Compositions and methods for immunooncology

CRISPR/Cas systems are used to engineer T cells with targeted gRNA molecules and CARs, addressing the need for enhanced genome editing in immune cells to improve cancer therapy.

JP2025131615APending Publication Date: 2025-09-09NOVARTIS AG +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025082591
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2016-09-14
Filing Date
2025-05-16
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Current immuno-oncology approaches lack effective methods for targeted genome editing in immune cells, such as T cells, to enhance their therapeutic efficacy against cancer.

Method used

The use of CRISPR/Cas systems for genome editing in eukaryotic cells, specifically engineering T cells with gRNA molecules targeting specific allogeneic T cell targets and inhibitory molecules to modulate their function, combined with chimeric antigen receptors (CARs), to enhance their anti-tumor activity.

Benefits of technology

This approach enables precise genome editing in T cells, leading to enhanced expression of CARs and reduced expression of inhibitory molecules, thereby improving the cells' ability to target and eliminate cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025131615000571
    Figure 2025131615000571
  • Figure 2025131615000572
    Figure 2025131615000572
  • Figure 2025131615000573
    Figure 2025131615000573
Patent Text Reader

Abstract

To provide compositions and methods for immunooncology, for example, cells modified at specific target sequences in their genome, including as modified by introduction of CRISPR systems that include gRNA molecules which target the target sequences, and methods of making and using them.SOLUTION: A gRNA molecule comprising a tracr and crRNA is provided, where the crRNA comprises a targeting domain that is complementary with a target sequence of an allogeneic T-cell target selected from B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HLA-A, HLA-B, HLA-C, DCK, CD52, FKBP1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C1.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application is a continuation of U.S. Provisional Patent Application No. 62 / 263,169, filed December 4, 2015. No. 62 / 316,784, filed April 1, 2016. and U.S. Provisional Patent Application No. 62 / 394,290, filed September 14, 2016. Nos. 11 / 199,992 and 11 / 199,996, filed on Oct. 1, 2003, and 2004, the entire contents of which are incorporated herein by reference. will be incorporated into

[0002] background CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats (Short Palindromic Repeats) are used in bacteria to prevent viral attack. Upon exposure to a virus, the virus DNA is transferred to the host. A short segment of RNA is integrated into the CRISPR locus in the bacterial genome. Transcribed from the portion of the CRISPR locus that contains the viral sequence. Complementary to the viral genome This RNA, containing a sequence specific for the Cas9 protein, is used to target the protein to a sequence within the viral genome. The Cas9 protein mediates targeting by cleaving the viral target, thereby , silencing viral targets.

[0003] Recently, the CRISPR / Cas system has been adapted for genome editing in eukaryotic cells. The introduction of targeted single-strand breaks (SSBs) or double-strand breaks (DSBs) can be achieved by, for example, non-homologous end joining. This allows for targeted sequence alteration via either NHEJ or homology-directed repair (HDR).

[0004] Summary of the Invention The invention described herein provides compositions and methods for immuno-oncology, e.g. a cell modified at a specific target sequence within its genome, said cell comprising a target gene for said target sequence; cells, including cells modified by the introduction of a CRISPR system containing a gRNA molecule that targets and methods of making and using them. For example, the present disclosure relates to cells, e.g., T Genome editing of cells, e.g., T cells, which have been further engineered to express chimeric antigen receptors. and the like. The present invention relates to PR systems, cells, and methods.

[0005] In a first aspect, the present invention provides a gRNA molecule comprising tracr and crRNA, crRNAs for B2M, CD247, CD3D, CD3E, CD3G, TRAC, and TRB C1, TRBC2, HLA-A, HLA-B, HLA-C, DCK, CD52, FKBP 1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C a targeting domain complementary to a target sequence of an allogeneic T cell target selected from The present invention provides a gRNA molecule comprising:

[0006] In some embodiments, the gRNA molecule: 2(a) The allogeneic T cell target is B2M and the targeting domain is 1 to SEQ ID NO: 83, or any one of SEQ ID NO: 5492 to SEQ ID NO: 5527 Contains; 2(b) The allogeneic T cell target is TRAC and the targeting domain is No. 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965 Contains any one of the following; 2(c) The allogeneic T cell target is TRBC1 and the targeting domain has the sequence Of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097 or contains one of the following; 2(d) The allogeneic T cell target is TRBC2 and the targeting domain has the sequence Of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226 or contains one of the following; 2(e) The allogeneic T cell target is CD247 and the targeting domain is Contains any one of SEQ ID NOs: 84 to 392; 2(f) the allogeneic T cell target is CD3D and the targeting domain is No. 393 to SEQ ID NO: 532, or SEQ ID NO: 10780 to SEQ ID NO: 10794 Contains any one of the following; 2(g) The allogeneic T cell target is CD3E and the targeting domain is No. 533 to SEQ ID NO: 839, or SEQ ID NO: 10677 to SEQ ID NO: 10764 Contains any one of the following; 2(h) the allogeneic T cell target is CD3G and the targeting domain is No. 840 to No. 968, or No. 10765 to No. 10779 Contains any one of the following; 2(i) The allogeneic T cell target is HLA-A and the targeting domain is Contains any one of sequence numbers 969 to 1345; 2(j) the allogeneic T cell target is HLA-B and the targeting domain has the sequence Contains any one of sequence numbers 1346 to 1698; The 2(k) allogeneic T cell target is HLA-C and the targeting domain is Contains any one of sequence numbers 1699 to 2068; 2(l) The allogeneic T cell target is DCK and the targeting domain is Contains any one of SEQ ID NOs: 5278 to 5491; 2(m) The allogeneic T cell target is CD52 and the targeting domain is Contains any one of SEQ ID NOs. 6227 to 6324; 2(n) The allogeneic T cell target is FKBP1A and the targeting domain is Sequence numbers 6325 to 6583, or sequence numbers 6662 to 6749 Contains one of the following: 2(o) The allogeneic T cell target is NR3C1, and the targeting domain has the sequence Contains any one of sequence numbers 2069 to 2941; 2(p) The allogeneic T cell target is CIITA, and the targeting domain has the sequence Of SEQ ID NO: 6750 to SEQ ID NO: 7716, or SEQ ID NO: 7717 to SEQ ID NO: 7804 or The 2(q) allogeneic T cell target is NLRC5, and the targeting domain has the sequence Includes any one of sequence numbers 8622 to 10089.

[0007] In some embodiments of the gRNA molecule, the allogeneic T cell target is TRAC. , the targeting domain is SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587 , SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: No. 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 559 8, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, or SEQ ID NO: 5620; For example, the targeting domain may be SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5 587, SEQ ID NO: 5592, SEQ ID NO: 5599, or SEQ ID NO: 5600, for example , the targeting domain is SEQ ID NO: 5569, SEQ ID NO: 5587, SEQ ID NO: 5592 or SEQ ID NO: 5586, for example, the targeting domain comprises SEQ ID NO: 556 Includes 9.

[0008] In some embodiments of the gRNA molecule, the allogeneic T cell target is TRBC2. The targeting domain is SEQ ID NO: 5719, SEQ ID NO: 5694, SEQ ID NO: 570 6, SEQ ID NO: 5696, SEQ ID NO: 5711, SEQ ID NO: 5708, SEQ ID NO: 5709, SEQ ID NO: No. 5712, SEQ ID NO: 5703, SEQ ID NO: 5707, SEQ ID NO: 5687, SEQ ID NO: 57 05, SEQ ID NO: 5713, SEQ ID NO: 5715, or SEQ ID NO: 5710.

[0009] In embodiments of the gRNA molecule, the allogeneic T cell target is B2M; The targeting domain is SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 5517 , SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: SEQ ID NO: 5508, SEQ ID NO: 5514, or SEQ ID NO: 5492, e.g., targeting The good domain comprises SEQ ID NO:5496, SEQ ID NO:5498, or SEQ ID NO:5509.

[0010] In some embodiments of the gRNA molecule, the allogeneic T cell target is CIITA. The targeting domains are SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 777 3, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: No. 7770, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 77 85, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 775 For example, the targeting domain may be SEQ ID NO: 7769, SEQ ID NO: 7771, Includes SEQ ID NO: 7739, or SEQ ID NO: 7785.

[0011] In some embodiments of the gRNA molecule, the allogeneic T cell target is CD3E. , the targeting domain is SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10 764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: Including No. 10722.

[0012] In some embodiments of the gRNA molecule, the allogeneic T cell target is FKBP1A. The targeting domain is SEQ ID NO: 6693, SEQ ID NO: 6705, SEQ ID NO: 66 94, SEQ ID NO: 6708, or SEQ ID NO: 6699.

[0013] In a second aspect, the present invention provides a gRNA molecule comprising tracr and crRNA, crRNA is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTL A4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or C EACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B 4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HV EM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MH C class II, GAL9, adenosine, and TGF-beta, or PTPN11 Targets of inhibitory molecules or downstream effectors of inhibitory molecule-mediated signal transduction The gRNA molecule is provided, comprising a targeting domain complementary to a target sequence.

[0014] In some embodiments, the gRNA molecule: 15(a) The inhibitory molecule is CD274 (PD-L1), which has a targeting domain includes any one of SEQ ID NOs: 2942 to 3270; 15(b) The inhibitory molecule is HAVCR2 (TIM3) and the targeting domain includes any one of SEQ ID NOs: 3271 to 3541; 15(c) The inhibitory molecule is LAG3 and the targeting domain is SEQ ID NO: 35 42 to 4032; 15(d) The inhibitory molecule is PDCD1 (PD-1), and the targeting domain is , SEQ ID NO: 4033 to SEQ ID NO: 4589, or SEQ ID NO: 5720 to SEQ ID NO: 5815 or 15(e) The downstream effector of signal transduction via inhibitory molecules is PTPN1. The targeting domain is any one of SEQ ID NOs: 4590 to 5277. Includes one.

[0015] In some embodiments of the gRNA molecule, the inhibitory molecule is PDCD1 and the target The targeting domain is SEQ ID NO: 5743, SEQ ID NO: 5798, SEQ ID NO: 5748, SEQ ID NO: No. 5722, SEQ ID NO: 5800, SEQ ID NO: 5735, SEQ ID NO: 5724, SEQ ID NO: 57 31, SEQ ID NO: 5725, SEQ ID NO: 5775, SEQ ID NO: 5766, SEQ ID NO: 5727, For example, target sequences containing sequence number 5744, sequence number 5751, or sequence number 5734. The binding domain comprises SEQ ID NO:5775.

[0016] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments including any of the following, the targeting domain is Any one of the targeting domain sequences, 17, 18, 19, 20, 21 (reference 22 (present in the reference sequence), 23 (present in the reference sequence) 24 (if present in the reference sequence), or 25 (if present in the reference sequence) The foregoing aspects and embodiments of the gRNA molecule include contiguous nucleic acids of In other embodiments, including any of the following, the targeting domain is Any one of the targeting domain sequences, 17, 18, 19, 20, 21 (bases 22 (present in the reference sequence), 23 (present in the reference sequence) 24 (if present in the reference sequence), or 25 (if present in the reference sequence) In some embodiments, the gRNA molecule comprises a sequence of contiguous nucleic acids, including the sequence of the preceding nucleic acid sequence (if present). In embodiments including any of the above aspects and embodiments, the enumerated Any one of the targeting domain sequences, 17, 18, 19, 20, 21 22 (if present in the reference sequence), 23 (if present in the reference sequence) 24 (if present in the reference sequence), or 25 (if present in the reference sequence) (if present) are located at the 3' end of the listed targeting domain sequence. 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence) 23 (present in the reference sequence), or 24 (present in the reference sequence) gRNA fragments are 25 (if present in the reference sequence) or 25 (if present in the reference sequence) contiguous nucleic acids. Other implementations, including any of the above aspects and embodiments of the child In the form of any one of the listed targeting domain sequences, , 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence) , 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids are included in the enumerated targeting domain 17, 18, 19, 20, 21 (if present in the reference sequence) located at the 5' end of the sequence 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence) or 25 (if present in the reference sequence) consecutive nuclei Any of the above aspects and embodiments of the gRNA molecule. In other embodiments, including any of the listed targeting domain sequences, or one of 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence) 23 (if present in the reference sequence), or 24 (if present in the reference sequence) 25 (if present), or 25 (if present in the reference sequence) contiguous nucleic acids are It does not include nucleic acids 5' or 3' of the targeting domain sequence.

[0017] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments including any of the following, the targeting domain is It consists of a targeting domain sequence.

[0018] The following general aspects of gRNA molecules may be combined or used alone: or a targeting domain as described herein, e.g., in multiple embodiments and and a gRN comprising a targeting domain as recited in any of the embodiments. It may be a combination with any of A.

[0019] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments including any of the forms, the portion of crRNA and the portion of tracr are , hybridized to a flagpole comprising SEQ ID NO: 6584 or SEQ ID NO: 6585 In another embodiment, the flagpole is attached to the crRNA portion of the flagpole. a first flagpole extension located 3' to said first flagpole In another embodiment, the flagpole extension comprises SEQ ID NO: 6586. For the crRNA portion of the flagpole and, if present, the first flagpole extension. and a second flagpole extension located 3' to said second flagpole. The loop extension comprises SEQ ID NO:6587.

[0020] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms, tracr is (a) optionally, at the 3' end, an additional 1, 2, 3, 4, 5, 6 , or SEQ ID NO: 7820, which further contains seven uracil (U) nucleotides; (b) SEQ ID NO: 6660; or (c) SEQ ID NO: 6661 In such embodiments, the flagpole crRNA comprises, e.g., consists of: The portion comprises SEQ ID NO:6607 or SEQ ID NO:6608.

[0021] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms, tracr is SEQ ID NO: 6589 or SEQ ID NO: No. 6590 and, optionally, if a first flagpole extension is present, SEQ ID NO: 6 589 or SEQ ID NO: 6590, and a first tracr extension located 5' to wherein said first tracr extension comprises SEQ ID NO: 6591.

[0022] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments including any of the forms, the targeting domain and the tracr , located on separate nucleic acid molecules.

[0023] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms, the crRNA is ting domain]-: a) SEQ ID NO: 6584; b) SEQ ID NO: 6585; c) SEQ ID NO: 6605; d) SEQ ID NO: 6606; e) SEQ ID NO: 6607; f) SEQ ID NO: 6608; or g) SEQ ID NO: 7806 includes (e.g., consists of)

[0024] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms, tracr is, from 5' to 3': a) SEQ ID NO: 6589; b) SEQ ID NO: 6590; c) SEQ ID NO: 6609; d) SEQ ID NO: 6610; e) SEQ ID NO: 6660; f) SEQ ID NO: 6661; g) SEQ ID NO: 7820; h) SEQ ID NO: 7807; i) SEQ ID NO: 7808; j) SEQ ID NO: 7809; k) at least 1, 2, 3, 4, 5, 6, or 7 at the 3' end Uracil (U) nucleotides, e.g., 1, 2, 3, 4, 5, 6, if Any of the above a) to j) further containing at least seven uracil (U) nucleotides. mosquito; l) at least 1, 2, 3, 4, 5, 6, or 7 at the 3' end Adenine (A) nucleotides, e.g., 1, 2, 3, 4, 5, 6, if Any of the above a) to k) further containing at least seven adenine (A) nucleotides. or m) at least one at the 5' end (e.g., the 5' terminus), Two, three, four, five, six, or seven adenine (A) nucleotides, e.g., One, two, three, four, five, six, or seven adenine (A) nucleotides Any of the above a) to l) including includes (e.g., consists of)

[0025] A preferred embodiment of the gRNA molecule comprises multiple aspects and multiple implementations described above. In some embodiments, including any of the embodiments, the targeting domain and the tracr are located on separate nucleic acid molecules, and the nucleic acid molecule comprising the targeting domain is optionally and SEQ ID NO: 6607 located immediately 3' to the targeting domain; A nucleic acid molecule comprising tracr comprises, for example consists of, SEQ ID NO:6660.

[0026] Any of the above aspects and embodiments of the gRNA molecule. In other embodiments, the targeting domain and the tracr are located on a single nucleic acid molecule. and tracr is located 3' to the targeting domain. Such an embodiment of the gRNA molecule may include any of the above aspects and embodiments. In embodiments, including any of the embodiments, the gRNA molecule comprises a targeting domain a loop located 3' to the nucleotide sequence and 5' to the nucleotide sequence, e.g., For example, it further comprises a loop comprising (e.g., consisting of) SEQ ID NO:6588.

[0027] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the following forms, the gRNA molecule is Targeting Domain]-: (a) SEQ ID NO: 6601; (b) SEQ ID NO: 6602; (c) SEQ ID NO: 6603; (d) SEQ ID NO: 6604; (e) SEQ ID NO: 7811; or (f) one, two, three, four, five, six, or seven urea residues at the 3' end Any of (a) to (e) above, further comprising a syl (U) nucleotide. includes (e.g., consists of)

[0028] A preferred embodiment of the gRNA molecule comprises multiple aspects and multiple implementations described above. In some embodiments, including any of the embodiments, the targeting domain and the tracr are located on a single nucleic acid molecule, and the nucleic acid molecule comprises the targeting domain and any Optionally, SEQ ID NO: 660 located immediately 3' to the targeting domain 1 and includes, for example, consists of:

[0029] A preferred embodiment of the gRNA molecule comprises multiple aspects and multiple implementations described above. In some embodiments, including any of the embodiments, the targeting domain and the tracr are located on a single nucleic acid molecule, and the nucleic acid molecule comprises the targeting domain and any Optionally, SEQ ID NO: 781 located immediately 3' to the targeting domain 1 and includes, for example, consists of:

[0030] In some embodiments, the gRNA molecule comprises unmodified RNA nucleotides and nucleic acid binding sites. In other embodiments, the gRNA molecule may be one or more of the following: In some embodiments, the gRNA molecule contains a number of modifications. In embodiments, including any of the similar and multiple embodiments, the nucleic acid molecule of the gRNA molecule One or, optionally, more than one of a) one or more nucleic acid molecules, e.g., three phosphoro groups at the 3' end of said one or more nucleic acid molecules; Thioate (phosphorothioate) modification; b) one or more nucleic acid molecules, e.g., three phosphoro groups at the 5' end of said one or more nucleic acid molecules; Thioate (phosphorothioate) modification; c) one, for example, three 2'-O residues at the 3' end of said one or more nucleic acid molecules -Methyl modification; d) one, for example, three 2'-O residues at the 5' end of said one or more nucleic acid molecules -Methyl modification; e) a fourth position relative to the end, a third position relative to the end, and a fourth position relative to the end of said one or more nucleic acid molecules a 2'-O-methyl modification at each of the 3' residues at the first and second 3' residues relative to the terminus; or f) Any combination of these Includes.

[0031] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms of a gRNA molecule (e.g., as described herein), CRISPR systems (e.g., RNPs described herein, e.g., When an RNP containing a Cas9 molecule as described herein is introduced into a cell, it encodes a gRNA molecule. Indels are formed in or near a target sequence complementary to the targeting domain of In some embodiments, the indel is a frameshift mutation. In terms of morphology, indels are shown in Figures 34A, 34B, 36, 38, 41, 44, and 48. , FIG. 49, FIG. 50, or FIG. 53.

[0032] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms of a gRNA molecule (e.g., as described herein), CRISPR systems (e.g., RNPs described herein, e.g., When an RNP containing a Cas9 molecule as described herein is introduced into a cell population, the cells in the population At least about 40%, for example, at least about 50%, for example, at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about At least about 97%, for example, at least about 98%, for example, at least about 99% of The target sequence is complementary to the targeting domain of the RNA molecule or is adjacent to the target sequence. In some embodiments, at least about 20% of the cells of the population, e.g., For example, at least about 30%, for example, at least about 35%, for example, at least about 40% , e.g., at least about 45%, e.g., at least about 50%, e.g., at least about 5 5%, e.g., at least about 60%, e.g., at least about 65%, e.g., at least About 70%, e.g., at least about 75%, e.g., at least about 80%, e.g., at least At least about 85%, for example, at least about 90%, for example, at least about 95%, for example, at least about At least approximately 99% of the target sequences are complementary to the targeting domain of the gRNA molecule. Indels, which are frameshift mutations, are formed in or near these regions. In embodiments, at least about 30%, e.g., at least about 40%, of the cells of the population For example, at least about 50%, for example, at least about 60%, for example, at least about 70% %, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 96%, e.g., at least about 97%, e.g., at least Indels are present in at least about 98%, e.g., at least about 99%, of the sequences shown in Figures 34A, 34B, and 34C. 36, 38, 41, 44, 48, 49, 50, or 53 In some embodiments, the most frequently detected indels in the cell population are those listed below. The five indels identified are shown in Figures 34A, 34B, 36, 38, 41, 44, and 45. 48, FIG. 49, FIG. 50, or FIG. 53. three or more, e.g., four, e.g., five, of the consecutive indels. Indel patterns can be measured and / or analyzed by next-generation sequencing (NGS). For example, it can be quantified.

[0033] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms of a gRNA molecule (e.g., as described herein), CRISPR systems (e.g., RNPs described herein, e.g., RNPs containing Cas9 molecules as described herein) can be transfected into cells (or When introduced into a cell population, the gRNA molecule binds to the targeting domain of the gRNA molecule in the cells. Expression of the gene containing the complementary target sequence is reduced or eliminated. In this case, at least about 40%, e.g., at least about 50%, e.g., of the cells in the population , at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., For example, at least about 90%, for example, at least about 95%, for example, at least about 96% , e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 9 In 9% of cases, expression of the gene is reduced or eliminated. The expression, which is reduced or abolished, is measured by flow cytometry. In embodiments, for example, in the case of FKBP1A, the reduction or elimination of expression can be achieved by, for example, the methods described herein. This is measured by functional assays described in the literature.

[0034] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms of a gRNA molecule (e.g., as described herein), CRISPR systems (e.g., RNPs described herein, e.g., Introduction of an RNP containing a Cas9 molecule as described herein into a cell as described herein. Then, in the cell, for example, next generation sequencing, e.g., as described herein, and / or off-target indels detectable by nucleotide insertion assays. It cannot be done.

[0035] Embodiments of gRNA molecules, including the aforementioned aspects and implementations In embodiments, including any of the forms of a gRNA molecule (e.g., as described herein), CRISPR systems (e.g., RNPs described herein, e.g., and (RNPs containing Cas9 molecules as described herein) into a cell population as described herein. Once introduced, they can be used in, for example, next-generation sequencing and / or nucleotide insertion assays. More detectable off-target indels occur in approximately 5% or less of the cells in a cell population, e.g. , is detected in about 1% or less, for example, about 0.1% or less, for example, about 0.01% or less.

[0036] In any of the foregoing aspects and embodiments of the cell, the cell , mammalian, primate, or human cells, e.g., human cells (or cell populations). Any of the above aspects and embodiments of the cell. In either case, the cell is an immune effector cell, e.g., a T cell or a NK cell, e.g., For example, T cells, e.g., CD4+ T cells, CD8+ T cells, or a combination thereof. (or the cell population includes these).

[0037] In any of the above aspects and embodiments of the cell, the cell ( or cell population) has been engineered to express a chimeric antigen receptor (CAR), In some embodiments, the CAR is (a) CD19 CAR; or (b)BCMA CAR In some embodiments, (a) CAR is an antibody comprising any one of SEQ ID NOs: 7883 to 7898. Is it a CD19 CAR containing a native binding domain? (b) the CAR is a CD19 CAR comprising SEQ ID NO: 7909 or SEQ ID NO: 7920 Is there; (c) CAR is an antibody comprising any one of SEQ ID NOs: 7939 to 8112. BCM comprising an antigen-binding domain, e.g., comprising the antigen-binding domain of SEQ ID NO: 7949 A CAR; or (d) CAR comprises any one of SEQ ID NOs: 8549 to 8621; For example, a BCMA CAR comprising sequence number 8559.

[0038] In any of the foregoing aspects and embodiments of the cell, the cell In another embodiment, the cells are allogeneic with respect to the patient to whom they are administered. Autologous with respect to the patient receiving the cells.

[0039] In another aspect, the invention relates to the preceding aspects and aspects further comprising a Cas9 molecule. A composition comprising the first gRNA molecule of any of the embodiments is provided. In the form, the Cas9 molecule is SEQ ID NO: 6611, or SEQ ID NO: 7821 to SEQ ID NO: 78 31. In some embodiments, the Cas The Cas9 molecule is an active or inactive S. pyogenes Cas9. In embodiments, the first gRNA molecule and the Cas9 molecule are fused together in a ribonucleoprotein complex (R NP).

[0040] In embodiments, the composition comprises more than one gRNA molecule, e.g., each of which is It may contain more than one gRNA molecule complexed with a Cas9 molecule as described herein. For example, in some embodiments, the composition comprises a second gRNA molecule; and a third gRNA molecule; or a second gRNA molecule, a third gRNA molecule, and a third gRNA molecule. The second gRNA molecule, the third gRNA molecule (if present) If present, the first gRNA molecule, if present, and the fourth gRNA molecule, if present, are selected from the gRNA molecules described herein. a gRNA molecule of any of the above aspects and embodiments, Each gRNA molecule of the composition is complementary to a different target sequence (i.e., a different target sequence). In some embodiments, the first gRNA molecule, the second gRNA molecule, a gRNA molecule, a third gRNA molecule (if present), and a fourth gRNA molecule (if present) In such an embodiment, the first g RNA molecule, a second gRNA molecule, a third gRNA molecule (if present), and a fourth gRNA molecule The gRNA molecule (if present) must be no longer than 20,000 nucleotides, and no longer than 10,000 nucleotides. nucleotides or less, 6000 or less, 5000 or less, 4000 or less, 1000 or less nucleotides or less, 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, 200 nucleotides or less, 100 nucleotides or less, 90 nucleotides or less, 80 nucleotides or less nucleotides or less, 70 nucleotides or less, 60 nucleotides or less, 50 nucleotides or less, 4 0 nucleotides or less, 30 nucleotides or less, 20 nucleotides or less, or 10 nucleotides or less In other embodiments, the first gRNA fragment is complementary to a target sequence separated by no more than a single nucleotide. the second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA The molecules (if present) may be targeted to target sequences within different genes or different loci, e.g. They are complementary to target sequences within the different genes described herein.

[0041] In some embodiments, the first gRNA molecule is selected from the group consisting of 2(b), 2(c), 2(d), 2(d ), 2(e), 2(f), 2(g), or 2(h) gRNA molecule. the second gRNA molecule is 2(a), 2(i), 2(j), 2(k), or 2(q ), and the third gRNA molecule is any one of 15(a), 15( b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is selected from the group consisting of 2(b), 2(c), 2(d), 2(d ), 2(e), 2(f), 2(g), or 2(h) gRNA molecule. the second gRNA molecule is one of 2(l), 2(m), 2(n), or 2(o) the third gRNA molecule is 15(a), 15(b), 15 (c), 15(d), or 15(e). In an embodiment, the first gRNA molecule is selected from the group consisting of 2(b), 2(c), 2(d), 2(d), 2(e ), 2(f), 2(g), or 2(h); The gRNA molecule may be either 2(l), 2(m), 2(n), or 2(o). In other embodiments, the first gRNA molecule is a 2(b), 2(c), Any of 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h) the second gRNA molecule is 2(a), 2(i), 2(j), or In other embodiments, the first gRNA molecule is any one of the two (k) gRNA molecules. The child is 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or is one of the gRNA molecules in 2(h); the second gRNA molecule is one of the gRNA molecules in 15(a) , 15(b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is 15(a), 15(b), 15 (c), 15(d), or 7(e); a second gRNA molecule The RNA molecule is 15(a), 15(b), 15(c), 15(d), or 15(e). The gRNA molecule of any of the above embodiments. In this embodiment, a third gRNA is present, and the third gRNA molecule is 15(a), 15 (b), 15(c), 15(d), or 15(e) gRNA molecule. In embodiments, the compositions comprise multiple aspects and methods of the aforementioned gRNA molecules. In some embodiments, the gene comprises two gRNA molecules. The composition may comprise any of the aspects and embodiments of the gRNA molecules described above. In some embodiments, the composition comprises three gRNA molecules, each of which is selected from the group consisting of: The first gRNA molecule of any of several aspects and embodiments, the targeting domain of the first gRNA molecule is 2(a), 2(i), 2(j), or a first gRNA molecule that is a targeting domain of any of 2(k) The first of any of the aspects and embodiments of the gRNA molecule described above. 2 gRNA molecules, wherein the targeting domain of the second gRNA molecule is 2( b), 2(c), 2(d), 2(f), 2(g), 2(h), or 2(i). and a second gRNA molecule that contains either the targeting domain.

[0042] In some embodiments, the composition comprises two gRNA molecules, wherein the first gRNA molecule The targeting domains of SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499 , SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: No. 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 551 7, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: SEQ ID NO: 5508, SEQ ID NO: 5514, or SEQ ID NO: 5492, e.g., the targeting domain of the second gRNA molecule is SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589 , SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: No. 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 559 1, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, or comprises, e.g., consists of, SEQ ID NO: 5620.

[0043] In some embodiments, the composition comprises two gRNA molecules, wherein the first gRNA molecule The targeting domain of SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, e.g., consisting of; the targeting domain of said second gRNA molecule The sequences are SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5592, Column number 5599, or SEQ ID NO: 5600, including, for example, consisting of:

[0044] In some embodiments, the composition comprises two gRNA molecules, wherein the first gRNA molecule The targeting domain of SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, e.g., consisting of; the targeting domain of said second gRNA molecule The sequence comprises, for example consists of, SEQ ID NO: 5569.

[0045] In some embodiments, the composition comprises two gRNA molecules, wherein the first gRNA molecule The targeting domain of SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, e.g., consisting of; the targeting domain of said second gRNA molecule The sequences are SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 107 89, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722, e.g. For example, it will happen from now on.

[0046] In embodiments, including any of the above aspects and embodiments, The compositions are described herein, for example, in multiple embodiments and multiple versions of the aforementioned gRNA molecules. and a third gRNA molecule as described in any of the embodiments of The targeting domain of the gRNA molecule can be either 2(n) or 2(q). In some embodiments, the targeting domain of the third gRNA molecule The targeting domain is SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: No. 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 77 70, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, Contains column number 7731, sequence number 7772, sequence number 7743, or sequence number 7750 , e.g., consisting of; e.g., SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 77 39, or comprising (e.g., consisting of) SEQ ID NO: 7785.

[0047] In embodiments, including any of the above aspects and embodiments, The compositions are described herein, for example, in multiple embodiments and multiple versions of the aforementioned gRNA molecules. 10. The method of claim 1, further comprising administering to said patient a fourth gRNA molecule ... The targeting domain of the gRNA molecule may target the target of the NK inhibitory molecule, e.g., LILR. In some embodiments, the target sequence of the fourth gRNA molecule is complementary to the target sequence of B1. The ting domain is a) any one of SEQ ID NOs: 10090 to 10673; b) 17, 18, or any one of SEQ ID NOs: 10090 to 10673 19, 20, 21, 22, 23, or 24 consecutive nucleotides, preferably 20 consecutive nucleotide; c) the 5'-17 region of any one of SEQ ID NOs: 10090 to 10673 , 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides Ochido; or d) the 3'-17 amino acid sequence of any one of SEQ ID NOs: 10090 to 10673 , 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides Ochido

[0047] Including, for example, consisting of:

[0048] Composition embodiments (including any of the above aspects and embodiments) In either case, the targeting domain of the first gRNA molecule (described herein) is the main and targeting domains of a second gRNA molecule (described herein); If present, the targeting domain of the third gRNA molecule (described herein) What is that? a) Combination A1 to Combination A72 in Table 33; b) Combination B1 to Combination B84 in Table 34; c) Combination C1 to Combination C42 in Table 35; d) Combination D1 to combination D36 in Table 36; e) Combination E1 to Combination E30 in Table 37; or f) Combination F1 to Combination F60 in Table 38 Any array of

[0047] Including, for example, consisting of:

[0049] In any of the foregoing aspects and embodiments, each of the gRNA molecules These, along with the Cas9 molecules described herein, are incorporated into ribonucleoprotein complexes (RNPs). is located.

[0050] In some embodiments, the gRNA molecule or composition is formulated in a medium suitable for electroporation. do.

[0051] Each of the gRNA molecules is present in an RNP along with a Cas9 molecule as described herein. In some embodiments, each of the RNP complexes has a concentration of less than about 10 uM, e.g., less than about 3 uM. Less than M, for example, less than about 1 uM, for example, less than about 0.5 uM, for example, less than about 0.3 uM , for example, at a concentration of less than about 0.1 uM.

[0052] In embodiments, the composition comprises a cell, e.g., a population of cells, e.g., an immune effector A cell, e.g., an immune effector cell described herein, e.g., expressing a CAR. Further includes:

[0053] In another aspect, the present invention provides multiple embodiments and implementations of the aforementioned gRNA molecules. Multiple embodiments and compositions of any of the gRNA molecules of the embodiments or the aforementioned compositions are also possible. and encoding (e.g., all) of the components of the composition of any of the multiple embodiments. In some embodiments, the nucleic acid acts on a sequence encoding a gRNA molecule. In some embodiments, the promoter comprises a promoter operably linked to the RNA polymerase. It is a promoter recognized by RNA polymerase II or RNA polymerase III. In this embodiment, the promoter is a U6 promoter or a HI promoter. In some embodiments, the nucleic acid further encodes a Cas9 molecule. The acid may be a promoter, e.g., EF, operably linked to a sequence encoding the Cas9 molecule. -1 promoter, CMV IE gene promoter, EF-1α promoter, ubiquitin containing the phosphoglycerate kinase (PGK) promoter .

[0054] In another aspect, the present invention provides the nucleic acids of the above aspects and embodiments. In some embodiments, the vector comprises a nucleic acid selected from the group consisting of: Antiviral vectors, adenoviral vectors, adeno-associated virus (AAV) vectors -, herpes simplex virus (HSV) vector, plasmid, minicircle, nanoplus and RNA vectors.

[0055] In another aspect, the present invention provides multiple embodiments and multiple implementations of the aforementioned gRNA molecules. A gRNA molecule of any of the embodiments and, for example, a Cas9 molecule described herein and a nucleic acid encoding the

[0056] In another aspect, the present invention provides multiple embodiments and multiple implementations of the aforementioned gRNA molecules. A gRNA molecule of any of the embodiments and, for example, a Cas9 molecule described herein and a nucleic acid encoding the nucleic acid.

[0057] In some embodiments of any of the compositions of the invention, the composition comprises a template nucleic acid In some embodiments, the template nucleic acid further comprises a nucleotide sequence corresponding to the target sequence of the gRNA molecule. In some embodiments, the template nucleic acid comprises nucleotides corresponding to the nucleotides described herein, e.g., In some embodiments, the nucleic acid encoding the chimeric antigen receptor (CAR) is CAR may be (a) a method for preparing a compound according to the present invention, for example, as described in WO 2012 / 079000 or CD19 C described in International Publication No. 2014 / 153270 AR; or (b) e.g., a BCMA CAR described herein, e.g., SEQ ID NO: In some embodiments, the template nucleic acid is a BCMA CAR comprising, for example, The present invention includes nucleic acids encoding the NK inhibitory molecules described herein.

