Method for producing peptide containing non-natural amino acid

Abstract

To provide an efficient method for producing a peptide containing a non-natural amino acid, and a modified L31 protein to be used in the method, and a ribosome containing the same.SOLUTION: A method for producing a peptide includes a step of translating an mRNA that encodes a peptide containing one or more non-natural amino acids in a translation system containing a ribosome comprising a modified L31 protein, wherein the ribosome comprising the modified L31 protein shows higher translation activity for the peptide containing the non-natural amino acid compared with a ribosome comprising an Escherichia coli wild-type L31 including the amino acid sequence of SEQ ID NO:1.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to methods for producing peptides containing unnatural amino acids or libraries containing such peptides. The present invention also relates to modified L31 proteins and the like for use in such methods. [Background technology]

[0002] In recent years, drug discovery methods have been devised that involve selecting drug candidate substances from libraries of diverse peptides containing multiple unnatural amino acids. Among these, mRNA display libraries of peptides containing unnatural amino acids using cell-free translation systems are attracting attention due to their diversity and ease of screening. Several methods for synthesizing peptides containing unnatural amino acids using translation systems have been reported (Non-Patent Documents 1 and 2). However, the methods described in these documents have low translational synthesis efficiency.

[0003] In vivo, peptides are synthesized by the polymerization of amino acids according to the base sequence information contained in mRNA. This peptide synthesis process is called translation. Ribosomes play a central role in the translation process. Purified ribosomes are usually added to the cell-free translation system used to prepare mRNA display libraries.

[0004] The L31 protein is known to be a ribosome-constituting protein. The L31 protein forms the intersubunit Bridge B1b and plays a role in stabilizing the association between the 30S and 50S (70S) (Non-Patent Document 3).

[0005] The L31 protein is known to be degraded by protease 7 during its purification. When the activities of ribosomes prepared from a wild-type strain of E. coli, a protease 7 KO strain lacking protease 7, and an L31KO strain lacking the L31 protein were compared, it was reported that the ribosomes prepared from the protease 7-deficient strain exhibited greater activity than those prepared from a wild-type strain of E. coli or an L31-deficient strain (Non-Patent Document 3). It has also been reported that ribosomes prepared from an L31-deficient strain exhibit a 38% reduced initiation rate in vivo and a slower rate of 70S formation in vitro (Non-Patent Document 4). Furthermore, it has been reported that fidelity is reduced in an L31-deficient strain (Non-Patent Document 4). Thus, it was known that ribosomes containing L31 protein that has not been digested by protease 7 are more active in translating peptides consisting of natural amino acids than ribosomes containing cleaved L31 protein or ribosomes without L31 protein. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Maini, R., Umemoto, S. &Suga, H. Ribosome-mediated synthesis of natural product-like peptides viacell-free translation. Current opinion in chemical biology 34, 44-52, doi:10.1016 / j.cbpa.2016.06.006 (2016). [Non-patent document 2] Hartman, MC, Josephson, K.,Lin, CW & Szostak, JW Anexpanded set of amino acid analogs for theribosomal translation of unnatural peptides. PloS one 2, e972,doi:10.1371 / journal.pone.0000972 (2007). [Non-patent document 3] Ueta M, Wada C, Bessho Y, MaedaM, Wada A. Genes Cells. 2017May;22(5):452-471. doi: 10.1111 / gtc.12488. Epub2017 Apr 10. Genes Cells. 2017 [Non-patent document 4] Lilleorg S, Reier K, Remme J,Liiv A. J Mol Biol. 2017 Apr7;429(7):1067-1080. doi: 10.1016 / j.jmb.2017.02.015.Epub 2017 Feb 24. J Mol Biol.2017 [Non-patent document 5] Chadani Y, Niwa T, Izumi T,Sugata N, Nagao A, Suzuki T, Chiba S, ItoK, Taguchi H. Mol Cell. 2017 Nov2;68(3):528-539.e5. doi:10.1016 / j.molcel.2017.10.020. Mol Cell. 2017 Summary of the Invention [Problem to be solved by the invention]

[0007] In one aspect, the present invention aims to provide a method for efficiently producing a peptide containing an unnatural amino acid, as well as a modified L31 protein for use in the method, and a ribosome containing the modified L31 protein. [Means for solving the problem]

[0008] The present inventors investigated whether there was a difference in mRNA translation efficiency between ribosomes containing L31 protein that had not been digested by Protease 7 and ribosomes containing L31 protein cleaved by Protease 7 when producing peptides containing unnatural amino acids using a translation system. The inventors found that when translating mRNA encoding a peptide containing an unnatural amino acid using the initiation suppression (iSP) method, using ribosomes containing L31 protein cleaved by Protease 7 increased the amount of translation of the target product compared to using ribosomes containing L31 protein that had not been digested by Protease 7. The inventors also found that using ribosomes containing L31 protein cleaved by Protease 7 reduced the relative amount of by-products. These results were contrary to previously known findings regarding the translation of peptides that do not contain unnatural amino acids. Furthermore, the inventors synthesized peptides by varying the magnesium ion concentration in the translation system, and found that when the magnesium ion concentration was within a certain range, the translation yield was high and the proportion of by-products was low.

[0009] The present invention is based on such findings and specifically relates to the following [1] to

[37] . [1] A method for producing a peptide, comprising a step of translating mRNA encoding a peptide containing one or more unnatural amino acids in a translation system containing a ribosome containing a modified L31 protein, wherein the ribosome containing the modified L31 protein has a greater translation activity for the peptide containing the unnatural amino acid than a ribosome containing Escherichia coli wild-type L31 having the amino acid sequence of SEQ ID NO: 1. [2] A method for producing a peptide, comprising: translating, in a translation system comprising a ribosome containing a modified L31 protein, an mRNA encoding a peptide containing one or more unnatural amino acids, wherein the modified L31 protein is selected from the group consisting of the proteins described in (1) to (3) below: (1) A protein comprising an amino acid sequence in which 6 or more amino acid residues are deleted from the C-terminus of the amino acid sequence represented by SEQ ID NO: 1; (2) A protein comprising the amino acid sequence of the protein according to (1) above, in which one or more amino acids are inserted, substituted, deleted, and / or added. (3) A protein comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence of the protein described in (1) above. [3] A method for producing a peptide, comprising: translating, in a translation system comprising a ribosome containing a modified L31 protein, an mRNA encoding a peptide containing one or more unnatural amino acids, wherein the modified L31 protein is selected from the group consisting of the proteins described in (1) to (3) below: (1) a protein consisting of an amino acid sequence represented by SEQ ID NO: 1, in which 6 or more amino acid residues are deleted from the C-terminus; (2) A protein having an amino acid sequence in which one or more amino acids are inserted, substituted, deleted, and / or added in the amino acid sequence of the protein according to (1). (3) A protein consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence of the protein described in (1) above. [4] The method according to [2] or [3], wherein the amino acid sequence having 6 or more amino acid residues deleted from the C-terminus described in (1) above is an amino acid sequence having 8 or more amino acid residues deleted from the C-terminus. [5] The method according to [4], wherein the amino acid sequence of SEQ ID NO: 1 according to (1) above, in which 8 or more amino acid residues are deleted from the C-terminus, is an amino acid sequence selected from the group consisting of SEQ ID NOs: 2 and 42 to 48. [6] The method according to any one of [2] to [5], wherein a ribosome containing the protein described in (2) and (3) has a higher translation activity of a peptide containing an unnatural amino acid compared to a ribosome containing Escherichia coli wild-type L31 containing the amino acid sequence of SEQ ID NO: 1. [7] The method according to any one of [2] to [6], wherein a ribosome containing the protein described in (1) above has a higher translation activity of a peptide containing an unnatural amino acid compared to a ribosome containing Escherichia coli wild-type L31 containing the amino acid sequence of SEQ ID NO: 1. [8] The method according to any one of [2] to [7], wherein the amino acid sequence having 6 or more amino acid residues deleted from the C-terminus is an amino acid sequence having 6 to 50 amino acid residues deleted from the C-terminus. [9] The method according to any one of [2] to [7], wherein the amino acid sequence having 6 or more amino acid residues deleted from the C-terminus is an amino acid sequence having 8 to 50 amino acid residues deleted from the C-terminus.

[10] The method according to any one of [2] to [7], wherein the amino acid sequence having 6 or more amino acid residues deleted from the C-terminus is an amino acid sequence having 6 to 43 amino acid residues deleted from the C-terminus.

[11] The method according to any one of [2] to [7], wherein the amino acid sequence having 6 or more amino acid residues deleted from the C-terminus is an amino acid sequence having 8 to 43 amino acid residues deleted from the C-terminus.

[12] The method described in any of [1] to

[11] , wherein the modified L31 protein is a protein consisting of an amino acid sequence represented by SEQ ID NO: 1, in which 8 or more amino acid residues are deleted from the C-terminus.

[13] The method described in any one of [1] to

[12] , wherein the modified L31 protein is a protein consisting of an amino acid sequence represented by any one selected from the group consisting of SEQ ID NOs: 2 and 42 to 48.

[14] The method according to any one of [1] to

[13] , wherein the ratio of ribosomes containing the modified L31 protein to all ribosomes in the translation system is 50% or more.

[15] The method according to any one of [1] to

[14] , wherein the translation system further contains 2 to 8 mM magnesium ions.

[16] The method according to any one of [1] to

[15] , further comprising a step of cyclizing the peptide.

[17] The method according to any one of [1] to

[16] , wherein the peptide contains an unnatural amino acid at the starting amino acid position.

[18] The method according to any one of [1] to

[17] , wherein the translation is carried out by initiation suppression.

[19] The method according to any one of [1] to

[18] , wherein an initiator tRNA contained in the translation system is acylated with an unnatural amino acid.

[20] The method according to any one of [1] to

[19] , wherein the translation activity is evaluated by the ratio of translation products in which amino acid skipping occurs to all translation products (iRT ratio).

[21] The method according to any one of [1] to

[20] , wherein the translation activity is evaluated by translating the peptide of SEQ ID NO: 29 using the template mRNA of SEQ ID NO: 10.

[22] The method described in any of [1] to

[21] , wherein the iRT rate of a ribosome containing the modified L31 protein is 15% or more lower than the iRT rate of a ribosome containing Escherichia coli wild-type L31 having the amino acid sequence of SEQ ID NO: 1.

[23] A peptide produced by the method according to any one of [1] to

[22] or a library comprising said peptide.

[24] A method for screening a peptide that binds to a target substance, comprising the steps of (a) and (b) below: (a) contacting a target substance with a peptide obtained by the method according to any one of [1] to

[22] or a library containing the peptide, or with the peptide or library according to

[23] ; (b) selecting a peptide that binds to the target substance;

[25] A modified L31 protein according to any one of [2] to

[24] .

[26] The modified L31 protein according to

[25] (excluding the L31 protein consisting of the amino acid sequence represented by SEQ ID NO: 2).

[27] An isolated nucleic acid encoding the modified L31 protein of

[25] or

[26] .

[28] A vector or cell containing the nucleic acid described in

[27] .

[29] A method for producing a ribosome containing a modified L31 protein, comprising the steps of: (a) preparing a ribosome containing a modified L31 protein; (a) culturing the cell according to

[28] ; (b) producing a lysate from the culture of the cells; and (c) purifying ribosomes from the lysate.

[30] A method for producing a modified L31 protein, comprising the steps of (a) and (b) below: (a) culturing the cell according to

[28] ; and (b) isolating the expression product from the culture of said cells.

[31] A method for producing a ribosome, comprising the steps of (a) and (b) below: (a) producing a lysate from a culture of wild-type E. coli using a French press under conditions where the magnesium ion concentration is 5 mM or less; and (b) purifying ribosomes from the lysate.

[32] A ribosome comprising the modified L31 protein according to

[25] or

[26] .

[33] A composition comprising the ribosome described in

[32] .

[34] The composition according to

[33] , wherein the ratio of ribosomes containing the modified L31 protein to all ribosomes is 50% or more.

[35] The composition according to

[33] or

[34] , further comprising the following (a) and / or (b); (a) aminoacyl-tRNA formed by binding an unnatural amino acid to a tRNA; (b) mRNA encoding a peptide containing one or more unnatural amino acids.

[36] The composition according to any one of

[33] to

[35] , further comprising an initiator tRNA acylated with an unnatural amino acid.

[37] A method for producing a cell-free translation system, comprising the steps of: (a) producing a ribosome by the method according to

[29] or

[31] ; and (b) mixing the ribosome with an initiator tRNA acylated with an unnatural amino acid; [Effects of the Invention]

[0010] The present invention provides a method for efficiently producing peptides containing unnatural amino acids and libraries containing such peptides. The present invention also provides a modified L31 protein and a ribosome containing the same for use in the method. By using the methods of the present invention, peptides containing unnatural amino acids and libraries thereof can be efficiently produced. It has previously been suggested that ribosomes containing L31 protein cleaved by protease 7 have lower activity than ribosomes containing uncleaved L31 protein. In light of this fact, it was a surprising effect that peptides containing unnatural amino acids can be efficiently translated by using ribosomes containing the modified L31 protein described herein. [Brief explanation of the drawings]

[0011] [Figure 1] 1 is a graph showing the amount of the target product translated and the amount of the iRT peptide translated when the mR-1 sequence was translated using L31short ribosomes or L31intact ribosomes. [Figure 2] 1 is a graph showing the amount of the target product translated and the amount of the iRT peptide translated when the mR-2 sequence was translated using L31short ribosomes or L31intact ribosomes. [Figure 3] 1 is a graph showing the amount of the target product translated and the amount of the iRT peptide translated when the mR-1 sequence was translated using WT-0MG ribosomes, WT-5MG ribosomes, or WT-10MG ribosomes. DETAILED DESCRIPTION OF THE INVENTION

[0012] The present invention relates to a method for producing a peptide or a library of peptides, comprising the step of translating mRNA encoding peptides containing one or more unnatural amino acids in a translation system comprising ribosomes containing a modified L31 protein. In the present invention, a peptide or a library of peptides can be produced by mixing a translation system comprising ribosomes containing a modified L31 protein with mRNA encoding peptides containing one or more unnatural amino acids. Accordingly, the present invention relates to a method for producing a peptide or a library of peptides, comprising the steps of mixing a translation system comprising ribosomes containing a modified L31 protein with mRNA encoding peptides containing one or more unnatural amino acids and translating the mRNA. The production method of the present invention enables more efficient translation of peptides containing unnatural amino acids than when using ribosomes containing wild-type L31 protein having the amino acid sequence set forth in SEQ ID NO: 1 derived from wild-type E. coli.

[0013] The L31 protein is one of the proteins that constitute the ribosome and plays an important role in the assembly of the 50S and 30S subunits. The present inventors have found that when a peptide containing one or more unnatural amino acids is synthesized in a translation system containing ribosomes containing a modified L31 protein, in which amino acid residues at the C-terminus of the wild-type E. coli L31 protein having the amino acid sequence set forth in SEQ ID NO: 1 are deleted, the amount of translation product is increased compared to when the peptide is synthesized in a translation system containing ribosomes containing the E. coli wild-type L31 protein. Furthermore, the present inventors have found that the relative amount of by-products produced can be reduced when a translation system containing ribosomes containing the modified L31 protein is used compared to when a translation system containing ribosomes containing the E. coli wild-type L31 protein is used.

[0014] As used herein, the term "E. coli wild-type L31 protein" refers to the L31 having the amino acid sequence set forth in SEQ ID NO: 1, and may also be referred to as "E. coli wild-type L31," "intact L31," "L31intact," or the like. As used herein, the term "modified L31 protein" refers to a modified L31 protein in which six or more amino acid residues are deleted from the C-terminus of the E. coli wild-type L31 protein. Among such proteins, the term "modified L31 protein in which amino acid residues 63 and beyond are deleted from the E. coli wild-type L31 protein," specifically, L31 having the amino acid sequence set forth in SEQ ID NO: 2, may also be referred to as "short L31," "L31short," or the like. The term "modified L31 protein in which amino acid residues (X+1) and beyond are deleted from the E. coli wild-type L31 protein" may also be referred to as "L31(1-X)." In other words, the short L31 is also referred to as "L31(1-62)." Furthermore, herein, ribosomes containing a certain L31 protein may be referred to by adding "ribosome" after the name of the L31 protein. For example, ribosomes containing "intact L31," "L31intact," "shortL31," "L31(1-62)," or "L31short" may be referred to as "intactL31 ribosome," "L31intact ribosome," "shortL31 ribosome," "L31(1-62) ribosome," or "L31short ribosome," respectively. Furthermore, ribosomes purified from a wild-type strain of E. coli may be referred to as "WT ribosome," etc.

[0015] Modified L31 protein In the production method of the present disclosure, the use of ribosomes containing the modified L31 protein enables more efficient translation of peptides containing unnatural amino acids than the use of ribosomes containing wild-type E. coli L31. In one embodiment of the present invention, the modified L31 protein (1) A protein comprising an amino acid sequence in which 6 or more amino acid residues are deleted from the C-terminus of the amino acid sequence represented by SEQ ID NO: 1; (2) A protein comprising the amino acid sequence of the protein according to (1) above, in which one or more amino acids are inserted, substituted, deleted, and / or added. (3) A protein comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence of the protein described in (1). Examples include:

[0016] The protein of (1) may be a protein comprising an amino acid sequence of SEQ ID NO: 1 in which 8 or more amino acid residues or 9 or more amino acid residues have been deleted from the C-terminus, and examples thereof include proteins comprising an amino acid sequence in which a number of amino acid residues has been deleted from the C-terminus within the range of 6, 7, 8, 9, 10, 11, 12, or 13, with a lower limit selected from 6, 7, 8, 9, 10, 11, 12, or 13, to an upper limit selected from 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, or 38. In one embodiment, the protein of (1) may be a protein comprising an amino acid sequence of SEQ ID NO: 1 in which any number of amino acid residues within the range of 6 to 50, any number of amino acid residues within the range of 6 to 43, any number of amino acid residues within the range of 8 to 50, or any number of amino acid residues within the range of 8 to 43, from the C-terminus. In a further embodiment, the protein (1) above may include a protein comprising an amino acid sequence in which 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 27, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid residues are deleted from the C-terminus of the amino acid sequence represented by SEQ ID NO: 1. More specifically, the modified L31 proteins of the present disclosure include proteins comprising an amino acid sequence in which 8, 43, 38, 33, 28, 23, 18, or 13 amino acids are deleted from the C-terminus of the amino acid sequence represented by SEQ ID NO: 1, and proteins in which amino acid residues have been modified (deleted, substituted, and / or inserted) in these proteins. That is, the modified L31 proteins of the present disclosure include: (1) a protein comprising an amino acid sequence selected from SEQ ID NOs: 2 and 42 to 48; (2) A protein comprising an amino acid sequence selected from SEQ ID NOs: 2 and 42 to 48, in which one or more amino acids are deleted, inserted, substituted, and / or added; and (3) A protein comprising an amino acid sequence having 80% or more sequence identity with any one of the amino acid sequences represented by SEQ ID NOs: 2 and 42 to 48. Also included are: The modified L31 protein of the present invention is preferably any one of SEQ ID NOs: 2 and 42 to 48, or a protein functionally equivalent to a protein comprising the amino acid sequence set forth in SEQ ID NO: 2. In this specification, "comprises" means both "includes" and "consists of."

[0017] In some embodiments, the modified L31 protein of the present disclosure may be (i) a protein comprising an amino acid sequence of SEQ ID NO: 1, with six or more or eight or more amino acid residues deleted from the C-terminus, or (ii) a protein comprising an amino acid sequence of a protein comprising an amino acid sequence selected from SEQ ID NOs: 2 and 42 to 48, with one or more amino acid insertions, substitutions, deletions, and / or additions (e.g., 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, or 3 or less, or 2, 3, 4, 5, 6, 7, 8, 9, or 10, or more than 10). Amino acid additions, deletions, substitutions, and / or insertions can be performed by methods known in the art. For example, a nucleic acid encoding the amino acid sequence can be subjected to, for example, site-directed mutagenesis (Kunkel et al., Proc. Natl. Acad. Sci. USA 82, 488-492 (1985)) or overlap extension PCR. These may be carried out individually or in combination as appropriate.

[0018] In general, modifications (e.g., conservative substitutions, deletions, insertions, and / or additions) of one or more (e.g., 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, or 3 or less, or 2, 3, 4, 5, 6, 7, 8, 9, or 10, or more than 10) amino acids in a protein are known not to affect the function of the peptide or even to enhance the function of the original protein. Amino acids are classified into hydrophobic amino acids (A, I, L, M, F, P, W, Y, V) and hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T) according to the characteristics of their side chains. Amino acid side chains can also be classified into aliphatic side chains (G, A, V, L, I, P), hydroxyl-containing side chains (S, T, Y), sulfur-containing side chains (C, M), carboxylic acid and amide-containing side chains (D, N, E, Q), base-containing side chains (R, K, H), and aromatic side chains (H, F, Y, W). The modified L31 proteins of the present invention also include proteins in which an amino acid contained in a protein having an amino acid sequence represented by any of SEQ ID NOS: 1, 2, and 42-48 has been modified with another amino acid group having the same characteristics. However, the modified L31 proteins of the present invention may also include non-conservative modifications as long as they are functionally equivalent to a protein having the amino acid sequence represented by any of SEQ ID NOS: 2, 42-48, or SEQ ID NOS: 2.

[0019] In one embodiment of the present invention, the modified L31 protein of the present disclosure also encompasses an amino acid sequence in which 6 or more or 8 or more amino acid residues are deleted from the C-terminus of the amino acid sequence represented by SEQ ID NO: 1, or an amino acid sequence that has a high sequence identity to any of the amino acid sequences represented by SEQ ID NOs: 1, 2, and 42 to 48. In the present disclosure, high identity refers to a sequence identity of at least 50% or more, more preferably 70% or more, even more preferably 80% or more, even more preferably 85% or more, and even more preferably 90% or more (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) of the entire amino acid sequence or the entire nucleotide sequence. Sequence identity can be determined using the BLAST algorithm by Carlin and Altschul (Proc. Natl. Acad. Sci. USA 87:2264-2268, 1990; Proc. Natl. Acad. Sci. USA 90:5873, 1993). Programs based on the BLAST algorithm, called BLASTN and BLASTX, have been developed (Altschul SF, et al: J Mol Biol 215:403, 1990). When analyzing a nucleotide sequence using BLASTN, parameters are set, for example, to score=100 and wordlength=12. When analyzing an amino acid sequence using BLASTX, parameters are set, for example, to score=50 and wordlength=3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific techniques for these analysis methods are known.

