs contain sugar-modified nucleotides that are resistant to nuclease activity (highly stable) and have single-nucleotide discrimination against mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules have 2'-O,4'-C-ethylene-bridged nucleic acids and can be modified with 2'-deoxy-2"-fluorouridine. Furthermore, LNAs constrain the sugar moiety in a 3'-end conformation, thereby pre-arranging the nucleotide for base pairing and increasing the melting temperature of the oligonucleotide by as much as 10°C per base, thereby increasing the specificity of the oligonucleotide.

[0245] In another exemplary embodiment, the RNA silencing agent described herein comprises peptide nucleic acid (PNA). PNA comprises modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced with a neutral 2-aminoethylglycine moiety, which can form a polyamide backbone, which is highly resistant to nuclease digestion and contributes to improving binding specificity to molecules (Nielsen, et al., Science, (2001), 254: 1497-1500).

[0246] Also an example is nucleobase-modified ribonucleotide, i.e., ribonucleotide, which contains at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase.The base can be modified to block the activity of adenosine deaminase.Exemplary modified nucleobases include, but are not limited to, uridine and / or cytidine modifications at position 5, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modifications at position 8, such as 8-bromoguanosine; deazanucleotides, such as 7-deaza-adenosine; O- and N-alkylated nucleotides, such as N6-methyladenosine, are suitable.It should be noted that the above modifications can be combined.

[0247] In other embodiments, crosslinking can be used to modify the pharmacokinetics of RNA silencing agents, for example, to extend their half-life in the body.Therefore, the present invention includes RNA silencing agents having two complementary strands of nucleic acid, where the two strands are crosslinked.The present invention also includes RNA silencing agents that are conjugated or not (for example, at their 3' ends) to other moieties (for example, non-nucleic acid moieties such as peptides), organic compounds (for example, dyes), etc.).This modification of siRNA derivatives can improve the cellular uptake or enhance the cell targeting activity of the resulting siRNA derivatives compared to the corresponding siRNAs, and is useful for tracing iRNA derivatives in cells or improving the stability of siRNA derivatives compared to the corresponding siRNAs.

[0248] Other exemplary modifications include: (a) 2' modifications, such as providing a 2'-OMe moiety on a U in the sense or antisense strand, particularly the sense strand, or a 3' overhang, such as providing a 2'-OMe moiety at the 3' end (3' end means the 3' atom or the 3'-most portion of the molecule, e.g., the 3'-most P or 2' position, as indicated by the context); (b) backbone modifications, such as substituting S for O in a phosphate backbone, e.g., U or A or both, particularly providing phosphorothioate modifications in the antisense strand; e.g., substituting S for P; (c) substituting a C5 amino linker for U; (d) substituting G for A (particularly in embodiments where the sequence change is located in the sense strand and not in the antisense strand); and (d) modifications at the 2', 6', 7', or 8' position. Exemplary embodiments are those in which one or more of these modifications are present in the sense strand but not in the antisense strand, or the antisense strand has fewer such modifications. Still other exemplary modifications include a 3' overhang, e.g., the use of a methylated P at the 3' end; a 2' modification, e.g., the provision of a 2'-OMe moiety and a combination of modifying the backbone, e.g., by substituting P with S, e.g., the provision of a phosphorothioate modification, or the use of a 3' overhang, e.g., a methylated P at the 3' end; modification with a 3' alkyl; modification with a 3' overhang, e.g., a non-basic pyrrolidone at the 3' end; modification with naproxen, ibuprofen, or other moieties that prevent degradation at the 3' end.

[0249] 4) Modifications to enhance cellular uptake In other embodiments, the RNA silencing agents (e.g., siRNAs) described herein can be modified with chemical moieties, e.g., to enhance cellular uptake by target cells (e.g., neuronal cells). Thus, the present invention includes siRNAs that are unconjugated (e.g., at their 3' ends) or conjugated to other moieties (e.g., non-nucleic acid moieties such as peptides), organic compounds (e.g., dyes), etc. Conjugation is achieved by methods known in the art, for example, using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3):137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids bound to intercalators, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids bound to nanoparticles).

[0250] In certain embodiments, modifications to RNA silencing agents of the invention include a VP motif in one or more intersubunit linkers of the oligonucleotide, wherein the VP motif has the following formula: [ka] It has.

[0251] In certain embodiments, siRNA is conjugated to a lipophilic moiety. In some embodiments, the lipophilic moiety is a ligand containing a cationic group. In other embodiments, the lipophilic moiety is bound to one or both strands of siRNA. In exemplary embodiments, the lipophilic moiety is bound to one end of the sense strand of siRNA. In other exemplary embodiments, the lipophilic moiety is bound to the 3' end of the sense strand. In some embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin D, DHA, DHAg2 (PC DHA), DCA, DCAg2 (PC DCA), EPA, vitamin E, vitamin K, vitamin A, folic acid, or cationic dye (e.g., Cy3).

[0252] 5) Tethered Ligand Others can be tethered to the RNA silencing agents of the present invention. For example, ligands can be tethered to RNA silencing agents to improve hybridization thermodynamic stability with target nucleic acids, target specific tissues or cell types, or improve cell permeability, for example, via endocytosis-dependent or -independent mechanisms. Ligands and related modifications can also increase sequence specificity and, as a result, reduce off-site targeting. The tethered ligand can contain one or more modified bases or sugars that can function as intercalators. In some exemplary embodiments, these are located in internal regions, such as overhangs, of the RNA silencing agent / target duplex. The intercalator can be aromatic, for example, a polycyclic aromatic or heterocyclic aromatic compound. Polycyclic intercalators can have stacking strength and can include systems of two, three, or four fused rings. The universal bases described herein can be included in the ligand. In some embodiments, the ligand can contain a leaving group that contributes to target gene inhibition by cleaving the target nucleic acid. The leaving group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or metal ion chelating group.The metal ion chelating group can include, for example, Lu(III) or EU(III) macrocyclic complex, Zn(II) 2,9-dimethylphenanthroline derivative, Cu(II) terpyridine, or acridine, which can promote the selective cleavage of target RNA at the protrusion site by free metal ions such as Lu(III).In some embodiments, a peptide ligand is tethered to the RNA silencing agent, for example, to promote the cleavage of target RNA at the protrusion region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (e.g., via an amino acid derivative) to promote target RNA cleavage. The tethered ligand is an aminoglycoside ligand that can improve the hybridization properties or sequence specificity of the RNA silencing agent.Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine. The use of acridine analogs can increase sequence specificity. For example, neomycin B has a high affinity for RNA compared to DNA, but low sequence specificity. The acridine analog, neo-5-acridine, has increased affinity for the HIV Rev-response element (RRE). In some embodiments, a guanidine analog (guanidinoglycoside) of the aminoglycoside ligand is tethered to the RNA silencing agent. In guanidinoglycosides, the amino acid amine group is replaced with a guanidine group. The attachment of a guanidine analog can increase the cell permeability of the RNA silencing agent. The tethering ligand can be a poly-arginine peptide, peptoid, or peptidomimetic, which can enhance cellular uptake of an oligonucleotide agent.

[0253] Exemplary ligands are generally covalently bound to ligand-conjugated carriers, either directly or indirectly via intermediate tethers.In exemplary embodiments, ligands are bound to carriers via intermediate tethers.In exemplary embodiments, ligands change the distribution, targeting or life span of incorporated RNA silencing agents.In exemplary embodiments, ligands enhance the affinity of selected targets, for example, molecules, cells or cell types, compartments, for example, body cell or organ compartments, tissues, organs or regions, for example, compared with species that do not have such ligands.

[0254] Exemplary ligands can improve the transport, hybridization, and specificity of the resulting natural or modified RNA silencing agent or polymer molecule, including any combination of monomers and / or natural or modified ribonucleotides described herein, and can also improve nuclease resistance. Ligands can generally include, for example, therapeutic modifiers for enhancing uptake; diagnostic compounds or reporter groups for monitoring distribution; cross-linking agents; nuclease-resistance-conferring moieties; and natural or unusual nucleobases. Common examples include lipophilic groups, lipids, steroids (e.g., uvaol, hesigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelinol-derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein-binding agents, integrin-targeting molecules, polycationic groups, peptides, polyamines, and peptidomimetics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); amino acids or lipids. Ligands can also be synthetic molecules such as recombinant or synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer or polyphosphazine.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0255] Ligands can also include targeting groups, e.g., cell or tissue targeting agents, e.g., lectins, glycoproteins, lipids, or proteins, e.g., antibodies that bind to specific cell types such as kidney cells. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptidomimetic. Other examples of ligands include dyes, intercalators (e.g., acridine and substituted acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidinium aminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules, e.g., cholesterol (and its thioanalogues), cholic acid, cholanic acid, lithocholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono-, bis-, or tris-fatty acid esters, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19or C 20 fatty acids) and their ethers, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 or C 20 alkyl; e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., ante napedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, naproxen, vitamins, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraazamacrocyclic compounds, Eu 3+ complex), dinitrophenyl, HRP or AP.

[0256] Ligands can be proteins, e.g., glycoproteins or peptides, e.g., molecules with specific affinity for co-ligands, or antibodies, e.g., antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. Ligands can also include lipids, lectins, carbohydrates, vitamins, cofactors, and non-peptides, such as multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharide, p38 MAP kinase activator, or NF-κB activator.

[0257] The ligand can be, for example, a substance, such as a drug, that can increase the uptake of the RNA silencing agent into cells, for example, by disrupting the cytoskeleton of cells, for example, by partially disrupting the microtubules, microfilaments, and / or intermediate filaments of cells.The drug can be, for example, taxane, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.The ligand can increase the uptake of the RNA silencing agent into cells, for example, by activating an inflammatory response.Exemplary ligands that have such effects include tumor necrosis factor alpha (TNFα), interleukin-1 beta, or gamma interferon.

[0258] In some embodiments, the ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecules generally bind to serum proteins, such as human serum albumin (HSA). HSA-binding ligands allow the conjugate to be distributed to target tissues in the body, such as non-renal target tissues. For example, the target tissue can be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligands can (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) be used to regulate the binding to serum proteins, such as HSA. Lipid-based ligands can be used to regulate, for example, control, the binding of the conjugate to target tissues. In certain embodiments, the lipid-based ligand binds to HSA. However, it is desirable that the affinity is not so strong that the HSA-ligand binding is not reversible. In other exemplary embodiments, the lipid-based ligand binds weakly or not at all to HSA.

[0259] In other embodiments, the ligand is a moiety, such as a vitamin, that is taken up by target cells, for example, proliferating cells. These can be useful for treating disorders characterized by unwanted cell proliferation, for example, malignant or non-malignant types, such as cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamin B, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients that are taken up by cancer cells. Also included are HSA and low-density lipoprotein (LDL).

[0260] In other embodiments, the ligand is a cell-penetrating agent, generally a helical cell-penetrating agent. In some exemplary embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennapedia. If the agent is a peptide, it can be modified, including peptidyl mimetics, invertomers, non-peptide or pseudo-peptide bonds, and the use of D-amino acids. The helical agent is generally an alpha-helical agent, generally having a lipophilic face and a lipophobic face.

[0261] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules that can fold into defined tertiary structures similar to natural peptides. Attachment of peptides and peptidomimetics to oligonucleotide agents can affect the pharmacokinetic distribution of RNA silencing agents, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. Alternatively, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). The peptide or peptidomimetic is encoded by a random sequence of DNA, such as a peptide identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature 354:82-84, 1991). In an exemplary embodiment, the peptide or peptidomimetic tethered to the RNA silencing agent via an incorporated monomer unit is a cell-targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can be structurally modified to direct conformation for increased stability. Any of the following structural modifications can be utilized:

[0262] 6) Hydrophobic part In some embodiments of the RNA silencing agent (for example, siRNA) provided herein, the RNA silencing agent is conjugated to one or more hydrophobic moieties (see PCT Publication WO2018 / 031933, which is incorporated herein by reference).In some embodiments, the hydrophobic moiety has affinity for low-density lipoprotein and / or medium-density lipoprotein.In related embodiments, the hydrophobic moiety is saturated or has less than three double bonds and is an unsaturated moiety.