[0058] In another aspect, the present invention provides a method for modifying a target sequence in a cell, e.g., by altering its structure, e.g., sequence a) modifying the cell with multiple embodiments of the gRNA molecule; and gRNA molecules of any of the multiple embodiments, e.g., more than one gRNA molecules, as well as, for example, the Cas9 molecules described herein; b) the gRNA molecules described above. Any of the aspects and embodiments of the gRNA molecule, e.g. , more than one gRNA molecule, as well as, for example, a Cas9 molecule as described herein. c) Nucleic acids encoding the gRNA molecules; and c) aspects and embodiments of the gRNA molecules described above. any of the gRNA molecules, e.g., a nucleic acid encoding more than one gRNA molecule. , as well as, for example, the Cas9 molecules described herein; d) the gRNA molecules described above. The gRNA molecule of any of the aspects and embodiments, e.g., Nucleic acids encoding more than one gRNA molecule, as well as nucleic acids encoding, for example, the C a nucleic acid encoding an as9 molecule; and e) any one of a) to d) above, and a template nucleic acid. f) a nucleic acid comprising any one of the above a) to d) and a sequence encoding a template nucleic acid; g) any combination of the aspects and embodiments of the foregoing compositions. or h) any of the aspects and embodiments of the vectors described above. In some embodiments, the method comprises contacting the vector with: a gRNA molecule or a nucleic acid encoding a gRNA molecule and a Cas9 molecule or a Cas9 molecule In another embodiment, the nucleic acid encoding the gRNA molecule is formulated in a single composition. or a nucleic acid encoding a gRNA molecule and a Cas9 molecule or a nucleic acid encoding a Cas9 molecule The nucleic acid is formulated in more than one composition. In some embodiments, the nucleic acid is formulated in more than one composition. The substances can be delivered simultaneously or sequentially, e.g., simultaneously to the cells described herein. In some embodiments, the cells are animal cells, e.g., mammalian cells. In some embodiments, the cells are immune effector cells. a population of immune effector cells, such as T cells or NK cells, e.g., T cells, for example, CD4+ T cells, CD8+ T cells, or a combination thereof. In embodiments, the cells are capable of expressing, for example, a chimeric antigen receptor (CAR) as described herein. In some embodiments, the gene is engineered or will be engineered to express For example, the cells may comprise a chimeric antigen receptor (CAR) as described herein, or In some embodiments, the cells are selected from the group consisting of, for example, those described herein. The present invention relates to a method for producing a chimeric antigen receptor (CAR) comprising administering to a subject a therapeutic agent, the method ... In embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMA CAR. In some embodiments, the CAR is a CAR selected from the group consisting of SEQ ID NOs: 7883 to 7898. It is a CD19 CAR containing an antigen-binding domain containing any one of the above. In an embodiment, the CAR is a CD19 CAR and is set forth in SEQ ID NOs: 7908 to 7920. In some embodiments, the CAR comprises any one of SEQ ID NO: 7939 to SEQ ID NO: A BCMA CAR containing an antigen-binding domain containing any one of the following: In some embodiments, the CAR is a BCMA CAR and is represented by SEQ ID NO: 8549. Contains any one of sequence numbers 8621, for example, sequence number 8559. In embodiments, the cells are allogeneic with respect to the patient to whom they are administered. In some embodiments, the cells are isolated from a healthy human donor. The cells are autologous with respect to the patient receiving them.

[0059] In another aspect, the present invention provides aspects and embodiments of the aforementioned methods. modified by any of the methods described herein. In another aspect, the present invention provides a cell containing the gRNA molecule. The first gRNA molecule of any of the aspects and embodiments, or the aforementioned composition. The composition of any of the aspects and embodiments of the product, the nucleic acid as described above. The nucleic acid of any of the aspects and embodiments of vectors of any of the aspects and embodiments of the vector In some embodiments, the gRNA molecule, composition, nucleic acid, or vector is provided. In another embodiment, the gRNA molecule, The composition, nucleic acid, or vector is introduced into the cell in vivo. In some embodiments, the cell is an animal cell, e.g., a mammalian, primate, or human cell. In some embodiments, the cells are immune effector cells (e.g., immune effector cells a population of cells), e.g., T cells or NK cells, e.g., T cells, e.g., CD4+ T cells In some embodiments, the cells are, for example, CD8+ T cells, CD8+ T cells, or a combination thereof. For example, a chimeric antigen receptor (CAR) engineered to express the chimeric antigen receptor (CAR) described herein. In embodiments, the cells will be engineered or otherwise manipulated, e.g., as described herein. The invention also includes or will include the chimeric antigen receptors (CARs) described herein. In this embodiment, the cells contain, for example, a chimeric antigen receptor (CAR) as described herein. In some embodiments, the nucleic acid encoding the CAR is (a) a CD19 CAR; or (b) a BCMA CAR. The CAR is an antigen-binding fragment comprising any one of SEQ ID NOs: 7883 to 7898. In some embodiments, the CAR is a CD19 CAR comprising a CD19 fusion domain. CAR and includes any one of SEQ ID NOs: 7908 to 7920. In several embodiments, the CAR is any one of SEQ ID NOs: 7939 to 8112. In some embodiments, the BCMA CAR comprises an antigen-binding domain comprising one or more of the following: R is a BCMA CAR and is any one of SEQ ID NOs: 8549 to 8621. In some embodiments, the cell comprises one of the following: In some embodiments, the cells are allogeneic with respect to the patient to whom they are administered. In embodiments, the cells are isolated from an autologous donor with respect to the patient to whom they are administered. In some embodiments, the cells are transfected with the second gRNA of any one of claims 1 to 60. of the aspects and embodiments of the molecule or the gRNA molecule described above. either comprising, comprising, or comprising a nucleic acid encoding a second gRNA molecule Therefore, the first gRNA molecule and the second gRNA molecule have non-identical targeting sequences. In several embodiments, the first gRNA molecule comprises a gRNA domain for targeting allogeneic T cells. a targeting domain complementary to the target sequence (e.g., a targeting domain described in Tables 1, 3, 4, or 5); a targeting domain (wherein the targeting domain is a targeting domain in the targeting domain), and the second gRNA molecule is an inhibitory molecule, or A targeting sequence complementary to the target sequence of a downstream effector of signal transduction via an inhibitory molecule. a targeting domain (e.g., a targeting domain listed in Table 2 or Table 6) In some embodiments, the inhibitory molecule or the inhibition of signal transduction through the inhibitory molecule Downstream effectors include CD274, HAVCR2, LAG3, PDCD1, and PD-L2 , CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD16 0, 2B4, CD80, CD86, B7-H3(CD113), B7-H4(VTCN1 ), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGF-beta, or PTPN1 In some embodiments, the first gRNA molecule is selected from the group consisting of TRAC, TRBC1, TRB Targets complementary to the target sequences of C2, CD247, CD3D, CD3E, or CD3G The second gRNA molecule contains a targeting domain complementary to the target sequence of NLRC5. For example, any of SEQ ID NOs: 8622 to 10089, including a binding domain. and a targeting domain comprising (e.g., consisting of) one of: In this embodiment, the first gRNA molecule is selected from the group consisting of TRAC, TRBC1, TRBC2, CD247, and CD47. a targeting domain complementary to a target sequence of CD3D, CD3E, or CD3G; The second gRNA molecule binds to the target sequence of B2M, HLA-A, HLA-B, or HLA-C. In some embodiments, the cells contain a complementary targeting domain. The third gRNA of any of the aspects and embodiments of the molecule of the aspects and embodiments of the molecule or the gRNA molecule described above. further comprising, or comprising, a nucleic acid encoding a third gRNA molecule, will include a first gRNA molecule, a second gRNA molecule, and a third gRNA molecule In some embodiments, the third gRNA comprises a non-identical targeting domain. The molecule may be CIITA, RFXANK, RFX5, or RFXAP, e.g., CIITA 7717 to 7720, which comprise a targeting domain complementary to a target sequence of Targeting domains including, for example, any one of the following: For example, SEQ ID NO: 7769, SEQ ID NO: 7771, or SEQ ID NO: 7785. A targeting domain that includes, for example, consists of, any one of the following: In embodiments, the cell comprises three gRNA molecules, the first gRNA molecule encoding the TRAC The second gRNA molecule contains a targeting domain complementary to the target sequence; the third gRNA molecule contains a targeting domain complementary to the target sequence of CIITA; In some embodiments, the cells comprise a targeting domain complementary to the target sequence. The first gRNA molecule is a target complementary to the target sequence of TRAC. the second gRNA molecule contains a targeting domain complementary to the target sequence of NLRC5; the third gRNA molecule contains a targeting domain complementary to the target sequence of CIITA; In some embodiments, the cell comprises two gRNA molecules, The first gRNA molecule targets TRAC, TRBC1, TRBC2, CD247, CD3D, C a targeting domain complementary to the target sequence of D3E or CD3G, and a second g The RNA molecule is complementary to the target sequence of NR3C1, DCK, CD52, or FKBP1A. Includes targeting domains.

[0060] Cells containing gRNA molecules (e.g., one or more gRNA molecules as described herein) In some embodiments of the cells, (1) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from SEQ ID NOs: 1 to 83 and SEQ ID NOs: 5492 to 5494. or comprising a targeting domain selected from the group consisting of sequence number 5527; (2) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345. whether it contains targeting domains that may be used; (3) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698 whether it contains targeting domains that will be used; (4) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068 whether it contains targeting domains that will be used; (5) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941. whether it contains targeting domains that will be used; (6) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491. whether it contains targeting domains that will be used; (7) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324. whether it contains targeting domains that will be used; (8) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583. whether it contains targeting domains that will be used; (9) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: Nos. 5966 to 6097. The second guide RNA molecule is selected from SEQ ID NOs: 1 to 83 and SEQ ID NOs: 5492 to 5494. or comprising a targeting domain selected from the group consisting of sequence number 5527; (10) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345. whether it contains targeting domains that will be used; (11) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698. Contains targeting domains that may be selected; (12) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068. Contains targeting domains that may be selected; (13) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941. Contains targeting domains that may be selected; (14) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491. Contains targeting domains that may be selected; (15) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324. Contains targeting domains that may be selected; (16) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583. Contains targeting domains that may be selected; (17) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. The second guide RNA molecule is SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5527; (18) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345. whether it contains targeting domains that will be used; (19) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698. Contains targeting domains that may be selected; (20) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068. Contains targeting domains that may be selected; (21) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941. Contains targeting domains that may be selected; (22) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491. Contains targeting domains that may be selected; (23) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324. Contains targeting domains that may be selected; (24) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583. Contains targeting domains that may be selected; (25) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2. 83, and a target selected from the group consisting of SEQ ID NOs: 5492 to 5527 whether it contains a ng domain; (26) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 970. or comprises a targeting domain selected from the group consisting of: 1345; (27) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 1346 to SEQ ID NO: 1347. or comprising a targeting domain selected from the group consisting of sequence number 1698; (28) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 1699 to SEQ ID NO: 1700. or comprising a targeting domain selected from the group consisting of sequence number 2068; (29) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 2069 to SEQ ID NO: 2070. or comprising a targeting domain selected from the group consisting of column number 2941; (30) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 5278 to SEQ ID NO: 5279. or comprising a targeting domain selected from the group consisting of column number 5491; (31) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 6227 to SEQ ID NO: 6228. or comprising a targeting domain selected from the group consisting of sequence number 6324; (32) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 6325 to SEQ ID NO: 6326. or comprising a targeting domain selected from the group consisting of sequence number 6583; (33) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. The second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2. SEQ ID NO: 83, and a target selected from the group consisting of SEQ ID NO: 5492 to SEQ ID NO: 5527 whether it contains a ing domain; (34) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 969 to 970. or comprising a targeting domain selected from the group consisting of column number 1345; (35) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1346 to 1348. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 1698; (36) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1699 to 1699. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2068; (37) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2069 to 2070. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2941; (38) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 5278 to 5280. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5491; (39) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6227 to 6229. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 6324; (40) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6325 to 6327. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 6583; (41) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. The second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2. SEQ ID NO: 83, and a target selected from the group consisting of SEQ ID NO: 5492 to SEQ ID NO: 5527 whether it contains a ing domain; (42) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 969 to 970. or comprising a targeting domain selected from the group consisting of column number 1345; (43) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1346 to 1348. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 1698; (44) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1699 to 1699. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2068; (45) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2069 to 2070. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2941; (46) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 5278 to 5280. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5491; (47) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6227 to 6229. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 6324; (48) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6325 to 6327. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 6583; (49) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. The second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2. SEQ ID NO: 83, and a target selected from the group consisting of SEQ ID NO: 5492 to SEQ ID NO: 5527 whether it contains a ing domain; (50) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 969 to 970. or comprising a targeting domain selected from the group consisting of column number 1345; (51) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1346 to 1348. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 1698; (52) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1699 to 1699. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2068; (53) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2069 to 2070. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 2941; (54) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 5278 to 5280. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5491; (55) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6227 to 6229. comprising a targeting domain selected from the group consisting of SEQ ID NO: 6324; or (56) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 6325 to 6327. comprising a targeting domain selected from the group consisting of SEQ ID NO: 6583.

[0061] A plurality of cells, including any of the aspects and embodiments of the cells described above. In this embodiment, the cell is a cell that expresses an inhibitory molecule or a signal transduction pathway downstream of the inhibitory molecule. A third gRNA molecule containing a targeting domain complementary to the target sequence of the effector is inserted. Further included are inhibitory molecules or downstream effectors of signal transduction via inhibitory molecules. CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CE ACAMs (e.g., CEACAM-1, CEACAM-3, and / or CEACAM -5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD8 0, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TN FRSF14 or CD107), KIR, A2aR, MHC class I, MHC class I I, GAL9, adenosine, and TGF beta, or PTPN11, e.g., The third gRNA molecule contains one of the targeting domains 15(a) to 15(e). Including Inn.

[0062] Cells containing gRNA molecules (e.g., one or more gRNA molecules as described herein) In some embodiments of the cells, (1) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270. whether it contains targeting domains that will be used; (2) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541. whether it contains targeting domains that will be used; (3) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032. whether it contains targeting domains that will be used; (4) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5 or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 720 to 5815; (5) The first gRNA molecule is selected from SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: SEQ ID NO: 5816 to SEQ ID NO: 5965. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277 whether it contains targeting domains that will be used; (6) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: Nos. 5966 to 6097. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270. whether it contains targeting domains that will be used; (7) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: Nos. 5966 to 6097. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541. whether it contains targeting domains that will be used; (8) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: Nos. 5966 to 6097. The second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032. whether it contains targeting domains that will be used; (9) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: Nos. 5966 to 6097. The second guide RNA molecule is SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5 or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 720 to 5815; (10) The first gRNA molecule is selected from SEQ ID NOs: 5624 to 5643, or the sequence SEQ ID NO: 5966 to SEQ ID NO: 6097. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277. Contains targeting domains that may be selected; (11) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270. Contains targeting domains that may be selected; (12) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541. Contains targeting domains that may be selected; (13) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032. Contains targeting domains that may be selected; (14) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. The second guide RNA molecule is SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5720 to 5815. ; (15) The first gRNA molecule is selected from SEQ ID NOs: 5644 to 5719, or the sequence SEQ ID NO: 6098 to SEQ ID NO: 6226. and the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277. Contains targeting domains that may be selected; (16) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 2942 to SEQ ID NO: 2943. or comprising a targeting domain selected from the group consisting of sequence number 3270; (17) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 3271 to SEQ ID NO: 3272. or comprising a targeting domain selected from the group consisting of sequence number 3541; (18) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 3542 to SEQ ID NO: 3543. or comprising a targeting domain selected from the group consisting of sequence number 4032; (19) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 4033 to SEQ ID NO: 4034. Sequence No. 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815 Does it include a targeting domain? (20) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392. and the second guide RNA molecule comprises a targeting domain comprising SEQ ID NO: 4590 to SEQ ID NO: 4600. or comprising a targeting domain selected from the group consisting of sequence number 5277; (21) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2942 to 2946. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3270; (22) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3271 to 3276. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3541; (23) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3542 to 3546. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 4032; (24) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4033 to 4039. SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815 whether it contains targeting domains; (25) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4590 to 4599. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5277; (26) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2942 to 2946. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3270; (27) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3271 to 3276. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3541; (28) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3542 to 3546. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 4032; (29) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4033 to 4039. SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815 whether it contains targeting domains; (30) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4590 to 4599. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 5277; (31) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 2942 to 2946. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3270; (32) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3271 to 3276. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 3541; (33) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 3542 to 3546. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 4032; (34) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4033 to 4039. SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815 or (35) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 4590 to 4599. The targeting domain is selected from the group consisting of SEQ ID NO: 5277.

[0063] In some embodiments of the cell, the targeting domain of the first gRNA molecule and , the targeting domain of the second gRNA molecule and, if present, the third gRNA molecule The targeting domain is g) Combination A1 to Combination A72 in Table 33; h) Combination B1 to Combination B84 in Table 34; i) Combinations C1 to C42 in Table 35; j) Combination D1 to Combination D36 in Table 36; k) Combination E1 to Combination E30 of Table 37; or l) Combination F1 to Combination F60 in Table 38 Any array of

[0047] Including, for example, consisting of:

[0064] In some embodiments for cells, the first gRNA molecule is selected from the group consisting of SEQ ID NO: 5569, the sequence 5592, or SEQ ID NO: 5586, and a second g The RNA molecule comprises a targeting domain comprising SEQ ID NO:5775.

[0065] In any of the aspects and embodiments of the aforementioned cell, a first a gene containing a target sequence complementary to the targeting domain of the gRNA molecule, and optionally In the selection, a gene containing a target sequence complementary to the targeting domain of the second gRNA molecule and / or a target sequence complementary to the targeting domain of the third gRNA molecule. The gene containing the target sequence complementary to the targeting domain of the first gRNA molecule is selected from the group consisting of: gene and, optionally, a targeting molecule complementary to the targeting domain of the second gRNA molecule. The functional product of the gene containing the target sequence, and / or the targeting sequence of the third gRNA molecule. reduce the expression of a functional product of a gene containing a target sequence complementary to the target domain, or It has been changed to make it disappear.

[0066] In another aspect, the present invention provides a method of generating anti-tumor immunity in a subject, comprising administering to the subject a and an effective amount of the cells described herein, e.g., multiple aspects and and administering the cells of any of the embodiments.

[0067] In another aspect, the present invention provides a method of treating cancer in a subject, comprising administering to the subject an effective Amounts of the cells described herein, e.g., multiple aspects and multiple The present invention provides a method comprising administering the cells of any of several embodiments.

[0068] In another aspect, the present invention provides a method for treating diseases associated with tumor antigen expression, such as proliferative diseases, Treating subjects with cancerous conditions, cancer, and non-cancer-related indications associated with tumor antigen expression The method includes administering to a subject an effective amount of a cell described herein, e.g., a cell described above. The steps of administering the cells of any of the aspects and embodiments of the cells. In some embodiments, the disease associated with tumor antigen expression is In some embodiments, the disease is colon cancer, rectal cancer, Renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, Skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer Hilar cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue cancer Oliosarcoma, urethral cancer, penile cancer, childhood solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, Central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brainstem Glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environment The cancer is selected from an inducible cancer, a combination of said cancers, and a metastatic lesion of said cancer. In some embodiments, the cancer is chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphocytic leukemia, or lymphocytic leukemia (ALL), B-cell acute lymphocytic leukemia (B-ALL), and T-cell acute lymphocytic leukemia (ALL). lymphocytic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML) ), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, Diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell Follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma , marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's lymphoma Hematologic malignancies selected from the group consisting of leukemia, leukemia, and preleukemia. be.

[0069] In some embodiments of any of the foregoing methods, the method further comprises administering to a subject a chemotherapeutic agent, For example, cyclophosphamide, fludarabine, or cyclophosphamide and fludarabine In some embodiments of the method, the method further comprises administering the vial. and administering to the subject an effective amount of a plurality of the cells described herein, e.g., the aforementioned cells. Prior to administering the cells of any of the aspects and embodiments, lymphocytes Administering a depleting or immunosuppressive agent.

[0070] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy. (a) for example, any of gRNA molecules 2b to 2h (as described herein) (e.g., more than one gRNA molecule, e.g., claims 3, 4, 5, 10, 11) or 12 gRNA molecules, e.g., more than one gRNA molecule, in the cells By introducing it into the body, we can reduce the expression of components of the T cell receptor (TCR) or (b) modifying the cells by, for example, 2a, 2i, 2j ... j, or 2k gRNA molecules (as described herein), e.g., 1 More than one gRNA molecule, e.g., the gRNA molecule of any of claims 6 or 7, e.g. By introducing more than one gRNA molecule into the cells, HLA (e.g., reduce expression of HLA-A, HLA-B, and / or HLA-C) or B2M (c) modifying the cells by causing them to grow or disappear; In some embodiments, the method comprises, for example, (as described herein), e.g., 2p, more than one gRNA molecule, e.g., The gRNA molecule of any of paragraphs 8 or 9, e.g., more than one gRNA molecule, is added to the cell. By introducing it into cells, the expression of CIITA was reduced or eliminated. The method further comprises the step of modifying the cells by expanding the cells. The modifying step is optionally performed before.

[0071] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy. (a) for example, any of gRNA molecules 2b to 2h (as described herein) (e.g., more than one gRNA molecule, e.g., claims 3, 4, 5, 10, 11) or 12 any gRNA molecules (as described herein), e.g., more than one By introducing gRNA molecules into the cells, components of the T cell receptor (TCR) are expressed. modifying the cells by reducing or eliminating expression of the gene; ) For example, any of the 21, 2m, 2n, or 2o gRNA molecules (referred to herein as described herein), e.g., more than one gRNA molecule (described herein), e.g., The gRNA molecule of claim 13 (as described herein), e.g., more than one gRNA molecule. By introducing a gene into the cells, the expression of the target of an immunosuppressant drug is reduced, or (c) modifying the cells by causing them to disappear; and

[0072]

[0013] In some embodiments of any of the aforementioned methods of preparing cells, the method further comprises: (d) e.g., a gRNA molecule of claim 14 or 15 (as described herein), e.g. , by introducing more than one gRNA molecule into the cell, or reducing the expression of downstream effectors of signal transduction via inhibitory molecules, The method further comprises modifying the cells by increasing or decreasing the number of cells, wherein the cells The step of modifying is optionally carried out before the step of expanding.

[0073] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy. (a) e.g., a gRNA molecule of claim 14 (as described herein), e.g. , more than one gRNA molecule, for example the gRNA molecule of any of claims 15 to 17; For example, by introducing more than one gRNA molecule into the cell, a first inhibition Reduces the expression of downstream effectors of signal transduction via agonistic or inhibitory molecules (c) modifying the cells by increasing or decreasing the number of cells; and

[0074]

[0013] In some embodiments of any of the aforementioned methods of preparing cells, the method further comprises: (e) For example, a gRNA molecule of claim 14 or 15, e.g., more than one gRNA molecule. The second inhibitory molecule or the inhibitory molecule-mediated by reducing or eliminating the expression of downstream effectors of signaling and further comprising modifying the cell, wherein the first inhibitory molecule, or downstream effectors of signaling through the receptor and a second inhibitory molecule, or It is distinct from downstream effectors of signal transduction via .

[0075] In some embodiments of any of the aforementioned methods of preparing cells, a gRNA The introduction of each of the molecules is simultaneous or sequential. In some embodiments, the introduction of the gRNA molecules Each introduction is sequential and lasts for at least 24 hours, 2 days, 3 days, 4 days, 5 days, They can be spaced 6, 7, 8, 9, or 10 days apart.

[0076]

[0013] In some embodiments of any of the aforementioned methods of preparing cells, the method further comprises: into the cell, e.g., by introducing a nucleic acid encoding a chimeric antigen receptor (CAR) as described herein. In some embodiments, the nucleic acid encoding the CAR is further comprised of: In some embodiments, the nucleic acid encoding the CAR is placed on a template nucleic acid. In some embodiments, the nucleic acid encoding the CAR is placed on a lentiviral vector. Place it on the monitor.

[0077]

[0013] In some embodiments of any of the aforementioned methods of preparing cells, the method further comprises: Further comprising isolating cells that are negative for expression of the TCR. In the method, the isolating step comprises isolating more than about 75%, for example, about 80%, of the cells. 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 9 Results show that >9% or >99.5% of cell populations are negative for TCR expression. In some embodiments, cells that are negative for expression of TCR are isolated. The step comprises treating the cell population with antibodies specific to components of the T cell receptor (TCR), optionally optionally, contacting the composition with a solid support or a detectable label; and In some embodiments, the cells are isolated from the immune system. The vector cell is, for example, a T cell or an NK cell, for example, a T cell. In this case, the cells are allogeneic to the subject to whom they are administered, e.g., the cells are administered to a healthy The cells are isolated from a donor, for example, a donor not suffering from a condition associated with expression of a tumor antigen. In some embodiments, the cells are autologous to the subject to whom they are administered. In some embodiments of any of the foregoing methods, steps (a) and / or Or (b) is performed ex vivo. In some embodiments, step (c) is performed by: In some embodiments, the expansion in step (c) is performed ex vivo. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days Crossing, or 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 3-1 0, 2-9, 3-9, 2-8, 3-8, 2-7, 3-7, 2-6, 3-6, 2-5, if The test is usually carried out over 3 to 5 days.

[0078] In some embodiments of any of the aforementioned methods of preparing cells, a gRNA The molecule may be a gRNA molecule as described herein, and may be a gRNA molecule (e.g., used in combination with The targeting domains of each of the above (used in the present invention) are listed in Table 33, Table 34, Table 35, Table 36, and Table 3 7 or any of the combinations listed in Table 38, e.g., In some embodiments, the targeting domain of each of the gRNA molecules comprises: a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A 8, combination A37~A40, or combination A41~A44; b) Combination B1 to Combination B84 in Table 34; c) Combination C1 to Combination C42 in Table 35; d) Combinations D1 to D36 in Table 36, for example, combination D2, combination D4, combination D 20, or combination D22; e) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E 8, or combination E10; or f) Combinations F1 to F60 in Table 38, for example, combinations F1 to F4, combinations F5 to F 8. Any of the combinations F13 to F16 or F17 to F20 Any array of

[0047] Including, for example, consisting of:

[0079] In another aspect, the present invention provides a method of treating a subject in need thereof, comprising administering to a subject a therapeutically effective amount of the compound described herein. The method for preparing the cells described, e.g., the aforementioned multiple methods for preparing the cells Cells prepared by the method of any of the aspects and embodiments (e.g., cells In some embodiments, particularly in the case of immunosuppressants, methods are provided that include administering a In some embodiments, the method comprises administering to a subject a gRNA molecule that binds to a target sequence of a target. an agent, e.g., rapamycin, a rapalog, or an mTor inhibitor, e.g., RAD001; In some embodiments, the subject further comprises administering to the subject a tumor antigen associated with expression of the tumor antigen. diseases associated with the expression of tumor antigens, such as proliferative disorders, precancerous conditions, cancers, and non-cancerous conditions associated with the expression of tumor antigens. and cancer-related indications, where the administration treats a disease associated with expression of the tumor antigen. In some embodiments, the disease associated with tumor antigen expression is cancer or a non-cancer-related disease. In some embodiments, the disease is colon cancer, rectal cancer, renal cell carcinoma, liver cancer, or the like. , non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, and head and neck cancer melanoma, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal region cancer, stomach cancer , testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's disease lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, Penile cancer, childhood solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) ) Neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brainstem glioma, pituitary gland tumors, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, In some embodiments, the cancer is selected from the group consisting of a combination of the above cancers, and metastatic lesions of said cancers. The cancer is chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphocytic leukemia (AL) L), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T- ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocyte Myeloid leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large cell type B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma , malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, Multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macrophage The blood cancer is selected from the group consisting of leukemia, leukemia, and preleukemia.

[0080] In another aspect, the present invention provides a method of treating a patient suffering from a disease, comprising: (a) providing a cell population derived from an allogeneic donor; (b) CD247, CD3D, CD3E, CD3G, TRAC, and TRBC1 and a targeting domain complementary to a target sequence in a gene selected from TRBC2. a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a C RISPR systems (e.g., S. pyogenes Cas9-based CRISPR systems) and introducing (c) optionally, selecting cells that have reduced or eliminated expression of a functional TCR; and (d) transducing the cell with a nucleic acid encoding a CAR; (e) administering the cells to a patient in need thereof, e.g., a patient with a CAR that expresses an antigen recognized by the CAR. administering the compound to a patient having a related disease; In some embodiments, the method comprises: G, the first gRNA molecule against TRAC, TRBC1, or TRBC2 is For example, the gRNA molecule of any one of claims 3, 4, 5, 10, Either 11 or 12 gRNA molecules.

[0081] In some embodiments, the method of treating a patient suffering from a disease includes administering to a cell a B2M, H A target sequence complementary to a target sequence in a gene selected from HLA-A, HLA-B, or HLA-C. a second gRNA molecule (or a gene encoding the gRNA molecule) containing a targeting domain; CRISPR systems (e.g., S. pyogenes Cas9) containing nucleic acids In some embodiments, the method further comprises introducing a CRISPR system (including B2M, H The second gRNA for HLA-A, HLA-B, or HLA-C is 2(a) or 2(b). (i) to 2(k), for example, a gRNA molecule of claim 6 or 7. In some embodiments, the method comprises transfecting a CIITA, a gRNA molecule, or a nucleotide sequence into a cell. RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, H A target complementary to a target sequence in a gene selected from HLA-DQ and HLA-DP a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a binding domain; ), including CRISPR systems (e.g., S. pyogenes Cas9-mediated CRISPR) In some embodiments, the method further comprises introducing a third gRNA molecule (an ISPR system). The molecule is any of the gRNA molecules in 2(a) or 2(i) to 2(k), e.g., For example, the gRNA molecule of claim 6 or 7.

[0082] In another embodiment, the method of treating a patient suffering from a disease comprises administering to a cell a DCK, a CD 52, FKBP1A, or NR3C1. a second gRNA molecule (or a gene encoding the gRNA molecule) containing a targeting domain; CRISPR systems (e.g., S. pyogenes Cas9) containing nucleic acids In some embodiments, the method further comprises introducing a CRISPR system (including DCK, C The second gRNA molecule against D52, FKBP1A, or NR3C1 is 2(l) to 2(l). (o) is any of the second gRNA molecules, for example, the second gRNA of claim 13 The second gRNA is directed against DCK, and the method is In some embodiments, the method further comprises administering an analog-based drug to the patient. For example, the nucleoside analogue-based drug is cytarabine or gemcitabine. The second gRNA is directed against CD52, and the method comprises administering an anti-CD52 antibody or In some embodiments, the method further comprises administering to the patient an antigen-binding fragment: For example, the anti-CD52 antibody or antigen-binding fragment thereof is alemtuzumab (CAMPATH In some embodiments, the second gRNA is directed against FKBP1A. The method includes administering FK506, cyclosporine, rapamycin or a rapalog, or RAD0 The method further comprises administering to the patient an mTor inhibitor, such as 01. the NA is directed against NR3C1, and the method comprises administering a corticosteroid to said patient. In embodiments further comprising administering, for example, the corticosteroid Dexamethasone.

[0083] Multiple implementations of any of the methods of treating patients suffering from the aforementioned diseases. In the form, the gRNA molecule is a gRNA molecule described herein, and the gRNA molecule ( For example, the targeting domains of each of the above (used in combination) are listed in Table 33, Table 34, Table 35, 35, Table 36, Table 37 or Table 38, For example, the targeting domain of each of the gRNA molecules consists of: The inn is a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A 8, combination A37~A40, or combination A41~A44; b) Combination B1 to Combination B84 in Table 34; c) Combination C1 to Combination C42 in Table 35; d) Combinations D1 to D36 in Table 36, for example, combination D2, combination D4, combination D 20, or combination D22; e) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E 8, or combination E10; or f) Combinations F1 to F60 in Table 38, for example, combinations F1 to F4, combinations F5 to F 8. Any of the combinations F13 to F16 or F17 to F20 Any array of

[0047] Including, for example, consisting of:

[0084] Multiple implementations of any of the methods of treating patients suffering from the aforementioned diseases. In one embodiment, the method comprises transfecting cells with a plurality of markers, including CD274, HAVCR2, LAG3, PDCD1, and PD -L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, C D160, 2B4, CD80, CD86, B7-H3(CD113), B7-H4(VT CN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC Class I, MHC class II, GAL9, adenosine, and TGF-beta, or PT PN11, comprising a targeting domain complementary to a target sequence in a gene selected from CRISPR comprising a fourth gRNA molecule (or a nucleic acid encoding said gRNA molecule). Introducing a system (e.g., S. pyogenes Cas9-based CRISPR system) For example, the fourth gRNA molecule may be a gRNA molecule encoding CD274, HAVCR2, L against AG3, PDCD1, or PTPN11, e.g., 15(a) to (e). Any of the gRNA molecules, for example, any of the gRNA molecules of claims 16 to 17. is.

[0085] In another aspect, the present invention provides a method of treating a patient suffering from a disease, comprising: (a) providing a cell population (as described herein), e.g., immune effector cells; Steps and; (b) CD247, CD3D, CD3E, CD3G, TRAC, and TRB into cell populations. C1, and TRBC2. a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a domain , CRISPR systems (e.g., S. pyogenes Cas9-mediated CRISPR) introducing a system; (c) Immunoglobulins selected from B2M, HLA-A, HLA-B, and HLA-C into a cell population. a second gRNA molecule containing a targeting domain complementary to a target sequence within the gene to be transfected; (or a nucleic acid encoding the gRNA molecule). Introducing S. pyogenes Cas9-based CRISPR system; (d) optionally a functional TCR, a functional B2M, or a functional TCR and B2M; Selecting cells that have reduced or eliminated expression of both; (d) introducing into the cell population a nucleic acid encoding a CAR; (e) administering the cell population to a patient in need thereof, e.g., a patient expressing an antigen recognized by the CAR. administering the compound to a patient having a disease associated with the present invention; In some embodiments of the method, the method further comprises: (f) administering to the cell population and in genes selected from CIITA, RFXANK, RFX5, and RFXAP. A third gRNA molecule (or the gRNA molecule) containing a targeting domain complementary to the target sequence. CRISPR systems (e.g., S. pyogenes) that contain nucleic acids encoding RNA molecules The method further includes the step of introducing Cas9-mediated CRISPR genes. In some embodiments, the first gRNA molecule may be, for example, a TRAC or TRBC as described herein. 1, and TRBC2, e.g., a gene selected from the group consisting of a gene complementary to a target sequence within TRAC and a targeting domain, e.g., SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: No. 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 559 4, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: No. 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 56 08, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620. targeting domains, e.g., SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 558 7, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586 Targeting domains, e.g., SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 592. In embodiments, the first gRNA molecule encodes, for example, CD3E, CD3 G, and a targeting domain complementary to a target sequence in a gene selected from CD3D. In some embodiments, the second gRNA molecule comprises, for example, a gRNA molecule described herein. B2M gene, for example, SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 549 9, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: No. 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 55 17, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, A target selected from sequence number 5508, sequence number 5514, and sequence number 5492 ing domains, e.g., SEQ ID NO: 5496, SEQ ID NO: 5498, and SEQ ID NO: 5509 In the B2M gene, the targeting domain comprises (e.g., consists of) a targeting domain selected from In some embodiments, the third gR comprises a targeting domain complementary to the target sequence of The NA molecule can be, for example, a CIITA gene described herein, e.g., SEQ ID NO: No. 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 775 8, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID NO: No. 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 77 72, SEQ ID NO: 7743, or SEQ ID NO: 7750. SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785. A CII comprising (e.g., consisting of) a targeting domain selected from It contains a targeting domain that is complementary to a target sequence within the TA gene. The targeting domain of each of the gRNA molecules (e.g., used in combination) The present invention relates to a method for preparing a nucleic acid sequence comprising the sequences of any of the combinations listed in Table 33, Table 34, or Table 38, e.g., In some embodiments, the targeting domain of each of the gRNA molecules comprises teeth, a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A 8, combination A37~A40, or combination A41~A44; b) Combinations B1 to B84 of Table 34; or c) Combinations F1 to F60 in Table 38, for example, combinations F1 to F4, combinations F5 to F 8. Any of the combinations F13 to F16 or F17 to F20 Any array of

[0047] Including, for example, consisting of:

[0086] In some embodiments of the method of treating a patient suffering from a disease, the method comprises: a nucleic acid molecule (e.g., as described herein) encoding an NK inhibitory molecule, such as For example, a nucleic acid molecule encoding an HLA-G:B2M fusion, e.g., SEQ ID NO: 10674, The method further comprises the step of introducing a nucleic acid molecule encoding the target gene into a patient suffering from a disease. In some embodiments of the method, the cell (or cell population) is an immune effector cell ( or a population of immune effector cells), e.g., a T cell (or a population of T cells). In some embodiments, the cells (or cell populations) are allogeneic to the patient, e.g., In other embodiments, the cells (or cell populations) are isolated from a patient. In some embodiments, the CAR is autologous to the CD19 CAR (e.g., (described in the detailed description), for example, any one of SEQ ID NOs: 7883 to 7898 In another embodiment, the CAR is a CD19 CAR comprising an antigen-binding domain comprising one or more of: For example, SEQ ID NO: 7939 to SEQ ID NO: 8112, or SEQ ID NO: 8155 to SEQ ID NO: 8166, or a BCMA CAR comprising an antigen recognition domain comprising any one of For example, SEQ ID NO: 7949, for example, SEQ ID NO: 8549 Any one of SEQ ID NO: 8621, for example, SEQ ID NO: 8559, e.g. For example, it includes an antigen recognition domain consisting of this.

[0087] In another aspect, the present invention provides a method for producing a modified T cell that has a) T cell receptor component that is different from an unmodified cell of the same type. b) B2M; and / or c) reduced or eliminated expression of CIITA. In some embodiments, the modified cells are TCR alpha. In another embodiment, the TCR is a TCR beta chain, e.g., a TCR alpha chain. is CD3 delta, CD3 epsilon, or CD3 gamma, e.g., In several embodiments, the engineered cells (or cell populations) are T cells Reducing or eliminating the expression of receptor components, B2M, and CIITA There are.