[0020] In the present disclosure, "functionally equivalent" means that a ribosome containing a modified L31 protein exhibits translation activity with respect to an mRNA encoding a peptide containing an unnatural amino acid that is equivalent to that of a ribosome containing an L31 protein consisting of an amino acid sequence represented by SEQ ID NO: 1 with six or more amino acid residues deleted from the C-terminus (e.g., an amino acid sequence set forth in any of SEQ ID NOs: 2 and 42-48). Therefore, when a ribosome containing a certain protein exhibits activity with respect to the translation of an mRNA encoding a peptide containing an unnatural amino acid that is equivalent to that of a ribosome containing an L31 protein consisting of an amino acid sequence represented by SEQ ID NO: 1 with six or more amino acid residues deleted from the C-terminus (e.g., an amino acid sequence set forth in any of SEQ ID NOs: 2 and 42-48), the certain protein can be said to be "functionally equivalent to an amino acid sequence represented by SEQ ID NO: 1 with six or more amino acid residues deleted from the C-terminus (e.g., a protein consisting of an amino acid sequence set forth in any of SEQ ID NOs: 2 and 42-48)." The present inventors have demonstrated that ribosomes containing an L31 protein comprising an amino acid sequence in which six or more amino acid residues have been deleted from the C-terminus of the amino acid sequence of SEQ ID NO: 1 (e.g., an amino acid sequence set forth in any of SEQ ID NOs: 2 and 42 to 48) have greater translation activity of mRNA encoding a peptide comprising an unnatural amino acid than ribosomes containing an L31 protein comprising the amino acid sequence of SEQ ID NO: 1. Therefore, when a ribosome containing a certain protein exhibits greater translation activity of mRNA encoding a peptide comprising an unnatural amino acid than a ribosome containing an L31 protein comprising the amino acid sequence of SEQ ID NO: 1, the certain protein can be said to be "functionally equivalent to a protein consisting of an amino acid sequence in which six or more amino acid residues have been deleted from the C-terminus of the amino acid sequence of SEQ ID NO: 1 (e.g., an amino acid sequence set forth in any of SEQ ID NOs: 2 and 42 to 48)."Alternatively, when a certain protein, compared to the L31 protein containing the amino acid sequence set forth in SEQ ID NO: 1, constitutes a ribosome and provides the ribosome with translation activity for an mRNA encoding a peptide containing a large unnatural amino acid, the certain protein can be said to be "a protein functionally equivalent to a protein consisting of an amino acid sequence in which six or more amino acid residues are deleted from the C-terminus of the amino acid sequence set forth in SEQ ID NO: 1 (e.g., the amino acid sequence set forth in any of SEQ ID NOs: 2 and 42-48)."

[0021] In the present disclosure, the "translation activity of an mRNA encoding a peptide comprising an unnatural amino acid" can also be expressed as the "translation efficiency of an mRNA encoding a peptide comprising an unnatural amino acid," and specifically includes the ease of incorporation of a tRNA having an unnatural amino acid, the degree of skipping of a codon encoding the unnatural amino acid, the amount of translated peptide, and / or the amount of by-products produced. In the present disclosure, "high translation activity of mRNA encoding a peptide containing an unnatural amino acid" can also be expressed as "high translation efficiency of mRNA encoding a peptide containing an unnatural amino acid," and specifically means that tRNA containing the unnatural amino acid is easily incorporated, codons encoding the unnatural amino acid are rarely skipped, a large amount of the target peptide is produced, and / or a small amount of by-products is produced.

[0022] In the present disclosure, the "translation activity of an mRNA encoding a peptide comprising an unnatural amino acid" can be evaluated using the proportion of translation products in which amino acid skipping occurs relative to all translation products as an indicator. Translation of an mRNA encoding a peptide comprising an unnatural amino acid can include, in addition to the target product (TM), initiation readthrough (iRT) peptides, such as a peptide translated from the second amino acid after skipping the initiation amino acid (referred to as "1iRT" in the present disclosure) or a peptide translated from the third amino acid after skipping the initiation amino acid and the second amino acid (referred to as "2iRT" in the present disclosure). In the present disclosure, the "iRT ratio," calculated from the concentrations of the initiation readthrough (iRT) and the target product (TM) using the following formula, can be used as the "translation activity of an mRNA encoding a peptide comprising an unnatural amino acid." The "iRT total concentration" in the formula can be calculated as the sum of the concentrations of the 1iRT (peptide whose translation initiated from the second letter) and the 2iRT (peptide whose translation initiated from the third letter).

[0023] (Number 1) iRT ratio = (iRT total concentration [nM]) / (iRT total concentration [nM] + TM concentration [nM]) × 100

[0024] Specifically, the iRT ratio can be evaluated by the method described in the Examples using the aminoacyl-tRNA and translation system described in the Examples. As an example, the "translation activity of an mRNA encoding a peptide containing an unnatural amino acid" can be evaluated by translating the peptide of any of SEQ ID NOS: 29 to 31, preferably SEQ ID NO: 29, using the template mRNA of SEQ ID NO: 10.

[0025] In the present disclosure, "increased translation activity of an mRNA encoding a peptide comprising an unnatural amino acid" can mean a lower iRT rate. "Increased translation activity of a peptide comprising an unnatural amino acid compared to a ribosome comprising an E. coli wild-type L31 comprising the amino acid sequence of SEQ ID NO:1" can mean, for example, that the iRT rate of a ribosome comprising a modified L31 protein of the present disclosure is 15%, 20%, 25%, or 30% or more lower than the iRT rate of a ribosome comprising an E. coli wild-type L31 comprising the amino acid sequence of SEQ ID NO:1.

[0026] Prokaryotic ribosomes contain a 50S large subunit and a 30S small subunit. The 50S subunit is further composed of 23S rRNA and 5S rRNA and multiple proteins. The 30S subunit is composed of 16S rRNA and multiple proteins. On the other hand, eukaryotic ribosomes contain a 60S large subunit and a 40S small subunit. The 60S subunit is further composed of 28S rRNA, 5.8S rRNA, and 5S rRNA and multiple proteins. The 40S subunit is composed of 18S rRNA and multiple proteins. The components of ribosomes are known to those skilled in the art.

[0027] amino acid In the present disclosure, the "amino acids" constituting peptides include "natural amino acids" such as α-amino acids and "unnatural amino acids" such as β-amino acids and γ-amino acids. The three-dimensional structure of amino acids may be either L-amino acids or D-amino acids. "Amino acids," "natural amino acids," and "unnatural amino acids" may also be referred to as "amino acid residues," "natural amino acid residues," and "unnatural amino acid residues," respectively.

[0028] In certain embodiments, naturally occurring amino acids consist of the following 20 α-amino acids: glycine (Gly), alanine (Ala), serine (Ser), threonine (Thr), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp), histidine (His), glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), cysteine ​​(Cys), methionine (Met), lysine (Lys), arginine (Arg), and proline (Pro). Alternatively, naturally occurring amino acids of the present disclosure may be those obtained by omitting any one or more amino acids from the above 20 amino acids. In one embodiment, naturally occurring amino acids consist of the 19 amino acids excluding isoleucine. In one embodiment, naturally occurring amino acids consist of the 19 amino acids excluding methionine. In a further embodiment, the naturally occurring amino acids consist of the 18 amino acids excluding isoleucine and methionine. The naturally occurring amino acids are usually L-amino acids.

[0029] Unnatural amino acids In the present disclosure, unnatural amino acids refer to all amino acids other than the 20 naturally occurring α-amino acids. Examples of unnatural amino acids include β-amino acids, γ-amino acids, D-amino acids, α-amino acids with side chains different from those of naturally occurring amino acids, α,α-disubstituted amino acids, and amino acids with a substituent in the main chain amino group (N-substituted amino acids). The side chains of unnatural amino acids are not particularly limited and may contain, in addition to hydrogen atoms, for example, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, cycloalkyl, etc. In addition, in the case of α,α-disubstituted amino acids, the two side chains may form a ring. Furthermore, these side chains may contain one or more substituents. In certain embodiments, the substituents can be selected from any functional group including a halogen atom, an O atom, a S atom, a N atom, a B atom, a Si atom, or a P atom. For example, in the present disclosure, "C1-C6 alkyl having a halogen atom as a substituent" refers to a "C1-C6 alkyl" in which at least one hydrogen atom in the alkyl has been substituted with a halogen atom, and specifically includes, for example, trifluoromethyl, difluoromethyl, fluoromethyl, pentafluoroethyl, tetrafluoroethyl, trifluoroethyl, difluoroethyl, fluoroethyl, trichloromethyl, dichloromethyl, chloromethyl, pentachloroethyl, tetrachloroethyl, trichloroethyl, dichloroethyl, chloroethyl, etc. Furthermore, for example, "C5-C10 aryl C1-C6 alkyl having a substituent" refers to a "C5-C10 aryl C1-C6 alkyl" in which at least one hydrogen atom in the aryl and / or alkyl has been substituted with a substituent. Furthermore, "having two or more substituents" also includes having a certain functional group (e.g., a functional group containing an S atom) as a substituent, and that functional group further having another substituent (e.g., a substituent such as amino or halogen). For specific examples of unnatural amino acids, see WO2013 / 100132 and WO2018 / 143145.

[0030] The amino group in the main chain of an unnatural amino acid may be an unsubstituted amino group (NH group) or a substituted amino group (NHR group). Here, R represents alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or cycloalkyl, each of which may have a substituent. Furthermore, as in proline, the carbon chain bonded to the N atom of the main chain amino group and the carbon atom at the α-position may form a ring. Examples of alkyl substitution of amino groups include N-methylation, N-ethylation, N-propylation, and N-butylation, and examples of aralkyl substitution include N-benzylation. Specific examples of N-methylamino acids include N-methylalanine, N-methylglycine, N-methylphenylalanine, N-methyltyrosine, N-methyl-3-chlorophenylalanine, N-methyl-4-chlorophenylalanine, N-methyl-4-methoxyphenylalanine, N-methyl-4-thiazolealanine, N-methylhistidine, N-methylserine, and N-methylaspartic acid.

[0031] Examples of the substituent containing a halogen include an alkyl group, a cycloalkyl group, an alkenyl group, an alkynyl group, an aryl group, a heteroaryl group, and an aralkyl group, each of which has a halogen as a substituent, and more specific examples thereof include a fluoroalkyl, a difluoroalkyl, and a trifluoroalkyl.

[0032] Examples of the substituent containing an O atom include hydroxyl (-OH), oxy (-OR), carbonyl (-C=OR), carboxyl (-COH), oxycarbonyl (-C=O-OR), carbonyloxy (-OC=OR), thiocarbonyl (-C=O-SR), carbonylthio group (-SC=OR), aminocarbonyl (-C=O-NHR), carbonylamino (-NH-C=OR), oxycarbonylamino (-NH-C=O-OR), sulfonylamino (-NH-SO2-R), aminosulfonyl (-SO2-NHR), sulfamoylamino (-NH-SO2-NHR), thiocarboxyl (-C(=O)-SH), and carboxylcarbonyl (-C(=O)-COH).

[0033] Examples of oxy (-OR) include alkoxy, cycloalkoxy, alkenyloxy, alkynyloxy, aryloxy, heteroaryloxy, aralkyloxy, and the like.

[0034] Examples of carbonyl (-C=OR) include formyl (-C=OH), alkylcarbonyl, cycloalkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, arylcarbonyl, heteroarylcarbonyl, aralkylcarbonyl, and the like.

[0035] Examples of oxycarbonyl (-C=O-OR) include alkyloxycarbonyl, cycloalkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, aralkyloxycarbonyl, and the like. (-C=O-OR)

[0036] Examples of carbonyloxy (-OC=OR) include alkylcarbonyloxy, cycloalkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy, arylcarbonyloxy, heteroarylcarbonyloxy, aralkylcarbonyloxy, and the like.

[0037] Examples of thiocarbonyl (-C=O-SR) include alkylthiocarbonyl, cycloalkylthiocarbonyl, alkenylthiocarbonyl, alkynylthiocarbonyl, arylthiocarbonyl, heteroarylthiocarbonyl, aralkylthiocarbonyl, and the like.

[0038] Examples of carbonylthio (-SC=OR) include alkylcarbonylthio, cycloalkylcarbonylthio, alkenylcarbonylthio, alkynylcarbonylthio, arylcarbonylthio, heteroarylcarbonylthio, aralkylcarbonylthio, and the like.

[0039] Examples of aminocarbonyl (-C=O-NHR) include alkylaminocarbonyl, cycloalkylaminocarbonyl, alkenylaminocarbonyl, alkynylaminocarbonyl, arylaminocarbonyl, heteroarylaminocarbonyl, aralkylaminocarbonyl, etc. In addition to these, groups in which the H atom bonded to the N atom in -C=O-NHR is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0040] Examples of carbonylamino (-NH-C=OR) include alkylcarbonylamino, cycloalkylcarbonylamino, alkenylcarbonylamino, alkynylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino, aralkylcarbonylamino, etc. In addition to these, the H atom bonded to the N atom in -NH-C=OR may be further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl.

[0041] Examples of oxycarbonylamino (-NH-C=O-OR) include alkoxycarbonylamino, cycloalkoxycarbonylamino, alkenyloxycarbonylamino, alkynyloxycarbonylamino, aryloxycarbonylamino, heteroaryloxycarbonylamino, aralkyloxycarbonylamino, etc. In addition to these, groups in which the H atom bonded to the N atom in -NH-C=O-OR is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0042] Examples of sulfonylamino (-NH-SO2-R) include alkylsulfonylamino, cycloalkylsulfonylamino, alkenylsulfonylamino, alkynylsulfonylamino, arylsulfonylamino, heteroarylsulfonylamino, aralkylsulfonylamino, etc. In addition to these, groups in which the H atom bonded to the N atom in -NH-SO2-R is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0043] Examples of aminosulfonyl (-SO2-NHR) include alkylaminosulfonyl, cycloalkylaminosulfonyl, alkenylaminosulfonyl, alkynylaminosulfonyl, arylaminosulfonyl, heteroarylaminosulfonyl, aralkylaminosulfonyl, etc. In addition to these, groups in which the H atom bonded to the N atom in -SO2-NHR is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0044] Examples of sulfamoylamino (-NH-SO-NHR) include alkylsulfamoylamino, cycloalkylsulfamoylamino, alkenylsulfamoylamino, alkynylsulfamoylamino, arylsulfamoylamino, heteroarylsulfamoylamino, aralkylsulfamoylamino, etc. Furthermore, the two H atoms bonded to the N atom in -NH-SO-NHR may be substituted with substituents independently selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, and these two substituents may form a ring.

[0045] Substituents containing an S atom include thiol (-SH), thio (-SR), sulfinyl (-S=OR), sulfonyl (-S(O)2-R), and sulfo (-SO3H).

[0046] Examples of thio (-SR) include alkylthio, cycloalkylthio, alkenylthio, alkynylthio, arylthio, heteroarylthio, aralkylthio, and the like.

[0047] Examples of sulfinyl (-S=OR) include alkylsulfinyl, cycloalkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, arylsulfinyl, heteroarylsulfinyl, aralkylsulfinyl, and the like.

[0048] Examples of sulfonyl (-S(O)2-R) include alkylsulfonyl, cycloalkylsulfonyl, alkenylsulfonyl, alkynylsulfonyl, arylsulfonyl, heteroarylsulfonyl, aralkylsulfonyl, and the like.

[0049] Substituents containing an N atom include azide (-N3, also referred to as an "azido group"), cyano (-CN), primary amino (-NH2), secondary amino (-NH-R), tertiary amino (-NR(R')), amidino (-C(=NH)-NH2), substituted amidino (-C(=NR)-NR'R''), guanidino (-NH-C(=NH)-NH2), substituted guanidino (-NR-C(=NR''')-NR'R''), and aminocarbonylamino (-NR-CO-NR'R'').

[0050] Examples of secondary amino (-NH-R) include alkylamino, cycloalkylamino, alkenylamino, alkynylamino, arylamino, heteroarylamino, aralkylamino, and the like.

[0051] Examples of tertiary amino (—NR(R′)) include an amino group having any two substituents independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, etc., such as alkyl(aralkyl)amino, and these two substituents may form a ring.

[0052] Examples of substituted amidino (-C(=NR)-NR'R'') include groups in which the three substituents R, R', and R'' on the N atom are each independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, such as alkyl(aralkyl)(aryl)amidino.

[0053] Examples of substituted guanidino (-NR-C(=NR''')-NR'R'') include groups in which R, R', R'', and R''' are each independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, or groups in which these groups form a ring.

[0054] Examples of aminocarbonylamino (-NR-CO-NR'R'') include groups in which R, R', and R'' are each independently selected from a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, or groups in which these groups form a ring.

[0055] Examples of substituents containing a B atom include boryl (-BR(R')) and dioxyboryl (-B(OR)(OR')). These two substituents, R and R', are independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, etc., or may form a ring.

[0056] At least one atom constituting the "amino acid" constituting the peptide may be an atom (isotope) with the same atomic number (number of protons) but a different mass number (sum of the number of protons and neutrons). Examples of isotopes contained in the "amino acids" constituting the peptide include hydrogen atoms, carbon atoms, nitrogen atoms, oxygen atoms, phosphorus atoms, sulfur atoms, fluorine atoms, and chlorine atoms, each of which is 2 H, 3 H, 13 C. 14 C. 15 N, 17 O. 18O. 31 P, 32 P, 35 S, 18 F, 36 Includes Cl etc.

[0057] As used herein, the term "halogen atom" includes, for example, F, Cl, Br, or I.

[0058] As used herein, "alkyl" refers to a monovalent group derived from an aliphatic hydrocarbon by removing any one hydrogen atom, and does not contain heteroatoms (atoms other than carbon and hydrogen atoms) or unsaturated carbon-carbon bonds in the skeleton, but has a subset of hydrocarbyl or hydrocarbon group structures containing hydrogen and carbon atoms. Alkyl includes not only linear but also branched chain alkyls. Specific examples of alkyl include alkyls having 1 to 20 carbon atoms (C1-C 20 , hereinafter referred to as “C p -C q " means that the number of carbon atoms is p to q), and preferably C1-C 10 Alkyl is preferably C1-C6 alkyl. Specific examples of alkyl include methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, isobutyl (2-methylpropyl), n-pentyl, s-pentyl (1-methylbutyl), t-pentyl (1,1-dimethylpropyl), neopentyl (2,2-dimethylpropyl), isopentyl (3-methylbutyl), 3-pentyl (1-ethylpropyl), 1,2-dimethylpropyl, 2-methylbutyl, n-hexyl, 1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1,1,2,2-tetramethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2-ethylbutyl, etc.

[0059] As used herein, "alkenyl" refers to an alkyl group having at least one double bond (two adjacent SP 2Alkenyl is a monovalent group having 2-4 carbon atoms. Depending on the configuration of the double bond and the substituents (if any), the geometry of the double bond can be Entgegen (E) or Zusammen (Z), cis or trans. Alkenyl includes not only straight chains but also branched chains. Alkenyl is preferably C2-C 10 Alkenyl, more preferably C2-C6 alkenyl, is exemplified, and specific examples include vinyl, allyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl (including cis and trans), 3-butenyl, pentenyl, 3-methyl-2-butenyl, hexenyl, etc.

[0060] As used herein, "alkynyl" refers to a monovalent group having at least one triple bond (two adjacent SP carbon atoms). Alkynyl includes not only straight chain but also branched chain. Alkynyl is preferably C2-C 10 Alkynyl, more preferably C2-C6 alkynyl, is included, and specific examples include ethynyl, 1-propynyl, propargyl, 3-butynyl, pentynyl, hexynyl, 3-phenyl-2-propynyl, 3-(2'-fluorophenyl)-2-propynyl, 2-hydroxy-2-propynyl, 3-(3-fluorophenyl)-2-propynyl, 3-methyl-(5-phenyl)-4-pentynyl, and the like.

[0061] As used herein, the term "cycloalkyl" refers to a saturated or partially saturated cyclic monovalent aliphatic hydrocarbon group, including monocyclic, bicyclic, and spirocyclic rings. Preferred examples of cycloalkyl include C3-C8 cycloalkyl, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bicyclo[2.2.1]heptyl, and spiro[3.3]heptyl.

[0062] As used herein, "aryl" refers to a monovalent aromatic hydrocarbon ring, preferably C6-C 10Specific examples of the aryl include phenyl and naphthyl (for example, 1-naphthyl and 2-naphthyl).

[0063] As used herein, "heteroaryl" refers to an aromatic cyclic monovalent group containing 1 to 5 heteroatoms in addition to carbon atoms. The ring may be a single ring or a condensed ring with other rings, and may be partially saturated. The number of atoms constituting the ring is preferably 5 to 10 (5- to 10-membered heteroaryl), and more preferably 5 to 7 (5- to 7-membered heteroaryl). Specific examples of heteroaryl include furyl, thienyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyrimidyl, pyridazinyl, pyrazinyl, triazinyl, benzofuranyl, benzothienyl, benzothiadiazolyl, benzothiazolyl, benzoxazolyl, benzoxadiazolyl, benzimidazolyl, indolyl, isoindolyl, indazolyl, quinolyl, isoquinolyl, cinnolinyl, quinazolinyl, quinoxalinyl, benzodioxolyl, indolizinyl, and imidazopyridyl.

[0064] As used herein, "alkoxy" refers to an oxy group bonded to an "alkyl" as defined above, and preferably includes C1-C6 alkoxy. Specific examples of alkoxy include methoxy, ethoxy, 1-propoxy, 2-propoxy, n-butoxy, i-butoxy, s-butoxy, t-butoxy, pentyloxy, and 3-methylbutoxy.

[0065] As used herein, "alkenyloxy" refers to an oxy group bonded to the above-defined "alkenyl," and preferably includes C2-C6 alkenyloxy. Specific examples of alkenyloxy include vinyloxy, allyloxy, 1-propenyloxy, 2-propenyloxy, 1-butenyloxy, 2-butenyloxy (including cis and trans), 3-butenyloxy, pentenyloxy, and hexenyloxy.

[0066] As used herein, "cycloalkoxy" refers to an oxy group bonded to a "cycloalkyl" as defined above, and preferably includes C3-C8 cycloalkoxy. Specific examples of cycloalkoxy include cyclopropoxy, cyclobutoxy, cyclopentyloxy, etc.

[0067] As used herein, "aryloxy" refers to an oxy group to which the above-defined "aryl" is bonded, and preferably has a C6-C 10 Specific examples of the aryloxy include phenoxy, 1-naphthyloxy, and 2-naphthyloxy.

[0068] As used herein, "amino" refers to -NH2 in a narrow sense and -NRR' in a broad sense, where R and R' are independently selected from hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl, or R and R' together with the nitrogen atom to which they are attached form a ring. Preferred amino groups include -NH2, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, and 4- to 8-membered cyclic amino.

[0069] As used herein, "monoalkylamino" refers to a group in which R is hydrogen and R' is an "alkyl" as defined above, among the "amino" groups defined above, and preferably includes mono-C1-C6 alkylamino. Specific examples of monoalkylamino include methylamino, ethylamino, n-propylamino, i-propylamino, n-butylamino, s-butylamino, and t-butylamino.

[0070] As used herein, "dialkylamino" refers to a group in which R and R' are independently "alkyl" as defined above, among the "amino" groups defined above, and preferably includes diC1-C6 alkylamino. Specific examples of dialkylamino include dimethylamino and diethylamino.

[0071] As used herein, "aminoalkyl" refers to a group in which one or more hydrogen atoms of an "alkyl" as defined above are substituted with an "amino" as defined above, and C1-C6 aminoalkyl is preferred. Specific examples of aminoalkyl include 1-pyridylmethyl, 2-(1-piperidyl)ethyl, 3-(1-piperidyl)propyl, and 4-aminobutyl.

[0072] As used herein, "aralkyl (arylalkyl)" refers to a group in which at least one hydrogen atom of an "alkyl" as defined above is substituted with an "aryl" as defined above, and is a C7-C 14 Aralkyl is preferred, C7-C 10 Aralkyl is more preferred. Specific examples of aralkyl include benzyl, phenethyl, and 3-phenylpropyl.

[0073] For specific examples of unnatural amino acids, see WO2013 / 100132 and WO2018 / 143145.