[0263] In other embodiments, the hydrophobic moiety has affinity for high density lipoprotein. In related embodiments, the hydrophobic moiety is a polyunsaturated moiety having three or more double bonds (e.g., having 3, 4, 5, 6, 7, 8, 9, or 10 double bonds). In certain embodiments, the hydrophobic moiety is a polyunsaturated moiety having three double bonds. In certain embodiments, the hydrophobic moiety is a polyunsaturated moiety having four double bonds. In certain embodiments, the hydrophobic moiety is a polyunsaturated moiety having five double bonds. In certain embodiments, the hydrophobic moiety is a polyunsaturated moiety having six double bonds.

[0264] In other embodiments, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides and nucleoside analogs and endocannabinoids.

[0265] In other embodiments, the hydrophobic moiety is a neuromodulatory lipid, such as an endocannabinoid. Non-limiting examples of endocannabinoids include anandamide, arachidonoylethanolamine, 2-arachidonylglyceryl ether (noladin ether), 2-arachidonoylglycerol, and N-arachidonoyldopamine.

[0266] In other embodiments, hydrophobic moiety is omega-3 fatty acid.Non-limiting examples of omega-3 fatty acid include but are not limited to hexadecatrienoic acid (HTA), alpha-linolenic acid (ALA), stearidonic acid (SDA), eicosatrienoic acid (ETE), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA, timnodonic acid), heneicosapentaenoic acid (HPA), docosapentaenoic acid (DPA, clupanodonic acid), docosahexaenoic acid (DHA, cervonic acid), tetracosapentaenoic acid and tetracosahexaenoic acid (nisinic acid).

[0267] In other embodiments, hydrophobic moiety is omega-6 fatty acid.Non-limiting examples of omega-6 fatty acid include but are not limited to linoleic acid, gamma-linolenic acid (GLA), eicosadienoic acid, dihomo-gamma-linolenic acid (DGLA), arachidonic acid (AA), docosadienoic acid, adrenic acid, docosapentaenoic acid (osbondoic acid), tetracosatetraenoic acid and tetracosapentaenoic acid.

[0268] In other embodiments, the hydrophobic moiety is an omega-9 fatty acid. Non-limiting examples of omega-9 fatty acids include, but are not limited to, oleic acid, eicosaenoic acid, mead acid, erucic acid, and nervonic acid.

[0269] In other embodiments, the hydrophobic moiety is a conjugated linolenic acid. Non-limiting examples of conjugated linolenic acids include, but are not limited to, α-calendic acid, β-calendic acid, jacaric acid, α-eleostearic acid, β-eleostearic acid, catarpic acid, and punicic acid.

[0270] In other embodiments, the hydrophobic moiety is a saturated fatty acid. Examples of saturated fatty acids include, but are not limited to, caprylic acid, capric acid, docosanoic acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, and cerotic acid.

[0271] In other embodiments, the hydrophobic moiety is an acid selected from the group consisting of lumelenic acid, α-parinaric acid, β-parinaric acid, boseopentaenoic acid, pinolenic acid, and podocarpic acid.

[0272] In other embodiments, the hydrophobic moiety is selected from the group consisting of docosanoic acid (DCA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA).In certain embodiments, the hydrophobic moiety is docosanoic acid (DCA).In other specific embodiments, the hydrophobic moiety is DHA.In other specific embodiments, the hydrophobic moiety is EPA.

[0273] In other embodiments, the hydrophobic moiety is a secosteroid. In certain embodiments, the hydrophobic moiety is calciferol. In other embodiments, the hydrophobic moiety is a steroid other than cholesterol.

[0274] In certain embodiments, the hydrophobic moiety is not cholesterol.

[0275] In other embodiments, the hydrophobic moiety is an alkyl chain, a vitamin, a peptide, or a biologically active conjugate, including, but not limited to, a glycosphingolipid, a polyunsaturated fatty acid, a secosteroid, a steroid hormone, or a sterol lipid.

[0276] In some embodiments, the oligonucleotide provided herein is a double-stranded RNA that comprises one or more chemically modified nucleotides.In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotide and 2'-fluoro-nucleotide.In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotide and 2'-deoxynucleotide.In certain embodiments, the double-stranded RNA comprises 2'-methoxy-nucleotide and 2'-ribose.In certain embodiments, the double-stranded RNA is completely chemically modified, comprising 2'-methoxy-nucleotide at all positions except for positions 2 and 14 from the 5' end of the antisense strand.

[0277] In some embodiments, the oligonucleotides provided herein are double-stranded RNAs comprising one or more nucleotides linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1 and 2 from the 5'-end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1 to 8 from the 3'-end of the antisense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1, 2, and 3 from the 5'-end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds. In certain embodiments, the nucleotides at positions 1, 2, and 3 from the 3'-end of the sense strand are linked to adjacent nucleotides via phosphorothioate bonds.

[0278] In some embodiments of the double-stranded RNA provided herein:

[0279] (1) The first oligonucleotide is fully chemically modified, containing 2'-methoxy-nucleotides at all positions except positions 2 and 14 from the 5' end of the antisense strand;

[0280] (2) a complete chemical modification containing 2′-methoxy-nucleotides at all positions;

[0281] (3) the nucleotides of the first oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, wherein the nucleotides 1 to 2 from the 5' end and / or 1 to 8 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and

[0282] (4) The nucleotides of the second oligonucleotide are linked to adjacent nucleotides via phosphodiester or phosphorothioate bonds, wherein the nucleotides at positions 1, 2, and 3 from the 3' end and / or the nucleotides at positions 1, 2, and 3 from the 5' end are linked to adjacent nucleotides via phosphorothioate bonds.

[0283] In some embodiments of double-stranded RNA, the first oligonucleotide has 3 to 7 more ribonucleotides than the second oligonucleotide.

[0284] In some embodiments, the first oligonucleotide is the antisense strand and the second oligonucleotide is the sense strand.

[0285] 7) Branched oligonucleotides The two or more RNA silencing agents, such as siRNAs, can be linked together by one or more moieties independently selected from a linker, a spacer, and a branch point to form a branched oligonucleotide containing two or more RNA silencing agents. Figure 31 shows an example of a di-siRNA bibranched scaffold for delivery of two siRNAs. In a representative embodiment, the nucleic acids of the branched oligonucleotide each contain an antisense strand (or a portion thereof), wherein the antisense strand has sufficient complementarity to a heterozygous single nucleotide polymorphism to mediate RNA-mediated silencing (e.g., RNAi). In another embodiment, a second type of branched oligonucleotide is provided, characterized by a nucleic acid containing a sense strand (or a portion thereof) for silencing an antisense transcript, wherein the sense strand has sufficient complementarity to the antisense transcript to mediate RNA-mediated silencing. In a further embodiment, a third type of branched oligonucleotide is provided, comprising both types of nucleic acids, i.e., a nucleic acid containing an antisense strand (or a portion thereof) and an oligonucleotide containing a sense strand (or a portion thereof).

[0286] In exemplary embodiments, the branched oligonucleotide may have 2 to 8 RNA silencing agents attached via a linker. The linker may be hydrophobic. In certain embodiments, the branched oligonucleotide of the present application has 2 to 3 oligonucleotides. In certain embodiments, the oligonucleotides independently have substantial chemical stabilization (e.g., at least 40% of the constituent bases are chemically modified). In certain embodiments, the oligonucleotides independently have complete chemical stabilization (i.e., all of the constituent bases are chemically modified). In certain embodiments, the branched oligonucleotide comprises one or more single-stranded phosphorothioated tails, each independently having 2 to 20 nucleotides. In certain embodiments, each single-stranded tail has 8 to 10 nucleotides.

[0287] In some embodiments, branched oligonucleotides are characterized by three properties: (1) a branched structure, (2) complete metabolic stabilization, and (3) the presence of a single-stranded tail containing a phosphorothioate linker. In specific embodiments, the branched oligonucleotide has two or three branches. It is believed that the increase in the overall size of the branched structure promotes increased uptake. Also, without being bound by a particular theory of activity, it is believed that multiple adjacent branches (e.g., two or three) allow each branch to act cooperatively, thereby dramatically enhancing the rate of internalization, transport, and release.

[0288] Branched oligonucleotides are provided in a variety of structurally diverse embodiments. For example, as shown in Figure 17, in one embodiment, the nucleic acid attached to the branch point is single-stranded and consists of an miRNA inhibitor, gapmer, mixmer, SSO, PMO, or PNA. These single strands can be attached at their 3' or 5' ends. Combinations of siRNA and single-stranded oligonucleotides can also be used for dual function. In other embodiments, short nucleic acids complementary to gapmers, mixmers, miRNA inhibitors, SSO, PMO, and PNA are used to enhance distribution and cellular internalization using these active single-stranded nucleic acids. The short duplex region has a low melting temperature (T ) for fast dissociation after internalization of the branched structure into cells. m approximately 37°C).

[0289] As shown in Figure 18, di-siRNA branched oligonucleotides can contain chemically diverse conjugates. Conjugated bioactive ligands can be used to enhance cell specificity and promote membrane binding, internalization, and serum protein binding. Examples of bioactive moieties used for conjugation include DHAg2, DHA, GalNAc, and cholesterol. These moieties can be attached to di-siRNA via a connecting linker or spacer or by addition via an additional linker or spacer attached to another free siRNA end.

[0290] The presence of branched structures improves tissue retention levels in the brain by over 100-fold compared to unbranched compounds of the same chemical composition, suggesting a new mechanism for cellular retention and distribution. Branched oligonucleotides are unexpectedly uniformly distributed throughout the spinal cord and brain. Furthermore, branched oligonucleotides are unexpectedly efficiently delivered systemically to a variety of tissues and exhibit extremely high levels of tissue accumulation.

[0291] Branched oligonucleotides include a variety of therapeutic nucleic acids, including ASO, miRNA, miRNA inhibitors, splice switching, PMO, and PNA. In some embodiments, the branched oligonucleotides further contain a conjugated hydrophobic moiety and exhibit unprecedented silencing and efficacy in vitro and in vivo.

[0292] Linker In some embodiments of the branched oligonucleotide, each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof; wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent. In some embodiments, each linker is an ethylene glycol chain. In other embodiments, each linker is an alkyl chain. In other embodiments, each linker is a peptide. In other embodiments, each linker is RNA. In other embodiments, each linker is DNA. In other embodiments, each linker is a phosphate. In other embodiments, each linker is a phosphonate. In other embodiments, each linker is a phosphoramidate. In other embodiments, each linker is an ester. In other embodiments, each linker is an amide. In other embodiments, each linker is a triazole. In other embodiments, each linker has a structure selected from the formula of Figure 19.

[0293] In other embodiments, provided herein are compounds of formula (I): [ka] is a branched oligonucleotide compound of the formula

[0294] wherein L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof, and wherein Formula (I) optionally further comprises one or more branch points B and one or more spacers; wherein B, at each occurrence, is independently a polyvalent organic species or a derivative thereof; S, at each occurrence, is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof; and N is an RNA duplex comprising a sense strand and an antisense strand, wherein the antisense strand is a region of complementarity that is substantially complementary to a region comprising a target gene.

[0295] The sense strand and the antisense strand each independently comprise one or more chemical modifications; n is 2, 3, 4, 5, 6, 7, or 8.