[0088] In another aspect, the present invention provides a method for producing a modified T cell that has a) T cell receptor component that is different from an unmodified cell of the same type. a) a gene encoding a nucleotide; b) B2M; and / or c) CIITA; or In this vicinity, modified sequences containing insertions or deletions of base pairs, for example, more than one base pair, are In embodiments, each of the insertions or deletions is an indel. In several embodiments, each of the insertions or deletions is a frameshift mutation. In this embodiment, the engineered cell (or cell population) contains genes encoding components of a T cell receptor. In or near the genes, B2M, and CIITA, base pairs, e.g. For example, it includes an insertion or deletion of more than one base pair.

[0089] In another aspect, the present invention provides multiple aspects and methods for the aforementioned cells (e.g., modified cells). and the modified cells of any of the embodiments, wherein at least about 30% of the cells and wherein at least one of the insertions or deletions is a frame that is measured, for example, by NGS. A population of cells is provided that is a shift mutation.

[0090] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (a) a nucleic acid sequence encoding a CAR, for example, as described herein; (b) optionally, a nucleic acid sequence encoding, for example, an NK inhibitory molecule described herein; HLA-G or HLA-G:B2M fusions, as described herein, Nucleic acids that do (c) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3E, C D3D, or CD3G, e.g., TRAC) or a gene encoding a regulatory element thereof Indels in or near the sequence of a gene, such as components of the TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; (d) in or on the sequence of the gene encoding B2M or its regulatory elements Indels in the vicinity, e.g., including the targeting domain for B2M, e.g., In the target sequence of the gRNA, which contains a targeting domain listed in Table 1 or Table 3 indels at or near this site; (e) optionally, a sequence of a gene encoding CIITA or a regulatory element thereof; Indels in or near this region, e.g., targeted to CIITA a targeting domain, e.g., a targeting domain listed in Table 1 or Table 6c; indels in or near the target sequence of the gRNA; and (f) optionally, the sequence of a gene encoding LILRB1 or a regulatory element thereof; Indels in or near LILRB1, e.g., targeting LILRB1 gRNs containing a targeting domain, e.g., a targeting domain listed in Table 6d. Indels in or near the target sequence of A A cell comprising: The cell (or a cell population comprising said cell) is co-transfected with a CAR and, optionally, an NK inhibitory molecule. and i) expressing TCR components (e.g., TRAC, TRBC1, TRBC2, CD3 D, CD3E, or CD3G, e.g., TRAC), ii) B2M, iii) CIIT A, and / or iv) the expression and / or function of one or more of LILRB1 exhibiting a reduction or elimination of Providing a cell (e.g., a cell comprising these, e.g., a cell population comprising more than one cell) In some embodiments, components of the TCR, B2M, and gRN for CIITA. The targeting domain sequence of the A molecule (described herein) is shown in Table 33, Table 34 or is any combination listed in Table 38, for example: a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A 8, combination A37~A40, or combination A41~A44; b) Combinations B1 to B84 of Table 34; or c) Combinations F1 to F60 in Table 38, for example, combinations F1 to F4, combinations F5 to F 8. Any of the combinations F13 to F16 or F17 to F20 The targeting domains may comprise, for example consist of, any of the targeting domains listed in

[0091] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (a) a nucleic acid sequence encoding a CAR, for example, as described herein; (b) optionally, a nucleic acid sequence encoding, for example, an NK inhibitory molecule described herein; a nucleic acid encoding a sequence, e.g., HLA-G, as described herein; (c) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a regulatory element thereof (e.g., TRAC) Indels in or near the sequence of a gene, such as components of the TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; (d) in the sequence of a gene encoding NLRC5 or its regulatory element or Indels in this vicinity, e.g., containing the targeting domain for NLRC5 In the target sequence of the gRNA, for example, containing the targeting domains listed in Table 1 indels at or near this site; (e) optionally, a sequence of a gene encoding CIITA or a regulatory element thereof; Indels in or near this region, e.g., targeted to CIITA a targeting domain, e.g., a targeting domain listed in Table 1 or Table 6c; indels in or near the target sequence of the gRNA; and (f) optionally, the sequence of a gene encoding LILRB1 or a regulatory element thereof; Indels in or near LILRB1, e.g., targeting LILRB1 gRNs containing a targeting domain, e.g., a targeting domain listed in Table 6d. Indels in or near the target sequence of A A cell comprising: The cell (or a cell population comprising one or more of said cells) is co-transfected with a CAR and optionally selectively expressing NK inhibitory molecules and i) components of the TCR (e.g., TRAC, TRBC) 1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), ii) B 2M, iii) NLRC5, and / or iv) LILRB1 exhibiting reduced or absent expression and / or function, Providing a cell (e.g., a cell comprising these, e.g., a cell population comprising more than one cell) do.

[0092] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (a) a nucleic acid sequence encoding a CAR, for example, as described herein; (b) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a regulatory element thereof (e.g., TRAC) Indels in or near the sequence of a gene, such as components of the TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; and (c) in the sequence of the gene encoding FKBP1A or its regulatory elements; Indels in this vicinity, e.g., targeting domains for FKBP1A, a gRNA comprising, for example, a targeting domain listed in Table 1 or Table 6b Indels in or near the target sequence of A cell comprising: The cell (or a cell comprising the cell, e.g., a cell population comprising more than one cell) is a CA R, and i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD 3D, CD3E, or CD3G, e.g., TRAC), and / or ii) FKBP exhibiting a reduction or elimination of expression and / or function of one or more of 12 Providing a cell (e.g., a cell comprising these, e.g., a cell population comprising more than one cell) In some embodiments, gRNA molecules against TCR components and FKBP1A ( The targeting domain sequence of any of the nucleotides in Table 35, Table 36, or Table 37 (as described herein) may be any of the nucleotides in Table 35, Table 36, or Table 37. Any combination listed in a) Combinations C1 to C42 in Table 35; b) Combinations D1 to D36 in Table 36, for example, combination D2, combination D4, combination D 20, or combination D22; or c) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E 8, or combination E10 The targeting domains may comprise, for example consist of, any of the targeting domains listed in

[0093] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (a) a nucleic acid sequence encoding a CAR, for example, as described herein; (b) a nucleic acid sequence encoding, for example, a rapamycin-resistant mTor as described herein For example, encoding mTor containing an S2035 mutation, e.g., an S2035I mutation a nucleic acid sequence (c) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a regulatory element thereof (e.g., TRAC) Indels in or near the sequence of a gene, such as components of the TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; Indels in or near the sequence A cell comprising: a cell (or a cell population comprising said cell, e.g., more than one of said cells) expresses CAR and rapamycin-resistant mTor, and expresses TCR components (e.g., TR AC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRA C) exhibits a reduction or elimination of expression and / or function, Providing a cell (e.g., a cell comprising these, e.g., a cell population comprising more than one cell) do.

[0094] Indels or indels in genes encoding components of the TCR, B2M, and CIITA In some embodiments, the TCR component comprises an indel at or near the The targeting domain of the gRNA molecule that targets B2M. The targeting domain of the gRNA molecule for CIIRA is a) a template of the gRNA molecule listed in any combination of A1 to A72 in Table 33, a) a targeting domain sequence; b) a targeting domain sequence listed in any combination of F1 to F60 in Table 38; or c) any of B1 to B84 of Table 34. The combination of the targeting domain sequences of each gRNA molecule is listed in, for example: It consists of this.

[0095] Indels or indels in genes encoding components of the TCR and FKBP1A In some embodiments, the gR sequence for a TCR component includes an indel in the vicinity of the The targeting domain of the gRNA molecule and the targeting domain of the gRNA molecule against FKBP1A The binding domains are each selected from the group consisting of: a) any combination of C1 to C42 listed in Table 35; a) a targeting domain sequence of the gRNA molecule; b) any combination of D1 to D36 in Table 36 or c) a targeting domain sequence of said gRNA molecule, as listed in Table 37. Any combination of E1 to E30 of the targeting domain of the gRNA molecule is listed in the above. The sequence may comprise, for example, consist of:

[0096] Any of the aspects and embodiments of the cells described above. In some embodiments, each of the indels in the cell is introduced into the cell, Each of the indels has a target sequence complementary to the target sequence at or near each of the indels. gRNA molecules, e.g., more than one gRNA molecule (e.g., , comprising each of the gRNA molecules, e.g., the one or more gRNA molecules, These are generated by introducing an R system, e.g., more than one CRISPR system).

[0097] In another embodiment, the present invention provides a method for the production of at least about 30% of the cells of a population, e.g., at least about 30% of the cells of a population. At least about 50%, e.g., at least about 75%, e.g., at least about 90%, of the cells are A cell population, which is a cell of any of the aspects or embodiments of the cells. In some embodiments, at least about 30% of the cells (e.g., For example, in at least about 40%, e.g., at least about 50%, of the cells. In, for example, at least about 60%, for example, at least about 70%, For example, at least about 80%, for example, at least about 90%, for example, at least about 95%, e.g., at least about 99%) of the indels Each is a frameshift mutation. In some embodiments, including any of the embodiments of FIGS. 34A, 34B, or a cell (or population of cells) containing an indel listed in Figure 49. Multiple embodiments, including any of the multiple aspects and multiple embodiments of cells In one embodiment, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48. Any of the aspects and embodiments of the aforementioned cells is provided. In some embodiments, the present invention provides a method for manufacturing a semiconductor device according to the present invention. and providing a cell (or a population of cells) containing the indel identified in the above-mentioned cells. In embodiments, including any of the aspects and embodiments, the present invention provides A cell (or population of cells) containing an indel listed in Figure 53 is provided.

[0098] In another aspect, the present invention provides the methods of the aspects and embodiments of the aforementioned cells. In some embodiments, the cells of the cell population are At least about 20% of the cells described above are In some embodiments, the cells of the cell population are either of the following types: At least about 50% of the aspects and embodiments of the aforementioned cells In some embodiments, less than about 5% of the cells in the cell population, e.g., For example, less than about 1%, e.g., less than about 0.01%, contain off-target indels. In some embodiments, the cells of the cell population are engineered to express a chimeric antigen receptor (CAR). In some embodiments, the CAR is a CD19 CAR (e.g., (described below), for example, any one of SEQ ID NOs: 7883 to 7898. or a CD19 CAR comprising an antigen-binding domain comprising SEQ ID NO: 7909 or In other embodiments, the CAR comprises the sequence of SEQ ID NO: 7920. 9 to SEQ ID NO: 8112, or any one of SEQ ID NO: 8155 to SEQ ID NO: 8166 7949, e.g., comprising an antigen recognition domain comprising one of: or a BCMA CAR comprising an antigen recognition domain such as, for example, SEQ ID NO: 8549 Contains any one of sequence numbers 8621, e.g., sequence number 8559, e.g. and a BCMA CAR comprising an antigen recognition domain consisting of: The cell may be an animal cell, e.g., a mammalian, primate, or human cell, e.g., a human cell. In some embodiments, the cells are immune effector cells (e.g., immune effector cells a population of cells), e.g., T cells or NK cells, e.g., T cells, e.g., CD4+ T cells In some embodiments, the cells are CD8+ T cells, CD8+ T cells, or a combination thereof. The cells are allogeneic to the patient to whom they are administered, e.g., the cells are isolated from a healthy human subject. In another embodiment, the cells are autologous to the patient receiving the cells.

[0099] In another aspect, the present invention provides a method for treating a disease, e.g., cancer, in a patient in need thereof. The method of any one of the aspects and embodiments of the aforementioned cells. In some embodiments, the method includes administering the cells of the present invention, particularly immunosuppression. In some embodiments, the method reduces or eliminates the expression or function of the drug target. further comprises administering an immunosuppressant drug, e.g., RAD001.

[0100] In another aspect, the present invention provides a gRNA as described herein for use as a medicament. molecules (e.g., gRNA molecules as described above, among other aspects and embodiments thereof). gRNA molecules in any of the compositions described herein (e.g., the compositions the composition of any of the aspects and embodiments of the present invention, Nucleic acids described herein (e.g., various aspects and embodiments of the aforementioned nucleic acids) nucleic acid in any of the forms described herein, vectors (e.g., A vector in any of the aspects and embodiments thereof ), or a cell (or cell population) described herein (e.g., a cell (e.g., Any of the aspects and embodiments of the modified cells or cell populations. The present invention provides a cell (or cell population) in either of the following:

[0101] In another aspect, the present invention provides a compound as described herein for use in the manufacture of a medicament. Aspects and embodiments of RNA molecules (e.g., gRNA molecules described above) gRNA molecules in any of the compositions described herein (e.g., Compositions according to any of the aspects and embodiments of the composition of ), nucleic acids described herein (e.g., multiple aspects and multiple the nucleic acid of any of the embodiments), a vector described herein (e.g., In any of the aspects and embodiments of the aforementioned vectors vector), or a cell (or cell population) described herein (e.g., the aforementioned cells Aspects and embodiments of the (e.g., modified cells) or cell populations are described below. The present invention provides a cell (or a cell population) in any of these.

[0102] In another aspect, the present invention provides a method for treating a disease comprising administering to a subject a compound of formula (I) or (II) as described herein. Aspects and embodiments of RNA molecules (e.g., gRNA molecules described above) gRNA molecules in any of the compositions described herein (e.g., Compositions according to any of the aspects and embodiments of the composition of ), nucleic acids described herein (e.g., multiple aspects and multiple the nucleic acid of any of the embodiments), a vector described herein (e.g., In any of the aspects and embodiments of the aforementioned vectors vector), or a cell (or cell population) described herein (e.g., the aforementioned cells Aspects and embodiments of the (e.g., modified cells) or cell populations are described below. The present invention provides a cell (or a cell population) in any of these.

[0103] In another aspect, the present invention provides a method for treating diseases associated with tumor antigen expression, such as proliferative diseases, For the treatment of cancerous conditions, cancers, and diseases associated with tumor antigen expression and non-cancer-related indications. gRNA molecules described herein (e.g., gRNA molecules described above) for use in gRNA molecule in any of the aspects and embodiments The compositions described herein (e.g., multiple aspects and multiple combinations of the aforementioned compositions) are also provided. the composition in any of several embodiments), the nucleic acids described herein (e.g., A nucleic acid according to any of the aspects and embodiments of the nucleic acid described above. ), vectors described herein (e.g., multiple embodiments and and vectors in any of the embodiments), or as described herein. For a cell (or cell population) (e.g., a cell (e.g., a modified cell) or cell population as described above), In any of the aspects and embodiments, the cell (or cell population) We provide a group.

[0104] In another aspect, the present invention provides a method for treating chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia, and the like. sexual leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large intestine malignant large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell type Follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, hepatocellular carcinoma Marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma , Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom a blood cancer selected from the group consisting of leukemia, leukemia, and preleukemia gRNA molecules described herein (e.g., as described above) for use in the treatment of cancer. gRNA molecules in any of the aspects and embodiments RNA molecules), compositions described herein (e.g., multiple aspect and composition of any of the embodiments), the core described herein Acids (e.g., any of the aspects and embodiments of the nucleic acids described above) nucleic acids in), vectors described herein (e.g., for the aforementioned vectors, a vector in any of the aspects and embodiments, or a cell (or cell population) described in (e.g., a cell (e.g., a modified cell) or The cells ( or cell population).

[0105] In another aspect, the present invention provides a method for treating cancers, such as mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, Renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, Skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer Hilar cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue cancer Oliosarcoma, urethral cancer, penile cancer, childhood solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, Central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brainstem Glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environment Inducible cancers, combinations of said cancers, and metastatic lesions of said cancers. gRNA molecules described herein (e.g., as described above) for use in the treatment of cancer. gRNA molecules in any of the aspects and embodiments RNA molecules), compositions described herein (e.g., multiple aspect and composition of any of the embodiments), the core described herein Acids (e.g., any of the aspects and embodiments of the nucleic acids described above) nucleic acids in), vectors described herein (e.g., for the aforementioned vectors, a vector in any of the aspects and embodiments, or a cell (or cell population) described in (e.g., a cell (e.g., a modified cell) or The cells ( or cell population).

[0106] In addition to the specific features of the invention described above, the gRNA molecule, the Cas9 molecule, and The following general features of the cells may be used in any of the embodiments and implementations of the invention described herein. Aspects and implementations including the aspects and embodiments described above It is expected that this method can be applied to various situations.

[0107] In any of the aspects and embodiments disclosed herein, gR a gRNA molecule (e.g., a gRNA molecule comprising a targeting domain described herein, or a combination of gRNA molecules) may comprise one or more of the following features:

[0108] In certain embodiments, a gRNA molecule (e.g., a targeting molecule described herein) is One or more gR domains of a gRNA molecule or combination of gRNA molecules The targeting domain and the tracr are arranged on separate nucleic acid molecules. In some embodiments, the crRNA is a dgRNA molecule that is Targeting Domain]-: a) SEQ ID NO: 6584; b) SEQ ID NO: 6585; c) SEQ ID NO: 6605; d) SEQ ID NO: 6606; e) SEQ ID NO: 6607; f) SEQ ID NO: 6608; or g) SEQ ID NO: 7806 In a preferred embodiment, the crRNA comprises, from 5' to 3', In some embodiments, tracr comprises a Streptococcus pyogenes gene. The tracr sequence of S. pyogenes (GUUGGAACCAUUCAAAACAGC AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA Of the AAAGUGGCACCGAGUCGGUGC, more than 15, for example, 20 or more, 30 or more, 40 or more, 50 or more or more, 60 or more, 70 or more, or 80 In some embodiments, tracr additionally comprises: One or more, e.g., 1, 2, 3, 4, 5, 6, at the 3' end It also contains one or seven, for example, preferably four or seven U nucleotides. In a preferred embodiment for NA, tracr comprises SEQ ID NO: 7820. In this embodiment, tracr additionally comprises one or more sequences at the 3' end, e.g. For example, one, two, three, four, five, six, or seven, for example, preferably four or also contains seven U nucleotides. In a preferred embodiment for a dgRNA, The cr comprises, e.g., consists of, SEQ ID NO: 6660. In a preferred embodiment, the crRNA comprises a [targeting domain] - SEQ ID NO: 6607. tracr comprises SEQ ID NO: 7820, e.g., SEQ ID NO: 6660, including, for example, consisting of:

[0109] In other embodiments, a gRNA molecule (e.g., a targeting domain described herein) One or more gRNA molecules of a gRNA molecule or combination of gRNA molecules containing the The targeting domain and tracr are arranged on a single nucleic acid molecule. In some embodiments, the sgRNA molecule is an RNA molecule. ]- (a) SEQ ID NO: 6601; (b) SEQ ID NO: 6602; (c) SEQ ID NO: 6603; (d) SEQ ID NO: 6604; or (e) one, two, three, four, five, six, or seven urea residues at the 3' end Any of (a) to (d) above, further comprising a syl (U) nucleotide. In a preferred embodiment, the sgRNA molecule comprises, for example, consists of, In a preferred embodiment, the sgRNA molecule comprises a sgRNA molecule having a sgRNA domain [SEQ ID NO: 6601]. , [targeting domain] - comprising, e.g. consisting of, SEQ ID NO: 7811.

[0110] In embodiments, including any of the above aspects and embodiments, , one or more of the nucleic acid molecules of the gRNA molecules described herein, e.g., All of the nucleic acid molecules of the gRNA molecules described herein contain nucleotide or internucleotide bonds. The present invention does not include modifications to the above aspects and embodiments. In other embodiments, one or more of the nucleic acid molecules of the gRNA molecules described herein. The number may be, for example, 1 to a nucleotide or internucleotide linkage as described herein. or a plurality of modifications. In some embodiments, the modifications include 2'-O-methyl modifications. In some embodiments, the modification is a phosphorothioate modification. In some embodiments, the modifications include one, two, three, or more modifications of the nucleic acid of the gRNA molecule. or more, e.g., 2'-O-methyl modifications at each of the three 3' nucleotides. In some embodiments, the modification comprises a modification at four positions relative to the end of the nucleic acid of the gRNA molecule. at the 3' nucleotides at the 1st, 3rd, and 2nd 3' nucleotides at the 2nd, 3rd, and 2nd 3' nucleotides at the 3rd, 3rd, and 2nd 3' nucleotides at the 2nd ... In some embodiments, the modifications include 2'-O-methyl modifications of the nucleic acids of the gRNA molecules. , one, two, three, or more, e.g., at each of the three 5' nucleotides. In some embodiments, the modifications include 2'-O-methyl modifications in the nucleus of the gRNA molecule. The fourth, third, and second 3' nucleotides of the acid 2'-O-methyl modifications in each of the nucleic acids of the gRNA molecule. Three or more, e.g., 2'-O- at each of the three 5' nucleotides In some embodiments, the modification is at the 3' end of the gRNA nucleic acid molecule. in, one or more, e.g., one, two, three, or more, e.g. , and three phosphorothioate linkages. The modifications can include one or more, e.g., one or more, modifications at the 5' end of the nucleic acid molecule of the gRNA. Two, three, or more, e.g., three, phosphorothioates In some embodiments, the modifications include a 3' end of the gRNA nucleic acid molecule and a 3' end of the gRNA nucleic acid molecule. and one or more, e.g., one, two, three, or more, at the 5' end. For example, it contains three phosphorothioate bonds. In some embodiments, both the tracr-containing molecule and the crRNA-containing molecule are In another embodiment, the dgRNA molecule is modified as described herein. The molecules containing tracr are unmodified, and the molecules containing crRNA are as described herein. In other embodiments involving dgRNA molecules, the crRNA-containing molecule is modified as follows: The unmodified tracr-containing molecule is modified as described herein.

[0111] In embodiments of the invention that include more than one gRNA molecule, each gRNA molecule independently The nucleic acid sequence may be, for example, a dgRNA molecule or an sgRNA molecule, as described herein. In some embodiments, all of the gRNA molecules in the combinations described herein are dgRNAs. In some embodiments, all of the gRNA molecules in the combinations described herein In some embodiments, the combinations described herein include the sgRNA molecule. One or more of the NA molecules is a dgRNA molecule, and the combinations described herein wherein one or more of the other gRNA molecules is an sgRNA molecule.

[0112] In some embodiments, the gRNA molecules of the invention are introduced into the cells described herein. When inserted, it results in an indel at or near the target sequence of the gRNA. In some embodiments, the gRNA molecules of the present invention are RNA molecules. At least about 70% of the cell population to be cultured, e.g., of the cells described herein, For example, at least about 80%, for example, at least about 90%, for example, at least about 95% %, e.g., at least about 96%, e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 99%, or more, containing indels. In some embodiments, the frequency of indels is determined by, for example, the frequency of indels as described herein. In some embodiments, the one or more indices are measured by NGS as described in In some embodiments, the mutation is or contains a frameshift mutation. The gRNA molecules of the invention may be used in combination with the gRNA molecules of the cell population into which they are introduced, e.g., as described herein. At least about 30%, for example, at least about 40%, for example, at least about 10%, of the cells to be transfected. at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, At least about 75%, for example, at least about 80%, for example, at least about 85%, e.g., For example, at least about 90%, e.g., at least about 95%, or more In some embodiments, the gRNA molecule is a gRNA molecule that induces a frameshift mutation. The frequency of genome-shift mutations is measured, for example, by NGS as described herein. In embodiments, the indels, indel frequencies, frameshift mutations, and and / or the frequency of frameshift mutations is determined by the R gene expression profile of the Cas9 molecule described herein. After introduction of the gRNA molecule as a NP, it is measured in a cell (or a population of cells). In this embodiment, the indels, indel frequencies, frameshift mutations, and / or The frequency of genomic DNA fragments or frameshift mutations is measured in cells (or cell populations) after introduction of the gRNA molecule. It is measured by electroporation within the cell.

[0113] In embodiments, the gRNA molecules of the invention are administered to cells or cells described herein. When introduced into a population, up to 50-fold less of the target sequence of the gRNA or its vicinity, e.g. For example, at a frequency of up to 100-fold, e.g., up to 1000-fold, off-target In a preferred embodiment, the gRNA molecule is a gRNA molecule that produces an indel at the site. When introduced into the cells or cell populations described herein, In some embodiments, the off-target site does not result in a detectable indel. Analysis of the target indels can be performed, for example, to identify predicted off-target sequences as described herein. Determined by targeted off-target sequencing of binding sites In some embodiments, analysis for off-target indels is performed using, for example, In some embodiments, the off- Target analysis involves the synthesis of gRNA molecules as RNPs with Cas9 molecules as described herein. In some embodiments, the expression level is measured in a cell (or a population of cells) after introduction of the gene. Targeting analysis involves the analysis of the targeting activity in a cell (or cell population) following the introduction of gRNA molecules, followed by electroporation. More measured.

[0114] In some embodiments, the RNP or combination of RNPs is delivered to cells by a single electroporation. In embodiments, the cells of the present invention are delivered by only a single electroporation step. do.

[0115] Aspects and embodiments of the invention involving combinations of gRNA molecules And in embodiments, each of the gRNA molecules of the combination has a unique feature of any of the aforementioned features. It can be included in standing.

[0116] In any of the aspects and embodiments disclosed herein, Ca The s9 molecule may include one or more of the following features:

[0117] In embodiments, the Cas9 molecule is a Cas9 from S. pyogenes, e.g., Modified or unmodified S. pyogenes Cas9 as described herein In some embodiments, the Cas9 molecule comprises SEQ ID NO: 6611. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7821. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7822. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7823. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7824. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7825. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7826. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7827. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7828. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7829. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7830. In some embodiments, the Cas9 molecule comprises, e.g., consists of, SEQ ID NO: 7831. The Cas9 molecule is represented by SEQ ID NO: 7821, SEQ ID NO: 7822, SEQ ID NO: 7825, and SEQ ID NO: No. 7828, for example, a Cas9 molecule comprising these.

[0118] one or more RNP complexes, e.g., comprising a Cas9 molecule as described herein; In some aspects and embodiments, the RNP complex comprises a plurality of RNP complexes. Each of the moieties is less than about 10 uM, e.g., less than about 3 uM, e.g., less than about 1 uM, e.g., , at a concentration of less than about 0.5 uM, e.g., less than about 0.3 uM, e.g., less than about 0.1 uM. In embodiments, the concentration can be determined, for example, by measuring the concentration of an electric field, e.g., as described herein. By air perforation, RNPs are introduced, e.g., into cells described herein (e.g., cells In some embodiments, the concentration of RNP complexes in a composition comprising a population of RNP complexes is The substrate is suitable for electroporation.

[0119] Aspects and embodiments of the invention relate to combinations of gRNA molecules, e.g. In aspects and embodiments involving combinations of RNPs comprising different gRNA molecules, the combination Ca Each of the s9 molecules can independently contain any of the aforementioned features.

[0120] In any of the aspects and embodiments disclosed herein, the cells (e.g., a cell population) may comprise one or more of the following characteristics:

[0121] In some embodiments, the cells (e.g., cell populations) contain components of the T cell receptor (TCR). In some embodiments, the expression of the gene is reduced or eliminated in one or more cells. The reduction or elimination of expression of components of the T cell receptor (TCR) reduces the expression of TRAC. In some embodiments, the expression of components of the T cell receptor (TCR) is reduced or eliminated. The reduction or elimination includes reduction or elimination of expression of TRBC1. Reduction or loss of expression of components of the TCR leads to reduction or loss of TRBC2 expression. In some embodiments, the expression of components of the T cell receptor (TCR) is reduced or eliminated. In some embodiments, the reduction or elimination of T cell receptor expression includes reduction or elimination of CD3G expression. The reduction or elimination of expression of components of the TCR leads to the reduction or elimination of CD3D expression. In embodiments, reduced or eliminated expression of components of the T cell receptor (TCR). In some embodiments, the TCR component comprises reduced or eliminated expression of CD3E. Alternatively, the reduction or elimination of expression may be achieved by the use of the antibodies described herein for components of the TCR. One or more gRNA molecules, e.g., one or two gRNA molecules, e.g., In some embodiments, the cell is the result of introducing one gRNA molecule into the cell. The target sequence of the targeting domain of the gRNA molecule for the TCR component In or near, for example, an indel as described herein, e.g., a frame In some embodiments, the cell population comprises a shift mutation of the expression of a component of the TCR. exhibiting a reduction or elimination of at least about 50%, for example at least about 60%, for example , at least about 70%, for example, at least about 80%, for example, at least about 90%, or In some embodiments, the TC comprises 1 or more cells (as described herein). The reduction or elimination of expression of components of R can be measured, for example, by flow cytometry as described herein. It is measured by fluoroscopy.

[0122] Multiple embodiments (alternatively or in addition to reduced or eliminated expression of TCR components) In some cases, the cells (e.g., cell populations) express beta-2 microglobulin (B2M) In some embodiments, the method further comprises one or more cells having reduced or eliminated expression of The reduction or elimination of expression of B2M is achieved by the use of the methods described herein for B2M. One or more gRNA molecules, e.g., one or two gRNA molecules, e.g., one In some embodiments, the cell is the result of the introduction of one gRNA molecule into the cell. in the target sequence of the targeting domain of a gRNA molecule against B2M, or In the vicinity, for example, an indel, e.g., a frameshift mutation, as described herein, In some embodiments, the cell population exhibits reduced or absent expression of B2M. at least about 50%, for example, at least about 60%, for example, at least about 70%, For example, at least about 80%, e.g., at least about 90%, or more of the cells ( In some embodiments, the B2M expression is reduced or The disappearance may be measured, for example, by flow cytometry as described herein. do.

[0123] Multiple aspects (e.g., reduced or absent expression of TCR components and / or B2M) In one embodiment, the cell (e.g., a cell population) is a cell that expresses CIITA. In some embodiments, the method comprises the step of: The reduction or elimination of the expression of CIITA is achieved by the treatment of CIITA with the compound described herein. One or more gRNA molecules, e.g., one or two gRNA molecules, e.g., For example, the result of introducing one gRNA molecule into the cell. is a target sequence of the targeting domain of the gRNA molecule for CIITA. At or near, for example, an indel as described herein, e.g., a frame sequence In some embodiments, the cell population comprises a reduced or no mutation in CIITA. exhibits a reduction of at least about 50%, for example, at least about 60%, for example, at least At least about 70%, for example, at least about 80%, for example, at least about 90%, or In some embodiments, the B2M expression vector comprises more than 100 cells (as described herein). The reduction or elimination of expression can be measured, for example, by flow cytometry as described herein. It is something that is done.

[0124] Multiple embodiments (alternatively or in addition to reduced or eliminated expression of TCR components) In some cases, the cells (e.g., cell populations) express a target of an immunosuppressant drug, e.g., FKBP1. The present invention also includes one or more cells in which expression of A has been reduced or abolished. Then, the reduction or elimination of the expression of the FKBP1A is One or more gRNA molecules, e.g., one or two gRNAs, as described herein. The result is the introduction of a molecule, e.g., a single gRNA molecule, into the cell. In this state, the cell is transfected with a targeting domain of a gRNA molecule for FKBP1A. In or near the target sequence, for example, an indel as described herein, e.g. In some embodiments, the cell population contains a FKBP1A gene encoding a FKBP1A gene. , exhibiting a reduction or elimination of expression by at least about 50%, for example, by at least about 60% , e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 9 In some embodiments, the cells contain 0% or more of the cells (as described herein). The reduction or elimination of the expression of FKBP1A can be achieved, for example, by the use of the flow cytometer described herein. It is measured by cytometry.

[0125] In some embodiments, the cells exhibit reduced or absent expression of more than one gene. In one embodiment, the cells express components of the TCR (e.g., TRAC, TRB Decreased expression or expression of CD3E, CD3G, and / or CD3D The expression of B2M was decreased or disappeared, and the expression of CIITA was decreased or disappeared. In some embodiments, the reduction or elimination of expression is due to the fact that the gRNA molecules of the combination g) a targeting domain sequence selected from the group consisting of: In some embodiments, the reduction in expression or expression of a gene results from the introduction of a combination of RNA molecules into a cell. The deletion occurs when the gRNA molecule of the combination is listed in any of combinations B1 to B84. resulting from the introduction into cells of a combination of gRNA molecules containing targeting domain sequences. In some embodiments, the cells are selected from the group consisting of Table 33, Table 34, and Table 38 (e.g., Combination A). gRNA molecules in any of 1 to A72, B1 to B84, or F1 to F60 ) in each target sequence of the gRNA molecule targeting domain, contains an indel, e.g., a frameshift mutation, in this vicinity.

[0126] In some embodiments, the cells exhibit reduced or absent expression of more than one gene. In one embodiment, the cells express components of the TCR (e.g., TRAC, TRB Decreased expression or expression of CD3E, CD3G, and / or CD3D and reduced or absent expression of immunosuppressant drug targets, such as FKBP1A. In some embodiments, the reduction or elimination of expression is due to the fact that the gRNA molecules of the combination g) a targeting domain sequence selected from the group consisting of C1 to C42; In some embodiments, the reduction in expression or expression of a gene results from the introduction of a combination of RNA molecules into a cell. The deletion occurs when the gRNA molecule of the combination is listed in any of the combinations D1 to D36. resulting from the introduction into cells of a combination of gRNA molecules containing targeting domain sequences. In some embodiments, the cells are selected from the group consisting of Table 35, Table 36, and Table 37 (e.g., combination C). gRNA molecules in either C1 to C42, D1 to D36, or E1 to E30 ) in each target sequence of the gRNA molecule targeting domain, contains an indel, e.g., a frameshift mutation, in this vicinity.

[0127] Reduce the expression of both T cell receptor components, e.g., TRAC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting TRAC is A molecule is SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7837 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7837 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7857 and SEQ ID NO: 6660, for example. dgRNAs comprising the above, SEQ ID NO: 7856 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7857 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0128] Reduce the expression of both T cell receptor components, e.g., TRAC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting TRAC is A molecule is SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7837 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7836 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7837 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7862 and SEQ ID NO: 6660, for example. dgRNAs consisting of the above, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0129] Reduce the expression of both T cell receptor components, e.g., TRAC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting TRAC is A molecule is SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7842 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7842 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7857 and SEQ ID NO: 6660, for example. dgRNAs comprising the above, SEQ ID NO: 7856 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7857 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0130] Reduce the expression of both T cell receptor components, e.g., TRAC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting TRAC is A molecule is SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7842 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7841 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7842 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7862 and SEQ ID NO: 6660, for example. dgRNAs consisting of the above, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0131] Reduce the expression of both T cell receptor components, e.g., TRBC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting the TRBCs is A molecule is SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7847 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7847 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7857 and SEQ ID NO: 6660, for example. dgRNAs comprising the above, SEQ ID NO: 7856 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7857 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0132] Reduce the expression of both T cell receptor components, e.g., TRBC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting the TRBCs is A molecule is SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7847 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7846 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7847 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7862 and SEQ ID NO: 6660, for example. dgRNAs consisting of the above, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0133] Reduce the expression of both T cell receptor components, e.g., TRBC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting the TRBCs is A molecule is SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7852 and SEQ ID NO: 6660, for example a dgRNA comprising thereof, SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7852 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7857 and SEQ ID NO: 6660, for example. dgRNAs comprising the above, SEQ ID NO: 7856 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7857 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0134] Reduce the expression of both T cell receptor components, e.g., TRBC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond CIITA may also be reduced or In some embodiments, the gRN targeting the TRBCs is A molecule is SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, e.g., a dgRNA comprising thereof, SEQ ID NO: 7852 and SEQ ID NO: 6660, for example a dgRNA comprising thereof, SEQ ID NO: 7851 and SEQ ID NO: 10798, and a dgRNA comprising, for example, the 7852 and SEQ ID NO: 10798, The gRNA molecules targeting B2M are SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, dgRNAs consisting of SEQ ID NO: 7862 and SEQ ID NO: 6660, for example. dgRNAs consisting of the above, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example. dgRNAs consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example. For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules is a Cas9 The RNPs are provided as RNPs with molecules, e.g., Cas9 molecules, as described herein.