[0074] In one aspect, peptides containing one or more unnatural amino acids obtained by the production method of the present invention can be used as pharmaceuticals. When peptides are used as pharmaceuticals, they preferably have excellent metabolic stability and membrane permeability. Such properties are referred to herein as "drug-likeness" or "drug-like." As used herein, "drug-like amino acids" refer to α-, β-, and γ-amino acids, in which one of the two hydrogen atoms in the main chain amino group (NH group) or one or two hydrogen atoms in the main chain methylene group (-CH- group) may be substituted with an alkyl group, cycloalkyl group, alkenyl group, alkynyl group, aryl group, heteroaryl group, aralkyl group, or the like. These substituents may be further substituted with "substituents that contribute to drug-likeness." Amino acids with "long side chains" as disclosed in WO2018 / 225864 are preferred examples of drug-like amino acids. Furthermore, drug-like amino acids may include L-amino acids, D-amino acids, α-, α-disubstituted amino acids, N-substituted amino acids, and the like. Drug-like amino acids do not necessarily need to be translatable. They include the side chain portion of a peptide obtained from a "translated amino acid" (e.g., if a hit compound is obtained using D-tyrosine, a D-amino acid chemically modified from D-tyrosine; if a hit compound is obtained using β-alanine, a β-amino acid chemically modified from D-alanine), or amino acids that can be chemically synthesized by structural optimization of the N-substituted portion through chemical conversion of an N-methyl amino acid. Because these amino acids function as building blocks of drug-like peptides, they are selected from a range of amino acids that will result in drug-like peptides after post-translational chemical modification. As described below, for example, lysine having an aminoalkyl group is not included in drug-like amino acids if the amino group is not involved in post-translational modification. However, when the amino group of lysine is utilized as a reactive functional group in post-translational modification (e.g., a crossover unit), the lysine unit is included as a drug-like amino acid unit. Thus, whether an amino acid is a "drug-like amino acid" is determined by the functional group converted by post-translational modification.Examples of such substituents include, among the substituents separately defined above, an ester group (-CO-OR), a thioester group (-CO-SR), a thiol group (-SH), or a protected thiol group, an amino group (-NH), a monosubstituted amino group (-NH-R), or a disubstituted amino group (-NRR'), or a protected amino group, a substituted sulfonylamino group (-NH-SO-R), an alkylborane group (-BRR'), an alkoxyborane group (-B(OR)(OR')), an azide group (-N), a keto acid group (-CO-COH), a thiocarboxylic acid group (-CO-SH), a phosphoryl ester group (-CO-PO(R)(R')), an acylhydroxyamino group (-NH-O-CO-R), etc. One or two non-adjacent methylene groups in the side chain of the drug-like amino acid may be substituted with an oxygen atom, a carbonyl group (-CO-), or a sulfonyl group (-SO-).

[0075] Examples of the "substituent that contributes to drug-likeness" in this specification include halogen (F, Cl, Br, I, etc.), hydroxy (-OH), alkoxy group (-OR), oxy (-OR), amide (-NR-COR' or -CO-NRR'), sulfonyl (-SO2-R), sulfinyl (-SOR), oxyamino (-NR-OR'), aminooxy (-O-NRR'), oxycarbonyl (-CO-OR), thiocarbonyl (-CO-SR), thiol (-SH), thio (-SR) Examples of the substituent include primary amino (-NH), secondary amino (-NHR), tertiary amino (-NRR'), sulfonylamino (-NH-SO-R), boryl (-BRR'), dioxyboryl (-B(OR)(OR')), azide (-N), carboxycarbonyl (-CO-COH), phosphorylcarbonyl (-CO-PO(R)(R')), carbonyloxyamino (-NH-O-CO-R), hydroxyamino (-NR-OR'), and aminohydroxy (-O-NRR').

[0076] Specific examples of unnatural amino acids constituting peptides containing one or more unnatural amino acids of the present disclosure include MeSer(tBuOH), BODIPYFL-4-AMF, MeCys(StBu), MeG, MeStBuOH, Nle, S3F5MePyr, SPh2Cl, MeF, MeHph, MeA3Pyr, SPh2Cl, Pic(2), MeHph, dA, etc. These unnatural amino acids can be included, for example, at the second or third letter position of the peptide.

[0077] peptide In the present disclosure, a peptide refers to two or more amino acids bonded together via an amide bond and / or an ester bond. Without intending to be limiting, peptides in the present disclosure include linear peptides and cyclic peptides. Furthermore, peptides in the present disclosure include peptides, peptide-nucleic acid complexes (peptide-nucleic acid complexes), peptide-ribosome-nucleic acid complexes, and the like. Furthermore, "nucleic acids" in the present disclosure include DNA, mRNA, and tRNA. Furthermore, "peptides" in the present disclosure may also include pharmaceutically acceptable salts thereof.

[0078] In one embodiment, the peptide of the present disclosure comprises 2 to 100, 3 to 50, 4 to 30, or 5 to 30 amino acids linked by amide bonds and / or ester bonds. For example, in one embodiment, when a peptide according to the present invention containing one or more unnatural amino acids is used as a pharmaceutical, in order to achieve high membrane permeability, the number of amino acids constituting the peptide is preferably 20 or less, more preferably 18 or less, 16 or less, 15 or less, or 14 or less, and particularly preferably 13 or less, and specific examples thereof include 9, 10, 11, 12, and 13. Furthermore, in order to achieve high metabolic stability, the number of amino acids constituting the peptide is preferably 8 or more, more preferably 9 or more, even more preferably 10 or more, and particularly preferably 11 or more. Considering both membrane permeability and metabolic stability, the number of amino acids constituting the peptide is preferably 5 to 20 or 7 to 20, more preferably 7 to 17, 8 to 16, 9 to 16, or 10 to 16, even more preferably 8 to 13, 10 to 15, 11 to 15, 10 to 14, 10 to 13, or 11 to 14, and particularly preferably 11 to 13.

[0079] The number of amino acids constituting the cyclic portion of the cyclic peptide of the present disclosure is not limited, and examples include 4 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 20 or less, 18 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16. In consideration of both membrane permeability and metabolic stability, the number of amino acids constituting the cyclic portion is preferably 5 to 15, more preferably 5 to 14, 7 to 14, or 8 to 14, even more preferably 8 to 13, 9 to 13, 8 to 12, 8 to 11, or 9 to 12, and particularly preferably 9 to 11. As used herein, the "cyclic portion" of a peptide refers to a cyclic moiety formed by linking two or more amino acid residues.

[0080] In a non-limiting embodiment, the cyclic peptide of the present disclosure may have a linear portion. As used herein, the term "linear portion" used to refer to a partial structure of a cyclic peptide refers to a portion that is not included in the main chain structure of the cyclic portion and that has at least one amide bond and / or ester bond on the chain of that portion. The number of amino acids (number of units) in the linear portion is preferably 0 to 8, more preferably 0 to 5, and even more preferably 0 to 3. In a non-limiting embodiment, the linear portion herein may contain natural amino acids or unnatural amino acids (including chemically modified or backbone-converted amino acids).

[0081] In a non-limiting embodiment, the number of unnatural amino acids contained in a peptide of the present disclosure is preferably 2 or more, more preferably 4 or more, 5 or more, or 6 or more, even more preferably 7 or more, and particularly preferably 8 or more, and preferably 20 or less, 15 or less, 14 or less, 13 or less, 12 or less, 10 or less, or 9 or less. The number of unnatural amino acids contained in a peptide of the present disclosure is 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, or 80% or more of the number of amino acids constituting the cyclic portion. The number of types of unnatural amino acids contained in a peptide of the present disclosure is preferably 1 or more, more preferably 2 or more, 3 or more, or 4 or more, even more preferably 7 or more, and particularly preferably 8 or more, and preferably 20 or less, 15 or less, 14 or less, 13 or less, 12 or less, 10 or less, or 9 or less.

[0082] In the peptides of the present disclosure comprising one or more unnatural amino acids, the position at which the unnatural amino acid is contained is not limited, but in one embodiment, the unnatural amino acid can be contained at the starting amino acid position, and further, the unnatural amino acid can be contained at the second and / or third amino acid positions.

[0083] It is known that when an amino acid other than fMet is introduced at the initiation amino acid position, a phenomenon defined as initiation read-through (iRT), in which translation initiates from the second or third amino acid, is observed (hereinafter, peptides produced in this manner are defined as initiation read-through peptides (iRT peptides)). By using the modified L31 protein of the present disclosure or ribosomes containing the same, the initiation read-through phenomenon can be prevented even when synthesizing peptides in which a non-natural amino acid has been introduced at the initiation amino acid position. Furthermore, iRT peptides are not cyclized. Therefore, when creating a library containing cyclic peptides, if the majority of the mRNAs encoding them encode iRT peptides, the number of molecules that can be displayed is limited, reducing the number of cyclic peptides displayed and the diversity of the library. By using the modified L31 protein of the present disclosure or ribosomes containing the same, such a decrease in library quality can be prevented.

[0084] Peptide-encoding mRNA In this disclosure, peptides are produced by translating mRNA encoding peptides containing one or more unnatural amino acids. mRNA is RNA that contains genetic information that can be translated into proteins. Genetic information is encoded on mRNA as codons, each corresponding to one of the 20 amino acids. Protein translation begins with an initiation codon and terminates with a termination codon. In eukaryotes, the initiation codon is generally AUG, but prokaryotes (eubacteria and archaea) may also use GUG or UUG as initiation codons. AUG encodes methionine (Met), and translation begins with methionine in eukaryotes and archaea. In contrast, in eubacteria, only the initiation codon AUG corresponds to N-formylmethionine (fMet), so translation begins with formylmethionine. There are three types of termination codons: UAA (ochre), UAG (amber), and UGA (opal). When the stop codon is recognized by a protein called a translation release factor (RF), the peptide chain synthesized up to that point dissociates from the tRNA, terminating the translation process. In one embodiment, an example of an mRNA encoding a peptide containing one or more unnatural amino acids according to the present disclosure is one that contains a codon encoding a peptide containing an unnatural amino acid at least at the start amino acid position. In the present disclosure, the site containing an unnatural amino acid in an mRNA encoding a peptide containing one or more unnatural amino acids is not limited, but in one embodiment, the codon encoding the unnatural amino acid can be included at the position of the start amino acid.

[0085] Peptide translation As described above, in the present disclosure, peptides containing one or more unnatural amino acids can be produced by translating mRNA encoding the peptide. As used herein, "translation" refers to the synthesis of a peptide by translation from a nucleic acid (e.g., DNA, RNA) encoding the peptide. Translation is a process in which a linear peptide is obtained by repeated amide bond and / or ester bond reactions using mRNA as a template by the action of ribosomes.

[0086] In one aspect, the present disclosure provides methods for producing peptides or libraries comprising peptides that include at least one, two or more, three or more, four or more, or five or more unnatural amino acids. Without limitation, such methods can include (i) and (ii) the following: (i) providing at least one, two or more, three or more, four or more, or five or more types of tRNAs bound to an unnatural amino acid; (ii) translating a nucleic acid containing at least one codon corresponding to the anticodon of the tRNA in a translation system to obtain the peptide. The nucleic acid may contain at least one codon corresponding to the anticodon of the tRNA. In a non-limiting embodiment, an mRNA encoding a peptide containing one or more unnatural amino acids of the present disclosure may contain a codon encoding a peptide containing an unnatural amino acid at least at the start amino acid position.

[0087] In the translation of natural amino acids, 64 codons are assigned to each of the 20 proteinogenic amino acids and a translation termination codon. When a specific amino acid is removed from a translation system, the codon corresponding to that amino acid becomes vacant. Therefore, if a desired unnatural amino acid is linked to a tRNA having an anticodon complementary to the vacant codon and translation is performed, the amino acid will be encoded by that codon, and a peptide will be translated in which the desired unnatural amino acid has been introduced in place of the removed amino acid.

[0088] In one embodiment of the present disclosure, the initiation suppression (iSP) method is preferably used for peptide translation. In normal translation, methionine is generally translated as the N-terminal amino acid, which is the translation initiation amino acid. A dedicated "initiator tRNA" is used for initiating translation. Translation is initiated when the initiator tRNA binds to methionine (formylmethionine in prokaryotes) and is transported to the ribosome, resulting in methionine (formylmethionine in prokaryotes) as the N-terminal amino acid. In contrast, the initiation suppression method involves removing (or preventing the production of) an initiator tRNA in which methionine has been aminoacylated from the translation system and adding a previously prepared initiator tRNA in which the desired amino acid has been aminoacylated to the translation system instead, thereby translating a peptide with the desired amino acid at the N-terminus. It is known that the tolerance for unnatural amino acids is higher during introduction into the N-terminus than during amino acid elongation, and unnatural amino acids with structures significantly different from those of natural amino acids can be used as the N-terminal amino acid (Non-Patent Document: J Am Chem Soc. 2009 Apr 15;131(14):5040-1. Translation initiation with initiator tRNA charged with exotic peptides. Goto Y, Suga H.). In one embodiment of the present disclosure, the initiator tRNA included in the translation system may be acylated with an unnatural amino acid.

[0089] Translation In this disclosure, the term "translation system" is defined as a concept that includes both methods for translating peptides and compositions for translating peptides. In this disclosure, the term "translation system" is not limited to systems that include ribosomes containing the modified L31 protein of this disclosure. The "translation system" of this disclosure preferably includes a combination of protein factors involved in translation, tRNA, amino acids, an energy source such as ATP, and a regeneration system that can translate mRNA into protein. The "translation system" herein also includes a system in which translation is in progress. The translation system herein may include a nucleic acid that serves as a template for peptide translation, and may also include initiation factors, elongation factors, release factors, aminoacyl-tRNA synthetases, and other factors. These factors can be obtained by purification from extracts of various cells. Cells for purifying factors can include, for example, prokaryotic or eukaryotic cells. Examples of prokaryotic cells include Escherichia coli cells, extreme thermophilic bacteria cells, and Bacillus subtilis cells. Known eukaryotic cells include yeast cells, wheat germ, rabbit reticulocytes, plant cells, insect cells, and animal cells. In addition to naturally occurring tRNAs and aminoacyl-tRNA synthetases (ARSs), artificial tRNAs and artificial aminoacyl-tRNA synthetases that recognize unnatural amino acids can also be used. Using artificial tRNAs and artificial aminoacyl-tRNA synthetases allows for the site-specific synthesis of peptides incorporating unnatural amino acids. If necessary, transcription from template DNA can also be performed by adding an RNA polymerase such as T7 RNA polymerase to the translation system.

[0090] As used herein, the phrase "a translation system containing a certain substance" also includes situations in which the substance is not present at the start of translation but is synthesized and contained within the system during the translation process. For example, if a tRNA acylated with an amino acid is synthesized during the translation process, the translation system is understood to contain the aminoacyl-tRNA.

[0091] The main types of translation systems are those that use living cells and those that use cell extracts (cell-free translation systems). For example, a known translation system that uses living cells is one in which desired aminoacyl-tRNA and mRNA are introduced into living cells such as Xenopus oocytes or mammalian cells by microinjection or lipofection to translate peptides (Nowak et al., Science (1995) 268: 439-442). Examples of cell-free translation systems include those using extracts from Escherichia coli (Chen et al., Methods Enzymol (1983) 101: 674-690), yeast (Gasior et al., J Biol Chem (1979) 254: 3965-3969), wheat germ (Erickson et al., Methods Enzymol (1983) 96: 38-50), rabbit reticulocytes (Jackson et al., Methods Enzymol (1983) 96: 50-74), HeLa cells (Barton et al., Methods Enzymol (1996) 275: 35-57), and insect cells (Swerdel et al., CompBiochemPhysiol B (1989) 93: 803-806). Such a translation system can be appropriately prepared by methods known to those skilled in the art or methods equivalent thereto. Cell-free translation systems also include translation systems constructed by isolating and purifying factors necessary for peptide translation and reconstituting them (reconstituted cell-free translation systems) (Shimizu et al., Nat Biotech (2001) 19: 751-755). Reconstituted cell-free translation systems typically include ribosomes, amino acids, tRNA, aminoacyl-tRNA synthetases (aaRS), translation initiation factors (e.g., IF1, IF2, IF3), translation elongation factors (e.g., EF-Tu, EF-Ts, EF-G), translation termination factors (e.g., RF1, RF2, RF3), ribosome recycling factors (RRF), NTPs as energy sources, an energy regeneration system, and other factors necessary for translation.When a transcription reaction from DNA is also performed, an RNA polymerase or the like may be further included. The various factors contained in the cell-free translation system can be isolated and purified by methods well known to those skilled in the art, and a reconstituted cell-free translation system can be appropriately constructed using them. Alternatively, commercially available reconstituted cell-free translation systems such as PUREfrex (registered trademark) from Gene Frontier and PURExpress (registered trademark) from New England BioLabs can also be used. In the case of a reconstituted cell-free translation system, the desired translation system can be constructed by reconstituting only the necessary components of the translation system.

[0092] PURESYSTEM® (BioComber, Japan) is a reconstituted cell-free translation system in which protein factors, energy regeneration enzymes, and ribosomes required for translation in Escherichia coli are extracted and purified, and then mixed with tRNA, amino acids, ATP, GTP, etc. Not only does it contain few impurities, but because it is a reconstituted system, it is easy to create a system that does not contain protein factors or amino acids that you want to eliminate ((i) Nat Biotechnol. 2001;19:751-5. Cell-free translation reconstituted with purified components. Shimizu Y, Inoue A, Tomari Y, Suzuki T, Yokogawa T, Nishikawa K, Ueda T. (ii) Methods Mol Biol. 2010;607:11-21. PUREtechnology. Shimizu Y, Ueda T.).

[0093] For example, while many methods have been reported that use stop codons to introduce unnatural amino acids, the aforementioned PURESYSTEM can be used to construct a synthesis system that excludes natural amino acids and ARSs. This allows unnatural amino acids to be linked to the codons encoding the natural amino acids to be excluded (J Am Chem Soc. 2005;127:11727-35. Ribosomal synthesis of unnatural peptides. Josephson K, Hartman MC, Szostak JW.). Furthermore, by breaking the codon degeneracy, unnatural amino acids can be added without excluding natural amino acids (Kwon I, et al. Breaking the degeneracy of the genetic code. J Am Chem Soc. 2003, 125, 7512-3.). Peptides containing N-methyl amino acids can be synthesized by ribosomes using cell-free translation systems such as the PURESYSTEM.

[0094] More specifically, the translation synthesis may involve, for example, protein factors necessary for translation in E. coli (methionyl-tRNA transformylase, EF-G, RF1, RF2, RF3, RRF, IF1, IF2, IF3, EF-Tu, EF-Ts, ARS (select from AlaRS, ArgRS, AsnRS, AspRS, CysRS, GlnRS, GluRS, GlyRS, HisRS, IleRS, LeuRS, LysRS, MetRS, PheRS, ProRS, SerRS, ThrRS, TrpRS, TyrRS, and ValRS)), ribosomes, amino acids, creatine kinase, myokinase, inorganic pyrophosphatase, nucleoside diphosphate kinase, E. coli-derived tRNA, creatine phosphate, potassium glutamate, HEPES-KOH This can be achieved by adding mRNA to a known cell-free translation system such as PURESYSTEM, which contains a pH 7.6 mixture of magnesium acetate, spermidine, dithiothreitol, GTP, ATP, CTP, UTP, and other ingredients. Furthermore, by adding T7 RNA polymerase, coupled transcription and translation from a template DNA containing a T7 promoter can be performed. Furthermore, peptide compounds containing unnatural amino acids can be translationally synthesized by adding desired aminoacyl-tRNAs or unnatural amino acids (e.g., F-Tyr) tolerated by aminoacyl-tRNA synthetase (ARS) to the system (Kawakami T, et al., Ribosomal synthesis of polypeptoids and peptoid-peptide hybrids. J Am Chem Soc. 2008, 130, 16861-3., Kawakami T, et al., Diverse backbone-cyclized peptides via codon reprogramming. Nat Chem Biol. 2009, 5, 888-90.). Furthermore, mRNA encoding peptides containing unnatural amino acids can be translated by including a modified ARS in the system in place of or in addition to the natural ARS, as well as a group of unnatural amino acids.Alternatively, the efficiency of translation of mRNA encoding peptides containing unnatural amino acids and the resulting incorporation of unnatural amino acids can be increased by utilizing mutants of ribosomes or EF-Tu (Dedkova LM, et al. Construction of modified ribosomes for incorporation of D-amino acids into proteins. Biochemistry. 2006, 45, 15541-51; Doi Y, et al. Elongation factor Tu mutants expand aminoacid tolerance of protein biosynthesis system. J Am Chem Soc. 2007, 129, 14458-62; Park HS, et al. Expanding the genetic code of Escherichia coli with phosphoserine. Science. 2011, 333, 1151-4).

[0095] Furthermore, the translation system of the present disclosure preferably contains ribosomes containing the modified L31 protein of the present disclosure in a proportion of at least 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and particularly preferably 90% or more (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more) of the total number of ribosomes contained in the translation system. The term "total ribosomes" is not particularly limited as long as they are ribosomes contained in the translation system, and can be exemplified by the sum of ribosomes containing the modified L31 protein of the present disclosure and other ribosomes (e.g., ribosomes containing E. coli wild-type L31 and ribosomes functionally equivalent thereto). The proportion of the modified L31 protein to all ribosomes contained in the translation system can be calculated based on the ratio of the intensity of the modified L31 protein to the intensity of all ribosomes measured by mass spectrometry, for example.

[0096] The translation system of the present disclosure preferably contains magnesium ions. It is known that magnesium ions are required to maintain the association between the small and large ribosomal subunits. The L31 protein is one of the proteins that mediates the interaction between the large and small ribosomal subunits. It has been shown that ribosomes lacking the L31 protein or ribosomes containing short L31 require a higher magnesium ion concentration to maintain the association than ribosomes containing intact L31. Therefore, in the production method of the present disclosure, in which ribosomes containing a modified L31 protein are used, it is preferable to increase the magnesium ion concentration to a level higher than that in a translation system in which ribosomes containing intact L31 are used. To prepare such a translation system, the method of the present invention can further include a step of adding magnesium ions to the translation system of the present invention. Alternatively, a translation system to which magnesium ions have been added beforehand can be used in the present invention. The amount of magnesium to be added is not particularly limited, but examples include a range that can be specified by any combination of a lower limit selected from 1 mM or more, 2 mM or more, 3 mM or more, 4 mM or more, 5 mM or more, 6 mM or more, or 7 mM or more, and an upper limit selected from 9 mM or less, 8 mM or less, 7 mM or less, 6 mM or less, 5 mM or less, 4 mM or less, or 3 mM or less.

[0097] tRNA In order to incorporate unnatural amino acids into peptides by translating mRNA encoding the peptide, aminoacylation of orthogonal tRNAs that are efficiently incorporated into ribosomes is required ((i) Biochemistry. 2003;42:9598-608. Adaptation of anorthogonalar leucyl-tRNA and synthetase pair for four-base, amber, and opal suppression. Anderson JC, Schultz PG.; (ii) Chem Biol. 2003;10:1077-84. Using a solid-phase ribozyme aminoacylation system to reprogram the genetic code. Murakami H, Kourouklis D, Suga H.). The following five methods can be used to aminoacylate tRNA.