[0296] In certain embodiments, the compound of Formula (I) has a structure selected from Formulas (I-1) through (I-9) in Table 1. [Table 1]

[0297] In some embodiments, the compound of Formula (I) is Formula (I-1). In other embodiments, the compound of Formula (I) is Formula (I-2). In other embodiments, the compound of Formula (I) is Formula (I-3). In other embodiments, the compound of Formula (I) is Formula (I-4). In other embodiments, the compound of Formula (I) is Formula (I-5). In other embodiments, the compound of Formula (I) is Formula (I-6). In other embodiments, the compound of Formula (I) is Formula (I-7). In other embodiments, the compound of Formula (I) is Formula (I-8). In other embodiments, the compound of Formula (I) is Formula (I-9).

[0298] In some embodiments of the compound of Formula (I), each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof; wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, has a hydroxyl substituent, or has an oxo substituent. In some embodiments of the compound of Formula (I), each linker is an ethylene glycol chain. In other embodiments, each linker is an alkyl chain. In other embodiments of the compound of Formula (I), each linker is a peptide. In other embodiments of the compound of Formula (I), each linker is RNA. In other embodiments of the compound of Formula (I), each linker is DNA. In other embodiments of the compound of Formula (I), each linker is a phosphate. In other embodiments, each linker is a phosphonate. In other embodiments of the compound of Formula (I), each linker is a phosphoramidate. In other embodiments of the compound of Formula (I), each linker is an ester. In other embodiments of the compound of Formula (I), each linker is an amide. In other embodiments of the compound of Formula (I), each linker is a triazole. In other embodiments of the compound of Formula (I), each linker is a structure selected from the formulas of Figure 17.

[0299] In certain embodiments of the compound of Formula (I), B is a polyvalent organic species. In other embodiments of the compound of Formula (I), B is a derivative of a polyvalent organic species. In certain embodiments of the compound of Formula (I), B is a triol or tetraol derivative. In other embodiments, B is a tri- or tetra-carboxylic acid derivative. In other embodiments, B is an amine derivative. In other embodiments, B is a tri- or tetra-amine derivative. In other embodiments, B is an amino acid derivative. In other embodiments of the compound of Formula (I), B is selected from the formulae of Figure 19.

[0300] Polyvalent organic species are moieties that contain carbon and three or more valencies (i.e., points of attachment to a moiety such as S, L, or N, as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, etc.), tetraols (e.g., ribose, pentaerythritol, 1,2,3,5-tetrahydroxybenzene, etc.), tri-carboxylic acids (e.g., citric acid, 1,3,5-cyclohexanetricarboxylic acid, trimesic acid, etc.), tetra-carboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, etc.), tertiary amines (e.g., tripropargylamine, triethanolamine, etc.), triamines (e.g., diethylenetriamine, etc.), tetramines, and species that contain combinations of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, cysteine, etc.).

[0301] In some embodiments of the compound of Formula (I), each nucleic acid comprises one or more chemically modified nucleotides. In some embodiments of the compound of Formula (I), each nucleic acid consists of chemically modified nucleotides. In some embodiments of the compound of Formula (I), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of each nucleic acid comprises chemically modified nucleotides.

[0302] In certain embodiments, each antisense strand independently comprises a 5'-terminal group R selected from the groups in Table 2. [Table 2]

[0303] In some embodiments, R is R1. In other embodiments, R is R2. In other embodiments, R is R3. In other embodiments, R is R4 。 In other embodiments, R is R5 。 In other embodiments, R is R 。 In other embodiments, R is R 。 In other embodiments, R is R。

[0304] Structure of Formula (II) In certain embodiments, the compound of Formula (I) may be a compound of Formula (II) [ka] wherein X, at each occurrence, independently comprises adenosine, guanosine, uridine, cytidine, or a chemically modified derivative thereof; Y, at each occurrence, independently comprises adenosine, guanosine, uridine, cytidine, or a chemically modified derivative thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, at each occurrence, independently represents a base pairing interaction or a mismatch. It has the following structure.

[0305] In some embodiments, the structure of Formula (II) does not contain any mismatch. In some embodiments, the structure of Formula (II) contains one mismatch. In other embodiments, the compound of Formula (II) contains two mismatches. In other embodiments, the compound of Formula (II) contains three mismatches. In other embodiments, the compound of Formula (II) contains four mismatches. In some embodiments, each nucleic acid is composed of chemically modified nucleotides.

[0306] In certain embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of Formula (II) are chemically modified nucleotides.

[0307] Structure of formula (III) In certain embodiments, the compound of Formula (I) has Formula (III) [ka] having the structure

[0308] During the ceremony, Xis independently, at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X is independently, at each occurrence, a nucleotide that includes a 2'-O-methyl modification; Y is independently, at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is independently, at each occurrence, a nucleotide that includes a 2'-O-methyl modification.

[0309] In some embodiments, X comprises a 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X comprises a 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y comprises a 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y comprises a 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0310] In some embodiments, the structure of Formula (III) does not contain any mismatches. In some embodiments, the structure of Formula (III) contains one mismatch. In other embodiments, the compound of Formula (III) contains two mismatches. In other embodiments, the compound of Formula (III) contains three mismatches. In other embodiments, the compound of Formula (III) contains four mismatches.

[0311] Structure of formula (IV) In certain embodiments, the compound of Formula (I) has Formula (IV) [ka] wherein X, at each occurrence, independently comprises adenosine, guanosine, uridine, cytidine, or a chemically modified derivative thereof; Y, at each occurrence, independently comprises adenosine, guanosine, uridine, cytidine, or a chemically modified derivative thereof; - represents a phosphodiester internucleoside linkage; = represents a phosphorothioate internucleoside linkage; and ---, at each occurrence, independently represents a base pairing interaction or a mismatch. It has the following structure.

[0312] In some embodiments, the structure of formula (IV) does not contain any mismatch. In some embodiments, the structure of formula (IV) contains one mismatch. In other embodiments, the compound of formula (IV) contains two mismatches. In other embodiments, the compound of formula (IV) contains three mismatches. In other embodiments, the compound of formula (IV) contains four mismatches. In some embodiments, each nucleic acid is composed of chemically modified nucleotides.

[0313] In some embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of formula (IV) are chemically modified nucleotides. In other embodiments, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of the X's in the structure of formula (IV) are chemically modified nucleotides.

[0314] Structure of formula (V) In certain embodiments, the compound of Formula (I) has the formula (V): [ka] [During the ceremony, X is independently, at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; X is independently, at each occurrence, a nucleotide that includes a 2'-O-methyl modification; Y is, independently at each occurrence, a nucleotide that includes a 2'-deoxy-2'-fluoro modification; and Y is, independently at each occurrence, a nucleotide that includes a 2'-O-methyl modification. It has the following structure.

[0315] In some embodiments, X comprises a 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X comprises a 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y comprises a 2'-deoxy-2'-fluoro modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y comprises a 2'-O-methyl modified adenosine, guanosine, uridine, or cytidine.

[0316] In some embodiments, the structure of Formula (V) contains no mismatches. In some embodiments, the structure of Formula (V) contains one mismatch. In other embodiments, the compound of Formula (V) contains two mismatches. In other embodiments, the compound of Formula (V) contains three mismatches. In other embodiments, the compound of Formula (V) contains four mismatches.

[0317] Flexible Linker In certain embodiments of compounds of Formula (I), L is L1 [ka] It has the following structure.

[0318] In some embodiments of L1, R is R 3 and n is 2.

[0319] In some embodiments of the structure of Formula (II), L has the structure of L1. In some embodiments of the structure of Formula (III), L has the structure of L1. In some embodiments of the structure of Formula (IV), L has the structure of L1. In some embodiments of the structure of Formula (V), L has the structure of L1. In some embodiments of the structure of Formula (VI), L has the structure of L1. In some embodiments of the structure of Formula (VI), L has the structure of L1.

[0320] In certain embodiments of compounds of Formula (I), L is L2 [ka] It has the following structure.

[0321] In some embodiments of L2, R is R 3 and n is 2. In some embodiments of the structure of Formula (II), L has the structure of L2. In some embodiments of the structure of Formula (III), L has the structure of L2. In some embodiments of the structure of Formula (IV), L has the structure of L2. In some embodiments of the structure of Formula (V), L has the structure of L2. In some embodiments of the structure of Formula (VI), L has the structure of L2. In some embodiments of the structure of Formula (VI), L has the structure of L2.

[0322] 10) delivery system In a further embodiment, the compound of formula (VI) [ka] wherein L comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, and wherein formula (VI) optionally further comprises one or more branch points B and one or more spacers S; wherein B, at each occurrence, is independently a polyvalent organic species or a derivative thereof; S, at each occurrence, is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and a combination thereof; each cNA is independently a carrier nucleic acid comprising one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8. A delivery system for therapeutic nucleic acids is provided having the structure:

[0323] In some embodiments of the delivery system, L is an ethylene glycol chain. In other embodiments of the delivery system, L is an alkyl chain. In other embodiments of the delivery system, L is a peptide. In other embodiments of the delivery system, L is RNA. In other embodiments of the delivery system, L is DNA. In other embodiments of the delivery system, L is a phosphate. In other embodiments of the delivery system, L is a phosphonate. In other embodiments of the delivery system, L is a phosphoramidate. In other embodiments of the delivery system, L is an ester. In other embodiments of the delivery system, L is an amide. In other embodiments of the delivery system, L is a triazole.

[0324] In some embodiments of the delivery system, S is an ethylene glycol chain. In other embodiments, S is an alkyl chain. In other embodiments of the delivery system, S is a peptide. In other embodiments, S is RNA. In other embodiments of the delivery system, S is DNA. In other embodiments of the delivery system, S is a phosphate. In other embodiments of the delivery system, S is a phosphonate. In other embodiments of the delivery system, S is a phosphoramidate. In other embodiments of the delivery system, S is an ester. In other embodiments, S is an amide. In other embodiments, S is a triazole.

[0325] In some embodiments of the delivery system, n is 2. In other embodiments of the delivery system, n is 3. In other embodiments of the delivery system, n is 4. In other embodiments of the delivery system, n is 5. In other embodiments of the delivery system, n is 6. In other embodiments of the delivery system, n is 7. In other embodiments of the delivery system, n is 8.

[0326] In some embodiments, each cNA comprises >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55% or >50% chemically modified nucleotides.

[0327] In certain embodiments, the compound of Formula (VI) has a structure selected from Formulas (VI-1) to (VI-9) in Table 3. [Table 3]

[0328] In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-1). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-2). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-3). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-4). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-5). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-6). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-7). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-8). In certain embodiments, the compound of Formula (VI) has the structure of Formula (VI-9).

[0329] In some embodiments, in the compound of formula (VI) (e.g., including formulas (VI-1) to (VI-9)), each cNA independently comprises at least 15 consecutive nucleotides. In some embodiments, each cNA independently comprises chemically modified nucleotides.

[0330] In some embodiments, the delivery system further comprises n therapeutic nucleic acids (NAs), wherein each NA comprises a region of complementarity that is substantially complementary to a region of the target gene. Also, each NA hybridizes to at least one cNA. In some embodiments, the delivery system consists of two NAs. In other embodiments, the delivery system consists of three NAs. In other embodiments, the delivery system consists of four NAs. In other embodiments, the delivery system consists of five NAs. In other embodiments, the delivery system consists of six NAs. In other embodiments, the delivery system consists of seven NAs. In other embodiments, the delivery system consists of eight NAs.

[0331] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides. In some embodiments, each NA independently comprises 16-20 consecutive nucleotides. In some embodiments, each NA independently comprises 16 consecutive nucleotides. In other embodiments, each NA independently comprises 17 consecutive nucleotides. In other embodiments, each NA independently comprises 18 consecutive nucleotides. In other embodiments, each NA independently comprises 19 consecutive nucleotides. In other embodiments, each NA independently comprises 20 consecutive nucleotides.