[0135] Reduced expression of both T cell receptor components, e.g., TRAC, and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRAC has the sequence No. 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising, for example, SEQ ID NO: 7836 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7837 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7867 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example. dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0136] Reduced expression of both T cell receptor components, e.g., TRAC, and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRAC has the sequence No. 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, SEQ ID NO: 7837 and SEQ ID NO: 6660, a dgRNA comprising, for example, SEQ ID NO: 7836 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7837 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7872 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7871 and SEQ ID NO: 10798, for example, dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0137] Reduced expression of both T cell receptor components, e.g., TRAC, and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRAC has the sequence No. 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, SEQ ID NO: 7842 and SEQ ID NO: 6660, SEQ ID NO: 7841 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7842 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7867 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example. dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0138] Reduced expression of both T cell receptor components, e.g., TRAC, and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRAC has the sequence No. 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, SEQ ID NO: 7842 and SEQ ID NO: 6660, SEQ ID NO: 7841 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7842 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7872 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7871 and SEQ ID NO: 10798, for example, dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0139] Reduced expression of both T cell receptor components, e.g., TRBC and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRBCs comprises the sequence No. 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846 and SEQ ID NO: 6660, SEQ ID NO: 7847 and SEQ ID NO: 6660, SEQ ID NO: 7846 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7847 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7867 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example. dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0140] Reduced expression of both T cell receptor components, e.g., TRBC and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRBCs comprises the sequence No. 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846 and SEQ ID NO: 6660, SEQ ID NO: 7847 and SEQ ID NO: 6660, SEQ ID NO: 7846 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7847 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7872 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7871 and SEQ ID NO: 10798, for example, dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0141] Reduced expression of both T cell receptor components, e.g., TRBC and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRBCs comprises the sequence No. 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising, for example, SEQ ID NO: 7851 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7852 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7867 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example. dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0142] Reduced expression of both T cell receptor components, e.g., TRBC and FKBP1A In a preferred embodiment, it is intended to enhance or eliminate further targets, e.g. In some cases, the expression or function of one or more additional targets may also be reduced or eliminated. In some embodiments, the gRNA molecule targeting TRBCs comprises the sequence No. 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, SEQ ID NO: 7852 and SEQ ID NO: 6660, a dgRNA comprising, for example, SEQ ID NO: 7851 and SEQ ID NO: 10798, and dgRNAs comprising, for example, SEQ ID NOs: 7852 and a dgRNA selected from, for example, a dgRNA comprising, for example, consisting of, SEQ ID NO: 10798; gRNA molecules targeting 1A are SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, for example dgRNAs comprising, for example, SEQ ID NO: 7872 and SEQ ID NO: 6660 dgRNAs, SEQ ID NO: 7871 and SEQ ID NO: 10798, for example, dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 10798, for example. As described herein, the dgRNA may be selected from the group consisting of: In some embodiments, each of the gRNA molecules is a Cas9 molecule, e.g., For example, it may be provided as an RNP with a Cas9 molecule as described herein.

[0143] In one embodiment, the cells exhibit reduced or absent expression of only one TCR component. (Also exhibit reduced or eliminated expression of one or more other targets that are not components of the TCR. In some embodiments, the cells express a single gene (or genes) that are components of a TCR. In or near the target sequence (or its regulatory elements) only (The cell contains one or more additional genes (or genes) that are not components of the TCR.) Indels are also present in or near the target sequence within the regulatory element Thus, in some embodiments, the cells contain one of the components of a TCR. In some embodiments, the cells contain no indels within genes greater than or equal to 100 kDa. and a gene encoding a second TCR component, e.g., TRBC1 or TRBC2. It does not contain indels.

[0144] In one aspect, the cell is a cell that expresses an inhibitory molecule or an enzyme downstream of signaling via an inhibitory molecule. does not exhibit reduced or absent expression of one or more genes containing the target sequence of the effector. In some embodiments, the cells is a gene encoding an inhibitory molecule or a downstream effector of signal transduction via an inhibitory molecule. Induction of an induction pathway at or near a target sequence within the (in one or more other genes (or their regulatory elements) In some embodiments, the cells contain a gene encoding PDCD1 or its regulatory elements. The fragment does not contain any indels.

[0145] In embodiments, the cells are animal cells, e.g., mammalian, primate, or human cells, e.g., For example, a human cell. In embodiments, the cell is an immune effector cell (e.g., one or more or a cell population containing multiple immune effector cells), e.g., T cells or NK cells, e.g. For example, T cells, e.g., CD4+ T cells, CD8+ T cells, or a combination thereof. be.

[0146] In some embodiments, the cells are autologous with respect to the patient to whom they are administered. In aspects, the cells are allogeneic with respect to the patient to whom they are administered. In the present invention, the cells are allogeneic with respect to the patient to whom they are administered and are induced pluripotent stem cells. In some embodiments, the cell is a cell that is, or is derived from, said cell The antibody is allogeneic with respect to the patient to whom it is administered, and does not contain immune effector cells, e.g., healthy human donors. These are T cells isolated from donors.

[0147] In some embodiments, the cells (or cell populations) described herein, e.g., The CAR-expressing cells described herein can be ex vivo expressed, e.g., by the methods described herein. In other embodiments, e.g., the method of the present invention is modified and / or altered in vivo. a cell (or cell population) described herein, e.g., a CAR-expressing cell described herein. can be modified and / or purified in vivo, for example, by the methods described herein. In some embodiments, the CRISPR system, gRNA molecules (referred to herein as (including those in an RNP complex with a Cas9 molecule), and / or compositions described herein. (e.g., a composition comprising more than one gRNA molecule of the invention) can be prepared, for example, by the methods described herein. ex vivo transfection into cells, e.g., CAR-expressing cells described herein. In other embodiments, the CRISPR system, gRNA molecules (as described herein) of the present invention are introduced. (including in an RNP complex with a Cas9 molecule, as described in the literature), and / or A composition (e.g., a composition comprising more than one gRNA molecule of the invention) can be used, e.g., as described herein. In vivo transfection of a cell described in any one of claims 1 to 4, e.g., a CAR-expressing cell described herein. It will be introduced in.

[0148] In embodiments, the cells express a chimeric antigen receptor (CAR) as described herein. have been, are being, or will be engineered to (The nucleic acid sequence encoding the CAR may be or may comprise a nucleic acid sequence encoding the CAR.) In some embodiments, the CAR may be, for example, a CD19;CD123;CD22 ;CD30;CD171;CS-1 (CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24; C-type lectin-like molecule 1 (CLL-1 or or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII) Ganglioside G2 (GD2); Ganglioside GD3 (aNeu5Ac(2-8)a Neu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer);TN F receptor family members, B cell maturation (BCMA); Tn antigen (TnAg) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor Tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (F LT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen sexual antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13R a2 or CD213A2); mesothelin; interleukin-11 receptor alpha (IL -11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testisin or or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antibody CD24; Platelet-derived growth factor receptor beta (PDGFR beta); Developmental stage-specific Subcutaneous fetal antigen 4 (SSEA-4); CD20; folate receptor alpha; receptor protein rosine kinase ERBB2 (Her2 / neu); cell surface-associated mucin 1 (MUC1); Epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostate Papillary acid phosphatase (PAP); elongation factor 2 mutant (ELF2M); ephrin B2 ; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (I GF-1 receptor; carbonic anhydrase IX (CAIX); beta-9 proteasome (pro lysosomal, macropenetran) subunit (LMP2); glycoprotein 100 (gp100) Breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene Oncogene fusion protein consisting of ABC homolog 1 (Abl) (bcr-abl); A-type ephrin receptor 2 (EphA2); fucosyl-GM1; sialyl Lewis adhesion Molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1- 4) bDGlcp(1-1)Cer; transglutaminase 5 (TGS5); polymer High molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD 2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker Car7-related (TEM7R); claudin6 (CLDN6); thyroid-stimulating hormone receptor body (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179 a;anaplastic lymphoma kinase (ALK);polysialic acid;placenta-specific 1 (PLAC1); Hexasaccharide moiety of globoH glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1) ;Uroplakin 2 (UPK2);Hepatitis A virus cellular receptor 1 (HAVCR1);Ad ADRB3 (adrenergic receptor beta 3); pannexin 3 (PANX3); G protein cofactor GPR20 (global receptor 20); lymphocyte antigen 6 complex, locus K9 (LY6K); olfactory Receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); Cancer / Testis antigen 1 (NY-ESO -1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 (ETV6-AML) located on chromosome 12p; sperm protein substance 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin Tissue-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen 1 (MAD-CT-1) ); melanoma cancer testis antigen 2 (MAD-CT-2); Fos-related antigen 1; tumor protein p 53 (p53); p53 mutant; prostein; survivin; telomerase; prostate Cancer tumor antigen 1 (PCTA-1 or galectin 8); a melanoma antigen recognized by T cells 1 (MelanA or MART1); Rat sarcoma (Ras) mutant; Human telomerase human teratogenic reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma apoptosis inhibitor (ML-I) AP);ERG (transmembrane serine protease 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired box protein Protein Pax-3 (PAX3); androgen receptor; CyclinB1; v-myc Avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog RhoC family member C (RhoC); tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger -protein)-like (BORIS or Brother of the Regulatory of Imprinted Sites);Squamous Cell Carcinom a Antigen Recognized by T Cells 3(SART3); Paired box protein Pax-5 (PAX5); proacrosin-binding protein s p32(OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for advanced glycation end products (RAGE-1); Renal ubiquitous 1 (RU1); Renal ubiquitous 2 (R U2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus HPV E7; intestinal carboxylesterase; mutant heat shock protein protein 70-2(mut hsp70-2);CD79a;CD79b;CD72;leukemia Lymphocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR) or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILR A2); CD300 molecule-like family member f (CD300LF); C-type lectin domain In family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 ( LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin It recognizes an antigen selected from the group consisting of globulin lambda-like polypeptide 1 (IGLL1).

[0149] In embodiments, the CAR binds to CD19, e.g., as described herein. In some embodiments, the CAR comprises an antigen recognition domain. In some embodiments, the CAR comprises an anti-CD19 binding domain, for example, consisting of , SEQ ID NO: 7884.

[0150] In embodiments, the CAR binds to BCMA, e.g., as described herein. In some embodiments, the CAR comprises an antigen recognition domain. For example, it includes an anti-BCMA binding domain consisting of:

[0151] In embodiments, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain. In some embodiments, the transmembrane domain comprises a signaling domain. 4. In some embodiments, the intracellular signaling domain comprises a primary signal transduction domain. In some embodiments, the antibody comprises a co-stimulatory domain, a co-stimulatory domain, and / or a co-stimulatory domain. The primary signaling domain comprises the sequence of SEQ ID NO: 6648, or SEQ ID NO: 6650. In some embodiments, the costimulatory signaling domain comprises, e.g., consists of comprising, for example consisting of, the sequence of sequence number 6646 or sequence number 6636, for example In another embodiment, the co-stimulatory signaling molecule comprises, e.g., consists of, the sequence of SEQ ID NO: 6646. The signal transduction domain contains a sequence derived from the intracellular signaling domain of CD28.

[0152] In embodiments, the CAR is a CD19 CAR and has the sequence of SEQ ID NO: 7920. In some embodiments, the CAR is a CD19 CAR. , comprising, e.g., consisting of, the sequence of SEQ ID NO: 7909. In some embodiments, e.g. The cells described herein can be fused to a CD19 CAR described herein, e.g., a CD19 CAR having the sequence Nucleic acid sequence encoding CD19 CAR comprising the sequence of SEQ ID NO: 7920 or SEQ ID NO: 7909 Contains columns.

[0153] In embodiments, the CAR is a BCMA CAR and has the sequence of SEQ ID NO: 8559. In some embodiments, the cells may comprise, e.g., consist of, e.g., any of the cells described herein. is a BCMA CAR described herein, e.g., a BCMA comprising SEQ ID NO: 8559. In some embodiments, the nucleic acid sequence encoding the CAR is a BCMA CAR. The nucleic acid sequence comprises, for example consists of, SEQ ID NO:8574.

[0154] In some embodiments, the cells of the invention (e.g., cells of the invention), e.g., as described herein, The cell population further comprises a nucleic acid sequence encoding an NK inhibitory molecule. The cells have reduced or absent expression of one or more major histocompatibility class I (MHC I) molecules. or abolishment (e.g., abolishment of B2M expression, e.g., achieved by the methods described herein) reduction or elimination), and / or one or more major histocompatibility class II Reduced or absent expression of (MHC II) molecules (e.g., as described herein) In the case of a patient presenting with a condition in which the expression of CIITA is reduced or eliminated, the condition is In some embodiments, the NK inhibitory molecule is an HLA-G molecule, e.g., B2M. HLA-G molecules that do not require HLA-G2, HLA-G3, or HLA-G4 In other embodiments, the NK inhibitory molecule is an HLA-G:B2M fusion molecule. An example of an HLA-G:B2M fusion molecule is SEQ ID NO: 10674. An exemplary nucleic acid sequence encoding the fusion is SEQ ID NO:10675.

[0155] In some embodiments, the cells (e.g., cell populations) are characterized by a reduced expression of a target of an NK inhibitory molecule. For example, the expression of LILRB1 is reduced or eliminated.

[0156] In several embodiments, the CAR-expressing cells of the invention (e.g., those described herein) The expression or function of one or more proteins is reduced or eliminated by the method. The cells (induced cells) have the ability to proliferate in response to a stimulus, e.g., binding of the CAR to its target antigen. In some embodiments, the growth occurs ex vivo. In some embodiments, the expansion occurs in vivo. In some embodiments, the expansion occurs ex vivo. In some embodiments, the proliferation level occurs both in vivo and in vivo. (e.g., cells of the same type as the CAR-expressing cells) The same, but reduced or eliminated, for example, by the methods described herein. In some embodiments, the expression or function of one or more proteins was absent. The levels are measured using the same cell type (e.g., cells of the same kind as the CAR-expressing cells). At least 80%, at least 85%, at least 90%, at least 95% of the reproduction level %, at least 98% or higher, but for example, as described herein The expression or function of one or more proteins is reduced or eliminated by the method described above. It had no function.

[0157] Unless otherwise specified, all technical terms and and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In practicing or testing the present invention, methods and materials similar to those described herein may be used. Alternatively, equivalent methods and materials may be used, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are hereby incorporated by reference. are incorporated by reference in their entirety. Additionally, materials, methods, and examples are available from They are illustrative only and are not intended to be limiting. The elements by number or letter, e.g. (a), (b), (i), etc., are readable. Presented for ease of viewing only. Use of elements in this section requires that the steps or elements be performed in alphabetical order. Neither does it necessarily require that the steps or elements be distinct from one another. Other features, objects, and advantages of the invention will become apparent from the description and drawings, and from the claims. It will be clear from the above. [Brief explanation of the drawings]

[0158] [Figure 1] Figure 1 shows Cas9 editing of the B2M locus. Percent editing detected by NGS in HEK-293 Cas9GFP 24 hours after delivery of crRNA and trRNA targeting the B2M locus by lipofection. Each dot indicates a different crRNA, trRNA that was held constant. Genomic coordinates indicate the location on chromosome 15 (n=3). [Figure 2]1 is a histogram of TCR expression after editing with gRNA molecules containing targeting domains against TCR alpha, as listed in Table 1. Shown is the % mCherry+ TCR- cells after 7 days in Jurkat cells using three different concentrations of lentivirus. [Figure 3] Figure 1 shows the % TCR- primary T cells 6 and 12 days after transduction of lentivirus encoding the indicated gRNA and Cas9 / mCherry. Data represent the % mCherry+ TCR-edited cells. [Figure 4] Figure 1 shows the % PD1- primary T cells within the mCherry+ gated population at 3 days after restimulation (with CD3 / CD28 beads) and 8 days after activation in cells transfected with lentivirus encoding the indicated gRNA and Cas9 / mCherry. [Figure 5-1] Figures 5A and 5B: Histograms of TCR expression at day 7 of culture using TRAC-8 gRNA (Figure 5A) and PD-1 at day 8 of culture using PD1-6 gRNA (Figure 5B). [Figure 5-2] (As mentioned above.) [Figure 6] Figure 1 shows the expression profile of primary T cells engineered to express a CD19 CAR and treated with RNP containing a gRNA targeting TCR alpha. Pre-enrichment shows a cell population that is CAR+ / - and TCR+ / - after 11 days in culture. Post-enrichment shows >98% TCR- T cells after isolation using a CD3 microbead negative selection step. [Figure 7]Figure 1 shows the cytotoxic activity of CD19 CAR-transduced T cells against target-positive (Nalm6-luc) and target-negative (K562-luc) cell lines. "T1" and "T8" refer to gRNA TRAC-1 and gRNA TRAC-8, respectively. Results are shown for lentiviral or RNP-delivered Cas9 / gRNA and for both unsorted and TCR-sorted ("sorted") T cell populations. [Figure 8] Figure 1 shows the excision in the B2M gene using a CRISPR system containing two gRNA molecules. In each experiment, cells were exposed to a gRNA with the targeting domain of CR00442 and the indicated second gRNA molecule. The size of the predicted excision product is shown. [Figure 9] Figure 1 shows the results of exposure of gRNA pairs to the B2M gene with fewer than 100 predicted excision products. * indicates predicted excision products that are visible (green arrows). ? = predicted excision products could not be resolved from the assay. Yellow arrows indicate wild-type fragments. [Figure 10] Figure 1 shows the results of exposure of a gRNA pair to the B2M gene, with a predicted excision product of approximately 4000 base pairs. Red * indicates the predicted excision product seen (green box). Purple * = less than 10% editing efficiency. Orange box indicates the wild-type fragment. [Figure 11] Figure 1 shows the results of exposure of a gRNA pair to the B2M gene, with a predicted excision product of approximately 6000 base pairs. Red * indicates the predicted excision product seen (green box). Purple * = less than 10% editing efficiency. Orange box indicates the wild-type fragment. [Figure 12]

[0023] Figure 1 shows the average (n > 3) editing of CRISPR systems with dgRNAs directed against TRAC in HEK cells (stably expressing Cas9) or primary human CD3+ T cells (delivery of dgRNA: Cas9 RNP by electroporation). Also shown is the % of cells displaying TCR loss as determined by flow cytometry using an anti-TCRa / b antibody. [Figure 13] Figure 1 shows the average (n≧3) editing of CRISPR systems with dgRNAs directed against the TRBC1 and TRBC2 coding regions in HEK cells (stably expressing Cas9). Also shown is the % of T cells displaying TCR loss, as determined by flow cytometry using an anti-TCRa / b antibody. [Figure 14] Figure 1 shows the mean (n > 3) editing of CRISPR systems with dgRNAs directed against B2M in CD34+ primary human hematopoietic stem cells in HEK cells (stably expressing Cas9), and the % loss of B2M in primary CD3+ T cells as measured by flow cytometry. NGS assays were performed 24 hours after introduction of the CRISPR system into the indicated cells, and flow cytometry assays were performed 3-5 days after introduction of the CRISPR system into CD3+ T cells. [Figure 15]

[0023] Figure 1 shows editing, as measured by loss of TCR (flow cytometry), by CRISPR systems containing the indicated gRNA molecules in primary human CD3+ T cells from three different donors. For each gRNA, left bar = donor #1; middle bar = donor #2; right bar = donor #3. [Figure 16] FIG. 1 shows the average (n≧3) editing of CRISPR systems with dgRNAs indicated for PDCD1 in HEK cells (stably expressing Cas9) as measured by NGS, and for PDCD1 in primary human CD3+ cells (RNP electroporated) as measured by loss of PD-1 (flow cytometry using an anti-PD-1 antibody). [Figure 17-1] Figure 17A: Expression of TCR and / or B2M after electroporation of gRNA against TRAC and / or B2M at the indicated ratios by flow cytometry. [Figure 17-2] Figure 17B: Percentage of cells negative for both B2M and TCR at the indicated gRNA ratios. [Figure 17-3]FIG. 17C: Editing of B2M or TCR as measured by flow cytometry. [Figure 17-4] FIG. 17D: Cell viability 24 hours after electroporation. [Figure 18] Figure 1 shows % editing in primary CD3+ T cells using dgRNAs containing a targeting domain for PDCD1 (targeting domain of the indicated CRxxxx sequence), as measured by NGS (yellow bars) or loss of PD-1 by flow cytometry (using an anti-PD-1 antibody). NGS sequencing was performed 24 hours after RNP delivery; flow cytometry was performed 5 days after RNP delivery. [Figure 19] Figure 1 shows % editing (n>=3) in primary CD3+ T cells using dgRNAs containing targeting domains against PDCD1 (targeting domains of the indicated CRxxxx sequences), as measured by loss of PD-1 by flow cytometry (using an anti-PD-1 antibody) across three different donors (leftmost bar, donor #4; middle bar, donor #5; rightmost bar, donor #6). Lines with targeting domains against some targets show >50% loss of PD-1, demonstrating consistent results across multiple donors. gRNAs containing targeting domains for CR00852, CR00828, CR00870, CR00848, CR00855, and CR00838 show greater than 50% editing across at least two donors. [Figure 20]Figure 1 shows % editing (n>=3) in primary CD3+ T cells using dgRNAs containing targeting domains against B2M (targeting domains of the indicated CRxxxx sequences), as measured by loss of B2M by flow cytometry across three different donors (leftmost bar, donor #1; middle bar, donor #4; rightmost bar, donor #5). Lines with targeting domains against some target sequences show >40% loss of B2M, demonstrating consistent results across multiple donors. gRNAs containing targeting domains for CR00442, CR00444, and CR00455 show greater than 40% editing across at least two donors. [Figure 21] Figure 1 shows % editing (N=3) measured by NGS in HEK293 cells stably expressing Cas9 using dgRNAs containing the indicated targeting domains against FKBP1A (each unlabeled bar uses the odd-numbered CRxxxx targeting domain between the labeled numbers; e.g., data for the dgRNA containing the targeting domain of CR002073 is reported in the bar between labeled CR002072 and CR002074). [Figure 22] FIG. 1 shows % editing (N=3) and % frameshift (FS) editing in HEK293 cells stably expressing Cas9 using the indicated dgRNAs containing a targeting domain against FKBP1A, as measured by NGS. [Figure 23] FIG. 1 shows % editing (N=3) and % frameshift (FS) editing in HEK293 cells stably expressing Cas9 using the indicated dgRNAs containing a targeting domain against FKBP1A, as measured by NGS. [Figure 24] FIG. 1 shows % editing (N=3) and % frameshift editing (FS editing) measured by NGS in CD3+ T cells using RNPs containing dgRNAs containing a targeting domain against FKBP1A, as indicated. [Figure 25]Figure 1 shows the % of B2M- CD3+ T cells, TCR- CD3+ T cells (measured by anti-CD3 Ab), or B2M- / TCR- CD3+ T cells (double negative) as measured by FACS (4 days after the first electroporation) after sequential electroporation of RNPs containing gRNA against targets or simultaneous electroporation of RNPs containing gRNA against targets. [Figure 26] FIG. 1 shows the % of B2M- CD3+ T cells, TCR- CD3+ T cells (measured by anti-CD3 Ab), or B2M- / TCR- CD3+ T cells (double negative) as measured by NGS (48 hours after the first electroporation) after a single electroporation, sequential electroporation of RNPs containing gRNA against targets, or simultaneous (“Simult”) electroporation of RNPs containing gRNA against targets (B2M and TRAC). [Figure 27] FIG. 1 is a schematic diagram of the preparation of gene-edited TCR- / B2M- BCMA CAR-transduced T cells. [Figure 28-1] Figure 28: Surface expression of TCR (using anti-CD3-PercpCy5.5) and B2M (using anti-B2M-APC) 5 days after electroporation (of RNPs). T cells transduced with RNPs containing gRNA against B2M are labeled "B2M"; T cells transduced with RNPs containing gRNA against TRAC are labeled "TCR." T cells transduced with BCMA CAR are labeled "CAR." Untransduced cells are labeled "UTD." Cells electroporated with Cas9 but not guide RNA are labeled "no guide." CD4 staining using anti-CD4-V450 is shown in the bottom panel to verify that the loss of CD3 staining is due to loss of TCR and not T cells. [Figure 28-2] (As mentioned above.) [Figure 29]

[0023] Figure 1 shows surface expression of TCR and B2M in total T cells compared to CAR+ T cells from each population. "CAR" indicates CAR transduction; "no guide" indicates Cas9 electroporation without gRNA; "B2M" indicates electroporation with RNP containing gRNA specific for B2M; and "TCR" indicates electroporation with RNP containing gRNA specific for TRAC. [Figure 30] FIG. 1 shows CAR expression levels in cells electroporated with RNPs containing gRNAs specific for B2M ("B2M") and TRAC ("TCR"), or in cells electroporated with Cas9 without gRNAs ("no guide"). [Figure 31] Figure 1 shows assessment of T cell proliferation in response to tumor cell lines that express high (KMS11), low (RPMI8226), or are BCMA- (Nalm6). T cells were electroporated with Cas9 without gRNA ("no guide"), or with RNP containing gRNAs against B2M and TRAC ("B2M+TCR"), and / or transduced with a lentiviral vector encoding a BCMA CAR ("BCMA CAR"), or were untransduced ("UTD"), as indicated. [Figure 32]

[0023] Figure 1 shows the proliferation of CAR+ CD4+ and / or CD8+ T cells in response to tumor cell lines that express high levels of BCMA (KMS11), low levels of BCMA (RPMI8226), or are BCMA- (Nalm6). Cells were electroporated with Cas9 without gRNA ("no guide"), or with RNP containing gRNAs against B2M and TRAC ("B2M+TCR"), and / or transduced with a lentiviral vector encoding a BCMA CAR ("BCMA CAR"), or were untransduced ("UTD"), as indicated. [Figure 33-1]Figures 33A and 33B show assessment of the effect of gRNA targeting TRAC on cell surface TCR expression. 33A shows loss of CD3 staining for RNPs containing guides CR000961 (961), CR000978 (978), CR000984 (984), CR000992 (992), CR000985 (985), and CR000960 (gRNA1), and CR000979 (gRNA8). 33B shows loss of CD3 staining for RNPs containing guides CR000991 (991), CR000992 (992), CR000993 (993), and CR000978 (978). 991 and 992 are nearly superimposable. [Figure 33-2] (As mentioned above.) [Figure 33-3] (C) Genomic editing of the TRAC locus resulting from human primary T cell electroporation with RNPs containing gRNAs targeting the indicated TRAC locus. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence (% frameshift edits) is shown. [Figure 34-1] Figures 34A and 34B: Details of the top five most frequently observed sequence changes for each TRAC-targeting gRNA used for primary human T cell editing. Figures 34A and 34B are outcomes from two independently performed electroporation experiments. Wild-type (wt) unmodified bases are shown in uppercase. Deletions compared to the wt sequence are indicated by "-" and insertions compared to the wt sequence are shown in lowercase. Data for each experiment are averages from triplicate PCR products. Figures 34A-34B disclose SEQ ID NOs: 10845-10899, respectively, in order of appearance. [Figure 34-2] (As mentioned above.) [Figure 35]

[0023] Figure 1 shows assessment of the effect of gRNAs targeting B2M on cell surface expression of B2M. The guide numbers refer to the CR00xxx identifier of the targeting domain. [Figure 36]

[0039] Figure 36 shows genome editing of the B2M locus resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting the B2M locus. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence (% frameshift edits) is shown in the top panel. The top 10 most frequently observed sequence changes for each gRNA targeting B2M used for primary human T cell editing are detailed in the bottom panel. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by "-", and insertions relative to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. Figure 36 discloses SEQ ID NOs: 10900-10919, respectively, in order of appearance. [Figure 37] Figure 1 shows % editing at day 3 post-electroporation (day 5 of cell culture) of primary human T cells by RNPs containing the indicated concentrations of dgRNAs against the indicated CIITAs (numbers refer to the CRxxxxx identifier of the targeting domain), as measured by flow cytometry using anti-HLA-DR reagents. [Figure 38] Figure 38 shows genome editing of the CIITA locus resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting the CIITA locus. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence (% frameshift edits) is shown. The top five most frequently observed sequence changes are detailed in the bottom panel. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by "-" and insertions relative to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. Figure 38 discloses SEQ ID NOs: 10920-10939, respectively, in order of appearance. [Figure 39]Figure 1 shows % editing in primary human T cells at 3 days post-electroporation by RNPs containing the indicated dgRNAs (numbers refer to the CR00xxxx identifier of the targeting domain) against CIITA at the indicated concentrations, as measured by flow cytometry using anti-HLA-DR reagents. % editing represents HLA-DR expression at the cell surface of cells electroporated with the CIITA guide relative to expression in cells electroporated without the guide RNA. [Figure 40]

[0023] Figure 1 shows genome editing of the CIITA locus resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting the CIITA locus. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence (% frameshift edits) is shown. [Figure 41]

[0041] Figure 41 shows the top five most frequently observed sequence changes (indels) for each CIITA-targeting gRNA used for primary human T cell editing. Data are averages from triplicate PCR products. Wild-type (wt) unmodified bases are shown in uppercase. Deletions compared to the wt sequence are indicated by "-" and insertions compared to the wt sequence are shown in lowercase. Figure 41 discloses SEQ ID NOs: 10940-10974, respectively, in order of appearance. [Figure 42] Figure 1 shows % editing in primary human T cells at 3 days post-electroporation by RNPs containing the indicated dgRNAs (numbers refer to the CR00xxxx identifier of the targeting domain) against CIITA at the indicated concentrations, as measured by flow cytometry using anti-HLA-DR reagents. % editing represents HLA-DR expression at the cell surface of cells electroporated with the CIITA guide relative to expression in cells electroporated without the guide RNA. [Figure 43]

[0023] Figure 1 shows genome editing of the CIITA locus resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting the CIITA locus. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence (% frameshift edits) is shown. [Figure 44]

[0039] Figure 44 shows the top five most frequently observed sequence changes for each CIITA-targeting gRNA used for primary human T cell editing. Data are averages from triplicate PCR products. Wild-type (wt) unmodified bases are shown in uppercase. Deletions compared to the wt sequence are indicated by "-" and insertions compared to the wt sequence are shown in lowercase. Figure 44 discloses SEQ ID NOs: 10975-11014, respectively, in order of appearance. [Figure 45] FIG. 1 shows a schematic protocol for preparing primary human T cells edited at the B2M locus, the TRAC locus, and the CIITA locus (triple-edited cells). [Figure 46] Figure 4 shows the assessment of editing of TRAC, B2M, and CIITA by examining cell surface expression of CD3 epsilon, B2M, and HLA-DR, respectively, by flow cytometry. Cell surface expression was examined in cells electroporated with a single targeting RNP (single B2M 442, single TRAC 961, or single CIITA 991) or three RNPs simultaneously (triple 1, triple 2, triple 3, triple 4; as detailed in Figure 45). Cells without electroporation are labeled "No EP." Cells electroporated with Cas9 but not guide RNA are labeled "No guide." [Figure 47]

[0023] Figure 1 shows genome editing of the B2M, TRAC, and CIITA loci resulting from simultaneous electroporation of human primary T cells with three RNPs containing gRNAs targeting the B2M, TRAC, and CIITA loci. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence is shown in parentheses. [Figure 48]

[0049] Figure 48 shows the top 10 most frequently observed sequence changes at the B2M locus in primary human T cells for CR00442, a gRNA targeting B2M, in the context of simultaneous editing of three loci (triple editing) with different concentrations of each RNP, and are shown in the schematic diagram of Figure 45. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by "-" and insertions relative to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. Figure 48 discloses SEQ ID NOs: 11015-11054, respectively, in order of appearance. [Figure 49]

[0049] Figure 49 shows the top 10 most frequently observed sequence changes at the TRAC locus in primary human T cells for gRNA CR000961 targeting TRAC in the context of simultaneous editing of three loci (triple editing) with different concentrations of each RNP, and are shown in the schematic diagram in Figure 45. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by "-" and insertions relative to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. Figure 49 discloses SEQ ID NOs: 11055-11094, respectively, in order of appearance. [Figure 50]FIG. 50 shows the top 10 most frequently observed sequence changes at the CIITA locus in primary human T cells for CR002991, a gRNA targeting CIITA, in the context of simultaneous editing of three loci (triple editing) with different concentrations of each RNP, and are shown in the schematic diagram in FIG. 45. Wild-type (wt) unmodified bases are shown in uppercase. Deletions compared to the wt sequence are indicated by "-" and insertions compared to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. FIG. 50 discloses SEQ ID NOs: 11095-11134, respectively, in order of appearance. [Figure 51]

[0023] Figure 1 shows that guide RNA formats were assessed for editing efficiency. Guide RNAs for TRAC (CR000961; top panel) or B2M (CR00442; bottom panel) were synthesized in single-guide or dual-guide formats with or without the indicated chemical modifications (PS or OMePS). RNPs were electroporated into human primary T cells at the indicated concentrations. Editing efficiency was assessed by flow cytometry: for TRAC editing, by analysis of cell surface staining for CD3 epsilon (top), and for B2M editing, by analysis of cell surface staining for B2M protein (bottom). [Figure 52]

[0023] Figure 1 shows genome editing of the FKBP1A locus resulting from electroporation of human primary T cells with RNPs containing the indicated gRNAs targeting FKBP1A. The frequency of insertions or deletions (% indels) is indicated, and the percentage of these edits that result in frameshifting of the coding sequence is shown. [Figure 53]

[0049] Figure 53 shows the top five most frequently observed sequence changes for each gRNA targeting FKBP1A used for editing primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase. Deletions compared to the wt sequence are indicated by "-" and insertions compared to the wt sequence are shown in lowercase. Data are averages from triplicate PCR products. Figure 53 discloses SEQ ID NOs: 11135-11159, respectively, in order of appearance. [Figure 54]Figure 1 shows that T cells were edited with RNPs containing gRNAs with targeting domains against FKBP1A (CR002086, CR002097, CR002122; denoted as 2086, 2097, and 2112, respectively), as well as negative controls: 442 (uninvolved guide CR00442 targeting B2M); Cas9 (Cas9 alone without trRNA or crRNA); trRNA (with tracerRNA, but no crRNA or Cas9 protein); Cas9+trRNA (with Cas9 and tracerRNA, but no crRNA); EP (cells with electroporation alone); and no EP (cells without electroporation alone). After electroporation, cells were treated with 2.5 nM RAD001 (upper panel) or left untreated (lower panel), and the effect of mTOR pathway inhibition was assessed by analyzing S6 phosphorylation (pS6) by flow cytometry. The Y-axis indicates forward scatter (FSC), and the X-axis indicates pS6 levels. Positive staining for pS6 (shown in the gating trace) was determined by gating above the fluorescence level seen in the isotype antibody-stained control (not shown). Quantification of S6 phosphorylation from flow cytometry data is shown in the lower panel of the graph. [Figure 55-1]Figures 55A and 55B show cytokine production by edited CART cells in response to antigen exposure. Gene editing was performed on CART cells targeting the TRAC locus using the CR000961 guide and / or the FKBP1A locus using the CR002097 and CR002086 guides (shown as cr961, 2097, and 2086, respectively). CART cells electroporated with RNP containing no-guide RNA were prepared as a negative control. CART cells expressing CART-CD19, CART-BCMA-10, or untransduced (UTD) (as indicated) were mixed with the indicated cancer cells (KMS11 (BCMA-positive), Nalm6 (CD19-positive), or RPMI8226 (BCMA-positive)) at an effector-to-target ratio of 1:1 or 1:2.5 (as indicated). Cell culture supernatants were collected and either interferon gamma was measured (Panel A) or IL-2 was measured (Panel B). [Figure 55-2] (As mentioned above.) [Figure 56] Figure 1 shows killing of antigen-positive cancer cell lines by edited CART cells. Gene editing was performed on CART cells targeting the TRAC locus using the CR000961 guide and / or the FKBP1A locus using the CR002097 and CR002086 guides (denoted as cr961, 2097, and 2086, respectively). CART cells electroporated with RNP containing no-guide RNA were prepared as negative controls. CART cells expressing CART-CD19, CART-BCMA-10, or untransduced (UTD) (as indicated) were mixed with the indicated cancer cell lines stably expressing a luciferase reporter (KMS11 (BCMA-positive), Nalm6 (CD19-positive), or RPMI8226 (BCMA-positive)) at an effector-to-target ratio of 1:1. The luciferase signal was measured and cell killing was determined as the loss of luciferase activity. [Figure 57]

[0023] Figure 1 shows the proliferation of edited CART cells in response to antigen exposure. Gene editing was performed on CART cells targeting the TRAC locus using guide CR000961 and / or the FKBP1A locus using guides CR002097 and CR002086 (designated 961, 2097, and 2086, respectively). CART cells electroporated with RNP containing no-guide RNA were prepared as a negative control. CART cells expressing CART-CD19 (labeled CD19CAR), CART-BCMA-10 (labeled BCMA10CAR), or untransduced (UTD) (as indicated) were mixed with the indicated cancer cell lines (KMS11 (BCMA-positive), Nalm6 (CD19-positive), or RPMI8226 (BCMA-positive)) at an effector-to-target ratio of 1:1. Proliferation was measured by counting the total CD4+ and CD8+ cells that are CAR+ against a fixed number of counting beads. [Figure 58-1]Figure 58: A diagram showing the sensitivity of gene (TRAC and / or FKBP1A) edited CART cells to RAD001. CART cells expressing a BCMA10 CAR (A), a CD19 CAR (B), or no CAR (C; UTD) were prepared. Gene editing was performed on CART or UTD cells using guide CR000961 to target the TRAC locus and / or guides CR002097 and CR002086 to target the FKBP1A locus (denoted 961, 2097, and 2086, respectively). CART cells electroporated with RNP containing no-guide RNA were prepared as a negative control. After electroporation with RNP, cells were treated with 2.5 nM RAD001 (upper panel; shown with RAD001) or left untreated (lower panel; shown without RAD001), and the effect on mTOR pathway inhibition was assessed by analyzing S6 phosphorylation (pS6) by flow cytometry. The Y-axis indicates side scatter (SSC), and the X-axis indicates the level of phosphorylated S6 protein (pS6). Positive staining for pS6, shown in the lower right quadrant of the FACS plot, was determined by gating above the fluorescence level seen in the isotype antibody-stained control (not shown). The percentage of cells phosphorylated S6 is shown in the histogram (upper panel) and graph (lower panel). [Figure 58-2] (As mentioned above.) [Figure 58-3] (As mentioned above.) [Figure 58-4] (As mentioned above.) [Figure 58-5] (As mentioned above.) [Figure 58-6] (As mentioned above.) [Figure 58-7] (As mentioned above.) [Figure 58-8] (As mentioned above.) [Figure 58-9] (As mentioned above.) [Figure 59]Figure 1 shows the expression of HLA-G / B2M fusion protein in SupT1 cells as detected by HLA-G flow cytometry. The light gray histogram indicates background fluorescence in non-transduced cells in the PE channel. The dark gray histogram indicates fluorescence from HLA-G / B2M-transduced cells in the PE channel. [Figure 60]

[0023] Figure 1 shows editing efficiencies at the B2M locus targeted by different Cas9 mutants in CD34+ hematopoietic stem cells, as assessed by NGS and flow cytometry. NLS = SV40 NLS; His6 (SEQ ID NO: 10795) or His8 (SEQ ID NO: 10796) refer to six or eight histidine residues, respectively; TEV = tobacco etch virus cleavage site; and Cas9 = wild-type S. pyogenes Cas9 (mutations or variants are as indicated). [Figure 61] FIG. 1 shows the editing efficiency and concentration range at the B2M locus targeted by different Cas9 variants in primary human T cells as measured by flow cytometry. [Figure 62] Figure 1 shows the editing efficiency of two different Cas9 mutants at various concentrations in primary human T cells using two different gRNAs targeting B2M (left panel) or TRAC (right panel). Editing efficiency (% edit) was measured by measuring the loss of cell surface expression of B2M (left panel) or TCR (right panel) by flow cytometry. [Figure 63]Figure 1 shows that the off-target activity of TRAC and B2M guides was assessed using dsDNA oligo insertion in HEK-293 cells overexpressing Cas9. Detected on-target sites (triangles) and potential off-target sites (circles) are displayed. The y-axis indicates detection frequency. All gRNAs were examined in dgRNA format, with targeting domains indicated by CRxxxxx identifiers. Each gRNA shown was modified so that the three 5' and three 3' internucleotide linkages were phosphorothioate ("PS") linkages. [Figure 64] Figure 1 shows that guide RNA molecules targeting CIITA, FKBP1A, PDCD1, TRAC, and TRBC2 were evaluated for off-target activity using the dsDNA oligo insertion method in HEK-293 cells overexpressing Cas9. Detected on-target sites (triangles) and potential off-target sites (circles) are displayed. The y-axis indicates detection frequency. All gRNAs were examined in dgRNA format, with targeting domains denoted by CRxxxxx identifiers. [Figure 65] Figure 1 shows % editing in primary human CD3+ T cells, as measured by loss of CD3 surface expression (measured by flow cytometry), 72 hours after transfection with a CRISPR system targeting CD3 delta (dgRNA containing the indicated targeting domain). Each % CD3-negative cell is the mean (SD = standard deviation) of three independent experiments. [Figure 66] Figure 1 shows % editing in primary human CD3+ T cells, as measured by loss of CD3 surface expression (measured by flow cytometry), 72 hours after transfection with a CRISPR system targeting CD3 gamma (dgRNA containing the indicated targeting domain). Each CD3 negative cell % mean is the mean (SD = standard deviation) of three independent experiments.