[0098] Within cells, aminoacyl-tRNA synthetases (ARSs) are prepared for each amino acid as enzymes for aminoacylation of tRNA. Therefore, the first method is to utilize the fact that certain ARSs can tolerate unnatural amino acids such as N-Me His, or to prepare and use mutant aminoacyl-tRNA synthetases that can tolerate unnatural amino acids ((i) Proc Natl Acad Sci U S A. 2002;99:9715-20. An engineered Escherichia coli methylosyl-tRNA synthetase for site-specific incorporation of an unnatural amino acid into proteins in eukaryotic translation and its application in a wheat germcell-free system. Kiga D, Sakamoto K, Kodama K, Kigawa T, Matsuda T, Yabuki T, Shirouzu M, Harada Y, Nakayama H, Takio K, Hasegawa Y, Endo Y, Hirao I, Yokoyama S. (ii) Science. 2003;301:964-7. An expanded eukaryotic genetic code. Chin JW, Cropp TA, Anderson JC, Mukherji M, Zhang Z, Schultz PG. Chin, JW. (iii) Proc Natl Acad Sci US A. 2006;103:4356-61. Enzymatic aminoacylation of tRNA with unnatural aminoacids. Hartman MC, Josephson K, Szostak JW.) Second, a method can be used in vitro to aminoacylate tRNA and then chemically modify the amino acid (J Am Chem Soc. 2008;130:6131-6. Ribosomal synthesis of N-methylpeptides. Subtelny AO, Hartman MC, Szostak JW.).Third, aminoacyl-tRNA can be obtained by removing the CA from the CCA sequence at the 3' end of tRNA and ligating it with separately prepared aminoacylated pdCpA using RNA ligase (Biochemistry. 1984;23:1468-73. T4 RNA ligase-mediated preparation of novel "chemically misacylated" tRNAPheS. Heckler TG, Chang LH, Zama Y, Naka T, Chorghade MS, Hecht SM.). Aminoacylation can also be achieved using flexizyme, a ribozyme that can attach activated esters of various unnatural amino acids to tRNA (J AmChem Soc. 2002;124:6834-5. Aminoacyl-tRNA synthesis by aresin-immobilized ribozyme. Murakami H, Bonzagni NJ, Suga H.). Fourth, ultrasonic mixing of tRNA and an amino acid activated ester in cationic micelles can also be used (Chem Commun (Camb). 2005;(34):4321-3. Simple and quick chemical aminoacylation of tRNA in cationic micellar solution under ultrasonic agitation. Hashimoto N, Ninomiya K, Endo T, Sisido M.). Fifth, aminoacylation can also be achieved by adding a PNA complementary to the 3' end of tRNA to which an amino acid activated ester is bound to the tRNA (J Am Chem Soc. 2004;126:15984-9. In situ chemical aminoacylation with amino acid thioesters linked to a peptide nucleic acid. Ninomiya K, Minohata T, Nishimura M, Sisido M.).

[0099] More specifically, aminoacyl-tRNA can be prepared using the following methods. A template DNA encoding the desired tRNA sequence, with a T7, T3, or SP6 promoter upstream, is prepared, and RNA can be synthesized by transcription using an RNA polymerase compatible with the promoter, such as T7 RNA polymerase, T3, or SP6 RNA polymerase. Alternatively, tRNA can be extracted and purified from cells, and the desired tRNA can be extracted using a probe with a sequence complementary to the tRNA sequence. Cells transformed with an expression vector for the desired tRNA can also be used as the source. RNA with the desired sequence can also be synthesized chemically. For example, aminoacyl-tRNA can be obtained by ligating the thus-obtained tRNA, in which the CA has been removed from the 3'-terminal CCA sequence, with separately prepared aminoacylated pdCpA or pCpA using RNA ligase (pdCpA method, pCpA method). This tRNA is useful for peptide production. Alternatively, aminoacylation can be performed by preparing a full-length tRNA and using flexizyme, a ribozyme that loads activated esters of various unnatural amino acids onto the tRNA. Furthermore, although not intended to be limiting, aminoacyl-tRNAs can also be produced using natural ARSs or their modified forms. When natural ARSs or their modified forms are used, aminoacyl-tRNAs once consumed in the translation system can be regenerated by the natural ARSs or their modified forms, eliminating the need for large amounts of pre-produced aminoacyl-tRNAs in the translation system. Such modified ARSs are described in WO2016 / 148044. These methods for producing aminoacyl-tRNAs can also be combined as appropriate.

[0100] Peptide cyclization In a non-limiting embodiment, the method for producing a peptide or a library containing a peptide according to the present disclosure can further include a step of cyclizing the translated peptide. Examples of cyclization include cyclization using an amide bond, a carbon-carbon bond, a thioether bond, a disulfide bond, an ester bond, a thioester bond, a lactam bond, a bond via a triazole structure, or a bond via a fluorophore structure. Among these, an amide bond is preferred due to its high metabolic stability. The peptide translation step and the cyclization reaction step may be performed separately or sequentially. Cyclization can be performed by methods known to those skilled in the art, such as those described in WO2013 / 100132, WO2008 / 117833, WO2012 / 074129, etc.

[0101] The mode of bonding in the ring formation is not limited, and may be any of bonding between the N-terminus and C-terminus of the peptide, bonding between the N-terminus of the peptide and a side chain of another amino acid residue, bonding between the C-terminus of the peptide and a side chain of another amino acid residue, or bonding between the side chains of amino acid residues, or two or more of these may be used in combination.

[0102] In one non-limiting aspect, the present invention relates to a method for producing a peptide or a library comprising peptides, for example, comprising the steps of: (1) producing a non-cyclic peptide containing one or more unnatural amino acids by the methods described herein, wherein the non-cyclic peptide contains an amino acid residue having one reactive site in its side chain at the C-terminus and another reactive site at the N-terminus; and (2) A step of bonding the reactive site of an amino acid residue on the N-terminal side with the reactive site of an amino acid residue having a reactive site in the side chain on the C-terminal side to form an amide bond, a carbon-carbon bond, or a thioether bond. These steps (1) and (2) may be carried out separately or consecutively.

[0103] Specifically, non-limiting examples of methods for cyclizing peptides through amide bonds include a cyclization method in which the amino group of N-terminal methionine is crosslinked with the amino group of a downstream (C-terminal) lysine using disuccinimidyl glutarate (DSG); a cyclization method in which an amino acid derivative having a chloroacetyl group is introduced as the N-terminal translation initiation amino acid and Cys is placed downstream to form a thioether by intramolecular cyclization; and a method in which a peptide having cysteine ​​or a cysteine ​​analog at the N-terminus and an activated ester in the side chain of the C-terminal amino acid is translated and cyclized using native chemical ligation.

[0104] In a non-limiting embodiment, the C-terminal moiety of the peptide of the present disclosure may be chemically modified rather than remaining as a carboxylic acid. For example, the carboxylic acid moiety may be reacted with piperidine or the like to convert it to a piperidine amide or the like.

[0105] Library The present invention also relates to peptides produced by the peptide production methods described herein and libraries containing the peptides. The present invention also relates to libraries containing the peptides, which comprise a step of producing a peptide by the peptide production methods described herein. Libraries in this disclosure include libraries containing the peptides of this disclosure and libraries containing nucleic acids encoding the peptides of this disclosure. Libraries in this disclosure include libraries of peptides of this disclosure and libraries of peptide-nucleic acid complexes. Display libraries are preferred as libraries. Examples of display libraries include libraries that utilize display, and among these, mRNA display libraries, DNA display libraries, and ribosome display libraries are preferred, with mRNA display libraries being more preferred.

[0106] Display Library A display library is a library in which a peptide (phenotype) is associated with the RNA or DNA encoding the peptide (genotype). This library can be used to identify peptides that can specifically bind to a target molecule. For example, by contacting the library with a desired immobilized target and washing away molecules that do not bind to the target, peptides that bind to the target can be enriched (panning method). By analyzing the genetic information associated with the peptides selected through this process, the sequences of the peptides that bound to the target can be determined. For example, methods utilizing the nonspecific binding of the antibiotic puromycin, an aminoacyl-tRNA analog, to proteins during ribosomal mRNA translation elongation have been reported, including mRNA display (Proc Natl Acad SciUSA. 1997;94:12297-302. RNA-peptide fusions for the in vitro selection of peptides and proteins. Roberts RW, Szostak JW.) and in vitro virus (FEBS Lett. 1997;414:405-8. In vitro virus: bonding of mRNA bearing puromycin at the 3'-terminal end to the C-terminal end of its encoded protein on the ribosome in vitro. Nemoto N, Miyamoto-Sato E, Husimi Y, Yanagawa H.).

[0107] A spacer such as puromycin is attached to the 3' end of an mRNA library transcribed from a DNA library containing a promoter such as the T7 promoter. When the mRNA is translated into protein in a cell-free translation system, the puromycin is mistaken for an amino acid and incorporated into the protein by the ribosome, linking the mRNA and the protein it encodes, creating a library of corresponding mRNAs and their products. This process is highly efficient because it does not require transformation of E. coli or other organisms, making it possible to construct large-scale display libraries. The sequences of the bound peptides can be determined by synthesizing cDNA from the mRNA, which is a tag containing genetic information attached to the selected molecules through panning, amplifying it by PCR, and analyzing the base sequence.

[0108] In addition to mRNA display, cell-free translation system-based display libraries include cDNA display, which is a library consisting of cDNAs encoding peptides bound to a peptide-puromycin complex (Nucleic Acids Res. 2009;37(16):e108. cDNA display: a novel screening method for functional disulfide-rich peptides by solid-phase synthesis and stabilization of mRNA-protein fusions. Yamaguchi J, Naimuddin M, Biyani M, Sasaki T, Machida M, Kubo T, Funatsu T, Husimi Y, Nemoto N.), and ribosome display, which utilizes the relatively stable complex between ribosomes and translation products during mRNA translation (Proc Natl Acad Sci U S A. 1994;91:9022-6. An in vitro polysome display system for identifying ligands from very large peptide libraries. Mattheakis LC, Bhatt RR, Dower WJ.), covalent display, which utilizes the covalent bond formation between bacteriophage endonuclease P2A and DNA (Nucleic Acids Res. 2005;33:e10. Covalent antibody display - an in vitro antibody-DNA library selection system. Reiersen H, Lobersli I, Loset GA, Hvattum E, Simonsen B, Stacy JE, McGregor D, Fitzgerald K, Welschof M, Brekke OH, Marvik OJ.), and CIS display, which utilizes the binding of the microbial plasmid replication initiator protein RepA to the replication origin, ori (Proc Natl Acad Sci U S A. 2004;101:2806-10).CIS display: In vitro selection of peptides from libraries of protein-DNA complexes. Odegrip R, Coomber D, Eldridge B, Hederer R, Kuhlman PA, Ullman C, FitzGerald K, McGregor D.) is known. In vitro compartmentalization (Nat Biotechnol. 1998;16:652-6. Man-made cell-like compartments for molecular evolution. Tawfik DS, Griffiths AD.), in which a transcription-translation system is encapsulated in a water-in-oil emulsion or liposome for each DNA molecule constituting a DNA library, and the translation reaction is carried out, is also known. The above methods can be implemented using known methods as appropriate.

[0109] Nucleic Acid Library In the present disclosure, "nucleic acid" can include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or nucleotide derivatives containing artificial bases. It can also include peptide nucleic acid (PNA). In the present disclosure, nucleic acids can be any of these nucleic acids or a mixture thereof, as long as the desired genetic information is retained. In other words, nucleic acids in the present disclosure also include DNA-RNA hybrid nucleotides and chimeric nucleic acids in which different nucleic acids, such as DNA and RNA, are linked in a single strand.

[0110] Examples of nucleic acid libraries that serve as templates for peptides contained in peptide libraries include mRNA libraries and DNA libraries. Nucleic acid libraries can be obtained by synthesizing bases mixed at positions in the peptide sequence where amino acid residues are not fixed. For example, DNA libraries can be synthesized using A, T, G, and C, while RNA libraries can be synthesized using a mixture of four bases (A, U, G, and C) repeated a multiple of three times (N), or by synthesizing codons with N as the first and second letters and a mixture of two bases (W, M, K, S) as the third letter. Furthermore, if the number of amino acids to be introduced is limited to 16 or less, a single base can be used as the third letter. Furthermore, the frequency of occurrence of amino acid residues can be freely adjusted by preparing codon units corresponding to the three letters of a codon and mixing them in any ratio for synthesis.

[0111] These nucleic acid libraries can be translated using a cell-free translation system. When using a cell-free translation system, it is preferable to include a sequence encoding a spacer downstream of the target nucleic acid. Examples of spacer sequences include, but are not limited to, sequences containing glycine or serine. It is also preferable to include a linker formed from RNA, DNA, or a polymer of hexaethylene glycol (SPC18) (e.g., a five-member polymer) between the nucleic acid library and a compound that is incorporated into a peptide during ribosomal translation, such as puromycin or its derivatives.

[0112] The production of the library according to the present disclosure can be carried out in accordance with the peptide production method according to the present disclosure, and can be combined with known methods as appropriate. In one aspect, the peptide library according to the present disclosure can be produced using the cell-free translation system according to the present disclosure described above. That is, the method for producing a library according to the present disclosure may include a step of synthesizing peptides using the cell-free translation system according to the present disclosure. In one aspect, the examples, preferred ranges, and aspects described for the cell-free translation system according to the present disclosure can be applied as they are to the method for producing a library according to the present disclosure.

[0113] Screening Method In one non-limiting embodiment, peptides capable of specifically binding to a target molecule can be selected by screening using the library of the present disclosure.

[0114] In one non-limiting embodiment, the screening method of the present disclosure can enrich for peptides that bind to the target molecule by contacting a library of peptides containing one or more unnatural amino acids of the present disclosure with a target molecule and washing away peptides that do not bind to the target molecule (panning). In one embodiment, the amino acid sequences of the bound peptides can be determined by synthesizing cDNA from mRNA, which is a tag containing nucleotide sequence information contained in the peptides selected in this manner, amplifying it by PCR, and analyzing the nucleotide sequence. In another embodiment, an mRNA library can be obtained by transcribing the amplified cDNA, and a peptide library can be produced again using this as a template. Since this library is enriched for peptides that can bind to the target molecule, further panning can be performed using this library to further enrich for peptides that can specifically bind to the target molecule. This process can be repeated multiple times to further enrich the peptides of interest. In one embodiment, the amino acid sequences can be identified based on the nucleotide sequence information contained in the enriched peptides, and peptides that can specifically bind to the target molecule can be produced. In one embodiment, the screening method of the present disclosure can be performed in vitro.

[0115] In a non-limiting embodiment, the peptide obtained by the screening method of the present disclosure may be optimized by chemically modifying it using a known method. As used herein, "optimization" refers to chemically modifying the structure of each amino acid in the translated peptide to make it more drug-like, to make it have stronger activity against a pharmacological target, and / or to make it less toxic.

[0116] In one non-limiting embodiment, the screening method of the present disclosure comprises the following steps: (a) contacting a peptide included in a library of the present disclosure with a target molecule; (b) selecting a peptide capable of binding to said target molecule; The screening method of the present disclosure may include, prior to step (a), a step of obtaining a library by the methods described herein. The library can be obtained following the method for producing peptides of the present disclosure.

[0117] In one embodiment, the screening method of the present disclosure may enrich peptides capable of specifically binding to a target molecule by repeating the steps (a) and (b) above two or more times.

[0118] target molecule The target molecule used in the screening method of the present disclosure is not particularly limited, and examples thereof include proteins, peptides, nucleic acids, sugars, and lipids. Among these, it is preferable to target proteins. Furthermore, the location of the target molecule in the living body is also not particularly limited. In one embodiment, intracellular proteins can also be targeted.

[0119] In a non-limiting embodiment, the target molecule used in the screening method of the present disclosure is immobilized on a carrier. The carrier is not particularly limited as long as it can immobilize the target molecule, and examples thereof include beads and resins. The target molecule can be immobilized on the carrier by a known method.

[0120] As described above, the target molecules of the library and screening method of the present disclosure are not particularly limited, but examples include GTPase KRas (KRAS), dual specificity mitogen-activated protein kinase kinase 1 (MEK1), mitogen-stimulated protein kinase 3 (ERK1), and interleukin 6 receptor (IL-6R). As described in the Examples, the library of the present disclosure contains peptides that can specifically bind to various target molecules, and therefore, in one embodiment, may enable drug discovery for tough targets that have previously been considered difficult to discover drugs for.

[0121] In one non-limiting embodiment, a method for producing a peptide of the present disclosure may include the following steps: (i) contacting a peptide included in a library of the present disclosure with a target molecule; (ii) selecting a peptide capable of binding to the target molecule; and (iii) A step of producing a peptide based on the amino acid sequence of the peptide selected in (ii). The method can include obtaining the library by a method described herein.

[0122] In one non-limiting embodiment, the library production method, peptide production method, and / or screening method of the present disclosure may be performed in vitro.

[0123] In one aspect, the peptides of the present disclosure may be cyclized.

[0124] Nucleic acids encoding modified L31 proteins, etc. The present invention also relates to the modified L31 proteins of the present disclosure, ribosomes containing the proteins, and isolated nucleic acids encoding the proteins. The present invention also relates to vectors or cells containing the nucleic acids. Examples of the modified L31 proteins of the present disclosure include the following (1) to (6). (1) A protein comprising an amino acid sequence represented by SEQ ID NO: 1, in which 6 or more amino acid residues, 8 or more amino acid residues, or 9 or more amino acid residues are deleted from the C-terminus; (2) A protein comprising the amino acid sequence of the protein according to (1) above, in which one or more amino acids are inserted, substituted, deleted, and / or added. (3) A protein comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence of the protein described in (1). (4) A protein comprising an amino acid sequence selected from SEQ ID NOs: 2 and 42 to 48. (5) A protein comprising an amino acid sequence selected from SEQ ID NOs: 2 and 42 to 48, in which one or more amino acids are deleted, inserted, substituted, and / or added, and which is functionally equivalent to a protein comprising the amino acid sequence represented by SEQ ID NO: 2; and (6) A protein comprising an amino acid sequence having 80% or more sequence identity with any of the amino acid sequences represented by SEQ ID NO: 2 and 42 to 48, which is functionally equivalent to a protein comprising the amino acid sequence represented by SEQ ID NO: 2. The modified L31 protein, ribosomes containing the protein, and isolated nucleic acids encoding the protein, etc., disclosed herein can be used, for example, to produce peptides containing unnatural amino acids or libraries containing the peptides, etc., disclosed herein.

[0125] In the present disclosure, "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from components of its natural environment. Isolated nucleic acid includes a nucleic acid molecule contained in a cell that normally contains the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or in a location that is different from its natural chromosomal location. In the case of a nucleic acid that is not naturally present in a chromosome, the isolated nucleic acid may be present in any location within the cell. In the present disclosure, "nucleic acid" includes DNA (genomic DNA, cDNA) and RNA.

[0126] As used interchangeably herein, "polynucleotide" or "nucleic acid" refers to a polymer of nucleotides of any length, including DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substance that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can include modifications made after synthesis, such as conjugation to a label. Other types of modifications include, for example, "caps," substitutions of one or more naturally occurring nucleotides with analogs, internucleotide modifications, such as those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) and charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalating agents (e.g., acridine, psoralens, etc.), those containing chelating agents (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, modified linkages (e.g., alpha-anomeric nucleic acids, etc.), and unmodified forms of polynucleotides. Additionally, any hydroxyl groups normally present on the sugar can be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to generate additional linkages to additional nucleotides, or conjugated to solid or semi-solid supports. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups.Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl-, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, α-anomeric sugars, epimeric sugars such as arabinose or xylose or lyxose, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs, and basic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages can be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which phosphate is replaced by: P(O)S ("thioate"), P(S)S ("dithioate"), (O)NR2 ("amidate"), P(O)R, P(O)OR', CO, or CH2 ("formacetal"), where each R or R' is independently H or substituted or unsubstituted alkyl (1-20C), optionally including an ether (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need be identical. The above description applies to all polynucleotides referred to herein, including RNA and DNA.

[0127] Methods for preparing nucleic acids encoding the modified L31 proteins of the present disclosure include, for example, site-directed mutagenesis (Kramer, W. and Fritz, H.-J. (1987) Oligonucleotide-directed construction of mutagenesis via gapped duplex DNA. Methods in Enzymology, 154: 350-367). Alternatively, nucleic acids encoding proteins functionally equivalent to the modified L31 proteins set forth in any one of SEQ ID NOS: 2 and 42 to 48 can also be obtained by hybridization techniques (Southern, EM (1975) Journal of Molecular Biology, 98, 503). That is, nucleic acids encoding the modified L31 proteins of the present disclosure may hybridize under stringent conditions with nucleic acids encoding any one of the amino acid sequences set forth in SEQ ID NOS: 2 and 42 to 48. Stringent hybridization conditions can be appropriately selected by those skilled in the art. For example, prehybridization is performed overnight at 42°C in a hybridization solution containing 25% formamide, or more stringent conditions, such as 50% formamide, 4x SSC, 50 mM Hepes pH 7.0, 10x Denhardt's solution, and 20 μg / ml denatured salmon sperm DNA. The labeled probe is then added and hybridization is performed by incubating overnight at 42°C. The wash conditions and temperature for subsequent washes are, for example, 2x SSC, 0.1% SDS, 50°C, 2x SSC, 0.1% SDS, 42°C, or 1x SSC, 0.1% SDS, 37°C. More stringent conditions include 2x SSC, 0.1% SDS, 65°C, or 0.5x SSC, 0.1% SDS, 42°C. Even more stringent conditions include 0.2x SSC, 0.1% SDS, 65°C. In this way, the stricter the hybridization conditions, the more likely it is that a nucleic acid having a high degree of homology with a nucleic acid sequence encoding an amino acid sequence selected from any one of SEQ ID NOs: 2 and 42 to 48 will be isolated.However, the above combination of SSC, SDS, and temperature conditions is merely an example, and a person skilled in the art would be able to achieve similar stringency to that described above by appropriately combining the above or other factors that determine hybridization stringency (e.g., probe concentration, probe length, hybridization reaction time, etc.).

[0128] The nucleic acid isolated in this manner is considered to have high homology at the amino acid level to the modified L31 protein set forth in any one of SEQ ID NOs: 2 and 42 to 48. Furthermore, at the nucleotide sequence level, it is considered to have high homology to the nucleotide sequence of a nucleic acid encoding the amino acid sequence set forth in any one of SEQ ID NOs: 2 and 42 to 48. As described above, high homology refers to a sequence identity of at least 50% or more, more preferably 70% or more, even more preferably 80% or more, even more preferably 85% or more, and even more preferably 90% or more (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) across the entire amino acid sequence or the entire nucleotide sequence.

[0129] The nucleic acids of the present invention can be used, for example, to prepare modified L31 proteins or ribosomes containing the same. To prepare recombinant modified L31 proteins or ribosomes containing the same, a nucleic acid encoding the modified L31 protein is typically inserted into an appropriate expression vector, the vector is introduced into appropriate cells, and the transformed cells are cultured. The expressed modified L31 protein or ribosomes containing the same are then isolated, purified, and cultured. The modified L31 protein can also be expressed as a fusion protein with other proteins for purposes such as facilitating purification. For example, a method using Escherichia coli as a host to prepare a fusion protein with maltose-binding protein (vector pMAL series available from New England BioLabs, USA), a method using a glutathione S-transferase (GST) fusion protein (vector pGEX series available from Amersham Pharmacia Biotech), or a method using a histidine tag (pET series from Novagen) can be used.

[0130] In a non-limiting embodiment, the vector may be a knock-in vector into which a nucleic acid of the present invention has been knocked in by homologous recombination. That is, the modified L31 protein of the present invention or a ribosome containing the same can also be prepared by knocking in a nucleic acid of the present invention into a vector by homologous recombination. Such a vector may be constructed so that a nucleic acid of the present invention for preparing a modified L31 protein or a ribosome containing the same is inserted in the same reading frame as a target gene in a host such as E. coli. In one embodiment, the nucleic acid of the present invention is preferably inserted into an exon containing a translation start point of the knock-in vector so that its translation start point coincides with that of the target gene. In this case, it is preferred that a nucleotide sequence upstream of the translation start point of the target gene is located 5' from the translation start point of any foreign gene in the knock-in vector. In another embodiment, when an exon-intron structure sequence is added to the 5' side of any foreign gene in the knock-in vector, it is preferred that the 5' end of the exon-intron structure be inserted into an exon containing the translation start point of the target gene so that the 5' end coincides with that of the translation start point of the target gene. In this case, it is preferable that in the knock-in vector, a nucleotide sequence upstream of the translation initiation point of the target gene is located 5' upstream of the 5' end of the exon-intron structure.

[0131] Furthermore, the knock-in vector preferably has the ability to replicate in host cells. The knock-in vector is not particularly limited as long as it is a vector used in genetic engineering, and known vectors include, for example, plasmid vectors, cosmid vectors, bacterial artificial chromosome (BAC) vectors, yeast artificial chromosome (YAC) vectors, retroviral vectors, lentiviral vectors, and other viral vectors.