[0332] In some embodiments, each NA comprises an unpaired overhang of at least 2 nucleotides. In other embodiments, each NA comprises an unpaired overhang of at least 3 nucleotides. In other embodiments, each NA comprises an unpaired overhang of at least 4 nucleotides. In other embodiments, each NA comprises an unpaired overhang of at least 5 nucleotides. In other embodiments, each NA comprises an unpaired overhang of at least 6 nucleotides. In some embodiments, the nucleotides of the overhang are linked via phosphorothioate bonds.

[0333] In some embodiments, each NA independently comprises DNA, siRNA, antagomiR, miRNA, gapmer, mixmer, or guide RNA. In some embodiments, each NA independently is DNA. In other embodiments, each NA independently is siRNA. In other embodiments, each NA independently is antagomiR. In other embodiments, each NA independently is miRNA. In other embodiments, each NA independently is gapmer. In other embodiments, each NA independently is mixmer. In other embodiments, each NA independently is guide RNA. In some embodiments, each NA is the same. In some embodiments, each NA is not the same.

[0334] In some embodiments, the delivery system further comprising n therapeutic nucleic acids (NAs) has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises two therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In other embodiments, the delivery system further comprises three therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises four therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises five therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises six therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises seven therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein. In some embodiments, the delivery system further comprises eight therapeutic nucleic acids (NAs) and has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and embodiments thereof described herein.

[0335] In some embodiments, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and further comprises a linker of structure L1 or L2, where R is R3 and n is 2. In other embodiments, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and further comprises a linker of structure L1, where R is R3 and n is 2. In other embodiments, the delivery system has a structure selected from Formula (I), (II), (III), (IV), (V), (VI), and further comprises a linker of structure L2, where R is R3 and n is 2.

[0336] Pharmaceutical Compositions and Methods of Administration In certain embodiments, provided herein are pharmaceutical compositions comprising a therapeutically effective amount of one or more RNA silencing agents (e.g., siRNAs) described herein and a pharmaceutically acceptable carrier. In other specific embodiments, the pharmaceutical composition comprises a compound of Formulas I-VIII described herein and a pharmaceutically acceptable carrier.

[0337] The present invention relates to the use of the above-mentioned agents for the preventive and / or therapeutic treatments described herein. Therefore, the modulators of the present invention (e.g., siRNA agents) can be incorporated into pharmaceutical compositions suitable for administration. Such compositions generally comprise a nucleic acid molecule, a protein, an antibody, or a regulatory compound and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the composition is contemplated. Supplementary compounds can also be incorporated into the composition.

[0338] The pharmaceutical compositions of the present invention are formulated to be compatible with the intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous (IV), intradermal, subcutaneous (SC or SQ), intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may contain the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methylparaben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid; a buffer such as acetate, citrate, or phosphate, and a tonicity adjuster such as sodium chloride or dextrose. The pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in glass or plastic ampoules, disposable syringes, or multiple-dose vials.

[0339] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and easily syringable. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents in the composition, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, etc. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0340] Sterile injectable solution can be prepared by adding the required amount of active compound into the appropriate solvent that contains one or combination of above-mentioned components as needed, and then sterilize by filtration.Generally, dispersion is prepared by adding active compound to the sterile medium that contains basic dispersion medium and other components that are required from above.For the sterile powder that is used to prepare sterile injectable solution, the typical preparation method is to vacuum dry and freeze-dry the solution that contains active compound and any other required components that have been previously sterilized and filtered.

[0341] The toxicity and therapeutic efficacy of such compounds can be assessed, for example, by LD 50 (lethal dose to 50% of the population) and ED 50The LD (therapeutically effective dose in 50% of the population) can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, and the LD 50 / ED 50 The therapeutic index can be expressed as a ratio. Compounds with large therapeutic indices are suitable. Compounds that exhibit toxic side effects may be used, but consideration must be given to designing a delivery system that targets such compounds to the affected tissue to minimize potential damage to uninfected cells, thereby reducing side effects.

[0342] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds is generally determined to be within the ED 50 The therapeutically effective dose of any compound used in the method of the invention can be estimated initially from cell culture assays. In animal models, the therapeutically effective dose can be estimated from the EC 0.01-0.02 determined in cell culture. 50 Doses can be calculated to achieve a circulating plasma concentration range that includes (i.e., the concentration of the test compound that achieves a half-maximal response). Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

[0343] Treatment method In certain embodiments, the present invention provides methods for both prevention and treatment of subjects at risk for (or suspected of having) a disease or disorder.

[0344] As used herein, "treatment" or "treating" is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or a vector or transgene encoding same) to a patient, or to an isolated tissue or cell line from a patient, having a disease or disorder, a symptom of a disease or disorder, or a predisposition to a disease or disorder, with the intent to cure, treat, alleviate, palliate, alter, correct, ameliorate, improve or correct the disease or disorder, the symptom of a disease or disorder, or the predisposition to a disease.

[0345] In some embodiments, the present invention provides a method for treating diseases or disorders of the central nervous system with the oligonucleotide of the present invention.The oligonucleotide, such as the antisense strand of double-stranded nucleic acid, can have sufficient complementarity with the target gene involved in diseases or disorders of the central nervous system.In certain embodiments, the target gene is Htt, ApoE or C9ORF72.In certain embodiments, the disease or disorder of the central nervous system is Huntington's disease, amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

[0346] In some embodiments, methods are provided for preventing the above-described disease or disorder in a subject by administering a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding the same) to the subject. Subjects at risk for the disease can be identified, for example, by any or a combination of the diagnostic or prognostic assays described herein. Administration of a prophylactic agent can occur before the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or its progression is delayed.

[0347] Another aspect of the present invention relates to a method for therapeutically treating a subject, i.e., changing the onset of symptoms of a disease or disorder. In some exemplary embodiments, the regulatory method of the present invention comprises contacting cells expressing a gain-of-function mutant with a therapeutic agent (e.g., siRNA or a vector or transgene encoding it) that is specific to one or more target sequences in the gene, so as to achieve sequence-specific interference with the gene. These methods can be carried out in vitro (e.g., by culturing cells with the agent) or in vivo (e.g., by administering the agent to a subject).

[0348] The oligonucleotide modified for enhanced neuronal uptake may be administered at a concentration of less than about 1.4 mg / kg body weight or 10 mg / kg body weight, 5 mg / kg body weight, 2 mg / kg body weight, 1 mg / kg body weight, 0.5 mg / kg body weight, 0.1 mg / kg body weight, 0.05 mg / kg body weight, 0.01 mg / kg body weight, 0.005 mg / kg body weight, 0.001 mg / kg body weight, 0.0005 mg / kg body weight, 0.0001 mg / kg body weight, 0.00005 mg / kg body weight, or 0.00001 mg / kg body weight and less than 200 nmoles of RNA agent (e.g., about 4.4 x 10 16 The unit dose may be administered at a unit dose of less than 1500 nmoles, 750 nmoles, 300 nmoles, 150 nmoles, 75 nmoles, 15 nmoles, 7.5 nmoles, 1.5 nmoles, 0.75 nmoles, 0.15 nmoles, 0.075 nmoles, 0.015 nmoles, 0.0075 nmoles, 0.0015 nmoles, 0.00075 nmoles, or 0.00015 nmoles of RNA silencing agent per kg body weight. The unit dose may be administered, for example, by injection (e.g., intravenously or intramuscularly, intrathecally, or directly to the brain), inhalation, or topical application. Suitable dosages are less than 2 mg / kg body weight, 1 mg / kg body weight, or 0.1 mg / kg body weight.

[0349] Direct delivery of oligonucleotides to organs can be at a dose of about 0.00001 mg to about 3 mg / organ, or about 0.0001 to 0.001 mg / organ, about 0.03 to 3.0 mg / organ, about 0.1 to 3.0 mg / organ, or about 0.3 to 3.0 mg / organ. The dose can be an amount effective for treating or preventing a neurological disease or disorder. In some embodiments, the unit dose is administered less frequently than once a day, for example, less than every 2 days, every 4 days, every 8 days, or every 30 days. In other embodiments, the unit dose is not administered at a fixed frequency (e.g., not at a fixed frequency). For example, the unit dose can be administered one time. In some embodiments, the effective dose is administered in conjunction with other conventional therapeutic modalities.

[0350] In some embodiments, a subject is administered an initial dose of oligonucleotide and one or more maintenance doses. The one or more maintenance doses are generally lower than the initial dose, for example, half the initial dose. The maintenance regimen involves treating the subject with one or more doses of 0.01 μg to 1.4 mg / kg body weight / day, for example, 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg / kg body weight / day. The maintenance dose is generally administered less than once every 5 days, 10 days, or 30 days. Furthermore, the treatment regimen can continue for a period that varies depending on the nature of the specific disease, its severity, and the patient's overall condition. In some exemplary embodiments, the dosage can be delivered less than once a day, for example, not more than once every 24 hours, 36 hours, 48 ​​hours, or more, for example, not more than once every 5 or 8 days. After treatment, the patient can be monitored for changes in condition and relief of symptoms of the disease state. The dosage of the compound may be increased when the patient does not respond significantly to the current dosage level, or the dosage may be decreased if symptomatic relief of the disease state is observed, the disease state is eliminated, or unwanted side effects are observed.

[0351] An effective dose can be administered once or more than once, as desired or as deemed appropriate under certain circumstances.If repeated or frequent infusion is desired, the placement of a delivery device, such as a pump, a semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intravesical) or a reservoir may be advisable.In some embodiments, the pharmaceutical composition comprises multiple RNA silencing agent species.In other embodiments, the RNA silencing agent species comprises sequences that are non-overlapping and non-adjacent to other species with respect to naturally occurring target sequences.In other embodiments, the multiple RNA silencing agent species are specific for different naturally occurring target genes.In other embodiments, the RNA silencing agent is allele-specific.In other embodiments, the multiple RNA silencing agent species target two or more target sequences (e.g., 2, 3, 4, 5, 6 or more target sequences).

[0352] Following successful treatment, it may be desirable for patients to undergo maintenance therapy to prevent recurrence of the disease state, wherein a maintenance dose of a compound of the invention is administered in the range of 0.01 μg to 100 g / kg body weight (see U.S. Patent 6,107,094).

[0353] In another aspect, provided herein are methods for treating or managing a disease or disorder, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of a compound, oligonucleotide, or nucleic acid described herein, or a pharmaceutical composition comprising said compound, oligonucleotide, or nucleic acid.

[0354] In some exemplary embodiments, the composition comprising the RNA silencing agent of the present invention can be delivered to the nervous system of a subject by various routes.Exemplary routes include intrathecal, parenchyma (for example, brain), nasal and ocular delivery.The composition can also be delivered systemically, for example, by intravenous, subcutaneous or intramuscular injection, which can be useful for delivering RNA silencing agent to peripheral nerve cells.Exemplary delivery routes are directly to the brain, for example, the ventricle or hypothalamus, or the lateral or dorsal part of the brain.The RNA silencing agent for nerve cell delivery can be contained in pharmaceutical compositions suitable for administration.

[0355] For example, the composition may comprise one or more species of RNA silencing agent and a pharmaceutically acceptable carrier.The pharmaceutical composition of the present invention can be administered in a variety of ways, depending on whether local or systemic treatment is desired and the area to be treated.Administration includes topical (including ophthalmic, intranasal, transdermal), oral or parenteral.Parenteral administration includes intravenous infusion, subcutaneous, intraperitoneal or intramuscular injection, intrathecal or intraventricular (e.g., intracerebroventricular) administration.In some exemplary embodiments, the RNA silencing agent of the present invention is passed through the blood-brain barrier (BBB) ​​using various suitable compositions and methods described herein.