[0159] definition The terms "CRISPR system," "Cas system," or "CRISPR / Cas system" a molecule comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule; a set of molecules, together with an RNA-guided nuclease or other effector molecule; a set of sequences necessary and sufficient to direct and effect modification of nucleic acids in a target sequence by In one embodiment, the CRISPR system comprises a gRNA and a Cas protein, e.g., a C As used herein, the term "Cas9" refers to a protein that contains a Cas9 or modified Cas9 molecule. Such a system is referred to as a "Cas9 system" or a "CRISPR / Cas9 system." In this case, the gRNA molecule and the Cas molecule are complexed together to form a ribonucleoprotein (RNP) complex. Form a coalescence.

[0160] "Guide RNA," "guide RNA molecule," "gRNA molecule," or "gRNA" The terms RNA-guided nuclease and RNA-guided nuclease are used interchangeably and refer to RNA-guided nucleases or other effector molecules. It facilitates specific targeting of a molecule (typically complexed with a gRNA molecule) to a target sequence. In some embodiments, the direction refers to a set of nucleic acid molecules that guide the gRNA. hybridization to DNA (e.g., the targeting domain of the gRNA) via an RNA-guided nuclease or other nucleotide sequence of a portion of the gRNA molecule. by binding to an effector molecule (e.g., via at least the tracr of the gRNA) In embodiments, a gRNA molecule is referred to herein as a "single-guide RNA." A single continuous polynucleotide molecule, designated "gRNA" or "sgRNA" is used. In this embodiment, the gRNA molecule comprises multiple polynucleotide molecules, typically two polynucleotides. nucleotide molecules which themselves are capable of association, typically via hybridization. and are referred to herein as "dual guide RNAs" or "dgRNAs." gRNA molecules are described in more detail below and generally comprise: In some embodiments, the targeting domain comprises a tracr. In another embodiment, the domain and the tracr are located on a single polynucleotide. The targeting domain and tracr are located on separate polynucleotides.

[0161] The term "targeting domain" as used in the context of gRNAs , recognize a target sequence, e.g., a target sequence within a nucleic acid of a cell, e.g., a gene, e.g., This is the portion of the gRNA molecule that is complementary to it.

[0162] The term "crRNA" as used in relation to gRNA molecules refers to the target The binding domain and the region that interacts with tracr to form the flagpole region. is a portion of a gRNA molecule comprising:

[0163] The term "target sequence" refers to a sequence that is complementary to the targeting domain of a gRNA, e.g., In some embodiments, the target sequence is located on genomic DNA. In one embodiment, the target sequence is located (on the same strand of DNA or on the complementary strand). Proteins recognized by proteins with nuclease or other effector activity a spacer adjacent motif (PAM) sequence, e.g., a PAM sequence recognized by Cas9 In embodiments, the target sequence is a target sequence of an allogeneic T cell target. In some embodiments, the target sequence is a target sequence of an inhibitory molecule. The target sequence is the target sequence of a downstream effector of the inhibitory molecule.

[0164] As used herein, the term "flagpole" in relation to a gRNA molecule The crRNA and tracr bind to each other or hybridize to each other. This refers to the part of the gRNA that

[0165] As used herein, the term "tracr" as used in reference to a gRNA molecule means Refers to the portion of the gRNA that binds to a nuclease or other effector molecule. In some embodiments, tracr comprises a nucleic acid sequence that specifically binds to Cas9. In the present specification, tracr comprises a nucleic acid sequence that forms part of the flagpole.

[0166] The term "Cas9" or "Cas9 molecule" refers to a bacterial enzyme that is responsible for DNA cleavage. Refers to an enzyme derived from a type II CRISPR / Cas system. Cas9 is also a wild-type protein. This includes all known genes, as well as their functional and non-functional mutants.

[0167] The term "complementary" as used in reference to nucleic acids refers to base pairing, A's, T's, or U's. and G with C. The term complementary refers to completely complementary nucleic acid molecules. , i.e., forming AT pairs or AU pairs and GC pairs throughout the reference sequence as well as nucleic acid molecules at least 80%, 85%, 90%, 95%, or 99% complementary thereto. Also refers to.

[0168] "Template nucleic acid" as used in the context of homology-directed repair or homologous recombination refers to a nucleic acid that is For gene repair (insertion) in the target cell, the donor sequence inserted into the modified site by the CRISPR system is used. In one aspect, the template nucleic acid refers to a nucleic acid that is capable of expressing a chimeric antigen receptor, e.g., a chimeric antigen receptor, as described herein. In one embodiment, the template nucleic acid comprises a nucleic acid sequence encoding a receptor (CAR). and a vector comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR) as described in the document. .

[0169] As used herein, an "indel" refers to a gene that is present in a gRNA molecule, e.g., a CRI. A nucleic acid sequence that is amplified by one or more nucleic acids compared to a reference nucleic acid after exposure to a composition comprising an SPR system. Insertion of a nucleotide, deletion of one or more nucleotides, or insertion and deletion of nucleotides Indels refer to nucleic acids that contain a combination of a gRNA molecule and a nucleotide sequence. Indels are formed after exposure to a composition containing a gRNA molecule. This can be determined, for example, by sequencing the nucleic acid by NGS. For the reference site, it is about 10, 9, 8, 7, 6, 5, 4, 3, 2 or contains at least one insertion or deletion within 1 nucleotide of overlapping part or all of the reference site (e.g., at least one insertion or deletion) wherein the targeting domain of the gRNA molecule, e.g., a gR Insertions or deletions overlapping with the site complementary to the NA molecule, or from this, (including insertions or deletions of 7, 6, 5, 4, 3, 2, or 1 nucleotide or less) , indels are inserted into a reference site (e.g., a site complementary to the targeting domain of a gRNA molecule) ) is said to be "in or near this location."

[0170] As used herein, an "indel pattern" refers to a gene expression pattern that is a sequence of genes that contain a gRNA molecule. In one embodiment, the indel pattern refers to a set of indels that arise after exposure to a compound. The group consists of the top three indels by frequency of occurrence. The pattern consists of the top five indels by frequency of occurrence. A delta pattern is an intrinsic pattern present at a frequency greater than approximately 5% of all sequencing reads. In one embodiment, the indel pattern comprises indel sequencing reads. (i.e., reads that do not consist of the unmodified reference nucleic acid sequence) In one embodiment, the indel pattern consists of indels present at the most frequent The indel pattern includes any three of the top five indels observed at the highest frequency. For example, by sequencing cells from a cell population exposed to gRNA molecules. It can be determined.

[0171] As used herein, an "off-target indel" refers to an indel that is present in a gRNA molecule. Indels at or near sites other than the target sequence of the targeting domain Such sites are, for example, located at the site of the targeting domain of a gRNA. Compared to the sequence, there are 1, 2, 3, 4, 5 or more mismatched nucleotides. In exemplary embodiments, such moieties may be identified in silico. using targeted sequencing of predicted off-target sites, and is detected by insertion methods known in the art.

[0172] The term "inhibitory molecule" refers to a molecule that, when activated, inhibits cell survival, activation, proliferation, and / or proliferation. or a molecule that causes or contributes to the inhibition of function; and a molecule encoding said molecule. It refers to a gene and its associated regulatory elements, such as a promoter. In embodiments, the inhibitory molecule is a molecule expressed on immune effector cells, e.g., T cells. Non-limiting examples of inhibitory molecules include PD-1, PD-L1, PD-L2, and CTLA4. , TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3(CD276), B7-H4(V TCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MH These inhibitors are C class I, MHC class II, GAL9, adenosine, and TGF-beta. The term inhibitory molecule, when used in relation to a target sequence or gRNA molecule, refers to an inhibitory It is understood that this refers to the gene (and its associated regulatory elements) that codes for the protein of a molecule. In one embodiment, the gene encoding the inhibitory molecule is CD274. In one embodiment, the gene encoding the inhibitory molecule is HAVCR2. In embodiments, the gene encoding the inhibitory molecule is LAG3. The gene encoding the inhibitory molecule is PDCD1.

[0173] The term "downstream effector of signal transduction via an inhibitory molecule" refers to a downstream effector of an inhibitory molecule. a molecule that mediates the inhibitory effect of the gene encoding said molecule and its associated regulatory gene; The term refers to a downstream element, e.g., a promoter, of signal transduction via an inhibitory molecule. The term effector, when used in relation to a target sequence or gRNA molecule, refers to an inhibitory Genes encoding downstream effectors of protein-mediated signal transduction of sex molecules (and In one embodiment, the term "inhibitory" refers to a gene encoding a nucleotide sequence (e.g., a nucleotide sequence and its associated regulatory elements). The genes encoding downstream effectors of toxic molecule-mediated signal transduction are PTPN1 and PTPN1. It is 1.

[0174] As used herein, "allogeneic T cell targets" and "allogeneic T cells" refer to The terms "cell target" and "target" are used interchangeably and refer to a target that mediates a host-versus-graft response. or mediating or contributing to the graft-versus-host response a protein that is a target of an immunosuppressant drug; a gene encoding said molecule; and and its associated regulatory elements, e.g., promoter. The term "gRNA targeting" when used in reference to a target sequence or gRNA molecule refers to the targeting of allogeneic T cells. Understood to refer to the gene (and its associated regulatory elements) that encodes the target protein Without being bound by theory, for example, the methods and compositions disclosed herein Inhibition or elimination of one or more allogeneic T cell targets by, for example, Reduce or eliminate immunogenicity (such as host-versus-graft or graft-versus-host responses) By using the allogeneic T cells, the efficacy, survival, function, and may improve survival and / or survival.

[0175] In non-limiting examples, mediating a graft-versus-host response or a host-versus-graft response, or The proteins responsible for this are components of one or more T cell receptors. In form, the component of the T cell receptor is the T cell receptor alpha, e.g., TCR alpha In one embodiment, the T cell receptor component is the constant domain of the T cell receptor. beta chain, e.g., constant domain 1 or constant domain 2 of TCR beta. In an embodiment, the T cell receptor component is the delta chain of the T cell receptor. In one embodiment, the T cell receptor component is the epsilon chain of the T cell receptor. In one embodiment, the component of the T cell receptor is the zeta chain of the T cell receptor. The component of the cell receptor is the gamma chain of the T cell receptor. Therefore, allogeneic T cells In some embodiments, the protein encoded by the target is a component of a TCR. Genes encoding allogeneic T cell targets include, for example, TRAC, TRBC1, TRBC2 , CD3D, CD3E, CD3G, or CD247, and combinations thereof. .

[0176] In non-limiting examples, mediating a graft-versus-host response or a host-versus-graft response, or The proteins responsible for this are HLA proteins or B2M. Examples of HLA include HLA-A, HLA-B, and HLA-C. In some embodiments, the target protein of the cell is an HLA or B2M protein. Genes encoding allogeneic T cell targets include, for example, HLA-A, HLA-B, HLA- In another embodiment, the allogeneic T cells may be C, B2M, or B2M, and combinations thereof. The allogeneic T cell target protein is NLRC5, and the gene encoding the allogeneic T cell target is For example, it may be NLRC5.

[0177] In non-limiting examples, mediating a graft-versus-host response or a host-versus-graft response, or The proteins that contribute to this are major histocompatibility complex class II (MHC II) molecules ( For example, HLA-Dx (where x is an MHC II protein, e.g., HLA-DM) , HLA-DO, HLA-DR, HLA-DQ, and / or HLA-DP. or a regulatory factor for the expression of MHC II, and combinations thereof. A non-limiting example is CIITA (also referred to herein as C2TA). Thus, in some embodiments, the target protein of the allogeneic T cells is CIITA. The gene encoding the allogeneic T cell target can be, for example, CIITA. Typical examples include those that mediate or contribute to graft-versus-host or host-versus-graft responses. In another non-limiting example, a protein that inhibits graft-versus-host response or Proteins that mediate or contribute to the host-versus-graft response include RFXAP and RFXAP-1. In another non-limiting example, a marker that mediates a graft-versus-host response or a host-versus-graft response is , or a protein that contributes to this is RFX5.

[0178] As used herein, the term "target of an immunosuppressant drug" refers to a molecular target of an immunosuppressant drug, e.g., For example, a receptor or other protein (herein referred to as a drug or drug target) "Immunosuppressant" and "immunosuppressive" Immunosuppressants are drugs that act through one of several mechanisms of action. In other words, immunosuppressants are compounds that suppress immune function. The role played by the immune system is manifested by its ability to attenuate the degree of immune response and / or phagocytosis. One example of the type of activity exhibited by immunosuppressants is the suppression of T cells, e.g. For example, the activity of eliminating activated T cells. Another example is the activity of reducing the activity or activation level of T cells. , immunosuppressants include calcineurin inhibitors, target of rapamycin, and interleukin-2 a-chain blocker, inhibitor of inosine monophosphate dehydrogenase, dihydrofolate reductase inhibitors of steroids, corticosteroids, cyclosporine, or immunosuppressive antimetabolites. Classical cytotoxic immunosuppressants act by inhibiting DNA synthesis. Cytotoxic immunosuppressants act through T cell activation or by blocking helper cell activation. As a non-limiting example, the target of an immunosuppressant is deoxycytosine. kinase, CD52, glucocorticoid receptor (GR), FKBP family genes Members of the cyclophilin family of genes, such as FKBP12, In one embodiment, the target of the immunosuppressant drug is a deoxyribonucleotide. cytidine kinase (DCK), and the immunosuppressant is cytarabine (cytosine arabinoside ) or gemcitabine. The target of immunosuppressive drugs is the GR, and immunosuppressants are corticosteroids such as dexamethasone. In one embodiment, the target of the immunosuppressant is CD52 and the immunosuppressant is , anti-CD52 antibodies such as alemtuzumab (CAMPATH®) or their antigens In one embodiment, the target of the immunosuppressant is FKBP12, and the immunosuppressant is a binding fragment. Inhibitors include FK506 (or its analogs or FKBP12-binding fragments), cyclohexyl mTor inhibitors such as rosporin, rapamycin or rapalogs, or RAD001 Therefore, allogeneic T cell targets are multiple target proteins of immunosuppressants. In this embodiment, the gene encoding the allogeneic T cell target is, for example, NR3C1, FK It can be BP1A, CD52, or DCK, and combinations thereof.

[0179] The term "rapamycin-resistant mTor" refers to binding to FKBP12 (rapamycin, mTo such as FK506, rapalogs, cyclosporine, and / or other RAD001 mTor protein (and In exemplary embodiments, the gene encoding the mTor protein is The vasomycin-resistant mTor contains one or more mutations to the FRB domain. In an exemplary embodiment, the rapamycin-resistant mTor is a mutation at S2035. e.g., comprising, e.g., comprising, e.g., a mutation consisting of, e.g., a S2035I mutation For example, it will happen from now on.

[0180] The terms "a" and "an" have one grammatical object of the article. Refers to having or having more than one (i.e., at least one). As used herein, "an element" means one element or more than one element.

[0181] The term "about" when referring to a quantity, duration in time, or other measurable value, is used to express the extent to which such a variable can be measured. The variations may be within ±20% or less from the values ​​specified as appropriate for carrying out the disclosed method. or in some cases ±10%, or in some cases ±5%, or in some cases ±1 % or, in some cases, is intended to encompass a variation of ±0.1%.

[0182] The term "chimeric antigen receptor" or alternatively "CAR" typically refers to the simplest In some embodiments, a set of two polypeptides is administered to an immune effector cell. In some cases, cells are engineered to have specificity for target cells, typically cancer cells, and to control intracellular signaling. In some embodiments, a CAR refers to a set of genes that result in the development of a stimulatory Contains functional signaling domains derived from stimulatory and / or costimulatory molecules , at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signal transduction domain domain (also referred to herein as an "intracellular signaling domain"). In some aspects, the set of polypeptides are contiguous with one another. The set of peptides couples the polypeptides to each other in the presence of a dimerization molecule. For example, an antigen-binding domain can be coupled to an intracellular signaling domain. In one embodiment, the stimulatory molecule comprises a dimerization switch that can be activated by the T cell receptor complex. In one aspect, the cytoplasmic signaling domain is a zeta chain, as defined below. one or more functional signaling domains derived from at least one costimulatory molecule In one aspect, the costimulatory molecule is a costimulatory molecule described herein, e.g., For example, a selection from 41BB (i.e., CD137), CD27, and / or CD28. In one embodiment, the CAR comprises a functional signaling domain derived from a stimulatory molecule. It contains an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In one embodiment, the CAR comprises a chimeric fusion protein comprising a co-stimulatory molecule. functional signaling domains and functional signals derived from stimulatory molecules. The antibody comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain. In one embodiment, the CAR comprises a chimeric fusion protein comprising one or more nucleic acid transduction domains. Two functional signaling domains derived from multiple costimulatory molecules and a stimulatory molecule and a functional signaling domain derived from an extracellular antigen-binding domain, a membrane The present invention also includes chimeric fusion proteins comprising a transmembrane domain, ... and an intracellular signaling domain. In one embodiment, the CAR comprises at least two co-stimulatory molecules derived from one or more co-stimulatory molecules. Functional signaling domains and functional signaling domains derived from stimulatory molecules The antibody comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In one embodiment, the CAR comprises a chimeric fusion protein comprising a CAR fusion protein. In one embodiment, the protein comprises an optional leader sequence at the amino-terminus (N-ter) of the protein. The CAR further comprises a leader sequence at the N-terminus of the extracellular antigen-binding domain, In this case, the leader sequence optionally facilitates intracellular processing and delivery of the CAR to the cell membrane. Upon localization, it is cleaved from the antigen-binding domain (eg, scFv).

[0183] Targeting a specific tumor marker X, such as a tumor marker described herein CARs containing an antigen-binding domain (e.g., scFv or TCR) can also be used as X CARs. For example, a CAR containing an antigen-binding domain that targets CD19 can be As another example, an antigen-binding antibody targeting BCMA is A CAR containing the domain is referred to as a BCMA CAR.

[0184] The term "signaling domain" refers to a domain that acts by generating second messengers. They transmit intracellular information to regulate cellular activity through defined signaling pathways. By transmitting or responding to such messengers, It refers to the functional portion of a protein that acts by functioning as a vector.

[0185] As used herein, the term "antibody" refers to a protein derived from an immunoglobulin molecule. An antibody is a protein or polypeptide sequence that specifically binds to an antigen. , which may be polyclonal, monoclonal or multi-chain may be single chain or whole immunoglobulins, derived from natural sources Antibodies may be derived from recombinant sources or from a recombinant source. It can be a dimer.

[0186] The term "antibody fragment" refers to an antibody fragment that specifically interacts with (e.g., binds to) an epitope of an antigen. At least some of the antibodies retain their potency (due to steric hindrance, stabilization / destabilization, spatial distribution). Examples of antibody fragments include Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fv (sdFv), VH domains and CH1 domains Single domain antibodies such as Fd fragments, linear antibodies, and sdAbs (VL or VH) consisting of a domain antibodies, camelid VHH domains, and polyspecific antibodies formed from antibody fragments. A bivalent fragment containing two Fab fragments linked by a disulfide bridge in the range region. fragments, and isolated CDRs or epitope-binding fragments of other antibodies. Antigen-binding fragments also include single domain antibodies, maxibodies, minibodies, nanobodies, and the like. Nobodies, intrabodies, diabodies, triabodies, tetrabodies, v -NAR, and bis-scFv (see, e.g., Hollinger and Huds (See, Nature Biotechnology 23:1126-1136, 2005). Antigen-binding fragments also include , grafting onto scaffolds based on polypeptides such as type III fibronectin (Fn3). (See U.S. Pat. No. 6,449,623, which describes fibronectin polypeptide minibodies.) See U.S. Pat. No. 6,703,199.

[0187] The term "scFv" refers to an antibody fragment comprising at least one antibody fragment containing the variable region of a light chain and a heavy chain. and at least one antibody fragment containing the variable region of a light chain, The variable region and the heavy chain variable region may be separated, for example, by a synthetic linker, e.g., a short, flexible polypeptide. They can be linked together via a linker and expressed as a single polypeptide chain. scFv refers to a fusion protein that retains the specificity of the intact antibody from which it is derived. As used herein, an scFv refers to a polypeptide that is, for example, a polypeptide having a C-terminal end and a C-terminal end. Unless otherwise specified, the VL and VH variable regions may be in any order. In this case, the scFv may contain VL-linker-VH, and VH-linker-VL It may also include.

[0188] The portion of the CAR of the invention that comprises an antibody or antibody fragment thereof comprises an antigen-binding domain, e.g., For example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or The bispecific antibody may exist in various forms expressed as part of a continuous polypeptide chain. (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. S ci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). The antigen-binding domain of the disclosed CAR composition comprises an antibody fragment. The exact amino acid sequence boundaries of a given CDR are defined by Kaba et al. t et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Pu. blic Health Service, National Institutes of Health, Bethesda, MD (``Kabat'' numbering scheme), Al-Lazikani et al., (1997) JMB 273,927-948 ("Chothia Many well-known schemes are known, including those described by the "numbering scheme" (" The determination can be made using any one of these, or a combination of these.

[0189] As used herein, the term "binding domain" or "antibody molecule" refers to a protein a substance, e.g., an immunoglobulin, comprising at least one immunoglobulin variable domain sequence The term "binding domain" or "antibody molecule" refers to an antibody or In some embodiments, the antibody molecule is a multispecific antibody molecule, e.g., a For example, an antibody molecule may contain multiple immunoglobulin variable domain sequences, in which case multiple immunoglobulins may be present. The first immunoglobulin variable domain sequence is A fusion protein that has binding specificity for a single epitope and is composed of multiple immunoglobulin variable domain sequences. The second immunoglobulin variable domain sequence has binding specificity for a second epitope. In certain embodiments, the multispecific antibody molecule is a bispecific antibody molecule. Antibodies have specificity for no more than two antigens. Bispecific antibody molecules have specificity for the first epitope and the second epitope. a first immunoglobulin variable domain sequence having binding specificity for a second epitope; and a second immunoglobulin variable domain sequence having binding specificity for the tope. do.

[0190] The portion of the CAR of the invention that comprises an antibody or antibody fragment thereof comprises an antigen-binding domain, e.g., For example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or The bispecific antibody may exist in various forms expressed as part of a continuous polypeptide chain. (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. S ci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). The antigen-binding domain of the disclosed CAR composition comprises an antibody fragment. includes antibody fragments, including scFvs.

[0191] The term "antibody heavy chains" refers to the heavy chains present in antibody molecules in their naturally occurring conformation. The larger of the two types of polypeptide chains that exist, and this chain is usually , which determines the class to which the antibody belongs.

[0192] The term "antibody light chains" refers to the light chains present in antibody molecules in their naturally occurring conformation. The smaller of the two types of polypeptide chains that exist. Kappa (κ) light chain and lambda (λ) light chain refer to the two major antibody light chain isotypes.

[0193] The term "recombinant antibody" refers to antibodies that are produced using, for example, bacteriophage or yeast expression systems. The term also refers to antibodies produced using recombinant DNA technology, such as antibodies expressed using recombinant DNA technology. The term "antibody" may also be construed to mean an antibody produced by synthesis of a DNA molecule encoding the antibody. The DNA molecule expresses an antibody protein, or an amino acid sequence that specifies an antibody. In this case, the DNA or amino acid sequences are available and can be prepared by recombinant methods well known in the art. They have been obtained using DNA or amino acid sequencing techniques.

[0194] The term "antigen" or "Ag" refers to a molecule that provokes an immune response. induces antibody production or activation of specific immune-competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including virtually any protein or peptide, may be It will be understood that antigens may function as antigens. Furthermore, antigens may be derived from recombinant DNA. It may be derived from genomic DNA or from a recombinant protein. A nucleotide sequence or partial nucleotide sequence that encodes a protein that elicits an answer Any DNA, including the following, encodes an "antigen" as that term is used herein: Furthermore, one skilled in the art will understand that an antigen may be determined solely by the full length nucleotide sequence of a gene. It will be understood that the present invention does not require that the gene be encoded by a single gene. These nucleotide sequences include, but are not limited to, the use of nucleotide sequences such as: Arranged in various combinations to encode polypeptides that elicit the desired immune response Furthermore, those skilled in the art will appreciate that antigens are encoded by "genes." It will be understood that antigens need not be synthetically produced or naturally occurring. It may be derived from a biological sample and may be a polypeptide or a polymer. It is readily apparent that such biological samples may contain other biological components. These may include, but are not limited to, tissue samples, tumor samples, cells, or body fluids.

[0195] The term "anti-cancer effect" refers to a biological effect that can be manifested by a variety of means, For example, reduction in tumor volume, reduction in cancer cell count, reduction in metastasis, extension of life expectancy, cancer cell A variety of physiological symptoms associated with decreased proliferation, decreased cancer cell survival, or a cancerous state "Anti-cancer effect" also refers to a biological effect, including but not limited to, the alleviation of cancer. , on the ability of peptides, polynucleotides, cells, and antibodies in preventing the development of cancer. The term "anti-tumor effect" refers to a biological effect that can be manifested by a variety of means. biological effects, such as a reduction in tumor volume, a reduction in tumor cell number, or a reduction in tumor cell proliferation or refers to a biological effect including, but not limited to, a reduction in tumor cell survival.

[0196] The term "autologous" refers to a gene derived from the same individual and subsequently reintroduced into that individual. Refers to any material.

[0197] The term "allogeneic" refers to a material derived from a different animal of the same species as the individual into whom the material is introduced. If the genes at one or more loci are not identical, Two or more individuals are said to be allogeneic to one another. Allogeneic material from a single individual is sufficiently genetically heterologous to interact as an antigen. It can be one.

[0198] The term "xenogeneic" refers to a graft derived from an animal of a different species.

[0199] The term "cancer" refers to diseases characterized by the uncontrolled growth of abnormal cells. The cells may also spread locally and travel via the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein, including breast cancer, prostate cancer, Adenocarcinoma, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, and liver cancer These include, but are not limited to, cancer, brain tumors, lymphoma, leukemia, lung cancer, and the like. The terms "tumor" and "cancer" are used interchangeably, e.g., either term may refer to: This includes solid tumors and liquid tumors, e.g., diffuse or circulating tumors. The terms "cancer" or "tumor" as used herein include premalignant cancers and tumors as well as Also includes malignant cancer and malignant tumors.

[0200] As used herein, "derived from" refers to a molecule that is a first molecule and a second molecule. "Derived from" generally refers to the relationship between a first molecule and a second molecule. refers to the structural similarity of a molecule to another molecule, and the relative similarity of a molecule to a first molecule derived from a second molecule. No limitations on the process or source of the For example, in the case of the intracellular signaling domain derived from the CD3 zeta molecule, The signaling domain is a domain that allows the intracellular signaling domain to perform the required function, i.e., Sufficient CD3 zeta structures are available to have the ability to generate a signal under appropriate conditions. It contains the intracellular signaling domain derived from the CD3 zeta molecule. It does not imply or include limitations to the specific steps involved, such as "Derived from the CD3 zeta molecule" refers to a molecule that provides an intracellular signaling domain. To achieve this, we start with the CD3 zeta sequence and delete or mutate undesired sequences. This does not mean that the protein must reach the intracellular signaling domain. There is no.

[0201] The phrase "diseases associated with expression of the tumor antigens described herein" refers to diseases as described herein. a disease associated with expression of a tumor antigen as described herein, or a disease that expresses a tumor antigen as described herein conditions associated with cells that express the IL-1 receptor, such as cancer or malignant tumors, or myelodysplasia, proliferative disorders such as myelodysplastic syndromes or precancerous conditions such as preleukemia; or Diseases, including non-cancer-related indications, associated with cells expressing the tumor antigens described herein In one aspect, the expression of tumor antigens described herein is In one aspect, the cancer associated with the expression of a tumor antigen described herein is a hematological cancer. Cancers associated with expression of the tumor antigens described herein are solid tumors. Additional diseases include, for example, atypical cancers and cancers associated with expression of the tumor antigens described herein. and / or non-classical cancers, malignancies, precancerous conditions, or proliferative disorders, including but not limited to: Non-cancer-related indications associated with tumor antigen expression described herein are not limited to: For example, autoimmune diseases (e.g., lupus), inflammatory disorders (allergies and asthma), and In some embodiments, tumor antigen-expressing cells are used in tumor cell transplantation, including, but not limited to, transplantation of tumor cells. expresses mRNA encoding a tumor antigen or, at any time, In some embodiments, the tumor antigen-expressing cells express the tumor antigen protein (e.g., The tumor antigen protein is produced at normal or reduced levels. In some embodiments, cells expressing a tumor antigen may be present at detectable levels of tumor antigen. The tumor antigen protein was produced at one time point, but subsequently no detectable tumor antigen protein was detected. Substantially no protein was produced.

[0202] The term "conservative sequence modifications" refers to the binding of an antibody or antibody fragment containing an amino acid sequence. This refers to amino acid modifications that do not significantly affect or alter the characteristics. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications may be site-directed mutations. By standard techniques known in the art, such as mutagenesis and PCR-mediated mutagenesis, Conservative amino acid substitutions can be introduced into the antibodies or antibody fragments of the present invention. An amino acid substitution is an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. The field has defined families of amino acid residues with similar side chains. The family consists of basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine), glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, threonine, valine, isoleucine), beta-branched side chains (e.g., threonine, valine, isoleucine ), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine, Thus, one or more amino acids within the CAR of the present invention may be The acid residue can be replaced by other amino acid residues from the same side chain family, resulting in variations. The modified CAR can be examined using the functional assays described herein.

[0203] The term "stimulation" refers to the activation of a stimulatory molecule (e.g., a TCR / CD3 complex or a CAR). , induced by binding to its cognate ligand (or tumor antigen in the case of CAR), signaling through the TCR / CD3 complex or the appropriate NK receptor or C signaling through the signaling domain of AR, but are not limited to This refers to the primary response that mediates signal transduction events. Stimuli result in changes in the expression of certain molecules. It can be mediated.

[0204] The term "stimulatory molecule" refers to a molecule expressed by immune cells (e.g., T cells, NK cells, B cells). and a molecule that regulates at least some aspects of immune cell signaling pathways, It refers to a molecule that provides a cytoplasmic signaling sequence that regulates activation in a stimulatory manner. The signal may be, for example, the interaction of the TCR / CD3 complex with a peptide-loaded MHC molecule. T cell responses elicited by binding, including but not limited to proliferation, activation, and differentiation Cytoplasmic primary signal transduction that acts in a stimulatory manner. The sequence (also referred to as the "primary signaling domain") is the tyrosine-based domain of the immunoreceptor. The present invention may contain signaling motifs known as activation motifs or ITAMs. Examples of ITAMs containing cytoplasmic signaling sequences that are particularly useful for use in immunology include CD40 and CD50. 3 zeta, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc epsilon R1b), CD3 gamma, CD3 delta, CD3 epsilon, CD79 a, including ITAMs derived from CD79b, DAP10, and DAP12. Specific CARs of the invention include any one or more CARs of the invention. The intracellular signaling domain in , primary signaling sequences. In a specific CAR of the present invention, the primary signaling sequence of CD3 zeta The gene transfer sequence may be the sequence provided as SEQ ID NO: 18, or a sequence from a non-human species, e.g., mouse, These are equivalent residues from rodents, monkeys, apes, etc. In specific CARs of the invention, The primary signaling sequence of CD3 zeta may be the sequence provided in SEQ ID NO: 20, or a non-human The equivalent residues are from species such as mouse, rodent, monkey, ape, etc.

[0205] The term "antigen-presenting cell" or "APC" refers to a cell that expresses major histocompatibility complexes (MAHCs) on its surface. Accessory cells (e.g., B cells, T cells are cells of the immune system, such as dendritic cells (T cells), that express their T cell receptors (TCRs). APCs can process antigens and recognize these complexes. , and presents it to T cells.

[0206] As used herein, an "intracellular signaling domain" refers to a molecule that is The intracellular signaling domain refers to the portion of the CAR-containing cell, e.g., a CART cell. These cells generate signals that promote immune effector functions. For example, Examples of immune effector functions include cytolytic activity and helper functions, including the secretion of cytokines. and activity.