[0132] Host cells are not particularly limited as long as they are suitable for expressing recombinant proteins. In addition to the aforementioned E. coli, for example, yeast, various animal and plant cells, and insect cells can be used. Various methods known to those skilled in the art can be used to introduce vectors into host cells. For example, introduction into E. coli can be achieved using a calcium ion-based introduction method (Mandel, M., Higa, A. (1970) Journal of Molecular Biology, 53, 158-162; Hanahan, D. (1983) Journal of Molecular Biology, 166, 557-580). The modified L31 protein expressed in host cells can be purified and recovered from the host cells, their cell cultures, or culture supernatants by methods known to those skilled in the art. When the modified L31 protein is expressed as a fusion protein with the aforementioned maltose-binding protein or the like, affinity purification can be easily performed.

[0133] In one embodiment of the present disclosure, the nucleic acid of the present invention may be inserted into a vector. For example, when E. coli is used as a host, the vector may have an "ori" for amplification in E. coli (e.g., JM109, DH5α, HB101, XL1Blue) and a selectable gene for transformed E. coli (e.g., a drug resistance gene that can be detected by a drug (ampicillin, tetracycline, kanamycin, chloramphenicol, etc.)). This allows for the vector to be mass-produced by amplifying it in E. coli. Examples of such vectors include, but are not limited to, M13-based vectors, pUC-based vectors, pBR322, pBluescript, and pCR-Script. For the purpose of cDNA subcloning and excision, other vectors include, in addition to the above, pGEM-T, pDIRECT, and pT7. When using a vector for the purpose of producing a modified L31 protein, an expression vector is particularly useful. For example, when the expression vector is intended for expression in E. coli, it must have the above-mentioned characteristics that allow the vector to be amplified in E. coli. In addition, when the host is E. coli such as JM109, DH5α, HB101, or XL1-Blue, it must also have a promoter that allows efficient expression in E. coli, such as the lacZ promoter (Ward et al., Nature (1989) 341, 544-546; FASEB J. (1992) 6, 2422-2427), the araB promoter (Better et al., Science (1988) 240, 1041-1043), or the T7 promoter. In addition to the above vectors, other such vectors include pGEX-5X-1 (Pharmacia), the "QIAexpress system" (Qiagen), pEGFP, and pET.

[0134] The vector may also contain a signal sequence for polypeptide secretion. When producing a polypeptide in the periplasm of E. coli, the signal sequence used may be the pelB signal sequence (Lei, SP et al. J. Bacteriol. (1987) 169, 4379). The vector can be introduced into host cells using, for example, the calcium chloride method or electroporation. Examples of vectors that can be expressed in plants include pMH1, pMH2, and pCAMBIA.

[0135] In addition to E. coli, examples of vectors for producing modified L31 proteins include mammalian expression vectors (e.g., pcDNA3 (Invitrogen), pEGF-BOS (Nucleic Acids. Res. 1990, 18(17), p5322), pEF, and pCDM8), insect cell-derived expression vectors (e.g., the "Bac-to-BAC baculovairus expression system" (Gibco BRL), and pBacPAK8), plant-derived expression vectors (e.g., pMH1 and pMH2), animal virus-derived expression vectors (e.g., pHSV, pMV, and pAdexLcw), retrovirus-derived expression vectors (e.g., pZIPneo), yeast-derived expression vectors (e.g., "Pichia Expression Kit" (Invitrogen), pNV11, and SP-Q01), and Bacillus subtilis-derived expression vectors (e.g., pPL608 and pKTH50).

[0136] When the aim is to express the vector in animal cells such as CHO cells, COS cells, or NIH3T3 cells, it is essential to have a promoter necessary for intracellular expression, such as the SV40 promoter (Mulligan et al., Nature (1979) 277, 108), the MMLV-LTR promoter, the EF1α promoter (Mizushima et al., Nucleic Acids Res. (1990) 18, 5322), or the CMV promoter. It is even more preferable if the vector has a gene for selecting transformed cells (e.g., a drug resistance gene that can be detected by a drug (neomycin, G418, etc.)). Examples of vectors having such properties include pMAM, pDR2, pBK-RSV, pBK-CMV, pOPRSV, and pOP13.

[0137] The transformed cells of the present invention can be used, for example, as a production system for producing or expressing a modified L31 protein or a ribosome containing the same. Protein production systems include in vitro and in vivo production systems.

[0138] When eukaryotic cells are used, for example, animal cells, plant cells, or fungal cells can be used as hosts. Known animal cells include mammalian cells (e.g., the above-mentioned CHO cells, COS cells, and NIH3T3 cells, as well as 3T3, myeloma cells, BHK (baby hamster kidney), HeLa, and Vero cells), amphibian cells (e.g., Xenopus oocytes (Valle, et al., Nature (1981) 291, 358-340)), and insect cells (e.g., sf9, sf21, and Tn5 cells). As CHO cells, dhfr-CHO cells, which are CHO cells lacking the DHFR gene (Proc. Natl. Acad. Sci. USA (1980) 77, 4216-4220) and CHO K-1 (Proc. Natl. Acad. Sci. USA (1968) 60, 1275) are particularly suitable. CHO cells are particularly preferred for large-scale expression.

[0139] As for plant cells, in addition to cells derived from plants as described below, cells derived from Nicotiana tabacum, for example, are known as a protein production system, and these may be cultured as calluses. Known fungal cells include, but are not limited to, yeasts such as those of the genus Saccharomyces, e.g., Saccharomyces cerevisiae, and filamentous fungi such as those of the genus Aspergillus, e.g., Aspergillus niger.

[0140] In the present disclosure, the modified L31 protein or ribosomes containing the same can also be obtained by purification from a culture of wild-type E. coli. Specifically, a lysate containing the modified L31 protein can be obtained by suspending cultured wild-type E. coli in a buffer containing a low concentration of magnesium ions and disrupting the suspension. Specifically, a lysate containing the E. coli wild-type L31 protein set forth in SEQ ID NO: 1 described herein and the modified L31 protein of the present disclosure can be obtained by disrupting wild-type E. coli in a buffer containing, for example, 5 mM or less (more specifically, for example, 4 mM or less, 3 mM or less, 2 mM or less, 1 mM or less, or 0 mM) magnesium ions. Disruption of E. coli cells can be performed using techniques known to those skilled in the art, such as disruption using a French press, sonication, homogenization, glass beads, or a mortar. However, disruption using a French press is preferred in the present disclosure. The lysate thus prepared can be purified by a method known to those skilled in the art to isolate and obtain the modified L31 protein or a ribosome containing the same.

[0141] In another aspect of the present invention, a composition is provided comprising a ribosome comprising a modified L31 protein of the present disclosure. The composition of the present disclosure can be used, for example, as a translation system or a part thereof for producing peptides containing unnatural amino acids. Therefore, in addition to the ribosome comprising the modified L31 protein of the present disclosure, the composition preferably further comprises, for example, an aminoacyl-tRNA formed by binding an unnatural amino acid to a tRNA, or an mRNA encoding a peptide containing one or more unnatural amino acids. The composition of the present disclosure preferably comprises ribosomes comprising the modified L31 protein of the present disclosure in a proportion of at least 50% by number of molecules, preferably 60% by number or more, more preferably 70% by number or more, even more preferably 80% by number or more, and particularly preferably 90% by number or more (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% by number or more) of the total ribosomes contained in the composition.

[0142] All prior art documents cited in this specification are hereby incorporated by reference. [Example]

[0143] The present invention will be described in more detail below with reference to examples, but the content of the present invention is not necessarily limited to the following examples. The following abbreviations are used in the examples. AA Ammonium Acetate CH2CN cyanomethyl group CH3CN Acetonitrile CTACl N,N,N-trimethylhexadecan-1-aminium chloride DBU 1,8-diazabicyclo[5.4.0]-7-undecene DCM dichloromethane DIPEA N,N-Diisopropylethylamine DMF Dimethylformamide DMSO dimethyl sulfoxide FA formic acid Fmoc 9-fluorenylmethyloxycarbonyl group F-Pnaz 4-(2-(4-fluorophenyl)acetamido)benzyloxycarbonyl group: [ka] MeCN acetonitrile NMP N-methyl-2-pyrrolidone TEA Triethylamine TFA trifluoroacetic acid THF Tetrahydrofuran™ Desired product

[0144] MePhe may be abbreviated as MeF, Pic(2) as Pic2, Gly as G, Ile as I, Pro as P, Thr as T, MeSer(tBuOH) as MeStBuOH, D-Ala as dA, Leu as L, BODIPYFL-4-AMF as Bdp4AMF, Acbz-D-MeCys(StBu) as AcbzdMeCStBu, Acbz-MeCys(StBu) as AcbzMeCStBu, and Acbz-Cys(StBu) as AcbzCStBu.

[0145] Example 1. Construction of E. coli strains We constructed an ompT (Protease 7)-deficient strain (defined as the L31intact strain) and an L31short strain expressing the N-terminal 62 amino acids of the L31 protein. During the ribosome purification process, Protease 7 is known to cleave the L31 protein between the 62nd and 63rd amino acids. The E. coli strain was constructed according to the Quick and Easy Conditional Knockout Kit (loxP / Cre) (Gene Bridges).

[0146] Construction of functional cassettes with homology arms PCR reactions were performed using the functional cassette loxP-PGK-gb2-neo-loxP (Gene Bridges, A003) as a template with Prime STAR HS DNA Polymerase (Takara Bio, R010A). The resulting PCR product was purified using a QIAquick PCR Purification Kit (QIAGEN, 28104). The concentration of the functional cassette was approximately 200 ng / μL. PCR was performed using primers Oligo1 (SEQ ID NO: 3) and Oligo2 (SEQ ID NO: 4) to generate the functional cassette Cassette-1 for creating the ompT (Protease 7)-deficient strain. PCR was performed using primers Oligo3 (SEQ ID NO: 5) and Oligo4 (SEQ ID NO: 6) to generate the functional cassette Cassette-2 for creating the L31short strain.

[0147] Construction of E. coli strains The procedure was carried out according to the protocol provided with the Quick and Easy Conditional Knockout Kit (loxP / Cre) (Gene Bridges). Escherichia coli K-12 W3110 was transformed with pRed / ET to prepare competent cells expressing Red / ET. The functional cassette, Casette-1 or Casette-2, was electroporated into the prepared competent cells to induce homologous recombination. Colony PCR was performed on the resulting colonies, and the length of the amplified DNA confirmed the introduction of the kanamycin cassette and the deletion or partial deletion of the target gene. Following the protocol provided with the kit, the kanamycin resistance gene cassette flanked by LoxP sequences was deleted from the target E. coli strain. The resulting E. coli was isolated as a single colony, and the genomic DNA sequence at the recombined site was read to confirm the completion of the target strain.

[0148] Example 2. Ribosome preparation method E. coli cultivation The W3110 strain (WT) was cultured. Preculture medium (Glycerol 5g / L, Yeast Extract 6g / L, KH2PO 4, The W3110 strain was inoculated into a medium containing 4000kJ / L of ethanol (K2HPO49.3g / L) and pre-cultured. 600 The main culture medium (glycerol 10 g / L, yeast extract 10 g / L, polypeptone N 15 g / L, KH2PO4 4 g / L, MgSO4 7H2O 2.4 g / L, FeSO4 7H2O 0.04 g / L, CaCl2 2H2O 0.04 g / L, Adekanol LG-109 0.24 g / L) was added to 30 L of the medium so that the OD = 0.1. The culture was carried out in a 50 L culture tank. The culture was carried out at 37°C for 5.4 hours, and the OD 600 The culture medium was harvested when the pH reached 33.5. The culture medium was dispensed into 500 ml aliquots and left to stand at room temperature for 1 hour and then at 4°C for 1 hour. After standing, the medium was centrifuged at 6000 x g for 10 minutes, and the precipitate was suspended in D-PBS(-) (Takara Bio Inc., T9181) and centrifuged again at 6000 x g for 10 minutes. The harvested cells were frozen in liquid nitrogen and stored at -80°C.

[0149] Cultivation of L31short or L31intact strains LB medium, Miller (Nacalai Tesque, 20068-75) was used for the culture. The bacterial cells were pre-cultured. The pre-cultured cells were added to the main culture medium to achieve an OD600 of 0.05. Cultures were performed in a 3 L baffled flask (Corning, 431253) with 1 L of LB medium. Using a Climo-Shaker ISF-1-X, the cells were cultured at 37°C and 100 rpm for approximately 2 hours and 40 minutes. After confirming that the OD600 reached approximately 1.0, the cells were removed to room temperature and allowed to stand for 1 hour. The cells were then allowed to stand for 1 hour at 4°C. The bacterial cells were collected by centrifugation at 5000 × g for 10 minutes. The bacterial cells were suspended in an equal volume of PBS (Takara Bio, T9181) and centrifuged again at 5000 × g for 10 minutes. The bacterial cells were frozen in liquid nitrogen and stored at -80°C.

[0150] Disruption of E. coli Disruption of L31intact and L31short strains using FP The collected cells were suspended in 0.004 mL of lysis buffer (10 mM HEPES-KOH, pH 7.6, 5-10 mM MgCl2, 50 mM KCl, 1 mM DTT, 10 μg / mL DNase I) per 1 OD of cells. The cells were disrupted using a French press (Emulsi Flex B15, AVESTIN). The pressure was set at 40 Bar. The disruption rate was controlled to approximately 1 mL / min. The cells were centrifuged at 20,000 × g for 30 minutes at 4°C, and the supernatant was collected. Disruption using FP in the WT strain Three types of lysis buffer with the following compositions were prepared. Mg10 Lysis Buffer (10mM HEPES-KOH, pH7.6, 50mM KCl, 10mM MgCl2, 1mM DTT, 10μg / mLDNaseI) Mg5 Lysis Buffer (10mM HEPES-KOH, pH7.6, 50mM KCl, 5mM MgCl2, 1mM DTT, 10μg / mLDNaseI) Mg0 Lysis Buffer (10mM HEPES-KOH, pH7.6, 50mM KCl, 1mM DTT, 10 μg / mL DNaseI) Using each type of lysis buffer, the cells were suspended in 0.004 mL of lysis buffer per 1 OD of recovered cells. The cells were disrupted using a French press (EmulsiFlex B15, AVESTIN). The pressure was set at 40 Bar. The disruption rate was controlled to approximately 1 mL / min. The cells were centrifuged at 20,000 × g for 30 minutes at 4°C, and the supernatant was collected.

[0151] E. coli purification Ammonium sulfate precipitation of L31short or L31intact strains An equal volume of 2x ammonium sulfate precipitation buffer (10 mM HEPES-KOH, pH 7.6, 5-10 mM MgCl2, 50 mM KCl, 3.24 M ammonium sulfate, 1 mM DTT) was added to the supernatant of the E. coli lysate and stirred at 4°C for 30 minutes. The mixture was centrifuged at 20,000 x g for 40 minutes at 4°C, and the supernatant was collected and filtered through a 0.22 μm filter (Millipore).

[0152] Ammonium sulfate precipitation of the WT strain To 1 ml of the E. coli lysate supernatant, 0.222 g of ammonium sulfate, finely crushed in a mortar, was added while stirring using a stirrer. The mixture was stirred at 4°C for 30 minutes. The mixture was centrifuged at 4°C, 20,380 x g, for 40 minutes, and the supernatant was collected. It was then filtered through a 0.22 μm filter (Millipore).

[0153] Butyl sepharose purification An XK50 column (GE Healthcare, 28988952) packed with Butyl Sepharose 4 FastFlow (GE Healthcare, 17098002) was used. The column was purged with Buffer A (20 mM HEPES-KOH, pH 7.6, 10 mM Mg(OAc)2, 1.5 M(NH4)2SO4, 1 mM DTT). The ammonium sulfate precipitated sample was loaded onto the column at 2 ml / min. After washing with Buffer A, the column was further washed with 30% Buffer A and 70% Buffer B (20 mM HEPES-KOH, pH 7.6, 10 mM Mg(OAc)2, 1 mM DTT). The column was then eluted with 50% Buffer A and 50% Buffer B.

[0154] Ultracentrifugal purification Add 30% sucrose buffer (20 mM HEPES-KOH, pH 7.6, 10 mM Mg(OAc)2, 30 mM NH4Cl, 30% sucrose, 1 mM DTT) to half the volume of the ultracentrifuge tube, and add butyl ether to it without disturbing the interface. SepharoseThe purified eluate was added and centrifuged at 99,700 × g for 20 hours at 4°C. The pellet was suspended in storage buffer (20 mM HEPES-KOH, pH 7.6, 6 mM Mg(OAc)2, 30 mM KCl, 1 mM DTT). The final concentration was adjusted to 20 to 30 μM. Finally, five types of ribosomes were prepared: L31short ribosomes, L31intact ribosomes, WT-10MG ribosomes (using Mg10 Lysis Buffer), WT-5MG ribosomes (using Mg5 Lysis Buffer), and WT-0MG ribosomes (using Mg0 Lysis Buffer).

[0155] Example 3. Analysis of the decomposition rate of L31 The degradation rates of L31 in WT-10MG ribosomes, WT-5MG ribosomes, and WT-0MG ribosomes were analyzed.

[0156] Sample preparation methods 40 pmol of ribosomes were diluted with 38 μL of water. Trifluoroacetic acid was added to a concentration of 1% to precipitate ribosomal RNA. After centrifugation, the supernatant was mixed 1:1 with matrix (50% acetonitrile, 5 mg / mL sinapinic acid), and 1 μL of the mixture was spotted onto a MALDI / MS plate for crystallization.

[0157] MALDI / MS analysis Measurements were performed using a mass spectrometer (ABS CIEX·TOF / TOF 5800) in Linear Positive mode. Calibration was performed using ribosomal protein as an internal standard. Results from measurements where calibration was performed correctly were used. The percentage of intact L31 was calculated by dividing the MS intensity of intact L31 by the sum of the MS intensity of intact L31 and the MS intensity of short L31. Measurements were performed with N=3, and the average value was used as the percentage of intact L31.

[0158] Results of L31 decomposition rate analysis In WT-10MG ribosomes, 71% of L31 was intact, while in WT-5MG ribosomes, 20% and 7% of L31 were intact, respectively.

[0159] Example 4. Synthesis of pCpA-amino acid (also called aminoacyl pCpA) for use in cell-free translation systems The LCMS analysis conditions are as follows: [Table 1]

[0160] Synthesis of Pnaz-MeSer(tBuOH)-pCpA (TS01) Compound TS01 was synthesized according to the following scheme. [ka]

[0161] Synthesis of N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-N-methyl-L-serine (TS01-3) [ka]

[0162] (2S)-2-[[(9H-fluoren-9-ylmethoxy)carbonyl](methyl)amino]-3-(2-hydroxy-2-methylpropoxy)propanoic acid (TS01-1, 41.0 mg, 0.10 mmol), synthesized based on WO2018225864, was dissolved in DCM (0.10 mL), 4-(3-phenylpropyl)piperidine (32.0 μL, 0.15 mmol) was added, and the mixture was stirred at room temperature for 15 hours. The DCM was removed by concentration under reduced pressure, and (2S)-3-(2-hydroxy-2-methyl-propoxy)-2-(methylamino)propanoic acid (TS01-2) was obtained as a crude product. The resulting (2S)-3-(2-hydroxy-2-methyl-propoxy)-2-(methylamino)propanoic acid (TS01-2, crude product) and (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (110.0 mg, 0.26 mmol), synthesized based on WO2018225864, were dissolved in DMSO (0.50 mL), triethylamine (41.8 μL, 0.30 mmol) was added, and the mixture was stirred at 50 °C for 1 hour. The reaction mixture was purified by reverse-phase column chromatography (0.1% FA in HO / 0.1% FA in CHCN) to obtain the title compound (TS01-3, 40 mg, 84%). LCMS(ESI) m / z = 475.4 (M−H) Retention time: 0.64 minutes (Analysis conditions SQDFA05)

[0163] Synthesis of cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-N-methyl-L-serinate (TS01-4) [ka]

[0164] N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-N-methyl-L-serine (TS01-3, 19.0 mg, 0.04 mmol) was dissolved in CH3CN (0.20 mL), DIPEA (10.48 μL, 0.06 mmol) and 2-bromoacetonitrile (3.22 μL, 0.048 mmol) were added, and the mixture was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to give the title compound (TS01-4) as a crude product. LCMS(ESI) 514(MH)- Retention time: 0.73 minutes (Analysis conditions SQDFA05)

[0165] Synthesis of (2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-N-methyl-L-serinate (TS01) [ka]

[0166] (28.9 mg, 0.04 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate (synthesized according to the literature method (Helv. Chim. Acta, 90, 297-310)) was dissolved in buffer solution A (10 ml), and the resulting solution was treated with cyanomethyl An acetonitrile solution (0.021 mg, 0.04 mmol, 0.50 ml) of N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-(2-hydroxy-2-methylpropyl)-N-methyl-L-serinate (TS01-4, crude product) was added dropwise, followed by stirring at room temperature for 60 minutes. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (0.50 mL) was added. After stirring at 0°C for 60 minutes, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (TS01, 8.0 mg, 18.0%). LCMS(ESI) m / z = 1109.7 (M−H) Retention time: 0.50 minutes (Analysis conditions SQDFA05)

[0167] Buffer A was prepared as follows: Acetic acid was added to an aqueous solution of N,N,N-trimethylhexadecan-1-aminium chloride (6.40 g, 20 mmol) and imidazole (6.81 g, 100 mmol) to obtain Buffer A (1 L) with a pH of 7.9 and a concentration of 20 mM N,N,N-trimethylhexadecan-1-aminium and 100 mM imidazole.

