Antiviral SOX inhibitors
Antiviral compounds targeting SOX18 transcription factors, particularly SOX18, inhibit viral replication in lymphatic endothelial cells, addressing the limitations of current treatments for Kaposi's sarcoma and other herpesvirus-related diseases.
Patent Information
- Application Number
- JP2025092704
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-06-03
- Publication Date
- 2025-09-09
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current antiviral approaches are inadequate for effectively treating Kaposi's sarcoma caused by KSHV, particularly due to the virus's unique replication program in lymphatic endothelial cells, where SOX18 drives high viral genome copy numbers and lytic gene expression.
Development of antiviral compounds, specifically targeting SOX18 transcription factors, to inhibit viral replication by binding to the viral replication origin, using compounds of Formula 1, which can be administered to treat viral diseases or conditions.
The compounds effectively inhibit viral replication and treat Kaposi's sarcoma and other herpesvirus-related diseases by reducing viral load and symptom severity.
Smart Images

Figure 2025131690000001_ABST
Abstract
Description
[Technical Field]
[0001] The present disclosure generally relates to antiviral compounds for use in treating virus-related diseases or conditions. The present disclosure also relates to methods for preparing the antiviral compounds, and uses or methods for treating virus-related diseases or conditions, including administering the antiviral compounds. The present disclosure also provides antiviral compounds as inhibitors of SOX family transcription factors, particularly SOX18 transcription factor. [Background technology]
[0002] Kaposi's sarcoma (KS) is an angiogenic endothelial tumor caused by the KS-associated herpesvirus (KSHV). Most cases of KS occur in people infected with HIV, and these patients have a 20,000-fold increased risk of developing KS compared with people without HIV. KSHV infection is more common in some parts of the world, such as equatorial Africa, where more than 30% of the population has KSHV antibodies. In some parts of Africa, the virus appears to be spread from mother to child. Seropositivity for the virus ranges from 10% to 25% in the Mediterranean region. In other parts of the world where KSHV is not endemic, seroprevalence is approximately 2% to 5% (Horenstein et al., 2008; J. Cutan. Pathol. 35(Suppl. 2): pp. 40-44).
[0003] KS cells form purple, brown, or red lesions on the skin, usually papular (i.e., palpable or raised). In many cases, these skin lesions do not cause any symptoms; in other cases, they can cause painful swelling, especially in the leg area, groin area, or around the eyes. KS can cause serious problems and even become life-threatening if the lesions are in the lungs, liver, or digestive tract. Lesions in the digestive tract can cause blockages, resulting in nausea, vomiting, abdominal pain, and sometimes bleeding. Lung lesions can cause difficulty breathing.
[0004] KSHV appears to be transmitted through saliva, as is the case with other human herpesviruses. Sexual transmission through semen has also been suggested (Horenstein et al., (2008); J. Cutan. Pathol. 35(Suppl. 2): pp. 40-44). The virus may also be transmitted through organ donation. Some cases of KSHV have been reported in injection drug users, and it is thought to be spread when needles become contaminated with infected blood. Transmission of KSHV through blood appears to be rare, much less common than HIV transmission.
[0005] The histopathological hallmark of KS is the presence of KSHV-positive spindle cells (SCs), the tumor cells of KS (Ojala, PM & Schulz, TF (2014) Semin Cancer Biol 26: 69-77; Gramolelli, S. & Ojala, PM (2017) Curr Opin Virol 26: 156-162). The cell of origin of SCs has been debated for 20 years. The prevailing hypothesis suggests a lymphatic endothelial origin, but blood endothelial cells or mesenchymal cells are also candidates (Li, Y et al. (2018) Cancer Res 78: 230-245).
[0006] In vitro, latency is the default replication program in KSHV-infected cells with undetectable levels of lytic gene expression. However, KSHV infection of lymphatic endothelial cells (LECs and BECs) rather than blood results in a unique infection program characterized by high KSHV genome copies, spontaneous lytic gene expression, and release of infectious virus.
[0007] During embryonic development, LEC precursors are derived from COUPTF2 / SOX18 double-positive BECs that physically separate from the cardinal veins to establish the primary lymphatic plexus. During this process, COUPTF2 and SOX18 drive the expression of PROX1, thereby orchestrating LEC differentiation (Francois, M. et al., (2008) Nature 822: 456; Srinivasan, R. S. et al., (2010) Genes Dev 24, 696-707).
[0008] Alternatives to antiviral approaches for treating viruses such as KSHV are needed.
[0009] It will be understood that any prior art publications mentioned in this specification do not constitute an admission that any of these documents form part of the common general knowledge in the art in Australia or any other country. [Prior art documents] [Patent documents]
[0010] [Patent Document 1] International Publication No. 2018 / 112545 [Non-patent literature]
[0011] [Non-Patent Document 1] Horenstein et al. (2008); J. Cutan. Pathol. 35(Suppl. 2): pp. 40-44 [Non-patent document 2] Ojala, PM & Schulz, TF (2014) Semin Cancer Biol 26: pp. 69-77 [Non-patent document 3] Gramolelli, S. & Ojala, PM (2017) Curr Opin Virol 26: pp. 156–162 [Non-patent document 4] Li, Yら, (2018) Cancer Res 78: Pages 230~245
Non-patented document 5
Non-patent document 6
Non-patent document 7
Non-patent document 8
Non-patented document 9
Non-patent document 10
Non-patent document 11
Non-patent document 12
Non-patent document 13
Non-patent document 14
Non-Patent Document 15
Non-Patent Document 16
Non-Patent Document 17
Non-Patent Document 18
Non-Patent Document 19
Non-Patent Document 20
Non-Patent Document 21
Non-Patent Document 22
Non-Patent Document 23
Non-Patent Document 24
Summary of the Invention
Problems to be Solved by the Invention
[0012] The present disclosure is based on the discovery that SOX18 binds to viral replication origin and increases viral genome copy.Therefore, the present inventors have embarked on a wide-ranging development project to identify SOX inhibitors, particularly SOX18 inhibitors, that can inhibit viral replication, and this involves using Kaposi's sarcoma as an example. [Means for solving the problem]
[0013] In one embodiment, there is provided a method of treating a viral disease or condition by administering to a subject in need thereof an antiviral compound, wherein the antiviral compound is a compound of Formula 1:
[0014] [ka]
[0015] (In the formula, R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 selected from alkenylhalo; R 3 is hydrogen, C 1~10 Alkyl, C 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 selected from alkenylhalo; R 4 is hydrogen, OH, C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkylhalo, NH2, NH(C 1~10 alkyl), and N(C 1~10 alkyl)2; L 1 is C1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, OC 1~10 Alkenyl, OC(=O), OC(=O)(C 1~10 alkyl), NHC(=O), N(C 1~10 alkyl)C(=O), OS(=O)2, each alkyl or alkenyl is uninterrupted or selected from O, OC(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO2, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and aryl groups substituted with one or more groups selected from NO2). A method is provided in which:
[0016] In another aspect, there is provided a method of treating a viral disease or condition in a subject, comprising administering to a subject in need thereof an antiviral compound, wherein the antiviral compound is a compound of Formula 1, or a pharmaceutically acceptable salt, solvate, or stereoisomer thereof.
[0017] In another aspect, there is provided a use of a compound of Formula 1 as defined according to any aspect, embodiment or example described herein as an antiviral agent or for treating a viral disease or condition or a virus-related disease or condition.
[0018] In another aspect, there is provided the use of a compound of Formula 1 as defined according to any aspect, embodiment or example described herein in the manufacture of a medicament for treating a viral disease or condition or a virus-related disease or condition.
[0019] In another aspect, provided is a method of inhibiting herpesvirus replication in a subject and / or treating a viral disease or condition caused by a herpesvirus, comprising administering to the subject a compound of Formula 1 described herein.