[0207] In one embodiment, the intracellular signaling domain is an intracellular primary signaling domain. Exemplary intracellular primary signaling domains include those that signal the primary or antigen-dependent stimulation. In some embodiments, the primary intracellular signaling domain is derived from a molecule that contributes to stimulation of the target cell. In some embodiments, the intracellular signaling domain can include a costimulatory intracellular domain. The costimulatory intracellular signaling domains are responsible for the delivery of costimulatory signals or antigen-independent stimulation. The costimulatory intracellular signaling domains are derived from molecules that contribute to the In the case of CART, the intracellular primary signaling domain comprises the cytoplasmic sequence of the T cell receptor It is possible that the costimulatory intracellular signaling domain is a co-receptor or co-stimulatory molecule. It may contain cytoplasmic sequences derived from offspring.

[0208] The intracellular primary signaling domain contains tyrosine-based activation motifs or The cytoplasmic primary signaling sequence may contain signaling motifs known as ITAMs or ITAMs. Examples of ITAM containing sequences are CD3 zeta, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc epsilon R1b), CD3 gamma, CD3 de from ruta, CD3 epsilon, CD79a, CD79b, DAP10, and DAP12 This includes, but is not limited to, derived ITAMs.

[0209] "Zeta" or, alternatively, "Zeta chain", "CD3 zeta", or "TCR The term "zeta" is provided under GenBank accession number BAG36664.1 proteins, or derived from non-human species, e.g., mice, rodents, monkeys, apes, etc. The "zeta stimulatory domain" is defined as the equivalent residues of the CD3 zeta stimulatory domain, or alternatively, the "CD3 zeta stimulatory domain." A "TCR zeta stimulatory domain" or "TCR zeta stimulatory domain" refers to a domain that is a stimulatory domain of the zeta chain, or T a functional derivative thereof sufficient to functionally transmit the initial signal required for cell activation In one embodiment, the amino acid residues derived from the cytoplasmic domain of Zeta are The main sequence is residues 52 to 164 of GenBank accession number BAG36664.1, or non- the equivalent residue from a human species, e.g., mouse, rodent, monkey, ape, etc., In one embodiment, the "zeta stimulatory domain" or The "CD3 zeta stimulatory domain" is the sequence provided as SEQ ID NO: 18. In such instances, a "zeta stimulatory domain" or a "CD3 zeta stimulatory domain" may be any of the following: The sequence is provided as 20.

[0210] The term "costimulatory molecule" refers to the cognate binding partner on a T cell that binds to a costimulatory ligand. and specifically bind to the target gene, thereby inducing effects on T cells, including, but not limited to, proliferation. A costimulatory molecule is a binding partner that mediates a costimulatory response by an antigen receptor or Cell surface molecules other than their ligands that contribute to an efficient immune response Costimulatory molecules are involved in the regulation of MHC class I molecules, BTLA, and Toll ligand receptors. In addition to the condition, OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD 11a / CD18), ICOS (CD278), and 4-1BB (CD137) Further examples of such costimulatory molecules include, but are not limited to, CDS, ICAM- 1, GITR, BAFFR, HVEM(LIGHTR), SLAMF7, NKp80(K LRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, C D8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, I TGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VL A-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB 1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2 C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4 (CD244, 2B4), CD84, CD96(Tactile), CEACAM1, C RTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100( SEMA4D), CD69, SLAMF6(NTB-A, Ly108), SLAM(SL AMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (C D162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a and a ligand that specifically binds to CD83.

[0211] A costimulatory intracellular signaling domain can be the intracellular portion of a costimulatory molecule. The inhibitory molecules are members of the following protein families: TNF receptor proteins, immunoglobulin-like Proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (S Examples of such molecules include the LAM protein, and activating NK cell receptors. are CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NK G2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160 , B7-H3, and ligands that specifically bind to CD83.

[0212] An intracellular signaling domain refers to the entire intracellular portion of the molecule from which it is derived, or The entire native intracellular signaling domain, or a functional fragment or derivative thereof, It may include.

[0213] The term "4-1BB" refers to GenBank accession number AAA62478.2, or The equivalent residues from non-human species, e.g., mouse, rodent, monkey, ape, etc., are provided. 4-1B refers to a member of the TNFR superfamily with an amino acid sequence similar to that of the TNFR The "B costimulatory domain" is the amino acid residues of GenBank accession number AAA62478.2 214-255, or from non-human species, e.g., mice, rodents, monkeys, apes, etc. In one aspect, a "4-1BB costimulatory domain" is defined as the equivalent residues of: The sequence provided as SEQ ID NO: 14, or a non-human species, e.g., mouse, rodent, monkey , and equivalent residues from apes, etc.

[0214] "Immune effector cells," as the term is used herein, are cells that mediate an immune response, e.g. For example, they refer to cells that are involved in promoting immune effector responses. Examples of immune effector cells include: T cells, e.g., alpha / beta T cells and gamma / delta T cells, B cells, natural NK cells, natural killer T (NKT) cells, mast cells, and bone marrow Contains phagocytes derived from the sphere.

[0215] "Immune effector function or immune effector" as that term is used herein A "response" is, for example, an immune effector cell response that enhances or promotes immune attack of a target cell. For example, an immune effector function or response is the killing of target cells. This refers to the property of T cells or NK cells that promotes immune response or inhibits growth or proliferation. In the case of cells, primary and costimulation are involved in immune effector function or immune effector response. This is an example.

[0216] The term "encoding" refers to the process of encoding a specified nucleotide sequence in a biological process. sequences of genes (e.g., rRNA, tRNA, and mRNA) or defined amino acids Genetically engineered polymers that are used as templates for the synthesis of other polymers and macromolecules having the sequence A specific sequence of nucleotides within a polynucleotide, such as a nucleic acid, cDNA, or mRNA refers to the inherent properties of, and the biological properties that result from, a substance, whether intracellular or otherwise. In a biological system, transcription and translation of the mRNA corresponding to that gene produces the protein. When produced, a gene, cDNA, or RNA encodes a protein. The coding strand, whose nucleotide sequence is identical to that of the mRNA, is usually provided in the sequence listing, and Both the coding strand and the non-coding strand, which is used as a template for transcription of the gene or cDNA, are called transcription factors. The strand that encodes the protein or other product of that gene or cDNA. Cut.

[0217] Unless otherwise specified, "a nucleotide sequence encoding an amino acid sequence" means a sequence of nucleotides encoding an amino acid sequence. "Generic sequences" are all nucleotide sequences that are degenerate versions of each other and code for the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA also includes Nucleotide sequences encoding proteins also contain introns in some variations. To some extent, it may also contain introns.

[0218] As used herein, the terms "effective amount" and "therapeutically effective amount" are used interchangeably and are used interchangeably herein. The amount of a compound, formulation, material, or composition described herein that achieves a particular biological outcome refers to an amount effective to achieve a desired effect.

[0219] The term "endogenous" refers to something that originates from or is found within an organism, cell, tissue, or system. It refers to any material produced from these.

[0220] The term "exogenous" refers to something introduced from outside an organism, cell, tissue, or system; refers to any material produced from these.

[0221] The term "expression" refers to the transcription of a particular nucleotide sequence driven by a promoter. Refers to transcription and / or translation.

[0222] The term "transfer vector" includes an isolated nucleic acid and is used to deliver the isolated nucleic acid to the interior of a cell. In the art, the term "polynucleotide" refers to a composition that can be used to prepare a linear polynucleotide, an ionized polynucleotide, or a mixture thereof. Polynucleotides, Plasmids, and Viruses Associated with Compounds or Amphiphilic Compounds - Patent application Numerous vectors are known, including but not limited to, the term "transfer vector." The term "transfectant" includes an autonomously replicating plasmid or a virus. The term also includes, for example, Non-plasmid-based methods such as polylysine compounds and liposomes that facilitate the transfer of nucleic acids into cells The term "viral vector" is also intended to include viral compounds and non-viral compounds. Examples of vectors include adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, and These include, but are not limited to, viral vectors, lentiviral vectors, and the like.

[0223] The term "expression vector" refers to an expression vector operably linked to a nucleotide sequence to be expressed. An expression vector refers to a vector containing a recombinant polynucleotide containing a regulatory sequence. contains sufficient cis-acting elements; other elements for expression are determined by the host cell or in an in vitro expression system. Any expression vector known in the art that incorporates nucleotides, including cosmids , plasmids (e.g., naked plasmids or plasmids contained in liposomes) mide), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated virus).

[0224] The terms "homologous" or "identity" refer to the degree of similarity between two polymer molecules, e.g., Between two nucleic acid molecules, such as DNA molecules or two RNA molecules, or between two polypeptides This refers to the sequence identity of the subunits between two peptide molecules. When the same monomer subunit occupies the same bit position on each of two DNA molecules, e.g. If a position in the The homology between two sequences is a direct function of the number of matching or homologous positions. for example, half of the positions in the two sequences (e.g., 10 subunits long). If all five positions in the polymer are homologous, then the two sequences are 50% homologous; If % of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0225] "Humanized" forms of non-human (e.g., murine) antibodies are derived from non-human immunoglobulins. a chimeric immunoglobulin, a chimeric immunoglobulin chain, or a chimeric immunoglobulin chain containing the minimal sequence required for These fragments (Fv, Fab, Fab', F(ab')2, or other antigen-binding fragments of antibodies) For the most part, humanized antibodies and their fragments are derived from the recipient residues derived from the complementarity-determining regions (CDRs) of a human, such as mouse, rat, or rabbit, CDRs of a non-human species (donor antibody) that provide the desired specificity, affinity, and capacity a human immunoglobulin (recipient) in which the CDRs are replaced by residues from the CDRs having In some cases, the Fv framework of a human immunoglobulin. Residues in the FR region are replaced by corresponding non-human residues. The fragment may be present either in the recipient antibody or in the imported CDR or framework sequences. These modifications may be further refined to improve the efficacy of the antibody or antibody fragment. Generally, a humanized antibody or antibody fragment thereof has at least one One variable domain, typically two variable domains, including all of the CDR regions. or substantially all of the CDR regions of a non-human immunoglobulin sequence, and all of the FR regions or substantially of a variable domain, the significant portion of which is the FR region of a human immunoglobulin sequence. Humanized antibodies or antibody fragments may also contain the constant regions of immunoglobulins (F c), typically at least a portion of the Fc of a human immunoglobulin For further details, see Jones et al., Nature, 321: 522-525, 1986. ; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0226] "Fully human" refers to an immunoglobulin, such as an antibody or antibody fragment, in which the entire molecule is human derived from a human or have amino acid sequences identical to the human form of the antibody or immunoglobulin It refers to immunoglobulins consisting of:

[0227] The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally occurring in a living animal is "isolated." the same nucleic acid or peptide, but partially or completely separated from the material in its natural state. The peptide is "isolated." An isolated nucleic acid or protein is one that has been substantially purified. They may also exist in modified forms and in non-native environments, such as host cells. do.

[0228] The terms "operably linked" or "regulation of transcription" refer to a regulatory sequence and a heterologous nucleic acid sequence. refers to an operative linkage between a nucleic acid sequence and a nucleic acid sequence that results in the expression of the latter. For example, a first nucleic acid sequence, when placed in a functional relationship with a second nucleic acid sequence, For example, a promoter may direct the transcription or expression of a coding sequence. A gene is operably linked to a coding sequence if it actually affects the coding sequence. DNA sequences may be contiguous with one another, for example joining two protein coding regions. If necessary, the sequences are in the same reading frame.

[0229] The term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc) administration, intravenous administration, Intravenous (iv), intramuscular (im), or substernal injection, intratumoral, or includes injection administration.

[0230] The term "nucleic acid" or "polynucleotide" refers to a nucleic acid, Refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and their polymers Unless specifically limited, the term refers to known analogs of natural nucleotides. They have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, the term "nucleic acid" encompasses nucleic acids containing analogs thereof. A given nucleic acid sequence also implicitly includes conservatively modified variants thereof (e.g., degenerate codon substitutions). , alleles, orthologs, SNPs, and complementary sequences, as well as explicitly indicated sequences Specifically, degenerate codon substitutions are those that use one or more selected (or all) (a) a sequence in which the third position of the codon is replaced with a mixed base and / or a deoxyinosine residue; This can be achieved by creating a sequence of nucleotides (Batzer et al., Nucleic Acid Res. 1 9:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolin i et al., Mol. Cell. Probes 8:91-98 (1994)).

[0231] The terms "peptide," "polypeptide," and "protein" are used interchangeably. and a compound composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids. There is no limit to the maximum number of amino acids that a protein or peptide sequence may contain. A polypeptide is any molecule containing two or more amino acids joined together by peptide bonds. The term as used herein includes any peptide or protein known in the art. Also generally, short chains, also referred to as peptides, oligopeptides, and oligomers, and the long chains that are commonly referred to in the art as proteins and exist in many varieties. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, among others. Peptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides Polypeptides include naturally occurring peptides, derivatives, analogs, and fusion proteins. recombinant peptides, or combinations thereof.

[0232] The term "promoter" refers to a promoter that is recognized by the synthetic machinery of the cell or introduced synthetic machinery. A DNA sequence recognized by a gene that is required to induce specific transcription of a polynucleotide sequence. It refers to the DNA sequence that is

[0233] The term "promoter / regulatory sequence" refers to a group of sequences operably linked to a promoter / regulatory sequence. refers to a nucleic acid sequence required for expression of a selected gene product. In some cases, this sequence is a core It can be a promoter sequence; in other cases, this sequence also acts as an enhancer. It may also contain promoter sequences and other regulatory elements required for expression of the gene product. The control / regulatory sequence is, for example, a sequence that directs the expression of a gene product in a tissue-specific manner. Ugh.

[0234] The term "constitutive" promoter refers to a promoter that encodes or specifies a gene product. When operably linked to a nucleotide, it is capable of producing a nucleotide that ... It refers to a nucleotide sequence that causes the production of a gene product in a cell under physiological conditions.

[0235] The term "inducible" promoter refers to a promoter that encodes or specifies a gene product. When operably linked to the oligonucleotide, it essentially forms an inducible vector corresponding to the promoter. A nucleotide sequence that causes a gene product to be produced in a cell only if the enzyme is present in the cell. Point to the column.

[0236] The term "tissue-specific" promoter refers to a promoter that is a promoter that is specific to a gene. When operably linked to the nucleotide, the promoter is substantially "Genetic expression" refers to a nucleotide sequence that causes the production of a gene product within a cell, but only if the cell is a cell.

[0237] The terms "cancer-associated antigen" or "tumor antigen" are used interchangeably to refer to a cancer cell surface that is found in its entirety. and expressing the MHC / peptide fragments thereof to administer pharmacological agents to treat cancer. Molecules (typically proteins, carbon monoxide, etc.) that are useful for preferential targeting to cells. In some embodiments, tumor antigens are expressed in normal cells and cancer cells. Markers expressed by both the IL-1 and IL-2 cells, such as lineage markers, e.g., CD19 on B cells, are also used. In some embodiments, the tumor antigen is overexpressed in cancer cells compared to normal cells. For example, 1-fold overexpression, 2-fold overexpression, 3-fold overexpression compared to normal cells. In some embodiments, the tumor Antigens are cell surface molecules that are inappropriately synthesized in cancer cells, e.g., those expressed on normal cells. In some embodiments, the molecule contains deletions, additions, or mutations compared to the molecule. Tumor antigens are expressed exclusively on the cell surface of cancer cells, either in whole or as fragments (e.g., M It is expressed as a peptide (HC / peptide) and is not synthesized or expressed on the surface of normal cells. In some embodiments, the CAR of the present invention may be capable of expressing peptides presented by MHC. The CAR includes an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to Typically, peptides derived from endogenous proteins are expressed as major histocompatibility complex (MHC) class I peptides. It fills the pocket of the phospholipase I molecule and is bound by the T cell receptor (TCR) on CD8+ T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, Virus-specific peptide / MHC complexes and / or tumor-specific peptide / MHC complexes The combination represents a unique class of cell surface targets for immunotherapy. Human leukocyte antigen (HLA) derived from viral or tumor antigens in the context of HLA-A1 or HLA-A2 TCR-like antibodies targeting peptides have been described (e.g., Sa stry et al., J Virol. 2011 85(5):1935-1942; Sergeeva et al., Blood, 2011 117(16) :4262-4272; Verma et al., J Immunol 2010 184(4):2156-2165; Willemsen et al., Gen e Ther 2001 8(21) :1601-1608; Dao et al., Sci Transl Med 2013 5(176) :176ra33; See Tassev et al., Cancer Gene Ther 2012 19(2):84-100). For example, TC R-like antibodies can be generated by screening libraries such as human scFv phage display libraries. It can be identified by scanning.

[0238] The terms "tumor-supporting antigen" or "cancer-supporting antigen" are used interchangeably to refer to antigens that are not themselves cancerous. but e.g., promote their growth or survival, e.g., resistance to immune cells. This allows the molecules (typically proteins, Exemplary cells of this type are stromal cells and myeloid-derived Tumor-supporting antigens themselves are antigens that support cancer cells. As long as it is present on the cells involved, it need not play a role in supporting tumor cells.

[0239] "Flexible polypeptide linker" or "linker" as used in the context of scFvs The term "variable heavy chain region" refers to a variable heavy chain region and a variable light chain region that are linked together, either alone or in combination. Peptides consisting of amino acids such as glycine and / or serine residues, used in In one embodiment, the flexible polypeptide linker is a Gly / Ser linker. an amino acid sequence (Gly-Gly-Gly-Ser) n, where n is 1 n is a positive integer greater than or equal to 1. For example, n=1, n=2, n =3, n=4, n=5, and n=6, n=7, n=8, n=9, and n=10. (SEQ ID NO: 6592). In one embodiment, the flexible polypeptide linker is (Gly (Gly4Ser)4 (SEQ ID NO: 6593) or (Gly4Ser)3 (SEQ ID NO: 6594) In another embodiment, the linker is selected from the group consisting of (Gly2Ser), ( GlySer), or (Gly3Ser) (SEQ ID NO: 6595) See also WO 2012 / 138475, which is incorporated herein by reference. Linkers described in the pamphlet are also included within the scope of the present invention.

[0240] As used herein, in reference to messenger RNA (mRNA), a 5' cap (Also known as RNA cap, RNA 7-methylguanosine cap, or RNA m7 The G-cap (also called the G-cap) is a "front-end" of eukaryotic messenger RNA immediately after the start of transcription. A 5' cap is a modified guanine nucleotide added to the 5' or 5' end of a nucleic acid. It consists of a terminal group that is linked to the first transcribed nucleotide. Its presence is determined by the ribosome. The addition of a cap is crucial for transcription and capping. They are paired together and occur co-transcriptionally, with each influencing the other. Shortly after initiation, the cap-synthesizing complex, which associates with RNA polymerase, binds to the nascent m Binds to the 5' end of RNA. This enzyme complex is required for mRNA capping. Catalyzes chemical reactions. Synthesis proceeds as a multi-step biochemical reaction. Capping moiety is modified to modulate the functionality of the mRNA, such as its stability or translation efficiency. It is possible.

[0241] As used herein, "in vitro transcribed RNA" refers to RNA that is produced in vitro. It generally refers to in vitro transcribed RNA, preferably mRNA. RNA is produced from an in vitro transcription vector. - contains the template used to generate the in vitro transcribed RNA.

[0242] As used herein, "poly(A)" refers to the polyadenylation site attached to mRNA. A preferred embodiment of the construct for transient expression In this embodiment, the polyA is between 50 and 5000 (SEQ ID NO: 6596), or preferably 64 more preferably more than 100, most preferably more than 300, or The poly(A) sequence affects various aspects of mRNA, such as localization, stability, or translation efficiency. The protein can be chemically or enzymatically modified to modulate its functionality.

[0243] As used herein, "polyadenylation" refers to the polyadenylyl moiety or its modification. It refers to the covalent linkage of a modified variant to a messenger RNA molecule. In eukaryotes, most Messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is formed through the action of the enzyme polyadenylate polymerase. A long sequence of adenine nucleotides (often several hundred) added to pre-mRNA. In higher eukaryotes, the poly(A) tail is a specific sequence, polyadenylation. The poly(A) tail is added to the transcript containing the polyclonal signal. These proteins help protect mRNA from degradation by exonucleases. Polyadenylation is also important for the termination of transcription, export of mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but After transcription is terminated, the mRNA chain is split into two strands, called RNA polymerases. The cleavage site is typically the site of a cleavage event. It is characterized by the presence of the base sequence AAUAAA near the cleavage site. After the cleavage, an adenosine residue is added to the free 3' end of the cleavage site.

[0244] As used herein, "transient" refers to the expression of an unintegrated transgene for a period of a few hours. refers to expression over a period of time, such as over a period of several days or weeks, where the period of expression is within the host cell. and when integrated into the genome or contained within a stable plasmid replicon. In this case, the period for gene expression is less than the period required for expression of the gene.

[0245] As used herein, the terms "treat," "treatment," and "treating" The term refers to the administration of one or more therapies (e.g., one or more therapeutic agents, such as a CAR of the invention). ) resulting from the administration of or improvement of one or more symptoms (preferably one or more identifying symptoms) of a proliferative disorder. In a specific embodiment, "treating" refers to the alleviation of symptoms (symptoms that can be differentiated). The terms "treatment of" and "treating" include at least one of the following: A reduction in at least one measurable physical parameter, not necessarily discernible by the patient In other embodiments, the terms "treat," "treatment," and "treatment of" are used interchangeably. The term "inhibiting" refers to the inhibition of the progression of a proliferative disorder, including physical inhibition, e.g., Inhibition by stabilization of discernible symptoms, physiological inhibition, e.g., stabilization of physical parameters In another embodiment, the term "treatment" refers to "treatment of," "treatment," or both. The terms "placement" and "treating" are used in conjunction with the term "treatment" to refer to tumor size or cancerous cell count. This refers to the reduction or stabilization of

[0246] The term "signaling pathway" refers to a signal that travels from one part of a cell to another part of the cell. Refers to the biochemical relationships between various signaling molecules that play a role in signal transmission. The term "cell surface receptor" refers to a receptor that receives a signal and transmits the signal across the cell membrane. This includes molecules and complexes of molecules that are capable of being transmitted.

[0247] The term "subject" includes organisms in which an immune response can be elicited (e.g., mammals, humans). It is intended to be

[0248] The term "substantially purified" cells refers to cells that are essentially free of other cell types. A purified cell is also one that, in its naturally occurring state, is normally separated from other cell types with which it associates. In some cases, a substantially purified population of cells refers to a homogeneous population of cells. In other cases, the term simply refers to the molecules that, in their natural state, are naturally associated with one another. In some embodiments, the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro.

[0249] The term "therapeutic" as used herein means treatment. A therapeutic effect is an alleviation of a disease state. The benefit is achieved by the reduction, suppression, amelioration, or eradication of the disease.

[0250] As used herein, the term "prophylaxis" refers to the prevention or treatment of a disease or disease state. This means a defensive measure for them.

[0251] In the context of the present invention, "tumor antigen" or "hyperproliferative disorder antigen" or "hyperproliferative disorder antigen" are used. "Associated antigen" refers to an antigen common to a particular hyperproliferative disorder. The hyperproliferative disorder antigens of the present invention are directed to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, and leukemia. Cancer, lung cancer, liver cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemia, uterine cancer, Cancer of the cervix, bladder, kidney, breast, prostate, ovarian, pancreatic, etc. Derived from cancers including, but not limited to, adenocarcinoma.

[0252] "Transfected" or "transformed" or "transduced" The term "transfection" refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A cell that has been "infected" or "transformed" or "transduced" is a cell that has received exogenous nucleic acid in a The cells may be primary subject cells, and This includes their progeny.

[0253] The term "specifically binds to" refers to a binding partner (e.g., This refers to a molecule that recognizes and binds to the target protein (protein or nucleic acid) in a sample. It does not substantially recognize or bind to other molecules.

[0254] "Membrane anchor" or "membrane tethering domain" as the term is used herein is a protein that is sufficient to anchor the extracellular or intracellular domain to the cell membrane. It refers to a polypeptide or moiety, for example, a myristoyl group.

[0255] The term "bioequivalent" refers to an amount of a drug other than the reference compound (e.g., RAD001). Thus, the effect of a reference compound (e.g., RAD001) on a reference dose or amount is In some embodiments, the effect is equivalent to, for example, the amount required to produce an effect equivalent to, for example, For example, assessed in an in vivo or in vitro assay, e.g. For example, as measured by an assay described herein, e.g., a Boulet assay, For example, the level of mTOR inhibition as measured by P70 S6 kinase inhibition. In an embodiment, the effect is measured by cell sorting, i.e., PD-1 positive T cells / PD-1 negative T cells. In one embodiment, a bioequivalent amount or dose of an mTOR inhibitor is: The same level of P70 S6 kinase inhibition as that produced by a reference dose or reference amount of a reference compound In one embodiment, a bioequivalent or bioavailable amount of an mTOR inhibitor is used. The dose is the same level of PD-1 produced by a reference compound at a reference dose or amount. It is the amount or dose that achieves an alteration in the ratio of positive T cells to PD-1 negative T cells.

[0256] mTOR inhibitors, e.g., allosteric mTOR inhibitors, e.g., RAD001 or When used with rapamycin or catalytic mTOR inhibitors, The term "amount" refers to an mTOR inhibitor that partially, but not completely, inhibits mTOR activity. refers to the dose of an agent, e.g., as measured by inhibition of P70 S6 kinase activity. As used herein, mTOR activity is assessed, for example, by P70 S6 kinase inhibition. The dose is insufficient to result in complete immunosuppression. In one embodiment, a low immune enhancing dose of mT OR inhibitors reduce the number of PD-1 positive T cells and / or increase the number of PD-1 negative T cells. This results in an increase in the ratio of PD-1 negative T cells to PD-1 positive T cells. In certain embodiments, a low immune enhancing dose of an mTOR inhibitor results in an increase in the number of naive T cells. In one embodiment, the low immune enhancing dose of an mTOR inhibitor is For example, the following markers on memory T cells, e.g., on memory T cell precursors: CD 62Lhigh, CD127high, CD27+, and one or more of the following: Increased expression of numbers; For example, expression of KLRG1 on memory T cells, e.g., on precursor cells of memory T cells. a decrease in; and Memory T cell precursors, e.g., the following characteristics: increased CD62Lhigh, CD12 Among the increased 7high, increased CD27+, decreased KLRG1, and increased BCL2 an increase in the number of cells with any one or combination of; resulting in one or more of the following: In this case, any of the above-described changes may be present, e.g., compared to an untreated control, e.g., For example, it occurs at least transiently.

[0257] As used herein, "refractory" refers to a disease, e.g., cancer, that does not respond to treatment. In embodiments, the refractory cancer is a cancer that is refractory to treatment prior to or at the start of treatment. In other embodiments, refractory cancers may become resistant during treatment. The cancer is also called a resistant cancer.

[0258] As used herein, "relapsed" refers to a condition that has recurred after a period of improvement, e.g., due to treatment, e.g., cancer Symptoms of a disease (e.g., cancer) or disease such as cancer after previous treatment of a disease Refers to the recurrence of symptoms.

[0259] Ranges: Throughout this disclosure, various aspects of this invention may be presented in a range format. The description in range format is merely for convenience and brevity and is not intended to be limiting. It is understood that this should not be construed as an inflexible limitation on the scope of the invention. Thus, the description of a range includes all the possible subranges as well as individual numerical values ​​within that range. For example, a statement of a range such as 1 to 6 will be considered to specifically disclose the The above is specifically disclosed, for example, 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, etc. Subranges that are used, as well as individual numbers within those ranges, e.g., 1, 2, 2.7, 3, 4, 5, As another example, a s...

Claims

1. A gRNA molecule comprising a tracr and a crRNA, wherein the crRNA is B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HL AA, HLA-B, HLA-C, DCK, CD52, FKBP1A, CIITA, NL RC5, RFXANK, RFX5, RFXAP, or NR3C1 A gRNA molecule comprising a targeting domain complementary to a target sequence of an allogeneic T cell target.

2. (a) the allogeneic T cell target is B2M and the targeting domain is Any of sequence numbers 1 to 83, or sequence numbers 5492 to 5527 or one containing; (b) the allogeneic T cell target is TRAC and the targeting domain is SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965 Contains any one of the following: (c) the allogeneic T cell target is TRBC1 and the targeting domain is , SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: 5966 to 6097 or (d) the allogeneic T cell target is TRBC2 and the targeting domain is , SEQ ID NOs: 5644 to 5719, or SEQ ID NOs: 6098 to 6226 or (e) the allogeneic T cell target is CD247 and the targeting domain is , or any one of SEQ ID NOs: 84 to 392; (f) the allogeneic T cell target is CD3D and the targeting domain is SEQ ID NO: 393 to SEQ ID NO: 532, or SEQ ID NO: 10780 to SEQ ID NO: 10794 Contains any one of the following: (g) the allogeneic T cell target is CD3E and the targeting domain is SEQ ID NO: 533 to SEQ ID NO: 839, or SEQ ID NO: 10677 to SEQ ID NO: 10764 Contains any one of the following: (h) the allogeneic T cell target is CD3G and the targeting domain is SEQ ID NO: 840 to SEQ ID NO: 968, or SEQ ID NO: 10765 to SEQ ID NO: 10779 Contains any one of the following: (i) the allogeneic T cell target is HLA-A and the targeting domain is , or any one of SEQ ID NOs: 969 to 1345; (j) the allogeneic T cell target is HLA-B and the targeting domain is , or any one of SEQ ID NOs: 1346 to 1698; (k) the allogeneic T cell target is HLA-C and the targeting domain is , or any one of SEQ ID NOs: 1699 to 2068; (l) the allogeneic T cell target is DCK and the targeting domain is Contains any one of sequence numbers 5278 to 5491; (m) the allogeneic T cell target is CD52 and the targeting domain is comprising any one of SEQ ID NOs: 6227 to 6324; (n) the allogeneic T cell target is FKBP1A, and the targeting domain However, SEQ ID NOs: 6325 to 6583, or SEQ ID NOs: 6662 to 674 Contains any one of the nine; (o) the allogeneic T cell target is NR3C1, and the targeting domain is , or any one of SEQ ID NOs: 2069 to 2941; (p) the allogeneic T cell target is CIITA, and the targeting domain is , SEQ ID NOs: 6750 to 7716, or SEQ ID NOs: 7717 to 7804 or (q) the allogeneic T cell target is NLRC5, and the targeting domain is , comprising any one of SEQ ID NOs: 8622 to 10089; The gRNA molecule of claim 1.

3. the allogeneic T cell target is TRAC and the targeting domain is No. 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 560 1, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: No. 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 55 99, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, 3. The method according to claim 1, comprising the sequence number 5619 or the sequence number 5620. RNA molecule.

4. the allogeneic T cell target is TRAC and the targeting domain is No. 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 559 9, or SEQ ID NO: 5600.

5. the allogeneic T cell target is TRBC2 and the targeting domain has the sequence No. 5719, SEQ ID NO: 5694, SEQ ID NO: 5706, SEQ ID NO: 5696, SEQ ID NO: 57 11, SEQ ID NO: 5708, SEQ ID NO: 5709, SEQ ID NO: 5712, SEQ ID NO: 5703, Sequence number 5707, sequence number 5687, sequence number 5705, sequence number 5713, sequence number 5 715, or SEQ ID NO: 5710. child.

6. the allogeneic T cell target is B2M and the targeting domain is 5519, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503 , SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: No. 5506, SEQ ID NO: 5509, SEQ ID NO: 5517, SEQ ID NO: 5521, SEQ ID NO: 552 0, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: 5508, SEQ ID NO: 5514, and The gRNA molecule of any one of claims 1 to 2, wherein the gRNA molecule comprises SEQ ID NO: 5492.

7. the allogeneic T cell target is B2M and the targeting domain is 5496, SEQ ID NO: 5498, or SEQ ID NO: 5509. A molecule.

8. the allogeneic T cell target is CIITA and the targeting domain has the sequence No. 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 77 58, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, Sequence number 7754, sequence number 7745, sequence number 7785, sequence number 7731, sequence number 7 772, SEQ ID NO: 7743, or SEQ ID NO: 7750. The gRNA molecule of claim 1.

9. The targeting domain is selected from the group consisting of SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 77 39, or SEQ ID NO: 7785.

10. the allogeneic T cell target is TRAC and the targeting domain is SEQ ID NO: 5569, SEQ ID NO: 5587, SEQ ID NO: 5592, or SEQ ID NO: 5586.

5. The gRNA molecule of any one of claims 1 to 4.

11. the allogeneic T cell target is TRAC and the targeting domain is 11. The gRNA molecule of any one of claims 1 to 4 or 10, comprising No. 5569.

12. the allogeneic T cell target is CD3E and the targeting domain is No. 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722. A gRNA molecule according to any one of the preceding claims.

13. the allogeneic T cell target is FKBP1A and the targeting domain is Sequence number 6693, sequence number 6705, sequence number 6694, sequence number 6708, or sequence 3. The gRNA molecule of claim 1, comprising the sequence number 6699.

14. A gRNA molecule comprising a tracr and a crRNA, wherein the crRNA is a gene encoding CD27 4, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g. For example, CEACAM-1, CEACAM-3, and / or CEACAM-5), VI. STA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86 , B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9 an inhibitory molecule selected from adenosine, TGF-beta, or PTPN11; target sequence complementary to the target sequence of a downstream effector of signal transduction via an inhibitory molecule. A gRNA molecule comprising a targeting domain.

15. (a) the inhibitory molecule is CD274 (PD-L1), and the targeting domain The gene comprises any one of SEQ ID NOs: 2942 to 3270; (b) the inhibitory molecule is HAVCR2 (TIM3), and the targeting domain The gene comprises any one of SEQ ID NOs: 3271 to 3541; (c) the inhibitory molecule is LAG3 and the targeting domain is 3542 to 4032; (d) the inhibitory molecule is PDCD1 (PD-1), and the targeting domain The sequences are SEQ ID NOs: 4033 to 4589, or SEQ ID NOs: 5720 to 58 15; or (e) the downstream effector of signal transduction mediated by the inhibitory molecule is PTPN1; and the targeting domain is any one of SEQ ID NOs: 4590 to 5277. Contains one of the following:

15. The gRNA molecule of claim 14.

16. The inhibitory molecule is PDCD1 and the targeting domain is SEQ ID NO:57 43, SEQ ID NO: 5798, SEQ ID NO: 5748, SEQ ID NO: 5722, SEQ ID NO: 5800, Sequence number 5735, sequence number 5724, sequence number 5731, sequence number 5725, sequence number 5 775, SEQ ID NO: 5766, SEQ ID NO: 5727, SEQ ID NO: 5744, SEQ ID NO: 5751, or SEQ ID NO: 5734.

17. The inhibitory molecule is PDCD1 and the targeting domain is SEQ ID NO:57 16. The gRNA molecule of claim 14, comprising:

18. The targeting domain is any of the listed targeting domain sequences. any one of 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleic acids 17. A gRNA molecule according to any one of claims 2 to 13 or 15 to 16.

19. The targeting domain is any of the listed targeting domain sequences. consisting of any one of 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleic acids 17. The gRNA molecule of any one of claims 2 to 13 or 15 to 16.

20. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 9, 20, 21, 22, 23, or 24 consecutive nucleic acids are included in the recited targeting domain. 17, 18, 19, 20, 21, 22, 23, or 20. The gRNA molecule of claim 18 or 19, which is 24 consecutive nucleic acids.

21. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 9, 20, 21, 22, 23, or 24 consecutive nucleic acids are included in the recited targeting domain. 17, 18, 19, 20, 21, 22, 23, or 20. The gRNA molecule of claim 18 or 19, which is 24 consecutive nucleic acids.

22. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 9, 20, 21, 22, 23, or 24 consecutive nucleic acids are included in the recited targeting domain.

20. The gRNA molecule of claim 18 or 19, which does not include the 5' or 3' nucleic acid of the in sequence. 。

23. The targeting domain consists of the enumerated targeting domain sequence.

17. The gRNA molecule of any one of claims 2 to 13 or 15 to 16.

24. The portion of the crRNA and the portion of the tracr hybridize to form a sequence represented by SEQ ID NO: 6584 or 6585. A gRNA molecule according to any one of the preceding claims.

25. The flagpole is located 3' to the crRNA portion of the flagpole. and a first flagpole extension positioned on the flagpole, the first flagpole extension being , SEQ ID NO: 6586.

26. the flagpole and the crRNA portion of the flagpole, if present: A second flagpole extension is located 3' to the first flagpole extension. and wherein the second flagpole extension comprises SEQ ID NO: 6587.

26. The gRNA molecule of claim 24 or 25.

27. The tracr (a) optionally, at said 3' end, an additional 1, 2, 3, 4, 5, SEQ ID NO:7820, further comprising six or seven uracil (U) nucleotides; (b) SEQ ID NO: 6660; or (c) SEQ ID NO: 6661 27. The gRNA molecule of any one of claims 1 to 26, comprising:

28. The crRNA portion of the flagpole is SEQ ID NO: 6607 or SEQ ID NO: 660 8. The gRNA molecule of claim 27 .

29. the tracr is selected from SEQ ID NO: 6589 or SEQ ID NO: 6590 and, optionally, a first If flagpole extension is present, for SEQ ID NO: 6589 or SEQ ID NO: 6590 and a first tracr extension located 5' to said first tracr extension.