[0356] Delivery route can depend on the disorder of patient.In addition to the siRNA of the present invention, patient can be administered with secondary treatment, for example, palliative treatment and / or disease-specific treatment.Secondary treatment can be, for example, symptomatic (for example, to alleviate symptoms), protective (for example, to slow down or stop disease progression) or restorative (for example, to reverse disease process).

[0357] RNA silencing agents can be delivered to neurons in the brain.Delivery methods that do not require the composition to pass through the blood-brain barrier can be utilized.For example, pharmaceutical compositions containing RNA silencing agents can be delivered to patients by direct injection into the area containing disease-affected cells.For example, pharmaceutical compositions can be delivered by direct injection into the brain.Injection can be by stereotaxic injection into specific areas of the brain (for example, substantia nigra, cortex, hippocampus, striatum or globus pallidus).RNA silencing agents can be delivered to multiple areas of the central nervous system (for example, multiple areas of the brain and / or spinal cord).RNA silencing agents can be delivered to generalized areas of the brain (for example, generalized delivery to the cortex of the brain).

[0358] In some embodiments, RNA silencing agents can be delivered by means of a cannula or other delivery device, with one end being implanted in tissue, for example, the brain, for example, the substantia nigra, cortex, hippocampus, striatum or globus pallidus of the brain.The cannula can be connected to a reservoir of RNA silencing agents.The fluid flow or delivery can be mediated by a pump, for example, an osmotic pump or a minipump, for example, an Alzet pump (Durect, Cupertino, CA).In some embodiments, the pump and reservoir are implanted distal to tissue, for example, in the abdomen, and delivery is carried out by a conduit from the pump or reservoir to the release site.Devices for delivery to the brain are described, for example, in US Patents 6,093,180 and 5,814,014.

[0359] The siRNA of the present invention can be further modified so that it can pass through the blood-brain barrier (BBB).For example, RNA silencing agent can be conjugated with the molecule that allows the drug to pass through the barrier.This modified RNA silencing agent can be administered by any desired method, such as intracerebroventricular or intramuscular injection or by pulmonary delivery.

[0360] In certain embodiments, exosomes may be used to deliver the RNA silencing agents of the present invention. Exosomes can cross the BBB and, after systemic injection, specifically deliver siRNA, antisense oligonucleotides, chemotherapeutic agents, and proteins to neurons (Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr;29(4):341-5. doi: 10.1038 / nbt.1807; El-Andaloussi S, Lee Y, Lakhal-Littleton S, Li J, Seow Y, Gardiner C, Alvarez-Erviti L, Sargent IL, Wood MJ. (2011). Exosome-mediated delivery of siRNA in vitro and in vivo. Nat Protoc. 2012 Dec;7(12):2112-26. doi: 10.1038 / nprot.2012.131; EL Andaloussi S, Mager I, Breakefield XO, Wood MJ. (2013). Extracellular vesicles: biology and emerging therapeutic opportunities. Nat Rev Drug Discov. 2013 May;12(5):347-57. doi: 10.1038 / nrd3978; El Andaloussi S, Lakhal S, Maeger I, Wood MJ. (2013). Exosomes for targeted siRNA delivery across biological barriers. Adv. Drug Deliv Rev. 2013 Mar;65(3):391-7. doi: 10.1016 / j.addr.2012.08.008).

[0361] In some embodiments, one or more lipophilic molecules are used to enable delivery of the RNA silencing agents of the present invention through the BBB (Alvarez-Ervit (2011)). The RNA silencing agent drug is then activated, for example, by enzymatic degradation, to release the drug in its active form.

[0362] In some embodiments, one or more receptor-mediated permeabilizing compounds can be used to increase the permeability of the BBB, allowing delivery of the RNA silencing agents of the present invention. These drugs temporarily increase the permeability of the BBB by increasing blood osmotic pressure, which loosens the tight junctions between endothelial cells (El-Andaloussi (2012)). By loosening the tight junctions, the RNA silencing agent can be delivered via conventional intravenous injection.

[0363] In some embodiments, the RNA silencing agent of the present invention is delivered through BBB using nanoparticle-based delivery system.As used herein, " nanoparticle " refers to polymer nanoparticles, which are generally solid, biodegradable, colloidal, and have been widely studied as drug or gene carriers (SP Egusquiaguirre, M. Igartua, RM Hernandez, and JL Pedraz, " Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research," Clinical and Translational Oncology, vol. 14, no. 2, pp. 83-93, 2012).Polymer nanoparticles are divided into two major categories: natural polymers and synthetic polymers. Natural polymers for siRNA delivery include, but are not limited to, cyclodextrin, chitosan, and atelocollagen (Y. Wang, Z. Li, Y. Han, L.H. Liang, and A. Ji, "Nanoparticle-based delivery system for application of siRNA in vivo," Current Drug Metabolism, vol. 11, no. 2, pp. 182-196, 2010). Synthetic polymers include, but are not limited to, polyethyleneimine (PEI), poly(dl-lactide-co-glycolide) (PLGA), and dendrimers, which have been extensively studied (X. Yuan, S. Naguib, and Z. Wu, "Recent advances of siRNA delivery by nanoparticles," Expert Opinion on Drug Delivery, vol. 8, no. 4, pp. 521-536, 2011).For a review of nanoparticles and other suitable delivery systems, see Jong-Min Lee, Tae-Jong Yoon, and Young-Seok Cho, "Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy," BioMed Research International, vol. 2013, Article ID 782041, 10 pages, 2013. doi:10.1155 / 2013 / 782041 (incorporated herein by reference in its entirety).

[0364] The RNA silencing agent of the present invention can be administered to the eye for the treatment of retinal disorders, such as retinopathy. For example, the pharmaceutical composition can be applied to the ocular surface or adjacent tissues, such as the inside of the eyelid. They can be applied topically, for example, by droplet spray, as eye drops or ointments. Ointments or droppable solutions can be delivered by eye delivery systems known in the art, such as applicators or eyedroppers. Such compositions can contain mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropylmethylcellulose or poly(vinyl alcohol), preservatives such as sorbic acid, EDTA or benzylcuronium chloride, and a conventional amount of diluent and / or carrier. Pharmaceutical compositions can also be administered inside the eye, and can be injected through a needle or other delivery device that can be introduced into a selected area or structure. Compositions containing RNA silencing agents can also be applied through eye patches.

[0365] Generally, the RNA silencing agent of the present invention can be administered by any suitable method.Local delivery as used herein refers to the direct application of the RNA silencing agent to any surface or any internal surface of the body, including the eye, mucous membrane, and the surface of a body cavity.Preparations for local administration include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids.Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc. may be required or desired.Topical administration can also be used as a means to selectively deliver the RNA silencing agent to the epidermis or dermis of a subject, or specific layers thereof, or underlying tissues.

[0366] Compositions for intrathecal or intraventricular (e.g., intracerebroventricular) administration may comprise a sterile aqueous solution, which may also contain buffers, diluents, and other suitable additives. Compositions for intrathecal or intraventricular administration generally do not contain any additional lipophilic moieties other than the transfection reagent or, for example, the lipophilic moiety attached to the RNA silencing agent.

[0367] Formulations for parenteral administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives. Intraventricular injection may be facilitated, for example, by an intraventricular catheter attached to a reservoir. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.

[0368] The oligonucleotide of the present invention can be administered to subject by pulmonary delivery.Pulmonary delivery composition can be delivered by inhalation of dispersion, so that the composition in dispersion can reach lung, where it can be easily absorbed into blood circulation through alveolar area directly.Pulmonary delivery can be effective for both systemic delivery and local delivery for treating pulmonary disease.In some embodiments, the RNA silencing agent administered by pulmonary delivery is modified so that it can pass through the blood-brain barrier.

[0369] Pulmonary delivery can be achieved by various approaches, including the use of nebulization, aerosolization, micellar, and dry powder-based formulations. Delivery can be achieved with liquid nebulizers, aerosol-based inhalers, and dry powder dispersion devices. Metered-dose delivery devices are suitable. One benefit of using an atomizer or inhaler is that the device is self-contained, minimizing the risk of contamination. Dry powder dispersion devices, for example, deliver drugs that can be easily formulated as dry powders. RNA silencing agent compositions can be stably stored as lyophilized or spray-dried powders, either by themselves or in combination with a suitable powder carrier. Delivery of compositions for inhalation can be assisted by a dosing timing element, which, when incorporated into the device, can include a timer, dose counter, timing device, or time indicator that allows patient dose tracking, compliance monitoring, and / or dosing triggering during aerosol drug administration.

[0370] Types of pharmaceutical excipients useful as carriers include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides; pH adjusters or buffers; salts such as sodium chloride; etc. These carriers can be in crystalline or amorphous form or a mixture of the two.

[0371] Useful bulking agents include compatible carbohydrates, polypeptides, amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, and sorbose; disaccharides such as lactose and trehalose; cyclodextrins such as 2-hydroxypropyl-.beta.-cyclodextrin; and polysaccharides such as raffinose, maltodextrin, and dextran; alditols such as mannitol and xylitol. Suitable carbohydrate groups include lactose, trehalose, raffinose maltodextrin, and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.

[0372] Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate, sodium ascorbate, etc.; sodium citrate is preferred.

[0373] The RNA silencing agents of the present invention can be administered via oral and nasal delivery. For example, drugs administered through these membranes have a fast onset of action, provide therapeutic plasma levels, avoid the first-pass effect of liver metabolism, and avoid the adverse gastrointestinal (GI) environment of the drug. Additional advantages include easy access to the membrane site, allowing the drug to be easily applied, localized, and removed. In some embodiments, the RNA silencing agent administered via oral or nasal delivery is modified to allow it to cross the blood-brain barrier. It should be understood that the methods described herein are not limited to the specific methods and experimental conditions disclosed herein, as such methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0374] Furthermore, unless otherwise specified, the experiments described herein use conventional molecular and cell biological and immunological techniques that are within the skill of those skilled in the art.Such techniques are well known to those skilled in the art and are fully described in literature.See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition).

[0375] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made, using appropriate equivalents, without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, it will be more clearly understood with reference to the following examples, which are presented for purposes of illustration only and are not intended to be limiting. [Example]

[0376] Example 1. Efficacy of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications - Patterns 2-5 Several different O-methyl-rich, asymmetric hsiRNA patterns were designed and tested. Four patterns were designed (patterns 2, 3, 4, and 5), each containing an "A" variant, a "B" variant, a "C" variant, a "D" variant, an "E" variant, and an "F" variant (Figures 1A-1D and 20). Pattern 3 also contains a "G" variant and an "H" variant.

[0377] Pattern 2: Pattern 2A - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0378] Pattern 2B - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, 14, and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0379] Pattern 2C - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0380] Pattern 2D - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, 14, and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0381] Pattern 2E - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0382] Pattern 2F - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 4, 5, 6, 14, and 22 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0383] Pattern 3: Pattern 3A - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0384] Pattern 3B - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, 14, and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0385] Pattern 3C - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0386] Pattern 3D - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, 14, and 20 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0387] Pattern 3E - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0388] Pattern 3F - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, 14, and 22 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0389] Pattern 3G - siRNA with a 21-nucleotide guide (antisense) strand and a 16-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, and 14 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0390] Pattern 3H - siRNA with a 21-nucleotide guide (antisense) strand and a 16-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 4, 5, 6, 14, and 21 from the 5' end of the guide strand. 100% 2'-OMe modifications of the passenger strand.

[0391] Pattern 4: Pattern 4A - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. Positions 2, 6, 14, and 16 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 9, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0392] Pattern 4B - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. Positions 2, 6, 14, 16, and 20 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 9, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0393] Pattern 4C - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, 14, and 16 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 9, 10, and 11 from the 3' end of the passenger strand.

[0394] Pattern 4D - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, 14, 16, and 20 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 9, 10, and 11 from the 3' end of the passenger strand.

[0395] Pattern 4E - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, 14, and 16 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 9, 10, and 11 from the 3' end of the passenger strand.