[0020] It will be understood that other aspects, embodiments and examples of the compounds, pharmaceutical compositions, methods or uses are further described herein. [Brief explanation of the drawings]
[0021] [Figure 1] Figure 1 shows (a, b) luciferase reporter assays in transfected HeLa cells with increasing amounts of SOX18. Single values from (b) n = 8 and (c) n = 4 biological replicates are shown. Bars represent the mean ± standard error. [Figure 2]Figure 2 shows HeLa cells transfected with SOX18 and one of two luciferase reporter constructs: 7XTR and OriA for 18 hours, followed by treatment with GB001 (SM4), GB002, or GB004 for 24 hours. Luciferase signals were quantified, and single values from n=3 technical replicates are shown. Data points represent the mean + standard deviation. P values were calculated using two-way and ordinary one-way ANOVA followed by Dunnett's multiple comparison test. [Figure 3] Figure 3 shows LECs infected with KSHV and treated with the indicated concentrations of compounds for 6 days. Relative expression of KSHV from controls was quantified and single values from n=3 technical replicates are shown. Bars represent mean + standard deviation. P values were calculated using two-way ANOVA (left) and conventional one-way ANOVA (right) followed by Dunnett's multiple comparison test. DETAILED DESCRIPTION OF THE INVENTION
[0022] Key to the sequence table SEQ ID NO: 1 Sequence of K8.1 forward primer SEQ ID NO: 2: Sequence of K8.1 reverse primer SEQ ID NO: 3: Sequence of the genomic forward primer SEQ ID NO: 4: Genomic reverse primer sequence
[0023] Detailed Description general definition The following definitions apply to terms used throughout this specification, unless otherwise limited in specific instances: Unless specifically defined otherwise, all technical and scientific terms used herein shall be construed to have the same meaning as commonly understood by one of ordinary skill in the art.
[0024] As used herein, the term "and / or," e.g., "X and / or Y," shall be understood to mean either "X and Y" or "X or Y," and shall be interpreted as providing explicit support for both meanings or either meaning.
[0025] As used herein, the term "about" refers to + / - 20%, more preferably + / - 10% of the specified value, unless stated to the contrary.
[0026] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.
[0027] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0028] As used herein, the term "subject" refers to any organism susceptible to a disease or condition. For example, the subject may be a mammal, a primate, a livestock animal (e.g., sheep, cows, horses, pigs), a companion animal (e.g., dog, cat), or a laboratory animal (e.g., mouse, rabbit, rat, guinea pig, hamster). In one example, the subject is a mammal. In one embodiment, the subject is a human. In one embodiment, the disease or condition is associated with a virus.
[0029] As used herein, the term "treating" includes alleviating or reducing the symptoms associated with a particular disorder or condition.
[0030] As used herein, the term "prevention" includes the prevention of a particular disorder or condition. For example, as used herein, the term "preventing" refers to preventing the onset or persistence of symptoms associated with a virus.
[0031] The present disclosure relates to compounds of Formula 1 and salts thereof. Salts can be formed when embodiments of the compounds of Formula 1 contain suitable acidic or basic groups. Suitable salts of compounds of Formula 1 include those formed with organic or inorganic acids or bases.
[0032] As used herein, the phrase "pharmaceutically acceptable salt" or similar terms refers to a pharmaceutically acceptable organic or inorganic salt. It will be understood that any reference herein to a "salt" may include a "pharmaceutically acceptable salt." Exemplary acid addition salts include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Exemplary base addition salts include, but are not limited to, ammonium salts, alkali metal salts, such as potassium and sodium salts, alkaline earth metal salts, such as calcium and magnesium salts, and salts with organic bases, such as dicyclohexylamine, N-methyl-D-glucosamine, morpholine, thiomorpholine, piperidine, pyrrolidine, mono-, di-, or tri-lower alkylamines, such as ethyl, tert-butyl, diethyl, diisopropyl, triethyl, tributyl, or dimethylpropylamine, or mono-, di-, or trihydroxy lower alkylamines, such as mono-, di-, or triethanolamine. Pharmaceutically acceptable salts may involve the inclusion of another molecule, such as an acetate ion, a succinate ion, or other counterion. The counterion may be any organic or inorganic moiety that stabilizes the charge on the parent compound. Additionally, pharmaceutically acceptable salts may have more than one charged atom in their structure. In instances where multiple charged atoms are part of the pharmaceutically acceptable salt, there may be multiple counter ions. Thus, a pharmaceutically acceptable salt may have one or more charged atoms and / or one or more counter ions.It will also be understood that salts that are not pharmaceutically acceptable are also included within the scope of this disclosure, as these are useful as intermediates in the preparation of pharmaceutically acceptable salts or are useful during storage or transportation.
[0033] Those skilled in the art of organic chemistry and / or medicinal chemistry will understand that many organic compounds can form complexes in solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as "solvates." For example, a complex with water is known as a "hydrate." As used herein, the phrase "pharmaceutically acceptable solvate" or "solvate" refers to an association of one or more solvent molecules with a compound of the present disclosure. Examples of solvents that form pharmaceutically acceptable solvates include, but are not limited to, water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, and ethanolamine. It will be understood that the present disclosure encompasses solvated forms, including hydrates, of the compounds of formula (I) and salts thereof.
[0034] The compounds of the present disclosure may contain chiral (asymmetric) centers or the entire molecule may be chiral. Individual stereoisomers (enantiomers and diastereoisomers) and mixtures thereof are within the scope of the present disclosure.
[0035] As used herein, the term "stereoisomers" refers to compounds that have the same molecular formula and sequence of bonded atoms (i.e., atom connectivity), but differ in the three-dimensional orientation of their atoms in space. As used herein, the term "enantiomers" refers to two compounds that are non-superimposable mirror images of one another and are stereoisomers. The relevant stereocenter may be provided in either the (R)- or (S)-configuration.
[0036] Those skilled in the art of organic and / or medicinal chemistry will understand that the compounds of Formula 1 and their salts may exist in amorphous or crystalline form, and it will be understood that the present disclosure encompasses all forms and polymorphs of the compounds of Formula 1 and their salts.
[0037] As will be understood by one of skill in the art, the compound of Formula 1, or any salt, solvate, or stereoisomer thereof, is administered in a therapeutically effective amount. The term "therapeutically effective amount," as used herein, refers to a compound administered in an amount sufficient to alleviate or prevent to some extent one or more of the symptoms of the disorder or condition being treated. The result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease or condition, or any other desired alteration of a biological system. In one embodiment, the term "therapeutically effective amount" refers to a compound of Formula 1, or any salt thereof, administered in an amount sufficient to inhibit or modulate a SOX transcription factor (e.g., SOX18) to provide a therapeutic outcome.
[0038] As used herein, the term "halogen" or "halo" means fluorine, chlorine, bromine, or iodine.
[0039] As used herein, the term "alkyl" encompasses both straight-chain (i.e., linear) and branched-chain hydrocarbon groups. Examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, i-butyl, sec-butyl, pentyl, and hexyl groups. In one example, alkyl groups are those of 1 to 20 carbon atoms (i.e., C 1~20 In another example, the alkyl group is one of 1 to 10 carbon atoms (i.e., C 1~10 In another example, the alkyl group is one of 2 to 10 carbon atoms (i.e., C 2~10 In another example, the alkyl group is one of 1 to 6 carbon atoms (i.e., C 1~6 alkyl) or those of 2 to 6 carbon atoms (i.e., C 2~6 In another example, the alkyl group is one of 1 to 4 carbon atoms (i.e., C 1~4 alkyl) or those of 2 to 4 carbon atoms (i.e., C 2~4 alkyl).
[0040] As used herein, the term "alkenyl" refers to both straight- and branched-chain unsaturated hydrocarbon groups having at least one carbon-carbon double bond. Examples of alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, and hexenyl groups. In one example, an alkenyl group is one having 1 to 20 carbon atoms (i.e., C 1~20 In another example, the alkenyl group is one of 1 to 10 carbon atoms (i.e., C 1~10 In another example, the alkenyl group is one of 2 to 10 carbon atoms (i.e., C 1~10 In another example, an alkenyl group is an alkyl group having 1 to 6 carbon atoms (i.e., C 1~6 alkenyl) or those of 2 to 6 carbon atoms (i.e., C 2~6 In another example, an alkenyl group is an alkyl group having 1 to 4 carbon atoms (i.e., C 1~4 alkenyl) or 2 to 4 carbon atoms (i.e., C 2~4 alkenyl).
[0041] As used herein, the term "alkynyl" refers to both straight- and branched-chain unsaturated hydrocarbon groups having at least one carbon-carbon triple bond. Examples of alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, and hexynyl groups. In one example, an alkynyl group is one of 1 to 20 carbon atoms (i.e., C 1~20 In another example, the alkynyl group is one of 1 to 10 carbon atoms (i.e., C 1~10 In another example, the alkynyl group is one of 2 to 10 carbon atoms (i.e., C 2~10 In another example, an alkynyl group is an alkynyl group having 1 to 6 carbon atoms (i.e., C 1~6 alkynyl) or 2 to 6 carbon atoms (i.e., C 2~6 In another example, an alkynyl group is an alkynyl group having 1 to 4 carbon atoms (i.e., C 1~4 alkynyl) or 2 to 4 carbon atoms (i.e., C 2~4alkynyl).