27. The gRNA molecule of any one of claims 1 to 26, wherein said gRNA molecule comprises SEQ ID NO: 6591.

30. The targeting domain and the tracr are located on separate nucleic acid molecules.

21. A gRNA molecule according to any one of claims 19 to 20.

31. The crRNA comprises, from 5' to 3', [targeting domain]-: a) SEQ ID NO: 6584; b) SEQ ID NO: 6585; c) SEQ ID NO: 6605; d) SEQ ID NO: 6606; e) SEQ ID NO: 6607; f) SEQ ID NO: 6608; or g) SEQ ID NO: 7806 24. The gRNA molecule of any one of claims 1 to 23, comprising:

32. The tracr is, from 5' to 3': a) SEQ ID NO: 6589; b) SEQ ID NO: 6590; c) SEQ ID NO: 6609; d) SEQ ID NO: 6610; e) SEQ ID NO: 6660; f) SEQ ID NO: 6661; g) SEQ ID NO: 7820; h) SEQ ID NO: 7807; i) SEQ ID NO: 7808; j) SEQ ID NO: 7809; k) at least one, two, three, four, five, six, or is seven uracil (U) nucleotides, e.g., 1, 2, 3, 4, 5, 6, or any of the above a) to j) further containing seven uracil (U) nucleotides. Either; l) at least one, two, three, four, five, six, or is seven adenine (A) nucleotides, e.g., 1, 2, 3, 4, 5, 6, or any of the above a) to k) further containing seven adenine (A) nucleotides. Either; or m) at least one 5' end (e.g., 5' terminus) one, two, three, four, five, six, or seven adenine (A) nucleotides, e.g. For example, one, two, three, four, five, six, or seven adenine (A) nucleotides Any of the above a) to l) further including 32. The gRNA molecule of any one of claims 1 to 23 or 31, comprising:

33. the targeting domain and the tracr are located on separate nucleic acid molecules; The nucleic acid molecule comprising the targeting domain optionally comprises a SEQ ID NO: 6607 located immediately 3' to the main sequence and containing the tracr sequence 24. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises, for example consists of, SEQ ID NO: 6660. The gRNA molecule of any one of the preceding claims.

34. The targeting domain and the tracr are located on a single nucleic acid molecule; 3. The method of claim 2, wherein the tracr is positioned 3' to the targeting domain.

29. A gRNA molecule according to any one of claims 7 to 28.

35. Located 3' to the targeting domain and to the tracr 35. The gRNA molecule of claim 34, further comprising a loop located 5' to said target site.

36. 36. The gRNA molecule of Claim 35, wherein the loop comprises SEQ ID NO: 6588.

37. From 5' to 3', [targeting domain]-: (a) SEQ ID NO: 6601; (b) SEQ ID NO: 6602; (c) SEQ ID NO: 6603; (d) SEQ ID NO: 6604; (e) SEQ ID NO: 7811; or (f) at the 3' end, one, two, three, four, five, six, or seven Any of (a) to (e) above, further comprising a uracil (U) nucleotide.

24. The gRNA molecule of any one of claims 1 to 23, comprising:

38. The targeting domain and the tracr are located on a single nucleic acid molecule; The nucleic acid molecule comprises the targeting domain and, optionally, and SEQ ID NO: 6601 located immediately 3' to the 24. A gRNA molecule according to any one of claims 1 to 23.

39. The targeting domain and the tracr are located on a single nucleic acid molecule; The nucleic acid molecule comprises the targeting domain and, optionally, and SEQ ID NO: 7811 located immediately 3' to the 24. A gRNA molecule according to any one of claims 1 to 23.

40. one of the nucleic acid molecules comprising the gRNA molecule, or optionally , wherein the more than one nucleic acid molecule is a) one, e.g., three, phosphoro groups at the 3' end of said one or more nucleic acid molecules; Thioate (phosphorothioate) modification; b) one, e.g., three, phosphoro groups at the 5' end of said one or more nucleic acid molecules; Thioate (phosphorothioate) modification; c) one, e.g., three 2'-O residues at the 3' end of said one or more nucleic acid molecules -methyl modification; d) one, for example, three 2'-O residues at the 5' end of said one or more nucleic acid molecules -methyl modification; e) a fourth position relative to the end, a third position relative to the end, and a fourth position relative to the end of said one or more nucleic acid molecules and a 2'-O-methyl modification at each of the second 3' residue relative to the terminus; or f) any combination of these 40. The gRNA molecule of any one of claims 1 to 39, comprising:

41. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, Upon introduction into a cell, the targeting domain complementary to the targeting domain of the gRNA molecule is expressed.

41. The method of claim 1, wherein an indel is formed in or near the target sequence. The gRNA molecule of any one of the preceding claims.

42. 42. The gRNA molecule of Claim 41, wherein the indel is a frameshift mutation.

43. The indels are shown in Figures 34A, 34B, 36, 38, 41, 44, 48, 49, 50, or 53.

43. A gRNA molecule according to any one of claims 1 to 42.

43. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, Upon introduction into a cell population, at least about 40% of the cells in the population, e.g., At least about 50%, for example, at least about 60%, for example, at least about 70%, e.g., For example, at least about 80%, for example, at least about 90%, for example, at least about 95%, For example, at least about 96%, for example, at least about 97%, for example, at least about 98%. %, e.g., at least about 99%, of the targeting domain of the gRNA molecule. an indel is formed in or near the target sequence complementary to the target sequence; 41. A gRNA molecule according to any one of claims 1 to 40.

44. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, Upon introduction into a cell population, at least about 20% of the cells in the population, e.g., At least about 30%, for example, at least about 35%, for example, at least about 40%, e.g., For example, at least about 45%, for example, at least about 50%, for example, at least about 55%, For example, at least about 60%, for example, at least about 65%, for example, at least about 70% %, e.g., at least about 75%, e.g., at least about 80%, e.g., at least about 85%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 99% of the target domains complementary to the targeting domain of the gRNA molecule Indels, which are frameshift mutations, are formed in or near the sequence 41. The gRNA molecule of claim 1 , wherein

45. At least about 30%, e.g., at least about 40%, e.g., at ... For example, at least about 50%, for example, at least about 60%, for example, at least about 70% , e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 9 5%, for example, at least about 96%, for example, at least about 97%, for example, at least In about 98%, e.g., at least about 99%, the indels are Any of Figures 36, 38, 41, 44, 48, 49, 50, or 53 45. The gRNA molecule of any one of claims 43 to 44, wherein the indel is one of the indels listed in 。

46. The five most frequently detected indels in the cell population are shown in Figures 34A, 34B, and 34C. 36, 38, 41, 44, 48, 49, 50, or 53 Three or more of the indels associated with any gRNA listed in 46. ​​The gRNA molecule of any one of claims 43 to 45, comprising four, for example five,

47. The indels are measured by next generation sequencing (NGS).

47. The gRNA molecule of any one of paragraphs 41 to 46.

48. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, When introduced into a cell, the targeting domain of the gRNA molecule binds to the targeting domain of the gRNA molecule within the cell. The expression of the gene containing the complementary target sequence is reduced or eliminated. Item 48. The gRNA molecule of any one of items 1 to 47.

49. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, Upon introduction into a cell population, at least about 40% of the cells in the population, e.g., At least about 50%, for example, at least about 60%, for example, at least about 70%, e.g., For example, at least about 80%, for example, at least about 90%, for example, at least about 95%, For example, at least about 96%, for example, at least about 97%, for example, at least about 98%. %, e.g., at least about 99%, of the targeting domain of the gRNA molecule. the expression of the gene containing the target sequence complementary to the target sequence is reduced or eliminated; 49. A gRNA molecule described in any one of claims 1 to 48.

50. The reduced or absent expression is measured by flow cytometry.

50. A gRNA molecule according to any one of claims 48 to 49.

51. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, When introduced into a cell, it can be used in the cell for, for example, next generation sequencing and / or nucleotide sequencing. no off-target indels are formed that are detectable by leution insertion assay.

51. A gRNA molecule according to any one of claims 41 to 50.

52. a CRISPR system (e.g., an RNP described herein) comprising the gRNA molecule, Upon introduction into a cell population, the vectors can be used for, for example, next generation sequencing and / or nucleotide insertion. off-target indels detectable by the infusion assay among the cells of the cell population about 5% or less, for example, about 1% or less, for example, about 0.1% or less, for example, about 0.01% or less 51. The gRNA molecule of any one of claims 41 to 50, wherein the gRNA molecule is detected in:

53. The cell is a mammalian, primate, or human cell, e.g., a human cell (or or a cell population comprising the same), a gRNA molecule according to any one of claims 41 to 52 。

54. 10. The method of claim 1, wherein the cells are (or the cell population comprises) immune effector cells.

53. A gRNA molecule according to claim 53.

55. The immune effector cells are T cells or NK cells, for example, T cells ( or the cell population comprises thereof), the gRNA molecule of claim 54.

56. The T cells are CD4+ T cells, CD8+ T cells, or a combination thereof. or the cell population comprises thereof), the gRNA molecule of claim 55.

57. The cell (or cell population) is engineered to express a chimeric antigen receptor (CAR).

56. A gR according to any one of claims 52 to 55, which is or will be manipulated. NA molecule.

58. The CAR is (a) a CD19 CAR; or (b) BCMA CAR 58. The gRNA molecule of claim 57, wherein:

59. (a) the CAR comprises any one of SEQ ID NOs: 7883 to 7898. is a CD19 CAR comprising an antigen-binding domain containing (b) the CAR comprises a CD19 CA comprising SEQ ID NO: 7909 or SEQ ID NO: 7920. Is it R? (c) The CAR comprises any one of SEQ ID NOs: 7939 to 8112. B comprising an antigen-binding domain containing, for example, the antigen-binding domain of SEQ ID NO: 7949 Is a CMA CAR; or (d) The CAR comprises any one of SEQ ID NOs: 8549 to 8621. For example, a BCMA CAR comprising SEQ ID NO: 8559.

59. The gRNA molecule of claim 58.

60. 59. The cells are allogeneic with respect to the patient to whom they are administered. A gRNA molecule according to any one of the preceding claims.

61. 61. The first gRNA molecule of any one of claims 1 to 60, further comprising a Cas9 molecule. A composition comprising:

62. The Cas9 molecule is selected from the group consisting of SEQ ID NO: 6611, or SEQ ID NOs: 7821 to 7831.

62. The composition of claim 61, comprising, for example consisting of, any one of:

63. The Cas9 molecule may be an active or inactive S. pyogenes Cas9.

62. The composition of claim 61 .

64. The first gRNA molecule and the Cas9 molecule are located within a ribonucleoprotein complex (RNP).

64. The composition of any one of claims 61 to 63, wherein

65. a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule a second gRNA molecule, a third gRNA molecule, and a fourth gRNA molecule, gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule 27. The gene encoding the gRNA molecule of claim 1, wherein the gene encoding the gRNA molecule of claim 1 is a gene encoding the gRNA molecule of claim 26.

65. Any of claims 61 to 64, wherein each gRNA molecule of the composition is complementary to a different target sequence. The composition described above.

66. The first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) the first gRNA molecule (if present) and the second gRNA molecule (if present) target a target sequence within the same gene 66. The composition of claim 65, wherein the

67. The first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) and the fourth gRNA molecule (if present) is 20,000 nucleotides long. 10,000 nucleotides or less, 6,000 nucleotides or less, 5,000 nucleotides or less, 400 0 or less, 1000 or less, 500 or less, 400 or less , 300 nucleotides or less, 200 nucleotides or less, 100 nucleotides or less, 90 nucleotides or less nucleotides or less, 80 nucleotides or less, 70 nucleotides or less, 60 nucleotides or less , 50 nucleotides or less, 40 nucleotides or less, 30 nucleotides or less, 20 nucleotides or less 6. The method of claim 5, wherein the target sequence is complementary to a target sequence separated by no more than 10 nucleotides or no more than 10 nucleotides.

67. The composition according to claim 5 or 66.

68. The first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present) the first gRNA molecule (if present) and the second gRNA molecule (if present) target sequences within different genes 66. The composition of claim 65, wherein the sequence is complementary to the sequence.

69. a first gRNA molecule, a second gRNA molecule, and a third gRNA molecule, The gRNA molecule of claim 1 is 2(f), 2(g), or 2(h); The RNA molecule is any of claims 2(a), 2(i), 2(j), 2(k), or 2(q). the third gRNA molecule is a gRNA molecule according to claim 15(a), 15(b), or 15(c); (b), 15(c), 15(d), or 15(e).

69. The composition of claim 68.

70. a first gRNA molecule, a second gRNA molecule, and a third gRNA molecule, The gRNA molecule of claim 1 is 2(f), 2(g), or 2(h); The RNA molecule is as defined in any one of claims 2(l), 2(m), 2(n), or 2(o). and the third gRNA molecule is a gRNA molecule of claim 15(a), 15(b), or 1 5(c), 15(d), or 15(e). Item 70. The composition according to item 69.

71. a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule is Claim 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h) or 2(h) of the gRNA molecule of claim 2; (l), 2(m), 2(n), or 2(o), 71. The composition of claim 70.

72. a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule is Claim 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h) or 2(h) of the gRNA molecule of claim 2; (a), 2(i), 2(j), or 2(k).

71. The composition of claim 70.

73. a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule is Claim 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h) or 2(h) of the gRNA molecule of claim 1 5(a), 15(b), 15(c), 15(d), or 15(e).

71. The composition of claim 70, which is a gRNA molecule.

74. a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule is Claim 15(a), 15(b), 15(c), 15(d), or 7(e). the second gRNA molecule is a gRNA molecule according to claim 15(a), 15(b), 15(c), 15(d), or 15(e).

71. The composition of claim 70.

75. The method further comprises the step of: (a) determining whether a third gRNA molecule is present; (b) determining whether a third gRNA molecule is present; and (c) determining whether a third gRNA molecule is present. 5(b), 15(c), 15(d), or 15(e).

75. The composition of claim 74, wherein:

76. 65-66, consisting of two gRNA molecules according to any one of claims 1 to 60. 8, 71, 72, 73, or 74. A composition according to any one of claims 8, 71, 72, 73, or 74.

77. 65 to 67, consisting of three gRNA molecules according to any one of claims 1 to 60. 0 or 75. The composition of any of

78. a) wherein said targeting domain is a polypeptide of claim 2(a), 2(i), 2(j), or 61. Any of claims 1 to 60, wherein the targeting domain is any of 2(k) a first gRNA molecule described in any one of the preceding paragraphs; b) wherein the targeting domain is as defined in claim 2(b), 2(c), 2(d), 2(e), 2(f), 2(g), 2(h), 2(i), 2(j ... 2(f), 2(g), 2(h), or 2(i). and a second gRNA molecule according to any one of claims 1 to 60, A composition comprising:

79. a) the targeting domain of the first gRNA molecule is a target of claim 6 a targeting domain; b) the targeting domain of the second gRNA molecule is a target of claim 3 The targeting domain, 79. The composition of claim 78.

80. a) the targeting domain of the first gRNA molecule is a target of claim 7 a targeting domain; b) the targeting domain of the second gRNA molecule is a target of claim 4 The targeting domain, 79. The composition of claim 78.

81. a) the targeting domain of the first gRNA molecule is a target of claim 7 a targeting domain; b) the targeting domain of the second gRNA molecule is a targeting domain of claim 11 -targeting domain, 79. The composition of claim 78.

82. a) the targeting domain of the first gRNA molecule is a target of claim 7 a targeting domain; b) the targeting domain of the second gRNA molecule is a targeting domain of claim 12 -targeting domain, 79. The composition of claim 78.

83. 61. A method for the detection of a nucleotide sequence comprising the steps of: (a) detecting a nucleotide sequence of ... The targeting domain of the RNA molecule is any one of claims 2(n) or 2(q).

83. The composition of any one of claims 78 to 82, wherein the targeting domain is 。

84. The targeting domain of the third gRNA molecule is a targeting domain of claim 8.

84. The composition of claim 83, wherein the amino acid sequence is a binding domain.

85. The targeting domain of the third gRNA molecule is a targeting domain of claim 9.

84. The composition of claim 83, wherein the amino acid sequence is a binding domain.

86. The method further comprises the step of:

86. Any of claims 78 to 85, wherein the sequence is complementary to a target sequence of a target of the NK inhibitory molecule. The composition described above.

87. The composition of claim 86, wherein the target of the NK inhibitory molecule is LILRB1.

88. the targeting domain of the fourth gRNA molecule comprises: a) any one of SEQ ID NOs: 10090 to 10673; b) 17, 18, or any one of SEQ ID NOs: 10090 to 10673 19, 20, 21, 22, 23, or 24 consecutive nucleotides, preferably 20 consecutive nucleotide; c) 17 amino acids on the 5' side of any one of SEQ ID NOs: 10090 to 10673 , 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides Otid; or d) 17 amino acids on the 3' side of any one of SEQ ID NOs: 10090 to 10673 , 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides Ochido 88. The composition of claim 87, comprising, e.g. consisting of:

89. Each of the gRNA molecules, together with the Cas9 molecule described herein, encodes a ribonucleoprotein 89. The composition of any one of claims 78 to 88, wherein the composition is within a rhesus malate complex (RNP).

90. 90. The composition of any of claims 61 to 89, formulated in a medium suitable for electroporation. thing.

91. Each of the gRNA molecules is combined with a Cas9 molecule as described herein in an RNP complex. and each of said RNP complexes is less than about 10 uM, e.g., less than about 3 uM, e.g., , less than about 1 uM, for example, less than about 0.5 uM, for example, less than about 0.3 uM, for example, less than about 0 91. The composition of any one of claims 61 to 90, wherein the composition is at a concentration of less than 1 uM.

92. Cells, e.g., cell populations, e.g., immune effector cells, e.g., those described herein.

92. The method of claim 91, further comprising administering to said patient an immune effector cell, e.g., expressing a CAR. Composition of.

93. A gRNA molecule according to any one of claims 1 to 60 or any one of claims 61 to 92. A nucleic acid sequence encoding any, e.g., all, of the components of any of the compositions described herein.

94. the nucleic acid comprising a promoter operably linked to the sequence encoding the gRNA molecule; 94. The nucleic acid sequence of claim 93, comprising:

95. The promoter is capable of being transduced by RNA polymerase II or RNA polymerase III.

95. The nucleic acid sequence of claim 94, which is a recognized promoter.

96. 96. The method of claim 95, wherein the promoter is a U6 promoter or an HI promoter. The nucleic acid sequence described.

97. 97. The nucleic acid of any one of Claims 93 to 96, wherein the nucleic acid further encodes a Cas9 molecule. Nucleic acid sequence of.

98. the nucleic acid comprising a promoter operably linked to the sequence encoding a Cas9 molecule; 98. The nucleic acid sequence of claim 97, comprising:

99. The promoter is an EF-1 promoter, a CMV IE gene promoter, an EF -1α promoter, ubiquitin C promoter, or phosphoglycerate kinase ( 99. The nucleic acid sequence of claim 98, which is a promoter of the PGK gene.

100. 100. A vector comprising a nucleic acid according to any one of claims 93 to 99.

101. Lentiviral vectors, adenoviral vectors, adeno-associated virus (AAV) vectors vectors, herpes simplex virus (HSV) vectors, plasmids, minicircles, nanoplates 81. The vector of claim 80, selected from the group consisting of a plasmid and an RNA vector. -.

102. 61. A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 60 and a Cas9 molecule. and a composition comprising:

103. A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 60 and a Cas9 molecule. A composition comprising an acid.

104. 104. The method of any one of claims 61 to 92 or 102 to 103, further comprising a template nucleic acid. Composition of.

105. The template nucleic acid has nucleotides corresponding to nucleotides in the target sequence of the gRNA molecule.

105. The composition of claim 104, comprising:

106. Claim 104, wherein the template nucleic acid comprises a nucleic acid encoding a chimeric antigen receptor (CAR).

106. The composition according to any one of claims 1 to 105.

107. The CAR is (a) For example, WO 2012 / 079000 or WO 2012 / 079000 CD19 CAR as described in the pamphlet of 2014 / 153270; and teeth (b) e.g., a BCMA CAR described herein, e.g., SEQ ID NO: 8559. Including BCMA CAR The composition of claim 106, wherein

108. 108. The method of claim 104, wherein the template nucleic acid comprises a nucleic acid encoding an NK inhibitory molecule. The composition described in any one of the above.

109. 1. A method of altering a target sequence in a cell, e.g., altering its structure, e.g., sequence, comprising: The cells a) a gRNA molecule according to any one of claims 1 to 60, e.g., more than one gRNA A molecule, and a Cas9 molecule; b) a gRNA molecule according to any one of claims 1 to 60, e.g., more than one gRNA A molecule, and a nucleic acid encoding a Cas9 molecule; c) A gRNA molecule according to any one of claims 1 to 60, e.g., more than one gRNA a nucleic acid encoding an A molecule, and a Cas9 molecule; d) A gRNA molecule according to any one of claims 1 to 60, e.g., more than one gRNA a nucleic acid encoding an A molecule, and a nucleic acid encoding a Cas9 molecule; e) any one of a) to d) above, and a template nucleic acid; f) A nucleic acid comprising any one of the above a) to d) and a sequence encoding a template nucleic acid. ; g) a composition according to any one of claims 61 to 92 or 102 to 108; or h) A vector according to any one of claims 100 to 101. A method comprising contacting a

110. The gRNA molecule or a nucleic acid encoding the gRNA molecule and the Cas9 molecule or and the nucleic acid encoding the Cas9 molecule are formulated in a single composition. The method described below.

111. The gRNA molecule or a nucleic acid encoding the gRNA molecule and the Cas9 molecule or and the nucleic acid encoding the Cas9 molecule are formulated in more than one composition.

109. The method according to claim 109.

112. 112. The method of claim 111, wherein the more than one composition is delivered simultaneously or sequentially. method.

113. 113. The method of any of claims 109 to 112, wherein the cell is an animal cell.

114. 113. The method of any of claims 109 to 112, wherein the cell is a mammalian, primate, or human cell. The method according to any one of the preceding claims.

115. the cell is an immune effector cell (e.g., a population of immune effector cells); The method of claim 114.

116. 116. The method of claim 115, wherein the immune effector cells are T cells or NK cells. Law.

117. 117. The method of any one of claims 115 to 116, wherein the immune effector cells are T cells. How to post.

118. the T cells are CD4+ T cells, CD8+ T cells, or a combination thereof; The method of claim 1178.

119. the cells have been engineered to express a chimeric antigen receptor (CAR), or 120. A method according to any one of claims 113 to 119, wherein the method is to be operated.

120. The CAR is (a) a CD19 CAR; or (b) BCMA CAR The method of claim 119, wherein

121. The CAR comprises an antigen comprising any one of SEQ ID NOs: 7883 to 7898. The method of claim 120, wherein the CD19 CAR comprises a binding domain.

122. The CAR is a CD19 CAR, and is selected from the group consisting of SEQ ID NOs: 7908 to 7920.

122. The method of any one of claims 120 and 121, comprising any one of:

123. The CAR comprises an antigen comprising any one of SEQ ID NOs: 7939 to 8112. The method of claim 120, wherein the BCMA CAR comprises a binding domain.

124. the CAR is a BCMA CAR, 124. The method of claim 120, comprising any one of the following sequences: Any of the methods described above.

125. 10. The method of claim 1, wherein the cells are autologous or allogeneic with respect to the patient to whom the cells are administered.

125. The method of any one of claims 13 to 124.

126. 125. A cell modified by the method of any one of claims 109 to 124.

127. A first gRNA molecule according to any one of claims 1 to 60 or claims 61 to 92. or a composition according to any one of claims 102 to 108, or a composition according to any one of claims 93 to 99 102. A cell comprising the nucleic acid of claim 100 or the vector of claim 101.

128. A cell according to any one of claims 126 and 127, which is an animal cell.

129. 129. The method of any one of claims 126 to 128, which is a mammalian, primate, or human cell. cells.

130. 129. The method of claim 129, wherein the antibody is an immune effector cell (e.g., a population of immune effector cells). The cell described in

131. 131. The cell of claim 130, wherein the immune effector cell is a T cell or an NK cell. Cell.

132. 132. The method of any one of claims 130 to 131, wherein the immune effector cells are T cells. Cells on the plate.

133. the T cells are CD4+ T cells, CD8+ T cells, or a combination thereof; The cell described in claim 132.

134. engineered or to be engineered to express a chimeric antigen receptor (CAR) A cell according to any one of claims 126 to 133.

135. 135. The method of any one of claims 126 to 134, wherein the cells are autologous with respect to the patient to whom the cells are administered. The cells described.

136. 135. Any of claims 126 to 134, wherein the cells are allogeneic with respect to the patient to whom the cells are administered. The cell described above.

137. A second gRNA molecule according to any one of claims 1 to 60, or or comprising a nucleic acid encoding a second gRNA molecule according to any one of The first gRNA molecule and the second gRNA molecule are non-identical targets. A cell described in any one of claims 126 to 136, comprising a targeting domain.

138. the first gRNA molecule is a targeting molecule complementary to a target sequence of an allogeneic T cell target. a domain (e.g., a targeting domain listed in Tables 1, 3, 4, or 5) wherein the second gRNA molecule is an inhibitory molecule or a signal transduction molecule mediated by an inhibitory molecule. and a targeting domain complementary to the target sequence of a downstream effector of the targeting domain (e.g., 137) comprising a targeting domain set forth in Table 2 or Table 6 cells.

139. The inhibitory molecule, or a downstream effector of signal transduction via the inhibitory molecule, is C D274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACA M (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5) , VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, C D86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRS F14 or CD107), KIR, A2aR, MHC class I, MHC class II, G AL9, adenosine, and TGF-beta, or PTPN11. The cells described.

140. the first gRNA molecule encodes TRAC, TRBC1, TRBC2, CD247, CD3 a targeting domain complementary to a target sequence of CD3D, CD3E, or CD3G; The second gRNA molecule comprises a targeting domain complementary to a target sequence of NLRC5. For example, any one of SEQ ID NOs: 8622 to 10089 (e.g., The cell of claim 137, comprising a targeting domain (e.g., consisting of):

141. the first gRNA molecule encodes TRAC, TRBC1, TRBC2, CD247, CD3 a targeting domain complementary to a target sequence of CD3D, CD3E, or CD3G; The second gRNA molecule is a target sequence of B2M, HLA-A, HLA-B, or HLA-C. The cell of claim 137, comprising a targeting domain complementary to the sequence.

142. 61. A third gRNA molecule according to any one of claims 1 to 60, or a further comprising, or comprising, a nucleic acid encoding a third gRNA molecule of any one of or comprising the first gRNA molecule, the second gRNA molecule, and the 137. The method of claim 137, wherein the three gRNA molecules contain non-identical targeting domains.

141. A cell according to any one of 141.

143. the third gRNA molecule is CIITA, RFXANK, RFX5, or RFXAP The cell of claim 142, comprising a targeting domain complementary to a target sequence of

144. The third gRNA molecule has a targeting domain complementary to the target sequence of CIITA. The cell of claim 143, comprising:

145. the third gRNA molecule is any one of SEQ ID NOs: 7717 to 7804 and a targeting domain comprising, e.g., consisting of, e.g., SEQ ID NO: 77 69, SEQ ID NO: 7771, or SEQ ID NO: 7785, for example , the cell of claim 144, comprising a targeting domain consisting of:

146. The first gRNA molecule has a targeting domain complementary to the target sequence of TRAC. the second gRNA molecule comprises a targeting domain complementary to a target sequence of B2M. the third gRNA molecule comprising a targeted sequence complementary to a target sequence of CIITA.

146. A cell according to any one of claims 142 to 145, comprising a main.

147. The first gRNA molecule has a targeting domain complementary to the target sequence of TRAC. the second gRNA molecule has a targeting domain complementary to a target sequence of NLRC5. the third gRNA molecule comprises a targeting sequence complementary to the target sequence of CIITA.

146. A cell according to any one of claims 142 to 145, comprising a gu domain.

148. the first gRNA molecule encodes TRAC, TRBC1, TRBC2, CD247, CD3 a targeting domain complementary to a target sequence of CD3D, CD3E, or CD3G; The second gRNA molecule is a target sequence of NR3C1, DCK, CD52, or FKBP1A. The cell of claim 137, comprising a targeting domain complementary to the sequence.

149. (1) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO:

54. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 92 to SEQ ID NO: 5527; (2) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345. or a targeting domain selected from the group consisting of: (3) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 1346 to 1698. or comprising a targeting domain selected from: (4) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 1699 to 2068. or comprising a targeting domain selected from: (5) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 2069 to 2941. or comprising a targeting domain selected from: (6) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 5278 to 5491. or comprising a targeting domain selected from: (7) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 6227 to 6324. or comprising a targeting domain selected from: (8) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 6325 to 6583. or comprising a targeting domain selected from: (9) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NO: 5966 to SEQ ID NO: 6097 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO:

54. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 92 to SEQ ID NO: 5527; (10) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 969 to 1345. or comprising a targeting domain selected from: (11) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 1346 to 1698. or comprising a targeting domain selected from the group; (12) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 1699 to 2068. or comprising a targeting domain selected from the group; (13) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 2069 to 2941. or comprising a targeting domain selected from the group; (14) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 5278 to 5491. or comprising a targeting domain selected from the group; (15) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 6227 to 6324. or comprising a targeting domain selected from the group; (16) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 6325 to 6583. or comprising a targeting domain selected from the group; (17) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 and the second guide RNA molecule comprises: or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 492 to 5527; (18) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 969 to 1345. or comprising a targeting domain selected from: (19) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 1346 to 1698. or comprising a targeting domain selected from the group; (20) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 1699 to 2068. or comprising a targeting domain selected from the group; (21) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 2069 to 2941. or comprising a targeting domain selected from the group; (22) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 5278 to 5491. or comprising a targeting domain selected from the group; (23) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 6227 to 6324. or comprising a targeting domain selected from the group; (24) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 6325 to 6583. or comprising a targeting domain selected from the group; (25) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from SEQ ID NOs: 1 to 5. A sequence selected from the group consisting of SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527. - whether it contains a targeting domain; (26) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

96. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 1345; (27) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

13. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 46 to SEQ ID NO: 1698; (28) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

16. or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 99 to 2068; (29) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

20. or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 69 to 2941; (30) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

52. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 78 to SEQ ID NO: 5491; (31) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

62. or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 27 to 6324; (32) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

63. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 6583; (33) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527 Contains targeting domains; (34) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NO: 1345 to SEQ ID NO: 1365; (35) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 346 to SEQ ID NO: 1698; (36) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 699 to 2068; (37) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NOs: 069 to 2941; (38) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 278 to 5491; (39) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 227 to 6324; (40) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 325 to 6583; (41) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527 Contains targeting domains; (42) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NO: 1345 to SEQ ID NO: 1365; (43) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 346 to SEQ ID NO: 1698; (44) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 699 to 2068; (45) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NOs: 069 to 2941; (46) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 278 to 5491; (47) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 227 to 6324; (48) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 325 to 6583; (49) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527 Contains targeting domains; (50) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NO: 1345 to SEQ ID NO: 1365; (51) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 346 to SEQ ID NO: 1698; (52) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 699 to 2068; (53) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprising a targeting domain selected from the group consisting of SEQ ID NOs: 069 to 2941; (54) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 278 to 5491; (55) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 227 to 6324; or (56) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is 325 to 6583, comprising a targeting domain selected from the group consisting of: The cell described in claim 137.

150. Target sequences for inhibitory molecules or downstream effectors of signal transduction via inhibitory molecules and a third gRNA molecule comprising a targeting domain complementary to said inhibitory downstream effectors of signal transduction via the inhibitory molecules, such as CD274, H AVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA , BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7 -H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, Ad The cell of claim 149, wherein the cell is a TGF-β or PTPN11.

151. 16. The method of claim 1, wherein the third gRNA molecule is the third gRNA molecule of claim 15.

50. The cell according to claim 50.

152. (1) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 2942 to 3270. or comprising a targeting domain selected from: (2) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 3271 to 3541. or comprising a targeting domain selected from: (3) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 3542 to 4032. or comprising a targeting domain selected from: (4) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4033 to 4589, and A targeting domain selected from the group consisting of SEQ ID NO: 5720 to SEQ ID NO: 5815 Contains; (5) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5528 to 5623, or A targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 5965 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 4590 to 5277. or comprising a targeting domain selected from: (6) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NO: 5966 to SEQ ID NO: 6097 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 2942 to 3270. or comprising a targeting domain selected from: (7) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NO: 5966 to SEQ ID NO: 6097 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 3271 to 3541. or comprising a targeting domain selected from: (8) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NO: 5966 to SEQ ID NO: 6097 wherein the second guide RNA molecule is selected from the group consisting of SEQ ID NOs: 3542 to 4032. or comprising a targeting domain selected from: (9) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NO: 5966 to SEQ ID NO: 6097 wherein the second guide RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4033 to 4589, and A targeting domain selected from the group consisting of SEQ ID NO: 5720 to SEQ ID NO: 5815 Contains; (10) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5624 to 5643, or A targeting domain selected from the group consisting of SEQ ID NOs: 5966 to 6097. wherein the second guide RNA molecule consists of SEQ ID NOs: 4590 to 5277. or comprising a targeting domain selected from the group; (11) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 2942 to 3270. or comprising a targeting domain selected from the group; (12) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 3271 to 3541. or comprising a targeting domain selected from the group; (13) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 3542 to 4032. or comprising a targeting domain selected from the group; (14) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4033 to 4589, and A targeting domain selected from the group consisting of SEQ ID NOs: 5720 to 5815. Contains; (15) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 5644 to 5719, or A targeting domain selected from the group consisting of SEQ ID NOs: 6098 to 6226 wherein the second guide RNA molecule consists of SEQ ID NOs: 4590 to 5277. or comprising a targeting domain selected from the group; (16) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

29. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 42 to SEQ ID NO: 3270; (17) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

32. or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 71 to 3541; (18) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and wherein the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

35. or comprises a targeting domain selected from the group consisting of SEQ ID NO: 42 to SEQ ID NO: 4032; (19) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

40. 33 to 4589, and SEQ ID NO: 5720 to 5815. Contains the targeting domain to be selected; (20) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 84 to 392. and wherein the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO:

45. or comprising a targeting domain selected from the group consisting of SEQ ID NO: 5277 to SEQ ID NO: 90; (21) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 942 to 3270; (22) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 271 to 3541; (23) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 542 to SEQ ID NO: 4032; (24) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is From the group consisting of SEQ ID NOs: 033 to 4589, and SEQ ID NOs: 5720 to 5815 Contains a selected targeting domain; (25) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 393 to 532. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 590 to 5277; (26) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 942 to 3270; (27) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 271 to 3541; (28) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 542 to SEQ ID NO: 4032; (29) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is From the group consisting of SEQ ID NOs: 033 to 4589, and SEQ ID NOs: 5720 to 5815 Contains a selected targeting domain; (30) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 533 to 839. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 590 to 5277; (31) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 942 to 3270; (32) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NOs: 271 to 3541; (33) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is or comprises a targeting domain selected from the group consisting of SEQ ID NO: 542 to SEQ ID NO: 4032; (34) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is From the group consisting of SEQ ID NOs: 033 to 4589, and SEQ ID NOs: 5720 to 5815 contains a selected targeting domain; or (35) The first gRNA molecule is selected from the group consisting of SEQ ID NOs: 840 to 968. the second guide RNA molecule comprises a selected targeting domain and is A cell comprising a targeting domain selected from the group consisting of SEQ ID NO: 590 to SEQ ID NO: 5277 The cell according to claim 137.

153. The targeting domain of the first gRNA molecule, and the The targeting domain, and if present, the targeting domain of the third gRNA molecule Are any of the following sequences: a) Combinations A1 to A72 in Table 33; b) Combinations B1 to B84 in Table 34; c) Combinations C1 to C42 in Table 35; d) Combinations D1 to D36 in Table 36; e) Combinations E1 to E30 in Table 37; or f) Combinations F1 to F60 in Table 38 The cell according to claim 137 or claim 142, comprising, for example, consisting of.

154. The first gRNA molecule comprises a targeting domain comprising SEQ ID NO: 5569, SEQ ID NO: 5592, or SEQ ID NO: 5 586, and the second gRNA molecule comprises a targeting domain comprising SEQ ID NO: 57 75, the cell according to claim 137.