[0168] Synthesis of BdpFL-(4-AMF)-pCpA(MT01) Synthesis of (2S)-3-[4-(aminomethyl)phenyl]-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]propanoic acid (compound MT02) [ka]

[0169] Under a nitrogen atmosphere, a solution of 4N HCl in 1,4-dioxane was added to a suspension of (2S)-3-[4-(aminomethyl)phenyl]-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]propanoic acid (500 mg, 0.968 mmol) in dichloromethane (4.5 mL) at room temperature. After stirring at room temperature for 1 hour, the solvent was evaporated under reduced pressure. To a suspension of the resulting residue and [4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl (4-nitrophenyl) carbonate (411 mg, 0.968 mmol) in DMSO (5 mL), DIPEA (413 mg, 3.19 mmol) was added at room temperature. After stirring at room temperature for 2 hours, piperidine (400 mg, 4.7 mmol) was added at room temperature and the mixture was stirred for 15 minutes. The reaction mixture was purified by reverse-phase column chromatography (0.1% FA CHCN / HO) to give (2S)-3-[4-(aminomethyl)phenyl]-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]propanoic acid (compound MT02) (83.3 mg, 18% yield, 3 steps). LCMS(ESI) m / z = 480.3 (M+H)+ Retention time: 0.46 minutes (Analysis conditions SQDFA05)

[0170] (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ 4 ,5λ 4 Synthesis of -dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (compound MT03) [ka]

[0171] In a nitrogen atmosphere, a solution of (2S)-3-[4-(aminomethyl)phenyl]-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]propanoic acid (compound MT02) (11.8 mg, 0.030 mmol) in NMP (500 ml) containing 3-(3-((2,5-dioxopyrrolidin-1-yl)oxy)-3-oxopropyl)-5,5-difluoro-7,9-dimethyl-5H-5λ 4 A solution of 1,2-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-4-nium in NMP (500 ml) was added at room temperature. After stirring at 40°C for 10 minutes, the reaction mixture was purified by reverse phase column chromatography (0.1% FA CHCN / HO) to give (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ). 4 ,5λ 4 -dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (compound MT03) (14.6 mg, 64% yield) was obtained. LCMS(ESI) m / z = 752.2(MH)- Retention time: 0.79 minutes (Analysis conditions SQDFA05)

[0172] (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ 4 ,5λ 4 Synthesis of -dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid cyanomethyl ester (compound MT04) [ka]

[0173] Under a nitrogen atmosphere, (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ 4 ,5λ 4N-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (50 mg, 0.066 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (23.2 μL, 0.133 mmol) were dissolved in acetonitrile (200 μL), and 2-bromoacetonitrile (9.0 μL, 0.133 mmol) was added at 0°C, followed by stirring at 40°C for 3.5 hours. The reaction mixture was concentrated, and (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ) was obtained. 4 ,5λ 4 -dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid cyanomethyl ester (Compound MT04) was obtained as a crude product. The obtained crude product was used as it was in the next step. LCMS(ESI) 791.4(MH)- Retention time: 0.90 minutes (Analysis conditions SQDFA05)

[0174] [(2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl (2S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ) 4 ,5λ 4 Synthesis of -dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoate (compound MT01, BdpFL-(4-AMF)-pCpA) [ka]

[0175] In Buffer A (55 mL) was dissolved ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (47.7 mg, 0.066 mmol), and (S)-3-(4-((3-(5,5-difluoro-7,9-dimethyl-5H-4λ) 4 ,5λ 4 A solution (5 mL) of 4-(2-(4-fluorophenyl)acetamido)-4-pyrrolo[1,2-c:2',1'-f][1,3,2]diazaborinin-3-yl)propanamido)methyl)phenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid cyanomethyl ester (Compound MT03) (52.3 mg, 0.066 mmol) in acetonitrile was added in three portions, followed by stirring at room temperature for 90 minutes. TFA (3 mL) was added to the reaction mixture at 0°C, and the mixture was stirred for 5 minutes and then at room temperature for 40 minutes. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% TFA CHCN / HO) to obtain the title compound (Compound MT01, BdpFL-(4-AMF)-pCpA) (8.3 mg, 9.1% yield). LCMS(ESI) m / z = 1386.7 (M−H) Retention time: 0.65 minutes (Analysis conditions SQDFA05)

[0176] Example 5. Synthesis of aminoacyl-tRNA Sequence of tRNAGlu(-CA) The following tRNAGluCUU(-CA) was prepared by a standard method. Sequence TR-1 (SEQ ID NO:7) tRNAGluCUU(-CA) RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCUUACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC The following tRNAGluCUG(-CA) was prepared by a standard method. Sequence TR-2 (SEQ ID NO: 8) tRNAGluCUG(-CA) RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUCUGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC The following tRNAfMet(CAU)(-CA) was prepared by a standard method. Sequence TR-3 (SEQ ID NO: 9) GGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCGCAAC

[0177] Aminoacyl-tRNA synthesis using aminoacyl-pCpA: Part 1 50 μM transcribed tRNAGluCUG(-CA) (SEQ ID NO: 8) (20 μL) was mixed with 10X ligation buffer (500 mM HEPES-KOH pH 7.5, 200 mM MgCl2) (4 μL), 10 mM ATP (4 μL), and nuclease-free water (5.6 μL). The mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to refold the tRNA. 2.4 μL of 10 unit / μL T4 RNA ligase (New England BioLab.) and 4 μL of a 2.5 mM DMSO solution of aminoacyl pCpA (TSO1) were added, and the ligation reaction was carried out at 16°C for 45 minutes. Sodium acetate was added to the ligation reaction solution to a final concentration of 0.3 M, followed by phenol-chloroform extraction and ethanol precipitation to recover the aminoacyl tRNA (compound AAtR-1). The recovered aminoacyl-tRNA (compound AAtR-1) was dissolved in 1 mM sodium acetate immediately before addition to the translation mixture. Compound AAtR-1 MeSer(tBuOH)- tRNAGluCUG

[0178] Aminoacyl-tRNA synthesis using aminoacyl-pCpA: Part 2 50 μM transcribed tRNAGluCUU(-CA) (SEQ ID NO: 7) (20 μL) was mixed with 10X ligation buffer (500 mM HEPES-KOH pH 7.5, 200 mM MgCl2) (4 μL), 10 mM ATP (4 μL), and nuclease-free water (5.6 μL). The mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to refold the tRNA. 10 unit / μL T4 RNA ligase (New England BioLab) (2.4 μL) and a 2.5 mM DMSO solution of aminoacyl pCpA (MT01) (4 μL) were added, and the ligation reaction was carried out at 16°C for 45 minutes. Sodium acetate was added to the ligation reaction solution to a final concentration of 0.3 M, followed by phenol-chloroform extraction and ethanol precipitation to recover the aminoacyl tRNA (compound AAtR-2). The recovered aminoacyl-tRNA (compound AAtR-2) was dissolved in 1 mM sodium acetate immediately before addition to the translation mixture. Compound AAtR-2 BODIPYFL-4-AMF-tRNAGluCUU

[0179] Aminoacyl-tRNA synthesis using aminoacyl-pCpA: Part 3 To 50 μM transcribed tRNAfMetCAU(-CA) (SEQ ID NO: 9) (20 μl), 10X ligation buffer (500 mM HEPES-KOH pH 7.5, 200 mM MgCl) (4 μl), 10 mM ATP (4 μl), and nuclease-free water (5.6 μl) were added, and the mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow the tRNA to refold. 2.4 μL of 10 unit / μL T4 RNA ligase (New England BioLab.) and 4 μL of a 2.5 mM DMSO solution of Acbz-MeCys(StBu)-pCpA (compound nk14 described in patent document WO2017150732) were added, and the ligation reaction was carried out at 16°C for 45 minutes. 0.3 M sodium acetate was added to the ligation reaction solution, followed by phenol-chloroform extraction and ethanol precipitation to recover the aminoacyl-tRNA (compound AAtR-3). The recovered aminoacyl-tRNA (compound AAtR-3) was dissolved in 1 mM sodium acetate immediately before addition to the translation mixture. Compound AAtR-3 Acbz-MeCys(StBu)-tRNAfMetCAU

[0180] Example 6. Synthesis of LCT12 Synthesis of (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-((tetrahydro-2H-pyran-2-yl)oxy)butanoic acid (Fmoc-Thr(THP)-OH) for peptide synthesis using the LCT-12 peptide synthesizer [ka]

[0181] Toluene (50 mL) was added to a mixture of (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-hydroxybutanoic acid monohydrate (Fmoc-Thr-OH monohydrate, purchased from Tokyo Chemical Industry Co., Ltd., 5.0 g, 13.9 mmol) and pyridinium p-toluenesulfonate (PPTS, 0.175 g, 0.70 mmol). The water content was then removed by azeotropy. To the resulting residue, ultra-dehydrated tetrahydrofuran (THF, 28 mL) and 3,4-dihydro-2H-pyran (8.8 mL, 97 mmol) were added and the mixture was stirred at 50 °C for 4 hours under a nitrogen atmosphere. After confirming the disappearance of the starting materials by LCMS (SQDFA05), the mixture was cooled to 25 °C and ethyl acetate (30 mL) was added. Subsequently, saturated aqueous sodium chloride solution (30 mL) was added to wash the organic layer, and the aqueous layer was extracted with ethyl acetate (30 mL). All the obtained organic layers were combined and washed twice with saturated aqueous sodium chloride solution (30 mL). The organic layer was dried over sodium sulfate, and the solvent was evaporated under reduced pressure to obtain a crude product (9.3 g).

[0182] 4.65 g of the resulting crude product was dissolved in tetrahydrofuran (THF, 30 mL) and then 1.0 M phosphate buffer (30 mL) adjusted to pH 8.0 was added. This mixture was stirred at 50°C for 4 hours. After cooling to 25°C, ethyl acetate (30 mL) was added, and the organic and aqueous layers were separated. After extraction with ethyl acetate (30 mL) into the aqueous layer, all the resulting organic layers were combined and washed twice with saturated aqueous sodium chloride (30 mL). The organic layer was dried over sodium sulfate, the solvent was evaporated under reduced pressure, and the mixture was further dried under reduced pressure at 25°C for 30 minutes.

[0183] The resulting residue was dissolved in diethyl ether (50 mL), followed by the addition of heptane (50 mL). Diethyl ether was distilled off under controlled reduced pressure (~100 hPa), and the resulting mixture was filtered to obtain a solid. This heptane washing procedure was repeated twice. The resulting solid was dried under reduced pressure at 25°C for 2 hours to obtain the sodium salt of Fmoc-Thr(THP)-OH (2.80 g, 6.26 mmol).

[0184] Ethyl acetate (50 mL) and 0.05 M aqueous phosphoric acid (pH 2.1) (140 mL) were added to the entire sodium salt of Fmoc-Thr(THP)-OH obtained, and the mixture was stirred at 25°C for 5 minutes. The organic and aqueous layers were then separated. Ethyl acetate (50 mL) was added to the aqueous layer for extraction, and all the resulting organic layers were combined and washed twice with saturated aqueous sodium chloride (50 mL). The organic layer was dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was dried under reduced pressure at 25°C for 2 hours. The resulting solid was then dissolved in t-butyl methyl ether (TBME, 50 mL), and the solvent was evaporated under reduced pressure. Further drying at 25°C under reduced pressure with a pump for 1 hour afforded (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-((tetrahydro-2H-pyran-2-yl)oxy)butanoic acid (Fmoc-Thr(THP)-OH, 2.70 g, 30 mol% t-butyl methyl ether (TBME) remaining) as a diastereomer derived from the asymmetric carbon of the THP protection. The resulting Fmoc-Thr(THP)-OH was stored in a freezer at -25°C. LCMS(ESI)m / z=424.2(M−H)- Retention time: 0.84 minutes, 0.85 minutes (Analysis conditions SQDFA05_01)

[0185] Synthesis of a peptide (LCT-12) with BdpFL at the N-terminus for use as a standard for LC / MS [ka]

[0186] Peptide elongation was carried out on a peptide synthesizer using 2-chlorotriethyl resin (100 mg) loaded with Fmoc-Ala-OH and the Fmoc amino acids Fmoc-Gly-OH, Fmoc-Thr(THP)-OH, Fmoc-Ile-OH, Fmoc-Phe-OH, and Fmoc-Pro-OH. Peptide elongation was carried out according to the Fmoc peptide synthesis method ( WO2013100132B2 ). After peptide elongation, the N-terminal Fmoc group was removed on the peptide synthesizer, and the resin was washed with DCM.

[0187] The resin was added with TFE / DCM (1:1, v / v, 2 mL) and shaken for 1 hour to cleave the peptide from the resin. After the reaction was complete, the solution in the tube was filtered through a synthesis column to remove the resin, which was then washed twice with TFE / DCM (1:1, v / v, 1 mL). All extracts were combined, DMF (2 mL) was added, and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in NMP (0.5 mL), and one-quarter of the solution (125 μL) was used in the next reaction. BdpFL succinimide ester (140 μL), prepared at 76.5 mM, was added to the NMP solution of the peptide at room temperature, stirred overnight at 40°C, and then concentrated under reduced pressure. The resulting residue was dissolved in 0.05 M tetramethylammonium hydrogen sulfate in HFIP (1.2 mL, 0.060 mmol) and stirred at room temperature for 2 hours. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.1% FA MeCN / HO) to obtain the title compound (LCT-12) (0.3 mg). The amino acid sequence of LCT-12 is shown in SEQ ID NO: 17. LCMS(ESI) m / z = 1972.9 (M−H) Retention time: 0.74 minutes (Analysis conditions SQDFA05_01)

[0188] Example 7. Translational synthesis of peptides Overview of Experiment 1 We conducted an experiment to compare the translation properties of two types of ribosomes: ribosomes prepared from the L31intact strain (L31intact ribosomes) and ribosomes prepared from the L31short strain (L31short ribosomes). Specifically, the template mRNA sequence mR-1 (SEQ ID NO: 10) or sequence mR-2 (SEQ ID NO: 11) was translated using compounds AAtR-1, AAtR-2, and initiator-tRNA (AAtR-3) to synthesize peptide compounds. The translation products were designed to yield Acbz-MeCys(StBu):MeSer(tBuOH):MePhe:Ile:Ile:Gly:MePhe:BODIPYFL-4-AMF:Ile:Ile:Pro:Ile:Gly (SEQ ID NO: 14) for mR-1, and Acbz-MeCys(StBu):T:MePhe:Ile:Ile:Gly:MePhe:BODIPYFL-4-AMF:Ile:Ile:Pro:Ile:Gly (SEQ ID NO: 16) for mR-2. Hereinafter, amino acids are denoted by colons. LC-MS was used to quantify the target product (TM) and by-products. The main by-product observed was an initiation readthrough (iRT) peptide, where translation initiated from the third amino acid after the initiation amino acid.

[0189] Translation conditions The translation system used was the PURE system, a reconstituted cell-free protein synthesis system derived from prokaryotes. Specifically, the translation solution contained the following: 1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.0 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche) (a portion of the tRNA was removed by the method described in (Non-patent Document: Yokogawa T, Kitamura Y, Nakamura D, Ohno S, Nishikawa K. 2010. Nucleic acids research 38:e89)), 3 μM in vitro transcribed E. coli tRNA Ala1B, 0.26 μM EF-G, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 2.7 μM IF1, 0.4 μM IF2, 1.5μM IF3, 40μM EF-Tu, 35 μM EF-Ts, 1μM EF-P-Lys, 0.4unit / μl RNaseinRibonuclease inhibitor (Promega, N2111), 0.4~0.5μM PenicillinG Amidase (PGA), 2.7μM AlaRS, 1 μM GlyRS, 0.4μM IleRS, 0.5 μM mutant PheRS (WO2016 / 148044), 0.16 μM ProRS, 0.09 μM ThrRS, 1 μM mutant ValRS (WO2016 / 148044), 1 μM mutant SerRS (WO2016 / 148044), 250 μM Gly, 250 μM Lys, 100 μM Ile, 250 μM The translation reaction mixture contained Pro, 250 μM Thr, 5 mM N-methylalanine, 5 mM N-methylphenylalanine, 5 mM N-methylserine, and 5 mM N-methylvaline. Four concentrations of magnesium acetate were prepared: 2 mM, 4 mM, 6 mM, and 8 mM. The initiator aminoacyl-tRNA (compound AAtR-3) was added to the reaction mixture at 25 μM, and aminoacyl-tRNAs containing compounds AAtR-1 and AAtR-2 were added to the reaction mixture at 10 μM each.In addition, mRNA (mR-1 or mR-2) was added to the translation reaction mixture at 1 μM. The reaction mixture also contained 185 μM of aminoacyl-tRNA not used in translation. L31short ribosomes or L31incact ribosomes were added at 1.2 μM and incubated at 37°C for 1 hour. The mixture was then heated at 95°C for 3 minutes and allowed to cool to room temperature. Peptidyl-tRNA hydrolase (Pth) was then added at 8.58 μM and incubated at 37°C for 1 hour.

[0190] Preparation of mRNA Template mRNA, sequence mR-1 or sequence mR-2, was synthesized from template DNA (SEQ ID NO: 12 or SEQ ID NO: 13) by in vitro transcription using the RiboMAX LargeScale RNA production System T7 (Promega, P1280) and purified using the RNeasy Mini kit (Qiagen).

[0191] Analysis summary A solution containing a peptide translation product containing an unnatural amino acid was diluted 10-fold and analyzed using an LC-FLR-MS system. The retention time of the translated peptide was identified from the MS data, and the amount of translated peptide was evaluated by quantifying the fluorescence peak at the corresponding retention time. For quantitative evaluation, a calibration curve was created using the LCT12 standard synthesized in Example 6, and the content was calculated by relative quantification. LC-MS was performed under the following analytical conditions:

[0192] Analysis conditions [Table 2]

[0193] result In both translation experiments of the mRNA sequences mR-1 and mR-2 at the optimal Mg concentration for each ribosome, the amount of the target product translated using L31short ribosomes was higher than that translated using L31intact ribosomes. For both the mR-1 and mR-2 mRNA sequences at the optimal Mg concentration for each ribosome, the ratio of the amount of the by-product iRT peptide to the target product was lower when using L31short ribosomes than when using L31intact ribosomes. The sequence of mR-1, in which the second letter from the starting amino acid is MeSer(tBuOH), has a higher optimal Mg than the sequence of mR-2, in which the second letter from the starting amino acid is Thr. 2+ The L31short ribosome had a significant effect on improving the translation yield of the target product at this concentration. The usefulness of using L31short ribosomes prepared from the L31short strain during translation using the Initiation Suppression (iSup) method was demonstrated.

[0194] The amounts of the target product and the iRT peptide translated when the mR-1 sequence and the mR-2 sequence were translated using L31short ribosome or L31intact ribosome are shown below.

[0195] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

[0196] Overview of Experiment 2 In Example 2, wild-type E. coli derived from the W3110 strain was used, and the Mg content of the disruption buffer was 2+Ribosomes were prepared at three concentrations: 10 mM, 5 mM, and 0 mM. The ribosomes prepared by each method are called WT-10MG ribosomes, WT-5MG ribosomes, and WT-0MG ribosomes. In Example 3, the percentage of L31 protein degraded during purification in each ribosome was measured using MALDI-MS. As a result, the Mg 2+ The lower the value, the more L31 was decomposed. Using these ribosomes, translation experiments were carried out using the mR-2 sequence in the same manner as in Experiment 1. As a result, it was found that the amount of the desired product was greatest when WT-0MG ribosomes, which had the highest degradation of L31, were used.

[0197] Translation conditions The translation system used was the PURE system, a reconstituted cell-free protein synthesis system derived from prokaryotes. Specifically, the translation solution contained the following: 1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 4 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.0 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche) (a portion of the tRNA was removed as described in (Non-patent Document: Yokogawa T, Kitamura Y, Nakamura D, Ohno S, Nishikawa K. 2010. Nucleic acids research 38:e89)), 3 μM in vitro transcribed E. coli tRNA Ala1B, 0.26 μM EF-G, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 2.7 μM IF1, 0.4 μM IF2, 1.5 μM IF3, 40 μM EF-Tu, 35 μM EF-Ts, 1 μM EF-P-Lys, 0.4 unit / μL RNasein Ribonuclease inhibitor (Promega, N2111), 0.5 μM Penicillin G Amidase (PGA), 2.7 μM AlaRS, 1 μM GlyRS, 0.4 μM IleRS, 0.5 μM mutant PheRS (WO2016 / 148044), 0.16 μM ProRS, 0.09 μM ThrRS, 1 μM mutant ValRS (WO2016 / 148044), and 1 μM mutant SerRS (WO2016 / 148044). The translation reaction mixture contained 250 μM Gly, 250 μM Lys, 100 μM Ile, 250 μM Pro, 250 μM Thr, 5 mM N-methylalanine, 5 mM N-methylphenylalanine, 5 mM N-methylserine, and 5 mM N-methylvaline. The initiator aminoacyl-tRNA (compound AAtR-3) was added to the reaction mixture at 25 μM, and aminoacyl-tRNAs containing compounds AAtR-1 and AAtR-2 were added at 10 μM each. The aminoacyl-tRNA unused in translation was also included at 185 μM.WT-0MG ribosomes, WT-5MG ribosomes, or WT-10MG ribosomes were added at 1.2 μM and incubated at 37°C for 1 hour. After heating at 95°C for 3 minutes and allowing to cool to room temperature, peptidyl-tRNA hydrolase (Pth) was added to a final concentration of 8.58 μM and incubated at 37°C for 1 hour.

[0198] Analysis summary A solution containing a peptide translation product containing an unnatural amino acid was diluted 10-fold and analyzed using an LC-FLR-MS system. The retention time of the translated peptide was identified from the MS data, and the amount of translated peptide was evaluated by quantifying the fluorescence peak at the corresponding retention time. For quantitative evaluation, a calibration curve was created using the LCT12 standard synthesized in Example 6, and the content was calculated by relative quantification. LC-MS was performed under the following analytical conditions: Analysis conditions [Table 4]

[0199] result The WT-0MG ribosomes, WT-5MG ribosomes, and WT-10MG ribosomes translated the target product in decreasing order. Furthermore, the ratio of iRT peptide to the target product was, in descending order, WT-0MG ribosome, WT-5MG ribosome, and WT-10MG ribosome. From the results of Experiment 1 and Example 3, it was found that Mg 2+ At low concentrations, the proportion of ribosomes in which L31 is degraded increases, indicating that the translation yield in the iSup method can be increased.

[0200] [Table 5]

[0201] Example 8. Panning with L31short ribosomes Synthesis of acylated tRNA Acylated tRNAs used in panning were prepared using the method described in patent document (WO2013 / 100132). Elongator aminoacyl-tRNA mixtures were prepared using 15 amino acids, including Pic(2), MeAla(3-pyr), Ser(Ph-2-Cl), and MeGly, as described in patent document (WO2018 / 225864). The final concentration of each acylated tRNA in the translation solution was 10 μM to 20 μM. Pnaz-protected pCpA amino acids were subjected to phenol extraction and subsequent steps without deprotection. The initiator aminoacyl-tRNA was the same compound as compound AAtR-3 in Example 5, and was added to the translation solution to a final concentration of 25 μM.

[0202] Randomized double-stranded DNA library encoding peptide compound library A DNA library was constructed using the method described in patent document WO2013 / 100132. 24 triplets, including TTT, TTG, CTT, ATT, ATG, GTT, CCG, ACT, GCT, CAT, CAG, AAC, GAA, TGG, CGG, AGT, AGG, and GGT, were randomly repeated 8 to 9 times.

[0203] Preparation of biotinylated target proteins Glutathione S-transferase (GST) was used as the target protein for panning. GST was expressed in Escherichia coli and prepared. Biotinylation was performed according to the non-patent literature BMC biotechnology, 2008, 8, 41 and non-patent literature Protein Science, 1990; 108(4): 673-6.

[0204] Translation solution used for panning The translation solution contained the following substances: 1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 6 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, and 1 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche) (Non-patent literature: (Yokogawa T, Kitamura Y, Nakamura D, Ohno S, Nishikawa K. 2010. Nucleic acids research 38:e89), with some tRNA removed), 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.26 μM EF-G, 2.7 μM IF1, 0.4 μM IF2, 1.5 μM IF3, 40 μM EF-Tu, 49 μM EF-Ts, 1 μM EF-P-Lys, 1.2 μM ribosomes (L31short or L31 intact), 2.73 μM AlaRS, 1 μM IF-G, 2.7 μM IF-Ts, 0.4 ... 0.11 μM LysRS, 3 μM in vitro transcribed E. coli tRNA Ala1B, 250 μM glycine, 100 μM isoleucine, 250 μM proline, 250 μM threonine, 250 μM lysine, 5 mM N-methylvaline, 5 mM N-methylserine, 5 mM N-methylalanine, 5 mM N-methylphenylalanine, Elongator aminoacyl-tRNA mixture, 25 μM Initiator aminoacyl-tRNA, 10 μM Penicillin G Amidase (PGA).

[0205] Performing panning Panning was performed according to the patent document (WO2013 / 100132) using the double-stranded DNA library and a translation solution containing L31short or L31intact. A TEV protease recognition sequence was introduced between GST and biotin, and elution was performed using TEV protease. After interaction of the peptide library with biotinylated protein, the peptides were recovered using streptavidin-immobilized magnetic beads and washed. Then, TEV elution solution (50 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 1 mM DTT, 0.1 U / μL AcTEV protease (Thermo Fisher Scientific, product number 12575015)) was added to the beads and allowed to react. After the reaction, the supernatant was collected and PCR was performed.