[0042] As used herein, the term "alkylhalo" refers to an alkyl group having at least one halogen substituent, where "alkyl" and "halogen" are as defined above. Examples of alkylhalo groups include fluoromethyl, chloromethyl, bromomethyl, iodomethyl, fluoropropyl, and fluorobutyl groups. Examples include difluoromethyl and difluoroethyl groups, and trifluoromethyl and trifluoroethyl groups.
[0043] As used herein, the term "alkenylhalo" refers to an alkenyl group having at least one halogen substituent, where "alkenyl" and "halogen" are defined above.
[0044] As used herein, the term "alkynylhalo" refers to an alkynyl group having at least one halogen substituent, where "alkynyl" and "halogen" are defined above.
[0045] "Aryl," whether used alone or in compound words such as arylalkyl, refers to (i) an optionally substituted monocyclic or polycyclic aromatic carbocyclic moiety, e.g., of about 6 to about 20 carbon atoms, such as phenyl, naphthyl, or fluorenyl; or (ii) an optionally substituted partially saturated polycyclic carbocyclic aromatic ring system in which an aryl group and a cycloalkyl or cycloalkenyl group are fused to form a ring structure such as a tetrahydronaphthyl ring, an indenyl ring, an indanyl ring, or a fluorene ring. Polycyclic ring systems will be understood to include bicyclic and tricyclic ring systems. In further examples, the term "aryl" refers to aromatic hydrocarbon mono-, polynuclear, conjugated and fused residues, such as unsubstituted or substituted: phenyl, biphenyl, terphenyl, quaterphenyl, phenoxyphenyl, naphthyl, tetrahydronaphthyl, anthracenyl, dihydroanthracenyl, benzanthracenyl, dibenzanthracenyl and phenanthrenyl groups.
[0046] As used herein, the term "alkylaryl" refers to an alkyl group interrupted and / or substituted with at least one aryl group, where "alkyl" and "aryl" are defined above.
[0047] As used herein, the term "saturated" refers to a group in which all available valence bonds of a skeletal atom are attached to other atoms. Representative examples of saturated groups include, but are not limited to, butyl, cyclohexyl, piperidine, etc.
[0048] As used herein, the term "unsaturated" refers to a group in which at least one valence bond of two adjacent skeletal atoms is not attached to any other atom. Representative examples include, but are not limited to, alkenes (e.g., -CH-CH=CH-), phenyl, pyrrole, etc.
[0049] As used herein, the term "substituted" refers to a group having one or more hydrogen or other atoms removed from a carbon or suitable heteroatom and replaced with a further group (i.e., a substituent).
[0050] As used herein, the term "unsubstituted" refers to a group that does not have any additional groups attached to it or substituted by it.
[0051] All documents cited or referenced herein, and all documents cited or referenced in the documents cited herein, are hereby incorporated by reference in their entirety, along with all manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated herein by reference.
[0052] Compound of Formula 1 The present disclosure is directed to providing antiviral compounds. The antiviral compounds may be effective inhibitors of one or more SOX family transcription factors, particularly SOX18. It will be understood that the SOX family transcription factor is the sex-determining region Y protein (SRY-related HMG box protein). The antiviral compounds are based on a benzoic acid backbone or derivative, particularly a biarylbenzoic acid backbone. The antiviral compounds of the present disclosure can be provided by compounds of Formula 1 described herein.
[0053] In one embodiment, the compound of formula 1 can be provided as follows:
[0054] [ka]
[0055] .
[0056] In the example of Formula 1 above: R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 selected from alkenylhalo; R 3 is hydrogen, C 1~10 Alkyl, C 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 selected from alkenylhalo; R 4 is hydrogen, OH, C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkylhalo, NH2, NH(C 1~10 alkyl), and N(C 1~10 alkyl)2; L 1 is C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, OC 1~10 Alkenyl, OC(=O), OC(=O)(C 1~10 alkyl), NHC(=O), N(C 1~10 alkyl)C(=O), OS(=O)2, each alkyl or alkenyl is uninterrupted or selected from O, OC(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO2, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 The aryl group can be substituted with one or more groups selected from alkyl, and NO2.
[0057] In another example of Formula 1 above: R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl and OC 1~10 alkylhalo; R 3 is hydrogen, C 1~10 Alkyl and C 1~10 alkylhalo; R 4 OH, OC 1~10 Alkyl and OC 1~10 alkylhalo; L 1 is C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, and OC 1~10 alkenyl, wherein each alkyl or alkenyl is uninterrupted or is selected from O, OC(=O), NH, N(C 1~10alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 alkylhalo, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 The aryl group can be formed substituted with one or more groups selected from alkylhalo.
[0058] In another example of Formula 1 above: R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl and OC 1~10 alkylhalo; R 3 is hydrogen, C 1~10 Alkyl and C 1~10 alkylhalo; R 4 OH, OC 1~10 Alkyl and OC 1~10 alkylhalo; L 1 is C 2~4 Alkyl, OC 2~4 Alkyl, C 2~4 Alkenyl, and OC 2~4 alkenyl, wherein each alkyl or alkenyl is uninterrupted or is selected from O, OC(=O), NH, N(C 1~10alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 alkylhalo, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 The aryl group can be formed substituted with one or more groups selected from alkylhalo.
[0059] In another example of Formula 1 above: R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl and OC 1~10 alkylhalo; R 3 is hydrogen, C 1~10 Alkyl and C 1~10 alkylhalo; R 4 OH, OC 1~10 Alkyl and OC 1~10 alkylhalo; L 1 is C 2~4 Alkyl, OC 2~4 Alkyl, C 2~4 Alkenyl, and OC 2~4 alkenyl, wherein each alkyl or alkenyl is uninterrupted or is selected from O, OC(=O), NH, N(C 1~10alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 alkylhalo, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Monocyclic or bicyclic aryl groups can be formed substituted with one or more groups selected from alkylhalo.
[0060] In another example of Formula 1 above: R 1 and R 2 are each independently selected from hydrogen and halo; R 3 is hydrogen, C 1~10 Alkyl and C 1~10 alkylhalo; R 4 OH, OC 1~10 Alkyl and OC 1~10 alkylhalo; L 1 is C 2~4 Alkyl, OC 2~4 Alkyl, C 2~4 Alkenyl, and OC 2~4 alkenyl, wherein each alkyl or alkenyl is uninterrupted or is selected from O, OC(=O), NH, N(C 1~10alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 alkylhalo, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 It is possible to form a phenyl or naphthyl group substituted with one or more groups selected from alkylhalo.
[0061] In another example of Formula 1 above: R 1 and R 2 is hydrogen; R 3 is hydrogen; R 4 , OH, and OC 1~10 alkyl; L 1 is C 2~4 Alkyl, and C 2~4 alkenyl, each of which is uninterrupted or selected from O, OC(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O)2, and is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 alkylhalo, and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 The phenyl group can be substituted with one or more groups selected from alkylhalo.
[0062] A-ring group The above structure of Formula 1 includes the aryl "A" ring on the left, which is L 1 The A ring group is linked to the aryl "B" ring on the right side via a group. Compounds of formula 1 can be provided by a linked biaryl benzoic acid scaffold. In the above formula 1, the A ring group is linked to the aryl "B" ring on the right side via a group. 1 , R 2 , R 3 and R 4 Includes:
[0063] R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, and OC 1~10 In another example, R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl and OC 1~10 In another example of Formula 1, R 1 and R 2 are each independently hydrogen, OH, or OC 1~10 In another example of Formula 1, R 1is hydrogen. In another example of Formula 1, R 1 and R 2 is hydrogen.
[0064] R 3 is hydrogen, C 1~10 Alkyl, C 1~10 Alkyl halo, C 1~10 Alkenyl, and C 1~10 In another example of Formula 1, R 3 is hydrogen or C 1~6 In another example of Formula 1, R 3 is hydrogen.
[0065] R 4 is hydrogen, OH, C 1~10 Alkyl, OC 1~10 Alkyl, NH2, NH(C 1~10 alkyl), and N(C 1~10 In another example of Formula 1, R 4 is OH or C 1~6 In another example of Formula 1, R 4 is OH.
[0066] R 1 , R 2 , R 3 and R 4 It will be understood that the above various definitions and examples of R can be combined in any manner. For example, in some examples of Formula 1, R 1 is hydrogen and R 2 is hydrogen and R 3 is hydrogen or C 1~6 alkyl, and R 4 is OH or OC 1~6 It is alkyl.
[0067] Linker group L 1 Linker group L 1 connects aryl ring A to aryl ring B.
[0068] L 1 is C 1~10Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, OC 1~10 Alkenyl, OC(=O), OC(=O)(C 1~10 alkyl), NHC(=O), N(C 1~10 Each alkyl or alkenyl may be uninterrupted or may be interrupted by one or more groups, and / or may be unsubstituted or substituted by one or more groups. For example, each alkyl or alkenyl may be uninterrupted or may be selected from O, OC(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O)2, and / or is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O.