155. A gene comprising a target sequence complementary to the targeting domain of the first gRNA molecule, and optionally, a gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule, to the targeting domain of the first gRNA molecule The gene comprising a target sequence complementary to the target sequence, and optionally, the functional product of the gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule is The cell according to any one of claims 126 to 154, modified to reduce or eliminate expression. The gene comprising a target sequence complementary to the target sequence, and optionally, the functional product of the gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule is The cell according to any one of claims 126 to 154, modified to reduce or eliminate expression. The cell according to any one of claims 126 to 154, modified to reduce or eliminate expression. The cell according to any one of claims 126 to 154, modified to reduce or eliminate expression.

156. A method for inducing antitumor immunity in a subject, the method comprising administering to the subject an effective amount of a cell according to any one of claims 1 26 to 155.

157. A method for treating a subject having a disease associated with the expression of a tumor antigen, such as a proliferative disease, a pre-cancerous condition, cancer, and a non-cancer-related indication associated with the expression of the A method for treating a subject having a disease associated with the expression of a tumor antigen, such as a proliferative disease, a pre-cancerous condition, cancer, and a non-cancer-related indication associated with the expression of the A method for treating a subject having a disease associated with the expression of a tumor antigen, such as a proliferative disease, a pre-cancerous condition, cancer, and a non-cancer-related indication associated with the expression of the A method comprising administering to the subject an effective amount of a cell according to any one of claims 126 to 155.

158. The method according to claim 157, wherein the disease associated with the expression of the tumor antigen is cancer or a non-cancer-related indication. The method according to claim 157, wherein the disease associated with the expression of the tumor antigen is cancer or a non-cancer-related indication.

159. The diseases include colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, and esophageal cancer. Road cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma , uterine cancer, ovarian cancer, rectal cancer, anal cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer Cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid Cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder Bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma tumors, tumor angiogenesis, spinal axis tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinomas, Squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, chronic lymphocytic leukemia (CLL), acute Myeloid leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL) , T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute bone marrow AML, B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Kitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, Small cell or large cell follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, Toll cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes , Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom Leukemia, preleukemia, combinations of the above cancers, and progression of the above cancers The method of claim 158, wherein the cancer is selected from metastatic lesions.

160. 160. The method of any one of claims 156 to 159, further comprising administering a chemotherapeutic agent. How to post.

161. The chemotherapeutic agent is cyclophosphamide, fludarabine, or cyclophosphamide and and fludarabine.

162. Administering to the subject an effective amount of the cells of any of claims 126-155.

2. The method of claim 1, further comprising administering a lymphodepleting agent or an immunosuppressant prior to the step of administering the method of claim 1. 56 to 161.

163. 1. A method of preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) selecting a T cell recipient; The cells are modified by reducing or eliminating the expression of components of the receptor (TCR). a step of transforming into the cell a gRN according to any one of claims 2b to 2h; A molecule, e.g., more than one gRNA molecule, e.g., claims 3, 4, 5, 10, 11 or 12 or 13, e.g., to introduce more than one gRNA molecule. (b) detecting HLA (e.g., HLA-A, HLA-B, and / or or HLA-C) or B2M expression, thereby modifying the cell by adding to the cell a gene encoding a gene encoding a gene of claim 2a, 2i, 2j or 2k a gRNA molecule according to any one of claims 6 to 9, e.g., more than one gRNA molecule, e.g., a gRNA molecule according to claim 6 or 7. The method of claim 1, further comprising introducing a gRNA molecule, e.g., more than one gRNA molecule, into a mammalian cell. and (c) expanding the cells.

164. The cells are modified by reducing or eliminating the expression of CIITA. a step of administering to the cell a gRNA molecule according to claim 2p, for example, more than one A gRNA molecule comprising the sequence of claim 8 or 9, for example a ... and further comprising introducing more than one gRNA molecule into said cells.

164. The method of claim 163, wherein the modifying step is optionally performed before the method.

165. 1. A method of preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) selecting a T cell recipient; The cells are modified by reducing or eliminating the expression of components of the receptor (TCR). a step of transforming into the cell a gRN according to any one of claims 2b to 2h; A molecule, e.g., more than one gRNA molecule, e.g., claims 3, 4, 5, 10, 11 or 12 or 13, e.g., to introduce more than one gRNA molecule. (b) reducing or eliminating expression of a target of an immunosuppressant drug. A step of modifying a cell by applying to the cell a gene encoding a nucleotide sequence according to claims 21, 2m, and 2b. n or 2o, e.g., more than one gRNA molecule; For example, a gRNA molecule according to claim 13, e.g., more than one gRNA molecule, can be introduced. and (c) expanding the cells.

166. (d) the first inhibitory molecule or a downstream effector of signal transduction via the inhibitory molecule; modifying the cell by reducing or eliminating expression of , into the cell, a gRNA molecule of claim 14, e.g., more than one gRNA molecule. and prior to expanding the cells, further comprising introducing 166. The method of any of claims 163 to 165, wherein the modifying step is optional. 。

167. 1. A method of preparing cells (e.g., a cell population) for immunotherapy, comprising: (a) administering a first inhibitor to a cell population; Reducing the expression of downstream effectors of signal transduction via toxic or inhibitory molecules modifying a cell by introducing or eliminating a 15. The gRNA molecule of claim 14, e.g., more than one gRNA molecule, e.g., claim 18. A method for introducing a gRNA molecule according to any one of 15 to 17, e.g., more than one gRNA molecule. and (c) expanding the cells.

168. (e) a second inhibitory molecule, or a downstream effector of signaling through the inhibitory molecule modifying the cell by reducing or eliminating expression of , into the cell, a gRNA molecule of claim 14, e.g., more than one gRNA molecule. wherein the first inhibitory molecule, or the inhibitory molecule and a downstream effector of signaling via the second inhibitory molecule, or Any of claims 166 to 167, wherein the downstream effector of signal transduction via the The method described above.

169. 163 to 165, wherein the introduction of each of the gRNA molecules is simultaneous or sequential.

168. A method according to any one of claims 168 to 168.

170. wherein the introduction of each of the gRNA molecules is sequential and lasts for at least 24 hours, for 2 days; May be spaced 3, 4, 5, 6, 7, 8, 9, or 10 days apart 170. The method of claim 169.

171. into the cell, e.g., by administering to the cell a chimeric antigen receptor (CAR) encoding a chimeric antigen receptor (CAR), e.g., as described herein.

171. The method of any one of claims 163 to 170, further comprising the step of introducing a nucleic acid method.

172. 172. The method of Claim 171, wherein the nucleic acid encoding the CAR is located on a template nucleic acid.

173. The nucleic acid encoding the CAR of Claim 171 is located on an RNA vector. method.

174. 171. The nucleic acid encoding the CAR is placed on a lentiviral vector. The method described below.

175. Claim 163, further comprising the step of isolating cells negative for expression of TCR. 166 or 169 to 174.

176. The step of isolating comprises isolating approximately 90%, 91%, 92%, 93, 94% or more of the cells. %, 95%, 96%, 97%, 98%, 99% or more than 99.5% of the TCR 176. The method of claim 175, wherein the method results in a cell population that is negative for expression of

177. The step of isolating cells negative for expression of the TCR comprises isolating the cell population as a T and optionally, a solid support or contacting the cells that do not bind to the antibody with a composition conjugated to a detectable label, and 177. The method of claim 175 or 176, comprising separating.

178. 178. The method of any one of claims 163 to 177, wherein the cell is an immune effector cell. How to do it.

179. 179. The method of claim 178, wherein the cell is a T cell or an NK cell.

180. 179. The method of claim 178, wherein the cell is a T cell.

181. The cells are isolated from healthy donors, e.g., donors not suffering from a condition not associated with tumor antigen expression.

181. The method of any of claims 163 to 180, wherein the compound is isolated from a nucleus.

182. 163 to 166, wherein steps (a) and / or (b) are performed ex vivo.

181. A method according to any one of claims 181 to 181.

183. 183. The method of claim 182, wherein step (c) is performed ex vivo.

184. The expanding step (c) is performed by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 Over 1, 12, 13, 14, or 15 days, or 2-15, 2-14, 2-1 3、2~12、2~11、2~10、3~10、2~9、3~9、2~8、3~8、2~ 7, 3 to 7, 2 to 6, 3 to 6, 2 to 5, or 3 to 5 days. 63 to 183.

185. 165. A method of treating a subject in need thereof, comprising administering to a subject a compound according to any one of claims 163 to 164. A method comprising administering cells (e.g., cell populations) prepared by the methods described.

186. 1. A method of treating a subject in need thereof, comprising administering to a subject a therapeutically effective amount of a compound according to claim 1 in combination with an immunosuppressant. Administering cells (e.g., cell populations) prepared by the method of claim 65. method.

187. 185-186, wherein the cells (e.g., cell population) are autologous to the subject.

86. A method according to any one of claims 86 to 86.

188. 185 or 186, wherein the cells (e.g., cell population) are allogeneic to the subject. The method described in et al.

189. The subject has a disease associated with expression of a tumor antigen, e.g., a proliferative disease, a precancerous condition, and non-cancer-related indications associated with expression of said tumor antigen, and said administration 189. The method of any one of claims 185 to 188, for treating a disease associated with expression of a tumor antigen. Law.

190. 12. The method of claim 1, wherein the disease associated with expression of the tumor antigen is cancer or a non-cancer related indication.

89. The method according to claim 89.

191. The diseases include colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, and esophageal cancer. Road cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma , uterine cancer, ovarian cancer, rectal cancer, anal cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer Cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid Cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder Bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma tumors, tumor angiogenesis, spinal axis tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinomas, Squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, chronic lymphocytic leukemia (CLL), acute Myeloid leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL) , T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute bone marrow AML, B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Kitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, Small cell or large cell follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, Toll cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes , Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom Leukemia, preleukemia, combinations of the above cancers, and progression of the above cancers 191. The method of claim 190, wherein the cancer is selected from metastatic lesions.

192. 1. A method of treating a patient suffering from a disease, comprising: (a) providing a population of cells derived from an allogeneic donor; (b) transfecting the cells with CD247, CD3D, CD3E, CD3G, TRAC, or TRB C1, and TRBC2. a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a domain , CRISPR systems (e.g., S. pyogenes Cas9-based CRISPR) introducing a system; (c) optionally, selecting cells that have reduced or eliminated expression of a functional TCR; and (d) transducing the cells with a nucleic acid encoding a CAR; (e) administering the cells to a patient in need thereof, for example, administering to a patient an antigen recognized by the CAR. administering the compound to a patient having a disease associated with the expression of the compound; A method comprising:

193. CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, or TRBC The first gRNA molecule for 2 is a gRNA molecule according to any one of claims 2(b) to 2(h). The nucleic acid molecule is an RNA molecule, for example, as described in any one of claims 3, 4, 5, 10, 11, or 12. The method of claim 192, wherein the gRNA molecule is

194. A gene selected from B2M, HLA-A, HLA-B, or HLA-C is introduced into the cell. a second gRNA molecule (or A CRISPR system (e.g., a nucleic acid encoding the gRNA molecule) The method further comprises introducing a CRISPR system (S. pyogenes Cas9-based CRISPR system) into the cell.

194. A method according to any one of paragraphs 192 to 193.

195. the second gRNA directed against B2M, HLA-A, HLA-B, or HLA-C, A gRNA molecule according to any one of claims 2(a) or 2(i) to 2(k), e.g.

195. The method of claim 194, which is, for example, a gRNA molecule of claim 6 or 7. Law.

196. CIITA, RFXANK, RFXAP, RFX5, HLA-DM, H In a gene selected from HLA-DO, HLA-DR, HLA-DQ, and HLA-DP a third gRNA molecule (or the aforementioned) comprising a targeting domain complementary to the target sequence of a CRISPR system (e.g., a nucleic acid encoding a gRNA molecule) for Streptococcus pyogenes (S. p yogenes) Cas9-based CRISPR system. 92 to 195.

197. The third gRNA molecule is any of the gRNA molecules described in claims 2(a) or 2(i) to 2(k). The gRNA molecule is, for example, the gRNA molecule of claim 6 or 7. The method of claim 196.

198. a gene selected from DCK, CD52, FKBP1A, or NR3C1 into the cells; a second gRNA molecule (also known as a gRNA molecule) that contains a targeting domain complementary to a target sequence within the gene; a nucleic acid encoding the gRNA molecule), The method further comprises introducing a CRISPR system (S. pyogenes Cas9). The method of any one of claims 192 to 193.

199. the second gRNA molecule directed against DCK, CD52, FKBP1A, or NR3C1 is the second gRNA molecule according to any one of claims 2(l) to 2(o), for example: The method of claim 198, wherein the second gRNA molecule is the second gRNA molecule of claim 13.

200. the second gRNA is directed against DCK, and the method comprises administering a nucleoside analog 200. The method of claim 198, further comprising administering a base drug to the patient. A method according to any one of the preceding claims.

201. The nucleoside analog-based drug is cytarabine or gemcitabine.

201. The method according to paragraph 200.

202. the second gRNA is directed against CD52, and the method comprises using an anti-CD52 antibody or or an antigen-binding fragment thereof to said patient.

200. A method according to any one of claims 1 to 199.

203. The anti-CD52 antibody or antigen-binding fragment thereof is alemtuzumab (CAMPATH ( The method of claim 202, wherein the .

204. the second gRNA is directed against FKBP1A, and the method comprises: mTor inhibitors such as cyclosporine, rapamycin or a rapalog, or RAD001 200. Any of claims 198 to 199, further comprising the step of administering to said patient a therapeutically effective amount of ... The method described above.

205. the second gRNA is directed against NR3C1, and the method comprises administering a corticosterone-receptor 200. The method of any one of claims 198 to 199, further comprising administering to the patient The method described above.

206. 206. The method of claim 205, wherein the corticosteroid is dexamethasone.

207. The cells were transfected with CD274, HAVCR2, LAG3, PDCD1, PD-L2, and CT. LA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2 B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), H VEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, M HC class II, GAL9, adenosine, and TGFbeta, or PTPN11 a fourth gRN comprising a targeting domain complementary to a target sequence within a selected gene; A CRISPR system (e.g., Further, a step of introducing a CRISPR system using S. pyogenes Cas9 is also included.

207. The method of any of claims 192 to 206, further comprising:

208. the fourth gRNA molecule is selected from the group consisting of CD274, HAVCR2, LAG3, PDCD1, and is directed against PTPN11, and the gR according to any one of claims 15(a) to (e) A gRNA molecule, for example, a gRNA molecule according to any one of claims 15 to 17.

207. The method according to claim 207.

209. 1. A method of treating a patient suffering from a disease, comprising: (a) providing a population of immune effector cells; (b) transfecting the cell population with CD247, CD3D, CD3E, CD3G, TRAC, T A targeting molecule complementary to a target sequence in a gene selected from RBC1, and TRBC2. a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a gRNA domain; CRISPR systems (e.g., S. pyogenes Cas9-based CRISPR) introducing a PR system; (c) injecting into said cell population a selection of HLA-A, B2M, HLA-B, and HLA-C. a second gRNA comprising a targeting domain complementary to a target sequence within the gene of choice; a CRISPR system (e.g., a chemical introducing a S. pyogenes Cas9-based CRISPR system; (d) optionally a functional TCR, a functional B2M, or a functional TCR and B2M selecting cells that have reduced or eliminated expression of both (d) introducing into the cell population a nucleic acid encoding a CAR; (e) administering the cell population to a patient in need thereof, e.g., a patient receiving a therapeutic agent recognized by the CAR. administering the antigen to a patient having a disease associated with expression of the antigen; A method comprising:

210. (f) transferring CIITA, RFXANK, RFX5, and RFXAP to said cell population; a third gR comprising a targeting domain complementary to a target sequence within a gene selected from a CRISPR system (e.g., a nucleic acid encoding the gRNA molecule) , a step of introducing a Streptococcus pyogenes (S. pyogenes Cas9-based CRISPR system) 210. The method of claim 209, further comprising:

211. The first gRNA molecule is selected from TRAC, TRBC1, and TRBC2. Claims 209-210, comprising a targeting domain complementary to a target sequence within a gene The method described below.

212. The second gRNA molecule has a targeting domain complementary to a target sequence within the B2M gene. The method of claims 209 to 211, comprising:

213. The third gRNA molecule is a targeting molecule complementary to a target sequence within the CIITA gene.

213. The method of claims 210 to 212, comprising a domain.

214. The first gRNA molecule targets the sequence of the TRAC gene and is set forth in SEQ ID NO:

55. 69, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, Sequence number 5600, sequence number 5594, sequence number 5571, sequence number 5593, sequence number 5 574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, or A targeting domain including, for example, any one of the columns 5620 214. The method of any one of claims 209 to 213, comprising:

215. The first gRNA molecule is selected from the group consisting of SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587 , SEQ ID NO: 5599, SEQ ID NO: 5600, SEQ ID NO: 5586, e.g., SEQ ID NO: 5569 , SEQ ID NO: 5586, or SEQ ID NO: 5592, for example. The method of claim 214, comprising a targeting domain consisting of:

216. The second gRNA molecule targets the sequence of the B2M gene and is set forth in SEQ ID NO:

551. 9, SEQ ID NO: 5497, SEQ ID NO: 5499, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: No. 5496, SEQ ID NO: 5507, SEQ ID NO: 5515, SEQ ID NO: 5493, SEQ ID NO: 55 06, SEQ ID NO: 5509, SEQ ID NO: 5517, SEQ ID NO: 5521, SEQ ID NO: 5520, Sequence number 5500, sequence number 5494, sequence number 5508, sequence number 5514, or sequence A targeting domain including, for example, consisting of, any one of the following:

216. The method of any of claims 209 to 215, comprising:

217. the second gRNA molecule is selected from the group consisting of SEQ ID NO: 5496, SEQ ID NO: 5498, and SEQ ID NO: 5 509, e.g., comprising a targeting domain consisting of How to post.

218. The third gRNA molecule targets the sequence of the CIITA gene and is set forth in SEQ ID NO:

7. 771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO:7739, SEQ ID NO:7779, SEQ ID NO:7770, SEQ ID NO:7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 7772 , SEQ ID NO: 7743, or SEQ ID NO: 7750, for example.

218. The method of claim 210, comprising a targeting domain consisting of: method.

219. the third gRNA molecule is selected from the group consisting of SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739 or any one of SEQ ID NO: 7785, The method of claim 218, comprising a binding domain.

220. A nucleic acid molecule encoding an NK inhibitory molecule, such as an HLA-G:B2M fusion protein, is introduced into the cell. A nucleic acid molecule encoding the fusion protein, e.g., a nucleic acid molecule encoding SEQ ID NO: 10674, is introduced.

220. The method of any of claims 209 to 219, further comprising the step of:

221. 221. The method of claim 209-220, wherein the population of immune effector cells is a population of T cells. Any of the methods described above.

222. 221. The method of claim 221, wherein said population of immune effector cells is allogeneic to said patient. The method described below.

223. 223. The method of any one of claims 209 to 222, wherein the CAR is a CD19 CAR. method.

224. 223. The method of any one of claims 209 to 222, wherein the CAR is a BCMA CAR. method.

225. The BCMA CAR is selected from the group consisting of SEQ ID NOs: 7939 to 8112, or SEQ ID NO: 81 55 to 8166, for example, Claim 224 comprising an antigen recognition domain comprising, e.g., consisting of, SEQ ID NO: 7949 The method described below.

226. The BCMA CAR is any one of SEQ ID NOs: 8549 to 8621.

225. The method of claim 224, comprising, for example, comprising, for example, consisting of SEQ ID NO: 8559 How to do it.

227. compared to unmodified cells of the same type a) components of the T cell receptor; b) B2M; and / or c) CIITA Modified cells having reduced or eliminated expression of

228. wherein the T cell receptor component is a TCR alpha chain or a TCR beta chain.

228. The cell of paragraph 227.

229. The cell of claim 227, wherein the T cell receptor component is a TCR alpha chain. 。

230. The TCR component is CD3 delta, CD3 epsilon, or CD3 gamma. The cell of claim 227, wherein the cell is, for example, CD3 epsilon.

231. compared to unmodified cells of the same type a) genes encoding components of the T cell receptor; b) B2M; and / or c) CIITA; At or near these, an insertion or deletion of a base pair, e.g., more than one base pair, Modified cells containing a gene or deletion.

232. 232. The modified cell of claim 231, wherein each of the insertions or deletions is an indel.

233. 23. The method of claim 231, wherein each of the insertions or deletions is a frameshift mutation.

3. The modified cell according to any one of 2.

234. 234. The modified cells of any one of claims 231 to 233, wherein at least one of said cells In about 30% of cases, at least one of the insertions or deletions is detected, for example, by NGS. A cell population in which a frameshift mutation is measured.

235. reduced expression of components of the T cell receptor, B2M, and CIITA; and The modified cell (or cell population) of any one of claims 231 to 234, wherein 。

236. (g) a nucleic acid sequence encoding a CAR, e.g., as described herein; (h) optionally, a nucleic acid sequence encoding, for example, an NK inhibitory molecule described herein; sequences encoding, for example, HLA-G or HLA-G:B2M fusions described herein. nucleic acid; (i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3E, C D3D, or CD3G, e.g., TRAC) or a gene encoding a regulatory element thereof Indels in or near the sequence of a gene, such as components of a TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; (j) a sequence in or of a gene encoding B2M or a regulatory element thereof Indels in the vicinity, e.g., including the targeting domain for B2M, e.g. In the target sequence of the gRNA, which contains a targeting domain listed in Table 1 or Table 3 indels at or near this site; (k) optionally, a sequence of a gene encoding CIITA or a regulatory element thereof; Indels in or near this region, e.g., targeted to CIITA a targeting domain, for example, a targeting domain listed in Table 1 or Table 6c; Indels in or near the target sequence of the gRNA; and (l) Optionally, the sequence of a gene encoding LILRB1 or its regulatory elements. Indels in or near LILRB1, e.g., targeting LILRB1 gRNs containing a targeting domain, e.g., a targeting domain listed in Table 6d. A cell containing an indel at or near the target sequence of A, The cells (or a cell population comprising the cells) are and i) expressing components of the TCR (e.g., TRAC, TRBC1, TRB C2, CD3D, CD3E, or CD3G, e.g., TRAC), ii) B2M, ii i) CIITA, and / or iv) LILRB1; and and / or exhibiting a reduction or loss of function, A cell (eg, a cell comprising, eg, a cell population comprising more than one cell).

237. (g) a nucleic acid sequence encoding a CAR, e.g., as described herein; (h) optionally, a nucleic acid sequence encoding, for example, an NK inhibitory molecule described herein; a nucleic acid encoding a sequence, e.g., HLA-G, as described herein; (i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a CD3E, or CD3G (e.g., TRAC) or a regulatory element thereof Indels in or near the sequence of a gene, such as components of a TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; (j) in the sequence of a gene encoding NLRC5 or a regulatory element thereof; or Indels in this vicinity, e.g., containing the targeting domain for NLRC5 In the target sequence of the gRNA, for example, containing a targeting domain listed in Table 1 an indel at or near this site; (k) optionally, a sequence of a gene encoding CIITA or a regulatory element thereof Indels in or near this region, e.g., targeted to CIITA a targeting domain, for example, a targeting domain listed in Table 1 or Table 6c; Indels in or near the target sequence of the gRNA; and (l) optionally, the sequence of a gene encoding LILRB1 or a regulatory element thereof Indels in or near LILRB1, e.g., targeting LILRB1 gRNs containing a targeting domain, e.g., a targeting domain listed in Table 6d. A cell containing an indel at or near the target sequence of A, The cells (or a cell population containing one or more of the cells) are and optionally the NK inhibitory molecule, and i) a component of the TCR (e.g., TRA C, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC ), ii) B2M, iii) NLRC5, and / or iv) LILRB1. or exhibiting reduced or absent expression and / or function; A cell (eg, a cell comprising, eg, a cell population comprising more than one cell).

238. (d) a nucleic acid sequence encoding a CAR, e.g., as described herein; (e) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a CD3E, or CD3G (e.g., TRAC) or a regulatory element thereof Indels in or near the sequence of a gene, such as components of a TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; indels in or near the sequence; and (f) a sequence in the gene encoding FKBP1A or its regulatory elements; Indels in this vicinity, e.g., targeting domains for FKBP1A, gRNA comprising, for example, a targeting domain listed in Table 1 or Table 6b a cell containing an indel at or near a target sequence of the cells (or cells comprising them, e.g., a cell population comprising more than one cell) expressing the CAR, and i) components of a TCR (e.g., TRAC, TRBC1, TRBC 2, CD3D, CD3E, or CD3G, e.g., TRAC), and / or ii) exhibiting reduced or absent expression and / or function of one or more of FKBP12 do, A cell (eg, a cell comprising, eg, a cell population comprising more than one cell).

239. (d) a nucleic acid sequence encoding a CAR, e.g., as described herein; (e) a nucleic acid sequence encoding, for example, a rapamycin-resistant mTor as described herein , e.g., encoding mTor containing an S2035 mutation, e.g., an S2035I mutation a nucleic acid sequence corresponding to (f) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, C a gene encoding a CD3E, or CD3G (e.g., TRAC) or a regulatory element thereof Indels in or near the sequence of a gene, such as components of a TCR (e.g., For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. , TRAC), e.g., Table 1, Table 4, Table 5, Table 6 a targeting domain listed in Table 6e, Table 6f, or Table 6g; 1. A cell containing an indel in or near a sequence, the cells (or a cell population comprising the cells, e.g., more than one of the cells) The group) expresses the CAR and the rapamycin-resistant mTor, and expresses a TCR component ( For example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g. For example, they exhibit reduced or absent expression and / or function of TRAC; A cell (eg, a cell comprising, eg, a cell population comprising more than one cell).

240. The gRNA comprising a targeting domain for a component of a TCR is represented by SEQ ID NO:5 569, SEQ ID NO: 5568, SEQ ID NO: 5601, SEQ ID NO: 5592, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, for example, SEQ ID NO: 5569, Any one of SEQ ID NO: 5586, SEQ ID NO: 5587, or SEQ ID NO: 5592 239. Claims 236-239, comprising a targeting domain comprising (e.g., consisting of): The cell described in any one of the above.

241. The gRNA comprising a targeting domain for B2M is represented by SEQ ID NO: 5496, 5498, or any one of SEQ ID NO: 5509 (e.g., 241. The method of claim 236 or 240, comprising a targeting domain consisting of Cells on the plate.

242. The gRNA comprising a targeting domain for CIITA is represented by SEQ ID NO: 7739 , SEQ ID NO: 7769, SEQ ID NO: 7771, or SEQ ID NO: 7785 Claims 236 and 237, comprising a targeting domain comprising (e.g., consisting of): 239, 240, or 241.

243. The gRNA comprising a targeting domain for KFBP1A is represented by SEQ ID NO: 669 3, SEQ ID NO: 6705, SEQ ID NO: 6694, SEQ ID NO: 6699, or SEQ ID NO: 6708 a targeting domain comprising (e.g., consisting of) any one of 242. A cell according to any one of claims 238, 240, or 241.

244. The gRNA containing a targeting domain for a component of the TCR is listed in Table 6e, Table 6f or Table 6g, e.g., Table 6e (e.g., , consisting of) a targeting domain, e.g., SEQ ID NO: 10729, SEQ ID NO: 10 719, SEQ ID NO: 10764, SEQ ID NO: 10689, SEQ ID NO: 10701, SEQ ID NO: 10 700, or any one of SEQ ID NO: 10722. 9 or 241 to 243, a cell described in any one of claims 241 to 243.

245. the targeting domain of the gRNA molecule directed against a component of the TCR, B2 The targeting domain of the gRNA molecule for M and for CIIRA The targeting domains of the gRNA molecules each comprise: a) the target of said gRNA molecule listed in any combination of A1 to A72 of Table 33 a targeting domain sequence; or b) the target sequence of the gRNA molecule is listed in any combination of F1 to F60 of Table 38. Targeting domain sequence The cell of claim 236, comprising, for example consisting of:

246. the targeting domain of the gRNA molecule directed against a component of the TCR, B2 The targeting domain of the gRNA molecule for M and for CIIRA The targeting domain of the gRNA molecule is selected from the group consisting of B1 to B84 in Table 34, respectively. comprising the targeting domain sequences of each gRNA molecule listed in any combination; For example, the cell described in claim 236, consisting of:

247. the targeting domain of the gRNA molecule directed against a component of the TCR, and and the targeting domains of the gRNA molecules for FKBP1A and FKBP1A, respectively: The targeting of the gRNA molecule is listed in any combination of C1 to C42 of Table 35. The cell of claim 238, comprising, for example consisting of, a binding domain sequence.

248. the targeting domain of the gRNA molecule directed against a component of the TCR, and and the targeting domains of the gRNA molecules for FKBP1A and FKBP1A, respectively: : a) the target of the gRNA molecule listed in any combination of D1 to D36 of Table 36 a targeting domain sequence; or b) the target of said gRNA molecule is listed in any combination of E1 to E30 of Table 37 Targeting domain sequence The cell of claim 238, comprising, for example consisting of:

249. Each of the indels in the cell is transferred to the cell, each of which is a targeting domain complementary to the target sequence at or near the target sequence; RNA molecules, e.g., more than one gRNA molecule (e.g., the gRNA molecules, e.g., A CRISPR system, e.g., more than one CRISPR system, comprising each of the more than one gRNA molecules.

249. The method of any one of claims 236 to 248, wherein the method is produced by introducing a RISPR system. Cells on the plate.

250. At least about 30% of the cells of the population are any of claims 236-249. A cell population, the cell being any of the cells described above.

251. At least about 50% of the cells of the population are a cell of any one of claims 236 to 249. A cell population is a cell population of cells.

252. At least about 75% of the cells of the population are a cell of any one of claims 236 to 249. A cell population is a cell population of cells.

253. At least about 90% of the cells of the population are a cell of any one of claims 236 to 249. A cell population is a cell population of cells.

254. 250. The method of claim 249, wherein at least one of said cells is a cell-free medium. At least about 30% (e.g., at least about 40%, e.g., at least about 50%) %, e.g., at least about 60%, e.g., at least about 70% For example, at least about 80%, for example, at least about 90%, e.g., For example, at least about 95%, e.g., at least about 99%) of the index A cell population in which each of the mutations is a frameshift mutation.

255. 34A, 34B, or 49.

54. The cell (or cell population) of any one of 54.

256. Claims 236 or 239-25 comprising an indel listed in Figure 36 or Figure 48 6. A cell (or cell population) according to any one of claims 5 to 5.

257. 236, comprising an indel listed in FIG. 38, FIG. 41, FIG. 44, or FIG. 50; 237, or the cell (or cell population) of any one of 239 to 256.

258. 258. The method of claim 238, comprising administering to a subject the method of claim 257, the method comprising administering to a subject the method of claim 258, the A cell (or cell population).

259. A cell population comprising a cell according to any one of claims 255 to 258.

260. At least about 20% of the cells of the cell population are selected from the group consisting of any of claims 255 to 258. A cell population, the cell being the cell described in any one of claims 1 to 4.

261. At least about 50% of the cells of the cell population are selected from the group consisting of any of claims 255 to 258.

261. The cell population of claim 260, wherein the cell is a cell described in any one of claims 260.

262. Less than about 5%, for example less than about 1%, for example less than about 0.01%, of the cells in the cell population 262. The method of any one of claims 259 to 261, wherein less than % of the sequences contain off-target indels. cell population.

263. 236. A method according to any one of claims 227 to 235, engineered to express a chimeric antigen receptor. The cell (or cell population) described.

264. 264. The method of any one of claims 236 to 263, wherein the CAR is a CD19 CAR. A cell (or cell population).

265. 264. The method of any one of claims 236 to 263, wherein the CAR is a BCMA CAR. A cell (or cell population).

266. The BCMA CAR is selected from the group consisting of SEQ ID NOs: 7939 to 8112, or SEQ ID NO: 81 55 to 8166, for example, Claim 265, comprising an antigen recognition domain comprising, e.g., consisting of, SEQ ID NO: 7949 A cell (or cell population) according to claim 1.

267. The BCMA CAR is any one of SEQ ID NOs: 8549 to 8621.

266. The method of claim 265, comprising, for example, comprising, for example, consisting of SEQ ID NO: 8559 A cell (or cell population) of.

268. The CD19 CAR is any one of SEQ ID NOs: 7883 to 7898.

265. The cell (or cell population) of claim 264, comprising an antigen-binding domain comprising:

269. 2. The CD19 CAR of claim 1, wherein the CD19 CAR comprises SEQ ID NO: 7909 or SEQ ID NO: 7920.

64. A cell (or cell population) according to claim 64.

270. 269. The cell of any one of claims 227 to 269 (or a cell of any one of claims 227 to 269), wherein the cell is an animal cell. indicates cell population).

271. 2. The method of claim 1, wherein the cell is a mammalian, primate, or human cell, e.g., a human cell.

271. A cell (or cell population) according to any one of claims 27 to 270.

272. the cell is an immune effector cell (e.g., a population of immune effector cells); A cell (or cell population) according to any one of claims 227 to 271.

273. 273. The cell of claim 272, wherein the immune effector cell is a T cell or an NK cell. Cell (or cell cluster).

274. 274. The method of any one of claims 272 to 273, wherein the immune effector cells are T cells. A cell (or cell population) on the plate.

275. the T cells are CD4+ T cells, CD8+ T cells, or a combination thereof; A cell (or cell population) according to claim 274.

276. The cells of any of claims 227 to 275 are isolated from a healthy human subject. A cell (or cell population).

277. 227-229, wherein the cells are allogeneic to the patient to whom the cells are administered.

76. A cell (or cell population) according to any one of 76.

278. 1. A method for treating a disease, e.g., cancer, in a patient in need thereof, comprising:

278. A method comprising administering a cell according to any one of 27 to 277.

279. Any of claims 227 to 277 in combination with an immunosuppressant, e.g., RAD001.

279. The method of claim 278, comprising administering the cells described above.

280. A gRNA molecule according to any one of claims 1 to 60 for use as a medicament. The composition according to any one of claims 61 to 92 or 102 to 108, claims 93 to 9 9, a vector according to any one of claims 100 to 101, and The cell (or cells) according to any one of claims 126 to 155 or 227 to 277 cell population).

281. 61. A gRNA molecule according to any one of claims 1 to 60 for use in the manufacture of a medicament. , a composition according to any one of claims 61 to 92 or 102 to 108, claim 93 99. A nucleic acid according to any one of claims 100 to 101. or a cell (or cells) according to any of claims 126 to 155 or 227 to 277. or cell population).

282. 61. The gRNA molecule of any one of claims 1 to 60 for use in the treatment of a disease. , a composition according to any one of claims 61 to 92 or 102 to 108, claim 93 99. A nucleic acid according to any one of claims 100 to 101. or a cell (or cells) according to any of claims 126 to 155 or 227 to 277. or cell population).

283. Diseases associated with tumor antigen expression, such as proliferative diseases, precancerous conditions, cancer, and precancerous disorders For use in treating a disease that is a non-cancer-related indication associated with expression of the tumor antigen, A gRNA molecule according to any one of claims 1 to 60, claims 61 to 92 or 102 a composition according to any one of claims 93 to 108, a nucleic acid according to any one of claims 93 to 99, A vector according to any one of claims 100 to 101 or claims 126 to 155.

278. The cell (or cell population) according to any one of 227 to 277.

284. Chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphocytic leukemia (ALL), B-cell lymphoma Cystic acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), Chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia , blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma leukemia, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoma Myeloproliferative conditions, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma lymphoma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, Hodgkin's lymphoma, phenotype Blastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia and pre-leukemia. A gRNA molecule according to any one of claims 1 to 60, claims 61 to 92 or a composition according to any one of claims 102 to 108, a composition according to any one of claims 93 to 99 A nucleic acid, a vector according to any one of claims 100 to 101, or claims 126 to 129. 55 or 227 to 277. A cell (or cell population) according to any one of claims 55 to 227.

285. For example, mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-pulmonary Small cell carcinoma, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, Skin or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal region cancer, stomach cancer, testicular cancer Cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma , endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer Cancer, pediatric solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) neoplasia substances, primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brainstem glioma, pituitary adenoma, Posi-sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, combination of the above cancers and for use in treating a cancer selected from the group consisting of: a cancer of the present invention; A gRNA molecule according to any one of claims 1 to 60, claims 61 to 92 or a composition according to any one of claims 102 to 108, a composition according to any one of claims 93 to 99 A nucleic acid, a vector according to any one of claims 100 to 101, or claims 126 to 129. 55 or 227 to 277. A cell (or cell population) according to any one of claims 55 to 227.