[0396] Pattern 4F - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, 14, 16, and 22 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 9, 10, and 11 from the 3' end of the passenger strand.

[0397] Pattern 5: Pattern 5A - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. Positions 2, 6, and 14 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0398] Pattern 5B - siRNA with a 20-nucleotide guide (antisense) strand and a 15-nucleotide passenger (sense) strand. Positions 2, 6, 14, and 20 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0399] Pattern 5C - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. Positions 2, 6, and 14 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0400] Pattern 5D - siRNA with a 20-nucleotide guide (antisense) strand and an 18-nucleotide passenger (sense) strand. Positions 2, 6, 14, and 20 from the 5' end of the guide strand lack 2'-OMe modifications. Positions 7, 10, and 11 from the 3' end of the passenger strand lack 2'-OMe modifications.

[0401] Pattern 5E - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, and 14 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 10, and 11 from the 3' end of the passenger strand.

[0402] Pattern 5F - siRNA with a 22-nucleotide guide (antisense) strand and a 20-nucleotide passenger (sense) strand. No 2'-OMe modifications at positions 2, 6, 14, and 22 from the 5' end of the guide strand. No 2'-OMe modifications at positions 7, 10, and 11 from the 3' end of the passenger strand. P2A Antisense 5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2B Antisense 5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2C Antisense 5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) Sense 5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2D アンチセンス5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2E アンチセンス5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P2F アンチセンス5'→3' (mN)#(mN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3A アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3B アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3C アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3D アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3E アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3F アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P3G アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) P3H アンチセンス5'→3' (mN)#(fN)#(mN)(fN)(fN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN) P4A アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(fN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4B アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(fN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4C アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4D アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4E アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P4F アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(fN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5A アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fmN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5B アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5C アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5D アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)#(fN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5E アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)#(mN)#(mN) P5F アンチセンス5'→3' (mN)#(fN)#(mN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(mN)#(fN) センス5'→3' (mN)#(mN)#(mN)(mN)(mN)(mN)(mN)(mN)(mN)(fN)(fN)(mN)(mN)(fN)(mN)(mN)(mN)(mN)#(mN)#(mN)

[0403] The target sequences used in this example are shown below.

[0404] sFLT1 i13_2283 antisense strand (20 nucleotides long):

[0405] UAAAUUUGGAGAUCCGAGAG

[0406] sFLT1 i13_2283 antisense strand (21 nucleotides long):

[0407] UAAAUUUGGAGAUCCGAGAGA

[0408] sFLT1 i13_2283 sense strand (14 nucleotides long):

[0409] GAUCUCCAAAUUUA

[0410] sFLT1 i13_2283 sense strand (15 nucleotides long):

[0411] GGAUCUCCAAAUUUA

[0412] sFLT1 i13_2283 sense strand (16 nucleotides long):

[0413] CGGAUCUCCAAAUUUA

[0414] sFLT1 i13_2283 sense strand (18 nucleotides long):

[0415] CUCGGAUCUCCAAAUUUA

[0416] sFLT1 e15a_2519 antisense strand (20 nucleotides long):

[0417] UAUAAAUGGUAGCUAUGAUG

[0418] sFLT1 e15a_2519 antisense strand (21 nucleotides long):

[0419] UAUAAAUGGUAGCUAUGAUGA

[0420] sFLT1 e15a_2519 sense strand (15 nucleotides long):

[0421] UAGCUACCAUUUAUA

[0422] sFLT1 e15a_2519 sense strand (16 nucleotides long):

[0423] AUAGCUACCAUUUAUA

[0424] sFLT1 e15a_2519 sense strand (18 nucleotides long):

[0425] UCAUAGCUACCAUUUAUA

[0426] HTT-10150 antisense strand:

[0427] UUAAUCUCUUUACUGAUAUA

[0428] HTT-10150 mRNA target sequence:

[0429] UAUAUCAGUAAAGAGAUUA

[0430] In vitro silencing – Pattern 3A: The in vitro efficacy of Pattern 3A hsiRNAs for silencing sFTL1 i13 and sFTL1 e15a mRNAs was determined (Figures 4A, 4B, 5A, and 5B). Pattern 3A (75% 2'O-Me content in the guide strand) had similar silencing efficacy to control siRNAs with 50% 2'O-Me content in the guide strand. A variant of Pattern 3A with a 2'-F at position 8 from the 5' end of the guide strand was also found to be effective at silencing the target mRNA. These data demonstrate that O-methyl-rich, asymmetric, fully modified siRNAs with minimal 2'-fluoro modifications achieved unexpected improvements in in vitro efficacy targeting two different mRNA target sequences across two different cell lines using two different assays.

[0431] In vitro silencing – Alternative pattern 3: The in vitro efficacy of Pattern 3 variant hsiRNAs for silencing sFTL1 i13 mRNA was determined (Figure 20). HeLa cells were treated with various concentrations of Pattern 3 variant iRNAs for 72 hours. The Pattern 3 variants were: 1) a 20-nucleotide antisense and a 14-nucleotide sense strand; 2) a 20-nucleotide antisense and an 18-nucleotide sense strand; and 3) a 21-nucleotide antisense and a 16-nucleotide sense strand. mRNA was measured using Promega Dual-Glo® luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control. The 21-nucleotide antisense and 16-nucleotide sense strand iRNAs showed increased in vitro efficacy compared to other Pattern 3 siRNAs with different antisense and sense strand lengths.

[0432] In vitro silencing – Alternative pattern 1: The in vitro efficacy of Pattern 1 variant hsiRNAs for silencing sFTL1 e15a mRNA was determined (Figure 21). Pattern 1 siRNAs have non-2'-O-methyl nucleotides at positions 2 and 14 of the antisense strand and 100% 2'-O-methyl modified nucleotides in the sense strand. The antisense strand optionally has a non-2'-O-methyl nucleotide at the 3' end (i.e., position 20 of the 20-nucleotide strand, position 21 of the 21-nucleotide strand). Pattern 1 siRNAs are further detailed in PCT / US2019 / 048027, which is incorporated herein by reference. HeLa cells were treated with various concentrations of Pattern 1 variant iRNAs for 72 hours. The Pattern 1 variants were: 1) a 20-nucleotide antisense and a 15-nucleotide sense strand; 2) a 20-nucleotide antisense and an 18-nucleotide sense strand; and 3) a 21-nucleotide antisense and a 16-nucleotide sense strand. mRNA was measured using Promega Dual-Glo® luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control. The 21-nucleotide antisense and 16-nucleotide sense strand iRNAs demonstrated sustained increased in vitro efficacy compared to other patterns 1 with different antisense and sense strand lengths.

[0433] In vivo tissue accumulation - Pattern 2A: The in vivo tissue accumulation of Pattern 2A hsiRNA targeting sFTL1 e15a mRNA was determined (Figures 6A-6C). Pattern 2A hsiRNA containing DCA or PC-DCA modifications were administered to pregnant CD1 mice, and tissue distribution was assessed. O-methyl-rich-DCA and O-methyl-rich-PC-DCA hsiRNAs showed increased or similar guide strand accumulation in the liver, kidney, and placenta compared to non-methyl-rich control hsiRNA, despite half-dose administration. An additional control siRNA targeting Htt mRNA (HTT-10150) was also included.

[0434] We also determined the in vivo tissue accumulation, sFTL1 i13 mRNA silencing, and sFTL1 protein levels in the placenta of Pattern 3B targeting sFTL1 i13 mRNA (Figures 7A-7D). Pattern 3B showed increased or similar guide strand accumulation in the placenta compared to the non-methyl-rich control hsiRNA.

[0435] In vitro silencing – Patterns 1B and 4B: The in vitro efficacy of pattern 1B and 4B hsiRNAs for silencing Htt mRNA was determined (Figure 8). Pattern 4B (75% 2'O-Me content in the guide strand, 73% 2'O-Me content in the passenger strand) has similar silencing efficacy to a control siRNA with 50% 2'O-Me content in the guide strand.

[0436] In vivo tissue accumulation - Pattern 4B: The in vivo tissue accumulation of Pattern 4B hsiRNA targeting Htt mRNA was determined (Figure 9). Pattern 4B hsiRNA in biantennary siRNA format was administered to wild-type FVB / NJ mice, and tissue distribution was assessed. O-methyl-rich, branched hsiRNA showed increased or similar accumulation in the striatum, medial cortex, thalamus, and hippocampus compared with the non-methyl-rich control biantennary hsiRNA.

[0437] Example 2. Efficacy of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications - Role of position 20 of the guide strand The in vitro efficacy of hsiRNAs with and without 2'-O-Me modifications at position 20 from the 5' end of the guide strand was determined (Figures 10A-10D).

[0438] hsiRNAs with 50-55% 2'-O-Me content in the guide strand to silence sFTL1 i13, sFTL1 e15a, and Htt mRNAs were used in HeLa cells (Figure 10A, Figure 10C, and Figure 10D) and WM-115 cells (Figure 10B). These data indicate that when the 2'-O-Me content is 50-55%, the absence of 2'-O-Me at position 20 from the 5' end of the guide strand increases silencing efficacy. This was demonstrated with a 2'-fluoro modification at position 20, but may also apply to other types of nucleotide modifications, including, but not limited to, unmodified ribose with 2'-H or 2'-OH. This increased silencing efficacy was demonstrated with two different chemical modification patterns, each with a 50-55% 2'-O-Me content. FIG. 10D shows the role of the 2'-fluoro at position 20 in the context of an siRNA with a 21-nucleotide antisense strand, showing similar results as the 20-nucleotide antisense strand.

[0439] The effect of no 2'-O-Me at position 20 was tested in pattern 4 ("A" pattern - 2'-O-Me at position 20, "B" pattern - no 2'-O-Me at position 20). The 2'-O-Me content in the guide strand of pattern 4A was 75% 2'-O-Me, and pattern 4B was 80% 2'-O-Me (Figure 11). The data show that the presence or absence of 2'-O-Me at position 20 in siRNAs containing 75% and 80% 2'-O-Me content does not improve or interfere with silencing efficacy.

[0440] Example 3. Efficacy of 2'-O-methyl-rich hsiRNAs with reduced 2'-fluoro modifications - Role of guide strand positions 5 and 7 The in vitro efficacy of hsiRNAs with and without 2'-O-Me modifications at positions 5 (Figures 12A-C) and 7 (Figures 13A-B) from the 5' end of the guide strand was determined.

[0441] In vitro efficacy of sFLT1i13, sFLT1e15a, and HTT mRNA silencing with siRNAs with or without a 2'-OMe at position 5 of the guide strand. Figures 12A and 12C show HeLa cells treated with siRNAs containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations for 72 hours, while Figure 12B shows WM-115 cells. mRNA was measured using the Promega Dual-Glo® Luciferase or Affymetrix Quantigene 2.0 assay systems. Data were normalized to a control reporter (fLuc) or housekeeping gene (HPRT) and graphed as a percentage of the untreated control. The results show that inclusion of a 2'-F at position 5 of the guide strand increases the efficacy of fully modified siRNAs.

[0442] In vitro efficacy of sFLT1i13 and sFLT1e15a mRNA silencing with siRNAs with or without 2'-OMe at positions 5 and / or 7 of the guide strand. The guide strand in Figure 13A shows the presence and absence of 2'-OMe at position 5, while 2'-OMe is present at position 7. The guide strand in Figure 13B shows the presence and absence of 2'-OMe at positions 5 and 7. HeLa cells were treated for 72 hours with siRNA containing 50-55% 2'-OMe content in the guide strand at the indicated concentrations. mRNA was measured using Promega Dual-Glo® luciferase. Data were normalized to the control reporter (fLuc) and graphed as a percentage of the untreated control. The results show that inclusion of 2'-F at position 7 of the guide strand does not increase the efficacy of fully modified siRNA.