[0069] In one example, L 1 is C 1~10 Alkyl or C 1~10 In another example, each alkyl or alkenyl may be uninterrupted or may be selected from O, O-C(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O)2, and / or may be unsubstituted or substituted with one or more groups selected from halo, OH, and C=O.
[0070] In another example, L 1 is C 1~6 Alkyl or C 1~6 In another example, each alkyl or alkenyl is uninterrupted or interrupted by one or more groups selected from O, NH, NHC(=O), S, and S(=O)2.
[0071] In another example, L 1 is C 2~6 Alkyl or C 2~6In another example, each alkyl or alkenyl is uninterrupted or interrupted by one or more groups selected from O, NH, NHC(=O), S, and S(=O)2.
[0072] In another example, L 1 is C 2~4 Alkyl or C 2~4 In another example, each alkyl or alkenyl is uninterrupted or interrupted by one or more groups selected from O, NH, NHC(=O), S, and S(=O)2.
[0073] In another example, L 1 may be selected from any one of the following linker groups, where it will be understood that either end of the linker group may be attached to either the A ring or the B ring:
[0074] [Table 1]
[0075] In another example, the above L 1 Each of the groups may be further substituted with one or more groups selected from halo and OH.
[0076] The "one or more" groups described herein for optional substitution can be 1 to 6 groups, 1 to 5 groups, 1 to 4 groups, 1 to 3 groups, 1 or 2 groups, or 1 group.
[0077] The "one or more" groups described herein for an optional interruption can be 1 to 6 groups, 1 to 5 groups, 1 to 4 groups, 1 to 3 groups, 1 or 2 groups, or 1 group.
[0078] B-ring group In Formula 1, the B ring group is X 1 , X 2 , X 3 , X 4, and X 5 may include:
[0079] In one example, X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 Any two X groups can be combined to form an aryl group, e.g., X 2 and X 3 can be linked to form an aryl group (e.g., phenyl or naphthyl), such that ring B is a substituted or unsubstituted naphthyl or anthracenyl group. 1 and X 2 are bonded to form an aryl group, and X 4 and X 5 are bonded to form an aryl group (e.g., a phenyl group), so that Ring B is a substituted or unsubstituted anthracenyl group. The aryl group may be unsubstituted or substituted, for example, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 The aryl group may be substituted with one or more groups selected from alkyl, aryl, and N0. The aryl group may be a monocyclic group (e.g., phenyl) or a bicyclic group (e.g., naphthyl or linked biphenyl).
[0080] In another example, X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC1~6 Alkyl, OC 1~6 Can be selected from alkyl halo, X 2 and X 3 can be linked to form a phenyl group.
[0081] The phenyl group can be unsubstituted or substituted, for example, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO2.
[0082] In another example, X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 It can be selected from alkylhalo.
[0083] In another example, X 1 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Can be selected from alkyl halo, X 2 and X 3 are linked to form a phenyl group. The phenyl group can be unsubstituted or substituted, for example, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO2.
[0084] In another example, the compound of formula 1 can be provided by a compound of formula 1a:
[0085] [ka]
[0086] .
[0087] For Equation 1a, X 6 , X 7 , X 8 , X 9 , X 10 , X 11 , and X 12 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO2.
[0088] R 1 , R 2 , R 3 , R 4 , and L 1 Each of the above various embodiments or examples of compounds of Formula 1a may be applied to provide various independently selected further embodiments or examples of compounds of Formula 1a.
[0089] Exemplary Compounds of Formula 1 Exemplary compounds of Formula 1 can be selected from any one of the compounds in Table 1 below.
[0090] [Table 2A]
[0091] [Table 2B]
[0092] [Table 2C]
[0093] [Table 2D]
[0094] [Table 2E]
[0095] The compounds of the present invention also include stereoisomers of the compounds described herein, and compositions comprising more than one compound of the present invention may contain such stereoisomers, e.g., E / Z isomers, where applicable, either individually or mixed in any proportions. Stereoisomers may include, but are not limited to, enantiomers, diastereomers, racemic mixtures, and combinations thereof. Such stereoisomers can be prepared and separated using conventional techniques, such as by reacting enantiomeric starting materials or by separating isomers of the compounds and prodrugs of the present invention. Isomers may include geometric isomers. Examples of geometric isomers include, but are not limited to, trans isomers or cis isomers (E / Z) across a double bond. Other isomers are contemplated in the compounds of the present invention. Isomers can be used in pure form or mixed with other isomers of the compounds described herein.
[0096] The compounds may optionally be provided as enantiomerically or diastereomerically enriched compositions, for example, as mixtures of enantiomers or diastereomers in which one enantiomer or diastereomer is present in excess, particularly to the extent of 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more (including 100%).
[0097] The compounds may be utilized as such or in the form of pharmaceutically acceptable esters, amides, salts, solvates, prodrugs, or isomers, as appropriate. For example, the compounds may be provided as pharmaceutically acceptable salts. When used, the salts of drug compounds should be both pharmacologically and pharmaceutically acceptable, although pharmaceutically unacceptable salts may be used in the preparation of the compounds. Such pharmacologically and pharmaceutically acceptable salts can be prepared by reacting the drug with an organic or inorganic acid using standard methods detailed in the literature. Examples of pharmaceutically acceptable salts or solvates have been described above.
[0098] Preparation of Compounds of Formula 1
[0099] [ka]
[0100] Compounds of Formula 1 can generally be prepared according to Scheme 1 above. For example, salicylic acid derivative compound 1 provides the A-ring scaffold and can be protected to form cyclic lactam compound 2. A solution of compound 1, acetone, and DMAP in DME (30 mL) can be prepared and SOCl can be added at about 0° C. The mixture can be stirred at 0° C. for about 1 hour and then at room temperature. The resulting mixture can be quenched with water and purified to provide compound 2.
[0101] The free hydroxyl group of compound 2 can be activated by forming a triflate. A solution of compound 2 and pyridine in DCM (50 mL) can be stirred with TfO at about 0° C. for about 1 hour. The mixture can be purified to give compound 3.
[0102] The activated compound 3 can then be reacted with the linker-B ring scaffold. For example, a mixture of compound 3, 2-ethynylnaphthalene, Pd(PPh)Cl, diethylamine, and CuI in MeCN can be heated to reflux under a N atmosphere for about 2 hours. The reaction mixture can be purified to provide compound 4, which is a protected lactam derivative compound of Formula 1 containing an unsaturated linker group.
[0103] Compound 4 can be modified to reduce the unsaturated linker group to a fully saturated alkyl linker group. For example, a mixture of compound 4 and Pd / C (10% on activated carbon, 500 mg) in MeOH can be stirred under an atmosphere of H (1 atm) at room temperature for about 2 hours. The mixture can be worked up and purified to give compound 5.
[0104] Compound 5 can then be deprotected to give the compound of Formula 1. A mixture of compound 5, NaOH in THF and HO can be heated at 80° C. for about 16 hours. The mixture can be acidified with 1N HCl to pH 2-3 and extracted with EtOAc. The combined organic phase can be concentrated and purified to give compound 6.
[0105] It will be understood that the compounds may be prepared according to other synthetic approaches, and the above scheme provides one example of a synthetic approach.
[0106] Pharmaceutical Composition In another aspect, there is provided a pharmaceutical composition comprising a compound of Formula 1 according to any aspect, embodiment or example described herein, or any salt, stereoisomer, or solvate thereof, and a pharmaceutically acceptable carrier, diluent, and / or excipient.
[0107] Suitably, the pharmaceutically acceptable carrier, diluent and / or excipient may be or include one or more of: diluents, solvents, pH buffers, binders, fillers, emulsifiers, disintegrants, polymers, lubricants, oils, fats, waxes, coatings, viscosity modifiers, glidants, and the like.