[0206] Analysis of enriched sequences Sequences were extracted that had an occurrence frequency of at least one round: Rank A: 0.5% or higher, Rank B: 0.05% or higher, or Rank C: 50 or more NGS reads, and whose occurrence frequency increased by at least 10-fold when the target was added compared to when the pool from the previous round was divided and panned without adding the target. When using a translation system with L31short ribosomes, 33 sequences were ranked A, 253 sequences were ranked B, and 396 sequences were ranked C. On the other hand, when using a translation system with L31intact ribosomes, 32 sequences were ranked A, 175 sequences were ranked B, and 247 sequences were ranked C. Panning using L31short ribosomes enriched a greater variety of sequences than panning using L31intact.

[0207] Example 9. Translation experiments using L31 mutant ribosomes Overview of Example 9 As described in Example 14 below, eight L31 mutant strains with different L31 lengths were constructed. As described in Example 15, ribosomes were prepared from these strains as well as the L31short strain, the L31intact strain, and the W3110 strain. Peptide translation synthesis was performed using the resulting 11 types of ribosomes, and the translation properties of ribosomes containing the L31 mutants were investigated. Specifically, the following three types of peptides, each with a different amino acid in the second letter, were translated and synthesized using 11 types of ribosomes, R1 to R11, shown in Table 6. In this specification, amino acid sequences may be represented by separating amino acids with colons, as shown below. AcbzMeCStBu:MeG:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 29) AcbzMeCStBu:MeStBuOH:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 30) AcbzMeCStBu:L:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 31) The template mRNA sequence was mR-1 (SEQ ID NO: 10), and the aminoacyl-tRNAs that form the second letter were MeG-tRNAGlu(CUG), MeSer(tBuOH)-tRNAGlu(CUG), and Leu-tRNAGlu(CUG), respectively. The aminoacyl-tRNAs used were those prepared in Example 13.

[0208] [Table 6]

[0209] LC-MS was used to quantify the target product (TM) and by-products. The main by-product observed was an initiation readthrough (iRT) peptide, where translation initiated from the third amino acid from the initiation amino acid. In this specification, a peptide where translation initiated from the second amino acid after the initiation amino acid is sometimes referred to as 1iRT, and a peptide where translation initiated from the third amino acid after the initiation amino acid is sometimes referred to as 2iRT. TMs (SEQ ID NOs: 29 to 31) and their corresponding 1iRT and 2iRT are shown in Tables 7 to 9.

[0210] [Table 7]

[0211] [Table 8]

[0212] [Table 9]

[0213] Translation conditions The translation conditions were the same as those in Experiment 1 of Example 7, except that the in vitro transcribed E. coli tRNA Ala1B, Lys, and aminoacyl-tRNA were removed from the translation solution composition in Experiment 1 of Example 7, and 0.5 μM HisRS was added. The composition was 6.72 units / ml myokinase, 59 μM EF-Ts, 4 mM magnesium acetate, 20 μM initiator aminoacyl-tRNA (compound AAtR-3), 10 μM each type of aminoacyl-tRNA encoding the second letter, 1.2 μM each type of ribosome, and 1 μM mRNA.

[0214] Analysis summary The analysis was carried out in accordance with the method of Experiment 2 in Example 7, except that a calibration curve was prepared using LCT67 synthesized in Example 11 as a standard and quantitative evaluation was carried out.

[0215] result As shown in Table 10, for all three sequences, translation using ribosomes R1 to R7 and R11 showed high TM translation yields and a low proportion of initiation read-through (iRT) peptides. Ribosomes containing the L31 mutant, which has 62 or fewer amino acid residues from the N-terminus, were shown to have high translation activity and a low proportion of initiation read-through (iRT) peptides. The iRT proportion was calculated using the following formula.

[0216] (Number 1) iRT ratio = (iRT total concentration [nM]) / (iRT total concentration [nM] + TM concentration [nM]) × 100

[0217] [Table 10]

[0218] Example 10. Effect of L31short ribosomes on translational synthesis of various peptides Experiment 1: The starting amino acid is AcbzdMeCStBu, and various amino acids are placed in the second position. Overview of Experiment 1 Using the L31short ribosome and L31intact ribosome purified in Example 2, we performed translation synthesis of six types of peptides with different amino acids in the second letter, and confirmed that the superior translation properties of the L31short ribosome were observed in the translation synthesis of multiple peptides. Specifically, six types of peptides were translationally synthesized, each differing in the second amino acid letter (X) of the following amino acid sequence (SEQ ID NO: 36), where X was Nle, S3F5MePyr, SPh2Cl, I, T, or L. AcbzdMeCStBu:X:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 36)

[0219] The template mRNA sequence was mR-1 (SEQ ID NO: 10), and the aminoacyl-tRNAs that form the second letter were Nle-tRNAGlu(CUG), S3F5MePyr-tRNAGlu(CUG), SPh2Cl-tRNAGlu(CUG), Ile-tRNAGlu(CUG), Thr-tRNAGlu(CUG), and Leu-tRNAGlu(CUG). The aminoacyl-tRNAs used were those prepared in Example 13.

[0220] The target product (TM) and by-products were quantified using LC-MS. The main by-products observed were 1iRT and 2iRT. The iRT ratio was calculated using the following formula:

[0221] (Number 1) iRT ratio = (iRT total concentration [nM]) / (iRT total concentration [nM] + TM concentration [nM]) × 100

[0222] Translation conditions The translation conditions were the same as in Example 9, except for HisRS, and the conditions were 8 mM magnesium acetate, 3 μg / ml myokinase, The translation conditions were the same as those in Example 9, except for the composition of 49 μM EF-Ts and 20 μM initiator aminoacyl-tRNA (Acbz-D-MeCys(StBu)-tRNAfMetCAU) (Patent Document WO2017150732).

[0223] Analysis summary The analysis was carried out according to the method of Example 9.

[0224] result As shown in Table 11, for four of the six sequences, the amount of TM translation increased by 2.8 to 3.9 times when L31short ribosomes were used compared to when L31intact ribosomes were used, and for all six sequences, the rate of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used.

[0225] [Table 11]

[0226] Experiment 2: The starting amino acid is AcbzMeCStBu, and various amino acids are placed in the second position. Overview of Experiment 2 Using the L31short ribosomes and L31intact ribosomes purified in Example 2, we performed translation synthesis of 12 types of peptides with different amino acids in the second letter, and confirmed that the superior translation properties of the L31short ribosomes were observed in the translation synthesis of multiple peptides. Specifically, 12 types of peptides were translationally synthesized, each differing in the second amino acid letter (X) of the following amino acid sequence (SEQ ID NO: 37), where X was Nle, MeG, MeF, S3F5MePyr, MeHph, MeA3Pyr, SPh2Cl, G, I, T, MeStBuOH, or L. AcbzMeCStBu:X:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 37)

[0227] The experiment was carried out in the same manner as in Experiment 1 of Example 10, except that MeG-tRNAGlu(CUG), MePhe-tRNAGlu(CUG), MeHph-tRNAGlu(CUG), MeA3Pyr-tRNAGlu(CUG), Gly-tRNAGlu(CUG), and MeSer(tBuOH)-tRNAGlu(CUG) were additionally used as aminoacyl-tRNAs for the second letter. The main by-products observed were 1iRT and 2iRT.

[0228] Translation conditions The translation conditions were the same as those in Experiment 1 of Example 10, except that 4 mM magnesium acetate and 20 μM Minitiator aminoacyl-tRNA (compound AAtR-3) were used.

[0229] Analysis summary The analysis was carried out according to the method of Example 9.

[0230] result As shown in Table 12, for 11 of the 12 sequences, the amount of TM translation increased by 1.6 to 3.7 times when L31short ribosomes were used compared to when L31intact ribosomes were used, and for all of the 12 sequences, the rate of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used.

[0231] [Table 12]

[0232] Experiment 3: The starting amino acid is AcbzCStBu, and various amino acids are placed in the second position. Overview of Experiment 3 Using the L31short ribosomes and L31intact ribosomes purified in Example 2, we performed translation synthesis of 12 types of peptides with different amino acids in the second letter, and confirmed that the superior translation properties of the L31short ribosomes were observed in the translation synthesis of multiple peptides. Specifically, 12 types of peptides were translationally synthesized, each differing in the second amino acid letter (X) of the following amino acid sequence (SEQ ID NO: 38), where X was Nle, MeG, MeF, S3F5MePyr, MeHph, MeA3Pyr, SPh2Cl, G, I, T, MeStBuOH, or L. The experiment was carried out according to the method of Experiment 2 in Example 10. AcbzCStBu:X:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 38)

[0233] The target product (TM) and by-products were quantified using LC-MS. The main by-products observed were 1iRT and 2iRT.

[0234] Translation conditions The translation conditions were the same as those in Example 9, except that the mixture was 0.23 μM EF-G, 5.92 units / ml myokinase 2, 1.0 μg / ml nucleoside diphosphate kinase, 2.4 μM IF1, 1.3 μM IF3, 35 μM EF-Tu, 52 μM EF-Ts, and 20 μM initiator aminoacyl-tRNAAcbz-Cys(StBu)-tRNAfMetCAU (WO2017 / 150732).

[0235] Analysis summary The analysis was carried out according to the method of Example 9.

[0236] result As shown in Table 13, for all 12 sequences, the amount of TM translation increased by 1.7 to 3.8 times when L31short ribosomes were used compared to when L31intact ribosomes were used, and for all 12 sequences, the rate of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used.

[0237] [Table 13]

[0238] Experiment 4: The starting amino acid is fMet, and various amino acids are placed in the second letter. Overview of Experiment 4 Using the L31short ribosomes and L31intact ribosomes purified in Example 2, we performed translation synthesis of 13 types of peptides with different amino acids in the second letter, and confirmed that the superior translation properties of the L31short ribosomes were observed in the translation synthesis of multiple peptides. Specifically, 13 types of peptides were translationally synthesized, each differing in the second amino acid letter (X) of the following amino acid sequence (SEQ ID NO: 39), where X was Nle, MeG, MeF, S3F5MePyr, Pic(2), MeHph, MeA3Pyr, SPh2Cl, G, I, T, MeStBuOH, or L. fMet:X:MeF:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 39)

[0239] The experiment was carried out in accordance with the method of Experiment 2 in Example 10, except that Pic(2)-tRNAGlu(CUG) was additionally used as the aminoacyl-tRNA for the second letter. Quantification of the target product (TM) and by-products was performed using LC-MS. The main by-products observed were 1iRT and 2iRT.

[0240] Translation conditions The translation conditions were the same as those in Experiment 2 of Example 10, except that the initiator aminoacyl-tRNA (compound AAtR-3) was omitted and 0.03 μM MetRS, 0.6 μM methionyl-tRNA formyltransferase, 0.25 mM methionine, and 0.1 mM folate were added.

[0241] Analysis summary The analysis was carried out according to the method of Example 9.

[0242] result As shown in Table 14, for 12 of the 13 sequences, the amount of TM translation increased by 1.2 to 2 times when L31short ribosomes were used compared to when L31intact ribosomes were used, and for all of the 13 sequences, the rate of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used.

[0243] [Table 14]

[0244] Experiment 5: The starting amino acid is AcbzMeCStBu, the second amino acid is Thr, and various amino acids are placed in the third amino acid. Overview of Experiment 5 Using the L31short ribosomes and L31intact ribosomes purified in Example 15, we performed translation synthesis of 14 types of peptides with different amino acids at the third letter, and confirmed that the superior translation properties of the L31short ribosomes were observed in the translation synthesis of multiple peptides. Specifically, 14 types of peptides were translationally synthesized, each differing in the third amino acid (X) of the following amino acid sequence (SEQ ID NO: 40), where X was Nle, MeF, S3F5MePyr, Pic(2), MeHph, MeA3Pyr, SPh2Cl, G, I, P, T, MeStBuOH, dA, or L. AcbzMeCStBu:T:X:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 40)

[0245] The template mRNA sequence, mR-3 (SEQ ID NO: 28), and the aminoacyl-tRNAs that form the third letter were Nle-tRNAGlu(CUG), MePhe-tRNAGlu(CUG), S3F5MePyr-tRNAGlu(CUG), Pic(2)-tRNAGlu(CUG), MeHph-tRNAGlu(CUG), MeA3Pyr-tRNAGlu(CUG), SPh2Cl-tRNAGlu(CUG), Gly-tRNAGlu(CUG), Ile-tRNAGlu(CUG), Pro-tRNAGlu(CUG), Thr-tRNAGlu(CUG), MeSer(tBuOH)-tRNAGlu(CUG), D-Ala-tRNAGlu(CUG), and Leu-tRNAGlu(CUG). The aminoacyl-tRNAs used were those prepared in Example 13.

[0246] The target product (TM) and by-products were quantified using LC-MS. The main by-products observed were 1iRT and 2iRT.

[0247] Preparation of mRNA Template mRNA with the sequence mR-3 (SEQ ID NO: 28) was prepared from template DNA (SEQ ID NO: 27) by in vitro transcription using the RiboMAX Large Scale RNA production System T7 (Promega, P1280) and purified using an RNeasy Mini kit (Qiagen).

[0248] Translation conditions The translation conditions were the same as those in Example 9, except that 10 μM of each aminoacyl-tRNA encoding the third letter was added.

[0249] Analysis summary The analysis was carried out according to the method of Example 9.

[0250] result As shown in Table 15, the amount of TM translation increased 1.1 to 20.9 times when L31short ribosomes were used compared to when L31intact ribosomes were used for all 14 sequences, and the proportion of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used for all 14 sequences. The "1iRT + 2iRT concentration" in the table represents the combined concentration of 1iRT and 2iRT quantified from the combined values ​​of the peaks when the peaks corresponding to 1iRT and 2iRT were not separated in the chromatogram.

[0251] [Table 15]

[0252] Experiment 6: The starting amino acid is fMet, the second amino acid is Thr, and various amino acids are placed in the third amino acid. Overview of Experiment 6 Using the L31short ribosomes and L31intact ribosomes purified in Example 15, we performed translation synthesis of 15 types of peptides with different amino acids at the third letter, and confirmed that the superior translation properties of the L31short ribosomes were observed in the translation synthesis of multiple peptides. Specifically, 15 types of peptides were translationally synthesized, each differing in the third amino acid (X) of the following amino acid sequence (SEQ ID NO: 41), where X was Nle, MeG, MeF, S3F5MePyr, Pic(2), MeHph, MeA3Pyr, SPh2Cl, G, I, P, T, MeStBuOH, dA, or L. fMet:T:X:I:I:G:MeF:Bdp4AMF:I:I:P:I:G (SEQ ID NO: 41)

[0253] The experiment was carried out in accordance with the method of Experiment 5 in Example 10, except that MeG-tRNAGlu(CUG) was additionally used as the aminoacyl-tRNA for the third letter. The target product (TM) and by-products were quantified using LC-MS. The main by-products observed were 1iRT and 2iRT.

[0254] Translation conditions The same procedure as in Example 10, Experiment 4 was followed, except that the concentrations were 6.72 units / ml myokinase, 59 μM EF-Ts, and 0.09 μM GlyRS.

[0255] Analysis summary The analysis was carried out according to the method of Example 9.

[0256] result As shown in Table 16, for all 15 sequences, the amount of TM translation increased when L31short ribosomes were used compared to when L31intact ribosomes were used, and the amount of TM translation when L31intact was used was below the detection limit. For all 15 sequences, the proportion of iRT decreased when L31short ribosomes were used compared to when L31intact ribosomes were used. The "1iRT + 2iRT concentration" in the table represents the combined concentration of 1iRT and 2iRT quantified from the combined values ​​of each peak when the peaks corresponding to 1iRT and 2iRT were not separated in the chromatogram.

[0257] [Table 16]

[0258] Example 11. Synthesis of LCT-67 A peptide (LCT-67) having BdpFL at the N-terminus to be used as a standard for LC / MS was synthesized by the following procedure. Peptide elongation was performed on a peptide synthesizer using 2-chlorotriethyl resin (100 mg) loaded with Fmoc-Gly-OH. The Fmoc amino acids were Fmoc-Gly-OH, Fmoc-Thr(THP)-OH (aa01), Fmoc-Ile-OH, Fmoc-Leu-OH, Fmoc-Phe-OH, Fmoc-MePhe-OH, and Fmoc-Pro-OH (synthesized by the method described in patent literature (WO2018225864)). The amino acid abbreviations are described elsewhere in this specification. Peptide elongation was performed according to the Fmoc peptide synthesis method (see, for example, WO2013100132). After peptide elongation, the N-terminal Fmoc group was removed on the peptide synthesizer, and the resin was washed with DCM.

[0259] The resin was added with TFE / DCM (1:1, v / v, 2 mL) and shaken for 1 hour to cleave the peptide from the resin. After completion of the reaction, the solution in the tube was filtered through a synthesis column to remove the resin, which was then washed twice with TFE / DCM (1:1, v / v, 1 mL). All extracts were combined, DMF (2 mL) was added, and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in NMP (1 mL) and 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionic acid N-succinimidyl ester (5 mg, 0.013 mmol) was added at room temperature. After stirring for 19 hours, the reaction mixture was subjected to reverse-phase silica gel column chromatography (0.1% FA MeCN / HO), and the fraction containing the intermediate was concentrated under reduced pressure. The resulting residue was dissolved in 5% TFA in DCM (2 mL) and stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by reverse-phase silica gel column chromatography (0.1% FA MeCN / HO) to give the title compound (LCT-67) (13 mg). The amino acid sequence of LCT-67 is shown in SEQ ID NO: 223. LCMS(ESI) m / z =1751.2(MH)- Retention time: 0.97 minutes (Analysis conditions SQDFA05_02)

[0260] Example 12. Synthesis of pCpA amino acid In this example, the following abbreviations were used: Gly or G (glycine), Ile or I (isoleucine), Leu or L (leucine), Phe or F (phenylalanine), Pro or P (proline), Thr or T (threonine). The LCMS analysis conditions are shown in Table 17 below.

[0261] [Table 17]

[0262] Aminoacyl pCpAs (ST04, ST08, ST11, ST14, ST17, ST20, ST23, ST28, ST31, ST32, ST33, and ST34) were synthesized according to the following scheme. [ka]

[0263] Synthesis of (2S)-2-aminohexanoic acid (compound ST01, Nle-OH) [ka]

[0264] Under a nitrogen atmosphere, (2S)-2-(9H-fluoren-9-ylmethoxycarbonylamino) hexanoic acid (35.3 mg, 0.10 mmol) synthesized by the method described in patent document (WO2018225851A1) was added to DCM (0.2 ml) H2O (0.8 ml) at room temperature, and then 4-(3-phenylpropyl)piperidine (0.212 ml, 1.00 mmol) was added at room temperature and stirred for 30 minutes. The reaction mixture was left to stand, and the aqueous layer was purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), to obtain (2S)-2-aminohexanoic acid (compound ST01, Nle-OH) (10 mg, 76%). LCMS(ESI) m / z = 130.0 (M−H)- Retention time: 0.14 minutes (Analysis conditions SQDFA05_02)

[0265] Synthesis of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoic acid (compound ST02, F-Pnaz-Nle-OH) [ka]

[0266] Under a nitrogen atmosphere, a mixture of (2S)-2-aminohexanoic acid (compound ST01, Nle-OH) (3.94 mg, 0.03 mmol) and (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (12.7 mg, 0.03 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (150 μL) and triethylamine (9.62 μL, 0.07 mmol). The reaction mixture was stirred at room temperature for 1 hour and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoic acid (compound ST02, F-Pnaz-Nle-OH) (9 mg, 72%). LCMS(ESI) m / z = 415.3 (M−H) Retention time: 0.74 minutes (Analysis conditions SQDFA05_02)

[0267] Cyanomethyl(2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoate (compound ST03, F-Pnaz-Nle-OCH 2 Synthesis of CN [ka]

[0268] Under a nitrogen atmosphere, 2-bromoacetonitrile (2.0 μL, 0.03 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (7.0 μL, 0.04 mmol) were added sequentially to a solution of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoic acid (compound ST02, F-Pnaz-Nle-OH) (8.3 mg, 0.02 mmol) in acetonitrile (0.1 mL) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then concentrated to give the crude product, cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoate (compound ST03, F-Pnaz-Nle-OCHCN). The resulting crude product was dissolved in acetonitrile (0.45 mL) and used directly in the next step. LCMS(ESI) m / z = 454.4 (M−H) Retention time: 0.83 minutes (Analysis conditions SQDFA05_02)

[0269] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoate (compound ST04, F-Pnaz-Nle-pCpA) [ka]

[0270] In buffer solution A (9 mL) was dissolved (22 mg, 0.03 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl An acetonitrile solution (0.45 mL, 0.02 mmol) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoate (Compound ST03, F-Pnaz-Nle-OCHCN) was added and stirred at room temperature for 90 minutes. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (0.45 mL) was added. After stirring at room temperature for 30 minutes, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (Compound ST04, F-Pnaz-Nle-pCpA) (5.7 mg, 27%). LCMS(ESI) m / z = 1049.7 (M−H) Retention time: 0.54 minutes (Analysis conditions SQDFA05_02)

[0271] Buffer A was prepared as follows. Acetic acid was added to an aqueous solution of N,N,N-trimethylhexadecan-1-aminium chloride (6.40 g, 20 mmol) and imidazole (6.81 g, 100 mmol) to obtain Buffer A (1 L) with a pH of 8 and a concentration of 20 mM N,N,N-trimethylhexadecan-1-aminium and 100 mM imidazole.