[0443] To demonstrate that altering 2'-modifications can strongly negatively affect activity, we determined the in vitro efficacy of Pattern 4 siRNA (see Figure 11) for HTT mRNA silencing compared to siRNAs with alternative modification patterns. HeLa cells were treated with siRNAs at the indicated concentrations for 72 hours. mRNA was measured using the Affymetrix Quantigene 2.0 assay system. Data were normalized to the housekeeping gene (HPRT) and graphed as % of the untreated control (Figure 14).

[0444] The contents of all references (including articles, patents, patent applications, and websites) cited throughout this specification are expressly incorporated herein by reference in their entirety. The present invention employs, unless otherwise indicated, conventional techniques of immunology, molecular biology, and cell biology, which are well known in the art.

[0445] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The foregoing embodiments are therefore to be construed as all being illustrative rather than limiting of the present invention. The scope of the present invention is therefore indicated by the appended claims, rather than the foregoing, and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Claims

1. at least 14 contiguous nucleotides at the 5' and 3' ends; and Greater than 50% 2'-O-methyl modifications An oligonucleotide comprising: An oligonucleotide, wherein the nucleotides at positions 4, 5, 6 and 14 from the 5' end of the oligonucleotide contain a non-2'-O-methyl modification or moiety.

2. The oligonucleotide of claim 1, wherein the oligonucleotide comprises an antisense oligonucleotide (ASO).

3. 10. The oligonucleotide of claim 1, wherein the oligonucleotide comprises perfect or less than perfect complementarity to the target.

4. The oligonucleotide of claim 3, wherein the target comprises a mammalian or viral mRNA.

5. 2. The oligonucleotide of claim 1, wherein one or more of the nucleotides at positions 2, 8, and 20 from the 5' end of the oligonucleotide comprise a non-2'-O-methyl modification or moiety.

6. 2. The oligonucleotide of claim 1, wherein the 3' terminal nucleotide of the oligonucleotide comprises a non-2'-O-methyl modification or moiety.

7. 2. The oligonucleotide of claim 1, wherein one or more nucleotides at positions 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

8. 2. The oligonucleotide of claim 1, wherein nucleotides 1 to 6 from the 3' end or 1 to 7 from the 3' end of the oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

9. 9. The oligonucleotide of any of claims 1 to 8, wherein the non-2'-O-methyl modifications or moieties include 2'-F modifications or 2'-H modifications or 2'-OH moieties.

10. 10. The oligonucleotide of claim 9, wherein the non-2'-O-methyl modifications comprise 2'-F modifications.

11. 10. The oligonucleotide of claim 9, wherein the non-2'-O-methyl modifications comprise 2'-H modifications.

12. 10. The oligonucleotide of claim 9, wherein the non-2'-O-methyl moiety comprises a 2'-OH moiety.

13. 2. The oligonucleotide of claim 1, comprising less than 85% 2'-O-methyl modifications.

14. 14. The oligonucleotide of any one of claims 1 to 13, further comprising a complementary second oligonucleotide comprising at least 13 consecutive nucleotides at the 5' end and the 3' end.

15. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises at least 70% 2'-O-methyl modified nucleotides.

16. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises at least 80% 2'-O-methyl modified nucleotides.

17. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises at least 90% 2'-O-methyl modified nucleotides.

18. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises 100% 2'-O-methyl modified nucleotides.

19. 15. The oligonucleotide of claim 14, wherein one or more of the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide do not contain a 2'-O-methyl modification.

20. 15. The oligonucleotide of claim 14, wherein the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification or moiety.

21. 2. The oligonucleotide of claim 1, comprising 15 to 22 contiguous nucleotides.

22. 22. The oligonucleotide of claim 21, comprising 20 consecutive nucleotides.

23. 22. The oligonucleotide of claim 21, comprising 21 consecutive nucleotides.

24. 22. The oligonucleotide of claim 21, comprising 22 consecutive nucleotides.

25. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises 15 to 20 contiguous nucleotides.

26. 26. The oligonucleotide of claim 25, wherein the second oligonucleotide comprises 15 consecutive nucleotides.

27. 26. The oligonucleotide of claim 25, wherein the second oligonucleotide comprises 16 consecutive nucleotides.

28. 26. The oligonucleotide of claim 25, wherein the second oligonucleotide comprises 18 consecutive nucleotides.

29. 26. The oligonucleotide of claim 25, wherein the second oligonucleotide comprises 20 consecutive nucleotides.

30. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises one or more nucleotide mismatches between the first and second oligonucleotides.

31. 31. The oligonucleotide of claim 30, wherein the one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the second oligonucleotide.

32. 31. The oligonucleotide of claim 30, wherein the nucleotide mismatches are at positions 2, 6, and 12 from the 5' end of the second oligonucleotide.

33. 15. The oligonucleotide of claim 14, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

34. 15. The oligonucleotide of claim 14, wherein the nucleotides 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds.

35. 15. The oligonucleotide of claim 14, wherein the second oligonucleotide comprises a hydrophobic molecule at the 3' end of the second oligonucleotide.

36. 2. The oligonucleotide of claim 1, wherein the nucleotides at positions 1 and 2 from the 5' end of the oligonucleotide are linked to adjacent ribonucleotides by phosphorothioate bonds.

37. A pharmaceutical composition comprising one or more oligonucleotides according to any one of claims 1 to 36 and a pharmaceutically acceptable carrier.

38. 40. A method of treating or managing a disease or disorder, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 37.

39. A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein: the antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to the target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end, a 3' end, and is complementary to the antisense strand; the antisense strand contains greater than 50% 2'-O-methyl modifications; the nucleotides at positions 4, 5, 6 and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications; Double-stranded nucleic acid structure.

40. A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein: the antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to the target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end, a 3' end, and is complementary to the antisense strand; one or more nucleotides at positions 4, 5, and 6 from the 5' end of the antisense strand contain a non-2'-O-methyl modification; and one or more nucleotides at positions 7, 9, 10 and 11 from the 3' end of the second oligonucleotide contain a non-2'-O-methyl modification or moiety; Double-stranded nucleic acid structure.

41. A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein: the antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and has complementarity to the target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end, a 3' end, and is complementary to the antisense strand; The antisense strand contains more than 60% 2'-O-methyl modifications. one or more nucleotides at positions 4, 5, and 6 from the 5' end of the antisense strand contain a non-2'-O-methyl modification; and the nucleotide at position 7 from the 3' end of the second oligonucleotide comprises a non-2'-O-methyl modification or moiety; Double-stranded nucleic acid structure.

42. 42. The double-stranded nucleic acid structure of any of claims 39 to 41, wherein the antisense strand comprises perfect or less than perfect complementarity to the target.

43. 43. The double-stranded nucleic acid structure of any of claims 39 to 42, wherein the target comprises mammalian or viral mRNA.

44. 44. The double-stranded nucleic acid structure of any of claims 39 to 43, wherein one or more of the nucleotides at positions 2, 8 and 20 from the 5' end of the antisense strand contain a non-2'-O-methyl modification or moiety.

45. 45. The double-stranded nucleic acid structure of any of claims 39 to 44, wherein the 3' terminal nucleotide of the antisense strand comprises a non-2'-O-methyl modification or moiety.

46. The double-stranded nucleic acid structure of any one of claims 39 to 45, wherein one or more nucleotides at positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

47. The double-stranded nucleic acid structure of any one of claims 39 to 45, wherein nucleotides 1 to 6 from the 3' end or 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

48. 48. The double-stranded nucleic acid structure of any of claims 39 to 47, wherein the non-2'-O-methyl modifications or moieties comprise 2'-F modifications, 2'-H modifications or 2'-OH moieties.

49. 49. The double-stranded nucleic acid structure of claim 48, wherein the non-2'-O-methyl modifications comprise 2'-F modifications.

50. 49. The double-stranded nucleic acid structure of claim 48, wherein the non-2'-O-methyl modifications comprise 2'-H modifications.

51. 49. The double-stranded nucleic acid structure of claim 48, wherein the non-2'-O-methyl moiety comprises a 2'-OH moiety.

52. 52. The double-stranded nucleic acid structure of any of claims 39 to 51, wherein the antisense strand contains less than 85% 2'-O-methyl modifications.

53. 53. The double-stranded nucleic acid structure of any of claims 39 to 52, wherein the sense strand comprises at least 70% 2'-O-methyl modified nucleotides.

54. 53. The double-stranded nucleic acid structure of any of claims 39 to 52, wherein the sense strand comprises at least 80% 2'-O-methyl modified nucleotides.

55. 53. The double-stranded nucleic acid structure of any of claims 39 to 52, wherein the sense strand comprises at least 90% 2'-O-methyl modified nucleotides.

56. 53. The double-stranded nucleic acid structure of any of claims 39 to 52, wherein the sense strand comprises 100% 2'-O-methyl modified nucleotides.

57. 40. The double-stranded nucleic acid structure of claim 39, wherein one or more of the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide do not contain a 2'-O-methyl modification.

58. 40. The double-stranded nucleic acid structure of claim 39, wherein the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the second oligonucleotide comprise a non-2'-O-methyl modification or moiety.

59. 60. The double-stranded nucleic acid structure of any of claims 39 to 59, wherein the antisense strand comprises 15 to 22 contiguous nucleotides.

60. 60. The double-stranded nucleic acid structure of claim 59, wherein the antisense strand comprises 20 contiguous nucleotides.

61. 60. The double-stranded nucleic acid structure of claim 59, wherein the antisense strand comprises 21 contiguous nucleotides.

62. 60. The double-stranded nucleic acid structure of claim 59, wherein the antisense strand comprises 22 contiguous nucleotides.

63. 63. The double-stranded nucleic acid structure of claims 39-62, wherein the sense strand comprises 15-20 contiguous nucleotides.

64. 64. The double-stranded nucleic acid structure of claim 63, wherein the sense strand comprises 15 consecutive nucleotides.

65. 64. The double-stranded nucleic acid structure of claim 63, wherein the sense strand comprises 16 consecutive nucleotides.

66. 64. The double-stranded nucleic acid structure of claim 63, wherein the sense strand comprises 18 consecutive nucleotides.

67. 64. The double-stranded nucleic acid structure of claim 63, wherein the sense strand comprises 20 contiguous nucleotides.

68. 68. The double-stranded nucleic acid structure of any of claims 39 to 67, wherein the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand.

69. 69. The double-stranded nucleic acid structure of claim 68, wherein one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand.

70. 69. The double-stranded nucleic acid structure of claim 68, wherein the nucleotide mismatches are at positions 2, 6, and 12 from the 5' end of the sense strand.

71. 71. The double-stranded nucleic acid structure of any one of claims 39 to 70, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds.

72. 71. The double-stranded nucleic acid structure of any of claims 39 to 70, wherein the nucleotides 1 and 2 from the 3' end of the sense strand and the nucleotides 1 and 2 from the 5' end of the sense strand are linked to adjacent ribonucleotides by phosphorothioate bonds.

73. 73. The double-stranded nucleic acid structure of any one of claims 39 to 72, wherein the 3' end of the sense strand comprises a hydrophobic molecule.

74. 74. The double-stranded nucleic acid structure of any one of claims 39 to 73, wherein the nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent ribonucleotides by phosphorothioate bonds.

75. The double-stranded nucleic acid of any one of claims 39 to 74, wherein the antisense strand comprises a 5'-phosphate, a 5'-alkylphosphonate, or a 5'-alkylenephosphonate.

76. 76. The double-stranded nucleic acid of claim 75, wherein the antisense strand comprises a 5'-vinylphosphonate.

77. 77. The double-stranded nucleic acid of any one of claims 39 to 76, comprising 4 to 16 phosphorothioate bonds.