[0108] Diluents include one or more of microcrystalline cellulose, lactose, mannitol, calcium phosphate, calcium sulfate, kaolin, dry starch, powdered sugar, etc. Binders include one or more of povidone, starch, stearic acid, gum, hydroxypropyl methylcellulose, etc. Disintegrants include one or more of starch, croscarmellose sodium, crospovidone, sodium starch glycolate, etc. Solvents include one or more of ethanol, methanol, isopropanol, chloroform, acetone, methyl ethyl ketone, methylene chloride, water, etc. Lubricants include one or more of magnesium stearate, zinc stearate, calcium stearate, stearic acid, sodium stearyl fumarate, hydrogenated vegetable oil, glyceryl behenate, etc. Glidants may be one or more of colloidal silicon dioxide, talc, corn starch, etc. Buffers include, but are not limited to, phosphate buffers, borate buffers, and carbonate buffers. Fillers include, but are not limited to, one or more gels, including gelatin, starch, and synthetic polymer gels. Coatings may include one or more of a film-forming agent, a solvent, a plasticizer, and the like. Suitable film-forming agents may be one or more of hydroxypropylmethylcellulose, methylhydroxyethylcellulose, ethylcellulose, hydroxypropylcellulose, povidone, sodium carboxymethylcellulose, polyethylene glycol, acrylates, and the like. Suitable solvents may be one or more of water, ethanol, methanol, isopropanol, chloroform, acetone, methyl ethyl ketone, methylene chloride, and the like. Plasticizers may be one or more of propylene glycol, castor oil, glycerin, polyethylene glycol, polysorbates, and the like.
[0109] Reference is made to Handbook of Excipients, 6th Edition, Eds. Rowe, Sheskey & Quinn (Pharmaceutical Press), which provides non-limiting examples of excipients that may be useful in light of the present disclosure. Other pharmaceutical excipients and / or additives suitable for use in compositions according to the present disclosure are listed in "Remington: The Science & Practice of Pharmacy," 19th ed., Williams & Williams, (1995), and "Physician's Desk Reference," 52nd ed., Medical Economics, Montvale, NJ (1998), and "Handbook of Pharmaceutical Excipients," Third Ed., Ed. A. H. Kibbe, Pharmaceutical Press, 2000.
[0110] It will be understood that the choice of pharmaceutically acceptable carrier, diluent and / or excipient will depend, at least in part, on the mode of administration of the formulation. By way of example only, the composition may be in the form of a tablet, capsule, caplet, powder, injectable liquid, suppository, sustained release formulation, osmotic pump formulation, or any other form that is effective and safe for administration.
[0111] Dosage The amount of active ingredient required to achieve a therapeutic effect will, of course, vary depending on the particular compound, the route of administration, the subject being treated, including the type, species, age, weight, sex, and medical condition of the subject being treated, as well as the subject's renal and hepatic function, and the particular condition, disorder, or disease being treated, and its severity. An ordinarily skilled physician or clinician can readily determine and prescribe the effective amount of drug required to prevent or treat the condition, disorder, or disease.
[0112] The dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, when used for the indicated effects, may range, for example, from about 0.01 mg / kg body weight per day (mg / kg / day) to about 1000 mg / kg / day. In one example, the dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, is about 0.01 to 1000, 0.1 to 500, 0.1 to 100, or 1 to 50 mg / kg / day. In one example, the dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, is about 0.01 to 1000 mg / kg / day. In one example, the dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, is about 0.1 to 100 mg / kg / day. In one example, the dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, is greater than about 0.01, 0.1, 1, 10, 20, 50, 75, 100, 500, or 1000 mg / kg / day. In one example, the dosage of the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, is less than about 5000, 1000, 75, 50, 20, 10, 1, or 0.1 mg / kg / day.
[0113] The compound of Formula 1, or a salt, solvate, or stereoisomer thereof, may be administered, for example, as a single daily dose, or the total daily dose may be administered in divided doses two, three, or four times daily. In one example, the compound of Formula 1, or a salt, solvate, or stereoisomer thereof, may be administered less frequently than once daily, for example, every 2, 3, 4, 5, or 6 days, or once a week.
[0114] Indications / Uses The present disclosure also provides for the use of a compound of Formula 1 as defined according to any aspect, embodiment, or example described herein as an antiviral agent or for treating a viral disease or condition or a virus-related disease or condition.
[0115] Accordingly, the present disclosure provides a method of treating a viral disease or condition by administering to a subject in need thereof an antiviral compound, wherein the antiviral compound is a compound of Formula 1 according to any aspect, embodiment, or example thereof described herein, or a pharmaceutically acceptable salt, solvate, or stereoisomer thereof.
[0116] In one example, the compounds described herein are particularly useful for treating or preventing a SOX18-dependent viral disease or condition. "SOX18-dependent viral disease or condition," as used herein, refers to a disease or condition associated with SOX18 activity. In one example, SOX18 activity includes contacting and / or binding of SOX18 to DNA sequences and / or proteins. In a further example, the protein is selected from the group consisting of SOX7, RBPJ, XRCC5, SOX18, ILF3, DDX17, and any combination thereof.
[0117] In one example, a compound of Formula 1 described herein inhibits, prevents, or reduces SOX18 activity in a subject. In another example, a compound of Formula 1 exhibits one or more of the following activities as determined in cell culture, such as the KLEC or luciferase assays described herein: In one example, a compound of Formula 1 described herein selectively inhibits SOX18 activity.
[0118] The SOX18-dependent viral disease or condition can be selected from the group consisting of Kaposi's sarcoma, AIDS-related lymphoproliferative disorder, angioimmunoblastic T-cell lymphoma, Burkitt's lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, leiomyosarcoma, breast cancer, gastric cancer, nasal T / NK-cell lymphoma, T / NK-cell lymphoma, nasopharyngeal carcinoma, CMV retinitis of the eye, pneumonia, gastrointestinal ulcer, oral herpes, genital herpes, and joint inflammation.
[0119] The antiviral compounds of the present disclosure can be combined with additional agents such as antiretroviral agents, retinoid agents, or chemotherapeutic agents. Antiviral agents may also be combined with treatments such as radiation therapy, photodynamic therapy, or cryosurgery.
[0120] Examples of drugs that can be used in combination with compounds of the present disclosure include antiviral agents such as ganciclovir or forcarnet; retinoids such as alitretinoin, and chemotherapeutic agents such as aldoxorubicin, daunorubicin, paclitaxel, vinorelbine, bleomycin, and etoposide.
[0121] The present disclosure also provides the use of a compound of Formula 1 as defined herein in the manufacture of a medicament for treating a viral disease or condition or a virus-related disease or condition.
[0122] In another example, the antiviral compound of Formula 1 inhibits the homodimerization of SOX18 with SOX18. In another example, the antiviral compound of Formula 1 inhibits the heterodimerization of SOX18 with RBPJ.
[0123] The present disclosure also provides a method for inhibiting herpesvirus replication and / or treating a viral disease or condition caused by a herpesvirus in a subject, the method comprising administering to the subject a compound of Formula 1 described herein. In one example, the viral disease or condition is SOX18-dependent.
[0124] The herpesvirus can be selected from the group consisting of alphaherpesvirus, betaherpesvirus, gamma 1 herpesvirus, and gamma 2 herpesvirus. In one example, the herpesvirus is selected from the group consisting of Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), vesicular stomatitis virus (VSV), rhesus lymphocryptovirus (rLCV), herpes simplex virus 1 (HSV-1), herpes simplex virus (HSV-2), and Ross River virus (RRV).
[0125] In another example, the viral disease or condition is selected from any one of the following, or from the group consisting of: (i) Kaposi's sarcoma caused by KSHV; (ii) AIDS-associated lymphoproliferative disorder caused by KSHV; (iii) angioimmunoblastic T-cell lymphoma caused by EBV; (iv) Burkitt lymphoma caused by EBV; (v) Hodgkin's lymphoma caused by EBV; (vi) non-Hodgkin's lymphoma caused by EBV; (vii) leiomyosarcoma caused by EBV; (viii) breast cancer caused by EBV; (ix) EBV-induced gastric cancer; (x) EBV-induced nasal T / NK cell lymphoma; (xi) EBV-induced T / NK cell lymphoma; (xii) nasopharyngeal carcinoma caused by EBV; (xiii) ocular CMV retinitis caused by CMV; (xiv) pneumonia caused by CMV; (xv) gastrointestinal ulcers caused by CMV; (xvi) a condition or symptom caused by VSV; (xvii) oral herpes caused by HSV-1; (xviii) genital herpes caused by HSV-2; and (xix) Joint inflammation or rash caused by RRV.
[0126] In another example, the Kaposi's sarcoma is selected from any one of the group consisting of classic Kaposi's sarcoma, endemic Kaposi's sarcoma, AIDS-associated Kaposi's sarcoma, and iatrogenic Kaposi's sarcoma.
[0127] Kaposi's sarcoma Kaposi's sarcoma-associated herpesvirus (KSHV) is one of nine species in the genus Rhadinovirus, subfamily Gammaherpesvirinae, family Herpesviridae. Like other herpesviruses, KSHV establishes a lifelong infection in infected hosts and maintains the viral genome as an extrachromosomal episome in a latent state. The virus encodes a limited number of genes to survive without being recognized by the host's immune surveillance system. Latency-associated nuclear antigen (LANA) is a protein expressed in all latently infected cells (Rainbow L et al., (1997) J Virol 71: 5915-5921; Renne R et al., (1998) J Virol 72: 5182-5188).