[0272] Synthesis of (2S)-2-amino-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (compound ST05, S3F5MePyr-OH) [ka]

[0273] Under a nitrogen atmosphere, (2S)-2-(9H-fluoren-9-ylmethoxycarbonylamino)-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (43.6 mg, 0.10 mmol) synthesized by the method described in patent document (WO2018225864A1) was added to DCM (0.2 ml) H2O (0.2 ml) at room temperature, and then 4-(3-phenylpropyl)piperidine (63.5 ul, 0.3 mmol) was added at room temperature and stirred for 1 hour. The reaction mixture was left to stand, and the aqueous layer was purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), (2S)-2-amino-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (compound ST05, S3F5MePyr-OH) (14 mg, 66%) was obtained. LCMS(ESI) m / z = 213.0 (M−H) Retention time: 0.19 minutes (Analysis conditions SQDFA05_02)

[0274] Synthesis of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (compound ST06, F-Pnaz-S3F5MePyr-OH) [ka]

[0275] Under a nitrogen atmosphere, (2S)-2-amino-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (compound ST05, S3F5MePyr-OH) (10.7 mg, 0.05 mmol), carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl (21.2 mg, 0.05 mmol) synthesized by the method described in patent document (WO2018143145A1) was added to a mixture at room temperature with DMSO (250 μL) and triethylamine (16.0 μL, 0.12 mmol). The reaction mixture was stirred at room temperature for 1 hour and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]hexanoic acid (compound ST06, F-Pnaz-S3F5MePyr-OH) (23 mg, 92%). LCMS(ESI) m / z = 498.4 (M−H) Retention time: 0.66 minutes (Analysis conditions SQDFA05_02)

[0276] Cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoate (compound ST07, F-Pnaz-S3F5MePyr-OCH 2 Synthesis of CN [ka]

[0277] Under a nitrogen atmosphere, 2-bromoacetonitrile (2.0 μL, 0.03 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (7.0 μL, 0.04 mmol) were added in order to a solution (0.1 ml) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoic acid (compound ST06, F-Pnaz-S3F5MePyr-OH) (9.99 mg, 0.02 mmol) in acetonitrile at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then concentrated to give the crude product cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoate (compound ST07, F-Pnaz-S3F5MePyr-OCH2CN). The crude product was dissolved in acetonitrile (0.45 mL) and used directly in the next step. LCMS(ESI) m / z = 537.3 (M−H) Retention time: 0.74 minutes (Analysis conditions SQDFA05_02)

[0278] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoate (compound ST08, F-Pnaz-S3F5MePyr-pCpA) [ka]

[0279] In buffer solution A (9 mL) was dissolved (22 mg, 0.03 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl An acetonitrile solution (0.45 mL, 0.02 mmol) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-[(5-fluoropyridin-3-yl)methoxy]propanoate (compound ST07, F-Pnaz-S3F5MePyr-OCH2CN) was added and stirred at room temperature for 40 minutes. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (0.45 mL) was added. After stirring at 0°C for 1 hour, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound ST08, F-Pnaz-S3F5MePyr-pCpA) (6.5 mg, 29%). LCMS(ESI) m / z = 1132.7 (M−H)- Retention time: 0.51 minutes (Analysis conditions SQDFA05_02)

[0280] Synthesis of (2S)-1-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl]pyrrolidine-2-carboxylic acid (compound ST09, F-Pnaz-Pro-OH) [ka]

[0281] Under a nitrogen atmosphere, a mixture of L-proline (46.1 mg, 0.40 mmol), (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (178 mg, 0.42 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (2.00 mL) and triethylamine (128 μL, 0.92 mmol). The reaction mixture was stirred at room temperature for 2 days and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S)-1-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl]pyrrolidine-2-carboxylic acid (compound ST09, F-Pnaz-Pro-OH) (157 mg, 98%). LCMS(ESI) m / z = 399.2 (M−H) Retention time: 0.66 minutes (Analysis conditions SQDFA05_02)

[0282] 2-O-(cyanomethyl) 1-O-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl] (2S)-pyrrolidine-1,2-dicarboxylate (compound ST10, F-Pnaz-Pro-OCH 2 Synthesis of CN [ka]

[0283] Under a nitrogen atmosphere, 2-bromoacetonitrile (13.0 μL, 0.20 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (35.0 μL, 0.20 mmol) were added sequentially to a solution of (2S)-1-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl]pyrrolidine-2-carboxylic acid (compound ST09, F-Pnaz-Pro-OH) (40.0 mg, 0.10 mmol) in acetonitrile (0.5 mL) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then concentrated to give the crude product, 2-O-(cyanomethyl) 1-O-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl] (2S)-pyrrolidine-1,2-dicarboxylate (compound ST10, F-Pnaz-Pro-OCHCN). The obtained crude product was dissolved in acetonitrile (3.00 mL) and used as it was in the next step. LCMS(ESI) m / z = 438.3 (M−H)- Retention time: 0.76 minutes (Analysis conditions SQDFA05_02)

[0284] Synthesis of 2-O-[(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] 1-O-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl] (2S)-pyrrolidine-1,2-dicarboxylate (Compound ST11, F-Pnaz-Pro-pCpA) [ka]

[0285] In 60 mL of buffer solution A, (2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate (72.2 mg, 0.10 mmol), synthesized according to the method described in the literature (Helv. Chim. Acta, 90, 297-310), was dissolved, and 2-O-(cyanomethyl) 1-O-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl] An acetonitrile solution (3.00 mL, 0.10 mmol) of (2S)-pyrrolidine-1,2-dicarboxylate (compound ST10, F-Pnaz-Pro-OCHCN) was added and stirred at room temperature for 20 hours. The reaction solution was cooled to 0°C, and then trifluoroacetic acid (3.00 mL) was added. After stirring at room temperature for 30 minutes, the reaction solution was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound ST11, F-Pnaz-Pro-pCpA) (11 mg, 11%). LCMS(ESI) m / z = 1033.4 (M−H) Retention time: 0.49 minutes (Analysis conditions SQDFA05_02)

[0286] Synthesis of 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetic acid (compound ST12, F-Pnaz-Gly-OH) [ka]

[0287] Under a nitrogen atmosphere, a mixture of glycine (30.0 mg, 0.40 mmol), (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (178 mg, 0.42 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (2.00 mL) and triethylamine (128 μL, 0.92 mmol). The reaction mixture was stirred at room temperature for 2 days and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetic acid (compound ST12, F-Pnaz-Gly-OH) (57 mg, 40%). LCMS(ESI) m / z = 359.2 (M−H) Retention time: 0.60 minutes (Analysis conditions SQDFA05_02)

[0288] Cyanomethyl 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetate (compound ST13, F-Pnaz-Gly-OCH 2 Synthesis of CN [ka]

[0289] Under a nitrogen atmosphere, 2-bromoacetonitrile (13.0 μL, 0.20 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (35.0 μL, 0.20 mmol) were added sequentially to a solution of 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetic acid (compound ST12, F-Pnaz-Gly-OH) (36.0 mg, 0.10 mmol) in acetonitrile (0.5 mL) at room temperature. The reaction mixture was stirred at room temperature for 16 hours, and then concentrated to give the crude product, cyanomethyl 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetate (compound ST13, F-Pnaz-Gly-OCHCN). The resulting crude product was dissolved in acetonitrile (3.00 mL) and used directly in the next step. LCMS(ESI) m / z = 398.3 (M−H)- Retention time: 0.69 minutes (Analysis conditions SQDFA05_02)

[0290] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetate (Compound ST14, F-Pnaz-Gly-pCpA) [ka]

[0291] In buffer solution A (60 mL) was dissolved (72.2 mg, 0.10 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl An acetonitrile solution (3.00 mL, 0.10 mmol) of 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]acetate (Compound ST13, F-Pnaz-Gly-OCHCN) was added, and the mixture was stirred at room temperature for 90 minutes. The reaction mixture was cooled to 0°C, and then trifluoroacetic acid (3.00 mL) was added. After stirring at room temperature for 30 minutes, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (Compound ST14, F-Pnaz-Gly-pCpA) (16 mg, 16%). LCMS(ESI) m / z = 993.6 (M−H)- Retention time: 0.47 minutes (Analysis conditions SQDFA05_02)

[0292] Synthesis of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoic acid (compound ST15, F-Pnaz-Thr-OH) [ka]

[0293] Under a nitrogen atmosphere, a mixture of L-threonine (47.6 mg, 0.40 mmol), (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (178 mg, 0.42 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (2.00 mL) and triethylamine (128 μL, 0.92 mmol). The reaction mixture was stirred at room temperature for 2 days and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoic acid (compound ST15, F-Pnaz-Thr-OH) (141 mg, 87%). LCMS(ESI) m / z = 403.3 (M−H) Retention time: 0.59 minutes (Analysis conditions SQDFA05_02)

[0294] Cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoate (compound ST16, F-Pnaz-Thr-OCH 2 Synthesis of CN [ka]

[0295] Under a nitrogen atmosphere, 2-bromoacetonitrile (268 μL, 4.00 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (69.9 μL, 0.40 mmol) were added in order to a solution (1.0 mL) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoic acid (compound ST15, F-Pnaz-Thr-OH) (81.0 mg, 0.20 mmol) in acetonitrile at room temperature. The reaction mixture was stirred at room temperature for 3 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoate (compound ST16, F-Pnaz-Thr-OCHCN) (72.0 mg, 81%). LCMS(ESI) m / z = 442.3 (M−H) Retention time: 0.68 minutes (Analysis conditions SQDFA05_02)

[0296] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S,3R)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoate (compound ST17, F-Pnaz-Thr-pCpA) [ka]

[0297] In buffer solution A (60 mL) was dissolved (72.2 mg, 0.10 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl An acetonitrile solution (3.00 mL, 0.10 mmol) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-hydroxybutanoate (compound ST16, F-Pnaz-Thr-OCHCN) was added and stirred at room temperature for 90 minutes. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (3.00 mL) was added. After stirring at room temperature for 30 minutes, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound ST17, F-Pnaz-Thr-pCpA) (7 mg, 7%). LCMS(ESI) m / z = 1037.4 (M−H) Retention time: 0.48 minutes (Analysis conditions SQDFA05_02)

[0298] Synthesis of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoic acid (compound ST18, F-Pnaz-Leu-OH) [ka]

[0299] Under a nitrogen atmosphere, a mixture of L-leucine (13.1 mg, 0.10 mmol), (42.4 mg, 0.10 mmol) benzyl carbonate (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido) (synthesized by the method described in patent document WO2018143145A1), DMSO (0.50 mL), and triethylamine (32.1 μL, 0.23 mmol) was added at room temperature. The reaction mixture was stirred at room temperature for 1 hour and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoic acid (compound ST18, F-Pnaz-Leu-OH) (28 mg, 67%). LCMS(ESI) m / z = 415.3 (M−H) Retention time: 0.73 minutes (Analysis conditions SQDFA05_02)

[0300] Cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoate (compound ST19, F-Pnaz-Leu-OCH 2 Synthesis of CN [ka]

[0301] Under a nitrogen atmosphere, 2-bromoacetonitrile (20.0 μL, 0.30 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (7.86 μL, 0.05 mmol) were added sequentially to a solution of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoic acid (compound ST18, F-Pnaz-Leu-OH) (12.0 mg, 0.03 mmol) in acetonitrile (75.0 μL) at room temperature. The reaction mixture was stirred at room temperature for 1 hour, and then concentrated to give the crude product, cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoate (compound ST19, F-Pnaz-Leu-OCHCN). The obtained crude product was dissolved in acetonitrile (0.75 mL) and used as it was in the next step. LCMS(ESI) m / z = 454.3 (M−H) Retention time: 0.82 minutes (Analysis conditions SQDFA05_02)

[0302] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoate (compound ST20, F-Pnaz-Leu-pCpA) [ka]

[0303] In buffer solution A (15 mL) was dissolved (72.2 mg, 0.10 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl An acetonitrile solution (0.75 mL, 0.10 mmol) of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-4-methylpentanoate (compound ST19, F-Pnaz-Leu-OCHCN) was added and stirred at room temperature for 60 minutes. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (0.75 mL) was added. After stirring at room temperature for 30 minutes, the reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound ST20, F-Pnaz-Leu-pCpA) (9.6 mg, 31%). LCMS(ESI) m / z = 1049.6 (M−H)- Retention time: 0.54 minutes (Analysis conditions SQDFA05_02)

[0304] Synthesis of 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetic acid (compound ST21, F-Pnaz-MeG-OH) [ka]

[0305] Under a nitrogen atmosphere, a mixture of sarcosine (483 mg, 5.42 mmol), 4-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (2.0 g, 4.71 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (15 mL) and triethylamine (953.4 mg, 9.42 mmol). The reaction mixture was stirred at room temperature for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetic acid (compound ST21, F-Pnaz-MeG-OH) (1.4 g, 79%). LCMS(ESI) m / z = 397 (M+Na)+ Retention time: 0.88 minutes (Analysis conditions SMD method 3)

[0306] Cyanomethyl 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetate (compound ST22, F-Pnaz-MeG-OCH 2 Synthesis of CN [ka]

[0307] Under a nitrogen atmosphere, 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetic acid (compound ST21, F-Pnaz-MeG-OH) (1.38 g, 3.69 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (0.95 g, 7.38 mmol) were dissolved in DMF (28 mL), and 2-bromoacetonitrile (1.74 g, 14.75 mmol) was added at room temperature and stirred at room temperature for 16 hours. The reaction mixture was concentrated and purified by normal-phase silica gel column chromatography (ethyl acetate / petroleum ether) to give cyanomethyl 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetate (compound ST22, F-Pnaz-MeG-OCHCN) (1.2 g, 79%). LCMS(ESI) m / z = 436 (M+Na)+ Retention time: 0.70 minutes (Analysis conditions SMD method 4)

[0308] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetate (compound ST23, F-Pnaz-MeG-pCpA) [ka]

[0309] In buffer solution A (100 mL) was dissolved (422 mg, 0.58 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl A solution of 2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]acetate (compound ST22, F-Pnaz-MeG-OCHCN) (120.7 mg, 0.29 mmol) in acetonitrile (5 mL) was added dropwise over 15 minutes using a syringe pump and stirred at room temperature for 5 hours. Trifluoroacetic acid (2.3 mL) was added to the reaction mixture, and the reaction mixture was lyophilized. The mixture was then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to give the title compound (compound ST23, F-Pnaz-MeG-pCpA) (76.7 mg, 26%). LCMS(ESI) m / z = 1007.5 (M−H)- Retention time: 0.48 minutes (Analysis conditions SQDFA05_02)

[0310] A synthetic intermediate of compound ST28 was synthesized according to the following scheme. [ka]

[0311] Synthesis of (2S)-2-[9H-fluoren-9-ylmethoxycarbonyl(methyl)amino]-3-pyridin-3-ylpropanoic acid 2,2,2-trifluoroacetic acid (compound ST24, Fmoc-MeA3Pyr-OH·TFA) [ka]

[0312] (2S)-2-(9H-fluoren-9-ylmethoxycarbonylamino)-3-pyridin-3-ylpropanoic acid (15 g, 38.62 mmol), trifluoroacetic acid (27 mL, 348 mmol), and paraformaldehyde (CHO) n ) (3.48 g, 116 mmol) was suspended in toluene (50 mL) and stirred at 40°C under a nitrogen atmosphere for 16 hours. After cooling to room temperature, the reaction mixture was concentrated under reduced pressure. The residue was dissolved in DCM and washed with saturated aqueous sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the solvent, yielding (S)-(9H-fluoren-9-yl)methyl 5-oxo-4-(pyridin-3-ylmethyl)oxazolidine-3-carboxylate as a crude product.

[0313] The resulting crude product, (S)-5-oxo-4-(pyridin-3-ylmethyl)oxazolidine-3-carboxylic acid (9H-fluoren-9-yl) (18 g, 44.95 mmol), was dissolved in dichloroethane (100 mL), and triethylsilane (EtSiH) (47 g, 404.20 mmol) and trifluoroacetic acid (100 mL) were added at room temperature. The reaction mixture was stirred at 70°C under a nitrogen atmosphere for 16 hours, after which the mixture was concentrated under reduced pressure. The resulting residue was dissolved in isopropyl acetate, and a mixture of t-butyl methyl ether and hexane (9:1) was added. The solution was stirred at room temperature for 20 minutes and then allowed to stand at 4°C for 1 hour. The resulting precipitate was collected by filtration and washed with a cooled mixture of t-butyl methyl ether and hexane (9:1) to give (2S)-2-[9H-fluoren-9-ylmethoxycarbonyl(methyl)amino]-3-pyridin-3-ylpropanoic acid 2,2,2-trifluoroacetic acid (compound ST24, Fmoc-MeA3Pyr-OH·TFA) (19 g, 95%). LCMS(ESI) m / z = 403 (M+H)+ Retention time: 0.77 minutes (Analysis conditions SMD method 1)

[0314] Synthesis of (2S)-2-(methylamino)-3-pyridin-3-ylpropanoic acid (compound ST25, MeA3Pyr-OH) [ka]

[0315] (2S)-2-[9H-Fluoren-9-ylmethoxycarbonyl(methyl)amino]-3-pyridin-3-ylpropanoic acid; 2,2,2-trifluoroacetic acid (compound ST24, Fmoc-MeA3Pyr-OH·TFA) (19 g, 47.21 mmol) was added to DMF (72 mL) and piperidine (28.5 mL) at room temperature, and the reaction mixture was stirred at room temperature for 3 hours. Diethyl ether (140 mL) and hexane (280 mL) were added, and the mixture was stirred at room temperature for an additional 3 hours. The resulting precipitate was collected by filtration to quantitatively obtain (2S)-2-(methylamino)-3-pyridin-3-ylpropanoic acid (compound ST25, MeA3Pyr-OH) (7 g). LCMS(ESI) m / z = 181 (M+H)+ Retention time: 0.15 minutes (Analysis conditions SMD method 2)

[0316] Synthesis of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropanoic acid (compound ST26, F-Pnaz-MeA3Pyr-OH) [ka]

[0317] Under a nitrogen atmosphere, a mixture of (2S)-2-(methylamino)-3-pyridin-3-ylpropanoic acid (compound ST25, MeA3Pyr-OH) (970 mg, 5.38 mmol) and (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (2 g, 4.71 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (15 mL) and triethylamine (950 mg, 9.43 mmol). The reaction mixture was stirred at 40 °C for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropane. acid(Compound ST26, F-Pnaz-MeA3Pyr-OH) (1.0 g, 46%) was obtained. LCMS(ESI) m / z = 466 (M+H)+ Retention time: 0.98 minutes (Analysis conditions SMD method 3)

[0318] Cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropanoate (compound ST27, F-Pnaz-MeA3Pyr-OCH 2 Synthesis of CN [ka]

[0319] Under a nitrogen atmosphere, (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropane acid A mixture of (compound ST26, F-Pnaz-MeA3Pyr-OH) (800 mg, 1.72 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (444 mg, 3.44 mmol) was dissolved in DCM (20 mL), and 2-bromoacetonitrile (818 mg, 6.82 mmol) was added at room temperature and stirred at room temperature for 6 hours. The reaction mixture was concentrated and purified by normal phase silica gel column chromatography (ethyl acetate / petroleum ether) to give cyanomethyl (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropanoate (compound ST27, F-Pnaz-MeA3Pyr-OCH2CN) (221 mg, 25%). LCMS(ESI) m / z = 505 (M+H)+ Retention time: 0.83 minutes (Analysis conditions SMD method 4)

[0320] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropanoate (compound ST28, F-Pnaz-MeA3Pyr-pCpA) [ka]

[0321] In buffer solution A (100 mL) was dissolved (400 mg, 0.55 mmol) of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate, which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), and the resulting solution was treated with cyanomethyl A solution of (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-pyridin-3-ylpropanoate (compound ST27, F-Pnaz-MeA3Pyr-OCH2CN) (146 mg, 0.29 mmol) in acetonitrile (5 mL) was added dropwise over 15 minutes using a syringe pump and stirred at room temperature for 1 hour. Trifluoroacetic acid (2.3 mL) was added to the reaction mixture, and the reaction mixture was lyophilized. The mixture was then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to give the title compound (compound ST28, F-Pnaz-MeA3Pyr-pCpA) (64.4 mg, 5%). LCMS(ESI) m / z = 1098.5 (M−H)- Retention time: 0.39 minutes (Analysis conditions SQDFA05_01)

[0322] Synthesis of (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoic acid (compound ST29, F-Pnaz-Ile-OH) [ka]

[0323] Under a nitrogen atmosphere, a mixture of L-isoleucine (52.5 mg, 0.40 mmol), (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (178 mg, 0.42 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (2 mL) and triethylamine (128 μL, 0.92 mmol). The reaction mixture was stirred at room temperature for 2.5 days and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoic acid (compound ST29, F-Pnaz-Ile-OH) (125 mg, 75%). LCMS(ESI) m / z = 415.4 (M−H) Retention time: 0.74 minutes (Analysis conditions SQDFA05_02)

[0324] Cyanomethyl(2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoate (compound ST30, F-Pnaz-Ile-OCH 2 Synthesis of CN [ka]

[0325] Under a nitrogen atmosphere, (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoic acid (compound ST29, F-Pnaz-Ile-OH) (42 mg, 0.1 mmol) and 2-bromoacetonitrile (13 μL, 0.200 mmol) were dissolved in acetonitrile (500 μL), and N-ethyl-isopropylpropan-2-amine (DIPEA) (35 μL, 0.200 mmol) was added at room temperature. The mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated to give the crude product cyanomethyl (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoate (compound ST30, F-Pnaz-Ile-OCHCN). The obtained crude product was dissolved in acetonitrile (3.00 mL) and used as it was in the next step. LCMS(ESI) m / z = 454 (M−H)- Retention time: 0.83 minutes (Analysis conditions SQDFA05_02)

[0326] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoate (compound ST31, F-Pnaz-Ile-pCpA) [ka]

[0327] In 60 mL of buffer solution A, (2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate (72.2 mg, 0.100 mmol), synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310), was dissolved, and cyanomethyl A solution of (2S,3S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]-3-methylpentanoate (compound ST30, F-Pnaz-Ile-OCHCN) (45.5 mg, 0.100 mmol) in acetonitrile (3.00 mL) was added and stirred at room temperature for 20 hours. The reaction mixture was cooled to 0°C, and trifluoroacetic acid (3.00 mL) was added. The reaction mixture was stirred at room temperature for 30 minutes, and then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound ST31, F-Pnaz-Ile-pCpA) (12 mg, 11.4%). LCMS(ESI) m / z = 1049.4 (M−H)- Retention time: 0.54 minutes (Analysis conditions SQDFA05_02)

[0328] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-3-phenylpropanoate (compound ST32, F-Pnaz-MePhe-pCpA) [ka]

[0329] It was synthesized by the method described in WO2018 / 225864.

[0330] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2R)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonylamino]propanoate (compound ST33, F-Pnaz-D-Ala-pCpA) [ka]

[0331] It was synthesized by the method described in WO2018 / 143145.

[0332] Synthesis of 2-O-[(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] 1-O-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methyl] (2S)-piperidine-1,2-dicarboxylate (compound ST34, F-Pnaz-Pic(2)-pCpA) [ka]

[0333] It was synthesized by the method described in WO2020 / 138336.

[0334] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-4-phenylbutanoate (compound ST35, F-Pnaz-MeHph-pCpA) [ka]

[0335] It was synthesized by the method described in patent document (WO2020138336A1).

[0336] Synthesis of [(2R,3S,4R,5R)-2-[[[(2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1-yl)-4-hydroxy-2-(phosphonooxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(6-aminopurin-9-yl)-4-hydroxyoxolan-3-yl] (2S)-2-[[4-[[2-(4-fluorophenyl)acetyl]amino]phenyl]methoxycarbonyl-methylamino]-4-phenylbutanoate (compound ST36, F-Pnaz-SPh2Cl-pCpA) [ka]

[0337] It was synthesized by the method described in patent document (WO2020138336A1).

[0338] Example 13. Synthesis of aminoacyl-tRNA Various aminoacyl-tRNAs were synthesized and collected according to the method described in Example 5, "Synthesis of aminoacyl-tRNA using aminoacyl-pCpA: Part 1." The collected aminoacyl-tRNAs were dissolved in 1 mM sodium acetate. The names of the completed aminoacyl-tRNAs and the corresponding aminoacyl-pCpA amino acids are shown in Table 18.

[0339] [Table 18]

[0340] Example 14. Construction of E. coli strains expressing mutants Eight L31 mutant strains expressing various lengths of the N-terminal end of the L31 protein (L31(1-27), L31(1-32), L31(1-37), L31(1-42), L31(1-47), L31(1-52), L31(1-57), and L31(1-67)) were constructed using the Quick and Easy Conditional Knockout Kit (loxP / Cre) (Gene Bridges) according to the protocol provided with the kit.

[0341] Construction of functional cassettes with homology arms A functional cassette was prepared according to the method described in Example 1. Table 19 shows the correspondence between the length of the L31 expression region of each strain and the primers used in PCR for the functional cassette used to prepare the strain.

[0342] [Table 19]

[0343] Construction of the L31 mutant strain The L31 mutant strain was prepared according to the method described in Example 1.

[0344] Example 15. Purification of ribosomes Ribosome preparation using the L31 mutant strain, L31short strain, L31intact strain, and W3110 strain Strain cultivation, E. coli disruption, E. coli purification, butylsepharose purification, and ultracentrifugal purification were performed according to the method described in Example 2. All strains were treated in accordance with the procedures described for the L31intact strain and L31short strain in Example 2. E. coli was disrupted using the Mg10Lysis Buffer described in Example 2. A total of 11 types of ribosomes were prepared, including L31short ribosomes, L31intact ribosomes, WT ribosomes, and eight types of L31 mutant ribosomes, with final concentrations adjusted to 10 to 20 μM. [Industrial Applicability]

[0345] The present invention provides methods for producing peptides and peptide libraries containing unnatural amino acids, as well as modified L31 proteins for use in the methods. By using the production methods of the present invention, mRNA encoding peptides containing unnatural amino acids can be efficiently translated, and the peptides and libraries containing them can be efficiently produced.

Claims

[Claim 1] The invention described in the specification.

Images