78. 77. The double-stranded nucleic acid of any one of claims 39 to 76, comprising 8 to 13 phosphorothioate bonds.

79. The double-stranded nucleic acid of any one of claims 39 to 78, comprising a double-stranded region of 15 to 20 base pairs.

80. 80. The double-stranded nucleic acid of any one of claims 39 to 79, comprising a double-stranded region of 15 base pairs.

81. 80. The double-stranded nucleic acid of any one of claims 39 to 79, comprising a double-stranded region of 16 base pairs.

82. 80. The double-stranded nucleic acid of any one of claims 39 to 79, comprising a double-stranded region of 18 base pairs.

83. 80. The double-stranded nucleic acid of any one of claims 39 to 79, comprising a double-stranded region of 20 base pairs.

84. A pharmaceutical composition comprising one or more double-stranded chemically modified nucleic acids of any of claims 39 to 83 and a pharmaceutically acceptable carrier.

85. 85. A method of treating or managing a disease or disorder, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 84.

86. A double-stranded nucleic acid structure comprising an antisense strand and a sense strand, wherein: the antisense strand comprises at least 16 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the target; the sense strand comprises at least 13 contiguous nucleotides, a 5' end and a 3' end, and has complementarity to the first oligonucleotide; the antisense strand contains greater than 50% 2'-O-methyl modifications; the nucleotides at positions 2, 6, and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications; the sense strand contains at least 70% 2'-O-methyl modifications; and the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain non-2'-O-methyl modifications; Double-stranded nucleic acid structure.

87. 87. The double-stranded nucleic acid of claim 86, wherein one or more of the nucleotides at positions 8, 16, and 20 from the 5' end of the antisense strand do not contain a 2'-O-methyl modification.

88. 87. The double-stranded nucleic acid of claim 86, wherein the 3' terminal nucleotide of the antisense strand does not contain a 2'-O-methyl modification.

89. The double-stranded nucleic acid of any of claims 86 to 88, wherein the antisense strand contains less than 85% 2'-O-methyl modifications.

90. The double-stranded nucleic acid of any one of claims 86 to 89, wherein the sense strand comprises at least 70% 2'-O-methyl modified nucleotides.

91. The double-stranded nucleic acid of any one of claims 86 to 89, wherein the sense strand comprises at least 80% 2'-O-methyl modified nucleotides.

92. The double-stranded nucleic acid of any one of claims 86 to 89, wherein the sense strand comprises at least 90% 2'-O-methyl modified nucleotides.

93. The double-stranded nucleic acid of any one of claims 86 to 92, wherein the antisense strand comprises 16 to 22 consecutive nucleotides.

94. The double-stranded nucleic acid of any one of claims 86 to 93, wherein the antisense strand comprises 20 consecutive nucleotides.

95. The double-stranded nucleic acid of any one of claims 86 to 93, wherein the antisense strand comprises 21 consecutive nucleotides.

96. The double-stranded nucleic acid of any one of claims 86 to 93, wherein the antisense strand comprises 22 consecutive nucleotides.

97. 97. The double-stranded nucleic acid of any one of claims 86 to 96, wherein the sense strand comprises 15 to 20 consecutive nucleotides.

98. The double-stranded nucleic acid of any one of claims 86 to 97, wherein the sense strand comprises 15 consecutive nucleotides.

99. The double-stranded nucleic acid of any one of claims 86 to 97, wherein the sense strand comprises 16 consecutive nucleotides.

100. The double-stranded nucleic acid of any one of claims 86 to 97, wherein the sense strand comprises 18 consecutive nucleotides.

101. The double-stranded nucleic acid of any one of claims 86 to 97, wherein the sense strand comprises 20 consecutive nucleotides.

102. The double-stranded nucleic acid of any of claims 86 to 101, wherein the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand.

103. 103. The double-stranded nucleic acid of claim 102, wherein one or more nucleotide mismatches are present at positions 2, 6, and 12 from the 5' end of the sense strand.

104. 103. The double-stranded nucleic acid of claim 102, wherein the nucleotide mismatches are at positions 2, 6, and 12 from the 5' end of the sense strand.

105. The double-stranded nucleic acid of any one of claims 86 to 104, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds.

106. The double-stranded nucleic acid of any one of claims 86 to 104, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand and the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to adjacent nucleotides by phosphorothioate bonds.

107. The double-stranded nucleic acid of any one of claims 86 to 106, wherein the 3' end of the sense strand comprises a hydrophobic molecule.

108. The double-stranded nucleic acid of any one of claims 86 to 107, wherein the nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

109. The double-stranded nucleic acid of any one of claims 86 to 108, wherein one or more nucleotides at positions 1 to 7 from the 3' end of the antisense strand are linked to adjacent nucleotides by phosphorothioate bonds.

110. The double-stranded nucleic acid of any one of claims 86 to 109, wherein the antisense strand comprises a 5'-phosphate, a 5'-alkylphosphonate, or a 5'-alkylenephosphonate.

111. The double-stranded nucleic acid of claim 10, wherein the antisense strand comprises a 5'-vinylphosphonate.

112. The double-stranded nucleic acid of any one of claims 86 to 111, comprising 4 to 16 phosphorothioate bonds.

113. The double-stranded nucleic acid of any one of claims 86 to 111, comprising 8 to 13 phosphorothioate bonds.

114. The double-stranded nucleic acid of any one of claims 86 to 113, comprising a double-stranded region of 15 to 20 base pairs.

115. The double-stranded nucleic acid of any one of claims 86 to 114, comprising a double-stranded region of 15 base pairs.

116. The double-stranded nucleic acid of any one of claims 86 to 114, comprising a double-stranded region of 16 base pairs.

117. The double-stranded nucleic acid of any one of claims 86 to 114, comprising a double-stranded region of 18 base pairs.

118. The double-stranded nucleic acid of any one of claims 86 to 114, comprising a double-stranded region of 20 base pairs.

119. A branched oligonucleotide compound capable of mediating RNA silencing in a cell, comprising two or more double-stranded nucleic acids, wherein the nucleic acids (N) are connected to each other by one or more moieties selected from a linker (L), a spacer (S), and optionally a branch point (B), wherein: each double-stranded nucleic acid comprises an antisense strand and a sense strand, wherein each antisense strand comprises at least 14 contiguous nucleotides, a 5' end, a 3' end, and at least one antisense strand comprises greater than 50% 2'-O-methyl modifications; wherein at least one nucleotide 14 from the 5' end of the antisense strand contains a non-2'-O-methyl modification or moiety; and wherein one or more nucleotides at positions 1 to 7 from the 3' end of at least one antisense strand are linked to adjacent nucleotides by phosphorothioate bonds; Branched oligonucleotide compounds.

120. each antisense strand contains greater than 50% 2'-O-methyl modifications; The 14th nucleotide from the 5' end of each antisense strand comprises a non-2'-O-methyl modification or moiety; and / or One or more nucleotides at positions 1 to 7 from the 3' end of each antisense strand are linked to adjacent nucleotides by phosphorothioate bonds; 120. The branched oligonucleotide compound of claim 119.

121. 120. The branched oligonucleotide compound of claim 119, wherein the nucleotides at positions 1 and 2 from the 5'-end of the sense and antisense strands are joined to adjacent nucleotides by phosphorothioate bonds.

122. The branched oligonucleotide compound of any of claims 119 to 121, wherein each double-stranded nucleic acid is independently linked to a linker, spacer, or branch point at the 3'-end or 5'-end of the sense strand or the 3'-end or 5'-end of the antisense strand.

123. 123. The branched oligonucleotide compound of any of claims 119-122, wherein the compound further comprises a hydrophobic moiety attached to a terminal 5' position of the branched oligonucleotide compound.

124. 124. The branched oligonucleotide compound of claim 123, wherein the hydrophobic moiety comprises an alkyl, alkenyl, or aryl moiety; a vitamin; a cholesterol derivative; a lipophilic amino acid; or a combination thereof.

125. each linker is independently selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof; wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, carries a hydroxyl substituent, or carries an oxo substituent; 125. The branched oligonucleotide compound of any one of claims 119 to 124.

126. 126. The branched oligonucleotide compound of any of claims 119-125, wherein the 20th nucleotide from the 5' end of the antisense strand comprises a non-2'-O-methyl modification or moiety.

127. 126. The branched oligonucleotide compound of any of claims 119-125, wherein the 3' terminal nucleotide of the antisense strand comprises a non-2'-O-methyl modification or moiety.

128. 128. The branched oligonucleotide compound of any of claims 119-127, wherein the nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand comprise a non-2'-O-methyl modification or moiety.

129. 129. The branched oligonucleotide compound of any of claims 119-128, wherein the non-2'-O-methyl modification comprises a 2'-F modification, a 2'-H modification, or a 2'-OH moiety.

130. 130. The branched oligonucleotide compound of claim 129, wherein the non-2'-O-methyl modifications comprise 2'-F modifications.

131. 130. The branched oligonucleotide compound of claim 129, wherein the non-2'-O-methyl modifications comprise 2'-H modifications.

132. 130. The branched oligonucleotide compound of claim 129, comprising a 2'-OH moiety.

133. 122. The branched oligonucleotide compound of any of claims 119-121, wherein the antisense strand contains less than 85% 2'-O-methyl modifications.

134. 134. The branched oligonucleotide compound of any of claims 119-133, wherein the sense strand comprises at least 80% 2'-O-methyl modified nucleotides.

135. 134. The branched oligonucleotide compound of any of claims 119-133, wherein the sense strand comprises at least 90% 2'-O-methyl modified nucleotides.

136. 134. The branched oligonucleotide compound of any of claims 119-133, wherein the sense strand comprises 100% 2'-O-methyl modified nucleotides.

137. 137. The branched oligonucleotide compound of any of claims 119-136, wherein the antisense strand comprises 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides.

138. 138. The branched oligonucleotide compound of any of claims 119-137, wherein the antisense strand comprises 21 consecutive nucleotides.

139. 139. The branched oligonucleotide compound of any of claims 119-138, wherein the sense strand comprises 15, 16, 17, 18, 19, or 20 consecutive nucleotides.

140. 140. The branched oligonucleotide compound of any of claims 119 to 139, wherein the sense strand comprises 16 consecutive nucleotides.

141. 141. The branched oligonucleotide compound of any of claims 119 to 140, wherein the nucleotide at position 14 from the 5' end of the antisense strand and one or more of the nucleotides at positions 2, 4, 5, 6, 16, and 20 contain a non-2'-O-methyl modification.

142. the nucleotide at position 14 from the 5' end of the antisense strand contains a non-2'-O-methyl modification; one or more nucleotides at positions 2, 4, 5, 6, 16, and 20 from the 5' end of the antisense strand contain a non-2'-O-methyl modification; and the nucleotide at the 3' end of the antisense strand contains a non-2'-O-methyl modification; 142. The branched oligonucleotide compound of any one of claims 119 to 141.

143. 142. The branched oligonucleotide compound of any of claims 119-141, wherein the nucleotides at positions 2 and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

144. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 2, 14, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

145. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 4, 5, 6 and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

146. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 4, 5, 6, 14, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

147. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 2, 4, 5, 6 and 14 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

148. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 2, 4, 5, 6, 14, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

149. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 2, 6, 14, and 16 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

150. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 2, 6, 14, 16, and 20 from the 5' end of the antisense strand contain non-2'-O-methyl modifications.

151. 142. The branched oligonucleotide compound of any of claims 119-141, wherein one or more nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain a non-2'-O-methyl modification.

152. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 7, 10, and 11 from the 3' end of the sense strand contain non-2'-O-methyl modifications.

153. 142. The branched oligonucleotide compound of any of claims 119 to 141, wherein the nucleotides at positions 7, 9, 10, and 11 from the 3' end of the sense strand contain non-2'-O-methyl modifications.