[0128] LANA is considered an oncogenic protein due to its role in regulating cellular pathways required for inducing / promoting tumorigenesis (Moore PS, Chang Y (1998) J Natl Cancer Inst Monogr. 65-71). Along with its role in regulating various cellular and viral pathways, LANA is important for maintaining viral genomes in infected cells (Cotter MA, 2nd, Robertson ES (1999) Virology 264: 254-264; Ye FC et al. (2004) J Virol 78: 11121-11129).
[0129] LANA anchors the viral genome to the host chromosome by docking onto host chromatin via its amino-terminal chromatin-binding domain (CBD) and binding to the carboxyl-terminal DNA-binding domain within the terminal repeats (Barbera AJ et al. (2006) Science 311: 856-861; Cotter MA, 2nd, Subramanian C, Robertson ES (2001) Virology 291: 241-259).
[0130] The KSHV genome has multiple repeated copies of terminal repeats (TRs), which are proposed to be regions necessary for genome circularization. Each terminal repeat unit is an 801-bp-long GC-rich DNA element and has been shown to contain a potential origin or replication initiation site similar to that of EBV. Each TR unit has two LANA-binding sites (high-affinity site LBS1 and low-affinity site LBS2). A 31-bp-long sequence upstream of the LANA-binding sequence has been mapped as a replicator element (RE) important for replication initiation. Each TR unit contains a replicator element.
[0131] Studies have demonstrated the presence of an additional replication site at the left end of the KSHV genome (Verma SC et al. (2007) Cell Host Microbe 2: 106-118). This replication site does not require expression of LANA in trans and is referred to as an autonomous origin of replication (referred to herein as oriA). Thus, replication initiation events can occur throughout the KSHV genome, which is in stark contrast to previous conclusions that replication initiates from specific sites within the terminal repeats.
[0132] Types of Kaposi's sarcoma There are many different types of KS, each defined by different populations in which the disease manifests. Classical (or Mediterranean) KS occurs in older people of Mediterranean, Eastern European, and Middle Eastern descent, and is more common in men than women. Patients usually have one or more lesions on the legs, ankles, or soles of the feet. Compared to other types of KS, lesions in this type do not grow as rapidly, and new lesions do not occur frequently. People with classical KS come from areas where KSHV infection is more common than in the United States or Northern Europe. The immune systems of people with classical KS are not as weakened as those of people with epidemic KS (see below); however, because the immune system naturally weakens with aging, people who are already infected with KSHV are more likely to develop KS.
[0133] Endemic KS occurs in people living in equatorial Africa and is sometimes called African KS. KSHV infection is much more common in Africa than in other parts of the world, increasing the chance of developing KS. Because the disease affects a wider range of people, including children and women, other factors likely contribute to the development of KS in Africa. Endemic KS tends to occur in younger people (usually under 40 years of age). In some parts of Africa, KS is now considered the most common cancer (Horenstein et al., (2008); J. Cutan. Pathol. 35(Suppl.2): pp. 40-44).
[0134] The most common form of KS in the United States is epidemic or AIDS-associated KS. This form develops in individuals infected with HIV, the virus that causes AIDS. The severe immunosuppression caused by AIDS increases the likelihood of developing KS in individuals already infected with KSHV. This more aggressive form of KS was first noted in young homosexual men in the 1970s. In addition to deviating from the usual ethnic predisposition, the disease manifests with lesions that tend to occur at any site and spread more rapidly to lymph nodes and visceral organs, such as the gastrointestinal tract and respiratory tract. Gastrointestinal (GI) involvement is generally asymptomatic and does not affect prognosis, while pulmonary involvement is often symptomatic and negatively impacts prognosis. The disease progresses very rapidly, and many patients die within one year despite chemotherapy regimens. Treatment of HIV infection with highly active antiretroviral therapy (HAART) reduces the incidence of epidemic KS and, in many cases, prevents advanced KS from developing. The clinical course of AIDS-KS is variable, ranging from a very indolent course requiring little, if any, treatment to a rapidly progressive, fatal disease.
[0135] When KS develops in people with a suppressed immune system after an organ transplant, it is called iatrogenic, or transplant-associated, KS, or immunosuppression-associated KS. Most transplant patients take immunosuppressants, such as rapamycin, to prevent organ rejection. The immunosuppression caused by these drugs increases the likelihood that individuals infected with KSHV will develop KS. Stopping or reducing the dose of immunosuppressants often results in the disappearance or reduction of KS lesions. [Example]
[0136] Preparation of compounds Compound GB001 (SM4) was synthesized by the following method shown in Scheme 2.
[0137] [ka]
[0138] To a solution of compound 1a (51.9 mmol), acetone (67.53 mmol), and DMAP (2.59 mmol) in DME (30 mL) was added SOCl dropwise at 0 °C. The mixture was stirred at 0 °C for 1 h and then at room temperature for 16 h. The resulting mixture was quenched with water and purified by flash column chromatography on silica gel (0 to 100% EtOAc in PE) to give compound 2a (62.6%) as a yellow solid.
[0139] To a solution of compound 2a (25.8 mmol) and pyridine (92.7 mmol) in DCM (50 mL) was added TfO (30.9 mmol) at 0 °C. The mixture was stirred at room temperature for 1 h. The solvent was removed in vacuo, and the crude product was purified by flash column chromatography on silica gel (eluted with 0-50% EtOAc in PE) to give compound 3a (65.1%) as a yellow solid.
[0140] A mixture of compound 3a (3.06 mmol), 2-ethynylnaphthalene (3.36 mmol), Pd(PPh)Cl (0.055 mmol), diethylamine (6.12 mmol), and CuI (0.3 mmol) in MeCN (15 mL) was heated to reflux for 2 h under a N atmosphere. The reaction mixture was filtered through Celite. The filtrate was concentrated in vacuo and purified by flash column chromatography on silica gel (0–50% EtOAc in PE) to give compound 4a (75.22%) as a white solid.
[0141] A mixture of compound 4a (2.29 mmol) and Pd / C (10% on activated carbon, 500 mg) in MeOH (20 mL) was stirred under an atmosphere of H2 (1 atm) at room temperature for 2 h. The mixture was then filtered through Celite. The filtrate was concentrated and purified by flash column chromatography (0-50% EtOAc in PE) to give compound 5a (59.2%) as a white solid.
[0142] A mixture of compound 5a (1.36 mmol), NaOH (6.8 mmol) in THF (10 mL) and HO (10 mL) was heated at 80 °C for 16 h. The mixture was acidified with 1 N HCl to pH 2-3 and extracted with EtOAc. The combined organic phase was concentrated and purified on a Biotage Isolera One column (C18 column, eluted with 30%-100% MeCN / HO containing 0.1% HCOOH) to give compound 1 (GBM-0009, SM4) (88.16%) as a white solid.
[0143] The purity of compound 1 was assessed by HPLC-UV / MS and found to be 99.5% pure (UV 254 ), and has an accurate [M−H] mass of 290.95, as well as accurate assignments and peak areas for each proton. 1 H-NMR was reported.
[0144] The synthesis of GB003 was carried out similarly to that of GB001, by substituting 3-ethynylphenylene for 2-ethynylnaphthalene. The syntheses of GB002 and GB003 have previously been generally described above and in WO 2018 / 112545, the entire contents of which are incorporated herein by reference.
[0145] Compounds GB004, GB005 and GB006 were purchased from ABCr (Germany) and analyzed for purity by HPLC / MS.
[0146] Inhibitor treatment The following inhibitors were used: GB001, GB002, GB003, GB004, GB005 and GB006.
[0147] KSHV-infected cells were incubated with the indicated concentrations of inhibitors in the figure panels for 6 days before analysis. HeLa cells were incubated with the indicated concentrations of inhibitors in the figure panels for 24 hours before analysis.
[0148] KLEC genome copy number assay Primary human dermal lymphatic (C-12216) endothelial cells (LECs) were purchased from Promocell and grown in Lonza EBM-2 (00190860) supplemented with EGM™-2 MV Microvascular Endothelial SingleQuots™ (CC-4147). Cells from passages 1 to 3 were used.
[0149] rKSHV.219 was produced from iSLK219 cells reactivated with 0.2 μg / ml doxycycline and 1.35 mM NaB for 72 hours. The supernatant was collected, spun down (2000 rpm for 5 minutes), and sterile filtered using a 45 μm pore size filter. The supernatant was then ultracentrifuged at 22000 rpm for 2 hours. The concentrated virus was then aliquoted and stored at -80°C.
[0150] Viral titers were determined by infecting U2OS cells with serial dilutions of concentrated virus preparations and assessing the amount of GFP+ or LANA+ cells 24 hours post-infection by automated high-content microscopy.
[0151] Equal numbers of LECs were seeded into 6-well assay plates and incubated at 37°C and 5% CO2 until they reached 80% confluence. After reaching confluence, the LECs were infected with rKSHV.219 and incubated at 37°C and 5% CO2 for 3 days to ensure that cell densities remained similar. The cells were then mixed with uninfected LECs at a 2:3 ratio for 2 days. Once GFP expression and cell spindle formation were observed, the culture medium was replaced with medium containing experimental compounds at concentrations ranging from 0.1 μM to 50 μM and 0.25% DMSO (v / v). After 3 days of incubation, the cells were replenished with fresh medium containing the experimental compounds and incubated for an additional 3 days.
[0152] After compound incubation, cells were harvested and genomic and viral DNA was extracted using a NucleoSpin Tissue Kit (Macherey-Nagel, 740952) according to the kit's standard protocol. qPCR was then completed in triplicate using primers for viral K8.1 and human genomic actin (SYBR Green, ThermoFisher, K0222). K8.1 forward primer: AAAGCGTCCAGGCCACCACAGA (SEQ ID NO: 1); reverse primer: GGCAGAAAATGGCACACGGTTAC (SEQ ID NO: 2). Genomic actin forward primer: AGAAAATCTGGCACCACACC (SEQ ID NO: 3); reverse primer: AACGGCAGAGAAGAGAGACCA (SEQ ID NO: 4).
[0153] SOX18 luciferase reporter assay HeLa cells were cultured in DMEM containing 10% FCS, 1% L-glutamine, and 1% penicillin / streptomycin at 37°C and 5% CO. Cells were seeded at a density of 7000 cells / well in 125 μL of maintenance medium in a 96-well format and incubated for 24 hours.
[0154] Plasmids were transfected using FuGENE HD Transfection Reagent (Promega, E2311) (1:4 reagent to DNA ratio) and Opti-MEM (ThermoFisher, 31985062). OriA-luc negative control and experimental wells contained 25 ng of OriA-luc plasmid and 10 ng of SOX18 plasmid per well, while positive controls contained 25 ng of OriA-luc plasmid and 10 ng of mCherry plasmid per well. 7XTR-luc negative control and experimental wells contained 50 ng of 7XTR-luc plasmid and 20 ng of SOX18 plasmid per well, while positive controls contained 50 ng of 7XTR-luc plasmid and 20 ng of mCherry plasmid per well. After incubating the cells for 18 hours, the cells were replenished with fresh medium containing experimental compounds and incubated for 24 hours.
[0155] Luminescence was measured by adding an equal volume of Steady-Glo reagent to the cells at room temperature, and luminescence was quantified using a FLUOstar plate reader (BMG Labtech, FLUOstar Omega; 4-second interval per well).
[0156] Preparation of compounds A library of n-butanol fractions generated from marine libraries collected across Australia and the Antarctic was used for screening. Active fractions were fractionated to pure compounds, which were re-assayed in the same manner as the original fractions.
[0157] A library of 2,688 marine invertebrate and algal samples collected across southern Australia and Antarctica was processed to generate an extract library suitable for high-throughput bioassays. The EtOH extracts were concentrated by decantation, partitioned into n-BuOH and HO phases, and then transferred to a deep 96-well plate to remove salts, yielding a greater than 10-fold concentration of small molecules. The n-BuOH fraction (25 mg / mL w / v of dry residue) was used for screening after 10- and 100-fold dilutions (2.5 and 0.25 mg / mL). Active fractions were triturated with hexane, CHCl, and MeOH and fractionated to pure compounds by HPLC. All compounds were assayed in the same manner as the fractions.
[0158] Compound 1 (GB001, SM4) was purchased from EndosTherm GmbH (Germany) and analyzed for purity by HPLC / MS.
[0159] The synthesis of GB002 and GB004 is generally described above and in WO 2018 / 112545.
[0160] Sox18 activity of compounds Monkey kidney fibroblast-like cells (COS-7) were cultured in DMEM (Life Technologies, 11995) containing fetal bovine serum (FBS), sodium pyruvate, L-glutamine, penicillin, streptomycin, non-essential amino acids, and HEPES at 37°C and 5% CO2. Cells were grown to 80% confluence in 96-well plates and transfected with the mouse plasmid pGL2 Vcam-1 promoter construct (VC1889) and pReceiver M49 SOX18 using X-treme GENE HP DNA Transfection Reagent (Roche, 6366236001). Four hours after transfection, cells were incubated with compounds in 0.5% FBS medium for an additional 24 hours, followed by lysis and luciferase assay (Perkin Elmer, 6016711). Results are presented as % inhibition of the maximal signal observed in VCAM-1 and SOX18 transfected cells without compound incubation.
[0161] statistical analysis Data are expressed as the mean + / - standard deviation of at least three independent experiments. Conventional one-way or two-way ANOVA was performed as appropriate, followed by Dunnett's post-hoc test for multiple comparisons.
[0162] Example 1 Compounds and their activities on SOX18 protein interaction The compounds tested in this study are listed in Table 2 below.
[0163] [Table 3A]
[0164] [Table 3B]
[0165] [Table 3C]
[0166] Example 2 Involvement of 7XTR and OriA in Kaposi's sarcoma Replication of latent Kaposi's sarcoma (KS)-associated herpesvirus (KSHV), the causative virus of Kaposi's sarcoma, involves the terminal repeat regions (TR) and, to a lesser extent, the OriA region of the KSHV genome.
[0167] Therefore, we used luciferase assays to evaluate the role of SOX18 in the expression of the viral TR and OriA regions.
[0168] Activation of these genes was measured using HeLa cells transfected with a luciferase reporter carrying either seven copies of TR (7XTR) or the OriA promoter fused upstream of the SV40 promoter to the OriLyt promoter, along with a firefly luciferase reporter. ORF, which binds to OriLyt and is a potent activator of this reporter (Chen J et al., (2009) Virology 386: 290-302), was used as a positive control. In the presence of LANA, SOX18 expression increased the activity of the 7XTR reporter in a dose-dependent manner. SOX18 expression also increased the activity of the OriA+OriLyt reporter in an ORF50-independent manner. SOX18 did not alter the activity of a reporter plasmid carrying the ORF50 promoter (data not shown), supporting the specificity of the activation observed in the 7XTR and OriA+OriLyt reporters.
[0169] Figure 1 shows that HeLa cells co-transfected with SOX18 exhibit increased activity of 7XTR and OriA, indicating that activation of 7XTR and OriA is under the control of SOX18. Data taken from Gramolelli et al., 2020 Cancer Res.
[0170] Thus, the luciferase assay can be used as information about whether the compounds described herein can interfere with SOX18 and, therefore, Kaposi's sarcoma-associated herpesvirus replication.
[0171] Example 3 SOX18 activation of gene expression The ability of compounds to interfere with SOX18 activation of gene expression was measured by two different assays.
[0172] The first assay examined the ability of compound GB001 to inhibit SOX18 activity of the TR and OriA domains of Kaposi's sarcoma virus. Figure 2 shows the results of a luciferase assay of compounds GB001, GB002, and GB004 on HeLa cells transfected with 7xTR and OriA.
[0173] These results demonstrate that GB001, GB002 and GB004 interfere with SOX18-mediated gene transcription in Kaposi's sarcoma.
[0174] The second assay measured the interaction between SOX18 and the VCAM-1 promoter (Hosking et al. (2004) J. Biol. Chem. 297: 5314-5322). Inhibition of this interaction demonstrates the cell-based efficacy of the compound's ability to regulate SOX18-mediated gene transcription. Without being bound by theory, it is understood that viral infection can induce an inflammatory response in endothelial cells, the latter being the result of VCAM-1 gene expression regulated by SOX18 activity (Huber J. (1994) J. Virol. 68(6): 3453-8). In other words, since VCAM-1 expression is driven by SOX18, upon viral infection, SOX18 binds to the VCAM promoter and induces VCAM expression.
[0175] The compounds listed in Table 2 were tested in a VCAM-1 luciferase reporter assay, and the results are shown in Table 2 under the column % inhibition of SOX18.
[0176] The compounds that showed the greatest levels of inhibition were GB001 (99.10% inhibition), GB024 (100% inhibition), GB023 (78% inhibition), and GB012 (96.7% inhibition). As mentioned above, the VCAM-1 assay can indicate viral infection (Ou R et al., (2008) J Virol. 82(6): 2952-2965; Pati S et al., (2001) 75(10): 8660-73). Therefore, instead of the potential activity of the compounds as viral inhibitors, we tested the ability of the compounds to inhibit VCAM-1 expression.
[0177] Example 4 Effect of compounds on viral genome copy number The KLEC assay was used to examine the ability of compounds to inhibit viral copy number in virus-infected primary human dermal lymphatic endothelial cells (LECs).
[0178] Figure 3 shows results for LECs infected with Kaposi's sarcoma-associated herpesvirus (KSHV). Results are shown for three representative compounds (GB001, GB002, and GB004). Significant reductions in genome copy number, as indicated by fold change, were observed for GB001 at 10 μM and 50 μM; GB002 at 50 μM; and GB004 at 5 μM.
[0179] Those skilled in the art will appreciate that numerous variations and / or modifications may be made to the above-described embodiments without departing from the broad general scope of the present disclosure, and the present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
Claims
1. 1. A method of treating a viral disease or condition in a subject, comprising administering to a subject in need thereof an antiviral compound, wherein the antiviral compound is a compound of Formula 1: 【Chemical 1】 (In the formula, R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 selected from alkenylhalo; R 3 is hydrogen, C 1~10 Alkyl, C 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 selected from alkenylhalo; R 4 is hydrogen, OH, C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkylhalo, NH 2 , NH(C 1~10 alkyl), and N(C 1~10 alkyl) 2 More selected; L 1 is C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, OC 1~10 Alkenyl, OC(=O), OC(=O)(C 1~10 alkyl), NHC(=O), N(C 1~10 Alkyl)C(=O), OS(=O) 2 and each alkyl or alkenyl is uninterrupted or selected from O, OC(═O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O) 2 and is unsubstituted or substituted with one or more groups selected from halo, OH, and C═O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 (It is possible to form an aryl group substituted with one or more groups selected from the following) or a pharmaceutically acceptable salt, solvate, or stereoisomer thereof.
2. R 1 and R 2 The method of claim 1 , wherein is hydrogen.
3. R 3 is hydrogen or C 1~6 3. The method of claim 1 or 2, wherein the alkyl is alkyl.
4. R 4 is OH or C 1~6 4. The method of claim 1, wherein the alkyl is alkyl.
5. L 1 is C 1~10 Alkyl or C 1~10 alkenyl, wherein each alkyl or alkenyl is uninterrupted or is selected from O, OC(=O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O) 2 5. The method of claim 1, wherein the aryl group is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O.
6. L 1 is C 2~6 Alkyl or C 2~6 alkenyl, wherein each alkyl or alkenyl is uninterrupted or selected from O, NH, NHC(=O), S, and S(=O). 2 6. The method of claim 1, wherein the aryl group is unsubstituted or substituted with one or more groups selected from halo, OH, and C=O.
7. L 1 is C 2~4 Alkyl or C 2~4 alkenyl, wherein each alkyl or alkenyl is uninterrupted or selected from O, NH, NHC(=O), S, and S(=O). 2 The method according to any one of claims 1 to 6, wherein the alkyl group is interrupted by one or more groups selected from the group consisting of:
8. L 1 is C 2~4 Alkyl or C 2~4 8. The method of claim 1, wherein each alkyl or alkenyl is uninterrupted or interrupted by one or more groups selected from O and S.
9. X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 Selected from X 2 and X 3 are bonded together and are unsubstituted or halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 The method according to any one of claims 1 to 8, wherein the aryl group is substituted with one or more groups selected from the group consisting of:
10. X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 Selected from X 2 and X 3 are bonded together and are unsubstituted or halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 The method according to any one of claims 1 to 9, wherein a phenyl group or a naphthyl group substituted with one or more groups selected from the group consisting of:
11. X 1 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 alkylhalo; X 2 and X 3 are bonded together and are unsubstituted or halo, OH, C 1~6 Alkyl, C 1~6 Alkyl halo, OC 1~6 Alkyl, OC 1~6 Alkylhalo, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 The method according to any one of claims 1 to 10, wherein the phenyl group is substituted with one or more groups selected from the group consisting of:
12. 12. The method of any one of claims 1 to 11, wherein the compound of formula 1 is selected from any one of the following: Table 1A Table 1B Table 1C Table 1D 【Table 1E】
13. 13. The method of any one of claims 1 to 12, wherein the viral disease or condition is SOX18 dependent.
14. 14. The method of any one of claims 1 to 13, wherein the compound selectively inhibits SOX18 activity.
15. 15. The method of claim 14, wherein the SOX18 activity comprises contacting and / or binding to a DNA and / or protein sequence selected from the group consisting of RBPJ, SOX7, XRCC5, SOX18, ILF3, and DDX17.
16. 16. The method of claim 14 or 15, wherein the compound of formula 1 inhibits homodimerization of SOX18.
17. 17. The method of any one of claims 14 to 16, wherein the compound of formula 1 inhibits heterodimerization of SOX18 and RBPJ.
18. 18. The method of any one of claims 1 to 17, wherein the viral disease or condition is caused by a herpes virus.
19. Herpes viruses are alphaherpesviruses, betaherpesviruses, and gammaherpesviruses 1 Herpesvirus and gamma 2 19. The method of claim 18, wherein the virus is selected from the group consisting of herpes viruses.
20. 20. The method of claim 18 or 19, wherein the herpesvirus is selected from the group consisting of Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), vesicular stomatitis virus (VSV), rhesus lymphocryptovirus (rLCV), herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), and Ross River virus (RRV).
21. 21. The method of any one of claims 1 to 20, wherein the viral disease or condition is selected from the group consisting of: (i) Kaposi's sarcoma caused by KSHV; (ii) AIDs-associated lymphoproliferative disorder caused by KSHV; (iii) angioimmunoblastic T-cell lymphoma caused by EBV; (iv) Burkitt lymphoma caused by EBV; (v) Hodgkin's lymphoma caused by EBV; (vi) non-Hodgkin's lymphoma caused by EBV; (vii) leiomyosarcoma caused by EBV; (viii) breast cancer caused by EBV; (ix) EBV-induced gastric cancer; (x) EBV-induced nasal T / NK cell lymphoma; (xi) EBV-induced T / NK cell lymphoma; (xii) nasopharyngeal carcinoma caused by EBV; (xiii) ocular CMV retinitis caused by CMV; (xiv) pneumonia caused by CMV; (xv) gastrointestinal ulcers caused by CMV; (xvi) a condition or symptom caused by VSV; (xvii) oral herpes caused by HSV-1; (xviii) genital herpes caused by HSV-2; and (xix) Joint inflammation or rash caused by RRV.
22. 22. The method of any one of claims 1 to 21, wherein the compound is administered in the form of a pharmaceutical composition comprising a pharmaceutically acceptable excipient.
23. In the manufacture of a medicament for treating a viral disease or condition or a virus-related disease or condition, a compound of Formula 1: 【Chemistry 2】 (In the formula, R 1 and R 2 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 selected from alkenylhalo; R 3 is hydrogen, C 1~10 Alkyl, C 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 selected from alkenylhalo; R 4 is hydrogen, OH, C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkylhalo, NH 2 , NH(C 1~10 alkyl), and N(C 1~10 alkyl) 2 More selected; L 1 is C 1~10 Alkyl, OC 1~10 Alkyl, C 1~10 Alkenyl, OC 1~10 Alkenyl, OC(=O), OC(=O)(C 1~10 alkyl), NHC(=O), N(C 1~10 Alkyl)C(=O), OS(=O) 2 and each alkyl or alkenyl is uninterrupted or selected from O, OC(═O), NH, N(C 1~10 alkyl), NHC(=O), S, and S(=O) 2 and is unsubstituted or substituted with one or more groups selected from halo, OH, and C═O; X 1 , X 2 , X 3 , X 4 , and X 5 are each independently hydrogen, halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 and any two X groups joined together are unsubstituted or selected from halo, OH, C 1~10 Alkyl, C 1~10 Alkyl halo, OC 1~10 Alkyl, OC 1~10 Alkyl halo, C 1~10 Alkenyl, C 1~10 Alkenylhalo, OC 1~10 Alkenyl, OC 1~10 Alkenylhalo, C(=O)H, C(=O)OH, C(=O)O(C 1~10 alkyl), and NO 2 (It is possible to form an aryl group substituted with one or more groups selected from the following) or a pharmaceutically acceptable salt, solvate, or stereoisomer thereof.
24. 24. The use of claim 23, wherein the compound selectively inhibits SOX18 activity.
Citation Information
Patent Citations
Inhibitors of SOX18 protein activity for treating angiogenesis- and / or lymphangiogenesis-related diseases
WO2018112545A1